Datasets:

giuliadc

/

pubmed-filtered

like 0

pubmed-101

lymphomatoid granulomatosis (lyg) is a rare angiocentric and angiodestructive lymphoproliferative disease with granulomatous reaction involving the lungs most frequently, however, it may also involve the kidneys, skin and especially the central nervous system4,6,9,11). lyg is characterized by an infiltration of atypical lymphocytoid and plasmocytoid cells, with granulomatous inflammation in an angiocentric and angiodestructive polymorphic cellular infiltrate6,8). therefore the purpose of this study is to submit the first report about the case with thoracic spinal lyg after diagnosis with b-precursor childhood acute lymphoblastic leukemia (all). after surgical decompression with biopsy on the spinal lesion, diagnosis of grade ii lyg was made and rituximab was administered. the patient is in good neurological condition without recurrence at the 6-year follow-up. a 4-year-old girl was diagnosed with b-precursor all with the involvement of kidneys and pancreas in november, 2004. treatment was initiated according to the pediatric oncology group (pog) protocol 900612). on april 12, 2006, the patient was admitted to pediatric clinic with a complaint of intermittent fever for 3 days. on april 19, 2006, 7 days after the admission, the patient developed a gait disturbance. neurological examination revealed paraparesis of grade 3 on medical research council (mrc) muscle strength grading scale1) with increased deep tendon reflex in both ankles, knee jerks, and bilateral positive babinski sign, but her senses were intact. cerebrospinal fluid (csf) findings were as follows: elevation of protein (243.3mg/dl), and decrease of glucose (44mg/dl). the condition was suspected to be an acute inflammatory demyelinating polyneuropathy and was treated with intravenous immunoglobulin (400 mg/kg/day) for 5 days. however, her paraparesis was aggravated to grade 1 on mrc muscle strength grading scale from april 26, 2006, 14 days after the admission, and spinal mri was performed. t2 weighted mri demonstrated heterogeneous high signal intensity infiltration on t4 vertebral body and subligamental spreading soft tissue mass on t3-5 epidural space from t4 posterior vertebral body, causing spinal cord compression (fig. 1). on april 27, 2006, laminectomy of t3, 4 with open biopsy were performed. the epidural mass was encircling the spinal cord mainly on ventral surface and was slightly grey to yellow, solid and compact nature. a histopathologic examination showed an angiocentric distribution of polymorphous lymphoid infiltrate, with extensive necrosis. immunohistoche mical staining for cd3 and cd20 showed the predominance of mature t cells and atypical b cells (fig. hybridization revealed positivity for epstein-barr virus (ebv) encoded rna in a few lymphocytes, confirming the diagnosis of grade ii lyg. one-week post-operative neurologic examination showed paraparesis grade 3 on mrc scale, and bare independent walking but as she still had gait impairment, she received rehabilitation. after four weeks of the surgery, she restored her normal state and could walk quite well. at that time, there were no pulmonary lesions, so we suspected the spinal lesion as the primary involvement site. two weeks after, chest and abdomen ct revealed multiple low density nodular mass on the liver and the lower lobe of the left lung. histopathologically, lesions were not blastic in appearance and in immunophenotype, and the lesions were negative for cd10, tdt, and cd22, so we ruled out the relapse of all. she was treated with rituximab (275mg/m/day, 4 times per week) for 4 weeks and intravenous high dose methylprednisolone (30mg/kg per day for 3 days, 20mg/kg per day for 2 days and 10mg/kg per day for 2 days). chest and abdomen ct showed marked improvement of the lesions 3 months after the treatment compared with the lesions in the images obtained before the treatment. a follow-up mri study performed 4 months after the operation documented no evidence of residual mass or recurrence (fig. 3). chest and abdomen ct performed 1 year after the operation showed no demonstrable focal lesion in lung field and mediastinum and unremarkable abdominal organs. her weakness improved and she was able to walk independently and had no gait impairment. but unfortunately we failed to take additional follow-up of mri for the patient, as she was terrified to take mri and full sedation was not possible. moreover the parents of the patient did not agree with the idea of taking mri one more time because she was in good state at that time. to date, lyg is a rare lymphoproliferative disease characterized by angiocentric and angiodestructive ebv-positive b-cell proliferation of uncertain malignant potential, which might be associated with exuberant reactive t cell infiltration2,9). lyg affects men more than women with ratio 2 to 1 and presents mainly in adults between the fourth and sixth decades of life, although patients of all ages can be affected. its occurrence in children is quite rare4). there were three cases of lymphomatoid granulomatosis with onset after all. two of these patients died of the disease, only one obtained benefit from acyclovir therapy7). lyg usually affects lungs primarily, and it may also present several significant extrapulmonary manifestations, affecting skin, kidney, spleen, and the central nervous system. involvement of the spine has been rarely reported. to my best knowledge, this is the first report of thoracic spinal lyg presenting with unique progressive myelopathy. however, numerous granulomatous lesions in the central nervous system and lungs are highly suggestive of lyg. lyg with central nervous system involvement, observed in approximately 30% of the affected patients, indicates poor prognosis4,9,11). there was only one case report about lyg with spinal involvement. in that case, lyg involve cervical spinal cord, and the patient submitted four cycles of adjuvant cyclophosphamide, doxorubicin, vincristine and prednisone (chop). but the patient died 5 months after the treatment due to systemic progression of the disease7). a grading system of lyg is based on the number of atypical lymphocytes, ebv-positive b-cells and amount of necrosis5). pathophysiologically, grade i lesions consist of a polymorphous angiocentric and angiodestructive infiltrate of lymphocytes, plasma cells, and histocytes, with or without eosinophils. large lymphoid cells or immunoblasts were less than five in high power field (400) or absent. if large lymphoid cells or immunoblasts were present, there would be no cellular atypia and minimal-to-absent necrosis. grade ii lesions consisted of large lymphoid cells with less than twenty ebv-positive cells in high power field with some cellular atypia in small lymphoid cells, and necrosis was more common. grade iii lesions, angiocentric lymphomas, consisted of large atypical cells with more than twenty ebv positive cells in high power field with the marked cytologic atypia in both small and large lymphoid cells4,13). to date, no standard treatment has been established for lyg and treatments approach to systemic lyg include drugs acting on the immune system(corticosteroids, interferon alfa-2b, cyclosporine a, anti-cd20 monoclonal antibody-rituximab), mono- or combined chemotherapy, radiotherapy, and autologous stem cell transplantation. several treatments with rituximab have been reported, with or without chemotherapy or radiotherapy3,9,10,15). rituximab was approved for the treatment of recurrent, poorly differentiated refractory or follicular cd20 positive b-cell non-hodgkin's lymphoma14). in this case, immunohistochemical staining for cd3 and cd20 showed the predominance of mature t cells and atypical b cells. in situ hybridization revealed positive ebv encoded rna in a few lymphocytes, confirming the diagnosis of grade ii lyg. the patient experienced rapid worsening of neurological symptoms and absence of systemic involvement on pre-operative laboratory findings and radiological imaging, and she therefore was treated with surgical decompression and biopsy on the t3-5 epidural lesion and improved neurologic symptoms. surgical decompression can improve neurological morbidity of the patient. however, appropriate chemotherapy is highly needed as systemic progression of lyg make poor prognosis. the patient responded to rituximab therapy well without adverse effects, and her condition remained stable for 6 years. therefore it was suggestive that decompression and rituximab is suitable as the initial therapy for symptomatic spinal lyg. this case described an unusual occurrence of thoracic spinal lyg in a 4-year-old girl. childhood lyg is a rare disease but should be considered in the nodular pulmonary infiltrates and central nervous system manifestations, especially in the past diagnosis of childhood acute lymphoblastic leukemia. awareness of the features of lyg can lead to earlier diagnosis and prompt appropriate therapy.

lymphomatoid granulomatosis (lyg) is a lymphoproliferative disease involving the lungs most frequently; however, it may also involve the kidneys, skin and especially the central nervous system. unique initial presentation of spinal involvement is extremely rare and epidural lesion of thoracic spine has not been reported. the prognosis for lyg has been reported to be poor, and there currently exists no satisfactory established treatment protocol. the purpose of this study is to report a case of successful treatment with surgery and rituximab combination therapy in thoracic spinal lyg.

PMC4432382

pubmed-102

kidney transplant recipients not only have numerous comorbidities associated with renal failure, but also often have additional problems due to chronic immunosuppression [13]. the surgical management of colorectal cancer is risky to the patient in terms of the surgical procedure and the interruption of immunosuppression. in general, these patients are more susceptible to perioperative complications. although open colorectal resection has been practiced for many years in kidney recipient patients, the minimally invasive procedure has been developed and is gaining popularity. multiple randomized controlled trials have proven that minimally invasive surgery yields better short-term outcomes than open colorectal surgery in terms of reduced intraoperative bleeding, postoperative pain, and hospital stay, as well as a lower incidence of infection and respiratory complications, with equivalent long-term outcomes [4, 5]. however, selected high-risk patients may benefit from minimally invasive colorectal resection due to reduced morbidity. the aim of this study was to prove the safety and feasibility of laparoscopic and robotic colorectal resection in kidney transplant recipients by evaluating the technical protocol and the short- and long-term outcomes. this retrospective review of all kidney transplant recipients diagnosed with colon or rectal cancer who received laparoscopic or robotic resection was conducted between may 2007 and august 2012 at yonsei university college of medicine, south korea. data were analyzed using the spss statistical program (version 18 for windows; spss inc., all patients received 4 liters of golytely (peg-3350 and electrolytes for oral solution, braintree laboratories, inc., antibiotics and a stress dose of steroids of 100 mg were given on induction of anesthesia and continued postoperatively with tapering dose of steroid. a main concern in laparoscopic and robotic colorectal resection is accurate and safe port placement to avoid injury to the transplanted kidney. after periumbilical port insertion using an open or closed technique, the abdomen was insufflated with medical co2 to 1214 mmhg pressure. the kidney was shifted posterolaterally to provide adequate space for the working ports (figure 1). next, depending on the type of procedure, two right- or left-sided trocars under direct visualization were easily placed. for robotic trocar positioning, we used a hybrid technique by which the colon was mobilized laparoscopically and the robot was docked between the legs of the patients and used mainly for pelvic dissection. robotic port insertion depended on the location of the kidney: for the right kidney, arms 2 and 3 were on the left and arm 1 was on the right; for the left kidney, arms 1 and 3 were on the right and arm 2 was on the left. the procedure used colonic mobilization and followed total mesorectal excision principles as required for pelvic dissection. we started medial to lateral mobilization of the colon 2 cm distal to the sacral promontory going upward toward the inferior mesenteric artery where most of it is ligated at its origin. then, lateral dissection followed including splenic flexure mobilization. finally, we dissect the rectum starting posteriorly going deep to the levator ani muscles carefully to avoid hypogastric nerve injury. then, we dissect laterally and anteriorly where we should avoid injury to prostrate and neurovascular puddle. usually, we perform a rectal irrigation before transection. the specimen extracted from the left iliac fossa assistant port and duple stabling technique was used for bowel anastomosis. regarding the right colectomy cases, medial to lateral approach our preferred method is applying complete mesocolic principles where vessel ligation is performed at its origin. ten of these recipients were diagnosed with colon or rectal cancer and underwent minimally invasive surgical resection. five (50%) patients were males; the mean patient age was 56.8 (range, 4772) years, and the mean body mass index was 22.4 (range 20.526.4) kg/m. nine (90%) patients had hypertension, three (30%) had diabetes mellitus, one patient had a history of hepatitis, and one had a history of chronic pulmonary tuberculosis. the american society of anesthesiologists scores were ii in 60% of patients and i and iii in 20% of patients each. all rectal patients were evaluated by computed tomography (ct) scan and a colonoscopy. in addition, magnetic resonance imaging (mri) was used for further evaluation of the patients with rectal cancer. preoperative stages were i and ii in 40% of the patients and iii in 10% of the patients. no tumor invasion or extension beyond the mesorectal fat with a maximum stage preoperative chemoradiation therapy was administered to one patient with low-rectal cancer with a preoperative stage iii (t3n1 m0). four (40%) patients underwent an anterior and a low anterior resection, two (20%) underwent a covering ileostomy and a right hemicolectomy, and one patient (10%) underwent a left hemicolectomy. most (90%) procedures were performed laparoscopically and 10% were conducted robotically (table 1). pre- and postoperative laboratory blood findings were evaluated every other day to minimize intra- and postoperative complications (table 2). the mean carcinoembryonic antigen level was 3.66 2.53 (range 0.729.18) ng/ml and the mean white blood cell count was 7, 315 3,842 (range 2,99016,520) mm. three (30%) patients were anemic, with a mean hematocrit of 34.65 7.72% (range 26.753.4%) and a mean hemoglobin concentration of 11.38 2.54 (range 8.917.4) g/dl. mean preoperative urea and creatinine levels were 27.7 23.62 (range 11.489.4) mg/dl and 1.43 0.98 (range 0.593.94) mg/dl, respectively. most of the immunosuppressive medications used pre- and postoperatively were cyclosporine or tacrolimus combined with low dose of steroid ranging between 5 mg to 12 mg. no change in immunosuppressive the mean postoperative hemoglobin concentration was 10.63 2.45 (range 7.616.1) g/dl and no patient required a blood transfusion. the mean postoperative leukocyte count (10,655 2,219 (range 7,53014,220) mm) was slightly but significantly higher than the preoperative value (p=0.032), and no severe leukocytosis or leukopenia was seen. mean postoperative urea and creatinine levels were 18.35 17.8 (range 11.460.7) mg/dl and 1.40 0.76 (range 0.723.09) mg/dl, respectively. the mean interval between kidney transplantation and surgery was 11.7 (range 1.322) years. the mean estimated blood loss was 30 53.74 (range 0150) ml. we rarely found adhesions; most observed were minimal and were noted when the peritoneum was opened accidentally during the kidney transplant or another procedure. no significant difference was observed between pre- and postoperative kidney function parameters, and no organ rejection was reported. the mean timing of the first oral intake was 3.8 5.81 (range 27) days postoperatively. postoperative stages were i in 20% of the patients, ii in 50% of the patients, and iii in 30% of the patients (table 3). one patient underwent adjuvant chemoradiation (xeloda (capecitabine)+radiation) and four patients underwent adjuvant chemotherapy alone (fluorouracil, leucovorin, folic acid, oxaliplatin (folfox) in three cases, and 5-fluorouracil+leucovorin in one case). over a median follow-up period of 31.4 21.57 (range 263) months, no mortality occurred. one patient showed liver metastasis 1 year postoperatively, which was treated by radiofrequency ablation and no further recurrence till the present date of our study. in six patients who were followed for a mean of 43.5 9.84 (range 3263) months, the 3-year disease-free rate was 83.3% and the 3-year overall survival rate was 100% (table 3). the risk of colorectal neoplasia is high among renal transplant recipients and is associated with the duration of immunosuppression, regardless of age. the reported incidence of colorectal cancer in kidney transplant recipients has ranged from 0 to 0.9%. kim et al. found that the rate of right colon cancer was significantly higher in transplant recipients than in the general cancer population (35.2% versus 15.4%), whereas the rate of rectal cancer was significantly lower in transplant recipients (33.5% versus 46.5%; p=0.031). also reported that the risk of colorectal cancer was twofold higher in the first posttransplantation year than in the general population, and an additional 2.2-fold higher after the third posttransplantation year. in contrast, saidi et al. found no increased risk of colorectal cancer among transplant recipients compared with the general population and noted the need for further evaluation of this issue. parnaby et al. reported that three population-based studies showed increases of up to twofold in the incidence of colonic but not rectal cancer in renal transplant recipients and that two population-based studies showed threefold and 10-fold increases in the incidence of anal cancer in these patients. patients on immunosuppressive medications or who have undergone organ transplantation with comorbidities have increased morbidity (stress-related complications) and mortality and a prolonged postoperative recovery period, after major open surgery, including colorectal surgery [1215]. he concluded that the nonspecific immune response appeared to be less affected by laparoscopic surgery compared with open surgery, while specific cell-mediated immunity was equally affected. laparoscopic colorectal resection is less physically stressful and offers short-term advantages compared with open resection. technically, selection of the port insertion site is the most important step in a laparoscopic or robotic procedure. after the establishment of pneumoperitoneum, the kidney is moved inferolaterally to allow port placement. our hospital is one of the leading hospitals in robotic surgery in korea. as we reported in our results, that one case was performed by robotic method. in that case, we used a hybrid technique where the colonic mobilization was completed laparoscopically and the da vinci robot was used only for pelvic dissection. we found that the robotic port position of the 3rd arm should be positioned on the opposite side of the transplanted kidney because of its close proximity with the anterior superior iliac spine where the kidney is located even after pneumoperitoneum. however, any port position even in totally robotic technique could be safe as long as the ports are placed away from transplanted kidney. we found no or minimal adhesion during the procedures, which may have been related to peritoneum opening during retroperitoneal dissection in the kidney transplant procedure. adhesions from previous surgeries, possibly related to the use of steroids, were not an issue. only one case series of laparoscopic-assisted colectomy in three kidney transplant recipients has been published. in that series, the average time since transplantation was 8 (range 610) years and no patient experienced organ rejection. all patients had colon cancer, and all allografts were contralateral to colon resection. the mean operative time was 103 (range 100105) min and no complications occurred. the average hospital stay was 5 (range 47) days and the mean follow-up time was 17 (range 340) months. our series was larger than that described above, and it included patients with colonic and rectal cancer. moreover, we included patients who underwent laparoscopic and robotic surgery. in our series, the mean interval between kidney transplantation and diagnosis of colorectal cancer (11.7 years) was slightly longer. our mean operative time was 192.5 53.87 (range 77263) min, due to the longer operative time (263 min) of the robotic procedure; the mean operative time for laparoscopic procedures was 184.6 50.74 min. we observed similarly intact renal function and no rejection during the follow-up period. two patients in our series had minor complications (wound seroma and chyloperitoneum) that were managed conservatively. the leukocyte count is normally raised after any major surgical procedure, but no severe leukocytosis or leukopenia occurred in our patients indicating infection or rejection. no change in the form or dosage of immunosuppressive medications was required before surgery, and medications were resumed postoperatively under monitoring by the transplant team. in general, these patients are more susceptible to perioperative complications. immunosuppression can lead to a higher infection rate and surgical stress can increase immunosuppression, a phenomenon that is more pronounced following open (versus laparoscopic) surgical procedures [12, 14, 15]. our follow-up period (mean 31.4 21.57 months) was longer than that previously reported. in addition, the mean follow-up period was 43.5 9.84 months for the six patients in whom long-term outcomes were assessed. no mortality occurred; the 3-year disease-free rate was 83.3%, and the 3-year overall survival rate was 100%. in conclusion, minimally invasive surgery is feasible in kidney transplant recipients, who can benefit from fewer wound-related problems. technical proficiency, experience, and the use of a multidisciplinary team approach including an oncologist and transplant team can result in a successful procedure and ensure the safety of the transplanted kidney. therefore, minimally invasive colorectal procedures could be considered safe alternatives to open colorectal resection in selected kidney transplant patients.

aim. to prove the safety and feasibility of minimally invasive (laparoscopic and robotic) colorectal resection in kidney recipients by evaluating the technical protocol and reviewing short- and long-term outcomes. methods. between may 2007 and august 2012, a retrospective review of ten kidney transplant patients diagnosed with colorectal cancer was evaluated for technical tips, short- and long-term outcomes. results. the mean patients ' age was 56.8 9.91 years and 50% of them were male. anterior and low anterior resections were performed in 40% of the patients each; 20% and 10% of the patients underwent right and left hemicolectomy, respectively. most (90%) procedures were performed laparoscopically and 10% were performed robotically. no open conversions. mean operating time was 192.5 15 min, blood loss was 30 50 ml, and mean hospital stay was 9.7 5.5 days. two (20%) patients had postoperative complications: wound seroma and chyloperitoneum. over a mean follow-up period of 31.4 21.57 months, no mortality or kidney rejection occurred. among the six patients followed up for a mean of 43.5 9.84 months, 83.3% were 3-year disease-free and the overall survival rate was 100%. conclusion. minimally invasive colorectal resection is likely to be safe and feasible, with fewer complications and acceptable short- and long-term outcomes, in kidney transplant recipients.

PMC4897483

pubmed-103

acute occlusion of the superior mesenteric artery (sma) causes extensive intestinal necrosis due to the difficulty of early diagnosis, resulting in poor prognosis, with a high postoperative mortality rate of 65.2%. recent reports indicate that selective thrombolytic therapy with intraarterial infusion of urokinase is effective for acute sma occlusion diagnosed early after onset. early thrombolytic therapy can not always induce complete thrombolysis, and even if intestinal necrosis is avoided by administration of initial thrombolytic therapy, indications for additional thrombolytic therapy or the method for monitoring intestinal viability during subsequent follow-up have not been established. in this report, we present a case of acute sma occlusion diagnosed early after onset that was successfully treated by sequential and intermittent thrombolytic therapy by intraarterial urokinase infusion with angiographic evaluation of blood flow, thereby avoiding intestinal resection. an 82-year-old woman with a past history of atrial fibrillation was admitted to our hospital, complaining of acute epigastric pain and stool with fresh blood. physical examination was as follows: blood pressure 140/80, heart rate 70/min, o2 saturation 97% (room air), body temperature 37.2c. the abdomen was flat and soft, with no apparent tenderness or sign of peritoneal irritation. laboratory data on admission revealed an elevated wbc count and mildly elevated hepatic enzyme values (wbc 15,400/mm, crp 0.05 mg/dl, ldh 502 iu/l, ast 57 iu/l, alt 21 iu/l, cpk 113 colonoscopy revealed mildly erosive, edematous mucosa, but no obvious bleeding from the ascending colon to the terminal ileum. abdominal enhanced ct showed a filling defect in the proximal portion of the sma main trunk, which led to the diagnosis of acute sma occlusion (fig., selective sma angiography was performed, showing complete occlusion of the sma around the first jejunal artery branch. subsequently, intraarterial bolus infusion of urokinase (600,000 iu) with thrombus suction was performed. as a result, however, the thrombus remained, and intramural blood flow of the affected intestine was not visualized, suggesting possible necrosis of the affected intestine (fig. a mild ischemic change was observed at the intestinal wall from the jejunum 40 cm distal from the treitz ligament to the ascending colon, but no apparent necrosis. blood flow in the mesentery was well palpable at the central portion of the sma, while peripheral blood flow was not palpable. the operation was completed without intestinal resection or direct removal of the thrombus from the sma. 24 h after the laparotomy, a second angiography was performed via the catheter that remained in place after first angiography, because clinical signs such as abdominal pain suggested the progression of intestinal ischemia. peripheral blood flow was well visualized, and no signs of intestinal necrosis were observed. thereafter, thrombolysis with urokinase infusion (240,000 iu) and suction of the residual thrombus were performed. in addition, 36 h after the laparotomy, a third angiography and thrombolysis (urokinase 240,000 iu) were performed, showing improvement in peripheral blood flow via the gradual development of collateral blood flow. follow-up carefully monitored the possible onset of shower embolism by the residual thrombus. intestinal blood flow was well visualized on ct angiography performed 48 h after laparotomy (60 h after the first thrombolytic therapy). the patient began to take food by mouth on the 6th day after laparotomy and was discharged from our hospital 35 days after laparotomy. early diagnosis and treatment contribute to the improvement of therapeutic results for acute sma occlusion. a delay in diagnosis results in an extremely high mortality rate due to extensive intestinal necrosis; however, successful resection of necrotic intestine causes short bowel syndrome, severely impairing quality of life. recent reports indicate that enhanced ct is feasible for early diagnosis of acute sma occlusion. when acute sma occlusion is suspected from symptom, clinical history and physical findings, enhanced ct plays a role not only in identifying the causal portion, but also in determining the subsequent treatment plan. early thrombolytic therapy is effective for acute sma occlusion in avoiding extensive intestinal resection. since the first report by jamieson et al., reports that support the usefulness of selective thrombolytic therapy via a catheter for angiography have increased. the golden hour, the time during which the viability of the ischemic intestine can be preserved, varies, dependent on the portion and extent of occlusion. muneoka et al. studied 23 cases of acute sma occlusion treated by selective thrombolytic therapy in japan, and concluded that the golden hour is 5 h for occlusion of the sma main trunk and 12 h for the occlusion of the distal sma. the goal of thrombolytic therapy is complete thrombolysis, but administration over 48 h increases the risk of complication. easy bleeding due to fibrinolysis promoted by urokinase and shower emboli induced by the release of residual thrombi are known to be the major complications associated with thrombolytic therapy with urokinase. careful monitoring during 24 h after the completion of thrombolytic therapy is essential, and emergency laparotomy is mandatory if intestinal necrosis is suspected. urokinase has no influence during surgery as its half-life in blood is only 16 min. in the present case, the thrombus was detected in the sma main trunk by angiography performed 5 h from onset. therefore, judging that we were within the golden hour, we added urokinase infusion and thrombus suction via the angiography catheter. however, the thrombus remained left, and visualization of intramural blood flow was poor, therefore, we selected exploratory laparotomy. on the other hand, when no apparent intestinal necrosis is observed during exploratory laparotomy, a clinical consensus concerning the indication of additional thrombolytic therapy or optimal methods for evaluation of intestinal blood flow or viability in the subsequent follow-up is not yet established. even if intestinal necrosis can be avoided, intestinal ischemia would cause perforation or stricture of the affected intestine. from 1985 to 2007, 45 cases of thrombolytic therapy for acute sma occlusion were reported in japan. complete thrombolysis was successful in 28 cases (63.6%), and 17 cases (36.4%) received laparotomy following thrombolytic therapy. among those 17 patients, intestinal resection was performed in 5 cases (11.1%) due to intestinal necrosis; the remaining 12 cases (26.7%) without intestinal necrosis at laparotomy were thereafter free from intestinal necrosis. of those 12 patients, 2 received angiographic reevaluation of blood flow and subsequent second-look operation, 3 received embolectomy, and 6 were carefully observed by laboratory examination and physical findings without any invasive treatments. in the present case, we performed thrombolytic therapy with angiographic evaluation of blood flow, sequentially and intermittently, after exploratory laparotomy, which enabled us not only to accurately evaluate intestinal blood flow or viability, but also to avoid a second-look operation. in conclusion, sequential and intermittent thrombolytic therapy with meticulous angiographic evaluation of blood flow is effective in the early stage of acute sma. in particular, it is much less invasive than strategies described in previous reports and enables accurate evaluation of intestinal blood flow or viability over the time course.

acute occlusion of the superior mesenteric artery (sma) causes extensive bowel necrosis, resulting in a poor prognosis with an extremely high mortality rate. an 82-year-old woman was admitted to our hospital with the complaint of abdominal pain. she was diagnosed as having acute sma occlusion by enhanced ct. five hours from onset, the first thrombolytic therapy with urokinase was performed, but failed to complete thrombolysis and recanalization of peripheral blood flow. an exploratory laparotomy following the first thrombolytic therapy showed a mild ischemic change in the affected intestine and mesentery, but no sign of necrosis. after the laparotomy, local thrombolytic therapy with angiographic evaluation of blood flow at 24, 36 and 48 h from the first thrombolysis was performed. as a result, the residual thrombus disappeared and all branches of the sma became well visualized. the patient was discharged well without a second-look operation or major bowel resection. sequential intermittent thrombolytic therapy with meticulous angiographic evaluation of blood flow is effective for early-stage acute sma occlusion.

PMC2988921

pubmed-104

nucleotide excision repair (ner) plays a central role in preserving the genome of prokaryotes and eukaryotes. this versatile repair system removes structurally and chemically diverse bulky dna lesions, including those induced by exposure to uv light and environmental chemical carcinogens [1, 2]. the vital importance of this mechanism is demonstrated by several human ner-deficiency syndromes including xeroderma pigmentosum (xp), cockayne syndrome (cs), and trichothiodystrophy (ttd). xp, for example, is characterized by high photosensitivity, hyperpigmentation, premature skin ageing, and proneness to developing skin cancer. furthermore, the capacity of the ner pathway is important in cancer chemotherapy: ner diminishes the efficacy of chemotherapeutic agents such as cisplatin, which act via the formation of bulky dna adducts. a better understanding of the mechanisms of recognition of dna lesions by the ner system may lead to the design of improved chemotherapeutic drugs that can modulate the repair response. recent findings reveal that polymorphisms in human ner repair genes have an impact on the repair of dna lesions and cancer susceptibility [6, 7], as well as on chemotherapeutic efficacy. the eukaryotic ner pathway is a biologically complicated process and consists of two sub-pathways with different substrate specificity: global genome ner (gg-ner) [9, 10] and transcription-coupled repair (tcr) [1114]. both sub-pathways consist of ordered multistep processes, which differ in the early steps, when the dna lesions are recognized, but converge in the later steps. in gg-ner, the focus of our present interest, the whole genome is scanned for bulky lesions to initiate the repair process. two independent complexes, one involving the xpc/hr23b/centrin 2 proteins [1517] and the other involving the ddb1/ddb2 heterodimer [1821], have been implicated in the early steps of base-damage recognition during ner. by contrast, the tcr sub-pathway is activated by a stalled rna polymerase during transcription. once the lesion is detected, the two sub-pathways proceed in an essentially identical manner to excise it: the multisubunit transcription factor. tfiih, containing helicases xpb, and xpd, is recruited to the lesion site, followed by xpa, the single-strand dna binding protein rpa, and the two nucleases xpg and xpf-ercc1. once assembled, a 2432 oligonucleotide stretch containing the lesion is excised from the damaged strand. finally, gap resynthesis by dna polymerases,, and and ligation by dna ligase i complete the ner process. one remarkable characteristic of the ner pathway is its ability to excise an astounding variety of chemically and structurally diverse lesions, and the rates of repair can vary over several orders of magnitude. however, the differences in the structural and thermodynamic properties of the lesions that control the diverse ner efficiencies have remained elusive. it has been suggested that the ner factors do not recognize the lesion itself, but rather the local distortions and destabilizations in the dna that are associated with it [2430]. a number of different properties of damaged dna that elicit the ner response have been proposed. these include disruption of watson-crick hydrogen bonding [24, 31], kinks in the damaged dna, thermodynamic destabilization [24, 29, 33], diminished base stacking [34, 35], local conformational flexibility, and flipped-out bases in the unmodified complementary strand [3740]. a crystal structure of yeast rad4/rad23, the homolog of the human ner recognition factor xpc/hr23b, bound to dna containing a cyclobutane pyrimidine dimer, shows that rad4/rad23 inserts a -hairpin through the dna duplex and expels two mismatched thymines in the undamaged strand out of the duplex to bind with the enzyme (pdb i d: 2qsg). this structure suggests that lesions which thermodynamically destabilize the dna duplex and facilitate the flipping of base pairs and the intrusion of the beta-hairpin are good substrates to the ner machinery: the more locally destabilized the lesion, the better it is repaired. the modulation of ner susceptibility for the same lesion by neighboring base sequence context, is however, a relatively unexplored area. if a lesion is better repaired in one sequence context than the other, a lesion-induced mutational hotspot could result. in order to elucidate the relationship between ner efficiency and base sequence-governed dna distortion and destabilization induced by a bulky dna adduct, we have employed as a model system the major lesion derived from the cancer-causing compound benzo[a]pyrene (b[a]p). b[a]p is the most well-studied member in a family of ubiquitous environmental pollutants known as polycyclic aromatic hydrocarbons. the tumorigenic metabolite of b[a]p is the diol epoxide r7, t8-dihydroxy-t9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (b[a]pde). this intermediate reacts with dna and rna; the most abundantly stable adduct produced in mammalian cells [4446] is the 10s (+) -trans-anti-b[a]p-n-dg adduct ([ g*]) (figure 1(a)), the focus of our work. this adduct, unless removed by dna repair mechanisms, is highly mutagenic [48, 49]. we have investigated the identical 10s (+) -trans-anti-b[a]p-n-dg adduct in the six sequence contexts shown in figure 1(b), utilizing an array of approaches: ner in human hela cell extracts, ligation and polyacrylamide gel electrophoresis techniques to assess bending properties of the modified duplexes, and structural studies utilizing high resolution nmr methods as well as unrestrained molecular dynamics (md) simulations. the position of the b[a]p ring system in the b-dna minor groove, directed 5 along the modified strand, was first determined by nmr in the 5- c[g*]c-i sequence in 1992, but sequence-governed structural details as well as dynamic properties remained to be elucidated. one important motivation for our work was to explore the role of nearby guanine amino groups on the structural properties and ner susceptibilities of these duplexes. the key difference in these duplexes is the presence and positioning of guanines flanking the [g *], either immediately adjacent to the lesion or beyond: the b[a]p rings compete for space with the bulky amino group of guanine on the minor groove side of b-dna, which we anticipated would differentially impact the structures of the damaged duplexes in a sequence context-dependent manner. a further motivation was to explore the role of differing sequence contexts beyond the lesion that vary in intrinsic flexibility. we hypothesized that subtle but critical structural effects governed by sequence context would manifest themselves by impacting ner efficiencies. our results determined that sequence context could cause an up to four-fold difference in relative ner susceptibility, with even distant neighbors influencing ner. locally disturbed watson-crick hydrogen bonding and flexible bending are two key sequence-governed structural distortions caused by this lesion that the ner machinery appears to recognize with different efficiencies. more generally, different lesions in varied sequence contexts will cause different kinds of distortions; thus, the extent of the local thermodynamic destabilization will also vary; we hypothesize that it is the extent and type of destabilization that determines the relative ner efficiency. the 5- c[g *], 5- g[g *] c, and 5- i[g *] sequences. high resolution nmr solution studies have shown that the bulky aromatic b[a]p residue is positioned in the minor groove on the 5-side of [g *] in the 5- c[g*]g and 5- g[g*]c duplexes (figure 2). however, there are sequence-governed differences in some of the structural features. duplex, nmr studies revealed that the c: g base pair on the 5-side of [g *] is severely disturbed. in the case of the sequence-isomer 5- g[g*]c duplex, this perturbance is not observed. on the other hand, analyses of md simulations [51, 52] based on the nmr data revealed significant unwinding near the lesion site combined with an anomalously enlarged roll (figure 3), not observed in the 5- c[g*]g duplex. duplex, which is a manifestation of a kink that is highly flexible. this flexible bend is caused on a molecular level by the severe untwisting and enlarged roll determined by md from the nmr data: dna bending is largely caused by increased roll, which is correlated with untwisting [5557]. the underlying structural reasons for the disturbed watson-crick hydrogen bond in the 5-, the bulky amino group on g20 (figure 3), which is partner to the c on the 5 side of [g *], is sterically crowded by the b[a]p ring system since both are on the minor groove side, and hence this c5: g20 base pair is episodically denatured (figure 3(a)); for the 5- g[g*]c case, the b[a]p rings crowd the g6 amino group, and in this case the crowding is relieved by the severe untwisting accompanied by the increased roll, which produces the flexible bend observed by gel electrophoresis. investigations with the 5- i[g*]c sequence context substantiated the critical role of the guanine amino group since i (figure 1(b)) lacks this group: the gel electrophoretic manifestation of a flexible bend was abolished. the nmr data showed conformational heterogeneity in minor groove conformations, and the md simulations showed episodic denaturation of one of the two hydrogen bonds at the i: c base pair, explaining the heterogeneity. the repair efficiency relative to 5- c[g*]c-i, the standard sequence utilized in many nmr and ner studies [53, 58], is 4.1 0.2, 1.7 0.2 and 1.3 0.2 for the 5- c[g*]g, 5- g[g*]c and 5- i[g*]c duplexes, respectively (figure 4). duplex, dynamic episodic denaturation of watson crick base pairing flanking the lesion on the 5-side correlates with the greatest ner susceptibility while the flexible bend in 5- g[g*]c is a less pronounced ner recognition signal, and the disturbance to one hydrogen bond in the 5- i[g*]c case provides a still lesser signal [52, 53] in this series. the 5- c[g *] c-i and 5- t[g *] t-ii sequence contexts. the 5- c[g*]c-ii and 5- t[g*]t-ii while a single, well-defined minor groove adduct conformation is observed in 5- c[g*]c duplexes, in the 5- t[g*]t-ii sequence context, the minor groove-aligned adduct conformation is heterogeneous. furthermore, polyacrylamide gel electrophoresis studies showed that the adduct induces a rigid bend in the 5-c[g*]c-ii sequence context, the lesion induces a highly flexible bend [59, 60]. also, the 5- t[g*]t-ii 11-mer duplex has a lower thermal melting point than the 11-mer 5- duplex (the exact difference depends on sequence length) as expected from the thermodynamic properties of t: a and c: g watson-crick base pairs [62, 63]. molecular insights on these experimental observations were provided by md simulations for the 5- t[g*]t-ii and 5- c[g*]c-ii duplexes. consistent with the conformational heterogeneity observed in the nmr studies, it was found that the 5- t[g*]t-ii duplex is much more dynamic than the 5- c[g*]c-ii duplex: the highly dynamic base pair on the 5-side of the lesion exhibits episodic denaturation of one of the two watson-crick hydrogen bonds, in agreement with the partial rupturing of this base pair observed by the nmr methods; also, the 5- t[g*]t-ii duplex shows somewhat increased and more dynamic roll and untwisting compared to the 5- c[g*]c-ii duplex, consistent with the flexible bend observed only for the 5- t[g*]t-ii case; in addition, the b[a]p ring system exhibits greater mobility and the duplex groove dimensions are more variable. the differences are accounted for by a coupled series of properties: the intrinsically weaker stacking of t-g compared to c-g steps allows for greater flexibility in the 5- t[g*]t-ii duplex; the weaker t: a pair, with only two hydrogen bonds, compared to the c: g pair, with three bonds, provides enhanced flexibility; moreover, the absence of guanine amino groups adjacent to the [g *] in the 5- t[g*]t-ii case allows for greater mobility for the b[a]p ring system. overall, the greater flexibility of the 5- t[g*]t-ii sequence is attributable to the absence of the guanine amino group. the rates of incision in the human hela cell assay relative to 5- c[g*]c-i is 2.4 0.2 and 1.6 0.2 for the 5- t[g*]t-ii and the 5- c[g*]c-ii duplexes, respectively, corresponding to a 1.5 0.2-fold higher-repair efficiency for the 5- t[g*]t-ii case is consistent with the overall enhanced dynamics manifested in various structural properties, notably watson-crick hydrogen bonding and bending. the 5- c[g*]c-i and 5- c[g*]c-ii sequences (figure 1(b)) differ in the sequences beyond the nearest neighbors to [g *]. since different sequence steps are known to be differentially flexible [57, 65], we hypothesized that the same minor groove lesion [50, 64] with different distant neighbors would be differentially repaired. polyacrylamide gel electrophoresis and self-ligation circularization experiments revealed that the 5- c[g*]c-ii duplex is more bent and suggested that it has more torsional flexibility than the 5- c[g*]c-i duplex. the key role is played by the unique -c3-a4-c5- segment in the 5- c[g*]c-ii duplex. duplex originates from the guanine amino group at the c3: g20 pair (figure 5). this amino group acts as a wedge to open the minor groove; facilitated by the highly deformable local -c3-a4- base step, the amino group allows the b[a]p ring system to better bury its hydrophobic surface within the groove walls. this produces a yet more enlarged minor groove which is coupled with more local untwisting and more enlarged and flexible roll, causing the greater bend in 5- c[g*]c-ii (figure 5). the ner efficiencies are 1.6 0.2 times greater in the 5- c[g*]c-ii than in the 5- c[g*]c-i sequence context showing that distant neighbors to [g *] modulate the ner susceptibility. the greater ner susceptibility for the 5- c[g*]c-ii duplex is explained by its greater bending with enhanced flexibility: the intrinsic minor groove enlargement caused by both the guanine amino groups [55, 68] and the great flexibility of pyrimidine-purine steps, including the c-a step [57, 6972] allow the b[a]p moiety (figure 5) to more favorably position itself, but at the expense of the greater bend that makes it more repair-susceptible. we have carried out a series of studies with the same 10s (+) -trans-anti-b[a]p-n-dg lesion in a number of sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. additionally, we have considered differences in intrinsic flexibility of sequences flanking the lesion. these are model systems for gaining understanding of ner lesion recognition factors. we have obtained molecular structural data by nmr and md simulations, bending properties from gel electrophoresis studies, and ner data from human hela cell extracts for all of our investigated sequence contexts (figure 1(b)). figure 4 summarizes our key findings and enables us to infer a hierarchy of ner recognition signals for the series of sequences and the single lesion we explored. we point out here that a variety of structural disturbances are found in each case, which are correlated. examples include impaired watson-crick pairing that is accompanied by diminished base stacking, and dna bending towards the major groove, that is induced by a minor groove lesion and is accompanied by minor groove enlargement. our present model system suggests that disturbed watson-crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal: for example, for 5- t[g*]t-ii one episodically ruptured watson-crick hydrogen bond combined with the flexible bend results in better repair than just one disturbed hydrogen bond as in 5- i[g*]c, or the flexible bend alone in 5- g[g*]c (figure 4). for our system, steric hindrance between the minor groove-aligned lesion and nearby guanine amino groups, if present, determines the exact nature of the disturbances, depending on exactly where the guanine amino groups are situated. the intrinsic flexibility of the specific base steps also plays an important role in causing the differential disturbances. both the nearest neighbor and the more distant neighbor sequence contexts have an impact. more globally, different lesions may cause different types of distortions depending on the specific nature of the lesion and its sequence context. however, regardless of exactly what these distortions are, we hypothesize that they must provide a local thermodynamic destabilization signal for repair to ensue, and the greater the extent of destabilization, the better the repair. the destabilization would facilitate the strand separation, base-flipping, and -hairpin insertion by the xpc/hr23b recognition factor [41, 73] needed to initiate ner. in this way, the ner machinery would excise a large variety of lesions with different efficiencies, by recognizing the thermodynamic impact of the lesions rather than the lesions themselves [24, 29, 41, 73]. lesions that resist ner present a great hazard, as they survive to the replication step and produce a mutagenic outcome; such ner-resistant lesions provide an important opportunity for gaining further understanding of the mechanism utilized by the ner apparatus to recognize different lesions.

nucleotide excision repair (ner) plays a critical role in maintaining the integrity of the genome when damaged by bulky dna lesions, since inefficient repair can cause mutations and human diseases notably cancer. the structural properties of dna lesions that determine their relative susceptibilities to ner are therefore of great interest. as a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (b[a]p), 10s (+) -trans-anti-b[a]p-n2-dg in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. we have obtained molecular structural data by nmr and md simulations, bending properties from gel electrophoresis studies, and ner data obtained from human hela cell extracts for our six investigated sequence contexts. this model system suggests that disturbed watson-crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. both nearest neighbor and more distant neighbor sequence contexts have an impact. regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

PMC2943111

pubmed-105

differences in life span between males and females are commonly observed across many species. for example, where the heterogametic sex (xy sex chromosomes) is male, as in humans and drosophila, females tend to live longer than males. similarly, in caenorhabditis elegans, where the hermaphrodite has two x chromosomes (xx) and the male has one (xo), the hermaphrodite tends to live longer. in contrast, in most bird species, where the heterogametic sex is female (zw sex chromosomes), males tend to live longer than females. genetic and environmental interventions that affect life span tend to have a greater effect in one sex than the other. for example, reduced insulin/insulin-like growth factor 1 (igf-1) signaling and dietary restriction tend to increase life span more in females than males in drosophila and mammals, whereas mild stress tends to increase life span more in males than in females, at least in drosophila. quantitative genetic analyses have revealed a different genetic architecture of life span in males versus females. for example, quantitative trait loci (qtls) that affect life span are often sex-specific or sex-biased in drosophila, mice and humans, and studies over the past few years show strikingly different effects of inbreeding in male versus female insects. two recent studies in bmc evolutionary biology on the effects of inbreeding in a seed beetle (bilde et al.) and in drosophila (vermeulen et al.), respectively, provide additional insight into the genetic factors involved. taken together, all these data suggest that the genetic differences between males and females have a significant effect upon aging and life span. several possible and potentially overlapping genetic mechanisms have been suggested to explain differences in life span between genders, including asymmetric inheritance of sex chromosomes, differences in physiology, maternal effects, and sex-specific selective pressures. for example, the asymmetric inheritance of the sex chromosomes, such that males inherit a single x chromosome in flies, c. elegans and humans, means that in males any x chromosome recessive mutant phenotype will be expressed (the ' unprotected x ' model), whereas in females the presence of the second x chromosome means that there is likely to be a wild-type copy of the gene present, and the recessive phenotype will not be expressed. these deleterious recessive mutations could lead to decreased life span, affecting males more than females. consistent with this idea, inbreeding (which will tend to make recessive mutations homozygous) has been found to cause decreased life span in drosophila, mice and several other species (called inbreeding depression of life span). however, several other studies, including that of vermeulen et al. (and see references therein) have failed to detect inbreeding depression of adult life span, or found effects that varied depending upon the particular strain, sex, or environmental conditions. for example, vermeulen et al. mapped a recessive qtl on the second chromosome of drosophila that causes a temperature sensitive reduction in life span in inbred males but not females. asymmetric inheritance of mitochondrial genomes and other cytoplasmic genomes is another possible contributor to sex-specific differences in life span. given that the mitochondrial genome is inherited maternally in drosophila and humans, natural selection can not act to optimize mitochondrial function or nuclear-mitochondrial genetic interactions in the male genetic background. this might result in suboptimal mitochondrial function in males and reduced life span in males relative to females. the maternal effect may also contribute to differences in life span between males and female. in many species, the mother makes a large contribution of gene products to the egg or embryo, and this has been shown to affect life span in a gender-specific way in certain species. because the mother contributes these materials equally to eggs that will develop as either male or female, the genetic differences between male and female zygotes must underlie aspects of the sex-specific effects of maternal products on life span. one possibility is that because maternal-effect gene products are being produced by a female genome, they may be more optimized for female offspring, thereby contributing to the reduced life span often observed in males. consistent with this idea, maternal effects on life span are greater in males than females for certain species such as the seed beetle. finding mechanisms that explain the difference in life span between males and females is hindered by our lack of understanding of the basic mechanisms of aging and underlying causes of mortality. life span appears to be limited by the accumulation of irreversible damage, probably including oxidative damage to macromolecules, mutations, and loss of epigenetic regulation, as well as more acute and dynamic modifiers of mortality rates, perhaps including the efficiency of detoxification and excretion. mechanistic explanations often involve the concept of tradeoffs, that is, the allocation of energy or other ' resources ' to functions such as reproduction and behavior, at the expense of somatic maintenance pathways required for optimal longevity. in several recent studies, however, it was shown that life span can be increased by dietary restriction or altered insulin/igf-1 signaling without a detectable decrease in reproduction or overall metabolism, and conversely, reproduction can be increased in old female flies with no detectable cost for life span. seed beetles (figure 1) could be a particularly powerful model in which to look for trade-offs between somatic maintenance required for optimal life span and other traits such as fecundity. the adult is ' facultatively aphagous ' and does not require food or drink, but can rely on nutrient stores accumulated during development. have examined the effects of inbreeding on male and female life span in the species callosobruchus maculatus. they found that inbreeding reduced fitness of both males and females, as indicated by reduced total reproductive output. as expected, female life span was decreased by extreme inbreeding, but surprisingly, male life span was increased. previous studies of seed beetles by fox et al. had found a large maternal effect on life span of males but not females. however, the bilde et al. study included an elegant control for maternal effects, in that animals with varying amounts of inbreeding had mothers of the same genotype, thus separating the effects of cytoplasmic factors such as mitochondria and maternally contributed gene products from the effects of inbreeding. of course, this result does not rule out an important role for maternal products in modulating life span, but it does show that they are not the direct targets of the observed inbreeding effects. one possible explanation for the decrease in female life span is that inbreeding led to homozygosity of recessive alleles that are deleterious for female lifespan, providing support for the unprotected x hypothesis. however, this hypothesis can not account for the increase in life span observed in males. suggest that the increase in male life span might be due to changes in energy-intensive behaviors, such as a reduction in courtship or aggression, thereby leading to longer life span. (a) male and (b) female. the sex specific coloration of the posterior abdominal plate (pygidium) is shown. the squares are 1 mm. from beanbeetles.org. photographs by lawrence blumer, reproduced with permission. sex-specific differences in genetic architecture could contribute to the observed differences in life span and the effects of inbreeding. for example, a recent study examined how evolution shapes variation in transcript abundance in male and female drosophila, and sex-specific differences in the mode of transcriptome inheritance were identified. in males, variation in gene expression was found to be due mostly to additive interactions of alleles, whereas in females, gene expression variation was found to be due mostly to non-additive (epistatic) interactions between alleles; a substantial x-chromosome effect was shown to underlie these differences. similarly, in the seed beetle, loci affecting life span exhibited more non-additive interactions (dominance) in females than in males. given that additive variation responds to selection more quickly, because additive variation does not involve interactions of multiple loci, sex-specific differences in selection could underlie aspects of sexual dimorphism in life span observed in many species. sex-specific selective pressures that result in higher male reproductive fitness may contribute to sexual dimorphism of life span. for example, costly male-biased metabolism or behaviors, such as aggression or specific courtship behaviors, might be positively selected for, but could result in decreased life-span in males relative to females. future studies may be directed toward further study of the underlying differences in genetic architecture between males and females, in particular, testing the idea that deleterious alleles affecting life span may be more exposed to selection in males than in females due to reduced non-additive effects in males, thereby reducing inbreeding load for male-specific deleterious alleles in the population. it will be particularly interesting to ask if the increased life span observed in highly inbred male seed beetles by bilde et al. can be found to correlate with a reduction in specific costly aspects of metabolism, or behaviors such as locomotion and aggression. we thank sergey nuzhdin for helpful discussions. this work was supported by grants from the department of health and human services to jt (1r01ag011833) and to ma (1r01gm073039).

several possible and potentially overlapping genetic mechanisms have been suggested to explain differences in life span between males and females. two recent papers in bmc evolutionary biology on the effects of inbreeding provide additional insight into the genetic architecture underlying life span differences between genders in two different insects.

PMC2688912

pubmed-106

pathological gambling is defined in the current classification system of the world health organization (1992) (icd10) as an impulse control disorder (icd) which causes excessive, uncontrollable gambling despite financial losses and social problems, while the latest version of the diagnostic and statistical manual (dsm5) of the american psychiatric association (2013) grouped pathological gambling together with substancerelated and addictive disorders and renamed it to gambling disorder. despite this aetiological debate, in parkinson's patients it has been observed that pathological gambling occurs more frequently (3.46.1%) than in the general population (0.252%), alongside with icds, such as binge eating, so called hypersexuality and compulsive shopping (cox et al., 2005; avanzi et al., 2006; grosset et al., 2006; voon et al., 2006; bondolfi et al., 2008; weintraub et al., 2010; santangelo et al., the aetiology of the development of pathological gambling in parkinson's disease is still unclear, however, research suggests an association with dopamine replacement therapy, specifically with dopamine agonists (voon et al., 2006; weintraub et al., 2006; gallagher et al., 2007). this review summarizes evidence in this field of research attempting to reveal the relationship between parkinson therapy and pathological gambling, discusses the reasons why some patients react on them differently than others, what the relevant risk factors are and considers how impulsivity may contribute to the development of gambling symptoms. (2007) found that these patients are younger, earned a higher score in tests investigating noveltyseeking and impulsive behaviour, and were more likely to have a personal or family history of alcohol abuse. being male and smoking in the past also seem to be risk factors (gallagher et al., 2007; valena et al., 2013). in this respect, pathological gambling with and without parkinson's disease is rather similar: young age, male sex, impulsivity, noveltyseeking, smoking and alcoholism are also considered risk factors for pathological gambling in the general population (johansson et al., 2009). observing the progress of their disease, in comparison to other parkinson's patients, those who later develop pathological gambling tend to have an earlier onset of the illness and also suffer more frequently from manic or hypomanic episodes during the onperiod of dopaminergic medication (voon et al., 2007). even in the first case reports about parkinson's patients developing pathological gambling, a clear correlation has been observed with the initiation or dose escalation of dopaminergic medication (molina et al., 2000; seedat et al., 2000). in further studies comparing the effect of different parkinson's therapies, dopamine agonists emerged as the medication with the strongest association with the development of pathological gambling (voon et al., 2006; weintraub et al., 2006, 2010; some studies claim that pramipexole could have the largest effect (dodd et al., 2005). other studies systematically comparing different dopamine agonists have found no significant difference between each of them (weintraub et al., 2006; recent research also shows a strong effect of aripiprazole, prescribed for the treatment of mood disorders and schizophrenia, with stronger gamblingrelated cognition in comparison to other dopamine agonists (grallbronnec et al., 2016). levodopa seems to play a less important role as only a few patients developed pathological gambling under levodopa monotherapy (dodd et al., 2005; voon et al., 2006; gallagher et al., 2007), however, studies suggest that additionally prescribed levodopa raises the risk of the development of pathological gambling and icds (dodd et al., particularly high doses and longterm use of levodopa and shortacting dopamine agonists are also associated with dopamine dysregulation syndrome and punding, that is, stereotypic behaviour (gallagher et al., 2007). further, subthalamic nucleus deep brain stimulation (stn dbs) has a controversial role in the development of pathological gambling in parkinson's disease. it has been observed that after the initiation of stn dbs therapy, gambling symptoms resolved (ardouin et al., 2006; bandini et al. these results could be explained by the significant reduction in the dosage of dopamine agonist medications. however, in some individual cases, pathological gambling and/or impulsive behaviour only developed after stn dbs surgery (funkiewiez et al., 2003; contarino et al., 2007; smeding et al., 2007; 2011); although in these cases the symptoms resolved spontaneously or after the change in stimulation parameters and further reduction in dopaminergic therapy. this could be associated with the stimulation of the limbic subregion of the stn which has been shown to affect neurotransmission in the limbic basal gangliathalamocortical circuitry (winter et al., 2008). evidence also shows that patients are more impulsive after activating stn dbs (frank et al. 2009). as impulsivity is considered as a risk factor for developing pathological gambling in parkinson patients (voon et al., 2007), the contentious effects of stn dbs raise questions about the role of impulsivity in the development of gambling behaviour in general (table 1). main results of studies on the association of pathological gambling with parkinson's disease therapy bis, barratt impulsivity scale; da, dopamine agonists; icd, impulse control disorder; igt, iowa gambling task; ledd, ldopa equivalent daily dose; pd, parkinson's disease; pg, pathological gambling; stn dbs, subthalamic nucleus deep brain stimulation. the fact that not all parkinson's patients develop medicationassociated impulse control disorders or pathological gambling and that most of the patients solely developed pathological gambling under dopaminergic medication suggests an underlying genetic vulnerability mechanism (voon et al., 2006). to analyse the genetic susceptibility of parkinson's patients with pathological gambling, several genes have been examined that are relevant for the function of the mesolimbic reward system. the most obvious genes to investigate are the dopamine receptor genes, which could be affected by dopaminergic medications. some studies suggest that a certain mutation of the drd2 gene (taq1a) is more frequent in pathological gamblers than in the general population (lobo et al., 2010). this variation in the gene may be connected to a lower density of d2receptors in the striatum (thompson et al., 1997) and to impulsivity (eisenberg et al., 2007), while the literature is inconclusive regarding its potential role in alcohol addiction (heinz et al., 1996; heinz&goldman, 2000; munaf et al., 2007 however, no significant difference was found between the frequency of this mutation between parkinson's patients with and without pathological gambling (lee et al., 2009). interestingly, recent case reports suggest that not only dopamine agonists but also dopamine antagonists acting on the d2 receptors can trigger pathological gambling (grtsch et al., 2015), which underlines the role of this receptor. on the other hand, the homozygote genotype of a single nucleotide mutation (p.s9 g) of the drd3 gene has been shown to have a higher frequency in pathological gamblers with parkinson's disease (lee et al., 2009). this mutation is not associated with increased risk for pathological gambling in the general population (lobo et al., 2010). however, the heterozygote genotype of this mutation has been reported to be linked to impulsivity (retz et al., 2003; limosin et al., this mutation was also associated with decreased response rate to pramipexole in parkinson's patients (liu et al., 2009), which could result in higher prescribed dosage. according to our current knowledge, there has not been any study performed yet to assess the relationship between drd4 mutations and pathological gambling in parkinson's patients. however, the number of tandem repeats of a 48bp region in the drd4 gene is associated with pathological gambling, substance abuse and impulsivity, with discordant results of what number of repeats is relevant (de castro et al., 1997; comings et al., 1999 healthy subjects with this genotype also presented an increased gambling behaviour after receiving ldopa (eisenegger et al., 2010). another neurotransmitter system that has been shown to be affected in patients with pathological gambling is the serotoninergic system. (1999) have observed a significantly higher frequency of the short (s) allele of the promoter region of the serotonin transporter gene, 5httlpr, in male pathological gamblers compared to the general population. the s allele of 5httlpr has also been associated with increased risk of developing depression under stress (karg et al., 2011), some aspects of impulsivity (sakado et al., 2003), impulsive aggression and increased activity in the amygdala after negative affective visual stimuli (heinz et al., 2011). an association between this mutation and pathological gambling has indeed been observed in patients with parkinson's disease (lee et al., 2009). another mutation that may be associated with pathological gambling in parkinson's patients is the mutation of grin2b (lee et al., 2009). grin2b is a gene from the 2b subunit of the nmda receptor, which is mainly expressed in the hippocampus, the striatum and also the cortex (loftis&janowsky, 2003). the variation found to be more frequent in parkinson's patients with pathological gambling is a single nucleotide polymorphism. its specific role in the development of pathological gambling in parkinson's disease is unclear, as this variation does not cause an amino acid change (c.366c>g). furthermore, it was also found to be associated with schizophrenia (li&he, 2007), as a different polymorphism of grin2b has been associated with obsessive compulsive disorder (arnold et al., 2004). (2011) found a different single nucleotide polymorphism of the grin2b gene to be related with risky decisionmaking, which might be considered as impulsive behaviour and therefore explain a link to pg in parkinson's disease. these research findings suggest that an underlying genetic susceptibility might facilitate the development of pathological gambling in parkinson's patients. however, some studies are inconsistent and there are some differences between pathological gamblers with and without parkinson's disease. altogether, these results and the observed connection to dopaminergic medication described above suggest that the vulnerability of parkinson patients towards pathological gambling may be triggered by dopamine agonists. several studies have compared neuronal activation patterns of parkinson's patients with and without pathological gambling. summarizing the results, differences have been found in the activity of regions associated with the mesolimbic reward system, mainly in the orbitofrontal cortex (ofc) and the ventral striatum (cilia et al., 2008; (2008) compared the blood perfusion of different brain regions in parkinson's patients with pathological gambling with patients who only have parkinson's disease and a control group in a spect imaging study in a resting condition. they have observed a generally increased blood flow in the ofc, hippocampus, parahippocampal gyrus, amygdala, ventral striatum and cuneus on the right hemisphere and in the insulae on both sides in parkinson's patients with pathological gambling compared to both other groups. (2013) studied the function of the subthalamic nucleus by capturing local field potentials (lfp) in parkinson's patients with and without pathological gambling on medication during an economic task. the lfps were recorded with the aid of stn dbs electrodes that were implanted 4 days prior to the experiment. the economic task included nonconflict and conflict decisions with stimuli pairs with the same probability vs. stimuli pairs with different probabilities of winning money. in conflict situations, risky choices could result in a higher reward, however, the task was overall designed to reward more nonrisky choices. the results showed that during the economic decisionmaking task, lowfrequency oscillations synchronize in the subthalamic nucleus. this synchronization was stronger during highconflict situations in comparison to lowconflict situations in patients with pathological gambling. patients without pathological gambling showed no differences in the synchronization of lowfrequency oscillations during conflict or nonconflict situations. the results of this experiment underline the role of the subthalamic nucleus in decisionmaking and might also explain why symptoms of pathological gambling resolve in some parkinson patients after stn dbs surgery. however, the results do not explain why patients usually only improve after months of stn dbs therapy. some studies focused more on the dopaminergic system and several differences were found between pathological gamblers with parkinson's disease and parkinson's patients without gambling. the turnover of monoamines, including dopamine, in the ofc was found to be higher (joutsa et al., 2012), further the dopamine release during gambling tasks was found to be significantly increased in pathological gamblers (steeves et al., 2009). these results suggest that the vulnerability to gambling problems is partly mediated by increased dopaminergic neurotransmisson the ofc and the ventral striatum. pathological gambling in these patients may be caused by dopamine agonists in the mesolimbic dopaminergic system, particularly in the ventral striatum, which is less affected by the disease than the dorsal striatum. as dopamine agonist therapy seems to have a very strong association with the development of pathological gambling (voon et al. 2010), imaging studies have been conducted to further understand the effect of this medication. dopamine agonists have been shown to effect reward processing; patients on this medication have a diminished reaction in the ofc after negative prediction errors compared to patients on levodopa therapy or off medication (van eimeren et al., 2009), suggesting a decreased learning effect after punishment. parkinson's patients with and without pathological gambling or compulsive shopping were compared in a prediction learning task on or off dopamine agonists. patients with pathological gambling were faster and better at learning and had a higher activity in the ventral striatum and the ofc during rewardrelated learning while on medication. on the contrary, while learning through loss, the activity of these areas was lower in this group of patients than in the group with parkinson's disease only under the same circumstances. (2012) suggest that these patients have an impaired activation of d2 and d3autoreceptors caused by tonic stimulation through dopamine agonists. through the absence of negative feedback, these findings could be used to propose that dopamine agonists cause a higher vulnerability to pathological gambling due to impaired learning processes. as a consequence of the impaired negative feedback, the dopamine concentration would not decrease to the previous level after a rewardrelated dopamine release. the high level of dopamine could also blunt the drop of dopamine concentration after punishment. imaging studies with nonparkinson patients with pathological gambling also showed differences in the activation of the mesolimbic rewards system, however, the results are not consistent. some studies showed a reduced activation of the prefrontal cortex and ventral striatum during loss and gain anticipation as well (balodis et al. 2012), others showed higher activity in the striatum during gain anticipation (romanczukseiferth et al., 2015). the activity of the prefrontal cortex and the ventral striatum also seems to be diminished after successful loss avoidance compared to healthy control subjects (romanczukseiferth et al. neuronal activity during loss and gain anticipation and loss avoidance have not been researched yet in parkinson's patients with pathological gambling. as described above, impulsive behaviour is considered to be a general risk factor for developing pathological gambling in patients with parkinson's disease (voon et al., 2007; johansson et al., 2009). however, there are studies that indicate a more specific connection: frank et al. (2007) compared two groups of patients with parkinson's disease with a control group, assessing their learning ability in a probabilistic prediction task and their performance in a conflictbased decision task. one of the groups of parkinson's patients was treated with dopaminergic medication, the other group with stn dbs and lowdose dopaminergic therapy. the first group's performance was compared on and off medication, the second group's performance on and off stn dbs without changing the dosage of their medication. the results in the prediction task in the group taking dopaminergic medication only were similar to the findings of voon et al. (2010) described above, that is, the learning ability of patients from negative outcome was impaired on medication. the activation of deep brain stimulation showed no effect on the learning ability of the patients, neither after reward nor after punishment. on the other hand, in the conflictbased decision task, patients with activated stn dbs responded faster in high rather than in lowconflict conditions, while off deep brain stimulation, their response was slower during highconflict situations. dopaminergic medication did not affect the difference in decisionmaking speed in high vs. lowconflict conditions. this result is supported by other experiments assessing patients with stn dbs clinically with the barratt impulsiveness scale (hlbig et al., 2009) and the simon task (wylie et al., 2010). if high impulsivity can promote pathological gambling, as suggested by the results of frank et al. (2007), there should be a higher risk for parkinson's patients treated with stn dbs. however, there are only individual cases of patients developing pathological gambling after initiation of deep brain stimulation (smeding et al., 2007), with no clear way of interpretation, because dopaminergic medication had also been changed postoperatively. (2009) found a higher frequency of impulse control disorders (icds) in parkinson's patients treated with stn dbs. however, the difference in prevalence of icds to the patient group only receiving drug therapy was not significant and it was not described when these patients developed icds and how long they had already received dbs therapy. this information is relevant, as the recovery from icds after the initiation of dbs therapy can take up to 4 years and in some cases the symptoms initially worsen after the therapy (ardouin et al., 2006). the effects on impulsive and compulsive behaviour of stn dbs can also depend on the localization of the electrodes. the stimulation of the limbic subregion of the stn or the stimulation of adjacent structures can change the neurotransmission in limbic brain regions (winter et al., 2008). these findings question the causal relationship between high impulsivity and pathological gambling in parkinson's patients. altogether, more research is needed for clarification of the effects of stn dbs. on the other hand, the results of those studies comparing the effect of stn dbs and dopamine agonist medication support the theory that parkinson's patients with pathological gambling show impaired learning mechanisms modulated by dopamine agonists. therefore, alterations of reward and punishment processing seem to play a prominent role in the development of pathological gambling in parkinson's patients. several genetic and neurofunctional findings suggest that individual differences in dopaminergic neurotransmission in the ventral striatum and associated brain areas contribute to pathological gambling in parkinson's disease, and indicate complex interactions between such risk factors. taken together, altered learning processes in parkinson's patients with pathological gambling appear to include increased baseline blood perfusion of mesolimbic brain areas, increased activation by reward and reduced activation by punishment in those brain areas, which are implicated in reinforcement learning (schultz, 2002), impulsivity (horn et al., 2003), addiction (kalivas&volkow, 2005) and pathological gambling (romanczukseiferth et al., 2015). however, most of the studies performed in parkinson's patients with pathological gambling are retrospective or crosssectional research, which makes the analysis of potentially causal factors more difficult. for example, in crosssectional studies, impulsivity seems to be an important risk factor (voon et al., 2007); however, these findings are not fully consistent with the results of experimental studies on the effects of dbs of the stn. prospective or longitudinal studies could broaden the perspective on the role of potential risk factors, that is, impulsivity or impaired learning. despite the obstacles in conducting such studies, the results of this research can play a crucial role in understanding the development of pathological gambling and icds not only in parkinson's patients but also in the general population.

abstractthe incidence of pathological gambling in parkinson's patients is significantly greater than in the general population. a correlation has been observed between dopamine agonist medication and the development of pathological gambling. however, scientists conjecture that the affected patients have underlying risk factors. studies analysing parkinson's patients have detected that patients who developed pathological gambling are younger, score higher on noveltyseeking tests, are more impulsive and are more likely to have a personal or family history of alcohol addiction. in addition, some genetic variations have been associated with the susceptibility of developing pathological gambling, which include mutations of drd3, 5httlpr and grin2b. studies focusing on neurofunctional discrepancies between parkinson's patients with and without pathological gambling have found increased functional activation and dopamine release in regions associated with the mesolimbic reward system. furthermore, there is also evidence showing increased processing of reward and decreased activation elicited by punishment, suggesting altered learning processes. furthermore, the role of deep brain stimulation of the nucleus subthalamicus (stn dbs) is controversial. in most parkinson's patients, pathological gambling resolved after the initiation of the stn dbs, which might be explained by discontinuation or decrease in dopamine agonist medication. however, it has been also shown that some patients are more impulsive while the stn dbs is activated. these differences may depend on the dbs localization in the more limbic or motor part of the stn and their regulative effects on impulsivity. further research is needed to clarify susceptibility factors for the development of pathological gambling in parkinson's patients.

PMC5215459

pubmed-107

in the right amounts, boron is an essential nutrient for animals, plants, and fungi [13]. however, at high concentrations boric acid (ba) becomes an effective poison that is widely used for the killing of diverse organisms ranging from bacteria to rodents. in medicine while the molecular details of ba action on yeast remain unclear, it was recently shown that ba interferes with morphogenesis, to the effect that it inhibits the transition from the yeast to the hyphal form of the pathogenic yeast c. albicans. because the ability to switch to hyphal growth is an important virulence factor in c. albicans, suppression of such elongated growth by ba may in part explain its therapeutic effect. the present study was undertaken to assess the effect of ba on morphogenesis and cell wall synthesis in yeast, using the well-established model organism saccharomyces cerevisiae as a study subject. in s. cerevisiae, morphogenesis and cell wall synthesis depend on the correct assembly of cytoskeletal proteins. to guide cell wall synthesis during cytokinesis, a ring of septin filaments forms during the g1 phase of the cell cycle and is subsequently completed into a contractile actomyosin ring (car) by the addition of myosin and actin, among other proteins [8, 9]. to complete abscission, the last phase of cytokinesis, the cells first separate mother and daughter cells with a chitin primary septum. the deposition of glucan and mannoprotein-rich cell wall material on the mother and daughter side of the primary septum later completes the trilaminar septum that can be observed under normal culture conditions. a disturbance in the assembly of the septation apparatus the cohesive functional unit that constructs the primary septum leads to the formation of highly aberrant septa [10, 11]. the septa formed under these conditions do not allow for the separation of cells after cytokinesis, leading to the formation of chains and clumps of misshaped cells. based on the observation that ba causes such clumping and chain formation in s. cerevisiae, the present study was initiated to assess the influence of ba on the function of the septation apparatus. strain yms415 (chs3::ha-his3) was constructed by the short flanking homology method. the chs3::3ha-his3 fragment was amplified by pcr from plasmid pfa6a-3ha-his3mx6 with primers 5-tattctcaatcggaaggaggaaagtgactccttcgttgcaggtggaggtggaggtggaggtggacggatccccgggttaattaa-3 and 5-tcaacttgtaagtatcacagtaaaaatattttcatactgtgaattcgagctcgtttaaac-3. integration of the fragment was verified by pcr and western blotting. transformants showed a wild-type like distribution of chitin in calcofluor white stained preparations, demonstrating full functionality of the chs3p-ha fusion protein. a visual representation of ba sensitivity was obtained by serially diluting an overnight culture of yeast grown in ypd and spotting 5 l of cell dilutions on ypd plates with the indicated concentrations of ba. viability staining of yeast cultures was performed by incubating cells in 0.2 mg/ml methylene blue in 50 mm kh2po4 for 5 minutes at rt. in order to visualize the distribution of chitin and glucan in the cell wall, cells were washed and incubated for 5 minutes in 0.01% calcofluor white or 0.5% aniline blue, respectively. fluorescence was observed with a standard diamidino-2-phenylindol (dapi) filter set (zeiss). fifty ml yeast cultures at a titer of 1510 cells/ml in ypd were fixed by the addition of formaldehyde to a final concentration of 4% and incubated for 10 minutes at room temperature. cells were pelleted and incubated for 1 hour in phosphate buffered saline (pbs; 137 mm nacl, 2.7 mm kcl, 10 mm na2hpo4, 1.76 mm kh2po4, ph 7.4) with 4% formaldehyde. after 2 washes in pbs, cells were suspended in 100 l pbs with 10 l of an alexa 568-phalloidin solution (6.6 m in methanol; invitrogen) and 1 l of 1 mg/ml calcofluor white. cells were incubated for 1 hour in the dark and washed twice with pbs. cells were then pelleted and taken up in 50 l prolong antifade reagent (invitrogen) before mounting on slides. gfp-tagged cdc3p and myo1p were observed with the gfp-filter set (zeiss) in cells transformed with prs316cdc3gfp and pms55. analysis of slt2p phosphorylation and total slt2p by western blotting followed established protocols [19, 20]. as a loading control, an antibody directed against tub4p (goat -tubulin yk18, santa cruz biotechnology) was used at 1/1,000 dilution. for the determination of chs3p-ha, cell membranes were isolated according to orlean. one volume of mercaptoethanol-free 2x sample buffer with 2% sds (bio-rad) was added to the protein extracts and samples were loaded on 6% sds polyacrylamide gels without boiling. antibodies used were a 1/5,000 dilution of anti-ha/1/5,000 dilution of goat antimouse hrp (santa cruz biotechnology). membranes were stained in 0.02% coomassie blue r250 in 40% methanol, 5% acetic acid to serve as loading controls. for the determination of enzyme activities, a 40 l glucan synthase assay contained 20 l of membrane suspension at a protein concentration of 1 mg ml, 5 mm c-udp-glucose (activity 1 10 cpm mmol), 75 mm tris-cl ph 7.5, 25 mm kf, and when indicated with 20 m gtp--s for the determination of maximal gs activity. the reaction was incubated for 1 hour at 30c and then stopped by adding 1 ml 10% trichloroacetic acid (tca). reaction mixtures were filtered through a type a/e glass fiber filter (pall). filters were washed twice with 1 ml 10% tca and four times with 70% ethanol. filters were dried and taken up in 10 ml cytoscint es scintillation fluid (icn), and activity was recorded in a scintillation counter. chitin synthesis was determined as described by choi and cabib. to measure chitin synthase 2 and 3 activities, experiments were performed in the chs1 deletion strain ecy46-1-8d. the chs1 deletion was found to have no influence on ba sensitivity (figure 1(a)). the chitin synthase assay mixture contained 20 l of membrane suspension at 1 mg protein ml, 5 l of 0.5 m tris/cl ph 7.8, 5 l of 20 mm cobalt acetate, 5 l of 10 mm c-udp-glcnac (5000 c.p.m. l), and 2 l of trypsin solutions (sigma) at concentrations from 0.25 to 2.0 mg ml in a total volume of 46 l. for determination of chitin synthase 3 activity, 5 l of water were substituted with 5 l of 50 mm nickel acetate. proteolysis was stopped after incubating for 15 minutes at 30c by adding 2 l of a soybean trypsin inhibitor solution at 1.5x the concentration of the trypsin solution. chitin synthesis was initiated by adding 2 l of 0.8 m glcnac. after incubating for 60 minutes at 30c, chitin synthesis reaction mixtures were filtered, washed, and assayed in cytoscint fluid as described above. assays containing cobalt only show activities of chitin synthases 2 and 3 while cobalt/nickel assays show the activity of chitin synthase 3. vital staining of strains yph499 and ecy46-1-8d with 0.05% methylene blue showed that ba concentrations between 0.1 and 0.4% do not severely reduce cell viability (figure 1(a)). in the examined range around the minimal inhibitory concentration of 0.31%, ba thus functions as a fungistatic agent that slows down proliferation but does not kill cells. note that the decline in viability in chs1 deletion strain ecy46-1-8d parallels the decline in wildtype viability. due to the previously reported lysis of daughter cells in chs1 mutants, strain ecy46-1-8d shows a higher fraction of dead cells in all of the examined samples. clumping and chain formation of cells occurs at ba concentrations above 0.2%, with the most striking effect observed at 0.4% (figure 1(b)). this clumping is the hallmark of a cytokinesis defect that causes daughter cells to remain attached to mother cells. a spot test of by4742 cells on ypd plates showed that no growth occurs at ba concentrations above 0.5%although viable cells can be retrieved even after 10 days of incubation under these conditions (data not shown). staining of chitin and glucan in walls of cells grown with 0.4% ba revealed a buildup of cell wall material at bud necks, particularly in cell chains (figure 2). in order to characterize the cytokinesis defect in ba-treated cells, the localization of key morphogenetic proteins at the bud neck was examined by fluorescence microscopy. it was found that ba influences the localization of the septin cdc3, the cytokinetic myosin myo1p, and the ring of filamentous actin that form sequentially in preparation for cytokinesis. increasing concentrations of ba leads to the formation of cdc3gfp rings that are disorganized, uneven, and not centered at the bud neck. moreover, ba causes the formation of cdc3gfp patches at sites other than the buck neck (figure 3). imaging of myo1gfp and actin shows that the formation of the car is impaired in a manner similar to the disturbance in septin ring organization. increasing ba concentrations lowers the fraction of cells with myo1gfp rings at the bud neck from 49 5% at 0% to 25 11% at 0.2% to 11 11% at 0.4%. in addition, myo1gfp rings formed under the influence of ba are often irregular in shape and at high concentrations (0.4%) ectopic localization of myo1gfp patches at sites other than the bud neck is common (figure 4(a)). ba also impairs the assembly of the actin ring at the bud neck, which is the last component to be incorporated into the car before contraction starts (figure 4(b)). actin rings formed under the influence of ba become blurry, faint, and irregular in thickness. under these conditions, it can be observed that some actin rings fail to localize to the narrowest point of the bud neck. in some cases, ba-treated cells due to the low abundance of cells with actin rings in culture (< 2% in controls), quantification of rings yielded no statistically significant data. cultures of cells grown with 0.3% and 0.4% ba were examined by electron microscopy using a protocol that allowed for the visualization of chitin (figure 5). the analysis of ba-treated cells showed massive abnormalities in the cell wall, particularly in the area of the septum, worse at 0.4% than at 0.3%. at these concentrations, ba prevented the construction of a single, straight chitin septum to separate mother and daughter cells. instead, the cells synthesized protuberances extending far into the cytosol and large irregular septa, often at ectopic locations at the cell periphery. in order to assess ba-induced cell wall integrity signaling, the amounts and the phosphorylation status of the signaling kinase slt2p were determined by western blotting (figure 6(a)). phosphorylation of slt2p increases with escalating concentrations of ba, suggesting that ba induces a cell wall integrity stress response. the dramatic increase in phosphorylation of slt2p is accompanied by a weak increase in protein expression. furthermore, it was determined that a slt2 deletion mutant is sensitive to ba (figure 6(b)), suggesting that slt2p-signaling improves ba resistance by causing a transcriptional response to ba stress. western blotting showed a nonlinear correlation between ba concentration and abundance of chs3p-ha (figure 7(a)). while at ba concentrations of 0.1 and 0.2% the amount of chs3p-ha decreases, there is an increase of chs3p-ha at 0.4% ba. the increase of chs3p-ha parallels the increase of chitin-rich septa visible in calcofluor white-stained cultures. the multiple posttranslational and protein targeting processes involved in chs3p and chs2p activation necessitate enzymatic determination of chitin synthase activities in addition to detection of protein amounts. figure 7(b) shows that ba-induced changes in chitin synthase activities mirror the changes in chs3p-ha amount (figure 7(a)) and bud neck thickness (figure 2). while at 0.1% and 0.2% ba decreases chitin synthase activities, presence of 0.3% and 0.4% ba increases chitin synthesis. at 0.4% ba, a measurement of glucan synthase activity in the membranes of strain yph499 showed a constant decline with increasing ba concentrations (figure 7(b)). neither maximal nor physiological (without addition of gtp-s) glucan synthase activity showed an increase at high concentrations of ba. living organisms are constantly exposed to boron, a mineral that is abundant in soil and water. boron is a weak acid and, at physiological ph, is present mostly as boric acid (h3bo3; ba). for each organism, there is an optimal ba concentration. too little ba causes symptoms of deficiency while too much ba has a poorly defined cytotoxic effect. particularly the toxic effects of boron overload have led to a variety of applications for ba and related compounds, ranging from pest control to the treatment of vaginal yeast infections.. the biological function of ba might be due to its reactivity with cis-hydroxyl groups on carbohydrate molecules. examples for boron-dependent reactions include plant hormone-sensitive nadh oxidase activity, the crosslinking of plant cell wall carbohydrates, and the mineralization of bone. the molecular effects of boron lead to developmental defects in animals, particularly in the formation of the skeleton [30, 31]. these teratogenic effects of boron might be caused by direct or indirect inhibition of histone deacetylase activity and a shift in hox gene expression. however, none of the above observations about ba toxicity serve to explain its effect on yeast an organism that does not undergo genomic imprinting or hox-dependent development. the only published data about the ba effect on yeast come from a recent study of the yeast c. albicans that suggested that ba impairs oxidative metabolism. while this observation in itself is interesting and deserves further study, the authors also show that ba directly or indirectly influences the morphology of c. albicans. the present study expands on this observation by showing that ba disturbs morphogenesis in the model yeast saccharomyces cerevisiae, particularly during cytokinesis. the data presented here show that ba impairs the formation of the primary septum in s. cerevisiae a defect that can be explained by incorrect assembly of the cytoskeleton at the bud neck. the molecular machinery that constructs the chitin cell wall between mother and daughter cells, the septation apparatus, consists of chitin synthase 2, and a contractile actomyosin ring (car). the septation apparatus is assembled sequentially from myosin, chitin synthase 2 and actin on a scaffold of septins at the bud neck [8, 9]. should the assembly of a functional septation apparatus fail, the cell is unable to construct an orderly primary septum by chitin synthase 2 and is forced to divide by depositing large amounts of chitin-rich cell wall material at the bud neck. the chitin in these so-called default septa is provided by chitin synthase 3 [10, 33, 34]. since these irregular septum structures are resistant to degradation by chitinase, cells remain connected after cytokinesis and form cell chains and clumps. in s. cerevisiae. a septin assembly that erroneously localizes to a site other than the bud neck will direct the formation of a septum-like structure at the respective location. our data show that in s. cerevisiae increasing concentrations of ba leads to an irregular assembly of the septin scaffold, an inability to position the myo1 ring, and a failure to correctly assemble an actin ring at the bud neck. the aberrant localization and irregular appearance of the septin cdc3gfp in ba-treated cells is an important key to understanding the septation defect. we propose that ba causes problems with the assembly of the septin scaffold which later impair the localization and function of the car, resulting in the formation of highly irregular cell wall structures. like other threats to the integrity of the cell wall, septation defects trigger cell wall integrity signaling through the protein kinase c (pkc) pathway. under these conditions, cell wall integrity signaling leads to hyperphosphorylation of the pkc downstream effector slt2p [3638], accompanied with a much weaker increase in slt2p amount. this will ultimately lead to the activation of cell wall repair enzymes, most notably chitin synthase 3 [36, 40]. the present study shows that ba activates yeast cell wall integrity signaling pathways as evidenced by ba concentration-dependent phosphorylation of slt2p. presumably in response to cell wall integrity signaling, cells increase the activity of the cell wall repair enzyme chitin synthase 3 in a ba concentration-dependent manner. a decline at low concentrations followed by an increase at higher doses should be interpreted based on the impact boric acid on growth. we propose that at concentrations below the mic where the impact on growth is measurable but weak, boric acid stress reduces cell wall synthesis activity along with other metabolic activities. once boric acid stress exceeds a tolerable limit at concentrations above the mic the cell responds forcefully by induction of stress survival mechanisms such as chitin synthase 3-mediated cell wall reinforcement. it is worth noting that the activity of the chitin septum-forming chitin synthase 2 also increases during ba exposure. it is evident that the increase in chitin synthase 2 activity correlates well with the increased number and size of chitin septa in ba-treated cells. however, since the regulation of chitin synthase 2 activity is not well understood, we dare not hazard an explanation for this phenomenon. the data presented in this study show that in s. cerevisiae ba disturbs the localization of the contractile actomyosin ring secondary to causing irregularities in the septin scaffold at the bud neck. in agreement with the reviewed literature we propose that the aberrant localization of the septins ultimately impedes the formation of the primary septum, which leads to the synthesis of thick, chitin-rich default septa. in addition, the localization of septins at sites other than the bud neck explains the synthesis of cell wall protuberances that should be interpreted as incomplete ectopic septa. furthermore, our data show that a ba-induced septation defect, just like other septation defects, triggers cell wall integrity signaling through the pkc1-slt2 pathway and results in increased chitin synthase 3 activity.

boric acid (ba) has broad antimicrobial activity that makes it a popular treatment for yeast vaginitis in complementary and alternative medicine. in the model yeast s. cerevisiae, ba disturbs the cytoskeleton at the bud neck and impairs the assembly of the septation apparatus. ba treatment causes cells to form irregular septa and leads to the synthesis of irregular cell wall protuberances that extend far into the cytoplasm. the thick, chitin-rich septa that are formed during ba exposure prevent separation of cells after abscission and cause the formation of cell chains and clumps. as a response to the ba insult, cells signal cell wall stress through the slt2p pathway and increase chitin synthesis, presumably to repair cell wall damage.

PMC3017954

pubmed-108

these include the intrinsic flexor pollicis brevis, flexor pollicis longus, lumbricalis, flexor brevis, and flexor longus muscles1. toe-gripping strength is measured in the sitting position with the trunk vertical, the hip and knee joints at 90, and the ankle joint in the neutral position1,2,3. low toe-gripping strength is a risk factor of falls for the elderly, and several studies have reported that toe-gripping strength is lower in subjects with a history of falls than in those with no history of falls1,2,3,4. furthermore, toe-gripping strength can be increased by training5, which can decrease the risk of falls1. souma et al.6 studied the% iemg of several crural muscles (the soleus muscle, medial head of the gastrocnemius muscle, and tibialis anterior) during toe-gripping in 3 different ankle joint positions10 of plantar flexion and 0 and 10 of dorsiflexion and reported that the crural muscles help the ankle joint by co-contracting during toe-gripping. in another study, nakae et al.7 calculated the% iemg of the same muscles during toe-gripping with subjects seated on the edge of a seat or standing, and reported that the% iemg of the medial gastrocnemius muscle was significantly lower when subjects were seated than when they were standing. however, as both studies focused on the activity of the crural muscles, the activity of the femoral muscles during toe-gripping remains unclear. we believe it is important to elucidate the contribution of femoral muscles to toe-gripping strength. in the present study, we investigated femoral muscle activity during toe-gripping to examine the role of the femoral muscles in toe-gripping strength. their average (mean sd) age, height, and body weight were 20.6 1.0 years, 159.4 6.3 cm, and 51.8 5.8 kg, respectively. this study was approved by the ethics committee for human research of tohoku fukushi university, and written informed consent was received from all of the subjects after the purpose of the study had been explained to them. toe-gripping strength of the dominant toe and emg activity of the ipsilateral thigh were synchronously recorded to assess the activity of the rectus femoris and biceps femoris muscles. toe-gripping strength was measured using a toe-gripping dynamometer (t.k.k.3360; takei co, ltd, niigata, japan). as described by uritani8, the subjects were instructed to sit with their trunk in the vertical position, hip and knee joints at 90, and ankle joints in the neutral position. after a sufficient number of training trials and adequate rest, toe-gripping strength was measured twice and the maximal force was used in the analysis. for all subjects, the right toe was dominant (defined as the toe used to kick a ball). to measure the maximum voluntary contraction (mvc) activity of the rectus femoris muscles, as described by kai9, each subject was instructed to sit on a chair with the hip and knee joints at 90, and to exert maximal isometric force of knee extension while resisting an opposing force applied by the examiner. the emg was recorded for 3 seconds while each subject exerted maximal force of knee extension. to measure the mvc of the biceps femoris muscle, each subject was instructed to generate maximal isometric force of knee flexion while resisting an opposing force applied by the examiner. the emg was recorded for 3 seconds while each subject exerted maximal force of knee flexion. after confirmation of adequate skin preparation (skin resistance of less than 5 k), three bipolar lead electrodes (de-2.1, delsys, inc., boston, usa) were attached to the skin over the rectus femoris and the long head of the biceps femoris, as described by peroto10. for measurement of the rectus femoris muscle, the electrode was attached at the midpoint between the superior edge of the patella and the anterior superior iliac spine. for measurement of the long head of the biceps femoris, the electrode was attached at the midpoint between the head of the fibula and ischial tuberosity. the emg signal was collected using ml846 power lab 4/26 (sample: 1,000 hz; ad instruments co., ltd.) and transferred to a personal computer. the bandwidth was 20500 hz. the emg signal segment selected and integrated (integrated electromyogram: iemg) for analysis was the middle 1 s of the entire 3-s duration of continuous maximal toe-gripping strength. the iemg was analyzed using lab chart pro v7.3.5 (ad instruments co., ltd.) and normalized to the iemg of each muscle s mvc. repeated mann-whitney u tests were used to compare the% iemg of the rectus and biceps femoris muscles. relationships between the% iemg of the rectus and biceps femoris muscles were statistically analyzed using spearman s correlation coefficient. the average (mean sd) toe-gripping strength was 20.9 3.6 kg. the average (mean sd)% iemg values of the rectus and biceps femoris muscles were 7.0% 6.2% and 25.6% 15.9%, respectively. the% iemg of the biceps femoris was significantly higher than that of the rectus femoris (p<0.01, table 1table 1.comparison of the% iemg values of the rectus femoris and biceps femoris muscles during toe-gripping actionrectus femorisbiceps femorismedian (range: min max)median (range: min max)%iemg4.8*(1.521.1)27.2 (3.068.1)mann-whitney u test *: p<0.05). mann-whitney u test *: p<0.05 using spearman s correlation coefficient analysis, a significant positive correlation was found between the% iemg of the rectus femoris and that of the biceps femoris (r=0.548, p in the present study, we found that the% iemg of the biceps femoris was significantly higher than that of the rectus femoris. moreover, a significant positive correlation was found between the% iemg of these two muscles. these results suggest that femoral muscles co-contract during toe-gripping action, and thus possibly contribute to knee joint stability. we found that toe-gripping action stimulates femoral muscle activity and that the% iemg of the biceps femoris was significantly higher than that of the rectus femoris. sato et al.11 reported that during toe-gripping, the tibialis anterior and soleus muscles are activated first, followed by the gradual activation of the medial head of the gastrocnemius muscle. the biceps femoris initiates knee flexion, and the medial head of the gastrocnemius is a synergist for knee flexion. additionally, active tension of the biceps femoris decreases during toe-gripping in knee flexion. this may be because the length of the biceps femoris is shorter during active tension than during resting tension. we think that the activation of the biceps femoris during toe-gripping was caused by increasing motor unit recruitment and synchronization of the impulse to compensate for decreasing activity of the biceps femoris. in the present study, we found a significant positive correlation between the% iemg of the rectus femoris and that of the biceps femoris. this suggests that the% iemg of the rectus femoris increases with increases in the% iemg of the biceps femoris. toe-gripping strength was measured using a closed kinetic chain movement, and therefore, the likelihood of movement in the directions of flexion or extension of the knee joint is less. however, because the gastrocnemius also acts on knee joint flexion during exertion of toe-gripping strength, the knee joint is readily displaced in the direction of flexion. to prevent this, it is thought that the knee joint is immobilized by contraction of the rectus femoris, that is, we think the rectus femoris during exertion of toe-gripping strength acts in order to control the action of knee joint flexion by the gastrocnemius. first, we were unable to avoid the common problems that negatively affect surface emg recording, such as skin resistance, artifacts, and the effects of proximal muscles. second, as only healthy young women participated in this study, it is difficult to extend our findings to the general population. in future studies, we need to consider this aspect, and involve healthy young men and individuals of different age groups.

[ purpose] in the present study, we investigated femoral muscle activity during toe-gripping, and the role of the femoral muscles in toe-gripping strength. [subjects] fourteen healthy young women were selected. [methods] we measured the maximum voluntary contraction of the rectus femoris and long head of the biceps femoris muscles. we then calculated the percent integrated emg (% iemg) during the toe-gripping action. [results] we found that the% iemg of the biceps femoris was significantly higher than that of the rectus femoris. moreover, a significant positive correlation was found between the% iemg of the rectus femoris and that of the biceps femoris. [conclusion] these results suggest that femoral muscles co-contract during the toe-gripping action, and thus possibly contribute to knee joint stability.

PMC4210413

pubmed-109

the majority of our likes and dislikes we acquire throughout the lifespan are the product of learning. one of the most important ways through which stimuli acquire affective meaning is the change of valence that results from pairing one stimulus (cs) with a positive or negative affective stimulus (ucs). as a result this effect is called (associative) evaluative conditioning and has been demonstrated in humans with a large variety of procedures and stimuli (e.g., [24]; for a meta-analysis see). in dementia severely impaired explicit memory nonetheless, patients with dementia might still be able to implicitly learn affective reactions through the process of evaluative conditioning. however, to the best of our knowledge, no study applied this approach in dementia patients. another classical paradigm that has already been used to investigate conditioning of affective reactions in this population is fear conditioning. indeed, two studies indicate that fear conditioning is impaired in dementia patients [6, 7]. even though fear conditioning is impaired, evaluative conditioning might still be possible in dementia patients. some researchers have argued that while on a procedural level evaluative conditioning is similar to fear conditioning, the underlying processes might be different. it was hypothesized that fear conditioning is an instance of signal learning; it is learned that the ucs is going to appear after the presentation of the cs. evaluative conditioning, on the other hand, only involves a reference to the ucs without expectation of its occurrence. thus, explicit knowledge about the cs-ucs relation seems crucial in fear conditioning while evaluative conditioning can be demonstrated in the absence of contingency awareness [1012]. since there could be variables that play a different role in these forms of learning; dementia patients might show intact evaluative conditioning despite impaired fear conditioning. indeed, some studies indicate that dementia patients might retain the capacity to acquire affective reactions [13, 14]. blessing et al. demonstrated that dementia patients ' affective reactions can be influenced by pairing faces with fictional biographical content that characterized the depicted persons in terms of either positive or negative traits. pictures were rated before and at two different time points after the presentation of fictional biographical content with respect to valence and arousal. patients changed their ratings of pictures according to the biographical information presented, but did not recognize pictures above chance level or recall biographical information. these findings were replicated and extended in a subsequent study. the paradigm used by blessing et al. [however, there are two main differences: (1) in standard evaluative conditioning paradigms the subjects are not explicitly informed about the interrelation between stimuli in the learning phase. in the paradigm used by blessing et al. [13, 14] the paring of the cs and ucs is made explicit and thus, the procedure can not be described as a simple cooccurrence of stimuli; (2) in contrast to the approach of blessing et al. [13, 14] the ucs and cs in evaluative conditioning paradigms belong to the same type of stimuli (e.g., faces). hence, in the present study we addressed the question if affective evaluations of dementia patients can be manipulated using a standard evaluative conditioning paradigm. participants. demographical data and clinical characteristics of both groups are listed in table 1. the study included 15 dementia patients (diagnosed as alzheimer's disease (n=10) or mixed dementia (n=5)). patients were outpatients in the memory clinic of the psychiatric clinic of muensterlingen at the time of testing. all patients were diagnosed by a multidisciplinary team of the hospital ward using icd 10 criteria. all patients had received medical attendance including magnetic resonance imaging and specific screening blood tests, in order to exclude syphilis, diabetes, thyroid disorders, and vitamin b12 and folic acid deficiency. they reported that they had no known cns diseases, contact with toxic substances, or substance abuse. test stimuli were 10 pictures of neutral (i.e., displaying no facial expression of emotion) unfamiliar faces (6 female: 3 young, 3 old; 4 male: 2 young, 2 old) and one picture of a happy young, female adult as well as one picture of a happy old, male adult selected from the productive aging laboratory face database. however, based on affective valence ratings of these pictures in other studies (dann hier referenz), some of the included faces were also rated as positive or negative. the happy faces were added to increase the variance in subjective liking between pictures. emotional ratings. the sam was designed to assess subjective ratings of participants ' emotional responses and minimize the influence of language and culture on ratings. the sam valence rating scale has been successfully used in previous studies with dementia patients [13, 14]. using the paper-pencil version of this instrument, participants rated the stimuli as to their emotional valence (range: 19). similar to other studies investigating evaluative conditioning we used a cover story in order to minimize demand effects. participants were told that the aim of the experiment was to examine the relationship between mood and subjective affective evaluation. in line with this cover story participants rated their mood on a five-point likert scale (very good/good/normal/bad/very bad). subsequently, the pictures were presented to participants one after the other and rated with respect to valence using the sam rating scale. pictures were presented in four different pseudorandom sequences. after the valence rating an individual, unequivocal preference order of all stimuli was established. the pictures that received identical valence ratings were again presented to participants who then had to decide which of the pictures they preferred and the respective picture was put aside. again, the participants had to choose which of the remaining pictures with identical valence ratings they preferred and so on. the most preferred stimulus out of the 12 faces was used as the liked (l) stimulus and the stimulus with the lowest ranking was used as the disliked (d) stimulus. the four stimuli ranked 5th, 6th, 7th, and 8th were used as neutral (n) stimuli. the experimenter entered these six individual l, d, and n stimuli in a computer program (presentations 11.3) that automatically formed three stimuli pairs (i.e., neutral-liked, neutral-disliked, and neutral-neutral) by randomly assigning the neutral stimuli. participants were then seated about 50 cm from the computer screen and instructed to look at the pictures that would appear on the screen. each picture from the different pairs (i.e., (n-l), (n-d) or (n-n)) was presented 10 times in the center of the computer screen. the duration of each stimulus presentation was 1 second and the interstimulus interval (isi; i.e., onset of the first stimulus of a pair to onset of the second stimulus of a pair) was 4 seconds. the inter-trial interval (iti; i.e., onset of the first stimulus of the previous trial to onset of the first stimulus of the next trial) was 13 seconds. after the presentation of stimuli on the computer screen, participants were again asked to rate the n, d, and l stimuli on the sam valence rating scale. the three relevant n stimuli (i.e., the first stimulus of each pair) were placed one after the other in front of participants together with the three stimuli second in the pairs (l, d, n). participants were asked to indicate which of these three stimuli followed the currently presented n stimulus. the experimenter registered the answer on a response sheet. a repeated measures analyses of variance (anovas) was conducted for the valence ratings of the relevant n stimuli (i.e., the first stimulus of each pair). a separate analysis was performed for ratings of stimuli paired with l and d pictures. type of stimulus pair and measurement point (i.e., valence rating pre and post presentation) were used as within-participant factors and group was included as between subject factor. in the case of significant group differences a separate analysis was performed for both groups. the repeated measures anova revealed no main effect of type of stimulus pair (f(2,26)=2.42; p>.109) but an interaction between type of stimulus pair and time (f(2,26)=7.354; p>.003; see table 2). this interaction was due to the fact that there was no influence of the type of stimulus pair at baseline (f(2,27)=0.296; p>.746), but a significant effect after conditioning in the direction of the experimental manipulation (f(2,27)=5.460; p<.010). no interaction between type of stimulus pair and group (f(2,26)=3.023; p>.066) or stimulus pair, time, and group (f(2,26)=2.798; p>.079) appeared. anova indicated no main effect of time (f(1,27)=0.78; p>.385). as expected, we found a grater rating change over time for stimuli paired with l and d pictures than stimuli paired with n pictures (see table 2). we conducted a separate analysis using only pictures paired with l and d pictures to further investigate the influence of the experimental manipulation. the repeated measures anova revealed a main effect of type of stimulus pair (f(1,27)=4962; p>.034) along with an interaction between type of stimulus pair and time (f(1,26)=15.237; p>.001; see table 2). we found no significant interaction between type of stimulus pair and group (f(2,26)=2.894; p>.10) but a significant interactions between stimulus pair, time, and group (f(1,26)=5.784; p<.023). anova indicated no main effect of time (f(1,27)=0.296; p>.591). because of the significant interaction between stimulus pair, time, and group, indicating group differences, we performed a separate analysis for each group. the repeated measures anova for valence ratings of pictures paired with l and d stimuli of dementia patients revealed a significant main effect of type of stimulus pair (f(1,14)=16.000; p>.001) along with an interaction between type of stimulus pair and time (f(1,14)=29.007; p>.001). we found no main effect of time (f(1,14)=0.121; p>.733). the repeated measures anova for ratings of controls indicated no main effect of type of stimulus pair (f(1,13)=.087; p>.773) and no interaction between type of stimulus pair and time (f(1,13)=.832; p>.378). again, anova indicated no main effect of time (f(1,13)=0.188; p>.671). in the group of dementia patients, 24.4% of the relevant n stimuli were assigned to the correct stimulus second in the pairs in the forced choice test, which did not differ from chance level (i.e., 33.3%; p>.14). in the control group, 31% relevant n stimuli were assigned to the correct stimulus second in the pairs in the forced choice test, which did not differ from chance level (i.e., 33.3%; p>.37). the main aim of the present study was to investigate if affective evaluations of dementia patients can specifically be influenced through a standard evaluative conditioning paradigm. as hypothesized, dementia patients changed their valence ratings of unfamiliar and previously neutral faces according to its pairing with either a liked or disliked face stimulus. generally, the neutral pictures that were paired with a liked stimulus were rated higher and the neutral picture that was paired with the disliked stimulus was rated lower on the valence dimension after our evaluative conditioning intervention by dementia patients. thus, results indicate that ratings of initially neutral stimuli can be influenced in the according direction through simple time-near presentation (i.e., pairing) with both a liked as well as a disliked stimuli. it does not seem surprising that our forced choice recognition test indicated no contingency awareness as this is based on the functionality of explicit memory that is severely impaired in dementia patients. however, dementia patients significantly differed from controls in the effect of the experimental manipulation. the negative finding in the control group could indicate that our paradigm did not produce evaluative conditioning effects. consequently, the detected influence in the ad group could be accounted for by demand effects or other nonevaluative conditioning effects. another explanation could be that there was only a small effect in the control group that could not be detected due to small sample size. however, the sample size was only slightly smaller than that of the ad group. we looked at the data on the level of individual subjects and found that 11 of 14 subjects in the control group changed their ratings in the expected direction or showed no rating change. the negative result in the control group was due to two participants who showed a strong rating change in the opposite direction. post hoc analysis indicated a significant influence of the experimental manipulation in the control group after exclusion of these two outliers (p<.028). thus, it seems possible that evaluative conditioning effects in the control group were masked by the influence of outliers in our small sample. the rating changes of outliers could have been motivated by reactance, as observed in other studies investigating evaluative conditioning. our result could also indicate that evaluative conditioning effects are stronger in dementia patients than in healthy elderly controls. a possible reason for stronger effects could be lower attentional resources in dementia patients due to disease-related cognitive impairments. some studies indicate that attentional resources have a negative impact on affective learning through evaluative conditioning (e.g. [19, 20 ]) and accordingly it seems possible that dementia patients show stronger effects. however, there are conflicting findings concerning the influence of attentional resources on evaluative conditioning (e.g.,). the observed positive change of the valence rating in the neutral stimulus that was paired with another neutral stimulus could be a result of the mere exposure effect. this effect describes the preference for stimuli that have been previously presented over novel stimuli. preference changes due to the mere exposure effect have also been demonstrated in dementia patients [2325]. in line with this explanation are findings from other studies investigating evaluative conditioning that report a similar trend of positive changes in evaluations of neutral pictures paired with other neutral pictures over time. the results suggest that dementia patients changed their ratings according to the experimental manipulation without contingency awareness, since pairings were not identified above chance level in the forced choice recognition test. in fact, participants of the control group performed better than dementia patients in the recognition test, yet their results did not differ from chance level as well. the results of dementia patients are in line with findings demonstrating evaluative conditioning in healthy participants using subliminally presented stimuli [2729]. could show that the individual amount of the evaluative conditioning effect is not related to the number of pairings (i.e., neutral stimulus-affective stimulus) participants were aware of. on the other hand, findings of a recent meta analysis suggest that contingency awareness is an important moderator in evaluative conditioning. however, a critical limitation of the present study is our assessment of contingency awareness using a forced choice recognition test. following the recent discussion of gawronski and walther, it seems possible that we measured contingency memory rather than contingency awareness. subjects may have realised the respective pairings during conditioning but may not have been able to remember these pairings explicitly when the recognition test was applied. this may have been the case especially in dementia patients because of severe memory deficits. subjects may have remembered statistical probabilities that could not be assessed using a forced choice test. thus, it is also possible that contingency awareness differed between dementia patients and controls in our study and that contingency awareness influenced the results. to prohibit contingency awareness, very long time intervals on short isi could facilitate the detection of contingencies in the combinations of pictures and would enhance contingency awareness. however, this result has to be considered preliminary, since it is unclear what prevented rating changes in the expected direction in the control group in our paradigm. nevertheless, the results seem to be in contrast to previously reported impaired fear conditioning. as discussed above it is still unresolved whether evaluative conditioning is a form of pavlovian conditioning or if there are variables that are unique to evaluative conditioning. thus, the results of our study support the notion that different processes are involved in evaluative conditioning and fear conditioning. a relevant difference could be the dependence of pavlovian conditioning on contingency awareness in contrast to evaluative conditioning as discussed above. another reason for conflicting findings in fear conditioning versus evaluative conditioning studies could be the use of different dependent measures. fear conditioning studies primarily use skin conductance as a dependent measure, whereas evaluative conditioning studies rely on behavioural measures. this explanation is supported by recent findings from our lab revealing that changes of affective evaluations were not related to skin conductance responses but to heart rate response in dementia patients in a face-emotion association paradigm. accordingly, there might be a specific impairment in dementia patients with respect to skin conductance response. on a neurophysiological level, the underpinnings of evaluative conditioning are not well understood. some studies indicate that temporal regions and specifically the amygdala are involved in both fear conditioning [3235] and evaluative conditioning. however, there is also evidence suggesting that the functionality of the amygdaloid nuclear complex may not be crucial for the occurrence of evaluative conditioning. hence, preserved evaluative conditioning in dementia patients would be in line with findings demonstrating that despite of impaired fear conditioning evaluative conditioning is preserved in persons with unilateral damage to the amygdaloid nuclear complex. similarly, tranel and damasio report the case of a patient with bilateral damage to the entire medial lobe who could learn connections between unfamiliar persons and affective valence they displayed, despite severely impaired explicit memory. in summary, results of our study suggest that dementia patient ' affective evaluations of neutral stimuli can be changed through pairing with liked or disliked stimuli. however, caution is warranted since it is not unambiguous what caused these rating changes in our study. future research should focus on preserved learning processes in dementia patients since they are of great importance for nonpharmacological therapeutic interventions .

we present results of a study investigating evaluative learning in dementia patients with a classic evaluative conditioning paradigm. picture pairs of three unfamiliar faces with liked, disliked, or neutral faces, that were rated prior to the presentation, were presented 10 times each to a group of dementia patients (n=15) and healthy controls (n=14) in random order. valence ratings of all faces were assessed before and after presentation. in contrast to controls, dementia patients changed their valence ratings of unfamiliar faces according to their pairing with either a liked or disliked face, although they were not able to explicitly assign the picture pairs after the presentation. our finding suggests preserved evaluative conditioning in dementia patients. however, the result has to be considered preliminary, as it is unclear which factors prevented the predicted rating changes in the expected direction in the control group.

PMC4437290

pubmed-110

tumor-associated cell cycle defects, manifesting in unscheduled proliferation, and the associated genomic and chromosomal instabilities are mediated by misregulation of cyclin-dependent kinases (cdks). because of the main role in the division cycle, cdks have been recognized as targets for anticancer therapy. many small-molecule organic compounds, which have been identified as cdk modulators, are currently in preclinical or clinical development. however, no cdk inhibitors have gained marketing approval, despite 20 years of scientific investigation. several studies have shown synergism when cdk inhibitors were combined with organic (e.g., doxorubicin, paclitaxel) and inorganic (e.g., cisplatin, carboplatin) cytotoxic drugs. the first publications have appeared recently and include fe, cu, and pt complexes with cdk inhibitors derived from 6-benzylaminopurine, metal-based indolo-[3,2-d]benzazepines (paullones; ga, cu, ru, and os), and indolo-[3,2-c]quinolines (ru, os). another class of compounds potentially suitable for targeted metal-based chemotherapy is that of 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines. these have been documented recently as potent cdk1 inhibitors with antiproliferative activity in hela (cervical carcinoma), hct116 (colon carcinoma), and a375 (melanoma) human cancer cell lines. comparison of cdk1 inhibitory activity with the inhibiting activity in four other protein kinases (vegf-r2, her2, aurora-a, and ret) revealed selectivity for cdk1. structural modifications consisting of a replacement of both bicyclic rings in 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines by monocycles while retaining the imidazolyl pyrazole core have been proposed in order to obtain inhibitors with improved pharmacokinetic and solubility properties. the most promising were suggested to be 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines (see chart 1). the inspection of substitution patterns on the benzimidazole moiety and structure activity relationships revealed that a methoxymethyl group in position 7b (4b) is favorable for cdk1 inhibiting potency. the role of the pyrazole nh group is also of note, since its methylation led to a significant reduction of cdk1 activity. the effect of various heteroaryl groups in position 5a was also remarkable for the development of more-effective cdk inhibitors and antiproliferative agents. our previous experience with metal-based indolo-[3,2-d]benzazepines prompted the use of the half-sandwich metal-arene moiety as a suitable scaffold to which 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines may be attached. organometallic compounds [m(-arene)(yz)x] (where m=ru, os) exhibit promising anticancer activity and are the focus of attention for several groups. these compounds have shown activity toward classic (dna) and nonclassic (e.g., cdks) targets in anticancer chemotherapy. herein, we report (i) the modified synthetic approach to 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines (recall chart 1: l1, x=h, y=h; l2, x=br; y=h; l3, x=br; y=ch2och3); (ii) the synthesis and characterization of a new family of organoruthenium(ii) (11a, 12a, 13a) and osmium(ii) (11b, 12b, 13b) complexes of the general formula [mcl(-p-cymene)l]cl, where l=3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines (l1l3) (chart 1); (iii) stabilization of the 7b tautomer of methoxymethyl-substituted l3 by metal coordination as well as (iv) nmr spectroscopic characterization of two tautomers 7b-l3 and 4b-l3 in a metal-free state; and (v) cell cycle effects, as well as the antiproliferative and cdk inhibitory activities of both metal-free ligands and organometallic complexes. 1h-pyrazolo[3,4-b]pyridine-3-carboxylic acid (1) was obtained via the oxidation of 3-methyl-1h-pyrazolo[3,4-b]pyridine by kmno4 in the presence of a base, followed by acidification with 37% hcl. solvents [toluene, ethanol (etoh), tetrahydrofuran (thf), diethyl ether (et2o)] were dried using standard procedures. 3-methyl-1h-pyrazolo[3,4-b]pyridine (10.9 g, 0.08 mol) and anhydrous sodium acetate (10.21 g, 0.13 mol) were suspended in glacial acetic acid (42 ml). bromine (20.42 g, 0.13 mol) was added, and the resulting mixture was stirred at room temperature for 22.5 h and then at 110115 c for 2.53 h. afterward, water (300350 ml) was added and the mixture was stirred at room temperature. the formed light yellow precipitate was filtered off and dried in vacuo at 4050 c. yield: 17 g. the raw product was used without further purification in the next step. purification by column chromatography afforded a white powder (sio2, etoac, rf=0.79; 12.5 g, 72.6% yield). esi-ms in meoh (positive): m/z 213 [m+h], 235 [m+na], 253 [m+k]; (negative): m/z 211 [m h]. h nmr (500.32 mhz, meoh-d4): 8.55 (d, 1h, j=2.16 hz, ch), 8.43 (d, 1h, j=2.15 hz, ch), 2.56 (s, 3h, ch3) ppm. h nmr (500.32 mhz, dmso-d6): 13.42 (brs, 1h, nh), 8.54 (d, 1h, j=2.19 hz, ch), 8.53 (d, 1h, j=2.18 hz, ch), 2.49 (s, 3h, ch3) ppm. colorless crystals of 20.5h2o suitable for x-ray diffraction (xrd) study were grown in etoac (see figure s1 in the supporting information). to sodium hydroxide (9.54 g, 0.24 mol) in water (150 ml) was added the raw product 2 (7.1 g, 0.03 mol). after a dropwise addition of kmno4 (16.98 g, 0.11 mol) in water (300 ml) at 100 c over 2 h, the reaction mixture was further heated for 1 h. mno2 was filtered off from the hot reaction mixture and washed with hot water. 400 ml, and the yellow solution was acidified to ph 2, using concentrated hcl. yield: 2.28 g. the crude hydrochloride of 3 was used without further purification in the next step. esi-ms in meoh (positive): m/z 243 [m+h], 265 [m+na], 287 [m+2na h]; (negative): m/z 241 [m h]. h nmr (500.32 mhz, meoh-d4): 8.69 (d, 1h, j=2.22 hz, ch), 8.68 (d, 1h, j=2.22 hz, ch) ppm. h nmr (500.32 mhz, dmso-d6): 14.65 (s, 1h, nh), 13.45 (brs, 1h, nh), 8.72 (d, 1h, j=2.23 hz, ch), 8.58 (d, 1h, j=2.25 hz, ch) ppm. nah (1.75 g, 0.07 mol) was suspended in dry thf (200 ml). a solution of 2-amino-3-nitrobenzyl alcohol (5.23 g, 0.03 mol) in dry thf (100 ml) was added dropwise at 0 c and the mixture was stirred at the same temperature for 15 min. after a dropwise addition of mei (11.5 g, 0.08 mol), stirring was continued at room temperature for 3 h. a saturated aqueous solution of nahco3 (300 ml) and meoh (300 ml) then were added. the organic phase was dried over na2so4, filtered, and evaporated to yield a red oil (4.85 g). the raw product was purified by column chromatography (sio2, etoac, or etoac/hexane 1/1, first fraction, a red-orange oil crystallized to form a red solid at 4 c; yield: 3.68 g, 65%). h nmr (500.32 mhz, dmso-d6): 8.00 (d, 1h, j=8.71 hz, c6h3), 7.09 (br, 2h, nh2), 6.67 (t, 1h, j=8.45 hz, c6h3), 4.48 (s, 2h, ch2), 3.31 (s, 3h, ch3) ppm. a mixture of 4 (1.4 g, 0.008 mol) and 10% pd/c (0.18 g) in dry etoh (55 ml) was stirred under hydrogen atmosphere at room temperature for 1824 h. the catalyst was removed by filtration through gf-3-filter under argon and washed with dry etoh (5070 ml). the filtrate was evaporated in vacuo to give a light-orange solid (1.17 g, 100% yield), which was used immediately in the next step. h nmr (500.32 mhz, dmso-d6): 6.52 (dd, 1h, j=1.87 hz, j=7.25, c6h3), 6.426.36 (m, 2h, c6h3), 4.48 (br, 2h, nh2), 4.31 (br, 4h, nh2+ch2), 3.24 (s, 3h, ch3) ppm. n, n-carbonyldiimidazole (cdi, 4.16 g, 0.026 mol) was added in small portions to 1 (2.34 g) in dry dmf (12 ml). the mixture was stirred at room temperature for 2024 h. water (5 ml) then was added and the suspension was stirred until all co2 was ceased. the white precipitate was filtered off, washed with water (35 ml), and dried in a sublimator in vacuo at 60 c, to remove the imidazole as a contaminant. esi-ms in methanol (positive): m/z 214 [m+h], 237 [m+na]; (negative): m/z 212 [m h]. h nmr (500.32 mhz, dmso-d6): 14.95 (brs, 1h, nh), 8.91 (s, 1h, chim), 8.74 (dd, 1h, j=1.61 hz, j=4.51 hz, chpy), 8.63 (dd, 1h, j=1.59 hz, j=8.12 hz, chpy), 8.14 (t, 1h, j=1.23 hz, chim), 7.51 (dd, 1h, j=4.46 hz, j=8.06 hz, chpy), 7.20 (s, 1h, chim) ppm. n, n-carbonyldiimidazole (cdi, 16.2 g, 0.1 mol) was added in small portions to crude 3 (11.58 g) in dry dmf (70 ml). the mixture was stirred at room temperature for 2024 h. water (10 ml) then was added and the suspension was stirred until all co2 was ceased. the white precipitate was filtered off, washed with water (1015 ml), and dried in a sublimator in vacuo at 60 c, to remove the imidazole as a contaminant. esi-ms in methanol (positive): m/z 315 [m+na]; (negative): m/z 291 [m h]. h nmr (500.32 mhz, dmso-d6): 14.95 (brs, 1h, nh), 8.89 (s, 1h, chim), 8.83 (d, 1h, j=2.12 hz, chpy), 8.75 (d, 1h, j=2.07 hz, chpy), 8.13 (s, 1h, chim), 7.20 (s, 1h, chim) ppm. the solution of 1,2-diaminobenzene (0.5 g, 4.67 mmol) in dry dmf (2 ml) was added to the suspension of 6 (0.94 g, 4.41 mmol) in dry dmf (13 ml), and this reaction mixture was heated under argon at 85 c for 5 h. dmf then was evaporated in vacuo at 50 c and water (1012 ml) was added. the light-yellow precipitate was filtered off and dried in vacuo at 50 c. yield: 0.86 g. the raw product was used without purification in the next step. esi-ms in methanol (positive): m/z 255 [m+h], 277 [m+na]; (negative): m/z 253 [m h]. h nmr (500.32 mhz, dmso-d6): 14.30 (brs, 1h, nhpz), 9.73 (brs, 1h, conh), 8.64 (dd, 1h, j=1.59 hz, j=4.44 hz, chpy), 8.56 (dd, 1h, j=1.53 hz, j=8.02 hz, chpy), 7.397.36 (m, 2h, chpy+chbz), 6.97 (td, 1h, j=1.31 hz, j=7.73 hz, chbz), 6.82 (dd, 1h, j=1.2 hz, j=7.89 hz, chbz), 6.64 (td, 1h, j=1.2 hz, j=7.67 hz, chbz), 4.93 (s, 2h, nh2) ppm. (10 ml) was added to the suspension of 7 (2.28 g, 7.8 mmol) in dry dmf (10 ml), and this mixture was heated under argon at 85 c for 7 h. dmf then was evaporated in vacuo at 50 c and water (20 ml) was added. yield: 2.2 g. the raw product was used without purification in the next step. esi-ms in methanol (positive): m/z 333 [m+h], 355 [m+na]; (negative): m/z 331 [m h]. h nmr (500.32 mhz, dmso-d6): 14.54 (brs, 1h, nhpz), 9.80 (brs, 1h, conh), 8.73 (d, 1h, j=2.26 hz, chpy), 8.69 (d, 1h, j=2.22 hz, chpy), 7.34 (dd, 1h, j=0.98 hz, j=7.88 hz, chbz), 6.99 (td, 1h, j=1.43 hz, j=8.03 hz, chbz), 6.82 (dd, 1h, j=1.22 hz, j=7.96 hz, chbz), 6.64 (td, 1h, j=1.19 hz, j=7.73 hz, chbz), 4.94 (s, 2h, nh2) ppm. a mixture of 5 (1.17 g, 7.69 mmol) and 7 (2.1 g, 7.2 mmol) in dry dmf (45 ml) was heated under argon at 85 c for 20 h. dmf then was evaporated in vacuo at 50 c and water (20 ml) was added. yield: 2.3 g. the product was used without further purification in the next step. esi-ms in methanol (positive): m/z 399 [m+na]; (negative): m/z 375 [m h]. h nmr (500.32 mhz, dmso-d6): 14.54 (brs, 1h, nhpz), 9.85 (brs, 1h, conh), 8.73 (d, 1h, j=2.13 hz, chpy), 8.68 (d, 1h, j=2.05 hz, chpy), 7.29 (d, 1h, j=7.56 hz, chbz), 7.03 (d, 1h, j=7.29 hz, chbz), 6.65 (t, 1h, j=7.79 hz, chbz), 4.78 (brs, 2h, nh2), 4.42 (s, 2h, ch2), 3.29 (s, 3h, ch3) ppm. the raw product 8 (0.86 g) was heated in a glacial acetic acid (10 ml) at 125 c for 2.5 h. the solvent was evaporated under reduced pressure and the residue was dried in vacuo at 50 c, then resuspended in ch2cl2/meoh (4/1, 25 ml), filtered off, and dried in vacuo to give l1 as a white powder (0.4 g). the filtrate was evaporated and the residue was purified by column chromatography (sio2, etoac, rf=0.58) to give an additional amount of l1 (0.22 g). calcd for 110.15h2o0.1etoac (mr=246.76 g/mol): c, 65.22; h, 4.13; n, 28.38. found: c, 65.56; h, 3.90; n, 28.39. esi-ms in methanol (positive): m/z 237 [m+h], 259 [m+na]; (negative): m/z 235 [m h]. vis (methanol), max, nm (, m cm): 232 (25618), 275 (15198), 324 (22333). h nmr (500.32 mhz, dmso-d6): 14.19 (brs, 1h, h1a), 13.11 (brs, 1h, h1b), 8.85 (dd, 1h, j=1.5 hz, j=8.1 hz, h4a), 8.66 (dd, 1h, j=1.5 hz, j=4.5 hz, h6a), 7.75 (d, 1h, j=7.3 hz, h4b or h7b), 7.54 (d, 1h, j=7.7 hz, h4b or h7b), 7.39 (dd, 1h, j=4.5 hz, j=8.0 hz, h5a), 7.24 (m, 2h, h5b+h6b) ppm. c nmr (125.81 mhz, dmso-d6): 153.13 (c8a), 150.22 (c6a), 146.99 (c2b), 144.34 (c8b or c9b), 136.06 (c3a), 134.68 (c8b or c9b), 131.82 (c4a), 123.35 (c5b or c6b), 122.11 (c5b or c6b), 119.44 (c4b or c7b), 118.65 (c5a), 113.33 (c9a), 112.01 (c4b or c7b) ppm. n nmr (50.70 mhz, dmso-d6): 166.2 (n1a), 121.3 (n1b) ppm. the raw product 9 (2.2 g) was heated in a glacial acetic acid (30 ml) at 125 c for 2 h. the solvent was evaporated under reduced pressure, and the residue was dried in vacuo at 50 c, then resuspended in ch2cl2/meoh (7/1, 50 ml), filtered off and dried in vacuo to give l2 as a white powder (1.15 g). the filtrate was evaporated and the residue was purified by column chromatography (sio2, etoac/hexane 2/1, rf=0.6) to give an additional amount of the product (0.27 g). yield: 1.42 g, 58% based on 7. calcd for 120.25h2o0.04etoac (mr=322.17 g/mol): c, 49.06; h, 2.76; n, 21.74. esi-ms in methanol (positive): m/z 315 [m+h], 337 [m+na]; (negative): m/z 313 [m h]. vis (methanol), max, nm (, m cm): 234 (28154), 282 (17628), 335 (17198). h nmr (500.32 mhz, dmso-d6): 14.43 (brs, 1h, h1a), 13.19 (brs, 1h, h1b), 8.99 (d, 1h, j=2.2 hz, h4a), 8.75 (d, 1h, j=2.3 hz, h6a), 7.77 (d, 1h, j=7.9 hz, h4b or h7b), 7.54 (d, 1h, j=7.9 hz, h4b or h7b), 7.26 (m, 2h, h5b+h6b) ppm. c nmr (125.81 mhz, dmso-d6): 151.49 (c8a), 150.66 (c6a), 146.42 (c2b), 144.24 (c8b or c9b), 135.61 (c3a), 134.67 (c8b or c9b), 133.35 (c4a), 123.54 (c5b or c6b), 122.27 (c5b or c6b), 119.55 (c4b or c7b), 114.87 (c5a or c9a), 113.49 (c5a or c9a), 112.09 (c4b or c7b) ppm. n nmr (50.70 mhz, dmso-d6): 167.5 (n1a), 121.3 (n1b) ppm. the raw product 10 (2.3 g) was heated in a glacial acetic acid (40 ml) at 125 c for 2 h. the solvent was evaporated under reduced pressure, and the residue dried in vacuo at 50 c. after washing with ch2cl2 (30 ml), ch2cl2/meoh (2/1, 57 ml) the gray product was purified by column chromatography (sio2, etoac, rf=0.68) to give a white powder (0.9 g). the filtrates were evaporated and the remaining solid was purified by column chromatography to give an additional amount of the product (0.3 g). calcd for 13: c, 50.29; h, 3.38; n, 19.55. found: c, 50.03; h, 3.19; n, 19.19. esi-ms in methanol (positive): m/z 381 [m+na]; (negative): m/z 357 [m h]. vis (methanol), max, nm (, m cm): 235 (29776), 282 (17544), 337 (16958). nmr characterization of 7b-l3 and 4b-l3 tautomers (1/1.3) in dmso-d6: h nmr (500.32 mhz, dmso-d6), 7b-l3: 14.47 (brs, 1h, h1a), 13.25 (brs, 1h, h1b), 8.99 or 8.98 (d+d, (1+1.3)h, j=2.3 hz, h4a+h4a), 8.75 (d, (1+1.3)h, j=2.3 hz, h6a+h6a), 7.72 (dd, 1h, j=1.8 hz, j=6.8 hz, h4b), 7.287.21 (m, (2+2.6)h, h5a, h6a+h5a, h6a), 4.80 (s, 2h, h10b), 3.37 (s, 3h, h11b) ppm. h nmr (500.32 mhz, dmso-d6), 4b-l3: 14.43 (brs, 1.3h, h1a), 13.22 (brs, 1.3h, h1b), 8.99 or 8.98 (d+d, (1+1.3)h, j=2.3 hz, h4a+h4a), 8.75 (d, (1+1.3)h, j=2.3 hz, h6a+h6a), 7.47 (dd, 1.3h, j=1.2 hz, j=7.7 hz, h7b), 7.287.21 (m, (2+2.6)h, h5a, h6a+h5a, h6a), 4.96 (s, 2.6h, h10b), 3.44 (s, 3.9h, h11b) ppm. c nmr (125.81 mhz, dmso-d6), 7b-l3: 151.51 (c8a+c8a), 150.69 (c6a or c6a), 150.65 (c6a or c6a), 146.70 (c2b), 144.46 (c9b), 135.62 (c3a+c3a), 133.45 (c4a or c4a), 133.42 (c4a or c4a), 133.29 (c8b), 123.38 (c6b; c5b or c6b), 123.36 (c6b; c5b or c6b), 122.95 (c7b), 122.16 (c5b or c6b), 118.97 (c4b), 115.04 (c5a or c9a or c5a or c9a), 114.92 (c5a or c9a or c5a or c9a), 113.49 (c5a or c9a or c5a or c9a), 70.49 (c10b), 57.95 (c11b) ppm. c nmr (125.81 mhz, dmso-d6), 4b-l3: 151.51 (c8a+c8a), 150.69 (c6a or c6a), 150.65 (c6a or c6a), 146.13 (c2b), 142.50 (c9b), 135.62 (c3a+c3a), 134.42 (c8b), 133.45 (c4a or c4a), 133.42 (c4a or c4a), 129.38 (c4b), 123.38 (c6b; c5b or c6b), 123.36 (c6b; c5b or c6b), 122.16 (c5b or c6b), 120.81 (c5b), 115.04 (c5a or c9a or c5a or c9a), 114.92 (c5a or c9a or c5a or c9a), 113.49 (c5a or c9a or c5a or c9a), 111.17 (c7b), 69.90 (c10b), 58.35 (c11b) ppm. n nmr (50.70 mhz, dmso-d6): 167.6 (n1a+n1a), 121.4 (n1b+n1b) ppm. a mixture of l1 (54.7 mg, 0.23 mmol) and [rucl2(-p-cymene)]2 (70 mg, 0.11 mmol) in dry ethanol (25 ml) was stirred at room temperature for 1 h. ethanol then was evaporated up to ca. calcd for 11ah2o (mr=559.45 g/mol): c, 49.38; h, 4.50; n, 12.52; cl, 12.67. found: c, 49.68; h, 4.25; n, 12.11; cl, 12.26. esi-ms in methanol (positive): m/z 470 [m hcl cl], 507 [m cl], 528 [m hcl+na]; (negative): m/z 468 [m2hcl h], 505 [m hcl h]. vis (methanol), max, nm (, m cm): 251 (16335), 299 (26663), sh 347 (16012). vis (h2o), max, nm (, m cm): sh 245 (10728), 294 (18597), 360 (9666). h nmr (500.32 mhz, dmso-d6): 14.91 (brs, 1h, h1b), 9.17 (d, 1h, j=7.7 hz, h4a), 8.82 (d, 1h, j=3.8 hz, h6a), 8.11 (d, 1h, j=7.1 hz, h4b), 7.84 (d, 1h, j=8.5 hz, h7b), 7.58 (m, 3h, h5a+h5b+h6b), 6.43 (m, 2h, h2c+h6c), 6.31 (d, 1h, j=5.3 hz, h3c or h5c), 6.12 (d, 1h, j=5.5 hz, h3c or h5c), 2.54 (sep, 1h, h7c, under dmso-d6 peak), 2.21 (s, 3h, h10c), 0.94 (d, 3h, j=6.6 hz, h8c or h9c), 0.91 (d, 3h, j=6.6 hz, h8c or h9c) ppm. c nmr (125.81 mhz, dmso-d6): 153.97 (c8a), 150.45 (c6a), 146.52 (c2b), 141.37 (c9b), 134.70 (c8b), 134.64 (c3a), 131.48 (c4a), 125.39 (c5b or c6b), 124.92 (c5b or c6b), 119.56 (c5a), 117.85 (c4b), 113.96 (c7b), 111.54 (c9a), 103.96 (c4c), 103.74 (c1c), 84.44 (c2c or c6c), 83.73 (c2c or c6c), 82.15 (c3c or c5c), 80.84 (c3c or c5c), 31.12 (c7c), 22.19 (c8c+c9c), 19.17 (c10c) ppm. n nmr (50.70 mhz, dmso-d6): 128.7 (n1b) ppm. a mixture of l1 (42.5 mg, 0.18 mmol) and [oscl2(-p-cymene)]2 (70 mg, 0.09 mmol) in dry ethanol (25 ml) was stirred at room temperature for 2 h. ethanol then was removed under reduced pressure up to ca. calcd for 11bh2o (mr=648.61 g/mol): c, 42.59; h, 3.88; n, 10.79. found: c, 42.56; h, 3.57; n, 10.97. esi-ms in methanol (positive): m/z [m hcl cl], 596 [m cl], 618 [m hcl+na]; (negative): m/z 595 [m hcl h]. vis (methanol), max, nm (, m cm): sh 252 (17048), 299 (20228), 343 (19879). h nmr (500.32 mhz, meoh-d4): 8.99 (dd, 1h, j=1.3 hz, j=8.1 hz, h4a), 8.77 (dd, 1h, j=1.4 hz, j=4.8 hz, h6a), 7.96 (dd, 1h, j=2.0 hz, j=6.4 hz, h4b), 7.80 (dd, 1h, j=1.9 hz, j=6.1 hz, h7b), 7.647.59 (m, 3h, h5a+h5b+h6b), 6.66 (d, 1h, j=5.6 hz, h2c or h6c), 6.59 (d, 1h, j=5.7 hz, h2c or h6c), 6.43 (d, 1h, j=5.6 hz, h3c or h5c), 6.21 (d, 1h, j=5.7 hz, h3c or h5c), 2.43 (sep, 1h, j=6.9 hz, h7c), 2.38 (s, 3h, h10c), 0.96 (d, 3h, j=6.9 hz, h8c or h9c), 0.92 (d, 3h, j=6.9 hz, h8c or h9c) ppm. c nmr (125.81 mhz, meoh-d4): 153.25 (c8a), 148.91 (c2b), 147.42 (c6a), 140.49 (c9b), 135.15 (c3a), 134.25 (c8b), 132.07 (c4a), 125.47 (c5b or c6b), 124.81 (c5b or c6b), 118.48 (c5a), 116.89 (c4b), 112.98 (c7b), 112.92 (c9a), 97.71 (c4c), 94.88 (c1c), 76.44 (c2c or c6c), 74.99 (c2c or c6c), 71.93 (c3c or c5c), 70.44 (c2c or c6c), 31.37 (c7c), 21.35 (c8c or c9c), 21.09 (c8c or c9c), 17.84 (c10c) ppm. crystals of 11b4h2o suitable for xrd study have been obtained from a solution of 11b in ethanol. a mixture of l2 (73.2 mg, 0.23 mmol) and [rucl2(-p-cymene)]2 (70 mg, 0.11 mmol) in dry ethanol (25 ml) was stirred at room temperature for 1 h. ethanol then was removed under reduced pressure up to ca. calcd for 12ah2o (mr=638.35 g/mol): c, 43.28; h, 3.79; n, 10.97. esi-ms in methanol (positive): m/z 548 [m hcl cl], 608 [m hcl+na]; (negative): m/z 549 [m2hcl h], 582 [m hcl h]. vis (methanol), max, nm (, m cm): sh 254 (17778), 303 (29953), 351 (17387). h nmr (500.32 mhz, dmso-d6): 14.34 (brs, 1h, h1b), 9.21 (s, 1h, h4a), 8.73 (s, 1h, h6a), 8.06 (d, 1h, j=7.6 hz, h4b), 7.79 (d, 1h, j=8.5 hz, h7b), 7.52 (m, 2h, h5b+h6b), 6.32 (d, 2h, j=5.8 hz, h2c+h6c), 6.22 (d, 1h, j=6.2 hz, h3c or h5c), 6.03 (d, 1h, j=6.1 hz, h3c or h5c), 2.52 (sep, 1h, h7c, under dmso-d6 peak), 2.18 (s, 3h, h10c), 0.94 (d, 3h, j=6.8 hz, h8c or h9c), 0.89 (d, 3h, j=6.9 hz, h8c or h9c) ppm. c nmr (125.81 mhz, dmso-d6): 154.04 (c8a), 151.24 (c6a), 146.57 (c2b), 141.37 (c9b), 134.63 (c8b), 133.43 (c3a), 131.82 (c4a), 125.33 (c5b or c6b), 124.88 (c5b or c6b), 117.78 (c4b), 114.72 (c5a or c9a), 113.85 (c7b), 112.48 (c5a or c9a), 103.96 (c4c), 103.74 (c1c), 84.44 (c2c or c6c), 83.69 (c2c or c6c), 82.16 (c3c or c5c), 80.76 (c3c or c5c), 31.09 (c7c), 22.20 (c8c or c9c), 22.17 (c8c or c9c), 19.16 (c10c) ppm. n nmr (50.70 mhz, dmso-d6): 127.3 (n1b) ppm. a mixture of l2 (56.4 mg, 0.18 mmol) and [oscl2(-p-cymene)]2 (70 mg, 0.09 mmol) in dry ethanol (25 ml) was stirred at room temperature for 2 h. ethanol then was removed under reduced pressure up to ca. calcd for 12bh2o (mr=727.51 g/mol): c, 37.97; h, 3.33; n, 9.63. found: c, 37.82; h, 3.02; n, 9.33. esi-ms in methanol (positive): m/z 638 [m hcl cl], 696 [m hcl+na]; (negative): m/z 672 [m hcl h]. vis (methanol), max, nm (, m cm): sh 253 (21638), 302 (30505), 357 (21813). h nmr (500.32 mhz, meoh-d4): 9.08 (d, 1h, j=2.1 hz, h4a), 8.84 (d, 1h, j=2.1 hz, h6a), 7.96 (dd, 1h, j=2.1 hz, j=6 hz, h4b), 7.80 (dd, 1h, j=2.1 hz, j=6.1 hz, h7b), 7.63 (m, 2h, h5b+h6b), 6.69 (d, 1h, j=5.7 hz, h2c or h6c), 6.63 (d, 1h, j=5.6 hz, h2c or h6c), 6.48 (d, 1h, j=5.6 hz, h3c or h5c), 6.22 (d, 1h, j=5.7 hz, h3c or h5c), 2.42 (sep, 1h, j=6.9 hz, h7c), 2.39 (s, 3h, h10c), 0.95 (d, 3h, j=6.9 hz, h8c or h9c), 0.91 (d, 3h, j=6.9 hz, h8c or h9c) ppm. c nmr (125.81 mhz, meoh-d4): 153.04 (c8a), 152.49 (c6a), 148.15 (c2b), 140.47 (c9b), 134.58 (c3a), 134.19 (c8b), 131.13 (c4a), 125.79 (c5b or c6b), 125.05 (c5b or c6b), 116.99 (c4b), 115.39 (c5a or c9a), 113.09 (c7b), 112.11 (c5a or c9a), 98.54 (c4c), 95.52 (c1c), 75.73 (c2c or c6c), 75.25 (c2c or c6c), 71.87 (c3c or c5c), 69.99 (c3c or c5c), 31.41 (c7c), 21.34 (c8c or c9c), 21.16 (c8c or c9c), 17.84 (c10c) ppm. crystals of 12b and 12b2ch3oh2h2o suitable for xrd study have been obtained from a solution of 12b in methanol. a mixture of l3 (64 mg, 0.18 mmol) and [rucl2(-p-cymene)]2 (50 mg, 0.08 mmol) in dry ethanol (25 ml) was stirred at room temperature for 1 h. ethanol then was removed under reduced pressure up to ca. calcd for 13a1.5h2o (mr=691.41 g/mol): c, 43.43; h, 4.23; n, 10.13; cl, 10.26. found: c, 43.81; h, 4.24; n, 10.11; cl, 10.57. esi-ms in methanol (positive): m/z 592 [m hcl cl], 650 [m hcl+na]; (negative): m/z 591 [m2hcl h], 628 [m hcl h]. vis (methanol), max, nm (, mcm): sh 252 (18744), 306 (28529), 354 (16889). h nmr (500.32 mhz, dmso-d6): 13.88 (brs, 1h, h1b), 9.41 (s, 1h, h4a), 8.68 (s, 1h, h6a), 7.99 (d, 1h, j=7.7 hz, h4b), 7.49 (m, 2h, h5b+h6b), 6.29 (m, 2h, h2c+h6c), 6.20 (d, 1h, j=5.5 hz, h3c or h5c), 6.00 (d, 1h, j=5.9 hz, h3c or h5c), 4.88 (s, 2h, h10b), 3.39 (s, 3h, h11b), 2.48 (sep, 1h, h7c, under dmso-d6 peak), 2.17 (s, 3h, h10c), 0.93 (d, 3h, j=6.9 hz, h8c or h9c), 0.87 (d, 3h, j=6.8 hz, h8c or h9c) ppm. c nmr (125.81 mhz, dmso-d6): 155.35 (c8a), 150.27 (c6a), 147.43 (c2b), 141.64 (c9b), 133.07 (c8b), 132.68 (c3a), 131.68 (c4a), 124.87 (c5b or c6b), 124.59 (c5b or c6b), 124.53 (c7b), 117.18 (c4b), 114.23 (c5a or c9a), 112.78 (c5a or c9a), 103.74 (c4c), 103.09 (c1c), 85.38 (c2c or c6c), 83.68 (c2c or c6c), 82.13 (c3c or c5c), 81.05 (c3c or c5c), 70.19 (c10b), 58.03 (c11b), 31.04 (c7c), 22.22 (c8c or c9c), 22.09 (c8c or c9c), 19.13 (c10c) ppm. n nmr (50.70 mhz, dmso-d6): 122.9 (n1b) ppm. the red xrd-quality crystals of [rucl(-p-cymene)(l3h)] (13c) were obtained from etoh/et2o and an etoh solution of 13a (long crystallization). the yellow crystals of [rucl(-p-cymene)(l3)]cl[rucl(-p-cymene)(l3h)]ch3oh (13dch3oh) suitable for xrd study have been obtained from methanolic solution of 13a (short crystallization). h nmr (13c, 500.32 mhz, dmso-d6): 13.43 (s, 1h), 9.18 (d, 1h, j=2.1 hz), 8.48 (d, 1h, j=2.2 hz), 7.94 (d, 1h, j=8.2 hz), 7.45 (t, 1h, j=7.8 hz), 7.39 (d, 1h, j=7.2 hz), 6.16 (d, 1h, j=6.0 hz), 6.13 (d, 1h, j=6.1 hz), 6.07 (d, 1h, j=5.9 hz), 5.89 (d, 1h, j=6.4 hz), 4.85 (s, 2h), 4.04 (s, 3h), 2.14 (s, 3h), 0.93 (d, 3h, j=6.8 hz), 0.86 (d, 3h, j=6.9 a mixture of l3 (59 mg, 0.17 mmol) and [oscl2(-p-cymene)]2 (60 mg, 0.08 mmol) in dry ethanol (25 ml) was stirred at room temperature for 3 h. ethanol was evaporated up to ca. calcd for 13b: c, 39.85; h, 3.48; n, 9.29. found: c, 39.60; h, 3.32; n, 9.20. esi-ms in methanol (positive): m/z 682 [m hcl cl], 704 [m2hcl+na]; (negative): m/z 680 [m2hcl h], 716 [m hcl h]. vis (methanol), max, nm (, m cm): sh 256 (19825), 303 (24634), 357 (18850). h nmr (500.32 mhz, meoh-d4): 9.33 (d, 1h, j=2.1 hz, h4a), 8.84 (d, 1h, j=2.2 hz, h6a), 7.91 (dd, 1h, j=1.2 hz, j=7.8 hz, h4b), 7.647.58 (m, 2h, h5b+h6b), 6.69 (d, 1h, j=5.6 hz, h2c or h6c), 6.62 (d, 1h, j=5.7 hz, h2c or h6c), 6.47 (d, 1h, j=5.5 hz, h3c or h5c), 6.21 (d, 1h, j=5.6 hz, h3c or h5c), 4.94 (q, 2h, j=12.4 hz, h10b), 3.49 (s, 3h, h11b), 2.41 (sep, 1h, j=6.9 hz, h7c), 2.39 (s, 3h, h10c), 0.94 (d, 3h, j=6.9 hz, h8c or h9c), 0.89 (d, 3h, j=6.9 hz, h8c or h9c) ppm. c nmr (125.81 mhz, meoh-d4): 153.18 (c8a), 152.16 (c6a), 148.36 (c2b), 140.82 (c9b), 134.35 (c3a), 132.68 (c8b), 131.68 (c4a), 125.63 (c5b or c6b), 124.85 (c5b or c6b), 124.51 (c7b), 116.72 (c4b), 115.24 (c5a or c9a), 112.26 (c5a or c9a), 98.75 (c4c), 95.50 (c1c), 75.98 (c2c or c6c), 75.34 (c2c or c6c), 71.82 (c3c or c5c), 70.29 (c10b), 70.04 (c3c or c5c), 57.17 (c11b), 31.39 (c7c), 21.34 (c8c or c9c), 21.16 (c8c or c9c), 17.85 (c10c) ppm. the yellow crystals of [oscl(-p-cymene)(l3)]cl[oscl(-p-cymene)(l3h)]0.75 ch3oh0.25h2o (13e0.75ch3oh0.25h2o) suitable for xrd study have been obtained from a methanolic solution of 13b. elemental analyses (c, h, n, cl) were performed by the microanalytical service of the institute of physical chemistry, university of vienna. electrospray ionization mass spectrometry (esi-ms) was carried out with an esquire 3000 instrument (bruker daltonics, bremen, germany), using solutions of compounds in methanol. vis spectra were recorded on a lambda 20 uv vis spectrophotometer (perkin elmer), using samples dissolved in methanol (l1l3, 11a, 12a, 13a, 11b, 12b, 13b) and water (11a) over 24 or 48 h, correspondingly. the one-dimensional (h, c, n) and two-dimensional spectra (n, h hsqc, c, h hsqc, c, h hmbc, h, h cosy, h, h tocsy, h, h noesy (l3, 12a), h, h roesy (l3, 11a, 12a, 13a, 13b)) were recorded with a bruker model dpx500 (ultrashield magnet) system in dmso-d6 (l1l3, 11a, 12a, 13a), meoh-d4 (11b, 12b, 13b), d2o (h nmr, 11a), and d2o/dmso-d6 (h nmr, 12a), using standard pulse programs at 500.32 (h), 125.81 (c) and 50.70 (n) mhz. h signals are referenced relative to the solvent signals (dmso-d6 at 2.51, meoh-d4 at 3.33 ppm). single crystals were positioned at distances of 35, 40, 40, 40, 40, 40, and 35 mm from the detector, and 1556, 1131, 518, 1911, 1176, 1978, and 1039 frames were measured, each for 30, 60, 30, 20, 70, 60, and 30 s over 1 scan width for 20.5h2o, 11b4h2o, 12b, 12b2ch3oh2h2o, 13c, 13dch3oh, and 13e0.75ch3oh0.25h2o, correspondingly. crystal data, data collection parameters, and structure refinement details are given in table 1. the structures were solved by direct methods and refined by full-matrix least-squares techniques. refinement of the structure of 12b revealed that the chloride counteranion occupies two statistically disordered positions with site occupation factor (sof) values of 0.57:0.43, whereas, in 13c, the methoxymethylene group was found to be disordered over two positions with sof values of 0.80:0.20. similarly, the methoxymethylene group of one crystallographically independent complex in 13dch3oh or in both crystallographically independent complexes in 13e0.75ch3oh0.25h2o is disordered with sof values of 0.35:0.65 and 0.60:0.40, 0.80:0.20, correspondingly. the disorder was resolved with constrained anisotropic displacement parameters and restrained bond distances using eadp and sadi instructions of shelx97, respectively. structure solution was achieved with shelxs-97 and refinement with shelxl-97, and graphics were produced with ortep-3. wr2={[w(fo fc)]/[w(fo)]}. gof={[w(fo fc)]/(n p) }, where n is the number of reflections and p is the total number of parameters refined. a549 (non-small cell lung carcinoma, human) and sw480 (colon carcinoma, human) cells were kindly provided by brigitte marian (institute of cancer research, department of medicine i, medical university of vienna, austria). ch1 cells (ovarian cancer, human) were a gift from lloyd r. kelland (crc centre for cancer therapeutics, institute of cancer research, sutton, u.k.). cells were grown in 75-cm culture flasks (iwaki) in a complete medium (i.e., minimum essential medium supplemented with 10% heat-inactivated fetal bovine serum, 1 mm sodium pyruvate, 4 mm l-glutamine, and 1% nonessential amino acids from 100 stock) as adherent monolayer cultures. cultures were grown at 37 c under a humidified atmosphere containing 5% co2 and 95% air. antiproliferative activity in vitro was determined by the colorimetric mtt assay (mtt=3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2h-tetrazolium bromide, fluka). for this purpose, cells were harvested from culture flasks by the use of trypsin and seeded in complete medium (100 l/well) into 96-well plates (iwaki) in densities of 4 10 (a549), 1.5 10 (ch1), and 2.5 10 (sw480) viable cells per well. test compounds were dissolved in dmso first, appropriately diluted in complete medium, and instantly added to the plates (100 l/well), where the dmso content did not exceed 0.4% and 1% for the ligands and complexes, respectively. after exposure for 96 h, the medium was replaced with 100 l/well rpmi 1640 medium (supplemented with 10% heat-inactivated fetal bovine serum and 4 mm l-glutamine) plus 20 l/well mtt solution in phosphate-buffered saline (5 mg/ml), followed by incubation for 4 h. subsequently, the medium/mtt mixture was removed, and the formazan product formed by viable cells was dissolved in dmso (150 l/well). optical densities were measured with a microplate reader (tecan spectra classic) at 550 nm (and a reference wavelength of 690 nm) to yield relative quantities of viable cells as percentages of untreated controls, and 50% inhibitory concentrations (ic50) were interpolated from concentration effect curves. calculations are based on at least three independent experiments with triplicates for each concentration level. to study the effects on the cell cycle of exponentially growing ch1 cells by flow cytometric analysis of their relative dna content, cells were harvested from culture flasks, seeded in complete medium into 90-mm petri dishes (1 10 cells/dish) and, after recovery for 24 h, exposed to various concentrations of the test compounds for 24 h. for this purpose, test compounds were diluted from dmso stocks with complete medium (see above) such that the effective dmso content did not exceed 0.5%. after exposure, treated and control cells were collected by scratching, washed with pbs, and stained with 5 g/ml propidium iodide overnight. their fluorescence was measured with a facs calibur instrument (becton dickinson), and the obtained histograms were analyzed with cell quest pro software (becton dickinson). at least two independent experiments were performed for each setting, and 2.5 or 3.0 10 cells were measured per sample. the cdk-inhibitory capacities of test compounds were studied by a radiochemical assay using recombinant cdk1/cyclin b and cdk2/cyclin e isolated from sf21 insect cells and histone h1 as the substrate for phosphorylation, as described by marko et al. briefly, mops-buffered assay mixtures containing the test compound (with a maximum of 1% dmso), the respective kinase/cyclin complex, histone h1, and 0.4 ci (-p)atp per sample were incubated for 10 min at 30 c. aliquots of the solution were spotted onto phosphocellulose squares, which had been washed three times with 0.75% phosphoric acid, followed by acetone. the dried squares were measured in scintillation vials by -counting (perkin elmer tri-carb 2800tr; quanta smart software). results were obtained in duplicate in at least two independent experiments, and ic50 values were calculated by interpolation. several routes to 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines have been proposed by johnson&johnson pharmaceutical research&development l.l.c. the first one was developed for 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines with an unsubstituted benzimidazole moiety and involved sulfur-induced benzimidazole ring formation via the treatment of 5-bromo-1h-pyrazolo[3,4-b]pyridine-3-carboxaldehyde with 1,2-diaminobenzene. the poor reproducibility of this synthesis prompted the exploration of an alternative way, via 5-bromo-1h-pyrazolo[3,4-b]pyridine-3-carboxylic acid, which was used for the preparation of 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines with a substituted benzimidazole moiety. the patented route to 5-bromo-1h-pyrazolo[3,4-b]pyridine-3-carboxylic acid (3) consists of four steps (see scheme 1, steps i iv): oxidation of 3-methyl-1h-pyrazolo[3,4-b]pyridine by kmno4 in the presence of a base with subsequent acidification with h2so4, esterification of 1h-pyrazolo[3,4-b]pyridine-3-carboxylic acid (1) in the presence of h2so4 in methanol, bromination of 1h-pyrazolo[3,4-b]pyridine-3-carboxylic acid methyl ester in an acoh/acona mixture, and hydrolysis of 5-bromo-1h-pyrazolo[3,4-b]pyridine-3-carboxylic acid methyl ester in the presence of naoh, followed by acidification with hcl. reagents and conditions: (i) kmno4, naoh, 3 h, 100 c, h2so4; (ii) methanol, h2so4, reflux, 68 h, nahco3, 42% (i+ii); (iii) br2, acoh, acona, 115 c, overnight, chromatographic purification, 43%; (iv) naoh, meoh, reflux, 4 h, hcl, 100%; (v) br2, acoh, acona, 115 c, 2.53 h; and (vi) kmno4, naoh, 3 h, 100 c, hcl, 2435% (v+vi). we performed the synthesis of 3 in two steps (see scheme 1, steps v and vi): bromination of 3-methyl-1h-pyrazolo[3,4-b]pyridine in acoh/acona mixture and oxidation of crude 5-bromo-3-methyl-1h-pyrazolo[3,4-b]pyridine (2) by kmno4 in a basic medium, followed by acidification with 37% hcl, with an overall yield of 2435%. 5-bromo-3-methyl-1h-pyrazolo[3,4-b]pyridine (2) is a known compound, the synthesis of which is well-documented. for the benzimidazole ring formation, 1,2-diaminobenzene and 1-methoxymethyl-2,3-diaminobenzene the reported synthesis of 1-methoxymethyl-2,3-diaminobenzene (5) from 2,3-diaminobenzyl alcohol afforded the desired product in 34% yield (see scheme 2, step i). however, the instability and low yield of diamines, as well as the necessity to purify the desired ether using column chromatography, stimulated the search for a more-convenient procedure that was subsequently proposed: etherification of 2-amino-3-nitrobenzyl alcohol, followed by the reduction of 1-methoxymethyl-2-amino-3-nitrobenzene (4) with 10% pd/c in ethanol under a hydrogen atmosphere afforded 5 in 6575% yield (see scheme 2, steps ii and iii). reagents and conditions: (i) nah, mei, dry thf, 0 c, 30 min, room temperature, overnight, chromatographic purification, 34% yield; (ii) nah, mei, dry thf, 0 c, 15 min, room temperature, 3 h, chromatographic purification, 6575% yield; (iii) 10% pd/c, ethanol, h2, room temperature, 1824 h, 100% yield. patented benzimidazole ring formation by cyclization of the 3-carboxyl group of 5-bromo-1h-pyrazolo[3,4-b]pyridine-3-carboxylic acid (3) with substituted 1,2-diaminobenzenes was realized via amide formation using coupling reagents, followed by treatment with glacial acetic acid. hatu (n, n, n,n-tetramethyl-o-(7-azabenzotriazol-1-yl)uronium hexafluorophosphate) was used as a coupling reagent. three 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines (l1l3) (where x=h, br; and y=h, ch2och3) have been synthesized in this work (see chart 1): 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridine (l1) is a new compound that we have prepared as a model ligand for coordination to metals; 3-(1h-benzimidazol-2-yl)-5-bromo-1h-pyrazolo[3,4-b]pyridine (l2) was previously known as boc-protected compound prepared via 5-bromo-1h-pyrazolo[3,4-b]pyridine-3-carboxaldehyde;5-bromo-3-(4-methoxymethyl-1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridine (l3) was synthesized via 5-bromo-1h-pyrazolo[3,4-b]pyridine-3-carboxylic acid (3) and patented as a potential cdk inhibitor and antiproliferative agent. for the synthesis of l1l3, we used n, n-carbonyldiimidazole (cdi) as an amide-coupling reagent, because it is relatively inexpensive and the side products, carbon dioxide and imidazole, could be easily removed from the reaction mixture. cdi-mediated amidation of acids 1 and 3 was performed as shown in scheme 3 (steps i and ii). in the first step, the acyl-imidazolides 6 and 7 were obtained in dry dmf at room temperature and isolated as white solids. the yields based on 3-methyl-1h-pyrazolo[3,4-b]pyridine are: 2529% (6) and 1316% (7). in the second step, monoacylation of phenylenediamines (1,2-diaminobenzene and 1-methoxymethyl-2,3-diaminobenzene (5)) using acyl-imidazolides was performed in dmf at 8085 c. reagents and conditions: (i) cdi, dry dmf, room temperature, 2024 h; (ii) 1,2-diaminobenzene or 5, dry dmf, 8085 c; 520 h; and (iii) glacial acoh, 120125 c, 2.54.5 h, chromatographic purification. amides 810 were used without further purification in ring closure reactions in a glacial acetic acid at 120125 c and afforded the desired 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines: l1 (5560%), l2 (5861%), and l3 (4451%), based on 6 and 7 (see scheme 3, step iii). the reported synthesis of l3 is a one-pot approach for amide formation using hatu with 57% yield, followed by cyclization under acidic conditions (acetic acid) with 87% yield. thus, the ligands l1, l2, and l3 have been prepared in 7, 8, and 11 steps, correspondingly. finally, the ligands l1l3 were reacted with [mcl2(-p-cymene)]2 (where m=ru, os) in a 2:1 molar ratio in dry ethanol at room temperature to give [mcl(-arene)(l)]cl complexes (11a, 11b, 12a, 12b, 13a, 13b) in quantitative yields. crystallization of [rucl(-p-cymene)(l3)]cl (13a) in etoh or etoh/et2o resulted in xrd-quality crystals of [rucl(-p-cymene)(l3h)] (13c), while the crystallization of 13a in methanol afforded crystals of composition [rucl(-p-cymene)(l3)]cl[rucl(-p-cymene)(l3h)]ch3oh (13dch3oh). the osmium(ii) analogue 13e0.75ch3oh0.25h2o was obtained via the crystallization of 13b in methanol. the full assignment of proton, carbon, and nitrogen resonances for l1l3, 11a, 11b, 12a, 12b, 13a, and 13b is quoted in tables s1s3 in the supporting information. 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines with an unsubstituted benzimidazole moiety (l1, l2) display one set of signals. l1 is characterized by three doublets of doublets for h4a, h5a, h6a (8.85, 7.39, 8.66 ppm, correspondingly) of pyrazolopyridine moiety, two doublets for h4b, h7b (7.54 and 7.75 ppm), the overlapped h5b, h6b proton signals in one multiplet (7.24 ppm) for a benzimidazole moiety and two singlet resonances for h1a and h1b (for atom numbering, see chart 1). the substitution of h5a by bromine (l2) results in reduced multiplicity for the h4a and h6a signals (two doublets at 8.99 and 8.75 ppm), whereas the benzimidazole moiety spectrum remains almost unchanged. two singlets were attributed to nh protons and related to pyrazolopyridine (h1a, at 14.19 (l1), 14.43 (l2) ppm) and benzimidazole (h1b, at 13.11 (l1), 13.19 (l2) ppm) moieties. nmr spectra for 11a, 11b, 12a, and 12b, where l1 and l2 coordinate as bidentate ligands via n2a and n3b with the formation of a stable five-membered chelate cycle, show one set of signals. there was no evidence for monodentate or tridentate coordination of ligands with the formation of dinuclear or polynuclear complexes. coordination of l1 and l2 to ruthenium(ii) made it possible to assign the two doublets to proton resonances of h4b and h7b of the benzimidazole moiety. in the h, h roesy plots, one of them has cross-peaks with a ch cymene ring and the nearest to them is h4b (e.g., at 8.11 (11a), 8.06 (12a) ppm). a singlet at 14.91 (11a), 14.34 (12a) ppm was assigned to nh proton and showed no couplings with other atoms. the nitrogen resonance shift at 128.7 (11a), 127.3 (12a) ppm is closer to the benzimidazole nh chemical shift in metal-free ligands (121.3 (l1, l2) ppm) and, therefore, was assigned as n1b (see table s3 in the supporting information). the h1b resonance shows a significant shift by 1.8 and 1.15 ppm for 11a and 12a, respectively, upon ligand coordination (l1 and l2) to the metal(ii)-arene moiety. the nearest to the metal binding site pyrazolopyridine proton h1a was not detected for 11a, 11b, 12a, and 12b, and the proton resonance of h1b was also not seen for 11b or 12b. l3 displays two sets of signals originated from 7b-l3 and 4b-l3 tautomers (see chart 1). the signals of pyrazolopyridine moieties are partially overlapped (e.g., h1a (h1a) at 14.47 and 14.43 ppm, h4a (h4a) at 8.99 and 8.98 ppm, h6a (h6a) at 8.75 ppm), whereas the signals of the benzimidazole moieties are better resolved (see table s1 in the supporting information). according to the h, h roesy plot, one of the ch2 groups at 4.80 ppm couples with the nh proton at 13.25 ppm, indicating their attribution to the 7b-l3 tautomer, whereas another nh proton at 13.22 ppm gives a cross-peak with h7b at 7.47 ppm and belongs to 4b-l3 tautomer (figure 1). tautomers 7b-l3 and 4b-l3 are present in solution in 1:1.3 molar ratio and give, for the substituted benzimidazole moiety, two singlets (h1b at 13.22 ppm, h1b at 13.25 ppm), two doublets of doublets (h7b at 7.47 ppm, h4b at 7.72 ppm), one multiplet (h5b, h6b, h5b, h6b at 7.287.21 ppm), two ch2 (4.80 (h10b), 4.96 (h10b) ppm) and two ch3 singlets at 3.37 (h11b) and 3.44 (h11b) ppm. the absence of cross-peaks between h7b and h4b in the h, h cosy plot supports their relation to the two different molecules. the binding site in 4b-l3 tautomer is sterically shielded by a methoxymethyl group. consistent with this nmr spectra display, only one set of signals is shown for 13a and 13b with the coordination of the 7b-l3 tautomer to ruthenium(ii) and osmium(ii) via n2a and n3b (see scheme 4). the preference for coordination of the 7b-l3 tautomer is also confirmed by h, h roesy plots: h4b (7.99 (13a), 7.91 (13b) ppm) has couplings with ch protons of cymene ring. the cross-peak between h10b at 4.88 ppm (13a) and nh at 13.88 ppm (13a) enabled the assignment of this singlet to a benzimidazole moiety (h1b). in addition, the chemical shifts for the c atoms of the benzimidazole moiety (c4b, c7b, c5b, c6b) of the coordinated ligand and metal-free 7b-l3 tautomer are very similar (see table s2 in the supporting information). the nitrogen resonance at 122.9 ppm (13a) compares well to the benzimidazole nh chemical shift in metal-free l3 at 121.4 ppm. as for 11a, 11b, 12a, and 12b, the nearest to the coordination place pyrazolopyridine proton h1a resonance was not detected. according to the h, h roesy plots of 11a, 12a, 13a, and 13b only ch cymene ring protons have couplings with the nearest h4b benzene ring proton, suggesting that the isopropyl or methyl groups are further away from the h4b proton. the results of the xrd studies of [oscl(-p-cymene)(l1)]cl4h2o (11b4h2o), [oscl(-p-cymene)(l2)]cl (12b), [oscl(-p-cymene)(l2)]cl2ch3oh2h2o (12b2ch3oh2h2o), [rucl(-p-cymene)(l3h)] (13c), [rucl(-p-cymene)(l3)]cl[rucl(-p-cymene)(l3h)]ch3oh (13dch3oh) and [oscl(-p-cymene)(l3)]cl[oscl(-p-cymene)(l3h)]0.75ch3oh0.25h2o (13e0.75ch3oh0.25h2o) are shown in figures 2, figure s2 in the supporting information, and figures 36, respectively. all complexes have a typical three-legged piano-stool geometry of ruthenium(ii) and osmium(ii) arene complexes, with an -bound p-cymene ring forming the seat and three other donor atoms (two nitrogens n1 and n5 of the corresponding 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridine and one chlorido ligand) as the legs of the stool. selected bond distances and angles are quoted in the figure captions. all complexes crystallize as racemates, because of the presence of the stereogenic metal center. fragment of the crystal structure of 11b4h2o showing nitrogen atoms n3 and n4, which act as proton donors in intermolecular hydrogen bonding interactions n3hcl2 [n3cl2 3.067(7), n3hcl2 177.3] and n4ho3 [n4o3 2.671(9), n4ho3 170.9]; thermal ellipsoids have been drawn at 50% probability level. selected bond lengths and angles: os cl1, 2.421(2); os c(arene)av, 2.198(32); c1n2, 1.349(11); n2n1, 1.366(10); n1c6, 1.357(11); c6c7, 1.428(12); c7n5, 1.345(11); n5c13, 1.391(11); n1os n5, 75.6(3); n1os cl1, 85.5(2); n5os cl1, 83.4(2). the bidentate 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines, which can have different substituents in positions 5a and 7b, reveal different acid base properties. it can act as a neutral organic ligand, with nitrogen atoms n2 and n4 as proton donors involved in intermolecular hydrogen bonding interactions n4ho1(x+1, y+1, z+2) [n4o1, 2.730(4); n4ho1, 176.1] and n2ho3(x+2, y+1, z+1 [n2o3, 2.697(4); n4ho1, 172.3] with one methanol and one water molecule, respectively, as is the case for 12b2ch3oh2h2o (figure 3) or n2hcl2(cl2x) and n4hcl1(x, y, z+2) [n4cl1, 3.213(9); n4ho1, 162.91] in 12b (see figure s2 in the supporting information), correspondingly. the ligand can be protonated at n3 (n3hcl2) and deprotonated at n2 [n2h o4 (x+1, y+1, z+1) with n2o4 2.923(9), n2h o4 138.7] (overall charge zero) with atom n4 as a proton donor to one of the four co-crystallized water molecules n4ho3, as occurs in 11b4h2o (see figure 2). ortep plot of the structure of the cation [oscl(-p-cymene)(l2)] in 12b2ch3oh2h2o. thermal ellipsoids have been drawn at the 50% probability level. selected bond lengths and angles: os cl1, 2.4043(1); os c(arene)av, 2.197(26); c1n2, 1.361(5); n2n1, 1.344(4); n1c6, 1.336(5); c6c7, 1.447(6); c7n5, 1.335(5); n5c13, 1.380(5); n1os n5, 74.73(13), n1os cl1, 84.29(10); and n5os cl1, 83.25(10). in 13c, the ligand was found to be deprotonated at n2, acting as a proton acceptor in the intermolecular hydrogen bonding interaction n2h n4 (i denotes symmetry transformations x, y+1.5, z+0.5) used to generate equivalent atoms) [n2n4, 2.896(7); n2h n4, 155.6] (see figure 4). ortep plot of the complex [rucl(-p-cymene)(l3h)] (13c). thermal ellipsoids have been drawn at 30% probability level. selected bond lengths and angles: ru cl, 2.399(2); ru n1, c(arene)av, 2.186(31); c1n2, 1.366(8); n2n1, 1.353(7); n1c6, 1.362(7); c6c7, 1.426(9); c7n5, 1.335(8); n5c13, 1.398(8); n1ru n5, 75.9(2); n1ru cl, 87.35(17); and n5ru cl, 85.73(17). complexes 13dch3oh and 13e0.75ch3oh0.25h2o crystallized both in the centrosymmetric triclinic space group p1. the asymmetric unit in both consists of a neutral complex [mcl(-p-cymene)(l3h)] and a complex cation [mcl(-p-cymene)(l3)] (m=ru or os), a chloride counteranion and co-crystallized solvent (methanol or methanol/water). deprotonation of the organic ligand in [mcl(-p-cymene)(l3h)] is corroborated by the presence of hydrogen bonding of the type n2ah n2b (x+1, y+1, z+1) in the crystal structure of the ruthenium complex 13dch3oh (figure 5) and a similar interaction n2bh n2a (x, y+1, z) [n2bn2a, 2.810(9); n2bh n2a, 170.1] in the crystal of the osmium analogue 13e0.75ch3oh0.25h2o. in figure 6 the structure of [oscl(-p-cymene)(l3h)] is shown. in both structures, the atoms n4a and n4b act as proton donors in strong hydrogen bonding interactions to the chloride counteranion, namely, n4ah cl2 (x+1, y+2, z+1) [n4cl2, 3.275(6); n4ah cl2, 176.9], n4bh cl2 [n4bcl2, 3.211(5); n4bh cl2, 176.0] (13dch3oh) and n4ah cl2 (x+1, y+1, z+1) [n4acl2, 3.273(8); n4ah cl2, 177.0], n4bh cl2 [n4bcl2, 3.204(7); n4bh cl2, 177.0] (13e0.75ch3oh0.25h2o). fragment of the crystal structure of [rucl(-p-cymene)(l3)]cl[rucl(-p-cymene)(l3h)]ch3oh (13dch3oh) showing the intermolecular hydrogen bonding n2a hn2b [n2an2b (x+1, y+1, z+1), 2.814(7); n2a hn2b, 163.3]. selected bond lengths and angles: ru1a cl1a, 2.3952(17); ru1a c(arene)av, 2.194(33); c1a n2a, 1.358(8); n2a n1a, 1.354(7); n1a c6a, 1.350(8); c6a c7a, 1.441(9); c7a n5a, 1.335(8); n5a c13a, 1.381(8); n1a ru1a n5a, 75.6(2); n1a ru1a cl1a, 84.45(15); and n5a ru1a cl1a, 85.05(15). ortep plot of [oscl(-p-cymene)(l3h)] in [oscl(-p-cymene)(l3)]cl[oscl(-p-cymene)(l3h)]0.75ch3oh0.25h2o (13e0.75ch3oh0.25h2o). selected bond lengths and angles: os1a cl1a, 2.402(2); os1a n1a, 2.068(7); os1a n5a, 2.086(7); os1a c(arene)av, 2.192(25); c1a n2a, 1.349(10); n2a n1a 1.369(9); n1a c6a, 1.361(10); c6a c7a, 1.431(11); c7a n5a, 1.339(10); n5a c13a, 1.398(11); n1a os1a n5a, 75.1(3); n1a os1a cl1a, 83.56(18); and n5a os1a cl1a, 84.2(2). ligands l1l3, as well as the corresponding ruthenium(ii) (11a13a) and osmium(ii) (11b13b) arene complexes, were studied with regard to their capacity of inhibiting cell growth in vitro in the human cancer cell lines ch1 (ovarian carcinoma), sw480 (colon carcinoma), and a549 (non-small cell lung cancer), yielding the ic50 values listed in table 2. all compounds show the strongest effect in the generally chemosensitive ch1 cells, whereas the more chemoresistant a549 cells are also less affected by the compounds investigated here.>l2>l1, indicating that bromination (l2, l3) and, even more so, the double substitution (bromination and an additional replacement of h by a methoxymethyl group (l3)) are advantageous, with regard to activity. these structure activity relationships are also reflected in the rank orders of the corresponding ruthenium and osmium complexes for the ruthenium complexes, 13a>12a>11a, and for the osmium complexes, 13b>12b>11b. however, the ic50 values are shifted to higher concentrations (see figure 7). the differences between the ruthenium and osmium analogues are mostly small (ic50 values differ only up to a factor of 2.4), with the osmium complexes being at least as active as their ruthenium counterparts. ch1 denotes ovarian cancer, human; sw480 denotes colon carcinoma, human; and a549 denotes non-small-cell lung carcinoma, human. 50% inhibitory concentrations (mean value standard deviation from at least three independent experiments) obtained by the mtt assay (96-h exposure). concentration effect curves of each ligand, compared to the corresponding ruthenium and osmium complexes, in ch1 ovarian cancer cells (mtt assay, 96 h exposure): (a) l1, 11a, 11b; (b) l2, 12a, 12b; and (c) l3, 13a, 13b. both the presence of substituents in the ligands and complexation result in a marked shift of antiproliferative activity. since 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines have been reported to be potent cdk inhibitors, we expected the investigated ligands and complexes to induce cell cycle perturbations. to confirm this assumption in a sensitive cell line, exponentially growing ch1 cells were treated with the compounds for 24 h, stained with propidium iodide, and analyzed for their dna content by fluorescence-activated cell sorting (facs). surprisingly, the metal-free ligands l1l3 turned out to exert only modest effects on cell cycle distribution, with a slight increase of the g2/m fraction from 32% in the untreated control to 53% by 20 m l2 as the strongest effect observed in this setting (higher concentrations of this compound led to disintegration of cells already after 24 h). however, the less cytotoxic ruthenium complexes 12a and 13a, both bearing substituted ligands (l2 and l3 correspondingly), cause a more pronounced g2/m phase arrest, as reflected by an increase of this cell fraction to 65% at 80 m and 59% at 40 m, respectively, and a concomitant decrease of the g0/g1 fraction to 21% and 24% (compared to 42% in controls), whereas ruthenium complex 11a bearing an unsubstituted ligand l1 is devoid of activity on the cell cycle. on the other hand, the osmium complexes do not generally show stronger effects on the cell cycle than the metal-free ligands, perhaps with the exception of 13b, which induces an increase of the g2/m fraction up to 53% at 80 m, accompanied by a decline of the g0/g1 fraction to 31% (see figure 8). concentration-dependent effects of metal-free ligands (top), and the corresponding ruthenium (middle) and osmium complexes (bottom), on the cell cycle distribution of ch1 cells (() g0/g1, () s, and () g2/m phase). although the lack of generally pronounced cell cycle effects does not argue for a strong role of cdk inhibition in the mechanism of action of the investigated compounds, inhibitory potencies were studied in cell-free experiments with two recombinant cdk/cyclin complexes, by means of the histone h1 kinase assay. results reveal that all compounds are capable of inhibiting kinase activities in a concentration-dependent manner, being more effective on cdk2/cyclin e than on cdk1/cyclin b (see figure 9). in contrast to the observed cell cycle effects, but in accordance with antiproliferative activities, cdk-inhibitory potency of the metal-free ligands is consistently higher than that of the metal complexes. in particular, only l1l3 effectively inhibit cdk2/cyclin e in low concentrations (1 m or 10 m), whereas all complexes require higher concentrations to exert>50% inhibitory effects. as in the mtt assay, differences between the effects of corresponding ruthenium and osmium complexes are minor, compared to the differences from those of the metal-free ligands. concentration-dependent effects of metal-free ligands (l1l3) as well as corresponding ruthenium (11a13a) and osmium complexes (11b13b), on kinase activities of recombinant cdk1/cyclin b (top) and cdk2/cyclin e (bottom). the known multistep synthesis of 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines, which we have modified, essentially afforded three organic compounds (l1l3) that possess cdk-inhibiting properties. these were used as bidentate ligands, and six novel organometallic complexes of the general formula [mcl(-p-cymene)(l)]cl, where m=ru (11a, 12a, 13a) or os (11b, 12b, 13b) and l=l1l3, have been synthesized and comprehensively characterized using spectroscopic and x-ray diffraction methods. complexation of l1l3 with ruthenium or osmium yielded compounds with increased solubility in the biological medium, yet lowered antiproliferative activity in human cancer cell lines. modulation of biological activities by substitution at the ligands can be accomplished in the metal-free molecules and their metal complexes in a similar way. the known cdk-inhibitory activity of the ligands could be confirmed in cell-free experiments, in particular in cdk2/cyclin e, and their stronger effects on cdk activity parallel their higher capacity of inhibiting cancer cell growth in vitro, compared to their metal complexes. nevertheless, the lack of pronounced effects on the cell cycle of chemosensitive ovarian cancer cells argues against a major role for inhibition of cell growth, at least in this setting.

six organometallic complexes of the general formula [miicl(6-p-cymene)(l)]cl, where m=ru (11a, 12a, 13a) or os (11b, 12b, 13b) and l=3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines (l1l3) have been synthesized. the latter are known as potential cyclin-dependent kinase (cdk) inhibitors. all compounds have been comprehensively characterized by elemental analysis, one- and two-dimensional nmr spectroscopy, uv vis spectroscopy, esi mass spectrometry, and x-ray crystallography (11b and 12b). the multistep synthesis of 3-(1h-benzimidazol-2-yl)-1h-pyrazolo[3,4-b]pyridines (l1l3), which was reported by other researchers, has been modified by us essentially (e.g., the synthesis of 5-bromo-1h-pyrazolo[3,4-b]pyridine-3-carboxylic acid (3) via 5-bromo-3-methyl-1h-pyrazolo[3,4-b]pyridine (2); the synthesis of 1-methoxymethyl-2,3-diaminobenzene (5) by avoiding the use of unstable 2,3-diaminobenzyl alcohol; and the activation of 1h-pyrazolo[3,4-b]pyridine-3-carboxylic acids (1, 3) through the use of an inexpensive coupling reagent, n, n-carbonyldiimidazole (cdi)). stabilization of the 7b tautomer of methoxymethyl-substituted l3 by coordination to a metal(ii) center, as well as the nmr spectroscopic characterization of two tautomers 7b-l3 and 4b-l3 in a metal-free state are described. structure activity relationships with regard to cytotoxicity and cell cycle effects in human cancer cells, as well as cdk inhibitory activity, are also reported.

PMC3255473

pubmed-111

paraoxonases were originally discovered as enzymes hydrolyzing exogenous toxic organophosphate compounds such as insecticide paraoxon. there are three members of paraoxonases family currently known: paraoxonase 1 (pon1), paraoxonase 2 (pon2), and paraoxonase 3 (pon3), which are encoded by three separate genes on the same chromosome 7 (human) or chromosome 6 (mouse). all three human members of the family are 70% identical at nucleotide level and 60% identical at the amino acid level. studies on enzymatic activity of paraoxonases revealed esterase and lactonase/lactonizing activities in addition to organophosphatase activity. despite of the large number of compounds that can be hydrolyzed by paraoxonase, in many cases arylesterase activity is measured to access pon1 level in biological samples. based on kinetic parameters of paraoxonases toward different substrates hydrolysis of homocysteine thiolactone by pon1 is considered to be protective against coronary artery disease (cad). after the introduction of the oxidative stress hypothesis of atherosclerosis and the discovery of antioxidant effect of high-density lipoprotein (hdl), pon1 attracted significant interest as a protein that is responsible for the most of antioxidant properties of hdl. purified pon1 protects hdl and low-density lipoprotein (ldl) from oxidation catalyzed by copper ions. pon1 inhibits copper-induced hdl oxidation by prolonging oxidation lag phase, and reduces peroxide and aldehyde content in oxidized hdl. remarkably, pon1 inhibitors pd-11612, pd-65950, pd-92770, and pd-113487 lessen this antioxidative effect of pon1. pon1 is especially effective in decomposition of linoleate hydroperoxides. also, mass-spectrometry analysis of biologically active fraction of oxidized2-arachidonoyl-sn-glycero-3-phosphorylcholine (ox-papc) underwent pon1 treatment showed degradation of these oxidized phospholipids by pon1. the exact antioxidant mechanism of pon1 is not known yet, although it is known that protection is not caused by chelating of copper ions or because of potential lipid transfer from ldl to hdl. existence of an enzymatic mechanism is supported by the observation that heat inactivation of purified pon1 abolishes its antioxidant effect. some in vitro data suggest that antioxidant activity might be related to other components of purified pon1 preparations. however, experiments with pon1 deficient mouse provide strong evidences that pon1 is required to enable hdl antioxidant properties. hdl from pon1 knockout animals were more prone to oxidation and were less efficient in the protection of ldl from oxidation in co-cultured cell model of the artery wall compared with hdl from control mice. also, transfection of pon1-deficient peritoneal macrophages (isolated from pon1 knockout mice) with human pon1 decreased level of peroxides, lowered release of superoxide, and increased intracellular level of reduced glutathione, key observations are summarized in table 1. summary of key facts on pon1 expression, activity, and effects in in vitro and in vivo studies the first pon1 messenger ribonucleic acid (mrna)ionanalysis in different rabbit tissues was performed by northern blot, and revealed pon1 mrna expression predominately in liver. polymerase chain reaction (pcr) amplification using a panel of first-strand complementary deoxyribonucleic acid (cdnas) from 24 tissues detected pon1 expression in kidney and colon beside liver and fetal liver expression. biopsies showed pon1 mrna and protein expression in human but not in mouse gastrointestinal tract. deletion analysis in cultured cells revealed that cell type specific expression in liver and kidney is determined within first 200 bp of promoter area. there are several transcription factors and pathways that regulate pon1 expression [figure 1]. all processes occur in liver, and bile acid -stimulated synthesis of fibroblast growth factor 19 (fgf-19; or fgf-15 in mouse) might be additionally occur in ileum. signals from pma (phorbol 12-myristate 13-acetate) and high glucose activate transcription factor sp1 through protein kinases c (pkc) and p44/ p42 mitogen-activated protein kinases (mapk) a ubiquitous mammalian transcription factor specificity protein 1(sp1) plays an essential role in regulation of pon1 expression. high glucose level activates protein kinase c (pkc), which activates sp1, and stimulate pon1 transcription in human hepatoma cell lines hepg2 and huh7. a potent pkc activator phorbol 12-myristate 13-acetate (pma) also stimulates pon1 transcription in hepg2 through activation of sp1. two members of pkc family are involved, pkc (zeta) and pkc- (alpha) activation. statins (pitavastatin, simvastatin, or atorvastatin) stimulate pon1 transcription through sp1 activation as well, however, they activate another kinase, p44/p42 mitogen-activated protein (map) kinase, as was observed for pitavastatin in huh7 cells. also, pivostatin-stimulated p44/p42 mitogen-activated protein kinase (mapk) activates sterol regulatory element binding protein 2 (srebp-2), which contributes to transcriptional activation of pon1. dietary polyphenols, such as resveratrol, aspirin and its hydrolysis product salicylate, and artificial ligands of aryl hydrocarbon receptor (ahr), such as 3-methylcholanthrene, activate ahr and stimulate pon1 transcription activation in mouse liver and hepg2 cell line.[2426] c-jun is another transcription factors that is involved in pon1 expression. the activity of c-jun is regulated by c-jun n-terminal kinase (jnk). phosphorylated c-jun in a complex with c-fos or some other transcription factors forms an active ap-1 complex that usually promotes transcription of target genes. thus, berberine (benzyl tetrahydroxyquinoline), a cholesterol lowering alkaloid, activates jnk, c-jun and stimulates pon1 transcription in human hepatoma cell lines. however, stimulation of jnk/c-jun pathway by bile acids leads to opposite effect. bile acids such as taurocholate, cholic acid, or chenodeoxycholic acid inhibit pon1 expression in liver of c57bl/6j mice, and in hepg2 and huh7. the inhibition of pon1 expression starts with activation of farnesoid x receptor (fxr) by bile acids that promote expression of fibroblast growth factor 19 in human (fgf-19) or fgf-15 in mouse. the growth factor activates fibroblast growth factor receptor 4 (fgfr4) followed by activation of jnk, and phosphorylation of c-jun. opposite to activation of c-jun by berberine, fxr/fgf-19/fgfr4/jnk/c-jun pathway results in suppression of pon1 transcription. it is likely that pon1 stays associated with endoplasmic reticulum through its hydrophobic n-terminus until it is released from the hepatocytes. the mechanism of pon1 secretion is not well investigated. a study on cultured hepatocytes and transfected chinese hamster ovary (cho) cells, which do not naturally express pon1 and apoa proteins, when pon1 protein is synthesized, it accumulates on plasma membrane and slowly dissociate into extracellular medium. dissociation is promoted by hdl, very-low-density lipoprotein (vldl), and in much lesser extent by protein-free phospholipids particles or apoa-i protein. pon1 binds to hdl through interaction of hydrophobic n-terminus to phospholipids, and through pon1-apoa interaction. two major principal hdl proteins, that is, apoa-i and/or apoa-ii which differ in their properties are linked to atherosclerosis modulation. thus, transgenic mice with hdl consisting of both human apoa-i and apoa-ii developed 15-fold greater lesions compared with mice with hdl containing solely human apoa-i. in vitro study of reconstituted hdl demonstrated that apoa-i containing hdl stabilizes pon1 binding as compared with protein-free hdl particles, and apoa-ii in opposite destabilizes the hdl the paraoxonase and arylesterase activities of pon1 do not depend on the apolipoprotein content of hdl. however, apoa-i containing hdl significantly increases lactonase activity of pon1, promotes inhibition of ldl oxidation, and stimulates macrophage cholesterol efflux compared with apoa-ii containing hdl. a study of human hdl isolated from apoa-i deficient patients revealed that pon1 is still associated with hdl in the absence of apoa-1, however, the pon1hdl complex is less stable, and pon1 loses activity faster than in normal controls. a higher content of human apoa-ii protein in mouse hdl suppresses pon1 binding to hdl compared with hdl with lower human apoa-ii content. hdl high in human apoa-ii binds less pon1 protein, possesses less pon1 activity, and is impaired in protection of ldl from oxidation. transgenic mouse with higher human apoa-ii content in hdl are more susceptible to atherosclerosis compared with transgenic animals with lower apoa-ii level in hdl and control animal. hdl-associated pon1 can be successfully transferred to cultured cells in vitro and deliver protection from oxidative stress and bacterial substrate of pon1 n-3-oxo-dodecanoyl-l-homoserine lactone. beside hdl while liver is the major tissue of pon1 gene expression, lipoprotein-assisted circulation of pon1 in plasma delivers the enzyme to multiple tissues that do not express pon1 themselves. immunohistochemical staining of rat tissues revealed pon1 presence in liver, kidney, in endothelial lining of lung and brain. more recent study with mouse tissue detected pon1 protein in hepatocytes, adipocytes, chondrocytes, skeletal and cardiac muscle, kidney, spermatozoa, and epithelial cells of skin, stomach, intestine, trachea, bronchiole, and eye lens. studies did not find co-localization of pon1 with apoa-i protein that might mean local pon1 expression or different sources of apoa-i, an integral component of hdl. immunostaining of healthy human aorta shows a low level and granular distribution of pon1 in smooth muscle cells. western blot confirmed presence of intact and degraded pon1 in media of healthy aorta. with the development of atherosclerosis, pon1 increasing accumulation of pon1 with the progression of the atherosclerosis can be seen in the intimal part of aorta as well. aorta with advanced atherosclerosis lesions shows massive pon1 accumulation. a more recent study attributed an increased pon1 immunostaining in human atherosclerotic arteries to macrophages accumulated in lesions. high fat, high-cholesterol (atherogenic) diet leads to fast development of atherosclerosis in c57bl/6j mouse strain with concomitant decrease in liver pon1 expression. at the same time pon1 expression and its protective effects macrophages from this mouse did not protect ldl from oxidation by other cells in vitro, and pon1 knockout mice developed atherosclerosis faster than control mice on high fat, high cholesterol diet. to study the effect of pon1 knockout further ,. plasma lipid profile of these double knockout mice was similar to apoe-/- control animals with slightly decreased level of intermediate density lipoprotein (idl) and ldl, and increased level of lysophosphatidylcholine and oxidized phospholipids in idl and ldl. the rates of ldl oxidation and clearance were higher in pon1-/-, apoe-/- mice than in control mice as was determined by injection of human ldl. expression of genes responding to increase of oxldl, such as heme oxygenase-1, peroxisome proliferator-activated receptor gamma, scavenger receptor type a, cd36, and macrosialin, was upregulated in liver of pon1-/-, apoe-/- mice compared with apoe-/- mice. involvement of pon in inflammation and oxidative stress were detected in vascular wall of pon-/- animals. expression of mrna of essential cell adhesion molecules p-selectin and icam1 was upregulated in aortic wall. if a deficiency of pon1 leads to inflammation and oxidative stress, then increases in pon1 function could be beneficial. a transgenic mouse mpon1 was developed in 2001, with 5-fold higher level of mouse pon1 protein and corresponding increase in arylesterase activity. pon1 was associated with hdl, and protected hdl from oxidation by copper ions as it was assessed by lipid hydroperoxide formation assay, and by retaining oxidation-sensitive activity of lecithin: cholesterol acyltransferase (lcat). a decrease in atherosclerotic lesion size and improved oxidation status of aorta and peritoneal macrophages in pon1 overexpressing transgenic mouse on apoe-/- background have been compared with apoe-/- control have been reported. in another transgenic mouse model, pon1-tg, which overexpresses human pon1 gene of 55l/192q genotype, plasma level of arylesterase activity was twice higher in pon1-tg mouse compared with control mouse when animals were fed normal chow. the excess of pon1 level resulted in better retaining of its activity after feeding animals with atherogenic diet. pon1 activity decreased to about three-fourth (3/4) of original level after 15 weeks of atherogenic diet feeding to pon1-tg mice, and to less than one-half (1/2) of original level in control animals. thus, arylesterase activity mediated by pon1 was almost 4-fold higher in pon1-tg mice compared with control mice after feeding atherogenic diet. aortic lesion areas in pon1-tg animals were about half of the size of areas of the control mice after feeding atherogenic diet. apoe-/-, pon1-tg genotype mice fed normal chow similarly developed lesions slower, compared with apoe-/- controls; however, the difference in lesion area was just 22%. plasma arylesterase activity of apoe-/-, pon1-tg mice was 2.5-fold higher than that of apoe-/- animals, however, there is no difference between their lipid profile. a decreased inflammatory status of aortas in apoe-/-, pon1-tg mice compared with apoe-/- mice was detected by examination of the expression level of mcp-1 cytokine gene. hdl isolated from pon1-tg mouse plasma or apoe-/-, pon1-tg mouse plasma provided better protection against ldl oxidation, than hdl isolated from control animals. beside pon1 studies on transgenic mouse, a transient overexpression of pon1 gene in mouse adenovirus-mediated delivery of human pon1 gene (55 m, 192q genotype) in double knockout leptin-/- (ob/ob), ldlr-/- mouse resulted in more than 4-fold increase of pon1 activity on day 7 with gradual decrease to the control level by day 21. mice were injected with adenovirus at the age of 18 weeks when the progression of atherosclerosis occurs in a fast rate. six weeks later, cross-sections of the aortic root were analyzed by immunohistochemistry. plaque size, volume of macrophages, concentration of oxldl was significantly lower in pon1 expressing animals. the titer of anti-oxldl antibodies was lower in plasma of pon1 overexpressing mice as well. while an early pon1 intervention proved to have significant athero-protective effect, another study was performed to assess whether transient pon1 overexpression can improve vascular function in advanced atherosclerosis. similar to the previous study, 55m/192q variant of human pon1 gene was delivered in 18 month old apoe-/- mouse fed normal chow using adenovirus vector. serum pon1 activity was increased 10-fold by day 7 and 2.5-fold on the day 21 in pon1 overexpressing animals compared with controls. after 3 weeks, lesions were measured and no changes in their size were found. however, vasomotor function was improved by transient overexpression of pon1. thus, phenylephrine-constricted segments of the aortas relaxed significantly better in response to endothelium dependent agonists ach, adenosine-5-triphosphate (atp), and uridine-5-triphosphate (utp) observations on pon1 role in animal models is summarized in table 2. meta-analysis of 47 studies with 9853 cad and 11,408 control subjects published in 2012 confirmed association of lower plasma pon1 activity with increased cad risk (19% lower pon1 activity, p<0.00001). another meta-analysis published in 2012 included 43 studies with total 20,629 subjects showed similar association of pon1 activity and cad with standardized mean difference (smd) of -0.78 (p<0.001) for cad subjects compared with controls. slightly weaker association was between arylesterase activity of pon1 and cad with smd of -0.50 (p<0.001). both meta-analyses observed increased risk of cad in subjects with lower pon1 regardless of age and ethnicity; tables 3 and 4 summarizes the role of pon1 in human studies. summary of allele differences of pon1 in vitro, and conclusions from pon1 human studies recent human studies on the role of pon1 in cvd some alleles of polymorphous genes can be causative factors in development of diseases and reliable predictors. there are at least five known polymorphisms in promoter region of pon1: -909/-907 (c or g), -832/-824 (a or g), -162/-160 (a or g), -126 (c or g), and -108/-107 (c or t). also, there are two polymorphisms in the pon1 coding region, q192r (aka rs662 or 575a>g) and l55 m (aka rs854560 or 163 t>a), and several polymorphisms in 3 untranslated region of the gene. pon1 protein level in human serum varies more than 13-fold, and variations in the sequence of promoter region of pon1 gene might cause difference in its expression. two-fold differences in expression level between alleles were observed in cell culture reporter gene assay for three polymorphisms: -909/-907 (c or g), -162/-160 (a or g), and -108/-107 (c or t). polymorphisms -162/-160 (a or g) is a putative binding site for transcription factor nf-i, and -108/-107 (c or t) is a putative binding site for sp1. no effect on expression level in the reporter gene assay was observed for -832/-824 (a or g), -162/-160 (a or g) polymorphisms. gene expression and enzyme activity studies on pon1 polymorphisms in protein coding region q192r and l55 m resulted in several observations. first, messenger rna of allele 55 m appeared to be more stable than 55l as determined by pcr amplification and restriction analysis of cdna synthesized from heterozygous liver samples. l55 m heterozygous liver had roughly twice more mrna of 55 m allele compared with 55l. that might results in difference in protein expression levels between alleles and ultimately in pon1 activity and protection, although it was not assessed in the study. q192r and l55 m alleles differ in their enzymatic activities. in a study of serum of 279 healthy human subjects activity of 55 m homozygotes were always lower than 55l/m heterozygotes or 55l homozygotes. qq, qr, and rr phenotypes can be reliably determined by assaying pon1 catalytic activities toward two substrates: diazoxon and paraoxon. pon1 of qq genotype exhibits relatively high activity toward diazoxon and relatively low activity toward paraoxon. rr genotype, opposite to qq, exhibits low activity toward diazoxon and high activity toward paraoxon. 192r pon1 hydrolyzes homocysteine thiolactone faster than 192q pon1. q192r and l55 m pon1 enzymes differ in their protection to ldl from oxidation in vitro using ldl oxidation assay with copper in the presence of hdl. protection by pon1 decreases in the order of genotypes qq>qr>rr with almost no antioxidant activity in rr genotype, and about a half of qq activity in qr phenotype. the antioxidant activity of pon1 decreased in the series mm>lm>ll, with the activity of ll genotype about a half of activity of mm genotype. multiple clinical studies were performed to expose whether pon1 polymorphism may contribute to cad and other diseases. currently, analyses of association of pon1 polymorphism with atherosclerosis-related diseases determined just one reliable association, an association of q192r polymorphism with ischemic stroke. meta-analysis of 22 studies have been published earlier up to mid of 2009, totaling 7384 ischemic stroke subjects and 11,074 controls revealed odds ratio of 1.10 for g (192r) allele (95% ci: 1.041.17). another meta-analysis study that was published in 2010 and summarized results of 11 studies confirmed that 192r allele confers significant risk of ischemic stroke (odds ratio=1.25, 95% ci: 1.07,1.46, p=0.006). surprisingly, this risk is confined to caucasian subjects, but there is no significant association of 192r allele of pon1 and ischemic stroke in east asian population. association of pon1 polymorphism q192r with cad was examined in extensive meta-analysis of studies published before 2011. per-allele odds ratio for cad for 192r was 1.11 (95% ci: 1.05, 1.17) based on all studies regardless of their size. however, analysis suggested that small studies were less reliable, perhaps because of small studies bias. no significant association of 192r allele with cad was observed when 10 larger studies with more than 500 cases each were analyzed. similar conclusions regarding small study bias and the absence of reliable association of q192r polymorphism with cad were concluded in two other independent massive meta-analysis studies published in 2004; also, no association was found between cad and l55 m or -108/-107 (c or t) polymorphisms of pon1 gene. meta-analysis for l55 m and -108/-107 (c or t) pon1 polymorphisms determined per-allele odds ratios for cad as 0.94 (95% ci: 0.88,1.00) for 55 m and 1.02 (95% ci: 0.911.15) for -108/-107 c, respectively. no significant association of l55 m or -108/-107 (c or t) pon1 polymorphisms with cad were observed in an earlier meta-analysis study. no association between l55 m (rs854560) polymorphism and ischemic stroke was found in meta-analysis of 16 studies published before mid-2009 totaling 5518 ischemic stroke subjects and 8951 controls. similarly, a meta-analysis published in 2010 for 10 studies did not find significant association 55l allele with stroke regardless on the stroke type, age of patients, and ethnicity. resent human studies generally support the conclusions of meta-analyses [table 4]. a novel pon1 polymorphism associated with atherosclerosis was recently revealed, snp rs854563(a/g). in conclusion, pon1 antioxidant and anti-inflammatory effect is extensively examined in vitro, in cell culture and animal models. human studies confirm protective role of pon1 in cad and another atherosclerosis-related disease, ischemic stroke. although the current knowledge of pon1 provides valuable insights on the function and role of pon1, yet mechanism of pon1 action is still not well investigated. transient overexpression of pon1 in mouse demonstrated beneficial effects of pon1 beyond its antiatherogenic properties. further research of pon1 could potentially lead to new clinical strategies in prevention and treatment of cardiovascular diseases.

paraoxonase 1 (pon1) is a hydrolytic enzyme with wide range of substrates, and capability to protect against lipid oxidation. despite of the large number of compounds that can be hydrolyzed by paraoxonase, the biologically relevant substrates are still not clearly determined. there is a massive in vitro and in vivo data to demonstrate the beneficial effects of pon1 in several atherosclerosis-related processes. the enzyme is primarily expressed in liver; however, it is also localized in other tissues. pon1 attracted significant interest as a protein that is responsible for the most of antioxidant properties of high-density lipoprotein (hdl). several bioactive molecules such as dietary polyphenols, aspirin and its hydrolysis product salicylate, are known to stimulate pon1 transcription activation in mouse liver and hepg2 cell line. studies on the activity, function, and genetic makeup have revealed a protective role of pon1. some striking data were obtained in pon1 gene knockout and pon1 transgenic mouse models and in human studies. the goal of this review is to assess the current understanding of pon1 expression, enzymatic and antioxidant activity, and its atheroprotective effects. results from in vivo and in vitro basic studies; and from human studies on the association of pon1 with coronary artery disease (cad) and ischemic stroke will be discussed.

PMC3503369

pubmed-112

uterine adenomyosis is a common gynecologic disorder characterized by the presence and growth of heterotopic endometrial or endometrium-like structures in the myometrium, with adjacent smooth muscle hyperplasia and can lead to dysmenorrhea and infertility. the ectopic endometrial tissue induces hypertrophy and hyperplasia of the surrounding myometrium, resulting in diffuse globular enlargement of the uterus analogous to the concentric enlargement of the pregnant uterus. the presenting symptoms include a soft and diffusely enlarged uterus with menorrhagia (40%50%), dysmenorrhea (10%30%), metrorrhagia (10%12%), dyspareunia and dyschezia. the advised treatment for severe adenomyosis is total hysterectomy, but for patients wishing to preserve their uterus, a minimally invasive alternative procedure, uterine artery embolization (uae), can be performed. uae is a nonsurgical alternative for patients with menorrhagia, symptomatic adenomyosis, or symptomatic uterine fibroids. although uterine infarction is a relatively common occurrence after uae for the treatment of fibroids or adenomyosis, uterine infarction after ivf-et in a patient with adenomyosis is very rare. to our knowledge, this is the first report of uterine infarction after ivf-et in a patient with uterine adenomyosis in korea. she had suffered severe dysmenorrhea, menorrhagia, and pelvic pain due to severe adenomyosis which was diagnosed following a pelvic magnetic resonance imaging (mri) and clinical examination three years earlier. the patient had undergone three unsuccessful cycles of frozen-thawed embryo transfer at an external infertility clinic, due to primary infertility, during the period from 4-7 months before hospital admission. the patient was admitted to hospital for treatment of ovarian hyperstimulation syndrome (ohss) arising after controlled ovarian hyperstimulation about four months before the initiation of embryo transfer. a thyroid function test on january 2013 indicated a euthyroid state: triiodothyronine 166 ng/dl (range, 80-200 ng/dl), thyroid stimulating hormone 0.17 iu/ml (range, 0.4-4.1 iu/ml), free thyroxine 1.21 ng/dl (range, 0.80-1.90 mg/dl). the patient underwent another cycle of ivf at a local clinic in february 2013, during which she received follitropin- 150 iu from menstrual cycle day 3 to day 12 and chorionic gonadotropin 250 g at menstrual cycle day 13. ovum pick-up was performed about four weeks before she present to the emergency department and embryo transfer three days later. the patient received intramural progesterone 50 mg and was prescribed a vaginal progesterone gel (crinone) for daily use for 11 days after the embryo transfer. the patient presented to hospital with vaginal bleeding, fever and abdominal pain on eleven days after embryo transfer, and received antibiotic treatment followed by supportive care at a local clinic for three days. she visited our outpatient clinic due to vaginal bleeding and lower abdominal pain on sixteen days after embryo transfer and was admitted to hospital. c-reactive protein (crp) was elevated to 7.52 mg/dl and intravenous antibiotic treatment was given. biochemical abortion was diagnosed on nineteen days following embryo transfer after serum -hcg decreased from 161 to 63 mlu/ml in two days. the patient was discharged after symptom improvement, but presented with vaginal bleeding and lower abdominal pain, at a local clinic two days later, where she received hydration. the last day of that month, she presented to the emergency department with high fever (39) and, lower abdominal pain. peripheral blood cell analysis indicated a: white blood cell count of 17.510/l, an elevated crp of 24.3 mg/dl, a hemoglobin level of 7.6 g/dl and a hematocrit level of 24.5%. computed tomography at the emergency department revealed a wedge-shaped low attenuation area in the anterior uterine corpus. focal uterine infarction was suspected, and the pelvic mri revealed a wedge-shaped, irregularly marginated, non-enhancing area in the anterior uterine wall and the presence of preserved myometrium between the endometrial cavity and the inner margin of the necrotic myometrium (figure 1). blood markers investigated to establish the cause of infarction, including antiphospholipid immunoglobulin g (igg) and igm, protein c activation, protein s, and plasminogen, were all within normal ranges. five days after hospital admission, pelvic pain improved and crp decreased to 6.08 mg/dl, and the patient was discharged. two months later, pelvic mri showed interval regression of the previously noted possible focal uterine infarction site with a remarkably improved blood flow (figure 2). adenomyosis uteri is a pathological entity characterized by the presence of endometrial glands and stroma embedded within the myometrium, but without apparent contact with the endo-myometrial junction. uterine adenomyosis is relatively frequent, affecting 1% of females; its diagnosis is more often made in multiparous patients, in their fourth and fifth decade of life, and for this reason, infertility is not frequently concurrent with adenomyosis. however, given the trend for first pregnancies to be delayed until women are in their thirties or forties, adenomyosis uteri becoming a more frequently considered diagnosis. pregnancy resulting from assisted reproductive technology (art) is possible in patients with ademoyosis; however, spontaneous abortion, including biochemical abortion, still occurs in these patients. uterine infarction after ivf-et in a patient with adenomyosis has not previously been reported. the objective of uae is to initiate tumor infarction resulting in substantial reduction of the uterine and tumor volumes. first, when undergoing ivf-et, the risk of thrombosis is increased, as in the cases of pregnancy and hyperthyroidism, with which the patient also presented. the precise mechanisms by which the ohss and exogenous hormonal stimulation used in art induce thromboembolic events are still uncertain. however, vascular endothelial growth factor secreted during ohss, high estradiol concentrations, and blood hyperviscosity play a prominent part in inducing a prothrombotic state. reported that the overall venous thrombosis incidence rate during ivf pregnancies was three times higher than in reference pregnancies. an elevated crp can activate the coagulation system, following which microthrombosis formation, in the uterine myometrium, could cause necrosis of the myometrium and lead to focal uterine infarction. second, the disruption of the endometrial-myometrial interface also disrupts the organization of myometrial muscle fibers and may also disrupt normal contractility of the subendometrium. uterine adenomyosis with abnormal contractility and the subsequent abortion caused massive vaginal bleeding which may have led to uterine ischemia, and the resulting uterine infarction. clinical hyperthyroidism is generally accompanied by a hypercoagulable state, which may lead to microthrombosis of the uterine myometrium. last, fever and the elevated crp suggested that infection could have complicated the ischemic necrosis after uterine infarction. however, there were no clinical features such as rapid tumor growth, extrauterine extension or metastases, leading to the conclusion that the possibility of uterine sarcoma was very small. a follow-up mri three months later showed only traces of uterine infarction lesion and adenomyosis. in conclusion, we experienced a rare case of uterine adenomyosis that developed into uterine infarction after ivf-et and biochemical pregnancy. this case demonstrates that uterine infarction should be considered in the differential diagnosis of acute abdominal pain, vaginal bleeding and infectious signs in women with biochemical abortion after ivf-et, with a history of adenomyosis and hyperthyroidism. the insertion of a hormonal intrauterine device could be considered another option for treating the symptoms of adenomyosis in cases presenting with focal uterine infarction dysmenorrhea and menorrhagia. in addition, the surgical management of focal uterine infarction, may be considered in the management of uterine infarction after ivf-et in patients with uterine adenomyosis if future fertility is not desired. finally, it is important to note that the previous infarction site might be a potential risk site for uterine rupture in a future pregnancy.

adenomyosis is a common gynecological disorder characterized by the presence of endometrial glands and stroma deep within the myometrium associated with myometrial hypertrophy and hyperplasia. focal uterine infarction after ivf-et in a patient with adenomyosis following biochemical pregnancy has not been previously reported, although it occurs after uterine artery embolization in order to control symptoms caused by fibroids or adenomyosis. we report a case of a nulliparous woman who had uterine adenomyosis presenting with fever, pelvic pain and biochemical abortion after undergoing an ivf-et procedure and the detection of a slightly elevated serum hcg. focal uterine infarction was suspected after a pelvic magnetic resonance imaging demonstrated preserved myometrium between the endometrial cavity and inner margin of the necrotic myometrium. this case demonstrates that focal uterine infarction should be considered in the differential diagnosis of acute abdominal pain, vaginal bleeding and infectious signs in women experiencing biochemical abortion after an ivf-et procedure.

PMC4295945

pubmed-113

to optimize the benefits of minimally invasive procedures, surgeons have attempted to reduce the overall abdominal wall trauma by decreasing either the size of the ports or the number of trocars. in these efforts, transumbilical single-port surgery uses an umbilical single incision technique to access the peritoneal cavity and target organs. owing to the nature of umbilicus, single-port laparoscopy through the umbilicus offers an exciting opportunity to perform laparoscopic surgery with no visible scar. however, transumbilical single-port laparoscopy is not a new concept in gynecologic surgery [15]. in 1969, wheeless and thompson first published the technique and the results of a large series of laparoscopic tubal ligations using single-trocar laparoscopy. later, wheeless reported a large series of one-incision tubal ligation. additionally, in 1991, the first laparoscopic total abdominal hysterectomy with bilateral salpingooophorectomy (bso) using only a single incision was reported by pelosi and pelosi iii. one year later, four supracervical hysterectomies with bso for benign uterine disease were reported by the same authors [15]. although single-port surgery enhances cosmetic benefits and reduces postoperative pain and morbidity, use of this technique was not widespread due to technical difficulties. however, with advances in instrumental and surgical skills, the technical difficulties associated with this surgical procedure have been overcome considerably [615]. particularly, single-port surgery is ideal for laparoscopic-assisted vaginal hysterectomy (lavh) because the vagina of woman can be considered as an additional route for surgery; thus, uterine manipulators can be applied through the vagina [1117]. unlike uterine repair following myomectomy or bowel reanastomosis after bowel resection this is because the vaginal stump can be repaired not by laparoscopy, but through the vagina. in this study, we report our initial 100 cases observations of spa-lavh (with or without bilateral salpingooophrectomy (bso)) using a homemade, single-port, three-channel system. a retrospective medical records review was performed for the initial 100 patients who underwent spa-lavh at eun hospital. between march 2010 and september 2011, 100 patients had undergone spa-lavh for nonmalignant gynecological diseases, including uterine leiomyoma (25 cases), adenomyosis (19 cases), adenomyosis coexisting leiomyoma (41 cases), preinvasive lesion of cervix coexisting adenomyosis or leiomyoma (7 cases), ovarian huge cyst (5 cases), endometrial hyperplasia (2 cases), and tuboovarian abscess (1 case). past abdominopelvic surgery, body mass index (bmi), and the size of the uterus were not considered as exclusion criteria. the following parameters were determined in the present observational study: age, parity, bmi, surgical history, indication for surgery, operative time (from incision to final umbilical closure), largest dimension of the uterus, weight of the extirpated uterus (as pathology report), hemoglobin change (from before surgery to postoperative day 1), and perioperative and postoperative complications. we used homemade, single-port, three-channel system using the alexis wound retractor (applied medical, rancho santa margarita, ca, usa), surgical glove, two 10 mm trocars, and one 5 mm trocar [7, 16, 17]. after partial eversion of the umbilicus, a curved semilunar skin incision was performed at the hidden lateral aspect of the umbilical crater. the incision was c-shaped and followed the natural curve of the inferior lateral aspect of the umbilical crater near the base. after skin incision, a rectus fasciotomy and peritoneal incision were performed by direct cut-down technique. an approximately 1.5 2 cm-sized skin incision was sufficient to install the three-channel, single-port system, because of the elasticity of the skin and the tissue beneath it, which can be dissected as long as required [16, 17]. as shown in figure 1(a), the fascial edges were tagged with suture for traction prior to port system installation; this was useful for fascial closure at the end of the procedure. the alexis wound retractor consists of a proximal ring, distal ring, and connecting retractable sleeve. as shown in figure 1(a), the distal ring was loaded within the intraperitoneal space and tightly turned inside out of the proximal ring (rolled up manner), creating an effective seal and a wider opening of the single-port incision by connecting retractable sleeve between the distal and proximal rings. once fixed in the opening site, it laterally retracted the sides of the wound opening. subsequently, as shown in figure 1, a sterile surgical glove was placed over the proximal ring and fixed tightly to prevent leakage of carbon dioxide gas. three trocars were inserted through the surgical glove with cut edges of the distal fingertips and tied with an elastic string. the elastic nature of the glove enabled to achieve an airtight seal, which maintained the pneumoperitoneum. the multiple truncated fingers of the glove functioned as a multiport for surgical instruments [16, 17]. a limited range of motion was closely related to the bulkiest portion of the trocar head and instrumental grip (external handle) extracorporeally overlapping. as shown in figure 1(b), the length of the instruments was the same, but the lengths of the truncated glove digits varied. however, varying the height of the trocar head may minimize clashing of the bulkiest portion of the trocar head and instrumental grip (the external handle) extracorporeally overlapping. all the surgical procedures were performed as a standard lavh (with or without bso) technique using conventional nonarticulated rigid laparoscopic instruments and the ligasure system (valleylab, boulder, co, usa). as has been established earlier, exploration of pelvis, coagulation and cut of ligaments and vessel above the uterine vessel, and bladder mobilization were undertaken in laparoscopic phase. ligation of uterine vessel, cardinal and uterosacral ligament, extirpation of uterus, and vaginal stump closure were undertaken in the vaginal phase. all procedures were successfully completed through the single-port system and vagina without the need for extraumbilical puncture or conversion to laparotomy. as shown in table 1, the mean standard deviation (sd) of patient age, parity, and bmi was 48.2 6.5 years, 2.3 1.0, 25.4 3.3 kg/m, respectively. thirty-three patients had a past history of abdominopelvic surgery, such as a caesarean section, laparoscopic tubal ligation, appendectomy, ovarian cystectomy, or salpingooophrectomy. among these patients, six had a history of caesarean sections, five had a history of repeat caesarean sections, and five had a history of three caesarean sections. seven patients needed 2-3 units of packed red blood cell transfusion due to chronic anemia or intraoperative hemorrhage. the mean sd of time to installation of the transumbilical single-port system was 7.3 1.5 min. the mean sd of total operative time, largest dimension of the uterus, and weight of the uterus were 73.1 24.6 min, 10.5 2.1 cm, and 300.8 192.5 gram, respectively. the operative time between laparoscopic phase and vaginal phase was similar but depended on pelvic pathology. the median decline in the hemoglobin level from before surgery to postoperative day 1 was 1.8 0.9 g/dl. bladder injury occurred in one patient who had a history of three caesarean sections but was repaired through intraoperative laparoscopic suture. the postoperative course was uneventful in most patients, but three had a transient paralytic ileus, and five had pelvic hematoma, all of whom recovered following conservative managements. no port-related complications were noted, and the cosmetic results and patient satisfaction were excellent. spa-lavh is a technically safe and feasible procedure, and the homemade single-port system offers reliable and cost-effective access for single-port surgery. as mentioned earlier, lavh is most ideal for single-port surgery because the vagina of woman can be considered as an additional route for surgery; thus, uterine manipulators can be applied through the vagina. unlike uterine repair after myomectomy this is because the vaginal stump can be repaired not by laparoscopy, but through the vagina. thus, spa-lavh is safe, and the procedure can be learned by skillful surgeons over a short period of time, because a considerable portion of the procedure can be performed through the vagina. the homemade three-channel, single-port system using a surgical glove and an alexis wound retractor offers reliable, flexible, and cost-effective access for single-port procedures, and the system can be applicable in nonarticulated, rigid, conventional laparoscopic instruments [16, 17]. limitations of single-port surgery include the loss of instrumental triangulation, reduced operative working space, reduced laparoscopic visualization, and instrumental crowding and clashing. these limitations act as hurdles for some reconstructive procedures, such as repair after myomectomy. however, the reconstructive procedure can be performed with instrumental advancement, such as the use of articulated instruments [615]. our observations show that a history of abdominopelvic surgery is not a contraindication for single-port surgery; however, central obesity is problematic to secure a route for the single-port system through a small intraumbilical incision. procedural difficulties resulting from previous abdominopelvic surgery are not because of the single-port surgery itself, but owing to abdominopelvic conditions [10, 1517]. a linear correlation existed between the operation time and an extirpated uterine weight of>400 g, because more time was needed for uterine fragmentation for extirpation through the vagina; however, no linear correlation existed between the operation time and a uterus weight of<400 g. for pelvic adhesion, such as in previous pelvic surgery or endometriosis, additional operation time is required for adhesiolysis. it is not a case-control study, and pain score, hospital stay, cost effectiveness, and return to work were not considered because of the retrospective nature of the study. additional clinical data and long-term followup may be needed to address port-related complications.

objectives. to present our initial experiences with laparoscopically assisted vaginal hysterectomy performed using homemade transumbilical single-port system. materials and methods. we reviewed the medical records of one hundred patients who underwent single-port access laparoscopically assisted vaginal hysterectomy (spa-lavh). spa-lavh was performed with homemade single port system and conventional rigid laparoscopic instruments. results. all procedures were successfully completed through the single-port system and vagina without need for extraumbilical puncture or conversion to laparotomy. the median patient age was 48.2 6.5 years. thirty-three patients had history of past abdominopelvic surgery. the median total operative time, largest dimension of the uterus, and weight of the uterus were 73.1 24.6 min, 10.5 2.1 cm, and 300.8 192.5 gram, respectively. the median decline in the hemoglobin from before surgery to postoperative day 1 was 1.8 0.9 g/dl. bladder injury in occurred one patient who was repaired through intraoperative laparoscopic suture. the postoperative course was uneventful in most patients except for three who had a transient paralytic ileus, five who had pelvic hematoma, but they were recovered following conservative managements. no port-related complications were noted, and the cosmetic results were excellent. conclusions. spa-lavh is technically safe procedure, and the homemade single-port system offers reliable access for single-port surgery.

PMC3440953

pubmed-114

according to early treatment of diabetic retinopathy study (etdrs), protocol panretinal photocoagulation (prp) can prevent severe visual loss in proliferative diabetic retinopathy (pdr). several studies have shown histopathologic changes in choroid of diabetic patients [24]. meanwhile, using panretinal photocoagulation (prp), as was suggested beneficially by diabetic retinopathy study for proliferative diabetic retinopathy, has gotten general acceptance. with the advent of enhanced depth imaging optical coherence tomography (edi-oct), it is now possible to visualize and measure choroidal changes easily. to the best of our knowledge, no other study has compared these two laser modalities in changing choroidal or central retinal thickness. in this study, we have evaluated the subfoveal choroidal, central retinal, and peripapillary retinal nerve fiber layer (rnfl) thickness changes before and after prp using edi-oct and we compare the green and red laser in this regard. this clinical trial was approved by the institutional review board/ethics committee. written informed consents were obtained from all participants. exclusion criteria were advanced proliferative diabetic retinopathy, a history of any laser treatment (panretinal or focal laser photocoagulation), any history of intravitreal drug injection, ocular surgery, significant media opacity, myopia, or hyperopia with refractive error of more than 3 diopters. primary objective was to determine subfoveal choroidal and retinal thickness and peripapillary nerve fiber layer thickness changes 6 weeks after red versus prp laser. a complete ophthalmic examination including best corrected visual acuity (bcva) using snellen chart, goldmann applanation tonometry, and dilated indirect ophthalmoscopy was conducted. enhanced depth imaging optical coherence tomography (edi-oct) mapping was performed using sd-oct (spectralis, heidelberg engineering, heidelberg, germany). a total number of 1600 to 2000 spots per eye were applied to ablate retina using ellex integre pro scan laser photocoagulator (82 gilbert street, adelaide, sa 5000, australia). the order of treated areas was as follows: nasal, inferior, superior, and then temporal retina. power setting was chosen to have a mild gray-white burn (grade 2) according to etdrs guidelines. laser setting parameters did not differ significantly between two groups (mean power 303 mwatts in red and 290 mwatts in green laser group, p value: 0.14; mean laser spots 1789 spots in red and 1869 spots in green laser group, p value: 0.13). one eye of all patients was randomly assigned to red laser and the other eye to green laser. spectral domain optical coherence tomography images were obtained using spectralis oct (heidelberg engineering, heidelberg, germany) to measure central retinal thickness and enhanced depth imaging (edi) mode to measure subfoveal choroidal thickness. bcva measurement and an oct scan were performed at baseline and 6 weeks after completion of prp. subfoveal choroidal thickness was measured using apparatus measurement tool at baseline and 6 weeks after prp. choroidal segmentation was done manually, moving the reference lines from the retinal borders to the choroidal borders. the internal limiting membrane line was moved to the base of the retinal pigment epithelium. also retinal nerve fiber layer (rnfl) thickness analysis was done at baseline and 6 weeks after treatment. data were analyzed using spss software (version 16, spss, inc.). a paired sample t-test was used to compare macula and choroid thickness before and after treatment. independent sample t-test was performed to compare macula and choroid thickness changes from baseline between two groups. the mean visual acuity of patients was 0.32 0.28 logmar and 0.27 0.23 logmar in red laser group and green laser group, respectively. the mean subfoveal ct increased significantly in each group at 6 weeks follow-up (in red laser group, 202.14 24.5 micron at baseline and 211.7 26.6 micron at 6 weeks, p value<0.00, showing 4.86% ct increase compared to baseline) (in green group, 201.9 21.13 micron at baseline and 208.9 25.0 at 6 weeks, p value<there was not a significant difference between red and green laser in terms of choroidal thickness changes from baseline (p value 0.184). in red laser group, the mean central retinal thickness was 271.6 30.33 micron at baseline and 298.5 62.14 micron at week 6 of follow-up (p value 0.03). in green laser group, the mean central retinal thickness was 267.0 36.9 micron at baseline and 306.4 73.3 micron at week 6 of follow-up, (p value 0.000 for both groups). there was no significant difference between macular thickness increase between two groups (p value: 0.404) (table 2). there was no significant association between choroidal thickness change and retinal thickness change in each group (p values: 0.051 and 0.52, resp.). the mean peripapillary rnfl thickness was 100.5 20.1 micron in red laser group at baseline which increased to 108.2 23.1 micron at 6 weeks (p value 0.000) (7.8% as compared to baseline). in green laser group, it was 103.5 19.8 micron at baseline which increased to 112.7 22.9 in week 6 of follow-up (p value 0.000) (9.2% as compared to baseline). rnfl change between two groups was not significant (p value: 0.762) (table 2). in this study, in eyes with proliferative diabetic retinopathy and without significant macular edema, the mean subfoveal choroidal, central retinal, and peripapillary rnfl thickness increased significantly after both red and green argon laser treatments. this is in accordance with some of previously published studies that confirm this finding [69]. takahashi et al. measured changes in choroidal blood flow in the foveal area one month after prp in patients with severe diabetic retinopathy and no macular edema using a laser-doppler flowmetry. they reported that prp increases both the choroidal blood flow and the choroidal blood volume. changes in subfoveal choroidal thickness did not correlate with changes in macular thickness in their study. first, it has been attributed to redistribution of choroidal blood flow [1014]. this leads to redistribution of blood in other untreated areas, especially the macula. following blood flow increase, this transient inflammation probably causes release of cytokines and leads to increase of blood flow and choroidal thickness [18, 19]. mean ct increase in both groups in this study is similar to what have been reported before in other trials [710]. it is noteworthy that, in some other trials, the measured subfoveal ct showed decreased thickness after prp in short term follow-up. they have hypothesized that the reason may be due to the destruction of choroidal vasculature after thermal damage of prp [20, 21]. also, we found that central macular thickness and rnfl thickness increased significantly in both groups; this is also similar to what has been found in other studies [2024]. this finding is similar to what has been reported before about the increase of retinal thickness after prp and it was attributed to the release of proinflammatory cytokines or hypoxia-induced macular edema [2024]. also, we did not find any correlation between changes of choroidal thickness and central retinal thickness. one of the novel analyses done in this study is the comparison between red and green laser in changing retinal, choroidal, and rnfl thickness. although all three measured variables showed significant increase after treatment in each eye, intereye comparisons were not statistically significant considering central retinal, subfoveal choroidal, and rnfl thickness changes (p values: 0.404, 0.184, and 0.762, resp.) that may indicate no considerable difference between red and green laser in this regard. to the best of our knowledge, there is only one report by ghassemi et al. that compared the difference between red and green laser in pdr patients. they reported significant increase of rnfl thickness after prp without any difference between red and green laser. one of the advantages of this study is selection of both eyes of one patient which can exclude the effect of systemic factors on retinal, choroidal, and rnfl thickness. this study has some limitations including low sample size and short follow-up time. nonetheless, this study showed significant increase of subfoveal choroidal, foveal retinal, and peripapillary rnfl thickness after red and green laser prp and no significant difference between these two lasers in aforementioned measurements.

purpose. to compare subfoveal choroidal, central retinal, and peripapillary nerve fiber layer (rnfl) thickness after panretinal photocoagulation (prp) with red and green laser in diabetic patients. study design. randomized clinical trial. methods. a total of 50 patients with bilateral proliferative diabetic retinopathy and no diabetic macular edema underwent prp. one eye was randomly assigned to red or green laser. subfoveal choroidal, central retinal, and rnfl thicknesses were evaluated at baseline and 6 weeks after treatment. results. the mean subfoveal choroidal, central retinal, and peripapillary nerve fiber layer (rnfl) thickness increased significantly in each eye 6 weeks after prp (p values in red laser group:<0.01, 0.03, and<0.01, resp., and in green laser group<0.01,<0.01, and<0.01). there was no difference between red and green laser considering subfoveal choroidal, central retinal, and peripapillary nerve fiber layer (rnfl) thickness increase after prp (p values: 0.184, 0.404, and 0.726, resp.). conclusion. both red and green lasers increased mean subfoveal choroidal, central retinal, and peripapillary nerve fiber layer (rnfl) thickness significantly 6 weeks after prp, but there is no difference between these two modalities in this regard.

PMC4993942

pubmed-115

spinal anaesthesia has been widely used for caesarean section (cs) deliveries because of greater maternal safety, foetal benefits, higher parental satisfaction, and consumer demand. however, to address the problem of limited duration of action and to improve the quality of analgesia, various adjuvants are added intrathecally with local anaesthetics (la). the adjuvants gained widespread popularity as they reduce the amount of la and thus the incidence of side-effects. clonidine, a selective partial agonist for alpha-2 adrenoreceptors, is an attractive alternative to commonly used opioids, and is known to increase both sensory and motor block of la. several studies have shown that clonidine also has antihyperalgesic effect and thus reduces the post-operative analgesic requirement. commonly, adjuvants are mixed with la in a single syringe before injecting the drugs intrathecally. mixing of these drugs changes the density of both drugs, thus affecting their spread in the cerebrospinal fluid (csf). density is known to influence the spread of la, but the effect of adjuvant solution density on its movement in the csf has not been studied extensively. therefore, we hypothesised that if we administer la and the adjuvants separately, it may minimise the effect of the changes in densities and also hence their actions. thus, in this study we aimed to compare block characteristics, intra-operative haemodynamics and post-operative pain relief in parturients undergoing cs under subarachnoid block (sab), after administering hyperbaric bupivacaine (hb) and clonidine as a mixture in single syringe and sequentially in two syringes. after approval by the institutional ethical committee and written informed consent, sixty parturients with singleton pregnancy, american society of anaesthesiologist (asa) i and ii physical status, scheduled for elective cs under sab, were enrolled in this single-blind prospective randomised controlled trial. patients having multiple pregnancy, intrauterine deaths or known foetal anomaly, severe pregnancy induced hypertension, contraindication to sab, patients on cardiovascular medications and those having history of hypersensitivity to clonidine and la were excluded from the study. using a sealed envelope technique, (n=30) received hyperbaric bupivacaine (0.5%) 10 mg (2 ml) and clonidine 75 mcg (0.5 ml) as a mixture. group b (n=30) received clonidine 75 mcg (0.5 ml) followed by hyperbaric bupivacaine (0.5%) 10 mg (2 ml) in different syringes. for our study, the two drugs used were sourced from same company to avoid manufacturer's difference. hyperbaric bupivacaine used was heavy anawint and clonidine used was cloneont manufactured by neon laboratories limited, mumbai. patients were kept fasting overnight and antacid prophylaxis with oral ranitidine 150 mg at night and on the morning prior to surgery were given. the patients were familiarised with the concept of visual analogue scale (vas) for pain assessment with 0=no pain and 10=worst possible pain. in the operating room, monitor for heart rate (hr), non-invasive blood pressure, electrocardiography and oxygen saturation (spo2) was connected and baseline parameters were recorded. after establishing 18 gauge venous cannula, patients were pre-loaded with 15 ml/kg of lactated ringer's solution 15-20 min before spinal block. under all aseptic precautions sab was administered with 23 g quincke spinal needle through mid-line approach in sitting position. intrathecal (it) drug was injected in l3-l4 interspace over 30 s (including the time for change of syringe in sequential administration). after the block was performed, the patients were made supine with 15-20 left displacement of uterus until birth of baby by keeping a wedge under the right buttock. fluid therapy was maintained with lactated ringer's solution 10 ml/kg/h. an experienced anaesthesiologist who was unaware of the drug given evaluated the spinal block and other physiological parameters. haemodynamic parameters such as hr, systolic arterial pressure (sap), diastolic arterial pressure (dap) were monitored at every 2 min (min) for the first 20 min and then every 5 min subsequently until 75 min or until completion of surgery. any episode of hypotension and bradycardia in 24 h was noted. hypotension (decrease in sap below 90 mmhg or a fall in blood pressure by>20% of baseline values) was treated with a rapid infusion of crystalloids (200 ml) and a bolus of ephedrine 5 mg intravenous (i.v) was administered if hypotension persisted. bradycardia (hr<50 beats/min) was treated with injection atropine 10 mcg/kg i.v. the onset of sensory block was assessed by loss of pin prick sensation along the mid clavicular line bilaterally. dermatomal level was tested every 2 min after sab until level was stabilised for four consecutive readings. the time from it injection to highest sensory level (maximum block height) was noted. furthermore, level was tested every 30 min until regression from highest level to t10 dermatome was noted. degree of motor block was assessed by modified bromage scale as follows; i free movement of legs and feet; ii just able to flex knees with free movement of feet; iii unable to flex knees but with free movement of feet; iv unable to move legs and feet. time to achieve complete motor block (modified bromage iv) and its regression to modified bromage i was noted. respiration was monitored and respiratory depression was defined as respiratory rate<10 breaths/min or spo2<92%; oxygen was then supplemented through nasal prongs at 4 l/min. sedation score was assessed at the same interval as sensory block until 2 h post-operatively by ramsay sedation score (rss) as: level 1 awake, anxious, agitated, restlessness; level 2 awake, tranquil, co-operative; level 3 responds to commands; level 4 asleep, brisk response to stimuli; level 5 n asleep, sluggish response to stimuli; level 6 asleep, no response to stimuli. intra-operative pain was checked and expressed as vas, whenever the parturients complained of any discomfort or pain. duration of effective analgesia was defined as time from it injection till vas was 3, when rescue analgesia in the form of injection i.v diclofinac sodium 75 mg was administered. patients complaining of nausea or having any episode of vomiting were given injection ondansetron 0.15 mg/kg i.v., new-born's apgar scores were determined by a paediatrician not otherwise involved in the study at 1, 5, and 10 min. post-operatively any incidence of bradycardia, hypotension, nausea/vomiting, prolonged sedation reported by the recruited post-operative care unit staff was taken into account and managed accordingly. the parturients were also interviewed for post-dural puncture headache (pdph), backache, and examined for any neurological deficit. power analysis suggested that a sample size of 30 patients/group was required to achieve a power of 80% and a level significance of 0.05 to be able to detect a difference between the groups, based on the assumption that an increase in the mean duration of analgesia by 60 min in sequential group. interpretation of the data was carried out and analysed using software microsoft excel and spss version 19. data is represented as mean standard deviation for continuous data and frequency (percentage %) or median (range) for non-parametric (categorical) data. the proportion of adverse effects was compared using chi-square test and level of sedation was compared with the help of wilcoxon test. the p<0.05 was considered significant and p<0.01 was considered highly significant. demographic data in terms of age, height, weight, asa physical status and duration of surgery were comparable in both groups [table 1]. the onset time of sensory and motor block and also the highest level of block achieved (t4) were comparable in both groups [table 2]. mean time to reach maximal cephalad sensory block height was significantly less in group b (3.21 0.13 min) than in group m (4.43 0.26 min) and the total duration of analgesia lasted significantly longer in group b (474.3 20.79 min) as compared to group m (337 18.22 min) (p=0.000). complete motor blockade was achieved earlier in group b (4.75 0.40) than in group m (5.84 0.36) (p=0.000). the resolution time of motor block back to modified bromage i was significantly prolonged in group b (292.23 15.24 min) than in group m (189.50 16.31 min) [table 2]. characteristics of sensory and motor block haemodynamic parameters showed that the lowest values of the hr were after 45 min of the administration of sab, but none of the patients had bradycardia [figure 1]. there was a significant fall in sap at 2 min and 4 min after administration of sab in both groups [figure 2]. a significant fall in dap was seen at 2, 4, 6, and 8 min of administration of sab. there was an overall trend of fall in sap and dap in both groups, except during the time intervals of 20 and 25 min (during delivery of baby) where there was rise in both sap and dap [figures 2 and 3]. the falling trend of arterial blood pressures was more in the group b than in group m. heart rates at different time intervals systolic blood pressure at different time intervals diastolic blood pressure at different time intervals there was no noticeable fall in spo2 in both groups. it was observed that only one patient in group m and 3 in group b had sedation score of 4 according to rss. intra-operative incidence of hypotension, bradycardia, respiratory depression, nausea/vomiting, dry mouth and additional analgesic requirement are comparable in both groups [figure 4]. newborn's well-being, assessed by the apgar scoring system was observed in both groups. the median value was 8 at 1 min, 9 at 5 min and 10 at 10 min in both groups. activation of post-synaptic alpha-2 receptors in the substantia gelatinosa of the spinal cord is the presumed mechanism by which clonidine produces analgesia. these receptors are located on primary afferent terminals (both at peripheral and spinal endings), on neurons in the superficial lamina of the spinal cord, and within several brainstem nuclei implicated in analgesia, supporting the possibility of analgesic action at peripheral, spinal, and brainstem sites. various authors have used different doses of it clonidine ranging from 15 mcg to 300 mcg along with local anaesthetics. kaabachi et al., in their study used 2 mcg/kg of it clonidine and reported extended duration of post-operative analgesia, but with moderate side-effects. sethi et al., used 70 mcg of clonidine and found a significant decrease in mean arterial pressure and hr in clonidine group, but no therapeutic intervention was required for either. since marked decrease in blood pressure is observed only with intermediate doses of spinal clonidine (150 mcg) and relative haemodynamic stability is maintained after larger doses (300-400 mcg), we were interested to test a dose of lower range of efficacy. hence, we selected a 75 mcg of preservative free clonidine as an adjuvant for spinal anaesthesia in cs. patients scheduled for cs were chosen for the study because it is a well-known fact that visceral discomfort and pain is common occurence in cs under sab. the observations and results obtained in the study are based on the assumption that the original densities of hyperbaric bupivacaine and clonidine are lost when they are premixed in a syringe thus, they exert suboptimal actions when compared to their it administration in a sequential manner. the above assumption is supported by the work of desai et al. who studied the same effect by adding opioids to la solution intrathecally. the densities of the drugs that we used (hb and clonidine) were 1.0260 and 0.9930, respectively. the density of the mixture of 2 ml (10 mg) of hyperbaric bupivacaine and 0.5 ml (75 mcg) clonidine was also estimated and it was found to be 1.0189. in our study, we observed that the mean onset time of sensory and motor block was similar in both groups. however, onset of sensory block does not get any better after a particular dose as supported by a study done by heo et al. who did not report any difference in onset time even after using 150 mcg clonidine. the time to reach maximum sensory block height and maximum motor block was significantly less in group b (sequential drugs) than in group m (mixed drugs) in this study. this difference might have existed because of the preferential cephalad spread of clonidine when we administered it through a separate syringe, owing to its hypobaric nature which is lost when the drugs are premixed. desai et al. also observed that the time to reach highest level of block was less when morphine and fentanyl were administered sequentially with hb than when given as a mixture. in our study, we found that the mean time taken for sensory block to regress to t10 level was significantly longer in group b (240.67 18.47 min) than in group m (153.83 13.11 min). similarly, the mean duration of analgesia lasted significantly longer in group b (474.33 20.79 min) than in group m (337 18.22 min), depicting significant prolongation of analgesic effect in the group receiving drugs in a sequential fashion. this difference might be due to the fact that injecting clonidine and bupivacaine as a mixture dilutes clonidine and receptor occupancy might decrease leading to less pronounced effect. however, if clonidine is administered separately, we expect a greater spread and therefore formation of stronger bonds with the receptor leading to a denser and prolonged block. according to desai et al., dextrose in a hb solution slow the movement of morphine molecules in the csf, reducing the exposure of supraspinal centres to morphine. clonidine also being hypobaric drug, acting on both spinal and supraspinal receptors, might exhibit similar properties. gray et al. observed that duration of analgesia is increased when it morphine is administered with normal saline (hypobaric) than with dextrose saline (hyperbaric). clonidine decreases hr by a presynaptic mediated inhibition of nor epinephrine release and by a direct depression of atrioventricular nodal conduction after systemic absorption. the maximum fall in the hr when compared to the baseline was 28% in group b, whereas it was only 13% in group m which was statistically significant (p<0.001). this fall in hr was more pronounced after about 40-60 min of administration of sab and toward end of the surgery. however, in our study none of the patients had bradycardia. a significant fall in arterial blood pressure after sab the fall from baseline sap and dap in group m was 15% and 18% and in group b was 19% and 20%, respectively. haemodynamic effects of clonidine after neuraxial or systemic administration begin within 30 min, reach maximum within 1-2 h, and last approximately 6-8 h after a single injection. we observed hypotension in 13% patients in group m and 16% patient in group b. hypotention was managed by i.v fluids and vasopressors were needed for only 1% and 3% parturients in groups m and b, respectively which was comparable in both groups, suggesting that the clonidine groups did not have a higher predisposition for the development of hypotension if administered sequentially. in our study, the level of sedation provided by it clonidine (rss 2 and 3) was not only acceptable, but also beneficial owing to its anxiolytic role. none of the patients needed any additional analgesics during the intra-operative period. in line with our observations, benhamou et al. found that when it clonidine was administered with hb, none of patients required additional analgesics to obtain an adequate sensory block. none of the patients complained of dry mouth. in the post-operative period one patient each in group m and b developed pdph, which was managed conservatively. there was no incidence of hypotension, bradycardia and nausea/vomiting, neurological deficit, prolonged sedation in the post-operative period. neves et al. also concluded that addition of it clonidine did not adversely affect the neonatal outcome in terms of apgar scores. the limitation of our study was that we measured the densities of solutions in vitro; but, we could not measure the densities when injected into the csf. sequential administration of clonidine reduces the time to achieve complete sensory and motor block and significantly prolongs the total duration of analgesia. addition of clonidine to hyperbaric bupivacaine provided a dense surgical anaesthesia irrespective of the technique of administration. however, we noticed that sequential technique did not increase the level of sedation and incidence of hypotension or bradycardia as compared to the administration of drugs as mixture.

background and aims: mixing adjuvants with hyperbaric bupivacaine in a single syringe before injecting the drugs intrathecally is an age old practice. in doing so, the density of the hyperbaric solution and also of the adjuvant drugs may be altered, thus affecting the spread of drugs. administering local anaesthetic and the adjuvants separately may minimise the effect of the changes in densities. we aimed to compare block characteristics, intraoperative haemodynamics and post-operative pain relief in parturients undergoing caesarean section (cs) after administering hyperbaric bupivacaine and clonidine intrathecally as a mixture and sequentially. methods:in this single-blind prospective randomised controlled study at a tertiary care centre from 2010 to 12, 60 full-term parturients scheduled for elective css were divided into two groups on the basis of technique of intrathecal drug administration. group m received mixture of clonidine (75 mcg) and hyperbaric bupivacaine 0.5% (10 mg) intrathecally, whereas group b received clonidine (75 mcg) followed by hyperbaric bupivacaine 0.5% (10 mg) through separate syringes. observational descriptive statistics, analysis of variance test, wilcoxon test and chi-square test were used as applicable. results:duration of analgesia was significantly longer in group b (474.33 20.79 min) in which the drug was given sequentially than in group m (337 18.22 min). furthermore, the time to achieve highest sensory block and complete motor block was significantly less in group b without any major haemodynamic instability and neonatal outcome. conclusions:when clonidine and hyperbaric bupivacaine were administered in a sequential manner, block characteristics improved significantly compared to the administration of the mixture of the two drugs.

PMC4090994

pubmed-116

in 2014, there will be 63,920 new cases of kidney and renal pelvis cancer diagnoses resulting in approximately 13,860 deaths. renal cell carcinoma (rcc) is one of the most lethal genitourinary cancers and comprises 85% of these new diagnoses. the incidence of rcc has steadily increased over the past few decades due to incidentally discovered small renal masses (srm) on radiographic imaging resulting in stage migration to clinical t1a disease from more advanced disease. numerous treatment options exist for clinical t1a disease, including total nephrectomy, partial nephrectomy, radiofrequency ablation, cryoablation, and high-intensity focused ultrasound (hifu). in 2009, the american urologic association (aua) published the guideline for the clinical stage 1 renal mass which concluded that partial nephrectomy is the standard of care for clinical t1a disease suggesting that the open approach is preferred over minimally invasive techniques. in experienced hands, laparoscopic partial nephrectomy (lpn) is associated with similar oncologic outcomes to open partial nephrectomy (opn) with the added benefit of decreased narcotic use, decreased hospital stay, and earlier convalescence [57]. robotic partial nephrectomy (rpn) and lpn have also been compared with similar outcomes, if not superior rpn outcomes, in the hands of an experienced minimally invasive surgeon. most studies report the outcomes of either (a) single surgeon and single and/or dual approach or (b) multicenter, multisurgeon, and dual approach. to our knowledge, there have been no reports of a single surgeon's experience with each of the three modalities. our hypothesis is that when performed by a single surgeon, open, laparoscopic, and robotic partial nephrectomy could differ in postoperative complication rates and overall kidney function. thus, we report the perioperative outcomes of 106 consecutive patients treated with partial nephrectomy by a single surgeon using all three surgical approaches opn, lpn, and rpn. after obtaining institutional review board approval, a retrospective chart review of a prospectively collected kidney cancer database was performed. from august 2006 to february 2012, a single surgeon (rm) with minimally invasive and urologic oncology fellowship training performed 106 consecutive partial nephrectomies using any of the three available surgical modalities opn, lpn, or rpn. the decision for the approach was multifactorial and was based on patient and tumor characteristics. initially in the practice, lpn was offered to patients with tumors of favorable size and location. opn was reserved for patients who were uninephric, had compromised kidney function, or had large tumors in an unfavorable location. in early 2008, rpn gradually replaced lpn as the preferred minimally invasive approach. preoperative variables and demographics analyzed included age, gender, body mass index (bmi), american society of anesthesiologist (asa) score, glomerular filtration rate (gfr), hematocrit (within 30 days of surgery), tumor laterality, and tumor size. operative variables analyzed included operative time, estimated blood loss (ebl), complications, pathology (benign, malignant), and margin status. postoperative variables included length of stay, discharge hematocrit, transfusion, gfr, 3-month gfr, and 30-day complications. the indication for partial nephrectomy was an enhancing renal mass found on cross-sectional abdominal imaging. pathology was reviewed by a dedicated genitourinary pathologist for margin status and tumor type. briefly, patients were positioned in a modified 45-degree flank and an incision was made for access to the retroperitoneum. the kidney was dissected free of attachments in the retroperitoneal space and the hilum was identified. intravenous mannitol (12.5 g) administration and renal hypothermia (cold ischemia) were utilized prior to hilar clamping in all cases. the hilum was clamped using the satinsky vascular clamp and the resection of the renal lesion was performed with sharp dissection. the collecting system was closed primarily, and individual vessels were identified and controlled using nonabsorbable monofilament suture. argon beam coagulation achieved hemostasis prior to reapproximation of the renal parenchyma with surgicel (ethicon inc, somerville, nj) bolsters. in all cases, the patient was positioned in a modified flank configuration with a total of four ports. once the hilum and mass were identified, mannitol (12.5 g) was administered and the hilum was controlled using a laparoscopic vascular clamp (warm ischemia). surgicel (ethicon inc, somerville, nj) and floseal (biosurgery, deerfield, il) were used for hemostasis and the tumor bed was repaired in a running fashion based on the depth of the lesion. the parenchyma was reapproximated with 2.0 v lock suture, surgicel (ethicon inc, somerville, nj) bolsters, and secured with hem-o-lok clips. in superficial tumors penetrating less than 1 cm into kidney parenchyma, clamping and/or repair of the base of resection was not performed. all patients underwent warm ischemia, which was achieved using either laparoscopic bulldog clamps or a vascular clamp. similar to the lpn technique, the resection bed was closed in a running fashion using an absorbable suture and the defect was approximated using a surgicel (ethicon inc, somerville, nj) bolster in most cases. the statistical package for the social sciences v.19 (spss inc. all p values were one-sided, and p<0.05 was considered statistically significant. categorical variables were compared using a chi-square test and continuous variables were compared using one-way anova. among the 106 patients in the study, 23 patients (22%) underwent opn, 48 patients (45%) underwent lpn, and 35 patients (33%) underwent rpn. there was no difference in age, gender, bmi, asa score tumor laterality, or tumor size between the three groups (table 1). there was a statistical trend towards lower preoperative hematocrit for opn patients compared to the minimally invasive patients (opn40 4%, lpn43 4%, rpn42 4%, p=0.09). preoperative gfr was 71 28 ml/min for opn patients, 76 25 ml/min for lpn patients, and 96 37 ml/min for rpn patients (p=0.004). there was no difference in intraoperative complication rate, tumor pathology, or margin status between the opn, ldn, and rpn patients (table 2). operative time was the shortest in the opn group (opn163 35 min, lpn227 53 min, rpn244 53 min, p<0.0001). ebl (opn367 286 ml, lpn163 179 ml, rpn191 173 ml, p<all patients who had opn had the kidney cooled for an average time of 8 minutes before excision of the tumor. there were no differences in length of stay, blood transfusion, discharge gfr, or 3-month gfr for the three cohorts of patients (table 3). discharge hematocrit was significantly lower for opn patients (30 3%) compared to lpn (36 4%) and rpn (35 4%) patients (p<0.0001). upon follow-up, the opn group had the highest incidence of 30-day complications (30%), while the rpn group had the lowest (14%, p=0.008). the opn complications included clavien i (n=2), clavien ii (n=1), clavien iii (n=3), and clavien iv (n=1). the lpn complications included clavien i (n=4), clavien ii (n the rpn complications included clavien i (n=1), clavien ii (n=1), and clavien iii (n=3). radical nephrectomy (rn) has been the mainstay of treatment for clinical stage i tumors resulting in excellent cancer specific survival, local tumor control, and progression free survival; however, reports have highlighted a negative impact on renal function and chronic kidney disease (ckd) associated with rn. this effect was acknowledged in the 2009 aua guideline for the management of small renal masses which concluded that opn should be considered standard of care and that minimally invasive options, such as lpn and rpn, be considered as second line treatment modalities. furthermore, recent studies have established that partial nephrectomy (pn) provides similar oncological outcomes when compared to rn [1214]. the current study is the first, to our knowledge, which compares all three modalities of pn (opn, lpn, and rpn) by a single surgeon. multi-institutional studies may represent dissimilar patient cohorts that introduce selection bias and may invoke concerns regarding surgeon variability., there was no randomization or objective criteria for the pn approach; rather, the trend was for more minimally invasive surgery as the surgeon developed a comfort level with the lpn and rpn approach. this is evident by the fact that tumor characteristics for each group are comparable (laterality, size, pathology, and margin status). previous single surgeon studies have analyzed rpn versus lpn [11, 1519] with the consensus being that rpn offers a shorter learning curve to minimally invasive pn and comparable warm ischemia time, ebl, and length of stay. two common criticisms associated with rpn include (i) the cost of the robot and (ii) increased surgical time. although it is difficult to mitigate the cost associated with rpn compared to lpn and opn, the oft-held conception that procedures take significantly longer may be a misconception after achieving the learning curve associated with rpn. concluded that rpn achieved similar operative times to lpn after only 5 procedures and the current study corroborates similar operative times between the two approaches (244 53 versus 227 53 min). in the opn cohort, there was a 30-day complication rate of 30%, which was statistically significant compared to the lpn (17%) and rpn (14%) groups, and higher than that reported by other authors. gill et al. reported a 16% and 13% postoperative complication rate in their initial comparison of lpn and opn, respectively. bhayani and waxman and winfield reported postoperative complication rates of 16% and 18.2%, respectively, in each of their single-surgeon experiences with lpn [21, 22]. a recent report, which pooled data from 4 institutions considered centers-of-excellence, reported a postoperative complication rate of 14.4% in patients who underwent rpn. most complications were clavien grade i/ii and were managed conservatively and affirm the safety of rpn in experienced hands. the complication rate was lowest in the rpn group at 14% and is similar to other reports, with ranges of 1020% [8, 15, 24]. the primary limitation of the study is the inherent selection bias and patient confounders associated with a retrospective study. surgical confounders were minimized as only operations performed by a single surgeon were analyzed. secondly, renorrhaphy differed between the opn and minimally invasive cohorts along with the use of renal cooling in the opn group compared to warm ischemia time for the minimally invasive approaches. nephron sparing surgery has emerged as the optimal surgical approach for t1a and in experienced hands t1b kidney masses. by removing surgeon as a confounding variable, although not currently the gold standard for partial nephrectomy, robotic surgery continues to emerge as the future for renal surgery secondary. rpn offers less blood loss and fewer postoperative complications than opn and overcomes the technical difficulties of lpn.

objective. to report the perioperative outcomes of patients treated with partial nephrectomy by a single surgeon using three surgical modalities open, laparoscopic, and robotic. methods. between august 2006 and february 2012, 106 consecutive patients underwent open partial nephrectomy (opn) (n=23), laparoscopic partial nephrectomy (lpn) (n=48), and robotic partial nephrectomy (rpn) (n=35) by a single surgeon. clinical variables, operative parameters, and renal functional outcomes were analyzed. results. preoperative patient characteristics were similar except for baseline glomerular filtration rate (gfr), which was highest in the rpn group (p=0.004). surgery time was longest in the rpn group (244 minutes) and shortest in the opn group (163 minutes, p<0.0001). patients who had opn had the highest incidence of 30-day complications (30%), while the rpn approach had the lowest (14%, p=0.008). conclusions. when performed by a single surgeon, robotic partial nephrectomy appears to be associated with fewer complications than both open and laparoscopic partial nephrectomy. kidney function was not affected by surgical approach.

PMC4897561

pubmed-117

leishmania parasites are heteroxenous kinetoplastid protozoan organisms, which undergo complete differentiation upon a cycle of proliferation/differentiation in the midgut of phlebotomine sand flies followed by the transmission of infective metacyclic promastigotes [1, 2] to mammalian hosts during the insect blood meal. once infecting mammalian hosts, these organisms, from free-living protozoa, become obligate intracellular parasites, residing and proliferating inside phagolysosomes of mononuclear phagocytic cells as amastigote forms. in humans, leishmania parasites can cause a broad spectrum of clinical manifestations from mild, self-resolving skin diseases to potentially fatal, disseminated visceral diseases. the outcome of the infection is dependent on multiple, interdependent factors, such as vector species, parasite species and strain, genetic background, and immunological status of the host. there are two main groups of parasites, stratified upon the clinical outcome of the infection: the ones capable of causing tegumentar and the ones capable of causing visceral diseases. in both cases, disease is initiated by the bite of an infected sand fly, followed by the generation of a skin lesion, mainly caused by the inflammatory response induced on that site. in some cases the disease is confined to the skin or mucosal tissues, and is termed cutaneous (cl) or muco-cutaneous (mcl) leishmaniasis, respectively. in addition, diffuse cutaneous leishmaniasis (dcl) occurs when the parasite disseminates causing the appearance of multiple skin lesions, in distal sites relative to the transmission site. in a similar way, in visceral leishmaniasis, there is parasite dissemination through blood and lymphatic vessels from the initial lesion site. however, these parasites establish in organs that comprise important populations of mononuclear phagocytes, such as bone marrow, spleen, and liver. among the clinical manifestations observed in humans with the tegumentary disease, diffuse and mucocutaneous leishmaniasis most patients were found in the south and central america, associated with l. amazonensis infection for dcl and l. braziliensis infection for mcl. diffuse cutaneous leishmaniasis (dcl) is a rare clinical manifestation and is characterized by the appearance of several nonulcerated nodular skin lesions, uncontrolled parasite proliferation, an inefficient cellular immune response against parasite antigens, and resistance to most therapeutic strategies [5, 6]. the intense parasitism in the dcl lesions reflects the functional state of macrophages, which are considered permissive. the deficient macrophage activation in dcl hinders the elimination of leishmania resulting in a disorganized inflammatory process, unable to control the infection. the determinants of dcl are multifactorial and may be associated with both immunologic and genetic events of the patient and the pathogenic factors related to the parasite and vector. the participation of factors associated with the parasite has been shown by some authors although it is a point that still remains to be further explored. in this context, the exhibition of markers of apoptosis by the parasite could be a contributing factor during host-parasite interactions as a possible immunosuppressive mechanism of dcl. experimental infection models with leishmania parasites have been extensively used as a tool to study immune responses, especially regarding t-cell differentiation [8, 9]. this is due to the fact that inbred mice strains demonstrate specific patterns of susceptibility and resistance to the disease [9, 10] which correlate with the immune response built by these animals. the classical experimental model that generated this knowledge was infection with l. major parasites. c57bl/6 mice infected with this parasite develop a th1 cd4 t-cell response, which is highly effective to activate leishmanicidal and inflammatory mechanisms in macrophages, leading to intracellular parasite destruction. in this case, nevertheless, latent parasites remain in the infected tissue, providing antigens to maintain a protective immune response that prevent reinfections. on the other hand, balb/c mice infected with the same parasite species and strain developed a th2 cd4 t-cell response, which is not efficient to promote macrophage classical activation, leading to progressive disease. at the cellular level, this difference is mainly due to the activation of a population of cells that express a highly restricted t-cell receptor, v4 v8, which recognizes the lack (leishmania homologue of receptors for activated kinase) antigen and rapidly produces il-4, necessary to deviate the immune response towards th2. currently, it is clear that the proposed model of susceptibility and resistance to leishmania infection is quite reproducible when working with some specific strains of l. major though, for other strains and/or species, the picture is relatively more complex. indeed, effective macrophage activation is the key to control the infection; however, the phenotype displayed by t cells in different situations is not as polarized as observed in the classical model. actually, there are several papers that suggest that most correlations between cd4 t-cell response and disease development are not straightforward. balb/c il-4 receptor knock-out (ko) mice remained susceptible to l. major infection when infected with lv39 strain, which seems to be due to an increased production of il-10 by t cells. c57bl/6 mice infected with a l. major strain, isolated from a patient with nonhealing lesions, still developed a th1 response but displayed a progressive disease. in addition, when infected with the ir173 strain of l. major, cd4 t cells from both balb/c and the resistant mice strain b10.d2 produce il-4 very rapidly. other factors such as infection route, number of parasites inoculated, and type of infection (needle versus sand fly inoculation) are crucial to determine the type of response elicited (reviewed in). the complexity of the interactions that determines the clinical and immunological outcome of the disease is much less known, and apparently much more multifactorial in other infection systems, such as the ones that involve l. amazonensis infection. experimental infection with l. amazonensis parasites leads to progressive disease and uncontrolled lesion development in all inbred mouse strains, including those ones that are highly resistant to l. major infection. however, there is a gradient of disease severity, ranging from balb/c mice, which develop a very fast lesion, that ulcerate, generating extensive areas of necrotic tissue, to c3h.hen mice that still develop nonhealing lesions, however, displaying slow progression rates [16, 17]. nonetheless, the phenotype displayed by different mouse strains does not correlate with dichotomic th1/th2 responses. actually, in the analyzed mouse strains such as balb/c, c57bl/6, and c3h.hen, it was possible to observe cd4 t cells capable of producing different types of cytokines such as th2 cytokines (il-4, il-5, and il-13), th1 cytokines (ifn, and tnf), and regulatory cytokines (tgf and il-10), which characterizes an unpolarized cellular response [1820]. targeted deletion of the il4 or il10 gene [21, 22] causes minimal effects on lesion development and parasite tissue loads as well as treatment of infected mice with ifn or il-12. interestingly, l. amazonensis promastigotes and, especially amastigotes, are able to get through the innate immune response almost unnoticeable. as mentioned before, the main host cell for leishmania proliferation in the mammalian host is the macrophage, which is, together with dendritic cells (dcs), the main antigen presenting cells of the innate immune response. when compared to l. braziliensis parasites, for example, l. amazonensis parasites are much less capable of triggering the expression of cd40 and cd80, both costimulatory molecules for t-cell activation, and the production of il-12p40. actually, amastigote infection is able to downregulate the expression of mhc class ii molecules, which, during macrophage infection, is depending on sequestering these molecules inside the parasitophorous vacuole for degradation [26, 27]. during the first week of infection in c57bl/6 mice, chemokines such as ccl5, ccl3, ccl2, ccl4, and ccl11 as well as their receptors, are not upregulated when compared to l. major infection, both at the lesion site and draining lymph node. additionally, amastigote infection downregulates several intracellular pathways that lead to dc activation such as stat 1, stat 3 and erk 1/2 phosphorylation and the expression of the interferon-responsive elements irf8 and 1, suggesting a global inhibition of inflammatory responses of these cells. the most well-characterized ligand for amastigote recognition and internalization in macrophages is the opsonizing antibodies produced throughout infection. triggering of fc receptors on the host cells lead to il-10 production and has a pathogenic role. these events are necessary to evade the early immune response culminating with the ineffective t-cell response observed in most cases. in parallel to l. major infection in balb/c mice, where the oligoclonal v4 v8 cd4 t-cell population is necessary to the development of susceptibility in the host and is considered as pathogenic t cells, in l. amazonensis infection, t cells, in a general way, seem to be highly pathogenic. first of all, there is no clonal or oligoclonal t-cell population involved, since there is no predominance of a single or a group of v chains expressed on t cells that respond to l. amazonensis infection. however, the disruption of cd4 t cell effector functions, as observed in recombinase-activating gene ko mice (rag ko), mhc class ii transactivator ko mice (ciita ko) and nude mice leads to transient resistance to l. amazonensis infection, measured by lesion development. in addition, the adoptive transfer of regulatory t cells also restrains pathogenic effector t cells, diminishing lesion size and parasite tissue loads. the mechanisms underlying pathogenic role of t cells for the disease need to be determined. phosphatidylserine (ps) is a structural phospholipid present in virtually all membranes and cell types. in normal cells these molecules face the cytoplasmic leaflet of the plasma membrane, whereas during apoptotic cell death these molecules translocate to the outer surface. once outside the cell, ps becomes one of the ligands recognized by surrounding phagocytes to clear dying cells. ps is the most characterized tickling ligand of apoptotic cells, which means that ps provides the signals for the phagocyte to activate immunosuppressive and anti-inflammatory mechanisms. ps recognition is mandatory to prevent the establishment of a response to the self-antigens engulfed by these cells during apoptotic cell clearance and to avoid triggering inflammatory responses, especially during the embryogenesis, when massive amounts of apoptotic cells are generated and therefore, cleared [3537], but also in adults to prevent inflammatory immunopathologies. the intracellular events, receptors, and soluble factors involved in this mechanism are still being deciphered and are not the focus of this discussion. however, the effects of ps recognition in macrophages and dcs have a direct impact in immune responses. apoptotic cells actively induce the production of the anti-inflammatory cytokines tgf, pge2, and paf and actively inhibit the production of tnf and il-1, even upon lps challenge [35, 38]. recognition of apoptotic cells also decreases the expression of several activation markers and costimulatory molecules by both human and murine dcs [39, 40] and regulates the expression of cytokines involved with t-cell differentiation at the transcriptional level [41, 42]. at the single cell level, dcs that ingested an apoptotic cell and bacteria at the same time are able to discern between them and only present bacterial antigens this is possible because the generation of peptide-mhc class ii complexes is controlled by toll-like receptors (tlrs) in a strictly phagosome autonomous manner. since apoptotic cells do not trigger tlr activation, the generation of stable complexes is inhibited or abrogated. all these effects are fundamental to maintain homeostasis and comprehend the last step of the efferocytosis or apoptotic cell clearance. however, it seems that intracellular parasites elegantly make use of these mechanisms to establish in the host [4547]. furthermore, some parasites mimic the features of apoptotic cells to avoid host immune response, as discussed in the next section. one of the most common pcd phenotypes is phosphatidylserine (ps) exposure, which can be observed upon chemotherapy, starvation, and heat shock conditions in several unicellular organisms [4851] or is actively displayed in normal conditions. our group observed that lesion-derived amastigotes of l. amazonensis actively expose high levels of ps, and by blocking this molecule there is a drastic decrease in the ability of these parasites to infect and establish in the macrophages. these parasites are viable and capable of differentiating into promastigote forms in vitro (unpublished data) and inside the sand fly vector and to infect macrophages and mice [52, 54] and did not display other markers of pcd. ps exposure on amastigotes of l. amazonensis occurs in virtually 100% of the parasites; however, the amount of ps molecules depends on the infected host. parasites obtained from balb/c mice expose higher amounts of ps than the ones obtained from c57bl/6 mice. this observation demonstrates that the amount of ps at the surface of the amastigotes has a positive correlation with the severity of the disease and suggests that the host is able to modulate this phenotype of the parasite. following our description several other groups demonstrated the role of ps exposure and recognition in different infection models. blood and cell-derived trypomastigotes of trypanosoma cruzi are able to expose ps, in contrast with epimastigotes, which are not. in addition, infection with ps-exposing trypomastigote forms induces smad nuclear translocation and inducible nitric oxide synthase inhibition (inos), suggesting an autocrine modulation of the host cell dependent on tgf. it is interesting to note that, among all t. cruzi parasite stages, only the ones that are infective for mammalian cells evolve the ability to expose ps, suggesting the presence of an evolutionary link between ps exposure and the ability to infect host cells. similarly, toxoplasma gondii peritoneal tachyzoites expose ps at their surface, and the recognition of this molecule seems to be necessary to downmodulate inos expression and activity upon macrophage infection. more recently, several papers have demonstrated the role of exposed ps molecules for the infection by enveloped viral particles. for human immunodeficiency virus-1 (hiv-1), ps at the viral envelope is a cofactor for monocyte infection; in vaccinia virus infection, ps recognition modulates the activity of proteins involved in cytoskeleton reorganization such as p21-activated kinase (pak) and the small rho gtpase rac, leading to increased macropinocytic activity and uptake of viral particles. in addition, ps exposure by tumor cell, microvesicles shed by transformed cells, or endothelial cells in the intratumor environment seems to be involved in different events in tumor development, maintenance, and metastasis [59, 60]. this knowledge stimulated some researchers to evaluate the efficacy of anti-ps antibodies to treat viral and tumoral diseases. actually the results so far are promising. in murine models of lassa fever (pichinde virus) or murine cytomegaloviruses the treatment efficacy was very high, reaching complete cure (total absence of detectable viral loads) in combination with available antiaviral drugs. for experimental tumoral disease, lung cancer, pancreatic tumors, and glioblastomas were efficiently treated, decreasing tumor growth and metastasis in some cases or potentiating the effect of chemo- and radio-therapies [6264]. our group has been committed to study the role of ps exposure on the surface of different isolates of l. amazonensis. we worked with the hypothesis that l. amazonensis isolates from dcl patients would have higher ps exposure compared with localized cutaneous leishmaniasis (lcl), and this would contribute to macrophage deactivation, favoring parasite replication. for this, we compared ps exposure in l. amazonensis isolates from dcl clinical cases in the active phase of the disease, reported in maranho state in brazil, to those isolated from lcl patients of clinical cases from bahia. the results indicate that the isolates obtained from dcl patients indeed displayed more ps than isolates from lcl patients at early times postinfection. in addition, isolates from dcl patients were more infective than the ones obtained from lcl patients (frana-costa et al. the other hand, independent of parasite strain analyzed, the parameters of infectivity correlated positively with the exposure of ps in the parasites. these data suggest that in human infections the pattern observed in mice when comparing balb/c versus c57bl/6 mice is maintained. however, it is necessary to investigate the mechanisms by which the recognition of ps on the surface of the isolates of l. amazonensis deactivate the macrophage response. particularly, it would be necessary to evaluate whether freshly isolated parasites display this phenotype to validate our analysis made on amastigotes derived from macrophages infected in vitro with cultured promastigote parasites isolated from human lesions. we believe that understanding the dynamics of ps expression, along with identification of the mechanisms involved in the immunosuppression of dcl patients, can result in therapeutic targets for intervention in the immunopathogenesis of this chronic and severe form of leishmaniasis. in a similar way we are interested in the immunomodulatory mechanisms underlying ps exposure in different inbred mice strains. for that we are currently evaluating these mechanisms during balb/c infection, which induces high levels of ps exposure on intracellular amastigotes. we observed that ps exposure is intrinsic to the intracellular parasite and however, these levels are dramatically increased when infected macrophages are in the presence of previously primed t cells or their soluble products. we confirmed these results by infecting balb/c nude mice where we observed that the amastigotes obtained from these mice display minimal levels of ps, which are completely restored if we adoptively transfer primed cd4 t cells to nude mice (wanderley et al. interestingly, these data indicate that one possible role for the previously reported pathogenic t cells would be to induce ps exposure on intracellular amastigotes and, therefore, contributing to the generation of highly infective parasites. the t-cell-dependent ps exposure on amastigotes seems to be dependent on the induction of inos expression on host macrophages, and parasite survival is dependent on the concomitant induction of arginase 1 expression (wanderley et al. we propose that high levels of ps exposure are induced by parasite stress delivered by inos activity. in this case, it is still unknown whether ps exposure on amastigotes is indeed a phenotype triggered by pcd or a specific process involving modulation of ps translocation. under ps-inducting conditions, unpublished results), that is the enzyme necessary to produce ornithine, the precursor of polyamines. in this situation, polyamines could protect the parasite from the inos-dependent stress, stimulating parasite growth [66, 67] and increasing dna stabilization [68, 69]. we understand that the unique characteristics of the t-cell response to l. amazonensis infection contribute to the generation of a perfect environment to stimulate and maintain increased levels of ps on the surface of intracellular parasites. probably the balance observed in infected balb/c mice, when disrupted, leads to the differences observed among different mouse strains. in figure 1 we summarized our hypothesis regarding the t-cell-dependent modulation of ps exposure on intracellular amastigotes of l. amazonensis. the observation of ps exposure as a strategy to evade the immune system and persist in the mammalian host, made initially in the experimental model of l. amazonensis infection, was a breakthrough since it stimulated different groups around the world to look for the possibilities for basic and applied research on the field. our group is still studying the immunological, cellular, and molecular mechanisms underlying control of ps exposure in parasites and the effects of its recognition by parasitized cells and organisms. we believe that this could be a major strategy in different systems where avoidance from immune surveillance is necessary to establish a disease.

leishmania amazonensis parasites cause progressive disease in most inbred mouse strains and are associated with the development of diffuse cutaneous leishmaniasis in humans. the poor activation of an effective cellular response is correlated with the ability of these parasites to infect mononuclear phagocytic cells without triggering their activation or actively suppressing innate responses of these cells. here we discuss the possible role of phosphatidylserine exposure by these parasites as a main regulator of the mechanism underlying subversion of the immune system at different steps during the infection.

PMC3306939

pubmed-118

despite of presentation of medical ethics as a new science in academic teaching, the ethical concepts have been alongside the medicine, and its antiquity back to the medicine history. for instance, literatures such as hippocratic oath letter, liturgy of ibn maymun, and shirazi ethics ordinance are the old literatures in which the principles such as the necessity of patient preference defender on the physician and observing the principle of confidentiality have been emphasized. however, in the past literature using physician s commitment and pledge human being is a creature with physical, mental and spiritual dimensions which has rights during the health and illness. patient rights are the very expectations he has from the health care services and must encompass his physical, mental, spiritual and social needs which are manifested as criteria, standards, rules and laws (4, 5). emphasis on patient rights in the health care services particularly maintains patient dignity as a rank of a human, and is considered important especially when patient s vulnerability easily expose him to the violations and weaknesses of the health care system (6). considering that health is the most important existence aspect of every person and according to the article 29 of the constitution, providing health is the most important commitment of the government of islamic republic of iran; because of this, in 2002, for the first time the patients right charter was developed in iran and was notified by department of health, treatment and medical education (7). the patients right charter of iran was approved by health policy council with a new and comprehensive viewpoint aimed to clarify the rights of the health services recipients and observance of moral standards in the treatment and medical fields in november 26th, and in december 1st it was communicated to the relevant centers (1, 8, 9). in this charter patient satisfaction is considered as one of the characteristics of hospital effectiveness (9). today, the issues related to the quality of health care services, attention to the patients as customers and accomplishing their satisfaction are the main priorities and are of high importance. one of the important factors in patient satisfaction is regarding their demands and observing their rights and providing care along with respect (6). awareness of the patients rights and observing them accomplishes more satisfaction of the patient, physician and other medical team and hospital staff and will lead to the spread of good morals among patients and medical team; so eventually the moral status of all the individuals such as patients and medical team will be upgraded, but otherwise provided not observing these rights, it would lead to distrust to health care team. if there is no trust between medical staff and patients, it would lead to damages and losses for the patient and the medical team. furthermore, it would lead to terrible and unpleasant occurrences which are difficult to compensate and would be followed by the legal prosecution (5, 10). protecting the patient rights by the nurses only will be possible when they have gained necessary knowledge about it and suitable conditions be provided for respecting these rights (11). appropriate care and observing patient rights require nurses knowledge which would be possible through different ways such as side studies, retraining courses, and academic courses during education (5). in the studied researches about the nurses level of knowledge from patient rights, several aspects were mentioned. nasiriani et al (5) and houshmand et al (11) reported good nurses level of knowledge in yazd hospitals and teaching public wards of tehran hospitals respectively. observed moderate and parsinia et al obtained weak nurses knowledge in tehran and karaj hospitals respectively (10). the clinical researchers in different wards of teaching hospitals have reported that the patients rights have been ignored or have not been considered seriously due to shortage of nursing staff, high number of patients in the hospitals, psychological pressures and etc. taken together, we decided to evaluate the nurses knowledge about patients rights in one of the teaching hospitals of tehran city. this was a descriptive cross-sectional study in which the nurses knowledge about patient rights was determined. the study samples consisted of 156 nurses who have been selected randomly from one of the teaching hospitals of tehran. the data collection instrument was a two-part questionnaire; the first part included the demographic information (age, gender, marital status, work experience, educational level, etc.); the second part consisted of 10 questions according to the 10 section of patients rights charter of iran (11). this part determined the following areas about patient rights: right to receive essential information about health care providers, rate of tariff, target insurance coverage if sent to the other medical centers. right to receive respectful and quick treatment and care regardless of cultural and racial factors. right to know about the probable complications, treatment options and participate in the ultimate treatment choosing. right to make a decision about the presence of those who are not directly involved in the treatment process. right to announce personal satisfaction from ending the treatment and referring to other centers, and right to preserve privacy and being ensured about confidentiality of all of the medical information. the answers of the study subjects to the questions were quantified by measuring a three-score scale; good (3 scores), moderate (2 scores) and weak (1 scores). the maximum score in the questionnaire was 30 scores which were considered 2130 as high knowledge, 1020 as moderate knowledge and less than 10 as weak knowledge. the validity was done using content validity i.e. the questionnaire was given to 10 faculty members of universities of tehran and after collecting the comments, the relevant comments were applied. the validated questionnaire was given to 10 eligible study subjects for reliability and in both stages the questionnaire was completed with a 10-day interval and the required correlation of the first and second answers and confidence was obtained r=0.90 and finally these people were excluded from the study population. the questionnaires were completed during two weeks by direct referring of the researcher to the wards. in order to observe ethics, confidentiality and integrity, the mentioned questionnaires were anonymous and in all stages of the study the information were collected confidential and were kept by the researcher. the review of the demographic variables indicated that the majority of the nurses were females (76.28%) with mean age of 34.31 7.3. most of them (91.2%) had bachelor degree and were married (62.82%). in terms of employment and work experience, almost half of nurses (47.43%) were contractual, 46.79% had 610 years of work experiences, 30.99% never passed any course about patient rights and 30.99% of them had the simultaneous experience in public and private sectors. no association between the variables of gender, age, degree and marital status and nurses knowledge about patient rights was found. there was no significant difference between them in terms of work section, work experience and simultaneous work in the public and private sectors, however there was a significant difference between their level of knowledge about patient rights and simultaneous work in the public and private hospitals and work experience (table 1). the findings of the study about the nurses level of knowledge in different areas indicated that the highest level of knowledge (95.51%) was in the area of right to preserve privacy and being ensured about confidentiality of all medical information and the lowest level was right to receive essential information about health care providers, rate of tariff, target insurance coverage if sent to the other medical centers. observing patients rights is the most important ethical issue in a hospital which should absolutely be considered. regarding patients rights and respecting them are two main factors for patients care. observing patients rights means the accountability of all health care staff to the patients at the time of treatment and care giving (12,13). promoting patients rights is a multidimensional issue and in order to achieve it, comprehensive efforts should be done. world health organization has offered some strategies such as active participation of health care recipients and providers policy making and extending educational programs for health care providers and entire community (11). the findings of the study showed that nurses level of knowledge about patients rights in terms of the variables such as type of the hospital, work experience, degree, age and gender was good, moderate and weak in 58.33%, 39.10%, and 2.56% of them respectively. in the studies conducted in karaj hospitals (10) and the public wards of teaching hospitals of tehran (11) also the nurses level of knowledge reported as weak. today patients are more aware of their rights and physicians responsibilities and commitments and also hospitals managements regarding their rights (14) and they are more insisting on their principle rights (2). therefore it is highly needed that nurses with low level of knowledge, and the other health care providers be aware of patients right charter and increase their knowledge. determined the reasons of the nurses low level of knowledge as lack of institutionalization and regulation of the rights (12); lack of adequate time for studying and researching due to various obstacles such as poor economic conditions; lack of positive vision in selecting nursing profession; tough job conditions in the hospitals such as large number of the patients versus staff shortages, and lack of necessary facilities such as adequate and suitable libraries (5). the results indicated that there was a significant and direct association between level of knowledge and simultaneous jobs in the public and private hospitals (p=0.01) i.e. the nurses who provided services simultaneously in the public and private hospitals had higher level of knowledge. the reason might be due to regulations and rules which are performed more in the private hospitals compared to the public hospitals i.e. no implementation of patients right charter which may be followed by punishment. the findings of the present study indicated that in the area of right to preserve privacy and being ensured about confidentiality of all the medical information, the nurses had the highest level of knowledge. in the patients right charter codified in 2009 it says observance of the principle of confidentiality is necessary about all the information related to the patient except for the cases the law excluded (1). in a comparative study about the patients right charter in the selected countries with iran in 2007, it was indicated that regulations of iran for the right of the confidentiality of the patient information and medical records is similar to the other countries such as hungary, hong kong, new zealand, united states, south africa, european union and lithuania (14). unlike the above results, in canada it was indicated that 84% of the medical staff did not have enough knowledge about commitments and obligations of the law about confidentiality of the information and privacy of the patients information (15). our findings indicated that there was a direct and significant association between level of knowledge and work experience (p= 0.008) and the level of knowledge of the study subjects from patients rights charter was increased by increasing work experience which was in accordance with the studies of nasiriani et al. and in addition, the study indicated that there was no association between level of knowledge and degree and increasing degree had no effect on the level of knowledge. in a study in karaj it was mentioned that the level of knowledge of the technicians was higher in comparison with supervisors and matrons and the most important reasons were sense of job security, professional status and disregardness of matrons and supervisors to the important tasks (10). the findings indicated that nurses in the area of right to receive essential information about health care providers, rate of tariff, target insurance coverage if sent to the other medical centers had the lowest level of knowledge. the patients right charter codified in 2009 states that information must be given to the patient at the right time and appropriate condition by considering individual characteristics such as language, degree and perception; however the patient has the right to access all the information recorded in his/her clinical records (16, 17). in the patients right charter of some countries such as canada and united states unlike the other countries such as iran, hong kong, new zealand, africa, european union, lithuania, right to ask for explanation about the costs has been discussed (14). the results indicated that 66% of the nurses was aware of the right to access to the health care providers during hospitalization, instead of 90% of turkish nurses (17). nowadays ethical and legal concepts such as patient rights are included in the educational curriculum of greek and turkey (18, 19). according to the considerable gap between development and realization of the patient rights (20) and the increased knowledge, claims and demands of the patients and also the results of this study, in order to observe patients right the following solutions are suggested:-encouraging the nurses to consider patients right charter seriously.-establishing and empowering the sanction of patients right charter-more emphasizing on concepts of professional ethics and patient rights in teaching nursing students-attending expertise meetings with presence of beneficiaries for evaluating barriers and presenting strategies in order to implement the patients right charter as soon as possible-providing periodic educational programs for health care providers and patients about patient rights generally, since 41.6% of the nurses of the study had not a proper level of knowledge about patient rights and considering the fact that awareness and knowledge can be the base of nurses performance and also patients increasingly are getting informed about their rights, the implementation of patients right charter is highly recommended. holding educational programs, seminars, workshops and academic panels for nurses, and nursing students help overcome difficulties.

patients rights observance is one of the effective measures of patients satisfaction of health care services. we performed this study at the aim of evaluation of nurses awareness of patients rights in a teaching hospital in tehran.this cross-sectional study was conducted in 2010. in this study 156 nurses were randomly selected. two-part questionnaire was used for data collection. the validity and reliability of questionnaire was determined and then it was distributed between subjects. the data were analyzed by spss version 15 using descriptive and inferential statistics. our results showed that% 58.33,% 39.10 and% 2.56 of nurses have good, medium, and poor levels of awareness respectively. we observed a significant relationship between nurses awareness and work experience (p=0.008) and concurrent work in public and private hospitals (p=0.01). the most of the nurses (% 95.51) were aware of right to privacy protection and ensure confidentiality of information and the least of them (% 33.97) were aware of right to receiving necessary information about the health care providers, the rate of tariff and insurance coverage.according to our survey it is concluded that implementation of patients right charter in this hospital is accompanied by some limitations which necessitates promotion of the nurses awareness about patients rights. taken together in order to enhance nurses awareness special measures and strategies should be considered.

PMC3713951

pubmed-119

intensive insulin therapy using basal-bolus insulin regimen is the standard therapy for patients with type 1 diabetes mellitus. by mimicking the endogenous insulin secretion profile in healthy subjects, it has been shown to improve glycemic control and reduce the risk of long-term complications compared with conventional insulin therapy [1, 2]. unfortunately, many patients with type 1 diabetes can not achieve the target glycemic control, and insulin therapy leaves room for improvement. thus, the efficacy of basal insulin is especially important in this group of patients. importantly, in some type 1 diabetes patients with severe loss of endogenous insulin secretion capacity, once-daily injection of basal insulin does not always cover the basal effect of insulin over the 24-hour period [35]. in addition, the intraday and day-to-day variability in insulin agents could sometimes be an obstacle for optimized titration of insulin and a cause of increased frequency of hypoglycemia. given that increased frequency of injection and large fluctuations in blood glucose could be a burden in such patients, any improvement in the efficacy of basal insulin agents should be appreciated. insulin degludec is a new ultra-long-acting basal insulin that forms soluble multihexamers at the subcutaneous injection site from which insulin monomers are slowly and continuously absorbed into the circulation, leading to a peakless action profile over 42 hours. consistent with this pharmacological action, begin basal-bolus type 1 trial showed that the rate of nocturnal-confirmed hypoglycemia was 25% lower with insulin degludec than with insulin glargine. in addition, it was reported that the day-to-day variability in plasma glucose in type 1 diabetes patients treated with insulin degludec was lower compared to insulin glargine. taking these unique actions of insulin degludec into consideration, switching from twice-daily injections of basal insulin to once-daily injection of insulin degludec could provide great benefit to patients with type 1 diabetes. in this study, to evaluate the efficacy of insulin degludec as a basal insulin for basal-bolus regimen for japanese patients with type 1 diabetes mellitus who are treated with twice-daily basal insulin injection therapy, we investigated glycemic control, daily, and day-to-day variability in plasma glucose using continuous glucose monitoring before and after switching to once-daily insulin degludec injection in 22 patients with type 1 diabetes. we recruited 24 eligible japanese patients (8 males and 16 females) with type 1 diabetes who visited the outpatient clinic of juntendo university hospital between july 2013 and january 2014. patients who satisfied the following conditions were included: (1) treated with basal-bolus insulin regimen with twice-daily injections by insulin glargine or detemir and (2) aged more than 20 and less than 80 years. also, patients were excluded if they (1) had serious liver disease (ast and/or alt>100 iu/l), (2) had serious kidney disease (serum creatinine>2.0 mg/dl), (3) had untreated severe diabetic retinopathy, (4) had adrenal or pituitary insufficiency, (5) had other conditions considered by the attending physician to be contraindicated to inclusion in the study, or (6) were pregnant or breastfeeding women. this trial was conducted in accordance with the declaration of helsinki, and the protocol was approved by the human ethics committee of juntendo university. all patients provided a written informed consent prior to trial initiation. in this prospective, single-center, single-arm, open-label, 12-week study, we compared the effects of switching from twice-daily basal insulin to once-daily insulin degludec on glycemic control, daily, and day-to-day variability in plasma glucose. figure 1 shows the patient enrolment process. at baseline before switching, the following laboratory tests were performed in each patient: fasting plasma glucose (fpg), plasma c-peptide, hba1c, and glycosylated albumin. plasma c-peptide assay was performed using ultrasensitive c-peptide elisa kit (mercodia, uppsala, sweden) for precise determination of intrinsic basal insulin level. then, cgm and 7-point self-measured blood glucose (smbg) profiles (before and 2 hours after meals and bedtime) were obtained. after that, the patient was switched from twice-daily basal insulin to once-daily insulin degludec, which involved 10% reduction in insulin dosage without any change in the rapid acting insulin therapy. insulin degludec was administered once-daily at bedtime. at 4 weeks after switching, the same fasting laboratory tests, cgm and 7-point smbg, were repeated. after 4 weeks, the basal insulin dose was adjusted for each individual patient based on self-measured fbg levels taken before breakfast. the dose of insulin degludec was decreased by 1 unit if fbg was 80 mg/dl over three consecutive days just before the hospital visit. then, the increase of the dose of basal insulin or titration of rapid acting insulin was performed by the judgement of each physician in charge. at the end of the study (12 weeks), the same laboratory tests (fpg, hba1c, and glycosylated albumin) were repeated again. cgm data were obtained by using the ipro2 (medtronic; northridge, ca). patients were required to use cgm for six consecutive days. over each cgm occasion, at least 288/day cgm glucose values were to be recorded. as an index of day-to-day variability, the mean of daily difference (modd) was calculated from the absolute difference between paired cgm values during two successive days (days 2 to 3 and days 4 to 5), and the data were presented as the average of the two values. the patient was asked to record 7-point smbg profiles for one day during cgm for before and 2 hr after meals and at bedtime. the primary outcome of the study was change in hba1c before and 12 weeks after switching. the secondary outcomes based on cgm values were (1) changes in standard deviation (sd) and modd. safety variables included the frequencies of severe hypoglycemia, which was defined as low blood glucose level requiring assistance from another person to treat, nocturnal hypoglycemia, and adverse events. confirmed hypoglycemia was defined as a glucose value of less than 70 mg/dl by cgm and was reported in percentage (= times<70 mg/dl/total time of measurement). hypoglycemic episodes occurring between 0:00 and 5:59 hours were classified as nighttime while daytime episodes occurred between 6:00 and 23:59. data were expressed as mean sd. the mann-whitney u test was used for analysis of cgm data before and 4 weeks after switching and, for analysis of fpg, hba1c and glycosylated albumin before and 12 weeks after switching were used. all statistical analyses were conducted using statview statistical software package, version 5.0 (sas institute inc., cary, nc). two patients withdrew from the study after the first treatment period; one decided to withdraw during the conduct of the study and the other did not visit the outpatient clinic. the mean age and duration of type 1 diabetes mellitus were 54.8 14.5 and 14.6 9.0 years, respectively. fasting plasma c-peptide was below the detection limit of the ultrasensitive c-peptide elisa kit in 18 patients (81%), indicating severely low insulin secretion in most subjects. as shown in table 2, hba1c levels at baseline and 4 and 8 weeks after switching to insulin degludec were 8.5 1.4%, 8.6 1.6%, and 8.7 1.6%, respectively. glycosylated albumin levels before and 4 and 8 weeks after switching were 24.9 5.0%, 25.3 5.2%, and 24.7 3.6%, respectively. furthermore, fasting blood glucose levels were 203.2 81.2 mg/dl, 165.5 82.1 mg/dl, and 206.5 122.4 mg/dl, respectively. based on these data, it is clear that switching to insulin degludec did not improve glycemic control throughout the study. the mean basal insulin and total daily doses at 12 weeks after switching to insulin degludec were significantly reduced compared to the baseline (15.2 7.6 versus 11.6 6.9 u, p<0.01, and 40.0 17.3 versus 37.9 16.7 u, p<0.01, resp.) whereas the bolus insulin dose did not significantly change after switching. table 3 summarizes fluctuations in glucose level and the frequency of hypoglycemia recorded by cgm over 4 days before and after switching. the averages of blood glucose and standard deviation (sd) through the daytime (0:0023:59) were 184.1 45.8 versus 189.6 52.7 mg/dl and 68.4 14.5 versus 66.5 17.1 mg/dl, respectively. furthermore, the modd was 72.1 16.0 versus 74.0 23.0 mg/dl and the frequency of hypoglycemia below 70 mg/dl was 6.1 8.0 versus 6.5 9.7%, respectively. table 3 also shows fluctuations in glucose level and the frequency of hypoglycemic episodes recorded by cgm during the nighttime (0:005:59). the averages of blood glucose before and after switching were 156.5 63.7 versus 174.6 58.5 mg/dl during the nighttime. the sd during nighttime did not change significantly (before: 22.6 10.9, after: 24.8 10.7 mg/dl). modd tended to increase during the nighttime both at baseline and after switching, however; these changes were not significantly different. the frequency of hypoglycemic glucose (below 70 mg/dl) was 14.4 17.0 versus 11.1 15.0% during the nighttime, before and after switching. thus, the frequency of nocturnal hypoglycemia did not change significantly after switching, similar to other parameters, and no severe hypoglycemia was recorded during the study period. blood glucose level at 2 hours after lunch was significantly low before and after switching (207.6 87.7 versus 158.2 90.3 mg/dl, p<0.01). the present study investigated the efficacy and safety of switching from twice-daily basal insulin injections to once-daily insulin degludec injection in japanese patients with type 1 diabetes. however, some patients with extremely low insulin secretion capacity often need to use twice-daily basal insulin because the duration of action of insulin detemir is about 16 hours and that of insulin glargine does not last up to 24 hours [4, 12]. a few studies from japan have already investigated the outcome of switching from once-daily or twice-daily basal insulin to once-daily insulin degludec in patients with type 1 diabetes [1315]. specifically, these studies investigated the effects of switching to insulin degludec in type 1 diabetes patients who were being treated with a combination of once- or twice-daily injections of insulin glargine or detemir, though there are no studies that focused on type 1 diabetes patients treated only with twice-daily basal insulin. the basal insulin levels were very low in our patients and the level could not be detected in most patients even by using high-sensitivity c-peptide kits with detection limit of<0.015 ng/ml. therefore, the selection of twice-daily basal insulin injections in our study seems reasonable to achieve better glycemic control. insulin degludec, an ultra-long-acting basal insulin, became available in japan in 2013, ahead of other countries, and is known to have longer duration of action (over 42 hours) compared with insulin glargine and detemir. therefore, it is clinically worthy to investigate the efficacy and safety of switching from twice-daily insulin glargine or detemir to once-daily insulin degludec in type 1 diabetes patients with severely reduced insulin secretion. the results showed no significant changes in various parameters of glycemic control, such as fasting plasma glucose, hba1c, and glycosylated albumin, after switching to insulin degludec despite about 20% reduction in basal insulin dose at 12 weeks, indicating that insulin degludec has longer duration of action and a more potent glucose-lowering effect than insulin glargine or insulin detemir. the frequency of hypoglycemic episodes recorded by cgm did not increase at 4 weeks after switching to insulin degludec. in our study protocol, the bolus insulin dose was not changed before and after cgm recording because the effect of bolus insulin on glycemic control needed to be minimized. according to a previous report by the begin basal-bolus type 1 trial investigators, the mean doses of basal and premeal bolus insulin were significantly decreased by 14% and 10% in the insulin degludec group compared with the insulin glargine group at the end of the trial, leading to similar rate of overall hypoglycemia between insulin glargine and degludec groups. therefore, in daily clinical practice, adjustment of the premeal bolus insulin dose also needs be considered when switching to insulin degludec. the smbg data in our study showed that postlunch blood glucose level was significantly lower after switching to insulin degludec injected at bedtime, suggesting that the peak action of insulin degludec occurs 14-15 hours after injection. consistent with this finding, another study showed that the trough blood glucose was recorded at daytime when insulin degludec was injected at bedtime. in addition, one review showed that the peak of the glucose-lowering effect of insulin degludec appeared about 12 hours after injection. in addition to the longer duration of action of basal insulin, its effects on daily and day-to-day variability of plasma glucose should be noted. reported that the use of insulin degludec resulted in lower day-to-day variability in blood glucose compared to insulin glargine in type 1 diabetes patients. however, different from this study, our results showed that switching to insulin degludec did not reduce modd, an index of plasma glucose day-to-day variation, which was consistent with a previous study in japan [13, 14]. heise et al. examined the glucose fluctuation by the glucose clamp method after very long fasting, which was not different from our method by cgm. therefore, the inconsistency might be due to differences between experimental and real-world study. our study extended over a short period of time and included a limited sample size. in addition, the carry-over effect of hba1c could not be completely excluded because our study was not a randomized controlled trial. therefore, a crossover trial or randomized controlled trial of a larger sample size is needed in the future. in conclusion, our study demonstrated that glycemic control 12 weeks after switching to once-daily insulin degludec injection with 20% dose reduction was comparable to that in patients treated with twice-daily injection of basal insulin injections and that such switching did not change the frequency of nocturnal hypoglycemia recorded by cgm.

the aim of this study was to investigate the efficacy of insulin degludec used for basal-bolus insulin regimen after switching from twice-daily basal insulin in japanese patients with type 1 diabetes mellitus. the subjects were 22 type 1 diabetes patients treated with basal-bolus insulin regimen with twice-daily basal insulin. basal insulin was switched to once-daily injection of insulin degludec with 10% dose reduction. hba1c and fasting plasma glucose (fpg) were measured before and 12 weeks after switching. the frequency of hypoglycemic episodes, standard deviation (sd) of blood glucose, and mean of daily difference (modd) were evaluated by continuous glucose monitoring (cgm) before and 4 weeks after switching. hba1c and fpg before and 12 weeks after switching were comparable (hba1c 8.5 1.4 versus 8.7 1.6%, p=0.28; fpg 203.2 81.2 versus 206.5 122.4 mg/dl, p=0.91). the frequency of hypoglycemia during nighttime was not significantly different at 4 weeks after switching (14.4 17.0 versus 11.1 15.0%, p=0.45). in addition, sd and modd before and 4 weeks after switching were also comparable. in conclusion, glycemic control under once-daily insulin degludec injection was almost comparable to that under twice-daily basal insulin injections in japanese type 1 diabetes patients. this study was registered with i d: umin000010474.

PMC4576138

pubmed-120

fibrodysplasia ossificans progressiva (fop) is a rare genetic disoder characterized by bone formation within muscles tendons and ligaments. we hereby report a case of fop in a four year male child from a tribal family in orissa. 4 yr old male child presented with gradual development of stiffness of neck and hard nodules on his body for which his parents had sought all sort of indegenous treatment and manipulations by traditional bone setters. patient returned to our hospital at the age of four years with widespread ossification and stiffness of neck, shoulders and back. he also had upper tibial osteochondromas and scalp nodules and valgus deformity of bilateral great toes. though rare, diagnosis of myositis ossificans progressiva should be considered in a child with heterotopic bone formation and valgus deformities of great toes. being a rare condition, treatment guidelines are not clear and this condition need further research. fibrodysplasia ossificans progressiva (fop) is also known as myositis ossificans progressiva, stone man disease, munchmeyer s disease. fop is an extremely rare and most crippling form of heterotopic ossification in humans with an incidence of 1 in 2 millions. kitterman et al reported that it takes atleast six physician evaluations to reach the diagnosis and 90% of these individuals will have received some wrong or hazardous treatment before appropriate diagnosis. we hereby report a case of fop in a 4 year old boy coming from tribal family in orissa. the diagnosis of this patient was delayed due as the parents tried all sorts of indigenous medications and even manipulations by traditional bonesetters whose influence has been deep rooted in minds of the tribal population in this part of the country. our patients was a four year old boy who presented with chief complains of stiffness of neck, decreased movements in bilateral shoulders and had bony hard swellings in his back., his parents noticed that he had stiffness of neck and had developed nodules at his scalp, which gradually subsided without any treatment. coming from a tribal background, parents consulted many indigenous medicine practitioners and child was subjected to repeated manipulations of the neck by traditional bone setters. these swellings hardened over a period of few days and the child developed stiffness of spine. he was subjected to further manipulations and gradually developed stiffness of bilateral shoulders and left elbow. on examination, the patient had bony hard swellings in cervico-thoraco-lumbar spine, bilateral axillae and left elbow and left 3rd costochondral junction along with hypoplasia and valgus deformity of great toes (fig. a frontal view of the patient showing ankylosis of bilateral shoulders and left elbow with bony swelling at left 3rd costo chondral junction. radiographs revealed hallux valgus and hypoplasia of proximal phalanges of great toes with short widened first metacarpals bilaterally (fig. 2b, c) extensive ossification overlying both side of the neck and in the para vertebral tissues in dorsolumbar area (fig. diagnosis of fop was made in basis of all these radiological and clinical findings radiological findings. a- bilateral hallux valgus and hypoplastic proximal phalynx of great toe with short and widened first metatarsal. our case once again highlights the deleterious effects of trauma in the form of manipulations and massage that can aggravate the ossification process in case of fop. trauma as trivial as intramuscular injections, mandibular block during dental procedures, muscle fatigue, muscle trauma due to bumps, falls and influenza like illness can aggravate the process of heterotopic ossification in these patients. a sporadic mutation in the gene encoding bone morphogenetic protein (bmp) activin receptor type ia/activin-like kinase 2 (acvr1/alk2) located on chromosome 2q23-24 region has been identified as the main genetic abnormality in fop. recently, additional mutations have been identified in the gs-domain and kinase domain of acvr1 in individuals with a typical forms of fop. inheritance is in autosomal dominant manner but less than 10 cases of familial transmission have been reported. in vitro experiments with use of cells derived from patients with fibrodysplasia ossificans progressiva show a markedly attenuated response of noggin (bmp-4 antagonist) expression to bmp4 stimulation. an inadequate bmp-antagonist response following soft-tissue trauma would permit the rapid expansion of a bmp4 morphogenetic gradient in a patient with fibrodysplasia ossificans progressiva and could explain the explosive bone induction seen during flare-ups. a new research by quen et al interpreted that in addition to the above, the mutation also induces chondrogenesis by signaling in a bmp independent and bmp responsive manner. this mutation may also sensitize mesenchymal cells to bmp-induced osteoblast differentiation, and stimulates new bone formation. individuals with fop are normal at birth except for having valgus deformity of great toes. heterotopic ossification is heralded by the rapid appearance of large painful swellings of highly vascular fibro-proliferative tissue involving tendons, ligaments, fascia, and skeletal muscle. these preosseous swellings progress along a pathway of endochondral ossification to form mature heterotopic bone. typically, the dorsal, axial, cranial, and proximal regions of the body are involved early, and the ventral, appendicular, caudal, and distal regions are involved later. several skeletal muscles including the diaphragm, tongue, and extra-ocular muscles are spared from fop. cardiac muscle and smooth muscle histological examination of early fop lesions reveals an intense perivascular lymphocytic infiltrate followed by lymphocyte-associated death of skeletal muscle and robust development of fibro proliferative tissue with extensive neovascularity and mast cell infiltration. tissues from fop lesions at later stages of maturation exhibit characteristic features of endochondral ossification that support ectopic hematopoiesis. definitive genetic testing for fop is now available however is not essential for diagnosis which is purely clinical. this condition needs to be differentiated from progressive osseous hyperplasia (poh), which presents with heterotopic ossification. poh is distinguished from fop by the absence of congenital skeletal malformations, the absence of predictable regional patterns of heterotopic ossification, the pre- dominance of intramembranous rather than endochondral ossification, and the presence of heterotopic ossification in skin and subcutaneous fat piram et al noted 40% incidence of scalp nodules in patients of fop in their retrospective study on 43 patients. deirmengian et al reported 90% incidence of upper tibial osteochondromas in a study on 96 patients. our case had this particular finding and cases with combined heterotrophic ossifications with osteochondromas should be considered for this diagnosis. based on these typical and commonly found characteristics, mutlu et the great toe malformations along with rapidly developing and waxing/waning soft tissue lesions over head, neck and upper back are characteristics for fop. kaplan et al commented that failure to make such association is the commonest cause of misdiagnosis of fop. misdiagnosis may lead to inadvertent managements like manipulations, biopsies and surgery. as in our case, these strategies just help the disease to flare and make the life of patient much difficult. kitterman et al reported incidence of misdiagnosis to be>90%, with 68% receiving inappropriate treatment which lead to permanent disability in about 50% of cases. early diagnosis and high index of suspicion will not only prevent the itrogenic harm but may also slow the disease progress and avoid rapid and early deterioration in patients quality of life. in our case, this lead to rapid progression of disease in our case with early development of deformities. short course of steroids are used in during acute flare-ups in large joints and submandibular area. other drugs tried are nsaids and cox-2 inhibitors, bisphonates like etidronate and pamindronate, rosiglitazones, mast cell inhibitors, retinoic receptor agonists etc [15, 16]. however a statement made by julius rosenstirn in 1918 still holds true: the disease was attacked with all sorts of remedies and alternatives for faulty metabolism; every one of them with more or less marked success observed solely by its original author but pronounced a complete failure by every other follower. in many cases, the symptoms of the disease disappear often spontaneously, so the therapeutic effect (of any treatment) should not be unreservedly endorsed. the rare incidence of this disease and unpredictable nature of flare-ups makes it difficult to formulate an ideal treatment for it. kaplan et al reported that bone marrow transplant for replacement of hematopoietic cells was not sufficient to prevent ectopic skeletogenesis in the patient with fibrodysplasia ossificans progressiva but pharmacologic suppression of the apparently normal donor immune system following transplantation in the new host modulated the activity of the fibrodysplasia ossificans progressiva and diminished the expression of skeletal ectopia. glaser et al reported bmp4-induced heterotopic ossification can be prevented in vivo either by local delivery of wild-type noggin or after somatic cell gene transfer of a noggin mutein in murine model of fop. recently, dorsomorphin has been identified as a powerful orally-available signal transduction inhibitor of bmp signaling and preliminary data suggest that this category of stis may play a powerful role in inhibiting heterotopic ossification in animal models but its safety and efficacy in animal models of fop is still to be determined. although the rate of disease progression is variable, most patients are confined to a wheel- chair by their early twenties and require lifelong assistance with activities of daily living. patients with fop usually succumb later in adulthood at mean age of 40 years to cardiopulmonary complications secondary to thoracic insufficiency syndrome and severe restrictive pulmonary disease due to ossification and ankylosis of the joints of thoracic cage. thus in conclusion clinical suspicion, early diagnosis and expectant treatment are the main management strategy in cases with fop. fop demands further research to treat individuals suffering from this dreaded form of heterotopic ossification. valgus deformity of great toes and neck stiffness are important pointers towards diagnosis of fop and this condition needs further research to find an effective treatment modality for it

introduction: fibrodysplasia ossificans progressiva (fop) is a rare genetic disoder characterized by bone formation within muscles tendons and ligaments. it has an incidence of one in two million. we hereby report a case of fop in a four year male child from a tribal family in orissa. case report:4 yr old male child presented with gradual development of stiffness of neck and hard nodules on his body for which his parents had sought all sort of indegenous treatment and manipulations by traditional bone setters. patient returned to our hospital at the age of four years with widespread ossification and stiffness of neck, shoulders and back. he also had upper tibial osteochondromas and scalp nodules and valgus deformity of bilateral great toes. a diagnosis of fop was made on clinical and radiological examination. conclusion:though rare, diagnosis of myositis ossificans progressiva should be considered in a child with heterotopic bone formation and valgus deformities of great toes. being a rare condition, treatment guidelines are not clear and this condition need further research.

PMC4719173

pubmed-121

delivery of exogenous nucleic acids such as dna into cells (transfection) holds great promise for disease prevention and therapy (aka: gene therapy).(1) genetic material delivered into the cell modifies the function of such cells generally by altering the production of proteins. the selection of appropriate dna carriers is a common problem for gene therapy, and better gene delivery agents are still being sought. viral vectors (such as retroviral, lentiviral, adenoviral) and nonviral vectors (such as liposomal and polymeric) have both been used as gene delivery agents in the past. although viral vectors are efficient carriers due to their natural ability to penetrate cells, they have also often been shown to provoke undesirable immune responses, thus limiting their usefulness.(2) nonviral vectors often prove less immunogenic, but improvement is needed to increase their overall transfection efficiency. to increase such efficiency, effort should be directed at increasing the vector s ability to promote efficient dna condensation, intracellular transport, and sustained gene expression. additionally, the cytocompatibility of nonviral vectors must be well understood before they can be further optimized and become a viable option for gene therapy. fullerene (c60) derivatives have been extensively studied for a variety of medical applications(8) including their use as neuroprotective agents,(9) hiv-1 protease inhibitors,(10) bone-disorder therapy agents,(11) x-ray contrast agents,(12) and slow-release agents for drug delivery.(13) recently, c60-based reagents have also been examined as dna transfection vectors and tested for the ability to mediate gene transfer. these first generation c60-based transfection vectors have shown promise, but a few have also exhibited high cytotoxicity.(16) as many of the c60 derivatives previously described in the literature have only been slightly soluble in aqueous solutions, it has also been suggested that one possible reason for such observed cytotoxicity was due to the use of organic solvents that were necessary to dissolve those first generation c60-based transfection agents. thus, the search for new materials and enhanced protocols are key objectives in the continuing development of c60-based transfection vectors, including the design, construction, and testing of new reagents that are water soluble and able to effect enhanced gene delivery without promoting significant cytotoxicity. herein we report transfection efficiencies, cytotoxicity profiles, and biophysical structure/activity studies for a new class of water-soluble c60 vectors prepared using the hirschbingel reaction which is one of the simplest, highest-yielding, and most versatile c60 functionalization methods known. as shown in figure 1, the structurally derivatized c60 vectors reported herein were synthesized to yield either positively charged, negatively charged, or neutral chemical structures when solvated under physiological conditions. these vectors, which have been analyzed for their ability to promote dna transfection, offer the opportunity to elucidate the roles that hydrophobicity (due to the fullerene core), hydrophilicity (due to the water soluble substituents), and overall charge state displayed by the c60 derivatives have on dna transfection, gene expression, and cytotoxicity. depiction of the structures of the derivatized c60 vectors; the positively charged amino-c60 compounds (iiv), the neutral serinolamide-c60 compound (v), and the negatively charged c3-c60 compound (vi) (chemical structures depicted at neutral ph in aqueous solution; counterions in solution not shown). materials for culturing cells, including dulbecco s modified eagle s medium (dmem), trypsin, and phosphate buffer saline (pbs), were obtained from gibco (gibco life, grand island, ny). complete osteogenic medium containing minimum essential medium (mem), 10 mm -glycerophosphate, 50 g/ml ascorbic acid, and 10 vol% fetal bovine serum was obtained from gemini bio-products (calabasas, ca). a plasmid dna (7.2 kbp) containing the gene for a red-shifted wavelength variant of the enhanced green fluorescent protein (egfp) under the transcriptional control of the cytomegalovirus (cmv) immediate-early gene promoter was used as the dna construct from which reporter gene expression was measured in the transfection assays. plasmid dna was prepared in bulk from transformed bacterial sources and purified to homogeneity using commercial kits (qiagen; germantown, md) employing anion-exchange chromatography. the amino-c60 adducts (iiv), the seri-c60 adduct (v), and the c3-c60 adduct (vi) were synthesized and characterized according to previously published procedures. stock solutions of individual compounds ivi were prepared by weight and filtered for sterilization using a cellulose acetate membrane filter (0.2 m pore diameter) prior to use in forming transfection mixtures. standard solutions were prepared at a concentration 10 g/l for each of these compounds in both tris edta (te) solution (10 mm tris, 1 mm edta, ph=7.4), and in serum-free dmem in separate reaction vials. nih 3t3 mouse fibroblast cells (atcc #crl-1658) and hek 293 cells (human embryonic kidney; atcc #crl-1573) were cultured in dmem containing 10% fbs in a 5% co2 atmosphere at 37 c prior to collection and plating in individual assay wells used for transfection studies. for subculture of cells, routinely on reaching 80% confluence, the cells were washed with pbs, detached using trypsin-edta, harvested by centrifugation, resuspended in culture medium and counted in a coulter counter prior to plating in multiwell dishes for subsequent transfection assays. marrow stromal cells (mscs) were harvested from wistar rats as previously described.(24) mscs were cultured for 6 days in the presence of 10 m dexamethasone in complete osteogenic media before use in transfection studies and cultured under identical environmental conditions to 3t3 and hek 293 cells. mixtures of individual derivatized c60 vector material and plasmid dna were allowed to form a complex in serum-free dmem, as described below, prior to adding to cells in the transfection assays. each c60-vector solution was added dropwise to a solution of plasmid dna to obtain a final volume of 200 l. each resulting solution was then vortexed briefly and allowed to stand for 30 min at room temperature to allow complete assembly of the vector/dna complex, which was then used immediately in the transfection experiment. the final dna mass of each solution remained constant at 10 g while the concentration of the c60 derivative was varied to obtain a range of c60-reagent-to-dna-base-pair (bp) ratios (defined here as the value of dna mass was fixed at 10 g per well since it showed the most optimum transfection among different dna masses used (112 g) for transfection at r=16.8. transfections of nih 3t3 cells were carried out with c60/dna complexes in a range of r values (0.4242). for hek 293 cells and mscs, transfections were performed only at r=4.2 and r=16.8. cells were plated at 40,000 cells/cm in 96 well tissue culture plates and incubated overnight to permit cell attachment to the well surface. the culture medium was then replaced by the serum-free transfection mixture for various time periods (2 h, 8 h, 24 or 48 h) (transfection time). after exposing the cells for the respective periods of time to the serum-free transfection mixture, the cells were washed with pbs and the medium was replaced with complete medium (containing fbs). the cells were then further incubated for 8 h, 24 or 48 h (incubation time) before gfp fluorescence was measured using a flow cytometer. for comparative purposes, control cell populations were also transfected with plasmid dna alone (no c60 vector), or with plasmid dna complexed with an optimal level of one of two commercially available transfection reagents; such that the dna was complexed with either 25 kda polyethylenimine (pei), or with cytopure transfection reagent, which is reported by the manufacturer to exhibit very low levels of cytotoxicity. the dna/pei complexes were assembled using a well-established protocol(25) and the cytopure/dna complexes were assembled as per the manufacturer s instructions and optimized to obtain an optimal level of dna transfection/gfp expression within the nih 3t3 cell type. below is a brief description of the conditions which gave the optimal level of transfected nih 3t3 cells using 25 kda pei and cytopure. for pei, dna/polymer complexes were prepared in serum-free dmem to achieve a ratio of polymer to dna of 4. the complexes (100 l) were then incubated at 25 c for 1015 min and then added to cell wells that contained 100 l of serum-free dmem. for cytopure, 1.1 l of cytopure stock was diluted to 50 l with serum-free dmem. the cytopure mixture was then added slowly to 1 g of dna diluted to 50 l with serum-free dmem. the transfection mixture was vortexed, left standing for 15 min at room temperature and added to cell wells that contained 100 l of serum-free dmem. after 24 h of transfection, the cells were washed and the medium was replaced with the serum-containing medium. for purposes of this study, transfection as described herein also relates to cell viability for sufficient time to ensure gfp gene expression, which was determined by cell fluorescence levels above a defined background threshold level (determined using nontransfected cells to set lower detection limit parameter) with flow cytometry. cells were prepared for flow cytometry by trypsinization after being washed with sterile pbs to remove cell debris and any residual gene-delivery agents. cells that were transfected successfully expressed gfp protein and were detected at 470/515 nm (excitation/emission) by the flow cytometer. transfection efficiency has been determined as the percent of cells that express gfp per study sample relative to the total number of cells passing through the flow cytometer per study sample (10,000 events counted for each transfection sample).(25) the c60/dna complex solutions were prepared as described above. c60 vector solutions without dna (010 g/l) were prepared by diluting the c60 stock solution with serum-free dmem. the concentration of cultured cells was determined prior to cell plating using a coulter counter and the cells were plated on 96 well clear-bottom plates at a density of 40,000 cells/cm. after incubating overnight to allow cell attachment, the medium in each well was replaced either with 200 l of the c60 vector alone or with c60 vector/dna solutions prepared as described above. the cells were exposed to the solutions for either 2, 8 or 24 h before the cytotoxicity was determined. control cell samples were plated and grown under identical conditions as those described for treated cell samples, with the exception that neither c60 compounds nor transfection mixtures were added to the control cells. the live/dead viability/cytotoxicity assay (molecular probes, eugene, or) was used to determine cytotoxicity levels in cells treated with either c60-vector or c60-vector/dna solutions. this assay makes use of 2 different fluorescent dyes, calcein am and ethidium homodimer (ethd-1), to measure the number of live and dead cells respectively. the lipid permeable dye, calcein am, when taken up by living cells with intact plasma membranes, emits green fluorescence (excitation/emission: 495/515 nm) upon being cleaved by esterase enzymes in the cells. conversely, the ethd-1 dye emits red fluorescence (excitation/emission: 528/617 nm) on binding to nucleic acids released from dead cells, and is excluded by the intact cell membranes of viable cells. this assay was preferred over the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (mtt) assay for evaluation of cell viability because c60-vectors compounds i and ii interacted and attached to the mtt-formazan making the formazan crystals insoluble for the next colorimetric assay. similar effects have been reported for single-walled carbon nanotubes.(26) the reagents were prepared and added to the wells according to the manufacturer s guidelines. at the time points indicated, the media from the wells was aspirated and replaced with the live/dead reagent, after washing the cells with pbs. the plates were then incubated in the dark at room temperature for additional 30 min before being measured for fluorescence. fluorescence of each sample well was measured by using a fluorescent microplate reader (tecan safire). fluorescence of each sample well was normalized to percent of both live (no c60 compounds or transfection mixtures treatment condition) and dead (70% methanol treated) control cell groups. these normalized fractions are defined as the fraction of live and dead cells, respectively, in each of the c60-treated samples. since gfp fluorescence has excitation/emission wavelengths of 470/515 nm, close to that of calcein am, there was a possibility that gfp fluorescence could interfere with the calcein am (live) measurement leading to potential errors for those wells containing c60 vector/dna mixtures. thus, a baseline fluorescence intensity of each sample well at 495/515 nm was obtained before the addition of the live cell/dead cell dyes. this intensity was then subtracted from the final calcein am detection intensity. for the dynamic light scattering (dls) experiments, a standard solution with concentration 10 g/l of each of the c60 vectors was prepared in each of these solvents: hplc grade water, 10 mm tris/edta solution, and serum-free dmem. these solvents were filtered through a 0.22 m syringe filter (millpore, millex- gp) prior to use. the size of standard 100 nm polystyrene beads in tris/edta solution and in serum-free dmem was measured to confirm that no discrepancies were detected with the data acquisition system. dls measurements were conducted using a wyatt technologies dawn eos instrument equipped with a quasi-elastic light scattering interface module (wyatt qels unit). the scattering angle used for detection was 90 at a constant temperature of 25 c. data analysis and size distribution computations were performed using the vendor supplied software (astra v) and a multi- digital recorder (wyatt qels). statistical analysis was performed between groups for the live/dead assay and for flow cytometry studies. groups were analyzed by anova with significance defined by a p-value<0.05, and pairwise comparison was performed using the tukey test. the cytotoxicity studies had four samples per group, and the transfection studies had three samples per group. initial screening was performed on each of the six different derivatized c60 samples, compounds ivi (figure 1). the different c60-vector/dna complexes were assembled at various r values (0.4242) and each analyzed for its ability to affect transfection in nih 3t3 cells under serum-free conditions. serum-free conditions were used in these studies to ensure that derivatized nanomaterial/dna complexes were not compromised by serum lipids and/or proteins, and that the dna complexes were imported into the cells based on the individual physical properties of the complexes themselves, without the potential aid of serum proteins acting as carrier. the best transfection efficiencies were routinely observed after allowing transfection mixtures to remain on cells for 24 h (transfection time), then removing the transfection mixtures and incubating cells for an additional 24 h (incubation time) in the presence of serum for maximal gene expression to be detected. unless otherwise noted, all transfection efficiency data presented below were for cells transfected for 24 h under serum-free conditions and incubated for an additional 24 h in the presence of serum. all c60-conjugated transfection mixtures showed the ability to transfect cells with exogenous dna with statistically significant differences relative to unconjugated dna alone (naked dna) (table 1). transfection efficiency as reported in table 1 is defined as the ratio of gfp-positive cells as determined by fluorescence under flow cytometry per total number of cells counted in the flow cytometer. no statistical difference was observed between the transfection efficiencies of the different groups at r=0.42 and r=4.2. for r values above 4.2, compounds iii and iv exhibited a statistical difference in transfection efficiencies compared to the other compounds. both of these compounds exhibited an increased transfection efficiency relative to the other c60 compounds studied, with a maximum transfection efficiency of 31% at r=16.8. at larger values of r the efficiency dropped off. at r=16.8, their transfection efficiencies were comparable to that of 25 kda pei containing and cytopure transfection reagent containing complexes. 25 kda pei is a widely used and well-studied nonviral vector, while cytopure is a biodegradable polymeric transfection reagent that exhibits very low cytotoxicity and is reported to work on a broad spectrum of cell types, including hard-to-transfect primary cell isolates. c60 vectors are listed in order of their measured efficiency at promoting transfection in nih 3t3 cells under serum-free conditions. to assess the transfection ability of c60 vectors in different cell types, studies were also performed on two other cell types: hek 293 cells and mscs. hek 293 cells were chosen since they are another standard cell line used routinely for transfection assays, while mscs were chosen due to their eminence as primary cells for tissue engineering. based on the initial screening results of each of the various derivatized c60 compounds for transfection-promoting ability in nih 3t3 cells as reported in tables 1 and 2, transfection studies were also performed on hek 293 cells and mscs using compounds iii and iv at ratios of r=4.2 and r=16.8. however, hek 293 cells ' transfection efficiencies were lower than those observed for nih 3t3 cell at similar r values. mscs exhibited low transfection efficiencies overall, and no increase in transfection efficiency was observed with increase in r values. transfected cells were visualized by fluorescence microscopy for morphological analysis after transfection (micrographs not shown). positive transfection of cells with the plasmid coding for green fluorescent protein could be easily discerned by this technique. however, variations in transfection efficiency among the different cell types tested here is not surprising, as cell type is a major factor in determining the level of transfection and gene expression from nonviral vectors as noted previously.(27) differences in cell characteristics, such as cell mitosis rates, can play an important role in transgene expression, and may explain the differences in the level of gene expression among the various cell lines studied here. transfection efficiency values are presented as a quotient of gfp (+) cells relative to the total viable cells present in the transfected sample well as measured by flow cytometry. figures 2 a, b and c display the fraction of viable nih 3t3 cells as a function of the c60 vector (no dna present) concentration after 2, 8, or 24 h post-treatment incubation times, respectively. incubation with c60 compounds for 2 h resulted in a viable cell fraction greater than 50% for all c60 vector solutions. lowest overall cell viability was observed with compound i (0.55 0.08) at 10 g/l, and no statistically significant increase in cell viability was observed with decreasing compound i concentration. for all other c60 compounds tested, there was a general trend of increased cell viability with decreased c60 compound concentration. fraction of live nih 3t3 cells after incubation with the different c60 vectors as a function of derivatized fullerene concentration after (a) 2 h, (b) 8 h, or (c) 24 h c60-incubation times respectively, under serum-free conditions. error bars represent mean standard deviation for n=4. at the 8 h c60 incubation time, the fraction of live cells was higher than 50% for all c60 solutions tested except those exposed to compound i. for compound i, the cell viability was the lowest (0.51 0.04) at 10 g/l, but no statistically significant increase in cell viability was observed with decreasing compound i concentration. for all other c60 vectors, there was a general trend of increased cell viability with decreased compound concentration, but at each compound concentration tested, the cell viability was lower in the 8 h time point than in the corresponding sample concentration at the 2 h time point. at the 24 h c60 incubation time point, only cells treated with compounds iii and iv exhibited greater than 50% cell viability at all concentrations tested, with an increase in cell viability with decreased c60 compound (iii and iv) concentration. all other compounds showed a general trend of increased viability with a decrease in compound concentration, with cell viability values lower than 50% at 10 g/l. figures 3 a, b and c display the cell viability of nih 3t3 cells cultured in the presence of the various c60-vector/dna mixtures as a function of both c60 compound concentration and r values after 2, 8 or 24 h post-transfection time, respectively. cell viability at the two hour post-transfection time point for compound i/dna and compound ii/dna mixtures increased from 0.19 0.0 at 10 g/l (r=42) to 0.70 0.15 at 0.1 g/l (r=0.42). the fraction of live cells was greater than 50% for all other c60 derivative/dna solutions at the 2 h post-transfection time point. fraction of live nih 3t3 cells after incubation with the different c60/dna transfection mixtures as a function of c60 compound concentration and varying r value after (a) 2 h, (b) 8 h, or (c) 24 h post-transfection incubation time, under serum-free conditions respectively. error bars represent the mean standard deviation for n=4. at the 8 h post-transfection time point, the fraction of live cells for compound i/dna and compound ii/dna was less than 50% at all concentrations and r values tested. for all other samples, the trend was similar to that of the 2 h post-transfection time point, with cell viability greater than 50% and an increase in viability observed with a decrease in transfection mixture concentration. at the 24 h time point, cells treated with the compound v/dna mixture exhibited greater than 50% cell viability at all concentrations tested, while compound i/dna, compound ii/dna exhibited less than 50% cell viability. cells treated with compounds iii/dna, iv/dna and vi/dna mixtures resulted in cell viabilities less than 50% at 4 g/l (r=16.8) and 10 g/l (r=42), but greater than 50% viability when added at lower concentrations. dls and optical microscopy studies were performed to help elucidate the biophysical structure/activity relationships that might exist between the various c60 complexes. these studies were carried out to help generate correlations between the different c60 vectors, and the various c60 vector/dna structural attributes resulting in the different transfection efficiencies and cytotoxicity results observed under serum-free conditions. table 3 presents the dls measurements on the various c60 vector compounds ivi when dissolved alone in either water (4 g/l), in a 10 mm tris/edta solution (4 g/l), in serum-free dmem (4 g/l), or when dissolved in complex with dna in 10 mm tris/edta (4 g/l, r=16.8) or as a complex with dna in serum-free dmem (4 g/l, r=16.8). the concentration of 4 g/l was chosen for dls experiments since compounds iii and iv exhibited maximum transfection efficiency at this concentration of c60. the rh values in table 3 provide qualitative information about the transfection mixture aggregate behavior which can readily be seen in figures 4 and 5. the rh parameter obtained from the dls measurements, and shown in table 3, corresponds to the radius of a monodisperse hypothetical sphere having the same diffusion constant as that of the c60 compound aggregates or the c60/dna mixture aggregates under study. pdi values between 0 and 0.05 indicate more monodisperse particles, and values above 0.05 indicate broadened size distributions.(30) clearly, the rh values shown in table 3 for the various c60 compounds and c60/dna complexes are average values for quite polydisperse populations of aggregates. previous work by our group and others using atomic force microscopy (afm) and cryo transmission electron microscopy (cryo-tem) have shown that derivatized c60 compounds form aggregates that are irregularly shaped in solution. the rh values observed for these c60 compounds and the c60/dna mixtures suggests that these reagents also form such irregularly shaped aggregates when in aqueous solutions, including when dissolved in solutions of physiological ionic strength such as dmem. such qualitative information about the aggregate behavior provides valuable information for understanding the transfection and toxicity results, as discussed below. representative morphologies of nih 3t3 cells and the c60/dna complexes at r=0.42 ten minutes after transfection. the optical images represent complexes formed with compound (a) i, (b) ii, (c) iii, (d) iv, (e) v, and (f) vi. all images are shown at the same magnification. representative optical microscopy images of nih 3t3 cells incubated with c60/dna complexes formed using compounds (a) iii and (b) vi at r=0.42 twenty four hours post-transfection. all c60 compounds display a broadly distributed aggregate size in each solvent tested (water, 10 mm tris/edta solution, and serum-free dmem). the compounds had aggregate sizes between 47 and 650 nm (pdi=0.330.51) and between 33 and 446 nm (pdi=0.290.46) in plain water and 10 mm tris/edta solution, respectively. in the presence of dna, there is an increase in rh for all formulations. in general, the rh values decrease in the order v, vi>i>ii>iii, iv in the presence of dna. presumably, this trend is the result of the influence of the various structures of the c60 derivatives on the condensation behavior of the dna in the transfection mixture. in the case of cationic polymers, the condensation process with dna has been thought to rely predominantly on electrostatic interactions with minor contributions from other interactions such as hydrophobic interactions, hydrogen bonding, and van der waals forces.(5) in case of the positively charged c60 derivatives, the hydrophobicity of the c60 core, and electrostatic interactions between the water-soluble functional groups and the dna are the main contributors to the condensation process. compound i, with two adducts on the fullerene core, has less positive charge than the hexa-amino c60 adduct of compound ii and the octa-amino adduct of compound iii. fewer electrostatic interactions between functionalized c60 vectors and the dna sugarphosphate backbone can lead to a decrease in condensation capacity, resulting in larger c60-vector/dna complexes. compound v, although polar, has no net charge at neutral ph; while compound vi will possess a negative charge, the same as that of dna. thus, for compounds v and vi, hydrophobicity is presumably the only interaction contributing to the formation of the dna condensates, and this interaction appears insufficient to fully condense the dna, leading to large c60 vector/dna complex aggregates. the relatively large sizes for the c60 vector/dna complexes, and in particularly for those formed from compounds i, ii, v and vi, may be a reason for the poor transfection efficiencies observed with these compounds. this may also be a reason for the low transfection efficiency reported for a similar positively charged amino-c60 compound with a monoadduct on the fullerene core.(17) however, increased positive charge-state alone is insufficient to solely predict increased transfection capability of amino-derivatized fullerenes. variation in transfection protocol and/or cell types can also dramatically affect transfection efficiencies, as positively charged amino-derivatized c60 similar to compound iv have previously been shown to be inefficient at effecting transfection.(17) in general, the condensation behavior of nonviral vector/dna complexes is governed by several factors including the molecular weight of the dna condensing agent, the density of the charges on the condensing agent, and the ratio of composition (r values) between the condensing vector and the dna.(5) in addition, it is now well-documented that the size of the transfection vector/dna complex is one of the most important parameters for efficient dna delivery into cells, with the most efficient uptake observed for complex with sizes<150200 nm in diameter.(5) the rh values shown in table 3 suggest that only dna complexes formed with compounds iii and iv satisfy these criteria. on addition of the c60-vector/dna complexes to cells, the complexes formed with compounds i and ii immediately aggregated further to form large clusters, even at the lowest r value tested of 0.42. figure 4af shows the optical microscopy images of all c60-vector/dna complexes at r=0.42 ten min after their addition to nih 3t3 cells. large, irregularly shaped aggregates (shown as brown) can clearly be seen for complexes formed with compound i (figure 4a) and for complexes formed with compound ii (figure 4b). the aggregate concentration is greater and more densely distributed for compound i than for compound ii. no such increased aggregation propensity was seen for the other c60 vector/dna complexes (figure 4cf). however, time-dependence of aggregation could be observed for compound iii and compound vi. figure 5a, b shows the optical microscopy images of compound iii/dna, and compound vi/dna complexes at r=0.42 at 24 h post-transfection time. the images show the presence of large sized aggregates, more densly distributed for compound vi than for compound iii. interestingly, addition of compound iii/dna mixtures caused cell morphological changes when added to cultured cells, causing the attached cells to round up from the substratum surface in contrast to the usual planar, extended/elongated shapes the cells assumed in the normal growth state. this shape change may be attributed to the depolymerization/disruption of either the actin or tubulin networks of the cytoskeleton by the complexes, and/or to the disruption/inhibition of focal adhesion plaques formed on the cell surface. however, this observation at r=0.42 does not have any noticeable effects on cell proliferation, as flow cytometry measurements indicate no statistically significant difference in the number of cells for those treated with compound iii/dna complexes relative to the controls cells (no c60/dna complexes added). our results indicate that compounds iii and iv, when complexed with dna, bring about the highest levels of transfection when compared to the other derivatized c60 compounds under evaluation in this study. at the optimal ratio of compound iii or iv to dna (r=16.8), however, at 24 h post-transfection, there is only approximately 30% viability in cells treated with these two tranfection mixtures. this result is in contrast to cell viability of greater than 50% in cells treated with the compounds iii or iv alone at equivalent c60 concentrations (4g/l) as that when in complex with dna at r=16.8. the temporal increase in aggregate sizes for these c60/dna complexes (not seen in the free c60 compounds alone) leads to precipitation onto the cell surface when these mixtures are left in the culture medium for 24 h (e.g., see figure 5). this effect may explain the higher levels of cell death in the transfection mixture-treated cells. the overall trend observed in these studies was that increased cell death was observed with an increase in either c60 concentration alone or for increased r values in c60/dna mixtures, irrespective of the chemical nature of the c60 compound, with compounds iii and iv exhibiting the least toxicity when free in solution, but not necessarily when complexed with dna (under these conditions, compound v seems to exhibit the least cell toxicity). also, higher levels of cytotoxicity seem to correlate more with complex aggregate formation induced by the presence of dna in the mixtures, leading to the formation of visible precipitates. such deposition of aggregates onto the cell surface will impair normal functioning of the plasma membrane and thereby contribute to cell death.(31) there may also be other slow processes contributing to cell death for the positively charged c60 vectors in the c60/dna solutions at the longer (8 and 24 h) transfection times. following cellular entry, the presence of positively charged amino-c60 compounds (iiv) (individuals or as aggregates) inside the cell or nucleus may lead to disruptions to other cellular functions, such as interfering with histonedna interactions and/or other cellular processes.(7) the favorable transfection efficiencies of compounds iii and iv suggest that these compounds have some characteristics in common with other positively charged amino-c60 derivatives previously cited in the literature which are reported to effect transfection in cells. these similarities include having a flexible linker situated between the fullerene core and the positively charged amino groups. although the results presented here suggest that the structures of compounds iii and iv will result in higher levels of transfection than those previously reported by others, direct comparison of our results with the results from others using different structurally derivatized positively charged amino c60 vectors is not possible, since the structure of the c60 vectors, the cell lines tested, and the methodologies used are not consistent. another distinct feature of all the c60 vectors reported here is their water solubility which obviates the need to use organic solvents such as dimethylformamide (dmf) in the preparation of the transfection mixture; the high cytotoxicity observed for some other c60-based transfection agents has been attributed to the toxicity of dmf. the comparable transfection efficiencies of compounds iii and iv on nih 3t3 cells to those of commercially available nonviral vectors 25 kda pei and cytopure is encouraging. 25 kda pei is a widely used nonviral vector and is quite often used as a standard for comparing new nonviral vectors. this high cytotoxicity has been attributed more to free pei than to the pei/dna complex. however, in case of compound iii or iv, at the optimal r=16.8, their complexes with dna show higher toxicity (30% viability) compared to the free compounds iii or iv alone (greater than 50% cell viability). since the cytotoxicity seems to correlate more with complex aggregate formation induced by the presence of dna in the mixtures, future refinement of the c60/dna complex preparation protocol, such as disaggregating these complexes with phosphate buffer and/or nacl, should potentially lead to lower cytotoxicity while maintaining the same level of transfection efficiency, or potentially even increase these transfection efficiency levels. furthermore, although not addressed in this study (for reasons of maintaining uniformity in c60/dna complex formation and cellular entry), the presence of serum proteins on enhanced c60/dna complex uptake, and on subsequent cell viability during extended transfection times, would also be worth examining, and could be expected to lower the observed cellular cytotoxicity levels seen in this study. the small, but statistically significant, expression of the reporter protein from c60/dna conjugates formed from compounds v and vi was surprising and interesting since these samples do not possess a net positive charge under the physiological conditions used to form the complexes, although there have been limited reports of other nonpositive charged nanoparticles translocating into cells(35) and, indeed, also demonstrating gene transfection.(36) thus, at least for some derivatized c60 molecules, the hydrophobic nature of the c60 carbon nanostructures may be the common important property in their binding to dna and their subsequent translocation into the interior of the cell. there is now a growing body of work that suggests that carbon nanomaterials such as fullerenes, metallofullerenes and carbon nanotubes, due the hydrophobicity of their carbon sheaths, have the ability to efficiently translocate into the interior of cells irrespective of the charge of their water-solubilizing moieties. in addition, carbon nanomaterials such as gd@c60, gd@c82, gd@c80 and gd@ultrashort single-walled carbon nanotubes (gd@us-tubes) have shown potential as high-performance magnetic resonance imaging (mri) contrast agents suitable for advanced applications such as tracking and/or delivery of magnetically labeled cells by mri in vivo. these reports, along with the favorable c60-based gene transfection results reported here and by others, offer opportunities for development of analogous gd@c60-based vectors to monitor noninvasively the biodistribution and pharmacokinetics of gene therapy vectors in vivo.(49) a new class of water-soluble c60 transfecting agents with positively charged, negatively charged, or neutral chemical functionalities under physiological conditions was prepared using hirschbingel chemistry. transfection, cytotoxicity and biophysical structure/activity studies were performed in an effort to elucidate the relationship between the hydrophobicity of the fullerene core, the hydrophilicity of the water-solubilizing groups, and the overall charge state of the c60 vectors in gene delivery/expression. however, only two positively charged c60 derivatives, namely, an octa-amino derivatized c60 and a dodeca-amino derivatized c60 vector, showed efficient in vitro transfection. increased levels of cellular toxicity were observed for positively charged c60 vectors relative to the negatively charged and neutral vectors. structural analyses using dynamic light scattering and optical microscopy confirmed that higher positive charge on c60 compounds is a dominant physical attribute necessary for optimal c60/dna structural features leading to increased transfection efficiency, and that aggregation is the major factor that negatively affected the cytotoxicity profiles of the c60 vector/dna complexes. aggregation is presumably also the dominant reason for increased cytotoxicity of certain specific derivatized c60 compounds (most notable for compound i) even in the absence of dna, at least when analyzed under the serum-free conditions utilized in this study. future studies should be able to capitalize on this information and enable the design of additional c60 derivatives that address these issues specifically and help lower the propensity of these reagents to aggregate in the presence of dna. such reagents would be expected to enhance transfection of cells and tissues while simultaneously lowering toxicity levels. future studies using these reagents will also more precisely indicate the cellular uptake and endosomal release mechanisms that these compounds inherently possess, thereby lending further insight into potential enhanced chemical design of future generations of these carbon-based nanomaterials specifically for dna delivery into the cell nucleus. the successful demonstration of intracellular dna uptake, intracellular transport, and gene expression from dna using c60 vectors suggests the possibility of developing analogous gd@c60-based vectors to serve simultaneously as both therapeutic and diagnostic agents.

a new class of water-soluble c60 transfecting agents has been prepared using hirschbingel chemistry and assessed for their ability to act as gene-delivery vectors in vitro. in an effort to elucidate the relationship between the hydrophobicity of the fullerene core, the hydrophilicity of the water-solubilizing groups, and the overall charge state of the c60 vectors in gene delivery and expression, several different c60 derivatives were synthesized to yield either positively charged, negatively charged, or neutral chemical functionalities under physiological conditions. these fullerene derivatives were then tested for their ability to transfect cells grown in culture with dna carrying the green fluorescent protein (gfp) reporter gene. statistically significant expression of gfp was observed for all forms of the c60 derivatives when used as dna vectors and compared to the ability of naked dna alone to transfect cells. however, efficient in vitro transfection was only achieved with the two positively charged c60 derivatives, namely, an octa-amino derivatized c60 and a dodeca-amino derivatized c60 vector. all c60 vectors showed an increase in toxicity in a dose-dependent manner. increased levels of cellular toxicity were observed for positively charged c60 vectors relative to the negatively charged and neutral vectors. structural analyses using dynamic light scattering and optical microscopy offered further insights into possible correlations between the various derivatized c60 compounds, the c60 vector/dna complexes, their physical attributes (aggregation, charge) and their transfection efficiencies. recently, similar gd@c60-based compounds have demonstrated potential as advanced contrast agents for magnetic resonance imaging (mri). thus, the successful demonstration of intracellular dna uptake, intracellular transport, and gene expression from dna using c60 vectors suggests the possibility of developing analogous gd@c60-based vectors to serve simultaneously as both therapeutic and diagnostic agents.

PMC2652357

pubmed-122

previously we reported that deletion of neutral endopeptidase (nep) provides protection from obesity- and diabetes-induced neural complications. we have also shown that treating obese and streptozotocin-diabetic mice with the vasopeptidase inhibitor ilepatril prevented neural complications including slowing of nerve conduction velocity, thermal hypoalgesia, and decreased intraepidermal nerve fiber density. vasopeptidase inhibitors are drugs that simultaneously inhibit nep and angiotensin-converting enzyme (ace) activity. recent studies have shown increased expression of angiotensin-ii-forming enzymes in adipose tissue and increased activity of the renin-angiotensin system being implicated in the development of insulin resistance and type 2 diabetes. nep is found in many tissues including vascular and renal tissue and its activity is increased by fatty acids and glucose in human microvascular cells [59]. in the peripheral nervous system nep is located in schwann cell membranes surrounding dorsal root ganglion cells and nerve fibers [10, 11]. nep degrades many vaso- and neuroactive peptides including natriuretic peptides, adrenomedullin, bradykinin, and calcitonin-gene-related peptide [12, 13]. therefore, inhibition of ace and nep activity would be expected to improve vascular and neural function. in this regard we have demonstrated that treating type 1 and type 2 diabetic rats as well as a genetic rat model of obesity with ilepatril improves vascular and neural dysfunction [1416]. however, little information is available about the effect of vasopeptidase inhibitors in animal models of diet-induced obesity. in order to further elucidate the effects of vasopeptidase inhibitors in peripheral nerve dysfunction associated with obesity we examined the effect of diet-induced obesity on nerve conduction velocity and thermal response latency in the hindpaw of c57bl/6j mice and mice deficient in nep treated with ilepatril, enalapril, ace inhibitor, or candoxatril, nep inhibitor [1, 2]. unless stated otherwise all chemicals used in these studies were obtained from sigma chemical co. (st. louis, mo). c57bl/6jj breeding pairs of neutral endopeptidase-deficient (nep) mice were provided by drs. these mice have been bred and a colony created at the veterans affairs medical center, iowa city, ia. deficiency of nep activity was confirmed in nep mice by measuring the specific activity of nep in kidney homogenates using the method described by ayoub and melzig with modification. activity of nep in kidney from c57bl/6j and nep mice was 0.35 0.02 and 0.02 0.02 mm 7-amido-3-methylcoumarin (amc)/min/mg protein, respectively (p<0.001 versus c57bl/6j by unpaired t-test). this test was performed on all mice used in these studies in order to confirm that nep was functionally knocked out in the nep mice. mice were housed in a certified animal care facility and food (harlan teklad, no. adequate measures were taken to minimize pain or discomfort and all of the experiments were conducted in accordance with international standards on animal welfare and were compliant with all institutional and national institutes of health guidelines for use of animals (acurf protocol 1101009). for the prevention protocol c57bl/6j and nep mice at 12 weeks of age were divided into five groups. a second group was fed a high-fat diet containing 24 gm% fat, 24 gm% protein, and 41 gm% carbohydrate (d12451; research diets, new brunswick, nj). the primary source of the increased fat content in the diet was soybean oil and lard. the control and high-fat diet contained 0.4 and 0.3% sodium chloride, respectively. the average fat content of the control diet was 4.25 gm% (harlan teklad, no. the third through fifth groups were fed the high-fat diet containing ilepatril (500 mg/kg in the diet), candoxatril (30 mg/kg in the diet), or enalapril (500 mg/kg in the diet). we have found that these doses provide maximal inhibition of nep and/or ace activity in vivo [2, 19]. for the intervention study the same five groups of c57bl/6j and nep mice at 12 weeks of age were fed the control diet (group 1) or high-fat diet (groups 25) for 12 weeks. afterwards, the four groups of high-fat-fed mice were fed a high-fat diet with no additions (group 2) or high-fat diet containing ilepatril, candoxatril, or enalapril (groups 35) for 12 weeks. after an overnight fast mice were injected with a saline solution containing 2 g/kg glucose, i.p. immediately prior to the glucose injection and for 120 minutes afterwards blood samples were taken to measure circulating glucose levels with the use of glucose-dehydrogenase-based reagent strips (aviva accu-chek, roche, mannheim, germany). blood samples (0.6 l) were taken from a tail vein that was lanced once. thermal nociceptive response in the hindpaw was measured using the hargreaves method with instrumentation provided by iitc life science, woodland hills, ca (model 390 g) as previously described. the test was performed in a blind manner. thermal nociceptive responses were measured by placing the mouse in the observation chamber on top of the thermal testing apparatus and allowing it to acclimate to the warmed glass surface (33c) and surroundings for a period of 15 min. the mobile heat source was maneuvered so that it was under the heal of the hindpaw and then activated, a process that starts a timer and locally warms the glass surface, when the mouse withdrew its paw, the timer, and the heat source was turned off. following an initial recording, which was discarded, two measurements were made for each hindpaw, with a rest period of 5 min between each set of measurements. the mean of the measurements, reported in seconds, was used as a measure of the thermal nociceptive response latency., abbott laboratories, north chicago, il) and sensory nerve conduction velocities were determined as previously described [1, 2]. briefly, sensory nerve conduction velocity was recorded in the digital nerve to the second toe by stimulating with a square-wave pulse of 0.05 ms duration using the smallest intensity current that resulted in a maximal amplitude response (grass s44 stimulator; grass medical instruments, quincy, ma). the maximal sensory nerve conduction velocity was calculated by measuring the latency to the onset/peak of the initial negative deflection and the distance between stimulating and recording electrodes (measured in millimeters using a vernier caliper). biopsies of skin of the right hindpaw were fixed, dehydrated, and embedded in paraffin. sections (7 m) were collected and immunostained with anti-pgp9.5 antibody (rabbit anti-human no. 7863-0504 (this antibody cross-reacts with rat, mouse guinea pig, and other species), abd serotic, morpho sys us inc., raleigh, nc) overnight followed by treatment with secondary antibody alexa fluor 546 goat anti-rabbit (invitrogen, eugene, or). profiles were imaged using a zeiss 710 confocal microscope with a 40x objective and were counted by two individual investigators that were blinded to the sample identity. length of the epidermis was determined by drawing a polyline along the contour of the epidermis and recording its length in mm. comparisons between the groups for body weight, blood glucose, sensory nerve conduction velocity, thermal nociception, and intraepidermal nerve fiber profiles were conducted using a one-way anova and bonferroni's test for multiple comparisons (prism software; graphpad, san diego, ca). presented in table 1 are weight and blood glucose changes for c57/bl6j and nep mice used in the prevention study. at 12 weeks of age when fed a high-fat diet c57bl/6j and nep mice both gained a similar amount of weight. treating the high-fat diet with ilepatril or enalapril but not candoxatril completely prevented the gain in weight. the mass of the epididymal fat pad was significantly increased in high-fat-fed mice and mice fed the high-fat diet treated with candoxatril compared to control mice or mice fed the high-fat diet containing ilepatril or enalapril. when calculating the epididymal fat pad mass as a percent of total body weight epididymal fat pad mass was significantly increased in high-fat-fed c57bl/6j mice and mice fed a high-fat diet containing candoxatril compared to control. treating the high-fat diet with ilepatril and to a greater extent enalapril prevented the increase in epididymal fat pad mass when presented as percent of final body weight. nonfasting blood glucose levels were not significantly different between c57bl/6j and nep mice fed the control or high-fat diets and not affected by ilepatril, candoxatril, or enalapril treatment. in the intervention study all mice fed the high-fat diet for the initial 12 weeks of the experimental design gained a significant amount of weight (table 2). when transferred to a high-fat diet containing ilepatril or enalapril for an additional 12 weeks c57bl/6j and nep mice lost weight. mice remaining on the high diet or high-fat diet containing candoxatril continued to gain weight. the epididymal fat mass decreased after c57bl/6j or nep mice, fed a diet containing high fat for 12 weeks, were given a high-fat diet containing enalapril. the epididymal fat mass also was decreased after nep mice but not c57bl/6j mice were fed a high-fat diet treated with ilepatril. treating high-fat-fed c57bl/6j or nep mice with candoxatril did not reduce epididymal fat mass. a similar trend was observed when the epididymal fat mass data was presented as percentage of final body weight. nonfasting blood glucose levels were not changed in c57bl/6j or nep mice fed control or high-fat diets with or without ilepatril, candoxatril, or enalapril. in the prevention study c57bl/6j (figure 1) and nep (figure 2) mice fed the high-fat diet or high-fat diet containing candoxatril had an impaired glucose clearance curve compared to control mice. in contrast, the glucose clearance curve was near normal in c57bl/6j and nep mice fed a high-fat diet containing ilepatril or enalapril. in the intervention study feeding c57bl/6j (figure 3) or nep (figure 4) mice for 24 weeks a high-fat diet caused an impaired glucose clearance curve. treating high-fat-fed c57bl/6j or nep mice with enalapril for the last 12 weeks of the 24-week period partially corrected glucose utilization. treating nep mice with ilepatril treating c57bl/6j mice with ilepatril did not improve glucose utilization nor did treating c57bl/6j or nep with candoxatril. data in figure 5 (left) demonstrate that sensory nerve conduction velocity was significantly decreased in high-fat-fed c57bl/6j mice compared to control mice and that this was prevented by treating high-fat-fed mice with ilepatril or candoxatril using a prevention protocol. data in figure 5 (center) demonstrate that thermal nociception was significantly decreased in c57bl/6j mice after 12 weeks of a high-fat diet compared to control mice as indicated by an increase in paw withdrawal latency. treatment with ilepatril or candoxatril and to a lesser extent enalapril for the 12-week period prevented thermal hypoalgesia in high-fat-fed c57bl/6j mice. data in figure 5 (right) demonstrate that the number of intraepidermal nerve fiber profiles was significantly decreased in high-fat-fed c57bl/6j mice and that treatment of these mice with ilepatril or candoxatril but not enalapril for 12 weeks prevented the significant decrease. sensory nerve conduction velocity, thermal nociception, and intraepidermal nerve fiber density were not impaired in nep mice fed a high-fat diet (figure 6, left, center, and right, resp.). we also determined the effect of treating high-fat-fed c57bl/6j and nep mice using an intervention protocol (figures 7 and 8, resp.). in this study design high-fat-fed mice were untreated for 12 weeks followed by 12 weeks of a high-fat diet with or without treatment. feeding c57bl/6j mice a high-fat diet for 24 weeks caused a significant decrease in sensory nerve conduction velocity (figure 7, left). treating these mice for the last 12 weeks of the 24-week period with ilepatril, candoxatril, or enalapril the decrease in thermal nociception in high-fat-fed c57bl/6j mice was reversed by treating mice with ilepatril or candoxatril but not enalapril (figure 7, center). treating high-fat-fed c57bl/6j mice with ilepatril, candoxatril, or enalapril reversed the decrease in intraepidermal nerve fiber profiles (figure 7, right). feeding nep mice a high-fat diet for 24 weeks with or without treatment had no effect on sensory nerve conduction velocity, thermal nociception, or intraepidermal nerve fiber density (figure 8, left, center, and right, resp.). the main findings from these studies were that diet-induced obesity caused significant weight gain and impaired glucose utilization in c57bl/6j and nep mice that was improved when the mice were treated with ilepatril or enalapril using a prevention protocol. using the intervention protocol enalapril but not ilepatril treatment was effective improving glucose utilization by c57bl/6j mice. treating c57bl/6j or nep mice with candoxatril did not improve weight gain or glucose utilization. these data suggest that inhibition of ace and not nep activity was responsible for improving weight gain and glucose utilization in high-fat-fed mice. diet-induced obesity also caused slowing of sensory nerve conduction velocity, thermal hypoalgesia, and decrease in epidermal nerve fiber density in the paw of the hindlimb in c57bl/6j mice but not nep mice. the impairment in sensory nerve function endpoints in c57bl/6j mice fed a high-fat diet was prevented/improved when the mice were treated with ilepatril or candoxatril and to a much lesser extent enalapril using either the prevention or intervention protocol. these data suggest that increased nep activity/expression but not ace activity contributes to diet-induced obesity-related deficits in sensory nerve function. previous studies have shown that diet-induced obesity in rodent models can be prevented by ace inhibitors and angiotensin ii receptor blockers [2124]. in addition, diet-induced weight gain and fat mass are reduced, energy expenditure increased, and glucose tolerance improved in mice lacking ace or the angiotensin ii type 1a receptor [25, 26]. the mechanisms proposed for the improvement in obesity and glucose tolerance with treatment of rodent models with ace inhibitors are increased energy expenditure, liver and adipose tissue metabolic modulation, lower concentration of leptin, improved insulin signaling, and increased glucose and fatty acid utilization by muscle [2130]. in a study comparing the effects of ramipril, an ace inhibitor, to ilepatril in jcr: la-cp rats, an obese, insulin-resistant, hyperinsulinemic, normoglycemic model, it was found that both compounds reduced the surge of plasma insulin in a meal tolerance test by about 50% but ilepatril was more beneficial in improving vascular reactivity. in our study we found that enalapril trended to be more effective than ilepatril preventing/reducing fat pad mass. this could be because enalapril at the dosage used was a more effective ace inhibitor than ilepatril in target tissues. in another study using obese zucker rats it was found that dual inhibition of ace and nep improved insulin-mediated glucose disposal more effectively than monotherapy and this effect was linked to increased activation of the kinin-nitric oxide pathway. in a similar independent study it was found that omapatrilat, a vasopeptidase inhibitor, induced insulin sensitization and increased myocardial glucose uptake in obese zucker rats and that the effect of omapatrilat was greater than ramipril in part due to stimulation of the b2 receptor. later this group reported that treatment of obese zucker rats with a vasopeptidase inhibitor increased muscle glucose uptake independent of insulin signaling. in two of these studies protection of bradykinin from degradation by nep interestingly, it has been shown that natriuretic peptides promote muscle mitochondrial biogenesis and fat oxidation as to prevent obesity and glucose intolerance. the natriuretic peptides are also degraded by nep. because nep is expressed in skeletal muscle in relatively large amounts and being located on the cell surface, nep is able to hydrolyze peptides in the vicinity of their receptors thereby neutralizing their bioactivity [34, 36]. however, inhibition of ace may also lead to protection of bradykinin levels by inhibiting kininase-ii-mediated degradation of this nonapeptide. reported that ace inhibition by captopril improved glucose transport in insulin-resistant muscle of the obese zucker rat. they attributed the improvement to modulation of insulin action by bradykinin mediated through b2 receptors and by an increase in nitric oxide production. since bradykinin and natriuretic peptides may have a role in enhancing insulin action and regulating glucose and fatty acid metabolism by muscle protecting their bioactive function by preventing degradation through inhibition of ace and/or nep may be a therapeutic approach for treatment of obesity and insulin resistance [34, 36, 38]. we have previously shown that treating diabetic rats with enalapril improved vascular and nerve endpoints but enalapril was less effective in rats fed a high-fat diet [19, 36, 39, 40]. in contrast, we found that treating obese or diabetic rats with ilepatril was more effective than enalapril in improving peripheral nerve dysfunction [19, 36, 40]. we have shown that treating diabetic or diet-induced obese rodents with ilepatril improves vasodilation of blood vessels that provide circulation to the sciatic nerve by reducing oxidative stress and preventing degradation of vasoactive peptides by nep including calcitonin gene-related peptide and c-type natriuretic peptide thereby maintaining endoneurial blood flow and preventing ischemia. since nep degrades both calcitonin gene-related peptide and substance p, peptides important in pain signaling pathways, it is likely that blocking nep activity or mice deficient in nep would maintain higher levels of both of these neuroactive peptides and perhaps be more sensitive to painful stimuli. data from clinical trials clearly suggest that activation of the renin-angiotensin-aldosterone system plays an important role in the pathophysiology of the metabolic syndrome through interaction of a wide range of physiological and molecular mechanisms. more recently in humans activity of nep has been shown to correlate with body mass index and measures of insulin resistance with increasing activity found in subjects with multiple cardiovascular risk factors. in these studies we found that feeding mice a high-fat diet causes weight gain, impaired glucose tolerance, and sensory nerve dysfunction. inhibition of ace was effective in reducing weight gain and improving glucose utilization but generally noneffective in improving sensory nerve dysfunction. in contrast, inhibition of nep improved sensory nerve dysfunction and had no effect in improving weight gain or glucose utilization. treating high-fat-fed mice with a vasopeptidase inhibitor improved weight gain, glucose utilization, and sensory nerve function. thus, we conclude that increased activity of nep is associated with sensory nerve dysfunction in an animal model of diet-induced obesity and that dual inhibition of ace and nep may be more effective than monotherapy in reducing insulin resistance and the sensory nerve complications associated with metabolic syndrome.

we have demonstrated that treating diet-induced obese (dio) mice with the vasopeptidase inhibitor ilepatril improved neural function. vasopeptidase inhibitors block angiotensin-converting enzyme (ace) and neutral endopeptidase (nep) activity. we propose that increased activity of ace and nep contributes to pathophysiology of dio. to address this issue c57bl/6j mice or mice deficient in nep were fed a high-fat diet and treated with ilepatril, enalapril, ace inhibitor, or candoxatril, nep inhibitor, using both prevention and intervention protocols. endpoints included glucose utilization and neural function determination. in the prevention study glucose tolerance was impaired in dio c57bl/6j mice and improved with ilepatril or enalapril. sensory nerve conduction velocity, thermal nociception, and intraepidermal nerve fiber density were impaired in dio c57bl/6j mice and improved with ilepatril or candoxatril. in the intervention study only enalapril improved glucose tolerance. sensory nerve conduction velocity and intraepidermal nerve fiber density were improved by all three treatments, whereas thermal nociception was improved by ilepatril or candoxatril. in nep-deficient mice dio impaired glucose utilization and this was improved with enalapril. nerve function was not impaired by dio in nep-deficient mice. these studies suggest that ace and nep play a role in pathophysiology associated with dio.

PMC3465928

pubmed-123

follicular thyroid cancer (ftc) metastasizes most commonly to the lungs and non-cranial bones. skull and skin are uncommon sites and usually manifest well after the diagnosis of primary malignancy. metastasis to skull and skin as the presenting feature of ftc is infrequently reported in the literature. a 65-year-old caucasian woman with a history of thyroid nodule presented with the complaint of rapidly growing skull nodules which had been present for 3 years but were stable previously. she denied any history of smoking or head and neck irradiation. on physical examination, she had two non-tender gray cystic lesions one on her left temporal region and the other on the right parietal region. magnetic resonance imaging of the brain demonstrated 7.13.8 cm and 3.74.5 cm fairly homogeneous, enhancing, relatively well-defined masses centered in the posterior and left anterior lateral calvarium with intracranial and extracranial extensions but without any vasogenic edema or mass effect on the brain. histopathological studies of the thyroid gland revealed a well-differentiated ftc in the left lobe. she did not have any recurrence of the ftc or metastases during the follow-up period and will be receiving radioactive iodine treatment. bone and lung are the common sites of metastasis from ftc, but involvement of skull or skin is unusual, particularly as the presenting feature. metastases from ftc should be in the differential of patients with new osteolytic hypervascular skull lesions or cutaneous lesions in head and neck area. a 65-year-old caucasian woman with a history of thyroid nodule presented to dermatology clinic with the complaint of rapidly growing skull nodules. she reported that the nodules had been present for 3 years but had been stable, so she had not sought medical attention. she denied any fevers, chills, pain, or redness over the nodules, fatigue, weight loss, recent infections, or history of trauma. she admitted to drinking alcohol on social occasions but denied any history of smoking or head and neck irradiation. her family history was positive for leukemia in her father and melanoma in her mother. she indicated a remote history of thyroid nodule which she reported was benign on biopsy. on physical examination, she had two non-tender gray cystic lesions one on her left temporal region measuring about 5 cm in diameter and the other on the right parietal region measuring about 7 cm in diameter. laboratory tests revealed a normal tsh of 0.52 iu/ml (reference range 0.35.0 iu/ml) and t4 of 0.68 ng/dl (reference range 0.581.64 ng/dl). a complete metabolic panel including serum creatinine, bun, and hepatic panel was normal. biopsy was attempted under local anesthesia which revealed possible extension to the bone with vascular origin and hence the patient was referred to surgery for debulking. during surgery, total excision of the nodules could not be performed as there appeared to be skull erosion underneath. an immunohistochemical panel showed positive staining for ck7, thyroglobulin, and hbme-1 while it was weakly positive for pankeratin, suggesting a thyroid origin of these lesions, that is, metastatic ftc (fig. two large extra-axial enhancing masses with both intra- and extracranial components were seen (figs. 2, 3). magnetic resonance imaging (mri) of the brain demonstrated 7.13.8 cm and 3.74.5 cm fairly homogeneous, enhancing, relatively well-defined masses centered in the posterior and left anterior lateral calvarium with intracranial and extracranial extensions but without any vasogenic edema or mass effect on the brain (fig. 4). positron emission tomography (pet) or ct of the skull demonstrated the two skull lesions to be lytic. two foci of hypermetabolic activity were also seen in the thyroid gland in the left lobe and thyroid isthmus. thyroid ultrasound showed numerous nodules in both lobes, the largest measuring up to 2.5 cm in greatest dimension. ct head with and without contrast showing a large, round, relatively smoothly marginated enhancing extra-axial left frontal mass (4.4 cm in anteroposterior diameter and 4.1 cm in transverse diameter) that has eroded and partially destroyed the calvarium and extends into the subcutaneous scalp. ct head with and without contrast demonstrating a large, round, relatively smoothly marginated enhancing extra-axial mass (measuring 6.8 cm in transverse diameter, 5.9 cm in ap diameter) involving the right and left parietal region, straddling the posterior falx cerebri and superior sagittal sinus. mri brain revealing a large 7.13.8 cm fairly homogeneous enhancing relatively well-defined mass centered in the posterior calvarium with intracranial extension into the extra-axial space as well as extracranial extension. there is a similar appearing 3.74.5 cm fairly homogeneous relatively well-defined enhancing mass centered in the left anterior lateral calvarium also extending into the extra-axial space as well as extracranially. histopathological studies of the thyroid gland revealed a well-differentiated ftc in the left lobe, pathological stage pt2nxm1, a 1-cm focus of classic papillary thyroid cancer in the right lobe of thyroid, with a background of multinodular goiter (fig. she underwent intravascular embolization of the feeding blood vessels of her metastatic skull lesions from the external carotid system. then she underwent resection of the tumor in multiple stages with resection of the posterior and left frontal tumor, and calvaria, followed by cranioplasty. although she had other unrelated postoperative complications, she did not have any recurrence of the ftc or metastases during the follow-up period, had a normal thyroglobulin of 4.9 ng/ml (reference range 2.840.9 ng/ml), and will be receiving radioactive iodine treatment. it typically presents as a thyroid nodule, either noted by the patient or the physician on routine physical examination or incidentally on routine imaging (1). vascular invasion is characteristic for follicular carcinoma accounting for more common distant metastasis (5). these metastases occur in 1015% of patients with ftc, with lung and bone being the commonest sites of involvement. bone metastases from ftc tend to be multiple and often involve sternum, ribs, and vertebrae (3). skull metastases are uncommon with recent decline in incidence because of early detection and treatment of thyroid cancer; among thyroid carcinomas, these metastases tend to occur more commonly in ftc and have a female preponderance (68). there were only 12 reported cases of skull metastases out of 473 patients of thyroid cancer in one study, accounting for 2.5% of cases (8). likewise cutaneous metastases from dtc are uncommon with less than 30 reported cases of cutaneous metastases in the english literature until 2010 (9). these cutaneous metastases are more common in head and neck region and can manifest in a variety of histological appearances (1012). however, in most of these cases metastases occurred long after the diagnosis and institution of treatment for ftc and it is extremely unusual to encounter skull and cutaneous metastases as the presenting feature of ftc (3). skull metastases from ftc most commonly present as a slow-growing soft, painless usually hemispheric and singular lump in the occipital region (6, 7, 12). unusual presentations include headaches, hemiparesis, exophthalmos, cranial nerve dysfunction, and altered consciousness (13). these skull lesions are osteolytic on skull x-ray, and ct scans generally show homogeneous lesions with density slightly greater than the brain and a highly vascular appearance on angiographic assessment with blood supply most commonly from external carotid system (7, 14). in patients with scalp lesions, pet/ct can be used to determine the biopsy site (5). in patients with established diagnosis of ftc with no documented metastases, evaluation of possible metastatic lesions can be done with (131)i single photon emission ct/ct [(131)i-spect/ct] (15). (99m)tc-mibi scan has been reported to be a highly sensitive technique for the detection of dtc metastases that have lost the capability to uptake (131)i; the combined (99m)tc-mibi scintigraphy and serum thyroglobulin (tg) estimation appear to be an alternative method of radioiodine imaging in cases with dtc and elevated tg (16). bone metastases uncommonly respond to radioactive iodine therapy and are associated with poor prognosis (7). surgical approach should be considered as one of the treatments of choice for bone metastasis, if possible, and curative resection of solitary bone metastasis is associated with improved survival (7). bone defects often require extensive bone resection, bleeding is often profuse during surgical resection, and deaths have been reported from extreme hemorrhage (1, 4, 13, 14). because of the life-threatening nature of such hemorrhages, preoperative angiographic assessment of these lesions with prophylactic ligation or embolization of feeding vessels is recommended (14). when surgical excision is not possible, internal radiation with i-131 is recommended; external radiation is generally reserved for cases where uptake of i-131 by metastatic foci is poor (8). thyroid hormone should be administered after complete excision of thyroid gland to suppress endogenous tsh from promoting tumor growth (17). frequent follow-up examination is recommended and monitoring thyroglobulin measurement can be useful during follow-up (13). ftc is thought to have the most optimistic prognosis even with metastases to the lymph nodes and lung. however, when combined with distant, especially widespread, metastases, the quality of life is compromised and the overall survival rate significantly decreases (2). in one case series, the mean time from the diagnosis of thyroid tumor until discovery of skull metastasis was 23.3 years (8). prognosis in case of metastasis is generally poor and the 10-year survival with bone metastases from dtc is reported to be 27% (7). however, mean survival time of 4.5 years was reported with skull metastases in one case series, suggesting even worse prognosis and warranting an aggressive and multidisciplinary approach in this subset of patients (5). a regular follow-up is crucial in these patients for early detection and management of any residual or recurrent metastatic ftc (6). bone and lung are the common sites of metastasis from ftc but involvement of skull is unusual, especially as the presenting feature. metastases from ftc should be included in the differential of patients with new oteolytic hypervascular skull lesions or cutaneous lesions in head and neck area (7, 14). the authors have not received any funding or benefits from industry or elsewhere to conduct this study.

backgroundfollicular thyroid cancer (ftc) metastasizes most commonly to the lungs and non-cranial bones. skull and skin are uncommon sites and usually manifest well after the diagnosis of primary malignancy. metastasis to skull and skin as the presenting feature of ftc is infrequently reported in the literature. case presentationa 65-year-old caucasian woman with a history of thyroid nodule presented with the complaint of rapidly growing skull nodules which had been present for 3 years but were stable previously. she denied any fevers, chills, history of trauma, or weight loss. she denied any history of smoking or head and neck irradiation. on physical examination, she had two non-tender gray cystic lesions one on her left temporal region and the other on the right parietal region. biopsy was consistent with metastatic ftc. magnetic resonance imaging of the brain demonstrated 7.13.8 cm and 3.74.5 cm fairly homogeneous, enhancing, relatively well-defined masses centered in the posterior and left anterior lateral calvarium with intracranial and extracranial extensions but without any vasogenic edema or mass effect on the brain. thyroid ultrasound showed numerous nodules in both lobes. the patient underwent a total thyroidectomy. histopathological studies of the thyroid gland revealed a well-differentiated ftc in the left lobe. then she underwent resection of the tumor in multiple stages. she did not have any recurrence of the ftc or metastases during the follow-up period and will be receiving radioactive iodine treatment. conclusionbone and lung are the common sites of metastasis from ftc, but involvement of skull or skin is unusual, particularly as the presenting feature. metastases from ftc should be in the differential of patients with new osteolytic hypervascular skull lesions or cutaneous lesions in head and neck area.

PMC4318834

pubmed-124

although water-bath polymerization is extensively used to process polymethylmethacrylate (pmma), new resins and processing methods are often proposed to obtain better physical and esthetic properties and simplify the technique1,6,8,11,14. one of the advantages of microwave and visible light polymerization methods is the shorter processing time they offer in comparison to water bath. in addition, light-polymerized resins can be processed directly in the mouth using a portable light-curing device, which simplifies the clinical procedures9. while denture base acrylic resins polymerized by microwave irradiation and conventional water bath curing systems are composed of pmma6,8, visible light-polymerized resins are similar to composites, having an organic instead of an inorganic filler content. the material is composed of a urethane dimethacrylate matrix plus small amounts of microfine silica. the filler consists of acrylic resin beads (pmma) of varying sizes that become part of an interpenetrating polymer network. light polymerization occurs by exposure to quartz halogen lamps in the shorter blue 400 to 500 nm wavelength spectrum of visible light. visible light-polymerized resins were initially proposed for clinical repairs and/or additions in sub-extended removable dentures7, but due to their easy manipulation and fast polymerization, their are now indicated for many clinical situations, such as transitional and interim dentures, complete and removable partial dentures, provisional splints, denture repairs and additions, orthodontic appliances and record bases5,7,9. although light-polymerized resins have been used in removable partial dentures, it is not clear whether the presence of a metal framework could interfere with their polymerization, by possibly reflecting the light and affecting important physical properties, such as surface roughness and hardness. these properties are largely investigated because they indicate polymerization characteristics4,7,11,14 and might influence plaque accumulation later on 2,3,10. thus, the aims of this study were to investigate whether metal interferes with the surface hardness and roughness of a visible light-polymerized acrylic resin and to compare these values to those of water-bath- and microwave-polymerized resins. the resins used in this study are listed in table 1. twelve disc-shaped specimens, 30 mm in diameter and 4 mm thick, were fabricated for each resin according to the manufacturers ' directions. all specimens were made using a silicone (optosil, heraeus kulzer, hanau, germany) matrix (30 0.05 mm in diameter and 4 0.05 mm thick). the matrix was flasked in type iii dental stone (herodent soli-rock; vigodent, rio de janeiro, rj, brazil) using standard metal dental flasks (uraby; dlc, so paulo, sr brazil) or plastic flasks (onda cryl; artigo odontolgicos clssico ltd, so paulo, sp, brazil) for water bath and microwave polymerization, respectively. after the gypsum had completely set, the flasks were opened and the matrixes were removed. a separating medium (al-cote, dentsply ltd, rio de janeiro brazil) was applied to the exposed areas of the mold. before packing the resin, a rectangular (28 mm 8 mm 0.5 mm) insert of co-cr alloy bar (degussa, hanau, germany) was centered at the bottom of each mold. as the size of the metal bars was almost the same as that of the mold cavities, once positioned at the bottom of each mold microwave acrylic resin specimens were polymerized in a microwave oven (continental aw-42, with 2,450 hz frequency and 900w maximum potency; bosch, manaus, am, brazil), according to the manufacturer's directions (3 min at 360 w; 4 min resting and 3 min at 810 w). specimens polymerized by hot water bath were processed in an automatic polymerization unit (termotron p-100; termotron piracicaba, sp, brazil) at 74c for 9 h. once processed, all flasks were allowed to bench cooling for 2h. the resin samples were ground with water-cooled 320-, 400-, 600- and 1200-grit silicon carbide papers (carbimet; buehler, lake bluff, il, usa) in a polishing machine (arotec apl-4; so paulo, sp, brazil) followed by polishing with cloths and 1-m diamond suspension (metadi diamond suspension; buehler). next, they were ultra-sound cleaned (thornton-inpec eletrnica ltda, vinhedo, sp, brazil) for 2 min and then immersed in distilled water at 37c for 12 h to release residual monomers6,12,14. light-polymerized resin specimens were prepared using a transparent matrix, consisting of an acrylic resin plate containing a circular hole measuring 30 0.05 mm in diameter and 4 0.05 mm thick. first, a co-cr framework was placed at the bottom of the matrix and then the light-polymerized resin was inserted in the matrix. this assembly was put into a light box (edg lux; edg equipamentos e controles, so paulo, sp, brazil) containing four 75 w halogen lamps. the resin was polymerized for 6 min, according to manufacturer's instructions. after processing, the same finishing, polishing and cleaning procedures used for heat and microwave polymerized acrylic resins surface roughness was determined using a mechanical profilometer with a 2-m radius tip under a measuring force of 0.7 mn and accurate to 0.01 m (surfcorder se 1700, kosaka, tokyo, japan) calibrated at sample length of 0.25 mm, spread of 2.0 mm and speed of 0.5 mms. six readings were performed on each specimen and an average (ra) was determined. these profilometric traces were taken from the edge of specimen, in the middle and at its bottom.12 knoop hardness was assessed using a microhardness tester (shimadzu hmv-2000, shimadzu corporation, kyoto, japan). knoop penetrations were made on the acrylic surface of each sample at distances of 50, 100, 200, 400 and 800 m from the co-cr metal bar (figure 2). knoop hardness means were analyzed by two-way anova with 2 factors: acrylic resins and distances. the acrylic resin groups were compared using tukey test and distances were compared by kruskal-wallis test. means and standard deviations for acrylic resin surface roughness m) are presented in table 2. the visible light-polymerized resin (triad) showed the highest means (p<0.05), but the metal alloy did not interfere with surface roughness.. means and standard deviations for knoop hardness (kg/mm) of acrylic resins at several distances from the metal are described in table 3. comparisons between acrylic resins showed that the visible light-polymerized resin (triad) exhibited significantly higher means (p<0.05). however, no differences in hardness values at several distances from the metal alloy were found. mean followed by different letters are statistically different (p<0.05) lowercase letters indicate differences between acrylic resins and uppercase letters indicate differences between distances from metal. this technique is considered to be time-saving as it does not require cast inclusion, is non-toxic and biocompatible. it is therefore indicated for using in many clinical situations, such as complete and removable partial dentures9. however, little is known about the influence of metal alloys on the polymerization process and on important physical properties, such as hardness and roughness. in this study, a visible light-polymerized resin was compared to microwave- and heat-polymerized acrylic resins, which have similar composition and surface characteristics6,8. smooth surfaces do not readily retain food debris, epithelial cells and bacteria, thus facilitating oral hygiene, reducing the risk of plaque formation and preventing negative effects on periodontal tissues3. therefore, the roughness of intraoral surfaces helps determining their colonization by different microorganisms because retention preferably occurs on rough surfaces, as they provide protection against shear forces2. acrylic resin roughness is dependent on the polishing method used2. in this study, polishing was done with 360-, 400-, 600- and 1000-grit abrasive papers, resulting in roughness values below 0.2 m, which is considered clinically acceptable for preventing plaque accumulation2. although the same polishing procedure was carried out for all resins, higher roughness means were found in the light-polymerized resin group (0.11 0.02 m). this result may be explained by the large amounts of inorganic compounds in this resin, which were probably exposed during polishing procedures, causing irregularities on the resin surface. the surface roughness means of microwave- (onda-cryl) and water-bath-polymerized (clssico) resins did not differ statistically (p>0.05), probably because of the similarity of their composition. 12 (2004), who investigated the influence of denture cleansers on the surface roughness of heat- and microwave-polymerized resins. however, the findings of the present are in contrast with those of ulusoy et al.15, who reported higher roughness means (0.31 m). it is likely that these differences can be due to the polishing method used in each study because ulusoy et al.15 polished the specimens on a bench lathe using a roller brush with pumice/water paste, followed by a wet polishing wheel and a chalk. in contrast, in the present study, the specimens were polished with materials of decreasing granulation,(up to 1-m diamond particles). the other two resins (onda cryl and clssico), which do not have inorganic compounds, had lower roughness. hardness is a property used to predict the wear resistance of a material and its ability to abrade opposing dental structures1. therefore, surface scratching can be determined by its knoop hardness because its weakness explains why the surface is at risk of roughening during professional cleaning or even during habitual oral hygiene procedures10. this test can also be used to verify the efficacy of polymerization. in this study, it was used to assess resin polymerization around a metal alloy. the visible light-polymerized resin presented the highest knoop hardness, which is in accordance with khan et al. 7 (1987), who compared triad (dentsply inc.) hardness with that of a water-bath-polymerized resin. this could be explained by the inorganic content of the light-polymerized resin (silica)9, which increased the resistance of this resin to the microhardness indenter1. water-bath-and microwave-polymerized resins had similar knoop hardness means, which are in agreement with many authors4,11,12,14. no differences between 50, 100, 200, 400 and 800 m distances from the metal were found in any of the acrylic resins evaluated (p>0.05). the absence of significant differences suggests that light emission and polymerization processes were not affected by the presence of metal. these results are in consistent with those of braun et al. 4 (1998), who compared water bath- and microwave-polymerized resins with respect to the hardness means at pre-determined distances from a metal alloy. in this study, roughness and knoop hardness results indicated that triad has clinically acceptable properties and its polymerization was not affected by the presence of metal. however, further studies about the clinical behavior of visible light-polymerized acrylic resins should be conducted. within the limitations of this in vitro study, it may be concluded that the presence of a metal framework did not interfere with the roughness and knoop hardness of the tested visible light-polymerized (triad), microwave-polymerized (onda cryl) and water-bath-polymerized (clssico) acrylic resins, indicating that all materials can be used in removable partial dentures.

although visible light-polymerized acrylic resins have been used in removable partial dentures, it is not clear whether the presence of a metal framework could interfere with their polymerization, by possibly reflecting the light and affecting important properties, such as roughness and hardness, which would consequently increase biofilm accumulation. the aim of this study was to compare the roughness and knoop hardness of a visible light-polymerized acrylic resin and to compare these values to those of water-bath- and microwave-polymerized resins, in the presence of a metal framework. thirty-six specimens measuring 30.0 4.0 0.5 mm of a microwave- (onda cryl), a visible light- (triad) and a water-bath- polymerized (clssico) (control) acrylic resins containing a cobalt-chromium metal bar were prepared. after processing, specimens were ground with 360 to 1000-grit abrasive papers in a polishing machine, followed by polishing with cloths and 1m diamond particle suspension. roughness was evaluated using a profilometer (surfcorder se 1700) and knoop hardness (kg/mm2) was assayed using a microhardness tester (shimadzu hmv 2000) at distances of 50, 100, 200, 400 and 800 m from the metal bar. roughness and knoop hardness means were submitted to two-way anova and compared by tukey and kruskal wallis tests at a 5% significance level statistically significant differences were found (p<0.05) for roughness and knoop hardness, with light-polymerized resin presenting the highest values (ra=0.11 m and hardness between 20.2 and 21.4 kg/mm2). knoop values at different distances from the metal bar did not differ statistically (p>0.05). within the limitations of this in vitro study, it was concluded that the presence of metal did not influence roughness and hardness values of any of the tested acrylic resins.

PMC4327199

pubmed-125

there is limited data upon skin cancer screening program in western asia region and especially iran. the two most common variants are basal cell carcinoma (bcc) and squamous cell carcinoma (scc); regardless of their low mortality rates, these tumors can provoke severe consequence as a result of their treatment. the third most frequent skin cancer type, malignant melanoma (mm), has a more destructive behavior and accordingly a poor prognosis; malignant melanoma accounts for approximately 75% of all deaths from skin cancer. skin cancer screening includes the complete cutaneous examination and 2-3 minute visual inspection of the skin. there is strong data that whole-body clinical skin examination reduces the incidence of thick melanoma and, as a result, screening would reduce melanoma mortality. in us and however, some studies debate on the effective and beneficial method of skin cancer screening as mass screening or high risk group screening and the real impact of skin cancer screening result on the society health. in iran, there are limited studies about prevalence and incidence of skin cancers. therefore, this study was planned as a pilot one-week skin cancer screening campaign in tehran, iran to evaluate its profit and failure and design further large-scale screening program more definitely. this study was planned as a skin cancer screening campaign in the public health centers of shahid beheshti medical university in a one-week period in tehran, iran. we applied for the collaboration of the public health centers in tehran as the location of this screening program. the usual services provided in these centers include prenatal and pediatric care, women health, vaccination, health education, environmental or occupational health, etc., due to distribution of these centers in different areas of tehran, we discussed with the health deputy of the university for the collaboration of these health centers in this screening campaign and finally, thirty one public health centers were selected in different areas of tehran. physicians and health staffs of these health centers were volunteered to cooperate in this study. due to cultural and religious belief in our country, some female participants might be reluctant to be examined by male physicians. in this regard, we select a male physician and female health staff or vice versa in each center to avoid any limitation in examination of the female participants. practical information upon skin cancer risk factors and its early symptoms or signs along with any needed guideline of this screening project provided to them in a two-day course by an expert board certified dermatologist. an illustrated educational pamphlet in the case of the risk factors especially sun exposure, ways of prevention and early detection of skin cancer published and distributed in the health centers for general patient education. we invited all people over 40 years old to the mentioned health centers for complete skin examination in a one-week period on october 2008. we emphasized in these pamphlets and brochures that any bizarre or asymmetric skin lesion especially with change in shape, color and size might be important for screening. moreover, it has been advocated that any skin erosion or ulcer remained unimproved after one month should be examined by physicians. the participants would have undergone the whole-body skin examination by the trained physicians or health staffs. any lesion with bizarre or asymmetric shape, uneven color, increasing size, resistant ulcers or erosions considered as suspicious. patients with any suspected lesions were referred to the specialized dermatology clinics of shahid beheshti university of medical sciences for further evaluation of their lesions. all the participants were instructed about the study, and they signed the informed consent forms. a board certified dermatologist performed the whole-body skin examination for the referred patients and further evaluation particularly skin biopsy was done whenever needed. the skin examination was done by visual inspection and use of hand lens in the setting of proper lighting. the alarming signs including bizarre or asymmetric shape, uneven color, increasing size, resistant ulcers or erosions were considered for decision to perform skin biopsy. we could not use dermatoscope because of some limitation in the facilities. in the case of confirmed malignancies, the suitable treatment would be provided for the patients in the dermatology ward or referred to the proper department. all the data registered and the related questionnaires were completed. after gathering the data, statistical analysis was performed using the statistical software spss 16.0.0. in a one-week period of screening, 1314 patients, 194 males (14.8%) and 1120 females (85.2%), with mean age of 51.81 10.28 years were attended the allied health centers and underwent the whole-body skin examination. regarding the considerable attendance of female volunteers, most of them had indoor occupation especially being housewives. we had the data of the number of melanocytic nevi in 92.9% of the participants. 25% of them had less than 3 melanocytic lesions and 25% had more than 10 lesions. less than one percent of the participant had the positive personal history of skin cancer. we have found the personal history of non-skin cancers in 14 (1.1%) of participants. these were ovarian, prostate, breast and gastrointestinal carcinoma. physicians found suspected lesions in 182 (13.85%) of participants [142 (78%) females and 40 (22%) males] with possible diagnosis of bcc, scc or malignant melanoma which were located mostly on the head, neck and trunk [table 1]. these participants with suspected lesions were referred to the allied dermatology clinics of the university. all these patients underwent the whole-body skin examination by a board certified dermatologist and skin biopsy performed in 115 patients for the histopathological examination. table 2 shows the final diagnosis of suspected malignant skin lesions referred from the health centers. clinical diagnosis of suspected lesions by primary physician final diagnosis of the suspected lesions the diagnosis of skin cancer was finally confirmed by histopathology evaluation in 15 (1.14%) patients out of 1314 volunteers who participated in this skin cancer screening program [figures 1 and 2]. these malignancies include 10 (0.76%) cases of bcc, 2 (0.15%) cases of scc and 3 (0.23%) cases of malignant melanoma. two patients with bcc had positive personal history of breast and gastrointestinal cancers but no family history of skin and non-skin cancer found in these patients. thirty six (2.74%) cases of dysplastic nevus were also diagnosed in this study. in the case of confirmed malignancies, the proper treatment provided for the patients in the dermatology ward or surgery department. a morphoeic basal cell carcinoma found on the eyebrow of a middle-age man squamous cell carcinoma on the ear in an elderly man we found no significant difference in the number of common moles, multiple freckling, family history of skin and non-skin cancers between skin-cancer diagnosed patients and other participants. outdoor occupations and personal history of non-skin cancers was significantly higher in skin cancer diagnosed patients (p<0.05, chi-square test). early diagnosis of skin cancer is very crucial to improve the prognosis, for best treatment results, and increase the quality of life of the patient. in this regard, there are many studies upon skin cancer screening with valuable results upon the importance of early detection of skin malignancies. however, there is no strong evidence to establish whether there is a decrease in mortality due to regular physical examination of the skin. in this study, we find 15 cases (10 bbc, 2 scc and 2 malignant melanoma) of skin cancer. most of the participants in this campaign were housewives women and this could be due to the working hours of the public health centers that caused less attendance of male participants or those with outdoor jobs. if we could extend the active daily hours of screening to the evening, we could probably detect more skin cancers. regarding the high population of tehran, it would better screen more people or extend the campaign period to avoid this selection or estimating bias. however, this campaign was planned as pilot skin cancer screening program in tehran and its results and limitation could help us to design the large-scale screening program more definitely. there are different methods of skin cancer screening including population-based or targeted screening. planning of a population-based or mass skin cancer screening program needed considerable cooperation of different sectors including dermatology or health departments and it need substantial facilities for the project setting, announcement, training of the volunteered health staff, their remunerations and further diagnostic or treatment measure for the participants. well-trained physicians should be employed in order to reduce the false positive diagnosis and it may have great financial impact on the health care system. moreover, the current evidence seems to be insufficient to assess the balance of benefits and harms of mass screening for skin cancer. therefore, it might be more practical to perform the targeted screening programs for the high-risk groups such as patients with organ transplantation or those with the history of skin cancer or outdoor occupations. the media campaign increased the population awareness of skin cancers, promoted effective sun protection and make known the dangers of excessive uv-exposures. more educational activities for both patients and physicians regarding the skin cancer risk factors and their early signs and symptoms might be more beneficial and cost-effective to decrease the skin cancer mortality and morbidity. to the best of our knowledge, there was no similar study in iran to perform skin cancer screening and this study provides us useful information upon the profit and failure of a screening program. another limitation of this study was lack of comparison between different methods of skin cancer screening such as targeted or mass screening to provide more exact data upon the efficacy and cost-benefit of different methods of skin cancer screening. therefore, further controlled study could be beneficial to elucidate the more practical and cost-effective method of skin cancer screening in our country. this study gives us many practical clues to plan and perform large-scale skin cancer screening better.

background: early detection of skin cancers by screening could be very beneficial to decrease their morbidity or mortality. there is limited study about skin cancer screening in iran.aim:this essay was planned as a pilot skin cancer screening campaign in tehran, iran to evaluate its profit and failure and further design large-scale screening program more definitely. materials and methods: thirty one public health centers of shahid beheshti medical university were selected in different areas of tehran. the project was announced via media and invited all the people above 40 years old to come for the whole-body skin examination in a one-week period. patients with any suspected lesions were referred to the dermatology clinics of the university. results:1314 patients, 194 males (14.8%) and 120 females (85.2%), with mean age of 51.81 10.28 years participated in this screening campaign. physicians found suspected lesions in 182 (13.85%) of participants. the diagnosis of skin cancer was confirmed in 15 (1.14%) patients. these malignancies included 10 (0.76%) cases of basal cell carcinoma, 2 (0.15%) cases of squamous cell carcinoma and 3 (0.23%) cases of malignant melanoma. conclusion:skin cancer screening seems to be valuable to detect skin malignancies in their early course. regarding the considerable amount of facilities needed to perform skin cancer screening program, it might be more beneficial to perform the targeted screening programs for the high-risk groups or emphasis more on public education of skin cancer risk factors and their early signs.

PMC3884910

pubmed-126

renal clear cell carcinomas represent about 3% of all visceral cancers and account for 85% of renal cancers in adults. the tumours occur most often in older individuals, usually in the sixth and seventh decades of life, and are often diagnosed at incurable stages. in western countries the frequency of renal cancer remains relatively high, there being approximately 30,000 new cases and 12,000 deaths per year from the disease. the causes of kidney cancer are believed to be environmental (such as cigarette smoking, asbestos, petroleum products, heavy metals, unopposed oestrogen therapy, hypertension and obesity), genetic or a mixture of both. to date there are 19 hereditary syndromes described in which renal cell cancer may occur (table 1). genetic syndromes characterised by an increased risk of renal cancer (familial cancer database-facd, http://facd.uicc.org) the identification of genetic predispositions to renal cell cancer remains a priority since knowledge about the underlying molecular genetic basis of the disease will allow for a better understanding of the mechanisms giving rise to the disease and, perhaps more importantly, allow for the identification of individuals who are at risk of disease development. there are two aspects of these criteria that can be problematic in the clinical setting with respect to the identification of familial renal cell cancer patients. the first is the difficulty in fulfilling criteria in countries where large families and extensive pedigrees are impossible to identify, for whatever reason, even though the incidence of hereditary renal cell cancer may be quite high. second, the criteria do not take into consideration the existence of family cancer syndromes where renal cell cancer may occur in association with an extra-gastric malignancy. from a clinical perspective, there is a necessity to be able to identify hereditary renal cell cancer families with a minimum set of criteria that will provide a high likelihood of ascertainment. the aim of this study was to determine whether a minimum set of criteria could be established to identify suspected hereditary renal cell cancer patients when there is restricted information about the familial occurrence of disease. a total of 146 clear cell renal carcinoma (ccrc) patients comprising 3 groups were enrolled in the study. group a (familial renal cancer): comprising 46 patients affected by ccrc from 22 randomly selected families with at least two renal cancers among first or second degree relatives, independent of age at diagnosis of tumours. group a1 (nuclear pedigree): comprising 25 patients affected by ccrc from group a. none of the parents of these patients have been diagnosed as affected with renal cell cancer. group b: a total of 100 individuals diagnosed with ccrc between the years 1993 and 1997 irrespective of family history were collected from the city of szczecin (total population 400,000). the following inclusion features (if) for the identification of suspected hereditary forms of clear cell renal cancer were used and compared against one another for their sensitivity and specificity: if 1: at least one of the parents of the patient with ccrc was affected by lung cancer if 2: at least one of the parents of the patient with ccrc was affected by gastric cancer if 3: ccrc diagnosed at the age of 45 years or younger if 4: ccrc diagnosed at the age of 50 years or younger if 5: ccrc diagnosed at the age of 55 years or younger univariate statistical analysis (chi-squared, odds ratio (or), and sensitivity and specificity of selection were performed using the sas and logit programs. univariate statistical analysis (chi-squared, odds ratio (or), and sensitivity and specificity of selection were performed using the sas and logit programs. the comparison of the five ifs was undertaken to identify the most consistent criteria that can be employed in a clinical setting for the identification of suspected hereditary renal cell cancer, based on nuclear pedigree data. the first comparison was between group a (associated with a genetic predisposition to disease) compared to unselected cases from group b (table 2). the results indicate that all inclusion features are more frequent in group a (or 1.62-4.88). the second comparison was performed between group a1 and group b (table 3). the results indicate that there is a very strong correlation between hereditary (familial) predisposition to ccrc and occurrence of at least one of the following ifs: if1, if2 or if5-or 13.4; p<0.00001. the recognition of features that can be used for the identification of familial predispositions to ccrc in situations where extensive pedigree analysis is unknown or impossible to ascertain but the prevalence of the disease is relatively high in the population will aid in the identification of individuals at increased risk of developing ccrc. by using the criteria described herein and the consequent recognition of significant odds ratios for some of the inclusion features to identify ccrc families, we believe that the identification of additional genes associated with this malignancy will be expedited. of particular interest are the odds ratio values for the inclusion features if5 between groups a1 and b and if 1 between groups a1 and b, which were relatively high (6.21 and 6.09, respectively). since these inclusion features are significant we have a relatively high degree of confidence that the reported observations are not biased and are an accurate reflection of the validity of our approach for the identification of hereditary ccrc families. indeed, these criteria have been tested in our outpatient clinics to successfully identify hereditary ccrc. therefore if we have families matching if1 or if2 or if5, we are confident that a diagnosis of familial ccrc can be made. at present it seems reasonable to offer the option of ultrasonography examination to all individuals identified by the use of our inclusion features beginning at the age of 5 to 10 years before the youngest ccrc identified within the patient's family. such surveillance should only be an option and not a recommendation because the efficiency of such management procedures has not been rigorously determined to reduce morbidity and/or mortality. with respect to surveillance the real value of this will have to be established by studies on large cohorts of individuals from families matching pedigree and clinical criteria of suspected hereditary ccrc with identified constitutional dna variants associated with genetic predispositions. so far, the list of genetic changes associated with ccrc is somewhat limited but should be extended in the near future as more knowledge is gained about the genetic factors associated with altered ccrc predisposition. in summary, we advocate the use of our criteria for suspected hereditary clear cell renal cancer identified in this report in order to: a. offer an ultrasound examination option, b. create repositories of nuclear clear cell renal cancer families for future studies on the efficiency of surveillance for individuals with genetic predispositions to renal cancer, c. perform further studies to aid in the identification of genetic factors associated with ccrc.

renal clear cell carcinomas represent about 3% of all visceral cancers and account for approximately 85% of renal cancers in adults. environmental and genetic factors are involved in the development of renal cancer. although to date there are 19 hereditary syndromes described in which renal cell cancer may occur, only four syndromes with an unequivocal genetic predisposition to renal cell carcinoma have been identified: vhl syndrome (mutations in the vhl gene), hereditary clear cell carcinoma (translocations t(3:8), t(2:3)), hereditary papillary carcinoma (mutations in the met protooncogene) and tuberous sclerosis (mutations in the tsc1 and tsc2 genes). little is known genetically about the other forms of familial renal cell cancer. since there is a growing awareness about the necessity of early intervention, clinical criteria have been developed that aid in the identification of hereditary forms of renal cancer. the aim of the current study was to identify minimal inclusion criteria so that nuclear pedigree families can be ascertained for risk assessment and/or kidney tumour screening. the results reveal that inclusion features described herein, such as (a) renal clear cell cancer diagnosed before 55 years of age, and (b) renal clear cell cancer and gastric cancer or lung cancer among first degree relatives, are useful in identifying suspected hereditary clear cell renal cancer patients.

PMC2837295

pubmed-127

a 52-year-old female patient visited the hospital complaining of pain in both breasts. the pain started immediately after breast reduction surgery she underwent 3 years previously at a private plastic surgery hospital, and it had continued despite a subsequent surgery. the pattern of the pain included burning, shooting and itching sensations at the operation site as well as unbearable burning sensations when the patient was in the places where the temperature was higher than normal. the pain as measured by the visual analogue scale (vas) was approximately 70/100 mm. in particular, the degree of pain was dependent on the season, and it was unbearable under hot weather, with the patient complaining of pain at vas 80-90/100 mm. before coming to the hospital, the patient had taken aceclofenac (airtal, daewoong pharmaceutical) 200 mg, pregabalin (lyrica, pfizer) 300 mg, acetaminophen 1,300 mg and tramadol hcl 150 mg (ultracet, janssen korea) per day, but the pain was not relieved. thus, the patient tried pregabalin 600 mg, acetaminophen 1,300 mg and tramadol hcl 150 mg per day, but there was no effect. complaining of dizziness due to ultracet, the patient started to take 20 mg of oxycodone hcl (oxycontin, mundipharma korea) each day, but she eventually stopped taking it because of dizziness, nausea, and vomiting. subsequently, the patient underwent drug treatment with pregabalin 300 mg a day, but she visited the hospital because the pain did not subside. there was no specific finding in a simple plane chest x-ray spectrograph, while digital infrared thermographic imaging (diti) showed a slight temperature drop in both breasts. because the previous treatments were not effective in improving the symptoms and because the patient wanted another method of treatment due to the continued pain, it was decided that a thoracic epidural block would be performed, and informed consent was obtained from the patient. the patient was laid on her side and the epidural space was checked using the loss-of-resistance method with a 22-gauge epidural needle (hakko, japan) in between the t4 and t5, applying an aseptic technique in the interlaminar approach. 0.5% mepivacaine hcl (emcaine 2% inj. reyon pharm) 6 ml was then injected. the pain was relieved into the vas range of 40-50/100 mm after the procedure, and the patient was discharged. the vas was decreased to 40-50/100 mm after an additional procedure a week later, but the patient complained of continued pain. a decision was made to carry out prf to the spinal nerve and its root and. to measure the level and determine the effect, informed consent was received from the patient after she was provided with an explanation of the procedure and the side effects that may occur after the procedure. for the diagnosis, selective nerve root block (snb) was performed at t3, t4 and t5, one level each time in order with an interval of 2 days, by injecting 1% lidocaine 0.5 ml with a 25-gauge quincke needle (spinocan, bbraun). prf was carried out at the fourth thoracic spinal nerve and its root after giving an explanation to the patient about the procedure and the side effects that may occur after the procedure and receiving informed consent once again. after supporting the patient's lower abdomen with a pillow and placing her in a prone position, the site of the procedure was disinfected by a common sterilizing method and a standard monitor was attached. the area between t4 and t5 was identified in the anteroposterior view using a c-arm device and the 4 cm point right lateral from the t4 spinous process was chosen as the needle implantation point. local anesthesia was carried out with 1% lidocaine, and a 20-gauge 10 cm long rf cannula (owl sharp curved rf insulated cannula, diros technology inc., usa) with a 10 mm-active tip was then introduced into the anesthetized part. by continuously monitoring the position of the cannula with the c-arm, it continued to the inferior of end plate of fourth thoracic vertebral body (fig. 1), and the tip of the cannula was located at the posterior border of the vertebral space in the lateral view (fig. 3), and an rf generator (rfg-3c plus, radionics, usa) was then connected and an electric stimulus of 50 hz at 0.1 volt was applied. electric stimulus of 2 hz at 0.1 volt was applied, and it was verified that the muscle did not contract up to 0.8 volt. one minute after injecting 1% mepivacaine 1 ml, prf was performed two times for 120 seconds at 42. the same procedure was performed on the opposite side after one week. during the procedure, the vital signs of the patient were normal and no side effect took place. after the procedure, the pain was reduced to vas 20-30/100 mm. the patient currently undergoes oral administration of pregabalin 300 mg/day and nortriptyline (sensival, ilsung pharm) 10 mg/day and this was followed up at the hospital for 9 months without particular exacerbation of the pain or any other inconvenience in her daily tasks. pain after breast surgery, which is commonly complaint by patients, is known to be related with the injury, ischemia and inflammation of the soft tissue. if the pain in the affected part and arm continues for one year after the surgery, it is considered as chronic pain in general. the mechanism is not yet accurately known, but the chronic pain may be caused by injuries in various peripheral nerves that arise during the surgery and can develop into neuropathic pain such as stabbing, pricking, burning, shooting and sharp pains. wallace et al. investigated 282 women who underwent different types of breast surgery, and their result showed that 31% of women who underwent mastectomy, 49% of those who underwent mastectomy with reconstruction, 38% of those who underwent cosmetic augmentation and 22% of those who underwent breast reduction complained of pain up to one year after the surgery. particularly, as the survival rate of breast cancer patients has increased, the number of patients who complain of chronic pain after breast cancer survey has also increased. the patient in this case study was also a chronic neuropathic pain patient whose pain had continued for 3 years following breast reduction surgery. she complained of pricking, shooting and burning sensations at the site of the operation. although the patient complained of pain immediately after the surgery, she continued to suffer neuropathic pain for 3 years without being given appropriate pain treatment because she was not able to take medicine due to the side effects of the drugs. macrae stated that severe acute pain after the surgery may be a risk factor for chronic pain. this can be one possible cause of the chronic pain of the patient in this case report, because she complained severe pain at vas 70-80/100 mm immediately after the surgery but the pain was not properly controlled. in general, it is thought that the intercostal nerve (icn) from t1 to t6 and the nerves that originate from those braches can be damaged by breast surgery. for the patient in this case report, because she complained of the pain at the dermatome of the t4 spinal nerve, neuropathic pain caused by damage at the 4th icn and at the branch was suspected. the effect of a nerve block in controlling pain after breast surgery is well known. in particular, it was reported that a paravertebral block (pvb) reduced pain, nausea and vomiting after breast surgery. in addition, kairaluoma et al. reported that preoperative pvb reduced chronic pain after breast surgery. these results show that a nerve block can be used in controlling pain following breast surgery effectively, preventing it from becoming chronic. a nerve block using a local anesthetic is easy to perform in the treatment of pain and is effective in reducing pain. however, because the duration of desensibilization may not be sufficient depending on the disease causing the pain and because many repeated procedures may be required, radiofrequency thermocoagulation is sometimes employed to maintain the effect of the nerve block. radiofrequency thermocoagulation was first introduced in 1930 's by kirschner, who applied it treating trigeminal neuralgia at the gasserian ganglion. recently, the application of radiofrequency thermocoagulation in the case of various diseases has gradually increased as quality of the radiofrequency generator, the associated equipment, and the catheter needle has been improved. this treatment is highly advantageous, in that a more accurate lesion can be generated compared to other nerve-destructive procedures. moreover, the mechanism of radiofrequency thermocoagulation is known to change the nerve tissue due to the heat around the electrode, blocking and the inflow of the nerve stimulus. on the other hand, prf was introduced as a new method because another mechanism of radiofrequency-aided treatment arises in that a clinical effect is noted by the heat applied to the nerve and the electromagnetic field that forms around the electrode. prf is a radiofrequency-aided treatment in which pulsed radiofrequency stimulus of 20 msec is generated two times every 0.5 second at a temperature of 42, which is low enough for the nerve tissue to remain undamaged. prf is a novel treatment method that has corrected the problems of previous radiofrequency-aided treatments based on heat. it does not cause nerve destruction, side effects such as neuritis, or the complications of other types of radiofrequency-aided treatments based on heat. it can be performed to treat neuropathic pain even for body parts where side effects take place frequently due to radiofrequency thermocoagulation. it can be also performed on parts near bone or scar tissue, where the risk of complications is high when radiofrequency thermocoagulation is performed. rohof applied prf to the suprascapular nerve in the treatment of chronic shoulder pain and reported it to be a novel treatment method that is free from side effects or complications, in contrast to the conventional thermocoagulation. moreover, positive effects were reported when prf was applied to peripheral nerves such as the facial nerve, superior laryngeal nerve, suprascapular nerve, intercostals nerve, obturator nerve and the joint-dominating peripheral nerve articular branch, whose main nerve is sensory. in this case report as well, although the pain was controlled by an epidural block with a local anesthetic, repeated procedures were required due to the short duration of the first treatment. long-lasting pain reduction was achieved without any specific side effect, as the prf was carried out on the spinal nerve and its root under monitoring by a c-arm device. in this article, we report a case in which prf was applied to control the pain of a patient who came to the hospital complaining of chronic severe neuropathic pain at the operation site that arose after breast reduction surgery. appropriate pain control after breast surgery can reduce the suffering of the patient due to early pain and greatly affect the quality of life of the patient by preventing the pain from being chronic. if an appropriate pain treatment had been given after breast surgery to the patient in this case report, she would have not suffered from chronic pain. in the case of breast surgery, considerable attention should be paid to postoperative pain as well as surgical pain, and pain treatment should be carried out positively. it is thought that a nerve block as well as general analgesics can be helpful as a pain control strategy. in addition, prf may be helpful in reducing the pain of the patients who are not responsive to a nerve block using analgesics or local anesthetics. furthermore, additional studies are needed regarding the reduction of chronic neuropathic pain by prf after breast surgery.

breast surgery is a common procedure performed in women. many women who undergo breast surgery suffer from ill-defined pain syndromes. a nerve block is used in the treatment of the acute and chronic pain, but the effectiveness of the treatment has been limited because of its short duration. recently, the advent of pulsed radiofrequency lesioning (prf) has proved a successful treatment for chronic refractory pain involving the peripheral nerves. we experienced a case of a 52-year-old female patient complaining of chronic breast neuropathic pain after breast reduction, which was relieved after prf lesioning of the 4th thoracic spinal nerve and its root.

PMC3030046

pubmed-128

nature evolved a very limited number of chromophores in the different evolutionary branches of the tree of life because of the similar needs of the most diverse organisms for both the detection of the external world and the interaction with it. the study of these chromophores and their distribution inside cellular structures is usually based on extractive procedures, followed by biochemical or spectroscopic assays. extractive techniques often include disadvantages: they can modify the nature of the components and they are not successful in isolating the chromophores. direct investigation by means of microspectrophotometry of on intact samples has the advantage of preserving the integrity of biological structures or substructures. a microspectrophotometer is a simple apparatus consisting of a modified microscope that can measure absorption or emission spectra of very small areas inside a cell 1. a high quality microscope is equipped with a polychromator, i.e. a flat field concave grating, which is connected to the slit-shaped exit pupil of a 19 light-guides probe. the dispersion image of the exit pupil produced by the polychromator is focused onto a digital slow scan cooled ccd camera. the main feature of this instrumentation is the possibility to measure in vivo absorption or emission spectra at the same time on different sub-cellular compartments using extremely low light intensities. this set-up represents a better strategy with respect to traditional instruments, since it eliminates errors typical of microspectrophotometry, such as photobleaching, distributional errors, the schwarzschild-villiger effect, and allows in vivo reliable spectroscopic investigations 2, 3. the photosynthetic and the photoreceptive compartments are the main location of chromophores inside algal cells. absorption and emission spectra measured in vivo on these compartments can provide very precise and accurate information about the spectral range in which chromophore molecules capture photons in their natural environment and their de-excitation pathways 4. we tested our apparatus by measuring absorption spectra on the eyespot and chloroplast of the unicellular alga dunaliella and emission spectra on the photoreceptor and chloroplast of the unicellular alga euglena gracilis. cultures. euglena gracilis strain z (sammlung von algenkulturen gttingen, 1224-5/25) cells were grown axenically in cramer-myers medium 0.025 m in sodium acetate (ph 6.8) 5; cultures of dunaliella spp. (sammlung von algenkulturen gttingen, 19-5) were grown axenically in johnson's medium 6. both cultures were kept under constant temperature (24 c) and continuous illumination (2x10 mol photons m sec). the hardware platform consists of a zeiss axioplan microscope (zeiss, oberkoken, de), equipped with an epifluorescence system, 100x (n.a. the emission spectra were acquired with a combination of a uv-blue filter set (8 nm band pass excitation filter, 365 nm; chromatic beam splitter, 395 nm; barrier filter, 397 nm; irradiance 800 w/cm), and a blue-violet filter set (8 nm band pass excitation filter, 436 nm; chromatic beam splitter, 460 nm; barrier filter, 470 nm; irradiance 1100 w/cm). 77423 oriel, stratford, connecticut, usa) connected to a schott kl 1500 probe illuminator system (schott corporation, mainz, de) was mounted in the back focal plane of the ocular of the microscope (figure 1). this probe consists of an outer bundle of 24 light-guides and a central bundle of 19 light-guides (figure 2a). the outer bundle is used for centering the objects, while the central bundle of the probe is used for acquiring transmitted or emitted light. the sub-cellular components on which the spectra have to be measured, are placed in the microscope field and finely adjusted. the exit pupil of the probe (figure 2b) is connected to a flat field imaging concave grating polychromator (mod. 52300070, jobin yvon, longjumenau, france) that produces a dispersion image of the probe. this image is in turn focused onto a digital slow scan cooled ccd camera (dta discovery ds260e, pisa, italy), and it consists of 19 multi-lines strips showing the distribution of light intensity according to the wavelength. the microspectophotometer instrumentation possesses a graphical interface that allows the set-up of both the optics and the frame grabber (scion corporation, frederick, maryland, usa) and controls the measurements. once the instrumental has been set-up, the operator, on the basis of the light guide positions upon the cell, selects the zones of the dispersion image displayed on the top of the graphical layout (in the layout r stands for reference, and s for sample). the resulting spectrum is displayed at the bottom of the graphical layout, (figure 3). absorption measurements are based on the comparison of two radiant fluxes density is and ir. is results from the interaction of light with the sample (it is related to absorption cross section of the molecules and the number of absorbing molecules) 7, while ir results from the interaction of light with the reference material. therefore, we can consider the absorbance of a sample (as) as derived from the measures as follows: this equation is known as the lambert-beer's law. for the discussion on the theoretical aspects of image formation and the light transmission in microspectrophotometry see barsanti et al. absorption spectra were performed on both the eyespot (screening device) and the chloroplast (photosynthetic apparatus) of the unicellular alga dunaliella. the central bundle of the probe was centered on both the structures in the apical portion of the cell (is), in such a way that some light-guides were located outside the cell; these guides measure ir. measurements of emission microspectroscopy are based on the radiant flux density f. this density is given by: where ia is the amount of light absorbed by the chromophores; f is their fluorescence quantum yield and z represents the fraction of fluorescence collected by the objective, 9. emission spectra were performed on both the photoreceptor and chloroplast of the photosensitive alga euglena gracilis. the outer bundle of the probe was used for centering the photoreceptor and the chloroplast in the apical portion of the cell, while the central bundle of the probe was used for acquiring light emitted by the two structures. photographs were taken with an olympus camedia c-30303 digital camera (olympus, tokyo, japan) mounted onto the microscope. the eyespot is recognizable as a the bright orange spot located on the left side of the cell in the apical portion. the size of the eyespot is about 3 and the size of the chloroplast is about 10; the probe is superimposed on the structures in order to show their relative position (figures 4b). this spectrum closely resembles the spectrum obtained by batra and tollin 10 on a suspension of eyespot granules, and the other in vivo spectra previously recorded by strother and wolken 11, by benedetti et al. major peaks are due to lutein whose bands are centered at 410, 479.5, and 510 nm and -carotene whose bands are centered at 455.5, 481.5, and 510.5 nm (not shown). it clearly shows that dunaliella belongs to the green lineage of eukaryotic algae since only chlorophylls a and b and carotenoids are present in this spectrum. gaussian bands decomposition of this spectrum is easily explained as a combination of chlorophyll a bands centered at (410, 435, 444, 585, 615, 626, 634.5, 663, 672, 678, 683, 695 nm, chlorophyll b bands centered at 412, 428.5, 445, 452, 582, 594, 607, 621.5, 652 nm, and carotenoids lutein and bands centered at 410, 479.5, and 510 nm, (not shown), 14. the photoreceptor is recognizable as a the bright green spot located in the apical portion of the cell. the size of the photoreceptor is about 2 and the size of the chloroplast is about 10; the probe is superimposed on the structures in order to show their relative position (figure 6b). figure 7a shows the emission spectrum of a single photoreceptor under 436 nm excitation light, after 10 seconds of excitation with the 365 nm light. gaussian bands decomposition of the emission spectrum reveals 3 bands with different intensity centered at about 500 nm, 525 nm, and 556 nm (not shown). the bands obtained by the gaussian decomposition indicate the presence of a mixture of very similar conformers in the photoreceptor, each one capable of photocycling between a non-fluorescent parent species and a fluorescent excited species 15. the presence in the photoreceptor of euglena of a photochromic chromophore, which undergoes light-driven reversible photochromism has been well established by means of digital and fluorescence microscopy 16. the photoreceptor possesses optical bistability, i.e. upon photoexcitation the ground state generates a stable excited state, which can be photochemically driven back to the ground state. the 27 kda protein extracted from the photoreceptor shows a similar behavior, the photochromic reaction cycling between two different stable conformers, the parent and the excited conformers 17. figure 7b shows the emission spectrum of the thylakoid compartment of euglena gracilis excited at 463 nm. it is the typical emission spectrum of a chloroplast that contains only chlorophyll a and b whose bands are centered at 685 for the photosystem ii and at 725 nm for the photosystem i, 18. set-up of the polychromator-based microspectrophotometer entrance (a) and exit (b) pupils of the light guide probe layout of the software interface a) bright field image of dunaliella. b) position of the probe upon dunaliella absorption spectra of the eyespot (a) and a chloroplast (b) of dunaliella a) fluorescent image of euglena gracilis; b) position of the probe upon euglena gracilis emission spectra of the photoreceptor (a) and a chloroplast (b) of euglena gracilis

a microspectrophotometer is a digital microscope used to measure absorption and fluorescence spectra. in this paper we describe a polychromator-based microspectrophotometer that performs in vivo absorption or emission measurements at the same time on different subcellular compartments such as photoreceptive and photosynthetic structures of algal cells. in this system, a flat field imaging concave grating polychromator is connected to the slit-shaped exit pupil of a light-guide probe mounted onto a microscope equipped with an epifluorescence module.the subcellular components, on which the spectra will be measured, are placed in the microscope field and finely adjusted. the outer bundle of the probe is used for centering the objects, while the central bundle of the probe, containing 19 light guides, is used for acquiring either transmitted or emitted light (i.e. fluorescence). the light transmitted or emitted by the subcellular components is collected by the probe mounted in the back focal plane of the ocular. the exit pupil of this probe, connected to a flat field imaging concave grating polychromator, produces a dispersion image that in turn is focused onto a digital slow scan cooled ccd camera. absorption and emission spectra of algal subcellular compartments are presented

PMC1852396

pubmed-129

the rostral ventromedial medulla (rvm) is an important relay region that contributes to the descending pain control pathway from the periaqueductal gray (pag) to the superficial laminae (laminae i and ii) of the spinal cord [1, 2]. it is well known that the rvm is closely linked to long-lasting activation of descending control circuits that involve descending facilitation, which significantly contributes to the development of persistent pain induced by tissue and nerve injury. although many studies have focused on this region, the cellular and molecular mechanisms of descending pain facilitation control remain poorly understood. due to the role of the descending pain facilitation pathway, several types of injuries, such as tissue and nerve injury, often become chronic and persistent, eventually leading to neuropathic pain., significant progress has been made in basic and clinical studies; however, the currently available therapies for neuropathic pain remain inadequate, and the search continues not only for improved treatments but also for novel targets. the mammalian target of rapamycin (mtor), a conserved serine-threonine protein kinase that is inhibited by the effective clinical immunosuppressant rapamycin, regulates several intracellular processes in response to various extracellular signals and thereby modulates mrna translation. thus, mtor plays a critical role in the modulation of long-term plasticity and memory processes [57]. activation of the mtor complex with the protein raptor (mtorc1) promotes the phosphorylation of mtor downstream targets, including eukaryotic initiation factor 4e-binding protein (4e-bp1/2) and s6 kinase (s6k), which can further lead to local protein synthesis. it has been reported that deletion of either the 4e-bp1/2 or the s6k gene in mice results in deficits in synaptic plasticity and long-term memory [8, 9]. moreover, phosphorylated mtor (p-mtor), which is the activated form, is upregulated in the peripheral nervous system as well as at the spinal cord level in several pain models [1015]. inhibition of spinal cord mtor by intrathecal administration has proven to be effective in alleviating the nociceptive behaviors of animals under pain conditions [10, 11, 16, 17]. synaptic plasticity changes in chronic pain conditions can occur not only at the spinal cord level but also at the supraspinal level, including the rvm. therefore, considering the important role of the rvm in descending pain facilitation, targeting mtor in the rvm might be a promising way to combat pain. because serotoninergic (5-htergic) neurons are the primary constitutive element in the rvm and can send projections to the superficial spinal dorsal horn (sdh) [1820], we thus hypothesize that 5-htergic spinally projecting neurons in the rvm contain mtor, the activation of which could in turn increase the excitability of the 5-htergic neurons and thus may potently potentiate the descending facilitation pain control pathway and exaggerate neuropathic pain conditions. accordingly, we used a spared nerve injury (sni) model to evaluate the role of mtor in the rvm in neuropathic pain in rats. adult male sprague-dawley (sd) rats (weighing 250290 g) were used in the present study. the ethics committee for animal experiments of the fourth military medical university (xi'an, china) approved the animal experiments (permit number: 10071). briefly, rats were anesthetized with pentobarbital (45 mg/kg, i.p.), and three terminal branches of the sciatic nerve were exposed by direct incision of the skin and a section of the biceps femoris muscle in the left thigh. the tibial and common peroneal branches were carefully tight-ligated with 5-0 silk sutures and sectioned distal to the ligation, removing 24 mm of the distal nerve stump. the surgical procedures for the sham-operated group were identical to those for the sni group, except that the nerves were not lesioned. mechanical allodynia, as a behavioral sign of sni-induced neuropathic pain, was assessed by measuring the 50% paw withdrawal threshold (pwt) as described previously. the 50% pwt in response to a series of ascending von frey filaments (stoelting, kiel, wi, usa) was determined by the up-and-down method. von frey force was delivered perpendicularly to the plantar surface of the hind paw for 2 to 3 seconds. an abrupt withdrawal of the hind paw during stimulation was recorded as a positive response. the 50% pwt was calculated using the following formula: 50% pwt=10. mechanical allodynia was assessed by measuring the 50% pwt of the ipsilateral hind paw in sni- or sham-operated rats. measurements of the paw withdrawal latency (pwl) were obtained using a timer that was started by the activation of the heat source and stopped when withdrawal of the paw was detected with a photodetector. three measurements of the pwl were taken for each hind paw and were averaged as the result of each test session. the ipsilateral hind paw was tested with intervals of more than 5 min between consecutive tests. fluoro-gold (fg) was used as a retrograde tracer to label the rvm neurons that project to the sdh. the procedures for fg injection were essentially the same as in our previous studies [20, 27]. briefly, after exposing the lumbar cord, 0.1 l of a 4% solution of fg (fluorochrome, denver, co, usa) dissolved in 0.9% saline was stereotaxically injected into the left side of the lumbar dorsal horn with a microsyringe attached to a glass micropipette by pressure injection. due to the transportation period of the tracer, after perfusion, the brains and spinal cords of the rats were cut into sections. the sections were used to evaluate the fg injection sites in the sdh as well as the distribution patterns of the retrogradely fg-labeled neurons in the rvm under an epifluorescence microscope (bx-60; olympus, tokyo, japan) using an appropriate filter for fg (excitation 350395 nm; emission 430 nm). after the rats were anesthetized with pentobarbital (45 mg/kg, i.p.), a 26-gauge stainless steel guide cannula was stereotaxically implanted into a site above the rvm (10.52 mm posterior to bregma, 0 mm lateral from the midline, and 10.20 mm beneath the surface of the skull). intra-rvm microinjections were delivered via a 33-gauge injector needle cannula that was lowered 0.5 mm deeper into the brainstem than the guide cannula. the microinjection apparatus consisted of a hamilton syringe (10 l) connected to an injector (33-gauge) by a thin polyethylene tube and a motorized syringe pump. rapamycin (250 m/1 l, dissolved in a saline/dmso mix comprising 25% dmso, tocris bioscience, minneapolis, mn, usa), the specific inhibitor for mtor, was infused into the rvm at a rate of 0.1 l/min; an equivalent volume of 25% dmso was used as a vehicle. after injection, the microinjection needle was left in place for at least 2 min. the injection sites were verified at the end of all of the experiments by nissl staining, and injection sites outside the rvm region were excluded from the study. these rats were randomly divided into two groups designed for different purposes, as shown in figure 6(c): group 1: to investigate whether rapamycin could influence the induction stage of sni-induced neuropathic pain, behavioral tests were performed before the first drug or vehicle injection, followed by sni (pre-sni), and 30 min after the second injection on day 1 after sni (sni-d1) (figure 6(c), top) and group 2: behavioral tests were performed before sni (pre-sni), 6 days after sni (sni-d6), and 30 min after drug or vehicle injection on day 7 after sni (sni-d7) for the purpose of demonstrating the effect of rapamycin on the maintenance stage of sni-induced neuropathic pain (figure 6(c), bottom). the rats were transcardially perfused with 150 ml of 0.01 m phosphate-buffered saline (pbs, ph 7.4), followed by 500 ml of 4% paraformaldehyde in 0.1 m phosphate buffer (pb, ph 7.4). the brainstems and/or spinal cords were transversely sliced into 25 mm thick coronal sections using a freezing microtome (cm1950, leica, heidelberg, germany). double-immunofluorescence staining for p-mtor/neun, p-mtor/fg, or p-mtor/5-ht was performed. the sections were sequentially incubated at room temperature with primary antisera in 0.01 m pbs containing 5% normal donkey serum (nds), 0.3% triton x-100, 0.05% nan3, and 0.25% carrageenan (pbs-nds, ph 7.4) for 24 h. then, the sections were incubated with fluorescein-labeled igg (secondary antisera) for 6 h. a negative control experiment, in which the primary antisera were omitted, and a peptide competition assay were both carried out. after the immunofluorescence histochemical staining, the sections were observed and images were captured using a confocal laser-scanning microscope (clsm, fv1000, olympus). micrographs of 1012 sections per rat, which were 150 m apart within bregma 9.30 to 11.60 mm, were analyzed for p-mtor expression. using imagej software, the rvm area, including the nucleus raphe magnus (rmg) and the nucleus reticularis gigantocellularis pars, the p-mtor-positive cells within the area were counted manually by an observer blinded to the treatment conditions. the same counting method was used to evaluate the coexpression of 5-ht/p-mtor as well as that of p-mtor/fg within the rvm. cells with visible green cytoplasmic staining represent 5-htergic or fg-labeled cells, while red staining represents p-mtor-positive cells; thus, cells with 5-ht or fg double-labeling with p-mtor appear yellow. the rats were decapitated, and brain slices (400 mm) containing the rvm were cut at 0c with a vibratome (vt1200s, leica) in a sucrose cutting solution containing the following (in mm): kcl 2.5, nah2po4 1.2, nahco3 26, sucrose 252, mgso47h2o 6, cacl2 0.5, and glucose 10, bubbled with 95% o2/5% co2 (ph 7.4). for the electrophysiology studies, the brain slices were transferred to a submerged recovery chamber with oxygenated artificial cerebrospinal fluid (acsf) containing the following (in mm): nacl 124, kcl 2.5, mgso47h2o 2, nah2po4 1, nahco3 25, cacl2 2, and glucose 37 for 2 hours at room temperature before recording. for the biochemical experiments, the slices were slowly brought to a final temperature of 30c in acsf gassed with 95% o2/5% co2 and incubated for at least 1 hour before the experiments. the brain slices were treated with rapamycin (250 m) and vehicle for 30 min. subsequently, the rvm regions were microdissected and snap-frozen over dry ice. following the standard western blot protocol, rats were anesthetized with an overdose of pentobarbital (60 mg/kg, i.p.), and the rvm regions were carefully dissected and harvested for western blotting. to obtain total protein extracts, the tissues were lysed in 300 l lysis buffer containing 10 mm tris, 150 mm nacl, 1% triton x-100, 0.5% np-40, and 1 mm edta at ph 7.4. the samples were adequately mixed at a 100: 1 (v/v) ratio of protease inhibitor cocktail and phosphatase inhibitor cocktail (roche, tucson, az, usa). the procedures for the in vitro-infused brain slices were similar to those of the tissue protocols. then, 30 g of cell lysis material (quantitatively measured using the bca protein assay; thermo scientific, rockford, il, usa) was resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (sds-page) and transferred to pvdf membranes (immobilon-p, millipore). after blocking in nonfat milk for 1 h, the membranes were incubated overnight at 4c with the following primary antibodies: rabbit anti-mtor (1: 1000, cell signaling technology); rabbit anti-p-mtor (1: 1000, cell signaling technology); rabbit anti-s6k (1: 1000, cell signaling technology); rabbit anti-p-s6k (1: 1000, cell signaling technology); and mouse anti--actin (1: 5000, sigma, st. the immunoblots were then reacted with the corresponding horseradish peroxidase- (hrp-) conjugated secondary antibodies (anti-rabbit 1: 5000, anti-mouse 1: 5000; amersham pharmacia biotech, piscataway, nj, usa). all of the reactions were detected by the enhanced chemiluminescence (ecl) detection method (amersham) and exposure to film. target protein levels were normalized against -actin levels and expressed as fold changes relative to the nave control group. neurons in the rvm region were targeted for recording using an upright microscope equipped with zeiss (oberkochen, germany) infrared-differential interference contrast (ir-dic) optics, a 40 water-immersion objective, and a video-imaging camera. the patch pipette was filled with intracellular solution containing the following (in mm): k-gluconate 130, nacl 5, kcl 15, egta 0.4, hepes 10, mg-atp 4, and tris-gtp 0.2, ph 7.257.35, with an osmotic pressure of 290300 mosm/l. the pipette resistance, as measured in the bath, was typically 4 0.5 m. the voltage was held at 60 mv, and neurons were given at least 3 min to stabilize before data were collected. spontaneous discharge and the number of action potentials were used to investigate sni-induced changes in neuronal excitability in the rvm. the excitatory postsynaptic currents (epscs) of the rvm 5-htergic neurons, which are mediated by ampa receptors, were voltage-clamped and recorded at 60 mv with an axon 700b amplifier (molecular devices, sunnyvale, ca, usa) after blocking gabaergic transmission by picrotoxin (100 mm, sigma), a gabaa receptor antagonist. the membrane excitability of the recorded neurons was measured in current-clamp mode by determining the number of action potentials elicited by intracellular injection of 0, 10, 20, 30, 40, 50, and 60 pa depolarizing currents for 400 ms. the spike number was determined to estimate the influence of rapamycin on the recorded neurons. in all cases, biocytin (0.5%) was introduced into the intracellular solution to identify the morphological properties of the recorded neurons. after recording, the brain slices were immediately fixed in 4% paraformaldehyde in 0.1 m pb for 4 h at room temperature. then, sections were rinsed with 3% hydrogen peroxide in 0.01 m pbs for 30 min. after thorough washing with pbs, the tissue was incubated with a goat anti-5-ht (1: 500, immunostar) antibody in pbs-nds (ph 7.4) for 24 h, followed by incubation with alexa 594 avidin d (1: 1000, invitrogen) and alexa 488 donkey anti-goat (1: 500, invitrogen) antibodies in pbs for 6 h at room temperature. the sections were then observed, and images were captured with a confocal microscope (olympus). two-way anova with bonferroni multiple comparisons tests or one-way anova with tukey's multiple comparisons post hoc tests were used for between-groups comparisons (e.g., the western blot data with surgery and drug administration as main effects). student's paired t-test was used to analyze the differences between two groups (e.g., the difference in the numbers of p-mtor-positive cells between the sni-induced neuropathic pain group and the sham group). spared nerve injury (sni) produced increased nociceptive responses to innocuous mechanical stimulation (mechanical allodynia) of the ipsilateral hind paw in rats from as early as post-sni operation day 1, and this effect was maintained for at least 2 weeks (figure 1(a)). however, sni had no impact on the latency of withdrawal to the radiant heat stimulus (no thermal hyperalgesia) (figure 1(b)). in fact, our present data are consistent with a previous report demonstrating that the low mechanical threshold induced by sni could persist even for 9 weeks after surgery, but there was no reported decrease in the hind paw withdrawal latency to the radiant heat stimulus. by using double-immunofluorescence staining, we found that the activated form of mtor, p-mtor, was expressed in the rvm, and it was exclusively expressed by neurons based on the observation that p-mtor was almost completely colocalized with neun, a marker for neurons, in rats in both the sham (figures 2(a)2(c)) and post-sni day 7 groups (figures 2(d)2(f)). we observed that the number of p-mtor-positive neurons was significantly increased in the rvm on day 7 after sni compared to the sham group (figures 2(a), 2(d), and 2(f)), indicating that activation of mtor in the rvm may contribute to sni-induced neuropathic pain. it has been reported that s6k, a main downstream substrate for mtor, is involved in several intracellular processes, including neuronal plasticity and long-term memory. therefore, we used western blot analysis to further evaluate the mtor signaling pathway, including mtor and s6k, in the rvm after sni. compared with nave control rats, the expression of both phosphorylated mtor and phosphorylated s6k (p-mtor and p-s6k) was not significantly altered in the sham rats (figures 2(h), 2(i), and 2(k)). as indicated in figure 2(h), p-mtor and p-s6k were significantly elevated in the rvm 3 days after sni, and phosphorylation was maintained for at least 14 days compared to the control group (figures 2(h) and 2(i); p-mtor: sni d3: 1.42 0.25; sni d7: 1.86 0.39; sni d14: 1.49 0.28-fold of naive control, p<0.05; p-s6k: sni d3: 1.75 0.23; sni d7: 1.96 0.57; sni d14: 1.61 0.28-fold of nave control, p<0.05, n=4). the change in p-s6k was similar to that in p-mtor, indicating that the mtor signaling pathway in the rvm was activated by sni 3 days after surgery. compared with the nave control group, p-mtor and p-s6k expression was slightly increased, but no significant difference was detected at 1 day after sni (figures 2(h), 2(i), and 2(k), p-mtor: sni d1: 1.17 0.36-fold of nave control, p>0.05; p-s6k: sni d1: 1.14 0.38-fold of nave control, p>0.05, n=4). total mtor and s6k were not changed in any of the groups in the present study (figures 2(h), 2(j), and 2(l)). in summary, these data suggest that the mtor signaling pathway, including mtor and s6k, was activated in the rvm, which might indicate new protein synthesis and could result in changes in neuroplasticity. injections of fg into the lumbar sdh (figure 3(a) and 3(b)) resulted in many retrogradely labeled spinally projecting neurons in the rvm (figure 3(d)). although fg was injected unilaterally into the (left) lumbar sdh, 81.9% (203/248) of the retrogradely labeled spinally projecting neurons contained p-mtor-immunoreactive (ir) staining (figures 3(c)3(e)), which indicates that more than three-quarters of the spinally projecting neurons in the rvm express p-mtor. because 5-htergic neurons have previously been shown to be involved in the descending pain control pathway, particularly those localized within the rvm, we further investigated the relationship between 5-ht and p-mtor. our immunofluorescence staining results showed that a majority of the p-mtor-ir neurons contained 5-ht (figures 4(a)4(f)). the number of 5-htergic neurons was slightly increased within the rvm in the sni rats, but no statistical significance was detected compared to the sham control group (25.52 5.13 per section in the sni d7 group versus 20.8 4.02 in the sham control group, n=3 rats/group, p>0.05). interestingly, 5-ht-positive p-mtor-ir neurons were remarkably increased in the rvm 7 days after sni compared to sham rats (figure 4(g)). in contrast, 5-ht-negative p-mtor-ir neurons were not significantly altered 7 days after sni (figure 4(h)). these results indicate that sni-induced neuropathic pain caused a substantial upregulation of p-mtor, which primarily occurred in 5-htergic neurons in the rvm. as reported previously, rapamycin is a specific and effective inhibitor of mtor. to investigate the inhibitory effect of rapamycin in vitro, we incubated brain slices containing the rvm with rapamycin (250 m) for 30 min. we found that sni significantly increased the expression of both p-mtor and its downstream substrate p-s6k (figure 5(a), p-mtor: sni d7+vehicle: 1.80 0.48-fold of sham+vehicle, p<0.05; p-s6k: sni d7+vehicle: 1.77 0.45-fold of sham+vehicle, n=4, p<0.05), which is inconsistent with our tissue western blot data. moreover, rapamycin (250 m) significantly reversed the upregulation of p-mtor as well as p-s6k after 30 min of drug infusion (p-mtor: sni d7+rapamycin: 1.11 0.27-fold of nave control versus sni d7+vehicle: 1.80 0.48-fold of nave control, p<0.05; p-s6k: sni 7d+rapamycin: 1.17 0.29-fold of nave control versus sni d7+vehicle 1.77 0.45-fold of nave control, n=4, p<0.05), indicating that rapamycin could rapidly inhibit the activation of mtor after sni in vitro. to further investigate the neuronal excitability of 5-ht and the effect of rapamycin on 5-htergic neurons in the rvm a total of sixty 5-ht-positive neurons (n=60) from 12 rats were identified by biocytin introduction in combination with 5-ht immunofluorescence staining (figure 5(b)). moreover, they showed a relatively higher membrane capacitance (cm) and a smaller membrane resistance (rm) compared to other small neurons in the rvm, indicating that they have a larger membrane surface and smaller electrical resistance. we first investigated the frequency and amplitude of spontaneous excitatory postsynaptic currents (sepscs) in the rvm neurons. most of the 5-htergic neurons recorded in the rvm that were responsive to rapamycin showed increased activity. inconsistent with previous reports, the frequency and amplitude of sepscs were significantly increased after sni (figures 5(c)5(f)), which indicates that the probability of presynaptic transmitter release and the postsynaptic neuronal excitability, respectively, was elevated. subsequently, we used rapamycin (250 m) to evaluate whether the enhanced presynaptic and postsynaptic excitability could be reversed. we found that the amplitude (baseline, 45.26 1.89 pa; rapamycin, 35.83 2.58 pa. p<0.05, n=15, paired t-test), but not the frequency (baseline, 3.41 0.12 hz; rapamycin, 3.29 0.33, p>0.05, n=15, paired t-test), of the sepscs was inhibited by rapamycin application in rats with sni but not in the sham control rats (frequency: baseline, 1.22 0.11 hz; rapamycin, 1.20 0.19 hz. p>0.05, n=15, paired t-test; amplitude: baseline, 29.79 1.80 pa; rapamycin, 28.14 1.28 pa. p>0.05, n=15, paired t-test) (figures 5(c)5(f)). these results suggest that rapamycin can decrease the postsynaptic excitability of 5-htergic neurons in the rvm after sni. we next compared the effects of rapamycin on the action potentials of the 5-htergic neurons and determined that the spike number of the recorded neurons was obviously increased after sni (figures 5(g) and 5(h)). rapamycin (250 m) did not change the spike number in recorded neurons from the sham group (f(1,62)=2.25, p>0.05, n=15, two-way repeated measures anova) (figure 5(g)). however, in the presence of rapamycin, the spike number of 5-htergic neurons in the sni group was significantly reduced (f(1,48)=8.56, p<0.05, n=15, two-way repeated measures anova) (figure 5(h)). these results indicate that rapamycin inhibited the excitability of 5-htergic neurons in the rvm under neuropathic pain conditions. we preliminarily investigated nociceptive behaviors in the sni rats mentioned above. in agreement with previous reports, significant mechanical allodynia rather than thermal hyperalgesia was observed in the present study (figure 1). based on this observation, we next used mechanical pwt instead of heat pwl to assess the nociceptive behaviors. to determine whether rapamycin could prevent the development of the induction stage of mechanical allodynia, we microinjected rapamycin via a cannula implanted into the rvm (figures 6(a) and 6(b)) immediately before sni surgery and at day 1 after sni, which was followed by behavioral testing 30 min later (figure 6(c)). after treatment with rapamycin, the pwt in the sni+rapamycin group showed no significant change compared to that in the sni+vehicle control group at day 1 after sni (figure 6(d)), indicating that rapamycin could not alleviate the neuropathic pain induced by sni in the induction stage. subsequently, we investigated whether rapamycin could reverse established neuropathic pain. on day 6 after sni, the rats demonstrated typical increased nociceptive responses to nonnoxious mechanical stimulation (figure 6(e)). compared with the vehicle control group, the mechanical allodynia was significantly reduced after microinjection of rapamycin into the rvm on day 7 after sni (figure 6(e)). because our biochemical results showed that the amount of both p-mtor and p-s6k was increased after sni (figures 2(h), 2(i), and 2(k)) and because rapamycin infusion into the brain slices could effectively reverse the upregulated level of p-mtor and p-s6k (figure 5(a)), we concluded that the effect of rapamycin in partially reversing the mechanical allodynia was exerted via inactivation of the mtor signaling pathway, thus decreasing the excitability of 5-htergic spinally projecting neurons in the rvm. in the current study, we provide the first demonstration of the following: (1) mtor is expressed in the rvm region and can be activated in nerve injury-induced neuropathic pain; (2) this mtor is largely expressed in 5-htergic neurons, which mainly comprise the descending pain control pathway; (3) inhibition of the activated mtor restores the overexcitability of the 5-htergic neurons to normal; and (4) inactivation of mtor by intra-rvm rapamycin microinjection alleviates established hyperalgesia (abolished at the maintenance stage of neuropathic pain) rather than influencing the beginning priming (induction stage) of neuropathic pain. these findings suggest that the mtor signaling pathway in the rvm is involved in the maintenance of nerve injury-induced neuropathic pain and that inhibition of mtor in the rvm could effectively alleviate neuropathic pain in sni rats. due to the importance of the descending pain control pathway in mammals, it has been demonstrated that blockade of rvm activity with lidocaine produced conditioned place preference (cpp), which is linked to pain relief, in nerve injury models, indicating that descending pain facilitation pathways modulate injury-induced spontaneous tonic pain. wei et al. have reported that selectively depleting functional 5-ht phenotypes in rvm neurons with shrna interference (rnai) of tryptophan hydroxylase-2 (tph-2, the rate-limiting enzyme in the synthesis of neuronal 5-ht) attenuated tissue or nerve injury-induced allodynia and hyperalgesia. this finding provides strong evidence that descending 5-ht from the rvm is an important contributor to pain facilitation during the development of persistent pain. recently, by taking advantage of optogenetic methods, optogenetic stimulation in tph2-channelrhodopsin 2 (chr2) transgenic mice was shown to decrease both mechanical and thermal pain thresholds. however, in contrast, several studies showed the opposite results [3235], that 5-ht from the rvm is important for the descending inhibitory pathway. these controversial arguments regarding whether rvm 5-ht plays a facilitatory or inhibitory role might be explained by the different subtypes of 5-ht receptors located in the sdh, according to the reports. for example, 5-ht3 receptors are reported to mediate descending facilitation and to contribute to pain hypersensitivity, whereas the activation of 5-ht2 receptors can potentiate glycine release in the sdh to inhibit pain transmission. in addition, a previous study also provided evidence that, under conditions of experimental pain, activation of 5-ht7 receptors leads to antinociceptive effects in the spinal cord. in the present study, we found that 5-htergic neurons were slightly, although not significantly, increased after nerve injury. however, the excitability of these 5-htergic neurons was elevated after sni (figure 5). rapamycin could effectively inhibit 5-ht overexcitability and thus attenuate hyperalgesia (figure 6), which indicates that 5-ht in the rvm is probably involved in the descending pain facilitation pathway under nerve injury-induced neuropathic pain conditions. mtor has been extensively studied in tumors, cardiovascular diseases, and neurodegenerative disorders [40, 41]. recently, emerging evidence has indicated that mtor plays a role in pain processing, and it is becoming clear that mtor is important in the regulation of nociception, at both the peripheral and spinal cord levels [1017]. to date, however, no report has investigated mtor at the supraspinal level and its role in nociceptive modulation. here, we provide potent evidence that mtor contributes to neuropathic pain by increasing the neuronal excitability of 5-htergic neurons in the rvm, thus potentiating descending pain facilitation. 4e-bp1/2 and s6k are involved in the regulation of cell physiology through the modulation of protein synthesis. 4e-bp1/2 inhibits the interaction of the cap-binding translation initiation factor eif4e with other elongation factors, which is a key regulatory process in translation. mtor-mediated phosphorylation of 4e-bp1/2 releases this inhibition, allowing translation initiation to proceed. s6k-mediated phosphorylation of s6 promotes the unwinding and initiation of translation of a subgroup of mrnas called 5-terminal oligopyrimidine tract (top) mrnas. top mrnas encode ribosomal proteins and elongation factors 1a and 2, which are important in translational control. in the present study, we detected that p-mtor and p-s6k levels were significantly elevated in the rvm after sni (figure 2), which suggests that mtor-mediated protein translation and synthesis are increased. in contrast, the number of 5-htergic neurons was slightly increased within the rvm in the sni rats, but no statistical significance was detected compared to the sham control group. however, by using whole-cell patch recording, we found that the 5-htergic neurons were overexcited, with significant increases in the amplitude and frequency of sepscs as well as the number of action potentials (figure 5). in addition, rapamycin inhibited only the amplitude and not the frequency of sepscs (figure 5); we thus propose that the postsynaptic overexcitability of the 5-htergic neurons, which primarily depends on an increase in glutamate receptors, is mainly due to the activation of mtor. it has been reported that mtor signaling can potentiate the insertion of ampa (-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid) receptors into the postsynaptic membrane and lead to long-term potentiation (ltp) [44, 45]. thus, the data collected from our immunofluorescence staining and electrophysiology are consistent with previous reports and suggest that the activation of mtor might lead to an increase in ampa receptors and their insertion into the postsynaptic membrane, resulting in the elevated neuronal excitability of the 5-htergic neurons in the rvm. as an effective immunosuppressant, rapamycin is widely used to prevent transplant rejection. chronic treatment of patients with mtor inhibitors is associated with an increased incidence of pain [46, 47], including the possible development of complex regional pain syndrome (crps) [48, 49]. these conflicting results might be due to the following reasons: (1) the drug concentration of rapamycin or its analogues was not the same as in the other reports in which the inhibition of mtor produces antinociception; (2) long-term treatment might lead to feedback activation of other pronociceptive signal proteins or molecules; and (3) intrathecal administration of rapamycin (at the spinal cord level) might play a very complicated role in pain transmission with unknown mechanisms. the present study used intra-rvm, instead of intrathecal, administration of rapamycin (250 m, 30 min before the behavioral tests), and this treatment remarkably attenuated the nociceptive behaviors induced by sni (figure 6). moreover, intra-rvm rapamycin treatment was effective on day 7 after sni (the maintenance stage of neuropathic pain) but not on day 1 after sni (the induction stage). the behavioral pharmacological data suggest that inhibition of mtor in the rvm at the late phase (maintenance stage) of neuropathic pain might be effective, even though pain has already been well established. by contrast, inhibition of mtor in the rvm had no effect on the development (induction stage) of neuropathic pain. all of these results are consistent with our biochemical data showing that rvm p-mtor was not greatly enhanced at day 1 but showed a significant increase at 7 days after sni (figure 2). combining our current results with previous findings, we conclude that the specific inhibition of mtor by rapamycin in the rvm is a promising avenue for the management of neuropathic pain. this effect probably occurs via deactivation of 5-htergic spinally projecting neurons in the rvm, which are required for descending pain facilitation. due to the lack of a specific mtor activator, reverse experiments involving the activation of mtor in the rvm, which should produce or enhance nociception, are difficult to achieve. moreover, optogenetic methods as well as transgenic animals should be further introduced to confirm the role of mtor in the rvm, not only in neuropathic pain but also in inflammatory pain. through the deactivation of 5-htergic spinally projecting neurons in the rvm and thus the weakening of descending pain facilitation, specific targeting of the activation of mtor in the rvm is a promising avenue for the management of neuropathic pain.

the mammalian target of rapamycin (mtor), a serine-threonine protein kinase, integrates extracellular signals, thereby modulating several physiological and pathological processes, including pain. previous studies have suggested that rapamycin (an mtor inhibitor) can attenuate nociceptive behaviors in many pain models, most likely at the spinal cord level. however, the mechanisms of mtor at the supraspinal level, particularly at the level of the rostral ventromedial medulla (rvm), remain unclear. thus, the aim of this study was to elucidate the role of mtor in the rvm, a key relay region for the descending pain control pathway, under neuropathic pain conditions. phosphorylated mtor was mainly expressed in serotonergic spinally projecting neurons and was significantly increased in the rvm after spared nerve injury- (sni-) induced neuropathic pain. moreover, in sni rat brain slices, rapamycin infusion both decreased the amplitude instead of the frequency of spontaneous excitatory postsynaptic currents and reduced the numbers of action potentials in serotonergic neurons. finally, intra-rvm microinjection of rapamycin effectively alleviated established mechanical allodynia but failed to affect the development of neuropathic pain. in conclusion, our data provide strong evidence for the role of mtor in the rvm in nerve injury-induced neuropathic pain, indicating a novel mechanism of mtor inhibitor-induced analgesia.

PMC4684879

pubmed-130

selenium (se) has been recognized as an essential nutrient for plant, animal, and human body, but at high concentration it can become toxic. the range between the concentration in which selenium is essential and toxic is very narrow [1, 2]. this element plays an important role in elderly people as well as in the prevention of many age-associated diseases and in maintenance of normal immune function. se is potent antioxidant involved in cellular defense against free radical reactions, and the risk of deficiency seems to increase in proportion to the age. evidence is accumulating that most of the degenerative diseases have their origin in deleterious free radical reactions. these diseases include atherosclerosis, cancer, inflammatory joint, asthma, diabetes, senile dementia, and degenerative eye disease. but high se concentrations in human can cause loosing hair and nails and irritation of skin and eye. the required daily amount of se is 20 mcg day and 4070 mcg day for 46 years old and adult males, respectively. the essential role of the se is due to its presence in the active site of some enzymes (i.e., glutathione peroxidase and iodotironine-5-deiodinase) and the catalytic effect of selenium compounds on the reaction of intermediate metabolism and inhibition of the toxic effect of heavy metals. it has been established that diets with deficit in se are associated with some human diseases, but diets with se contents higher than 5 mg/kg are toxic and cause important symptoms in humans and animals. selenium is present as selenocysteine (se-cys) in at least 30 proteins. all these factors, together with the fact that the concentration levels are extremely low, call for sensitive and accurate method for the determination of this element. selenium can be present in 2, 0,+4, and+6 oxidation states. these forms can not simultaneously be evaluated by direct application of certain analytical techniques such as instrumental neutron activation analysis (inaa) [6, 7], as well as hydride generation atomic absorption spectroscopy (hg-aas), inductively coupled plasma atomic emission spectrometry (icp-aes), electrothermal atomic absorption spectrometry (et-aas), or inductively coupled plasma mass spectrometry (icp-ms), after digestion of sample [810]. the most common methods used for determination of various species of selenium were atomic absorption spectrometry (hydride generation and electrothermal atomization) [1114], molecular [15, 16] and atomic fluorescence spectrometry [1719], high-performance liquid chromatography (hplc) [2022], voltammetry [23, 24], atomic emission spectrometry (aes), such as inductively coupled plasma (icp) and inductively coupled plasma-mass spectrometry (icp-ms), and spectrophotometry methods [2528]. in spite of some of the above methods, spectrophotometric methods are popular because of their simplicity and are based on piazselenol complex formation between the reagents and selenium. an interesting alternative to traditional liquid-liquid extraction is the micelle-mediated extraction, firstly developed by watanabe and tanaka. the cloud point is the temperature above which aqueous solutions of nonionic and zwitterionic surfactant become turbid. micelles of such well-known nonionic surfactant as triton x-100 or x-114 have a nonpolar core and extended polar layer, where both extractants and extracted complexes can be solubilized. above the cloud point, the solution is separated into two phases, a rich phase containing a high surfactant concentration in a small volume and a poor phase with a surfactant concentration close to the critical micelle concentration (cmc). hydrophobic species (hydrophobic organic compounds or metal ions after reaction with a suitable hydrophobic ligand) present in sample are able to interact with the micelles, thus being concentrated in the small volume of the surfactant-rich phase. the aim of this work was to use a simple, rapid, and sensitive spectrophotometric method (dithizone as chromogenic reagent) for determination of trace amounts of selenium (iv) (5100 ng ml) in micellar medium (triton x-100) in cosmetic and pharmaceutical products. to improve the detection limit of this method, cloud point extraction (cpe) has been used. selenium metal (purity: 99.9%) was obtained from the riedel de haen (germany). nitric acid (> 99.5%), sodium hydroxide (> 97%), ascorbic acid, hydrochloric acid (36.538%), phenol (> 99.0%), methanol (> 99.8%), and sulfuric acid (95.097.0%) were purchased from merck (germany). all chemicals were used without any further purification. deionized water from a milli-q system (millipore, usa) was used for preparation of all solutions. selenium sulphide shampoo (iran), centrum tablet (usa), and selen plus capsule (germany) were obtained from market. a shimadzu double-beam uv-vis spectrophotometer (model 1650 pc, japan) with 1.0 cm quartz cell was used for all spectral measurements. in order to investigate the accuracy of method a perkinelmer (model optima 7000 dv) inductively coupled plasma optical emission spectrometer (icp-oes) separation of surfactant phase and aqueous phase was carried out with a hettich centrifuge (eba 20, uk). a microwave system (microdigest 301, prolabo, france) with a maximum irradiation power of 200 w was used. ph measurements were made with a metrohm ph meter (model 744, switzerland). the effect of temperature was investigated by a gfl thermostated bath (model 1003, germany). the stock standard solution of selenium (iv) (1000 g ml) was prepared by dissolving 100 mg of selenium metal in hot concentrated nitric acid and diluted to 100 ml with water. from this solution serial dilutions were made to obtain different concentration levels of 5, 15, 30, 40, 55, 70, 80, and 100 ng ml of selenium (iv). the stock solution of dithizone (10 mol l) was prepared daily by dissolving 12.8 mg of the reagent in 5 ml of naoh solution (0.1 m, containing the 50 mg of ascorbic acid for stabilizing the dithizone) and diluting to 50 ml with water. the stock solution was diluted with water to obtain the final dithizone concentration of about 7.5 mol l. the stock solution of triton x-100 (10% (w/v)) was prepared by weighing 10 g of this reagent into 100 ml volumetric flask, dissolving in water by gentle heating, and making up to the mark with water. the final concentration of triton x-100 (0.2%) was prepared by suitable dilution of stock solution with the diluent (solution of 0.5% (w/v) of phenol). an aliquot of 50 ml of a solution containing selenium (iv) (final concentration 5100 ng ml), triton x-100 (0.2% (w/v)), dithizone (7.5 mol l), and hcl (0.35 m) was kept for 15 min to complete the color development. then the mixture was placed in a water bath at 40c for 10 min, when 0.5% (w/v) of the phenol was used for inducing the cloud point. phase separation was accelerated by centrifuging the test tube at 3500 rpm for 15 min. the bulk aqueous phases were easily decanted by gently inverting the test tubes, and the surfactant-rich phase (complex rich) was made up to 5 ml by adding methanol. the same procedure was applied for preparation of blank solution without the selenium and dithizone. the absorbance of two methanolic solutions was measured at 424 and 592 nm, against a blank (prepared in the same way without se and dithizone). the absorption maxima of the complex (424 nm) and dithizone (434 nm) were overlapping (figure 1). hence, the corrected absorbance, a corr, was used to overcome the problem: (1)acorr=a424(a424a592)la592, where a 424 and a 592 are the absorbance of the complex measured at 424 and 592 nm, respectively, and (a 424/a 592)l is the absorbance ratio of dithizone at 424 and 592 nm. the complex does not show any absorbance at 592 nm. under optimum conditions, a calibration graph was used for determination of selenium in cosmetic and pharmaceutical products. shampoo (selenium sulphide, iran) sample dissolution was prepared using the procedure described by afkhami et al.. approximately 1 g of shampoo sample was weighted into a 100 ml beaker. concentrated sulfuric acid (1 ml) the solution was allowed to cool, and 5 ml of 30% (w/v) hydrogen peroxide was added. the mixture boiled vigorously to eliminate excess hydrogen peroxide and allowed to cool and then the digest transferred to a 100 ml volumetric flask. finally, 2 ml of this solution was taken for determination of selenium (iv) as in the recommended procedure. a centrum tablet (usa) containing 0.25 mg se (as sodium selenate) was placed in digestion vessel. 5 ml of concentrated nitric acid and 2 ml of hydrogen peroxide were added and the mixture subjected to microwave irradiation (25% of power, 5 min) in order to digest the sample. then, 10 ml of hydrochloric acid (6 m) was added, and the mixture was irradiated by microwave (75% of power, 5 min) in order to reduce all se to se (iv).. 1 ml of treated sample solution was dropwise passed through an eichrom cation exchange resin (sulfonic acid groups, mesh ranges: 50100 m, 8 cm), for removal of interferences, and selenium was determined with the recommended procedure. a selen plus capsule (germany) was dissolved in 10 ml hcl (6 m), and the mixture was irradiated by microwave (75% of power, 5 min) in order to reduce all se to se (iv). the mixture was then diluted to 50 ml with water, and then 1 ml of this mixture was taken for determination of selenium (iv) as in the recommended procedure. from the plot obtained by job's method of continuous variation, the se- (iv) to- dithizone (h2dz) ratio forming the complex was found to be 1: 4 at ph<1. the complex can, therefore, be represented as se(hdz)4 which is in agreement with the reported composition in the organic phase. the conditional stability constant of the 1: 4 (se: h2dz) complex was calculated, assuming the following equilibrium in the system: (2)h2seo3+4 h2dzse(hdz)4+3h2o. using the plot obtained by job's method, xmax (chdz/ctotal) was found to be 0.8, and therefore the ratio of se: hdz was calculated 1: 4 (figure 1). selenium (iv) reacts with dithizone (hdz) in micellar medium and forms a hydrophobic complex, se(hdz)4, which is subsequently trapped in the surfactant micelles and separated from the aqueous phase. figure 2 shows the absorption spectra for the dithizone and selenium-dithizonate complex in surfactant-rich phase against a reagent blank. the absorption maximum of the complex was 424 nm, and the absorption maxima of the dithizone were 434 and 592 nm. solution ph plays a unique role on metal-chelate function and subsequent extraction. figure 3 shows the influence of hcl concentration on the corrected absorbance of the selenium dithizonate complex at 424 nm. as can be seen, the complex extraction was increased with the increased hcl concentration and then showed a decrease. the reason for this behaviour might be because of decreasing the dithizone stability at higher phs. hence, an hcl concentration of 0.35 m was chosen for further studies. the influence of the dithizone (hdz) concentration on analytical response is shown in figure 4. this figure shows that the absorbance increased up to a known concentration of dithizone (7.5 mol l) and then reached a plateau that can be attributed to complete extraction. therefore, the concentration of 7.5 mol l of dithizone was selected as the optimum. the nonionic surfactant triton x-100 was chosen because of its commercial availability of high purified homogeneous form, low toxicological properties, and cost. the cloud point temperature of triton x-100 is 63.7c. to decrease the cloud point temperature of triton x-100 to room temperature (desirable temperature in cloud point procedure), this solution was prepared by the diluent (solution of 0.5% (w/v) of phenol). the variation of absorbance at max of complex as a function of the concentration of triton x-100 is shown in figure 5. at lower concentrations of triton x-100, the low extraction efficiency of the complex may be due to the inadequacy of the assemblies to entrap the hydrophobic complex quantitatively. the concentration of 0.2% (w/v) triton x-100 was selected for further studies. optimal incubation time and equilibration temperature are necessary to complete the reaction, easy phase separation, and preconcentration as efficient as possible. providing that the complexation reaction has been completed under certain conditions, corrected absorbance data show that, for equilibration times of 10 to 30 min, extraction efficiency is almost constant. on the other hand, it appears that the phase volume ratio of all nonionic surfactants decreases as the equilibration temperature increases. as can be seen in figure 7, the corrected absorbance increases very gently up to 40c and starts to decrease afterwards due to decrease in the stability of the dithizone and consequently the extraction efficiency. the dependence of corrected absorbance upon centrifugation time was studied within the range of 530 min. it was found that a time of 15 min is adequate for separation of two phases. calibration graph was obtained by preconcentrating 50 ml of the sample containing 5, 15, 30, 40, 55, 70, 80, and 100 ng ml of selenium (iv) under the optimal experimental conditions. analytical parameters for the determination of the selenium-dithizonate complex are presented in table 1. the relative standard deviation was 2.18% for six replicate measurements of standard selenium solution (50 ng ml). the effect of various cations and anions on the determination of 0.05 g ml of se(iv) was studied, and the results are summarized in table 2. the tolerance limit was taken as the concentration of added ion causing less than 5% relative error. cations such as ag(i), cu(ii), hg(ii), and fe(iii) were interfered with the determination of se(iv) ion. these cations can be removed using a cation exchange resin (sulfonic acid groups, mesh ranges: 50100, 8 cm). for this purpose, 25 ml solution containing 2.5 g of se(iv) and various amounts of desired cations was passed through 5 g cation exchange resin (8 cm wet resin) dropwise and collected in a 50 ml volumetric flask containing optimum amount of dithizone (7.5 mol l), hcl (0.35 m), and triton x-100 (0.2% w/v). after washing the column with water (three times, with 15 ml), 0.5% (w/v) phenol was added and the solution was diluted to the mark with water and the amount of se (iv) was determined using recommended procedure. to evaluate the analytical applicability, the method was applied to the determination of selenium in two multivitamin tablets (centrum and selen plus) and a selenium sulphide shampoo (for treatment of dandruff). the results for selenium sulphide shampoo, centrum, and selen plus multivitamins are given in tables 3, 4, and 5, respectively. in order to evaluate the accuracy of procedure, selenium was determined in centrum tablet (containing 0.25 mg se as sodium selenate) by icp-oes as reference method. in both methods the results agreed well (table 6). the limit of detection and relative standard deviation of the proposed method were compared with methods in the literature (table 7). as observed from the results limit of detection by the proposed method was lower than other methods. the simplicity, rapidity, and inexpensiveness of the proposed method in combination with the use of dithizone as a chromogenic reagent were utilized for selenium determination in cosmetic and pharmaceutical samples. precision and recovery data clearly indicated the reproducibility and accuracy of the method. in this investigation, spectrophotometric determination of selenium was carried out in micellar medium without the need for an extraction step. because of the overlapping of absorption maximum of complex at 424 nm with absorption maximum of dithizone at 434 nm, a corr was applied.

a simple, rapid, and sensitive spectrophotometric method for the determination of trace amounts of selenium (iv) was described. in this method, all selenium spices reduced to selenium (iv) using 6 m hcl. cloud point extraction was applied as a preconcentration method for spectrophotometric determination of selenium (iv) in aqueous solution. the proposed method is based on the complexation of selenium (iv) with dithizone at ph<1 in micellar medium (triton x-100). after complexation with dithizone, the analyte was quantitatively extracted to the surfactant-rich phase by centrifugation and diluted to 5 ml with methanol. since the absorption maxima of the complex (424 nm) and dithizone (434 nm) overlap, hence, the corrected absorbance, acorr, was used to overcome the problem. with regard to the preconcentration, the tested parameters were the ph of the extraction, the concentration of the surfactant, the concentration of dithizone, and equilibration temperature and time. the detection limit is 4.4 ng ml1; the relative standard deviation for six replicate measurements is 2.18% for 50 ng ml1 of selenium. the procedure was applied successfully to the determination of selenium in two kinds of pharmaceutical samples.

PMC3103859

pubmed-131

the field of utility organometallics is increasingly turning to more complex mixed-metal systems to deliver superior results, whether this be for metal halogen exchange, alkylation, insertion, or the trapping of reactive intermediates. in theory, mixed-metal reagents can offer more flexible, tunable solutions to any problem compared to more traditional monometallic alternatives due to the increased number of components which can be varied. furthermore, the different metal centers and ligand sets can exhibit cooperativity (or synergism) to produce new reactivities inaccessible to the monometallic components. hydrogen abstraction is an area in which the lure of such mixed-metal systems is proving to be irresistible. the combination of an alkali metal with a range of different subordinates (i.e., metals that would be expected to be less reactive than the alkali metals-zn, mg, mn, cr, fe, cu, cd, al) have been integrated with a diverse array of ligands (alkyl, amido, alkoxy, halide) and have been efficiently deployed in both ethereal and hydrocarbon media to overcome some of the great challenges facing deprotonation chemistry such as the incapability to metalate low brnsted acidity substrates, lack of compatibility with sensitive functionalities, low selectivity and the need to perform reactions under cryogenic conditions. recently our own group has started to investigate the use of diamines in a bimetallic context, reporting in a communication the synthesis of the diazaethene zincate complex (tmeda)li[(ipr)nch=chn(ipr)]zn(tbu) 1. 1,3-diazabutadiene ligands, from which diazaethene ligands are often prepared, are increasingly important within coordination chemistry due to their flexible coordination modes and redox properties. the synthesis of this complex from the fully saturated (ipr)nhch2ch2nh(ipr) (diisopropylethylenediamine) 2 (scheme 1) displayed a new mode of hydrogen activation previously unseen within zincate chemistry. we now report a detailed mechanistic overview of this surprising transformation from both experimental and theoretical perspectives. as reported previously, the cocomplexation of the monolithiated diamine li[(ipr)nch2ch2nh(ipr)] with (tbu)2zn(tmeda) at 0 c gives the expected product (tmeda)li[(ipr)nch2ch2nh(ipr)]zn(tbu)23 (scheme 1). in a fashion similar to that of the two-step mechanism for monoamido zincates originally proposed by uchiyama et al., the amino n h group of 3 is rapidly deprotonated by a tbu ligand to form the dimetalated diamido (tmeda)li[(ipr)nch2ch2n(ipr)]zn(tbu) 4 with the evolution of ibuh. although diamido 4 has thus far not crystallized, it has been characterized by multinuclear nmr spectroscopy, and we have succeeded in the crystallographic identification of several analogous structures. using the homologous (ipr)nhch2ch2ch2nh(ipr) (diisopropylpropylenediamine), the dimetalated diamido (tmeda)li[(ipr)nch2ch2ch2n(ipr)]zn(tbu) 5 (scheme 2 and figure 1) could be crystallized from the corresponding reaction of li[(ipr)nch2ch2ch2nh(ipr)] with (tbu)2zn(tmeda). unfortunately, the crystal data are of insufficient quality to allow discussion of the geometric parameters of the structure, but the connectivity is definite. zincate 5 contains an ncccnzn six-membered ring in a boat-type conformation. the diamido ligand thus chelates the zn center while its two ipr arms are oriented out of the plane of the ring. the (tmeda)li cation is coordinated to the hull of the boat, anchored exclusively to the two secondary amido groups to produce a puckered linznn four-membered ring. h nmr spectroscopic studies confirm the fully saturated nature of the propylene bridge with methylene resonances at 3.33, 2.95, and 1.93 ppm, while no characteristic diazaethene resonances were present in the 56 ppm region. molecular structure of the diamido zincate (tmeda)li[(ipr)nch2ch2ch2n(ipr)]zn(tbu) 5. hydrogen atoms and disordered tbu/tmeda components have been omitted for clarity. on utilizing thf as a donor ligand in the absence of tmeda, in a repeat of the synthesis of 4, the dimeric thf-solvated product {(thf)li[(ipr)nch2ch2n(ipr)]zn(tbu)}26 was isolated and subsequently crystallographically characterized (scheme 2 and figure 2). lithium zincate 6 has a centrosymmetric molecular structure consisting of two [(ipr)nch2ch2n(ipr)]zn(tbu) complex anions, juxtaposed, and bridged by two (thf)li cations to produce an eight-membered (linznn)2 ring. the cyclic conformation of 6 allows for the symmetrical coordination of each amido group to one lithium and one zinc center. both sets of metal centers occupy distorted trigonal planar geometries. the ipr groups on the amido ligands lie syn with respect to the znnccn ring, while the nonplanar nature of the diamide (n1c4c5n2 torsion angle of 50.0(2)) as well as its n c [1.471(3)] and c c [1.530(3)] bond distances, which are comparable with those found in the ruthenium complex [(ipr)nch2ch2n(ipr)]ruh2(co)5 [n c, 1.48(1); c c, 1.52(1)], establish that the ch2ch2 backbone remains saturated. thermal ellipsoids are shown at the 50% probability level. selected bond lengths [] and angles [deg]: zn1n1, 2.019(2); zn1n2, 1.986(2); zn1c9, 2.019(9); li1n1, 2.001(4); li1n2(a), 2.041(4); li1o1, 2.004(4); n1c4, 1.471(3); n2c5, 1.470(3); c4c5, 1.530(3); n1zn1n2, 91.20(7); n1zn1c9, 127.5(2); n2zn1c9, 141.2(2); n1c4c5n2, 50.0(2); n1li1n2(a), 127.0(2); n1li1o1, 117.7(2); n3li1o1, 114.9(2). to gain mechanistic insight a detailed nmr spectroscopic study was carried out on the reaction between the monometallic compounds li[(ipr)nch2ch2nh(ipr)] and (tbu)2zn(tmeda). a li nmr spectrum of isolated crystals of the cocomplexation product (tmeda)li[(ipr)nch2ch2nh(ipr)]zn(tbu)23 in c6d6 solution reveals two major resonances at 0.37 ppm and 0.63 ppm, suggesting a mixture of products. when this solution is gently warmed and reanalyzed, the resonance at 0.37 ppm is absent, intimating that the product associated with this low-frequency resonance has been fully consumed, and only the resonance at 0.63 ppm remains (see figure s24 in supporting information). this is consistent with the disappearing resonance at 0.37 ppm representing the bisalkyl zincate 3 which, via an intramolecular deprotonation and concomitant release of ibuh, forms the diamido complex 4. further support for this interpretation can be found when considering how close the signal assigned to complex 4 (0.63 ppm) comes to that of the structurally analogous propylene derivative 5 (0.75 ppm, i.e. a difference of only 0.12 ppm). when the reaction was repeated in situ at 0 c and an aliquot removed and analyzed by li nmr spectroscopy, two pertinent resonances at 2.39 ppm, and 1.71 ppm, as well as the resonance belonging to the previously identified intermediate 4, are present (see figure s24 in supporting information). li dosy nmr experiments reveal that the intermediate responsible for the resonance at 1.71 ppm has a molecular weight similar to that of 4 (see figure s25 in supporting information), presumably ruling out an aggregation process for the formation of this, as yet, unidentified species. comparison with the li nmr spectra of the diazaethene 1 in c6d6 reveals that the signal at 2.39 ppm is the result of a trace amount of this final product. due to the highly reactive, transient nature of the bis-alkylzincate 3, its presence is not detected in this in situ nmr study. another aliquot of the solution was removed after a 2-day stir at room temperature, but the recorded li nmr spectrum indicated no significant further compositional change had taken place. aliquots were then removed after 5 min, 1 h, and 2 h reflux time, and the recorded spectra revealed a gradual transformation from the saturated intermediate 4 to the unsaturated final product 1. after 2 h reflux, decomposition of the reaction mixture is evidenced by the deposition of a black solid. any further intermediates along the reaction pathway must be too short lived to be visible on the nmr time scale. the next step in the reaction pathway 4 1 has been shown to likely proceed through a hydride intermediate as we successfully trapped a hydride by using the electrophilic ketone (tbu)2co. the hydride produced can then deprotonate the now allylic proton on the ethylene bridge to give the final product. the system must then find a way of solubilizing and activating the produced lih, which is normally insoluble in hydrocarbon solvents. a more typical dehydrogenation pathway involving redox active transition metals, such as those reported by brookhart, can be ruled out as there are no redox-active metals present in our alkali metal instead, the reaction could be envisaged to proceed through a ligand-sited oxidation followed by a reduction (scheme 3). this reaction can thus be said to exploit a unique three-way cooperation, where the chemical properties of the two metals and the ethylenediamide ligand combine to allow a type of chemistry otherwise unavailable. in order to explore the possible pathways by which this reaction could proceed we carried out detailed mechanistic investigations using density functional theory (dft, see the supporting information for full details on the level of theory employed) in order to explore the potential energy surface (pes) associated with the proposed mechanisms. we initially inspected the structure and stability of the monomer species 4 at the dft level of theory. in agreement with the three-carbon bridge analogue (5, figure 1), 4 is found to be a stable minimum on the pes with the diamido ligand coordinated to the zn atom (n zn: 2.04 and 1.99) to form a five-membered ring (nccnzn) in a slightly twisted (nccn torsion of 31.4) envelope conformation with the zn atom below the nccn plane, (figure 3). the (tmeda)li cation is coordinated directly above the two n atoms of the five-membered ring by two essentially equivalent li based on the optimized structure of 4 two different mechanisms by which the proposed zinc hydride species could be formed are possible. all h atoms, except those involved in the reaction, are omitted for clarity. the h atom could be initially abstracted by the li cation to form a zn h bond below the plane of the ring, or direct abstraction by the zn to form the zn h bond above the ring plane. optimisation of the two hydride intermediate structures revealed that both were stable minima on the pes but were formed in endothermic reactions relative to 4 (figure 4). the intermediate with the h atom above the nccn plane (inta) is destabilized by 14.7 kcal/mol (g) relative to 4, while the intermediate with the h atom below the plane (intb) is destabilized by 8.6 kcal/mol (g), relative to 4. while both reactions are endothermic, the relative stabilities of the intermediates are not sufficiently different to determine which pathway is more favorable. therefore, we characterized the transition states leading to the intermediate structures in order to determine whether there was a kinetic preference toward either species. the activation barrier associated with the formation of inta is 23.2 kcal/mol (g *), compared to a barrier of 31.8 kcal/mol (g *) for the formation of intb. an activation barrier of 31.8 kcal/mol is still accessible under the experimental conditions employed in the reactivity of 4; thus, while inta is expected to be preferentially formed as an initial hydride intermediate in the formation of the diazaethene product (1), we also considered intb as a potential intermediate from which the second hydrogen abstraction could occur. abstraction of the second h atom from inta occurs with a barrier of 17.4 kcal/mol, relative to inta, (g *) in an exothermic reaction (g=13.2 kcal/mol) to generate h2 and the final product 1. however, despite exhaustive sampling, no transition state could be located that corresponded to the formation of h2 and 1 starting from intb. therefore, the overall reaction 4 1+h2, which is essentially thermoneutral (g=1.5 kcal/mol, figure 4), appears to preferentially occur via the hydride inta. free energy (g) profile for the formation of 1 from 4 via a hydride intermediate. the path in red corresponds to the formation of the hydride intermediate above the ring plane (inta), while the path in blue corresponds to the formation of the hydride intermediate below the ring plane (intb). the relative stabilities of ts(4-inta) and ts(4-intb) (figure 4) are dictated by the different roles that the li and zn centers play in the two different mechanisms. in both transition states, in order for the zn h bond to be formed, one zn n bond must be broken such that the zn atom is able to accommodate the incoming h and the unsaturated n=c bond can form. within the ts(4-inta) n bond breaking is facilitated by the formation of a stabilizing interaction between the n atom and the li. this is evidenced by the rotation around the c c bond [increase in the dihedral angle from 31.4 in 4 (figure 3) to 56.3 (figure 5a)], which decreases the li n distance from 2.02 (figure 3) to 1.98 (figure 5a) and increases the zn n distance from 2.04 (figure 3) to 3.39 (figure 5a). in contrast, the rotation around the c c bond in ts(4-intb) is not as great (34.1, figure 5b). in addition, in ts(4-intb) the li atom is forced to migrate toward the second n atom in order to facilitate the transfer of the h atom beneath the plane of the ring. n distance to 3.60 for the primary n (figure 5b), and consequently, the breaking of the zn n bond length is only slightly increased from 2.04 in 4 (figure 3) to 2.12 in ts(4-intb) (figure 5b). thus, the formation of the hydride intermediate is truly the result of the synergic interplay between the zn (stabilizing the formation of the zn h bond) and li (stabilizing the breaking of the zn returning to experimental studies, a molecular hydride species [(tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)h 7 has been isolated by using a variation of this mixed-metal approach with the ethylenediamide ligand, demonstrating that this system has the ability to encapsulate lih (scheme 4 and figure 6). dilithium hydridozincate 7 was synthesized while attempting to generate [(tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)2 by the n h deprotonation of (tmeda)li[(ipr)nch2ch2nh(ipr)]zn(tbu)23 with a molar equivalent of nbuli(tmeda) (scheme 4). [(tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)2 facilitates the -hydride formation and elimination of ibuh to generate the zinc hydride species 7. dft calculations have confirmed that such a process [4+(tmeda)lih 7] would be exothermic (g=28.4 kcal/mol). molecular hydride 7 can also be produced via the alternative reaction of the usually kinetically challenged base [(tmeda)li]2zn(tbu)4 with (ipr)nhch2ch2nh(ipr) with an improved yield of 65% relative to 35%. molecular structure of the zincate hydride complex [(tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)h 7 with hydrogen atoms (except for the hydride ion) omitted for clarity. thermal ellipsoids are shown at the 50% probability level. selected bond lengths [] and angles [deg]: li1h100, 1.96(2); li2h100, 2.07(2); zn1h100, 2.14(2); li1n2, 1.979(4); li2n1, 1.989(4); zn1n1, 2.043(2); zn1n2, 2.074(2); zn1c1, 2.045(3); n1c9, 1.481(3); n2c8, 1.448(3); c8c9, 1.523(4); n1zn1h100, 92.8(6); n1zn1n2, 89.66(8); n1zn1c1, 133.1(1); n2zn1c1, 125.19(9); n2zn1h100, 92.8(5); h100zn1c1, 113.0(6); n2li1n5, 121.8(2); n2li1n6, 129.6(2); n2li1h100, 101.5(6); n5li1n6, 85.7(2); n5li1h100, 115.9(6); n6li1h100, 101.6(6). mixed-metal zincate hydrides have repeatedly demonstrated their utility in organic synthesis as reagents for chemoselective, diastereoselective, and catalytic reductions. highly soluble, stable, and well-defined zincate hydride species are thus highly desirable. despite this, however, structurally characterized alkali metal zincate hydrides are extremely rare. to date the only examples on the ccdb are the zinc zinc bonded arzn(-h)(-na)znar (ar=c6h3-2,6-[c6h3-(ipr)2]2), the heterocubanes [(tbuoznh)4n(liotbuthf)n] (n=03), and the higher-order zincates na2[(et)2znh]2 and na3[(ipr)3zn(-h)zn(ipr)3]. although metal hydride complexes are notoriously insoluble, a reputation perpetuated by common hydride reagents such as lih and cah2, the hydride carrier 7 is soluble in the nonpolar solvent hexane. the structure of zinc hydride 7 bears a partial resemblance to that of the thf solvated dimer 6, with a [(ipr)nch2ch2n(ipr)]zn(tbu) complex anion having a lithium cation bound to each nitrogen atom. the li n amido bond distances in 7 (average 1.984) are close to those in dimer 6 (average 2.021). likewise the zn n bond distances in hydride 7 [2.074(2) and 2.043(2)] are only marginally longer than those in alkylamido 6 (average 2.002), owing to the increased number of anions bound to the zinc. the tbu group has been pushed out of the plane of the amido ligand to allow the zinc center to enter a distorted tetrahedral geometry by binding to the hydride ligand. as in the lithium zincate 6, the n c [1.481(3) and 1.448(3)] and c c [1.523(4)] bond lengths in 7 are consistent with an unactivated ethylene bridge. the trapped 3-hydride was successfully located and freely refined in the x-ray diffraction study. it caps a li2zn triangle asymmetrically with unequal li h bond distances [1.96(2) and 2.07(2)] and a longer zn h bond [2.14(2)]. the ccdb at the time of writing contains only 45 compounds exhibiting a zn hydride bond. excluding an anomalously long contact within a zinc borohydride compound (2.409), zn hydride bond lengths range from 1.4092.167 with an average distance of 1.771. the zn hydride contact in 7 is thus long-range to the best of our knowledge, the longest zn hydride contact in a non-borohydride complex to date (the value of 2.167 mentioned above also comes from a borohydride complex). there are currently 147 compounds in the ccdb containing li hydride contacts with their lengths spanning the wide range 1.6072.802. the average distance (2.044) is comparable with those found in 7. to the best of our knowledge however, there have been various dilithio 3-hydride compounds reported with other metals such as ga, al, zr, w, sm, ta, and fe. variable-concentration multinuclear (h, c and li) nmr spectroscopic studies of 7, as well as exchange spectroscopic (exsy) experiments, confirm the presence of a dynamic equilibrium in c6d6 solution. as well as resonances consistent with the solid state structure of 7, mixed-metal zincate complex 4 can thus be described as a molecular scaffold for the molecularization of the usually insoluble polymeric lih. an examination of the li nmr spectrum reveals a doublet with a jli h coupling constant of 13.3 hz, confirming the retention of the li only a few examples have been detected since the first measurement by bergman of (cp*)irh2sime3li(pmdeta) (cp *=c5me5, pmdeta=n, n, n,n,n-pentamethyldiethylenetriamine) in 1985. those detected have coupling constants ranging from 6.414.7 hz, placing our example at the upper end of the literature examples. surprisingly, two independent h resonances, at 3.27 and 3.19 ppm, were detected coupling with the doublet in the li nmr spectrum. this result can be tentatively assigned to the li resonance for the zincate hydride 7 sharing the same chemical shift as dissociated (tmeda)lih, in agreement with the presence of a dynamic equilibrium in solution. given the equilibrium between 4 and 7, the formation of a diazaethene compound, analogous to 1, may also occur using 7 as the starting point. the optimized structure of 7 closely matches the experimental x-ray structure, with a mean unsigned error of 0.07 between the measured and calculated bond lengths. the largest deviation between the calculated and experimental values occurs for the interactions involving the hydride ion (e.g., zn h: 1.94 calculated vs. 2.14 experimental, see table s1 in supporting information for details). the deviations in the hydride ion distances may be due to the uncertainty inherent in the crystallographic determination of hydride positions; however, even with the shorter calculated zn h interaction, at 1.94 the zn h contact is clearly long-range. the introduction of the (tmeda)lih ligand to 4 to form 7 results in a different mechanism for the formation of the diazaethene compound. one of the ethylene c8 hydrogen atoms from 7 (figure 7) is aligned for abstraction by the dilithio hydride to form the intermediate (intc) containing a (lih)2 unit. the formation of intc occurs in an endothermic step (g=21.7 kcal/mol), relative to 7, with an associated barrier of 30.1 kcal/mol (g *, figure 7). the subsequent abstraction of the h atom from c9 (figure 7) to form h2 and the diazaethene compound 8, occurs with a barrier (g *) of 11.8 kcal/mol, relative to intc, in an exothermic reaction (g=16.7 kcal/mol). overall, the reaction from 7 to form 8 is slightly endothermic (g=5.0 kcal/mol, figure 7). from the intermediate structure (intc) the barriers to the forward and reverse reaction (i.e., the formation of 8+h2 and 7, respectively) are comparable in energy (g *=3.4 kcal/mol). therefore, although the equilibrium from intc will be in the direction of 7, the formation of 8+h2 from this structure should also occur to some extent. free energy (g) profile for the formation of 8 from 7 via a dihydride intermediate. the possible formation of a zn hydride intermediate, in analogy to the mechanisms explored for the formation of 1 (via inta) was also investigated. the barrier associated with the formation of this hydride intermediate (g *=28.4 kcal/mol) is accessible under the experimental reaction conditions and the intermediate produced in this reaction is destabilized by 21.1 kcal/mol, relative to 7. however, the barrier to the subsequent second hydrogen abstraction (i.e., the formation of 8+h2) is 34.4 kcal/mol, which results in a strong preference for the reverse reaction back to the reactant 7 (g *=6.0 kcal/mol). as such, the mechanism resulting in the formation of dihydride intermediate (intc, figure 7) is expected to be the dominant mechanism for the formation of 8+h2, from 7. despite the comparable energetics for the formation of 8 from 7 (via intc) and 1 from 4 (via inta), the mechanisms and the synergic interaction of the two metals are distinctly different. the presence of the second li atom in 7 (relative to 4) allows the zn to stabilize the formation of the c=n bond (the zn n bond increases from 2.07 in 7 to 2.18 in ts(7-intc), figure 8), while the li atom is able to facilitate the c h bond breaking step. finally, the free energy associated with the loss of a (tmeda)lih ligand from 8 to form 1 is slightly less (g=24.9 kcal/mol) than the equivalent association/dissociation reaction between 4 and 7. therefore, given the similar overall kinetic barriers associated with the generation of the diazaethene species starting from 4 and 7, both reaction mechanisms described in figures 5 and 8, should be competitive and operate in a complementary fashion to generate the observed product 1. the closest analogy to the synthesis of 1 was reported by veith who formed 1,3-diaza-2-silacyclopentene by the double lithiation of (tbu)nhch2ch2nh(tbu) (di-tert-butylethylenediamine) with nbuli followed by an electrophilic quench with cl2si(me)n(h)tbu. it was acknowledged at the time that the process leading to this dehydrogenation was unclear but it was noted that the reaction was highly concentration dependent. for dehydrogenation to occur the lithiation step needed to be carried out in a highly concentrated nbuli hexane solution (2 m). this concentration dependence infers a different mechanism of hydrogen activation from that which results in the synthesis of 1, possibly involving either larger aggregates or an intermolecular process. large aggregates of liotbu have previously been found to activate and retain lih in solution. the diamido species was never characterized in veith s study. we have confirmed by nmr spectroscopy that (ipr)nhch2ch2nh(ipr), like its homologue (tbu)nhch2ch2nh(tbu), can be activated when refluxed in a concentrated nbuli solution. when the reaction was carried out at concentrations akin to that used in the synthesis of 1, then the dilithiated species could be crystallized as a tmeda solvate (figure 9). this product, [(tmeda)li(ipr)nch2ch2n(ipr)li]29, has a distorted ladder structure in the solid state with the diamido ligands adopting a trans bent conformation allowing them to bridge between opposite corners of alternate rungs. n bond distances of 2.227(2) and 1.971(2) between the outer rungs and 2.057(2) between the inner rungs. maintaining the c2 axis of symmetry, the long and short edges of the ladder alternate as the ladder is ascended. both outer lithium centers adopt distorted tetrahedral geometries, while the internal lithium atoms are three-coordinate. this trapping of a ladder segment instigated by the lewis base tmeda supports gardiner s assertions. selected bond lengths [] and angles [deg]: li1n1, 2.227(2); li1n2, 1.977(3); li1n3, 2.209(3); li1n4, 2.199(3); li2n1, 2.025(2); li2n2, 1.971(2); li2n1(a), 2.057(2); n1c2, 1.460(2); n2c1, 1.458(2); c1c2, 1.521(2); n1li1n2, 81.23(9); n1li1n3, 125.9(1); n1li1n4, 129.1(1); n2li1n3, 117.3(1); n2li1n4, 125.26(1); n3li1n4, 83.34(1); n1(a)li2n1, 109.6(1); n1(a)li2n2, 151.4(1); n1li2n2, 86.7(1). the activation of (ipr)nhch2ch2nh(ipr) has also been achieved starting from the sodium congener na[(ipr)nch2ch2nh(ipr)] and (tbu)2zn(tmeda) to generate the sodium diazaethene zincate (tmeda)na[(ipr)nch=chn(ipr)]zn(tbu) 10. although the initial cocomplexation adduct (tmeda)na[(ipr)nch2ch2nh(ipr)]zn(tbu)2 with one n h bond still remaining is apparently too short-lived to isolate, when the reaction was carried out at 0 c and the resulting solution stored at 30 c, it was possible to isolate and fully characterize the dimeric species {(tmeda)na[(ipr)nch2ch2n(ipr)]zn(tbu)}211 with no n h bond but containing the saturated ethylene diamido backbone (figure 10) which must exist further along the reaction pathway that ultimately produces 10. two independent centrosymmetric molecules of dimer 11 as well as a hexane molecule form the asymmetric unit. sodium zincate 11 is constructed from a 545 fused ring system in a distorted ladder conformation; the two znnccn rings lie anti about the strictly planar central znnznn core. the n c [1.452(6) and 1.463(6)] and c c [1.494(7)] bond distances are indicative of a fully saturated bisamide. contrary to binding in the lithium monomer 5, the heavier alkali metal binds to only one of the available amido groups, with the core nitrogen atoms (n1, n1a) coordinating exclusively to zinc. despite the variety of amide environments around zinc, the zn n bond distances show little variation (average 2.11). due to the narrow bite angle of the diamido ligand (85.9) the zinc center adopts a distorted tetrahedral geometry. a highly distorted tetrahedral geometry around sodium is also completed by a weak agostic interaction [2.977(6)] to a methyl arm of the tertiary butyl ligand on zinc. this is moderately longer than a similar interaction found in the bis-alkylamido zincate (tmeda)na(tmp)zn(tbu)2 (2.75). 545 fused ring systems have been found before in metallate complexes containing saturated nccn diamido ligands. examples include the lithium lanthanide complexes [(thf)3li[1,2-{n(sime3)}2c6h10]mcl2]2 (m=nd, yb) and the dimeric gallium species [{ (bz)nch2ch2n(bz)}li{(bz)nch2ch2n(bz)}gao]2 (bz=benzyl, ch2c6h5). molecular structure of one of the independent molecules of the dimeric sodium zincate [(tmeda)na[(ipr)nch2ch2n(ipr)]zn(tbu)]211. a weak agostic nac contact is denoted by a broken bond. hydrogen atoms, ipr groups, and disordered hexane of crystallization have been omitted for clarity. selected bond lengths [] and angles [deg]: na1n1, 3.720(4); na2n2, 2.326(5); na1n3, 2.490(6); na1n4, 2.490(5); na1c4, 2.977(6); zn1n1, 2.105(4); zn1n2, 2.103(4); zn1c1, 2.072(5); zn1n1(a), 2.122(4); n1c8, 1.463(6); n2c9, 1.452(6); c8c9, 1.494(7); n4na1n3, 75.4(2); n4na1n2, 121.9(2); n4na1c4, 147.7(2); n3na1n2, 137.7(2); n3na1c4, 91.8(2); n2na1c4, 87.4(2); n2zn1c1, 117.1(2); n2zn1n1, 85.9(2); n2zn1n1(a), 110.5(2); n1zn1c1, 127.6(2); n1zn1n5, 88.8(2); n5zn1c1, 120.0(2). as might be expected from polarity considerations, the sodium reagent proves more reactive than the lithium analogue, providing after a 30 min reflux in hexane, the sodium diazaethene 10 in 61% isolated yield. although the tmeda solvate 10 could be isolated as a crystalline solid, to obtain crystallographic data of adequate precision, the donor ligand thf had to be used in place of tmeda to produce the analogous thf solvate (thf)3na[(ipr)nch=chn(ipr)]zn(tbu) 10a (figure 11). here, the zinc atom is chelated symmetrically [zn n bond distances 1.957(2) and 1.971(2)] by the diamide ligand, lying below the plane defined by the nccn core of the diazaethene ligand. the methine carbons of the isopropyl groups lie in the plane of the diazaethene ligand while their methyl groups protrude above and below this plane. the sodium atom lies above the nccn bridge, though slightly off center, coordinating to both pairs of nitrogen and carbon atoms. three thf molecules complete the coordination sphere of the sodium center. comparing the c n [1.398 (average)] and c c [1.353(4)] bond distances of the diazaethene core with those found in the lithium analogue (tmeda)li[(ipr)nch=chn(ipr)]zn(me) [1.400 (average) and 1.349(3)] indicates that the change in alkali metal has little effect on the diazaethene ligand. dissolution of 10a in c6d6 to perform an nmr spectroscopic analysis was achieved by the addition of a drop of d8-thf. comparing the h nmr spectra of the thf solvate 10a with the tmeda solvate 10 reveals only marginal shift changes of the resonances associated with the diazaethene ligand. comparing the h nmr spectra of the homologues (tmeda)li[(ipr)nch=chn(ipr)]zn(tbu) 1 and (tmeda)na[(ipr)nch=chn(ipr)]zn(tbu) 10 reveals a 0.24 ppm downfield shift of the signal attributable to the ch=ch backbone of the diazaethene ligand on moving from lithium to sodium. interestingly, there are two sets of doublets associated with the methyl groups of the isopropyls of the lithium compound but only one set in the sodium congener. this would suggest sterically induced hindered rotation of the isopropyl groups in the lithium compound which is relieved on switching to the larger sodium cation. the synthesis of several alkali metal zincate diazaethene complexes has been achieved previously. however, to the best of our knowledge, all previous examples were synthesized by the reduction of unsaturated bis-imino ligands. therefore, the synthesis of the sodium zincate 10, along with the lithium zincates detailed in our recent communication, appear to represent the first such complexes to be synthesized via a double ch activation of a saturated diamido ligand. molecular structure of the diazaethene sodium zincate (thf)3na[(ipr)nch=chn(ipr)]zn(tbu) 10a. hydrogen atoms and minor disordered thf components have been omitted for clarity. thermal ellipsoids shown at the 50% probability level. selected bond lengths [] and angles [deg]: na1o1, 2.350(2); na1o2, 2.312(2); na1o3, 2.312(2); na1n1, 2.587(2); na1n2, 2.662(2); na1c8, 2.612(2); na1c9, 2.649(2); zn1n1, 1.957(2); zn1n2, 1.971(2); zn1c1, 2.009(2); n1na1n2, 60.81(6); n1zn1n2, 85.14(8); n1zn1c1, 139.88(10); n2zn1c1, 134.97(10). conversions of saturated diamines into unsaturated diazaethenes are usually associated with redox-amenable transition metal catalysts. however here we show through a combination of experimental (nmr spectroscopic, x-ray crystallographic) and theoretical (dft) studies that working co-operatively in a molecular mixed-metal system, an alkali metal (lithium or sodium) and zinc can bring about such transformations under challenging redox-inactive conditions.

the surprising transformation of the saturated diamine (ipr)nhch2ch2nh(ipr) to the unsaturated diazaethene [(ipr)nch=chn(ipr)]2- via the synergic mixture nbum, (tbu)2zn and tmeda (where m=li, na; tmeda=n, n, n,n-tetramethylethylenediamine) has been investigated by multinuclear nmr spectroscopic studies and dft calculations. several pertinent intermediary and related compounds (tmeda)li[(ipr)nch2ch2nh(ipr)]zn(tbu)2 (3), (tmeda)li[(ipr)nch2ch2ch2n(ipr)]zn(tbu) (5), {(thf)li[(ipr)nch2ch2n(ipr)]zn(tbu)}2 (6), and {(tmeda)na[(ipr)nch2ch2n(ipr)]zn(tbu)}2 (11), characterized by single-crystal x-ray diffraction, are discussed in relation to their role in the formation of (tmeda)m[(ipr)nch=chn(ipr)]zn(tbu) (m=li, 1; na, 10). in addition, the dilithio zincate molecular hydride [(tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)h 7 has been synthesized from the reaction of (tmeda)li[(ipr)nch2ch2nh(ipr)]zn(tbu)23 with nbuli(tmeda) and also characterized by both x-ray crystallographic and nmr spectroscopic studies. the retention of the li h bond of 7 in solution was confirmed by 7li1h hsqc experiments. also, the 7li nmr spectrum of 7 in c6d6 solution allowed for the rare observation of a scalar 1jli h coupling constant of 13.3 hz. possible mechanisms for the transformation from diamine to diazaethene, a process involving the formal breakage of four bonds, have been determined computationally using density functional theory. the dominant mechanism, starting from (tmeda)li[(ipr)nch2ch2n(ipr)]zn(tbu) (4), involves the formation of a hydride intermediate and leads directly to the observed diazaethene product. in addition the existence of 7 in equilibrium with 4 through the dynamic association and dissociation of a (tmeda)lih ligand, also provides a secondary mechanism for the formation of the diazaethene. the two reaction pathways (i.e., starting from 4 or 7) are quite distinct and provide excellent examples in which the two distinct metals in the system are able to interact synergically to catalyze this otherwise challenging transformation.

PMC3662402

pubmed-132

we reviewed the literature for reports of e. sakazakii disease in infants. using medical subject heading terms " e. sakazakii " or " enterobacter " in combination with " newborn, " " infant, " or " meningitis, finally, we reviewed e. sakazakii case consultations conducted by the centers for disease control and prevention (cdc) from 1998 to 2005 and reviewed results of a french outbreak reported to cdc in 2005 (14). we defined a case as an infant (< 12 months of age) with e. sakazakii cultured from an area of the body that is normally sterile: tissue, blood, cerebrospinal fluid, or urine aspirated through the bladder wall. infants with cultures of cerebrospinal fluid or brain abscesses yielding e. sakazakii were considered to have meningitis. because bacteremia is usually an intermediate step during the process of developing meningitis, patients with both bacteremia and meningitis bacteremia was defined as e. sakazakii grown from the blood of a case-patient without evidence of meningitis. infants with gestational ages<37 weeks, or those reported to be premature, were considered premature. a gestational age of 40 weeks was assigned to 3 (27%) of 11 infants with bacteremia and 4 (14%) of 28 infants with meningitis who were reported as born following term gestation without a specific gestational age mentioned. we defined birthweight<2,500 g as low birthweight (lbw),<1,500 g as very low birthweight (vlbw), and<1,000 g as extremely low birthweight (elbw). descriptive analysis was performed by using sas software (sas institute, cary, nc, usa). forty-six infants met the case definition (table 1). reported onset years ranged from 1958 to 2005; 32 (70%) cases cases were reported in 7 countries in north america, europe, and the middle east. thirty-three (72%) infants had meningitis, 12 (26%) had bacteremia, and 1 (2%) had a urinary tract infection. eight (40%) of 20 infants for whom data were available were delivered by cesarean section. twenty-nine (69%) of 42 infants experienced disease onset within a hospital. gestational duration was available for 38 infants; 21 (55%) were born prematurely, and the median gestational age overall was 36 weeks (range 23.540 weeks). the median birthweight was 2,063 g (range 5403,401); 18 (56%) of 32 infants had lbw; 9 (28%) of these met the definition for vlbw, and 7 (22%) met the definition for elbw. median age at the time of infection onset was 8.5 days (range 2300).*lbw, low birth weight; vlbw, very low birth weight; elbw, extremely low birth weight. although the proportion of infants who experienced nosocomial disease onset was not significantly different between the meningitis and bacteremia groups, other infant characteristics differed by site of infection (figure). the median gestational ages of infants with meningitis and bacteremia were 37 and 27.8 weeks, respectively (p=0.02). median birthweights were 2,454 g and 850 g, respectively (p=0.002). however, median age at infection onset was 6 days in the group with meningitis and 35 days in the group with bacteremia (p<0.0001). thirty (94%) of 32 infants with meningitis, but only 2 (18%) of 11 infants with bacteremia, were<28 days old when infection was detected. one infant (8%) with bacteremia died; this infant also had necrotizing enterocolitis. the single infant with a urinary tract infection recovered without complication. of 19 surviving infants, only those with meningitis suffered adverse outcomes, including brain abscess (21%, p=0.2), developmental delays (53%, p=0.004), motor impairment (21%, p=0.3), and ventricular shunt placement (42%, p=0.01); 74% experienced at least one of these outcomes. box plot with each box indicating range (vertical lines), first and third quartiles (lower and upper boundaries of box, respectively), and median value (horizontal solid line) for gestational age in weeks, birth weight in grams, and age of onset in days for infants with bacteremia only or meningitis. the dotted lines indicate median values for all cases.*significantly different values (= 0.05) between groups. twenty-four (92%) received a powdered formula product, including an infant who received powdered breast milk fortifier but no powdered infant formula; 1 additional infant received formula of an unspecified type. e. sakazakii was cultured from formula associated with 15 (68%) of 22 cases investigated. isolates were obtained from prepared formula, opened formula tins, and previously unopened formula tins associated with 2, 6, and 7 cases, respectively. thirteen (87%) of the 15 formula isolates were indistinguishable from the corresponding clinical strain by biotype or genotype; multiple formula manufacturers were implicated. in one of the remaining cases, multiple e. sakazakii strains were recovered from powdered formula, but none matched the clinical isolate by pulsed-field gel electrophoresis (cdc, unpub., 2 e. sakazakii strains were isolated from blood and from rectal swabs; a third strain, as determined by arbitrarily primed pcr, was recovered from the powdered infant formula (9). although numerous reports include infants with e. sakazakii isolated from nonsterile sites, such as respiratory secretions or stool, 46 infants identified from the literature and cdc sources met the case definition for this analysis (1,9,10,12). of the infants with sterile-site infection contrary to previous characterizations of e. sakazakii disease, we found that infants with meningitis and bacteremia alone fell into 2 distinct groups. those in whom meningitis developed tended to be of greater gestational age and birthweight than those with bacteremia alone. in fact, infants in whom meningitis developed tended to attain near-term gestational age and birthweight. in contrast, infants in whom bacteremia alone developed tended to be born very prematurely and have elbw. a second major difference between the group with meningitis and the group with bacteremia was the infants ' chronological ages. infants with meningitis were generally<1 week of age at the onset of infection with e. sakazakii, whereas infants with bacteremia had generally surpassed the neonatal period at the onset of their disease. rates of adverse outcome also differed between the 2 groups, although this was not unexpected. most infants with e. sakazakii bacteremia fared better than those with meningitis. among those in whom meningitis developed, rates of adverse outcome were similar to those reported in the literature: in this case series, 74% of meningitis survivors experienced an adverse neurologic outcome, while other studies cite adverse outcome in 20%78% of neonatal or infant meningitis survivors (2123). the division of the infant population into 2 distinct groups occurred for unclear reasons. that infants<1 week of age comprised the meningitis group was not surprising; the disparities in other infant characteristics, however, are not intuitive. since infants in the 2 groups experienced similar rates of nosocomial disease onset, the infants with bacteremia were unlikely to have simply received treatment earlier in the disease course than the infants with meningitis. powdered infant formula is a demonstrated source of e. sakazakii infection. a microbiologic survey of powdered infant formulas published in 1988 found e. sakazakii in 20 (14%) of 141 samples tested (24). however, a survey of 82 powdered infant formula samples in 2003 yielded e. sakazakii in 2 (2.4%), which suggests that recent rates of powdered formula contamination may be lower (25). powdered formula has also been implicated both epidemiologically and microbiologically as a vehicle in several cases of e. sakazakii disease in infants (1,3,9,10,13). although we could not explore feeding exposures fully with the data available in this series, infant feeding practices may relate to the differences we describe in chronological age of infants at onset of meningitis and bacteremia. infants with nearly normal gestational ages and birthweights are likely to be tended in normal newborn nurseries during the first 2472 hours of life. in such nurseries, powdered formula is frequently given to babies who are not breast-fed, and it may also be used as a supplement by mothers who have chosen to breast-feed. since infants are at highest risk for meningitis during the first several weeks of life, possibly because of immaturity of the blood-brain barrier, exposures to e. sakazakii in powdered formula or other sources during this time may quickly lead to central nervous system disease (26,27). conversely, in the intensive care settings where immature and low birthweight infants are tended, babies are not often fed powdered formula in the first few weeks of life. they may be given parenteral nutrition initially and may be fed breast milk from their own mothers or from a banked source when they do begin enteral feeds. if breast milk is not available, they are more likely to be given sterile, premixed infant formula than powdered formula, since standard preterm infant formula is only available in this form (28). powdered breast milk fortifiers are not introduced until premature infants tolerate full-volume feeds, which may not occur for days or weeks after birth. thus, infants in intensive care settings may not be exposed to nonsterile formula until they are more mature, which would lead to a greater proportion of e. sakazakii bacteremia than meningitis in this group if powdered formula is a source of infection. in this series, we were unable to explore the roles of indwelling enteric tubes, prior gastrointestinal surgery, and antecedent antacid or antimicrobial drug use as risk factors for infection. while the reservoir for e. sakazakii is unknown, e. sakazakii has been isolated from factories used to produce milk powder, chocolate, cereal, potato flour, spices, and pasta (29). it also has been isolated from household vacuum cleaner bags and from the guts of the stable fly, stomoxys calcitrans, and the mexican fruit fly, anastrpha ludens (2931). although a human vaginal tract culture yielding e. sakazakii has been reported, vertical transmission is unlikely because nearly half of infants with e. sakazakii disease in this review were delivered by cesarean section, and symptoms developed in only 1 infant earlier than 3 days of age (32). although cases with more severe outcomes might have been investigated and published more frequently than uncomplicated cases, this possible bias would not likely affect the representativeness of baseline infant characteristics. assigning a gestational age of 40 weeks to term infants without a reported gestational age may have falsely elevated the median gestational ages we report, since most term infants are born at<40 weeks ' gestation (33). however, a greater proportion of bacteremic infants than meningitic infants received this assignment, and therefore the significance of the differences in gestational age between the groups may be even greater than we report. we were unable to explore the effects of concomitant medical problems, treatments, and other environmental factors, and we relied on existing reports of feeding practices and formula testing. clearly, additional study is needed to elucidate the lingering questions about e. sakazakii reservoirs, disease risk factors, and disease course. other gram-negative organisms, including escherichia coli, enterobacter agglomerans, e. cloacae, klebsiella pneumoniae, k. oxytoca, and citrobacter freundii, can be found in powdered infant formula (24,25). powdered infant formula also has been associated with outbreaks of illness due to citrobacter and multiple salmonella serotypes (13,3438). the degree to which e. sakazakii is a marker for a range of neonatal infections possibly related to powdered infant formula remains to be defined. certain steps can be taken immediately, however, to prevent or mitigate e. sakazakii disease. in a joint conference on infant formula safety in february, 2004, the world health organization and food and agriculture organization of the united nations made the following recommendations: 1) encourage industry partners to develop a range of affordable sterile formula options; 2) consider setting an industry standard for enterobacteriaecae and e. sakazakii in infant formula; 3) inform infant caregivers of the risks associated with nonsterile, powdered formula; and 4) consider feeding high-risk infants sterile formula if they can not breast-feed (39). the findings of our case review suggest that all neonates as well as premature infants should be included in this high-risk infant category. the american dietetic association has issued guidelines for infant formula preparation, storage, and administration; these should be followed by infant caregivers in hospitals and private homes (40). rapid reporting of cases by clinicians could streamline data collection by local health departments and more rapidly resolve remaining questions about this illness. manufacturer warning labels on powdered infant formula packages should stress that powdered infant formula is nonsterile and requires proper preparation, handling, and storage, and that sterile, liquid formula alternatives are available. these actions, adopted in whole or in part, may decrease the infectious risks associated with powdered formula and prevent this rare but potentially devastating disease.

enterobacter sakazakii kills 40%80% of infected infants and has been associated with powdered formula. we analyzed 46 cases of invasive infant e. sakazakii infection to define risk factors and guide prevention and treatment. twelve infants had bacteremia, 33 had meningitis, and 1 had a urinary tract infection. compared with infants with isolated bacteremia, infants with meningitis had greater birthweight (2,454 g vs. 850 g, p=0.002) and gestational age (37 weeks vs. 27.8 weeks, p=0.02), and infection developed at a younger age (6 days vs. 35 days, p<0.001). among meningitis patients, 11 (33%) had seizures, 7 (21%) had brain abscess, and 14 (42%) died. twenty-four (92%) of 26 infants with feeding patterns specified were fed powdered formula. formula samples associated with 15 (68%) of 22 cases yielded e. sakazakii; in 13 cases, clinical and formula strains were indistinguishable. further clarification of clinical risk factors and improved powdered formula safety is needed.

PMC3291213

pubmed-133

radical prostatectomy (rp) is a common curative surgical treatment option in localized prostate cancer (pca). pelvic lymph node (ln) dissection is performed in order to determine the disease stage, prognosis, and the necessary future treatment options [1, 2]. the fatty tissue overlying the prostate is removed in order to have a better exposure of the dorsal venous complex, the puboprostatic ligaments, and the prostate apex. however, if this fatty tissue is not examined separately by a pathologist, the presence of lns and possible metastasis might be missed and underreported. this might ultimately have an impact on the postoperative disease stage, treatment, and oncologic outcomes. in our study, we investigated the histopathologic evaluation outcomes of anterior periprostatic fat (appf) tissues that were separately sent for pathologic evaluation in order to examine presence of lns and metastasis. overall, 129 patients who underwent rarp between january 2012 and october 2014 were included in our study. surgical procedures were performed by three robotic surgeons (afa, aec and mdb). all of the rarp procedures were performed via a transperitoneal approach and patients who had history of transurethral surgery or radiotherapy were excluded from the study. during the rarp procedures, appf covering prostate, endopelvic fascia, dorsal venous complex, prostatic apex, puboprostatic ligaments, prostate-vesical junction and the bladder neck was dissected en bloc laterally and cephalad. if metastatic ln(s) was /were detected, immunohistochemistry for prostate specific antigen (psa) and prostate specific acid phosphatase were performed. parameters including serum psa, prostate weight, body mass index (bmi), positive surgical margins (psm) and gleason score (gs) were included for further evaluation. patients were classified according to bmi (kg/m) as follows:<18.5 underweight, 18.524.9 optimal weight, 2529.9 overweight and>30 obese. mean patient age, serum psa, prostate weight and bmi were 62.2 5.5 (range 4574), 9.3 6.3ng/dl (range 0.330.3), 60.3 27.2 grams (range 11.0180) and 26.6 1.9 kg/m (range 20.0-30.3), respectively. overall, lns in appf tissues were detected in 14 (10.6%) patients with a mean ln yield of 1.1 0.7 lns (range, 13). among those found, no additional complication or morbidity due to excision of the appf was found in any of the patients. patient characteristics postoperative pathologic stages included pt0 (n=1, 0.8%), pt2a (n=22, 17.1%), pt2b (n=15, 11.6%), pt2c (n=62, 48.1%), pt3a (n=21, 16.3%) and pt3b (n=8, 6.2%). overall, psm were detected in 32 (24.8%) patients. of the patients with pt2 disease (n=99), psm rate was 13.1% (n=13). of the patients with pt3 disease (n=29), psm rate was 65.5% (n=19). of the patients with pt2a (n=22), pt2b (n=15), pt2c (n=62) and pt3a (n=21) disease, lns in appf tissues were detected in 1 (4.6%), 1 (6.7%), 11 (17.7%) and 1 (4.8%) patient in each group, respectively. no ln was detected in appf tissue in patients with pt0 (n=1) and pt3b (n=8) disease. of the patients with postoperative gs 3+3=6 (n=63), gs 3+4=7 (n=34), gs 4+3=7 (n=14) and gs 4+4=8 (n=7) diseases, lns in appf tissues were detected in 11 (17.5%), 1 (2.9%), 1 (7.1%) and 1 (14.3%) patient, respectively. no ln was detected in appf tissue in patients with postoperative gs of 5+3=8 (n=1), 3+5=8 (n=2) and 4+5=9 (n=6). we did not have any patient with postoperative gs of 5+4=9 or 5+5=10. of the patients, lns in appf tissues were detected in 0 (0%), 5 (35.7%), 8 (57.1%) and 1 (7.1%) patients of underweight, optimal weight, overweight and obese patients due to bmi, respectively. no association was detected between bmi and presence of lns or mean ln count in the appf tissue (p>0.05). we removed appf tissue as an en bloc excision and sent it as one piece for pathologic evaluation. we generally started removing the fat laterally from one side on the endopelvic fascia from, laterally to medially, and then shift to the other side. we accumulated both sides in the middle around the superficial dorsal vein on the prostate. thereafter, we elevated it above the prostate using maryland bipolar scissors and cauterized and cut its tip over the prostatic apex by applying bipolar energy. we then pushed it back up to the junction between the prostate and bladder neck and excised the tissue by applying monopolar and bipolar cautery. following excision of the appf tissue, the area of endopelvic fascia, puboprostatic ligaments, prostatic apex, surface of the prostate and junction between prostate and bladder neck are all cleared (figures 1 and 2). prostate, endopelvic fascia, puboprostatic ligaments, junction between prostate and bladder neck are covered with fat tissue. prostate, endopelvic fascia, puboprostatic ligaments, junction between prostate and bladder neck are seen clearly following excision of the fat tissue. in our study, we identified lns in appf tissue in 10.9% of the patients. aning et al. reported 14.7% (n=204) lns in appf tissue in their series, respectively. therefore, our findings are similar to previously published studies. in our study, no metastatic ln was detected in the lymphoid tissue that was obtained from the appf tissue region overlying the prostate. however, finley et al. found ln metastasis in 4 of 204 patients and jeong et al due to the published literature, ln metastasis rate in anterior periprostatic lymphoid tissue varied between 1.22.5% [58]. in our study, no metastatic ln was detected, which might be related to the limited number of patients in our series compared to the other published articles with a larger number of patients. in addition, studies that identified ln metastasis in anterior periprostatic lymphoid tissue had a higher volume of patients with high and intermediate risk patients, as compared to our study. in a multi-center study, kim et al. included 4261 rrp and rarp patients and there were 40 patients who had metastasis on periprostatic lns. of the 40 patients, 31 (77.5%) were in a high-risk group, 6 (15%) of them were in an intermediate group and 3 (7.5%) of them were in a low-risk group according to d'amico risk classifications. jeong et al. detected metastatic lns in appf tissue in 3 patients that were all in the high-risk group. in our study, 55 (42.6%) patients were in the high-risk group, 52 (40.3%) patients were in the intermediate-risk group and 22 (17.1%) patients were in the low-risk group. we summarized the outcomes of published literature on appf tissue and presence of lns in table 2. outcomes of published literature on periprostatic fat tissue and presence of lymph nodes the european association of urology (eau) and national comprehensive cancer network (nccn) recommended extended pelvic lymph node dissection (plnd) in patients at 10% or greater and 7% or greater calculated risk, respectively, for ln metastases. likewise, the american urological association (aua) recommended plnd in patients at higher risk for nodal involvement. prognostic significance of ln metastases in prostate cancer and assessment of rates of lns and ln metastases in periprostatic fat pads in radical prostatectomy were reported before. in our experience, we performed extended plnd in intermediate or high-risk pca patients and in those with at least 5% risk of pelvic ln involvement by pca, according to partin's tables. in addition, we always remove appf tissue and send it separately for histopathologic evaluation in patients with low, intermediate and high-risk in order to identify the presence of lns and possible metastasis that we think could have an impact on identifying the correct stage of the disease. we remove appf tissue in low-risk patients because removal of this tissue leads to better exposure of the prostatic apex, puboprostatic ligaments, endopelvic fascia and junction of bladder and prostate. kim et al. suggested that removal of appf tissue leads to more accurate staging of the patients. in their series, due to the identification of metastatic lns in the appf tissue, 0.63% of the patients were up-staged pathologically. this finding might certainly have an impact on postoperative adjuvant treatment requirement in this patient group. the condition of regional lns is one of the most important prognostic indicators of disease free survival and overall survival in pca. if a metastatic ln is detected in appf tissue; patients might require adjuvant hormone therapy or radiotherapy. by dissecting appf tissue anatomically, finley et al. observed that the anterior fat pad was directly connected to the obturator ln chain at the lateral pelvic wall. jeong et al. identified 3 patients with metastatic lns in appf tissue in their series of 258 patients, and 2 of these 3 also had metastasis in pelvic lns. harnisch et al. identified 4 patients who had metastasis in appf tissue in their study including 302 patients and 2 of these 4 patients had also pelvic ln metastasis. identified 4 patients with metastatic periprostatic lns but only one of them had also pelvic ln metastasis. to assess the need of adjuvant therapy, postoperative serum psa follow-up is important as well as detecting metastatic lns. in their multicenter study including 4261 patients, kim et al. reported that 6 of 40 patients with metastasis on periprostatic anterior fatty lymphoid tissue did not require adjuvant therapy at a follow-up of 1.651 months, which might suggest a therapeutic advantage. however, kim et al. separately evaluated appf tissue in three pieces as a left packet, middle packet and a right packet. in their results,, increased cost was another issue for pathological evaluation of periprostatic fat tissue. in order to decrease cost, they suggested asking for pathological evaluation of the appf tissue only in intermediate and high-risk patients. in our country, if the surgery is performed in private institutions, pathologic evaluation of the appf tissue increases costs. however, in government institutions, it does not increase overall cost because all expenses are covered by the government. in addition, because we think that complete removal of appf tissue leads to better exposure of the surgical field to the operating console surgeon, we excise it even in patients with low-risk pca. in our study, no association was detected between bmi and presence of lns or ln count in the appf tissue. bmi might have an impact on the amount of periprostatic fat rather than presence of lns. not only robotic series but also open retropubic radical prostatectomy (rrp) series have evaluated ln existence in appf tissue. identified lns in periprostatic region in 19 (5.5%) patients of 356 in their rrp series and 4 (1.2%) of them had metastasis, one of 4 patients had also pelvic ln metastasis. in this study they reported that there is no connection between periprostatic ln meta-stasis and pelvic ln metastasis, but in order to provide exact staging, pathologic examination of periprostatic lymphatic area should be a routine procedure. our study has some limitations that include limited number of patients and differences in the experiences of the surgeons that performed the cases. with increasing number of patients and having more high-risk pca patients lymph nodes might be present in the appf tissue which should be removed and sent for histopathologic evaluation following rarp. identification of metastatic lns in the appf might have an impact on postoperative staging and management of the patients. in addition, removal of appf leads to a better exposure of the surgical field.

introductionwe investigated whether anterior periprostatic fat (appf) tissue removed during robotic radical prostatectomy (rarp) contains any lymph nodes (lns). material and methodsappf tissues removed during rarp in 129 patients were evaluated histopathologically. correlation with postoperative pathologic stage was made. patients with a history of previous prostate or bladder surgery and radiation therapy were excluded. resultsmean patient age, serum prostate specific antigen (psa), prostate weight and body mass index (bmi) were 62.2 5.5 (range 4574), 9.3 6.3 ng/dl (range 0.26-30.3), 60.3 27.2 grams (range 11.0180) and 26.6 1.9 kg/m2 (range 20.030.3), respectively. overall, lns in appf tissues were detected in 14 (10.9%) patients with a mean ln yield of 1.1 0.7 lns (range, 13). among those found, no metastatic ln was detected. of the patients with pt2a (n=22), pt2b (n=15), pt2c (n=62) and pt3a (n=21) disease, lns in appf tissues were detected in 1 (4.6%), 1 (6.7%), 11 (17.7%) and 1 (4.8%) patient in each group, respectively. among the patients, lns in appf tissues were detected in 0 (0%), 5 (35.7%), 8 (57.1%) and 1 (7.1%) patients of underweight, optimal weight, overweight and obese patients due to body mass index, respectively. conclusionsin our series, lns were detected in around 10% of the patients. therefore, this fat should, not be pushed back during rarp but should be removed and sent for pathologic evaluation. although no metastatic ln was detected in our series, the presence of metastatic lns might have an impact on the oncologic outcomes of the patients and warrants further research.

PMC4742442

pubmed-134

the american marten (martes americana) is an arboreal mesocarnivore that ranges from the boreal forests of northern north america into coniferous and mixed coniferous/deciduous forests of the northern and northeastern united states, including the great lakes region (clark et al., 1987). the american marten was reintroduced to michigan's upper peninsula (up) and northern lower peninsula (nlp) in the mid-20th century after regional extirpation due to habitat loss and over-harvest (cooley et al., 2004). over 200 animals were reintroduced to the up over the course of several reintroductions. many fewer animals (n=36) were reintroduced in the huron-manistee national forest of the nlp and 49 martens were reintroduced to the pigeon river state forest of the nlp. in contrast, the species is considered a regional forester sensitive species and there is no harvest in the nlp (usda forest service, 2012). factors hypothesized to be contributing to the differences in population sustainability between the up and nlp include differences in habitat, genetic diversity, health and others. at the time of the original reintroduction, american marten were not examined for parasitic or infectious diseases (spriggs, unpublished data). some parasites are of economic or zoonotic importance and may be introduced with animal translocations. therefore, reintroduction programs should take into account the presence of parasites which are pathogenic or to which the species of concern is not adapted (kimber and kollias, 2000). a collaborative research effort has begun in order to investigate factors that may be contributing to the difference in sustainability between the up and nlp populations. the aim of this parasite survey was to describe the presence and prevalence of parasites in the huron-manistee national forest of the nlp and to determine whether there are differences in presence or prevalence of parasites between the nlp and up. should future translocation of animals from the up into the nlp be considered for management of the species, a non-invasive and inexpensive method for screening animals would be desirable. also, american marten are not harvested in the nlp and thus adequate numbers of carcasses are not available for examination. while some information exists regarding the prevalence of endoparasitism in american marten in north american, relatively little information is available for the species in michigan (poole et al., 1983, veine-smith et al., 2011). this study reviews previous parasite prevalence reports from american marten in north america, presents data from the parasitological examination of live-trapped american marten in michigan, and identifies a possible association between hookworm infection and anaemia in affected american marten. american marten (n=49) were sampled from the manistee national forest in the nlp (n=31), hiawatha national forest in the up (n=13) and ottawa national forest in the up (n=5). american marten were trapped and immobilized from 2011 to 2015 as described by desmarchelier et al. nine american marten were recaptured and re-sampled, resulting in a total of 60 faecal samples included in analyses. blood was collected from the jugular vein and placed into lithium heparin anticoagulant (bd microtainer tubes, becton dickinson and company). we determined haematocrit using microhematocrit capillary tubes (safecrit) and the statspin vt centrifuge (iris). individuals were identified as anaemic if the haematocrit was<42% based on a report of normal haematocrit in captive, fed american martens of 47 5% (nieminen et al., 2007). other health parameters were collected as part of a complete health assessment (spriggs, unpublished data). faecal float and sedimentation examinations were performed at michigan state university's diagnostic center for population and animal health using standard methods (zajac and conboy, 2012). faecal flotation was performed using sheather's sugar solution (specific gravity 1.251.27) alone (n=30) from may 2011may 2012 or with both sheather's sugar solution and zinc sulfate solution (specific gravity 1.18, n=30) from june 2012january 2015 and examined by light microscopy. fifty-nine of the samples, representing 48 individual animals, were sufficient in quantity for faecal sedimentation procedure. ova were identified based on morphologic characteristics including size and in accordance with parasitologic references and previous reports. upon consultation with a wildlife veterinary parasitologist (gerhold), 2 nematode species (syphacia muris and aspicularis sp.) prevalence was calculated as the number of infected hosts divided by the number of hosts examined. because some american marten were sampled more than once, all parasite species found in an individual were considered together for prevalence calculations. differences between locations (up and nlp) and sexes were examined with a pearson's test with p<0.05 considered significant. significant differences between presence or absence of anaemia and hookworm infection were also examined with a pearson's test. parasite species richness by host was calculated as the number of parasite species present per host; species richness by sample was calculated as the number of parasite species present per sample. an unidentified capillarid species was not included in the prevalence or host species richness if one or more species of capillaria was identified in other samples from the same host. thus, an individual american marten found with unidentified capillarid at the initial exam and aonchotheca sp. at a subsequent exam if both samples had unidentified capillaria, then the host was included in the calculation of prevalence of unidentified capillaria. differences between sex and location in species richness were examined with a wilcoxon rank sum test, with p<0.05 considered significant. the capture and handling protocol was approved by the university of tennessee animal care and use committee (protocol #2180), and american marten live-trapping and sample collection was an authorized tribal activity under the 2007 inland consent decree between the state of michigan and the little river band of ottawa indians. sixty samples from 49 individual american marten (28 males, 21 females) were examined, and results are shown in table 1. of 49 individual american marten examined, 91.8% were positive for 1 or more parasites and 69.4% were infected with 2 or more parasites. there was no significant difference in mean species richness by host between sexes or locations (nlp and up). trematode egg identification was suspected but not confirmed to be alaria sp. during the early part of the study (may 2011may 2012) when sheather's sugar solution alone was used for flotation, as alaria species may be distorted due to the osmotic pressure of sugar solution. later in the study (june 2012january 2015), trematode ova found on sedimentation were confirmed to be alaria species when the sample was floated with zinc sulfate solution, in which trematode ova will not be distorted. once the use of zinc sulfate solution was implemented, no trematode other than alaria species was identified, and the authors concluded that trematode eggs identified in the early samples were most likely alaria species, as suspected. in the up, 3 samples that were positive on sedimentation for trematode ova were suspected to be alaria species and 7 were confirmed via zinc sulfate flotation; in the nlp, 14 samples positive on sedimentation were suspected to be alaria species and 5 were confirmed via zinc sulfate flotation. capillaria eggs were seen in 79% and 78.1% of samples from the up and nlp, respectively. capillaria eggs were further identified as eucoleus aerophila, eucoleus boehmi, or aonchotheca putorii based on size and morphologic characteristics. a hookworm egg is shown in fig. 1. there was no significant difference in prevalence of any of the identified parasites between male and female american marten. of 9 american marten that were sampled more than once, only one had identical results for each time point. the mean haematocrit was 45.6 8.1 (range 3068; n=49). haematocrit was reported to be 47 5% in the only other report of american marten haematocrit (nieminen et al., 2007). using<42% as a cut-off american marten infected with hookworms were significantly more likely to be anaemic than non-infected american marten (p=0.01) with an odds ratio of 8.75 (95% confidence interval: 1.456.4). parasite species richness per host was similar to that reported by veine-smith et al. we identified more parasite species in the nlp than the up, but this result may be a function of the larger sample size from the nlp, and there was no significant difference in richness between the 2 locations. foreyt and langerquist (1993) found 2 or more parasites in 35% of american marten from eastern washington. in another survey from washington, 9 helminth species were found, and 48.4% of hosts had coinfection of 2 or more parasites, with a maximum of 4 (hoberg et al., 1990). overall, parasite prevalences were similar between the up and nlp in our samples and we conclude that the up may be suitable source for a translocation of marten to the nlp from the point of view of parasite translocation. additional screening of both populations, the use of molecular techniques to definitively speciate parasites, and testing of individual martens marked for translocation are recommended. parasites in our study were identified to the genus and/or species level as possible by microscopic examination alone. future research could employ the use of molecular tools such as polymerase chain reaction to provide more specific results. such techniques were not used in this study because we desired an inexpensive method that could be repeated in any future reintroduction programs that require screening of large numbers of animals. parasites identified as a concern for reintroduction of north american river otter included alaria canis, strongyloides lutrae, crenosoma goblei, capillaria and coccidia due to potential for pathogenic effects or high prevalence (kimber and kollias, 2000). river otter reintroduction programs tested and treated parasitized otters, and similar methods could be considered for reintroduction of american marten (hoover et al., 1985, griess, 1987, serfass et al., of 9 american marten that were sampled more than once, only one had identical results at subsequent sampling, indicating either a change in infection status or inconsistent shedding of ova in the remaining 8 marten. alaria species are flukes found in the small intestine of definitive hosts including felids, canids and mustelids. alaria mustelae is known to infect mink (mustela vison) and short-tailed weasels (mustela erminea), as well as american marten (veine-smith et al., alaria taxidae was identified from 25% (n=6) of american marten from the district of mackenzie, northwest territories and was identified in manitoba, canada, at prevalences ranging from 36 to 73% depending on the area (holmes, 1963, poole et al., 1983). a definitive host infected with alaria species in its intestines sheds eggs in its faeces. after 2 weeks in wet soil or water, the eggs hatch, producing a miracidium. the miracidium invades a freshwater snail, at which point it develops into a cercaria. when the tadpole is ingested by an amphibian, reptile, or rodent, the mesocercariae remain in the tissues of the paratenic host. the mesocercariae migrate through the stomach, across the diaphragm and into the lungs where the mesocercariae develops into metacercariae. the metacercariae are able to travel up the trachea and are then swallowed, at which point they develop into adult trematodes in the small intestines. while infection with alaria species typically does not cause disease in the definitive host, there are reports of the mesocercariae causing neurologic disease due to aberrant migration through the central nervous system and of respiratory illness due to migration through the lungs in domestic dogs (kimber and kollias, 2000, kazacos, 2001). other species of trematodes have caused disease in north american river otters, but the pathogenicity of alaria in american marten is not known (kimber and kollias, 2000). if a pregnant female rodent or carnivore becomes infected with alaria, the mesocercariae can migrate to the mammary glands and can be transmitted to nursing young (bowman et al., not yet weaned, in the nlp, histopathology revealed infection with alaria species in the duodenum, confirming the potential for lactogenic transmission of mesocercariae in this mustelid. in the report by veine-smith et al. (2011), faeces from the large intestines of 140 american marten carcasses from the up were examined for flukes using a sedimentation technique and found a prevalence of 39% (n=54). the difference in prevalence between that report and ours (55.6%, n=10) may be due to differences in sample size, methodology or a true difference (veine-smith et al., 2011). we recommend the use of both faecal sedimentation and zinc sulfate flotation for identification of trematode eggs in faecal samples obtained from live animals. euryhelmis squamula has been reported in raccoons (procyon lotor), mink, and american marten in washington and uses amphibian intermediate hosts in this region (hoberg et al. american marten from washington were documented with 6% prevalence from the southern cascades, confirming that marten are ingesting anuran prey in this area (hoberg et al., e. squamula has been reported in mink in north america and is a common parasite of the polecat in europe (ameel, 1938, miller and harkema, 1964). a related parasite, the mink is the natural host for euparyphium beaveri in michigan, while euparyphium inerme has been reported to infect river otters in the pacific northwest (miller and harkema, 1964, hoberg et al., 1997). hymenolepis nana is a zoonotic cestode of rodents, carnivores and humans found worldwide, but other species of hymenolepis infect galliformes, including potential american marten prey species. the parasite may use intermediate hosts or paratenic hosts, including dung beetles, stable flies and fleas (drew, 2003, joslin, 2003, loomis, 2003, sainsbury, 2003). without knowing the species of hymenolepis found from the american marten in the nlp, it is not known whether this may have been a pass-through finding or was truly an infection of the american marten; the zoonotic potential is not known. taenia species are cestodes (commonly known as tapeworms) that maintain a completely sylvatic life cycle. the definitive hosts for taenia mustelae and taenia martis americana are primarily mustelids. adult parasites live in the small intestine and eggs are passed in the faeces of the host. the ingested larvae form cysticercus in skeletal muscle and viscera, and the life cycle is completed when a carnivore consumes the infected intermediate host. while the definitive host typically shows no signs of disease, the intermediate host may suffer morbidity or mortality, including liver damage, as a result of infection (jones and pybus, 2001). t. mustelae has a wide distribution across the northern hemisphere and has been reported in north american mustelids, including american marten, short-tailed weasel (mustela erminea), mink (neovison vison) and least weasel (m. nivalis). the cestode has been found in 2 sciurid definitive hosts, marmota broweri and m. caligata (jones and pybus, 2001). taenia martis americana infects mustelids, including american marten, fisher (martes pennanti) and the ringtail (bassariscus astutus, family: procyonidae), as definitive hosts. rodents in north america reported with the larval stage of infection include lemmus sibiricus, microtus xanthognathus, mus musculus and ondatra zibethicus (jones and pybus, 2001). two american marten from the southern cascades were co-infected with both t. mustelae and t. martis americana (hoberg et al. adult parasites are found in the small intestine of definitive hosts, which include canids, felids and mustelids (bowman et al., larval or adult parasites can also infect birds, reptiles and other mammals (wardle and mcleod, 1952). eggs, or gravid proglottids, are suspected to be ingested by a first intermediate host, a coprophagic insect or a mite (chowdhury and aguirre, 2001, bowman et al., the insect is consumed by a second intermediate host, which may include birds, mammals, reptiles and amphibians. lastly, the definitive host becomes infected by ingesting the second intermediate host (bowman et al. definitive hosts may have clinical signs of infection including anorexia, low serum albumin and vomiting (chowdhury and aguirre, 2001). humans can be incidental definitive hosts and become infected by consuming undercooked game (chowdhury and aguirre, 2001, fuentes et al. mesocestoides lineatus was identified in the small intestine of 33% (n=14) of american marten from eastern washington with significantly higher rates in juveniles than in adults. current taxonomy, however, suggests that this species may have actually been m. variabilis, which occurs in north america, while m. lineatus is an old world species (fuentes et al., 2003). coinfections with m. lineatus and capillaria putorii occurred in 35% of parasitized american marten, and juveniles had statistically higher rates of coinfection than adults (foreyt and langerquist, 1993). hookworms are zoonotic nematode parasites infecting carnivores (taylor et al., 2007). carnivores may become infected via ingestion of larvae or eggs, paratenic hosts, or via percutaneous or lactogenic transmission. larvae migrate to the lungs, moult, and are coughed up and swallowed to lay eggs in the small intestine. ingested larvae may bypass pulmonary migration or migrate out of the lungs into the muscle and remain in an infected female mammal until pregnancy occurs, at which point the larvae migrate to the mammary gland leading to lactogenic transmission (taylor et al., 2007). hookworm infection in dogs and foxes can result in bloody diarrhoea, anaemia, poor hair coat, poor growth in puppies and respiratory signs (taylor et al., 2007). we found that the odds of having anaemia (haematocrit<42% as described by nieminen et al., 2007) were 8.75 higher for american marten infected with hookworms than in uninfected american marten in this study. while there was a significant association between presence of hookworm infection and presence of anaemia in this report, other clinical signs related to hookworm infection in addition, molecular techniques could be used to determine the species of parasite infecting american marten in michigan. because of the potential for anaemia to affect fitness of an individual american marten or the growth of kits infected via transmammary transmission, treatment of hookworm-infected american marten destined for relocation may be warranted. (previously known as capillaria putorii) infects the gastrointestinal tract of mustelids and other species, while other capillarids infect the respiratory tract, bladder or liver of their respective definitive hosts (bowman et al. a. putorii can have a direct or indirect life cycle in which adult parasites shed eggs in the gastrointestinal tract of the mammalian host. the eggs are capable of infecting other susceptible hosts directly or using an earthworm as an intermediate host (segovia et al., 2007, taylor et al., 2007) a. putorii was found in 77.8% (n=14) of american marten from the up in the current report, which was significantly higher than the 29.0% (n=9) prevalence in the nlp (p<0.05). however, during the initial stage of this parasite survey, some capillaria ova were not identified to species, and these are represented as if the 42.0% (n=13) prevalence of unidentified capillaria found in the nlp were in fact a. putorii, then there would not be a significant difference in prevalence of a. putorii between the up and nlp. the prevalence of a. putorii from the up in this report is higher than the 47% (n=66) previously reported from american marten carcasses from the up (veine-smith et al., 2011). a. putorii has also been reported in the stomach of ferret, mink, short-tailed weasel, raccoon, fisher and striped skunk (mephitis mephitis) and in the small intestine of bobcats, bears, raccoons, swine, hedgehogs and the domestic cat (foreyt and langerquist, 1993, bowman et al., 2009). in northeastern washington, c. putorii was found in 86% (n=13) of american marten carcasses, mostly in the stomach and less frequently in the large or small intestine of american marten. using faecal flotation alone, capillaria species ova were found in 64% (n=21) of samples examined from the same population (foreyt and langerquist, 1993). additional future comparisons between carcass and faecal examinations to determine prevalence of capillaria and other parasites is warranted. eucoleus aerophilus, previously known as capillaria aerophila, infects the respiratory tract of hosts including american marten and other carnivores, such as fisher, red fox (vulpes vulpes), raccoon, coyote (canis latrans), striped skunk and badger (taxidea taxus) (bowman et al., 2009). e. aerophilus rarely infects humans (laloevi et al., 2013). the life cycle of e. aerophilus may be direct or indirect with earthworms serving as intermediate hosts (bowman et al. aerophilus can lead to respiratory disease and clinical signs include coughing, wheezing, failure to thrive, pneumonia and even death. cats and dogs have also been infected but typically do not suffer the same degree of clinical signs as foxes since their infections are not as intense (bowman et al., 2009). e. aerophilus was identified in 4% of the respiratory tracts of american marten from ontario, but it is unknown whether infection resulted in disease or increased risk of being trapped (seville and addison, 1995). eucoleus boehmi has been reported to infect the respiratory tract of foxes and dogs (bowman et al., 2009). its ova can be differentiated from the similar e. aerophilus by its pitted surface (bowman et al., 2009). the relative contribution of earthworms to the american marten diet in michigan is not known but may be significant given the high overall prevalence of capillarid parasites seen there. physaloptera species are found in the stomach of infected carnivores, including mink, striped skunk, raccoons, dogs, and cats, and eggs are shed intermittently (chowdhury and aguirre, 2001, veine-smith et al., 2011). crickets, beetles or other invertebrates act as intermediate hosts, while rodents and reptiles may be paratenic hosts (chowdhury and aguirre, 2001). while most infections do not cause disease in the host, severe ulcerative gastritis has been reported in the bandicoot, a marsupial (perameles species) (holz, 2003). crenosoma species is a lungworm found within the respiratory tract of carnivores and insectivores (craig and anderson, 1972). adult parasites lay eggs in the lungs; larvae are coughed up, swallowed, and passed in host faeces. heavy infection with crenosoma species can cause clinical signs such as coughing, sneezing, nasal discharge and difficulty breathing (chowdhury and aguirre, 2001). the red fox is the typical host for crenosoma vulpis and is sympatric with american marten in both the up and nlp. given the global distribution of c. vulpis, it is likely that this parasite exists in the nlp red fox population although the parasite was not identified in american marten from the nlp in this study. crenosoma petrowi has been reported from free-ranging russian sable, a captive fisher in the united states and a badger from canada (craig and anderson, 1972). a single american marten from ontario was found to be infected with crenosoma petrowi (< 1% prevalence), but the reported prevalence in fisher from the same region was 15% (seville and addison, 1995). olsen (1952) examined 62 carcasses of martes caurina from colorado and found 18 (29%) to be infected with crenosoma, which he designated crenosoma coloradoensis. crenosoma species was found in the lungs of 2% (n=3) of american marten from the up of michigan (veine-smith et al., 2011). strongyloides martis and s. lutrae have been reported in river otters (hoberg et al., 1997). parasites of this genus are generally species or host-specific and undergo both a direct life cycle and a free-living stage. infective larvae or eggs in the soil are consumed by the host; larvae of some species can also enter the host through the skin (morris and shima, 2003). pathogenicity of strongyloides species in mustelids is not known, but disease could result from migration of the parasite through the lung (kimber and kollias, 2000). dioctophyme renale, commonly known as the giant kidney worm, is one of the largest roundworms infecting wild and domestic species worldwide including wolves, bears, foxes and mink, as well as domestic dogs, cattle, horses and pigs. humans have also been reported with d. renale (chowdhury and aguirre, 2001). the adult worm is typically found in the right kidney because the infective larvae exits the intestinal tract on the right side near the stomach. when the parasite dies, the kidney is essentially destroyed, and the host becomes reliant on the remaining left kidney. occasionally, both kidneys are infected or the parasite is found elsewhere in the abdomen. an adult female worm lays eggs within the kidney, and the eggs are shed in the urine of the host mammal. it takes about 6 months for the egg to become infective, at which point it may be swallowed by the intermediate host, lumbriculus variegatus, an aquatic annelid commonly known as blackworm. if the annelid is eaten by an american marten, or other mammalian host, the life cycle is completed when the larvae finds its way to a kidney. fish, frogs and crayfish may act as paratenic hosts by consuming the infected annelid (cheng, 1986, chowdhury and aguirre, 2001). a single american marten from the up was reported with nephritis due to suspected prior infection with d. renale (spriggs, unpublished data). in an examination of 405 american marten from ontario, d. renale was found in only 2% of american marten and only from districts with previous reports of infected mink. in 4 of the 5 infected american marten, there was evidence only of past infection such as the entire right kidney missing or merely a fibrous capsule remaining, while in 1 american marten the actual parasite was identified (seville and addison, 1995). filaroides martis is a helminth parasite found in the trachea, bronchi and lungs and has been reported to infect mustelids, including mink and american marten, as well as canids (chowdhury and aguirre, 2001). the larvae moults in the stomach mucosa of the definitive host and migrates to the thoracic cavity over the next month. larvae increase in size over 100-fold during this timeframe (ko and anderson, 1972). infection with f. martis has been reported to cause pneumonia in other species, but its effect on american marten is not known (chowdhury and aguirre, 2001). of 405 american marten examined from ontario, 8% had lung or aortic nodules associated with the parasite. because yearlings had a significantly higher prevalence of infection than other ages, the authors suggest that infection could have an effect on survival of yearlings or that american marten are able to recover from infection at older age groups (seville and addison, 1995). f. martis was found in the lungs of 4% (n=5) of american marten carcasses from the up of michigan (veine-smith et al., histopathology revealed lesions consistent with verminous pneumonia in 60% (n=9) of american marten carcasses from michigan (spriggs, unpublished data). while these were incidental findings and the causative parasite was not identified, it is possible that pneumonia may have resulted in mild respiratory compromise in affected american marten. pearsonema plica, previously known as capillaria plica, was identified in the urinary bladder of 6% of american marten from ontario (seville and addison, 1995). p. plica has been reported in the urinary tract of the domestic cat, dog, raccoon, red fox, coyote, wolf, striped skunk and fisher, as well as american marten (butterworth and beverley-burton, 1980). the definitive host begins to shed eggs of c. plica in the urine about 8 weeks after consuming an earthworm, the paratenic host (bowman et al., 2009). infection usually does not cause disease for the host, but there is a suggestion that p. plica resulted in poor growth in fox kits (bowman et al., baylisascaris devosi is a nematode reported in both american marten and fisher (kazacos, 2001). eggs shed from the definitive host become infective after 1114 days, at which point small mammals such as rodents and squirrels become infected by ingesting the eggs while foraging. the larvae migrate throughout the tissues of these paratenic hosts and typically localize to the muscle of the forelimbs and thorax. neural larval migrans, a neurologic disease, is rare or non-existent with b. devosi (kazacos, 2001). in contrast, the larvae of the related baylisascaris procyonis, or raccoon roundworm, frequently migrate to the central nervous system of non-adapted hosts and cause neural larval migrans. humans are susceptible to neural larval migrans caused by baylisascaris species, but b. devosi is less likely to cause disease in humans than b. procyonis (kazacos, 2001). adult b. devosi inhabits the small intestine; the definitive host does not typically show signs, but intestinal blockage is possible with a severe infection (chowdhury and aguirre, 2001). in 42 m. caurina carcasses examined from idaho, one was infected with b. devosi (erickson, 1946, poole et al., 1983). soboliphyme baturini, commonly known as stomach worm, is a nematode parasite distributed from central siberia across beringia to the pacific northwest of the united states (koehler et al., 2009). other mustelids reported with the parasite include ermine (m. erminea), mink and ferrets (mustelo putorius furo) (levine, 1968, swartz, 1968, koehler et al., 2009). s. baturini has been reported in other carnivores, including the fox and domestic cat (levine, 1968). mature female worms are found in the stomach or small intestine of the mustelid host, and eggs are passed in the faeces of the host. earthworms are the intermediate host, while shrews become paratenic hosts when they ingest the earthworm. american marten may be infected by consuming either infected shrews or earthworms (koehler et al., 2009). (2009) used genetic molecular data of s. baturini to shed light on the expansion of the ancestral american marten across beringia into north america, its speciation during isolation in glacial refugia, and re-colonization in alaska and reinfection with s. baturini. clinical manifestation of infection in sable includes anaemia and gastric ulceration (thomas et al., 2008). there was a 55% (n=155) prevalence of infection with s. baturini in american marten from prince of wales island in alaska (table 3). there was no correlation between intensity of s. baturini infection and fat deposits which measured to assess nutritional condition (thomas et al. american marten carcasses were collected over an 8-year time period from 3 locations in alaska and stomachs were examined for s. baturini (table 3). none of the american marten in that study had any sign of negative health impact from the parasite infection (zarnke et al., 2004). a study conducted in idaho examined 42 m. caurina carcasses and found one with s. baturini (erickson, 1946). it is found worldwide except in antarctica and australasia (chowdhury and aguirre, 2001). adult t. spiralis are found in the small intestine, and the females give birth to larvae which migrate through the body to become encysted in skeletal muscle. an american marten may become infected by consuming a rodent or other mammal with the encysted parasite. once consumed, the larvae are freed and migrate to the small intestine of the host to complete their life cycle. humans can acquire trichinellosis by eating undercooked meat (taylor et al., 2007). the first report of t. spiralis in american marten in north america was from manitoba, canada, where a single yearling was found infected of 139 american marten examined (poole et al., 1983). prevalence of trichinella in american marten and other species may vary from year to year (dick et al., 1986). american marten from the northern and southern cascades of washington were found to have trichinella encysted in the diaphragm, with a prevalence of 50% and 31%, respectively (hoberg et al., 1990). another study examined tongue muscle from 42 american marten from northeastern washington and found only 5% prevalence, which the authors attribute to differences in technique and tissues examined (foreyt and langerquist, 1993). a study conducted in ontario found a 3.4% prevalence (n=68) of infection with t. spiralis in american marten (dick et al., 1986). the prevalence in fishers in the study was slightly higher at 4.5% (n=83), and a single mink (of 12 tested) was positive. the authors suggested that american marten and fishers are key in the sylvatic transmission of trichinella in this part of canada (dick et al., 1986). other reports of t. spiralis in american marten are found in table 3. (1986) in which only mustelids were found with t. spiralis, this study found a high prevalence in coyote (61%, n=22) and confirmed infection in a variety of other mammals including carnivores and rodents (schmitt et al., 1976). dracunculus insignis is a parasite known to infect raccoons, dogs, mink, fishers and skunks in the united states east of the rocky mountains and in ontario, canada (crichton and beverly-burton, 1973, cheng, 1986). experimental infections in ferrets are used as a model for human dracunculiasis (eberhard et al., 1988). dracunculus lutrae infects otters in north america (crichton and beverly-burton, 1973). both species have a similar life cycle to the related the old world parasite didelphis medinensis, commonly called the guinea worm, a zoonotic parasite. female d. lutrae migrate to the tissues under the skin of the animal to give birth to live larvae while secreting a substance that causes a blister to form. when the blister ruptures and is exposed to water, the infective larvae is released into the water. the free-living larvae can survive for several days until they are consumed by an aquatic copepod, the intermediate host. d. insignis develops through several more stages within the copepod over the next 3 weeks. when a definitive host ingests the copepod while drinking water, the larvae are freed in the stomach or small intestine and migrate to abdominal organs and tissues where they continue to develop into adult worms over the next 812 months (cheng, 1986). d. insignis was found in only a single american marten of 405 examined in ontario despite the parasite being commonly found in raccoons of the same region. the authors suggested a higher true prevalence, but detection was low due to the pelt being removed for commercial reasons in most of the examined specimens (seville and addison, 1995). this parasite is of economic concern as it can affect pelt quality in fur-bearer species. a single american marten from the nlp was found to be shedding sarcocystis species sporocysts. sarcocystis species is a protozoal parasite that has infrequently been reported in carnivores such as domestic cats, dogs, raccoons, cougars, bobcats, mink, striped skunks, sea otters, fishers and pacific harbor seals (foreyt and langerquist, 1993, gerhold et al., 2005, larkin et al., 2011). (2005) reported a case of meningoencephalitis in a fisher caused by sarcocystis neurona in maryland, usa. the virginia opossum (didelphis virginiana) is the definitive host for the parasite in north america, but the natural intermediate host for s. neurona has not been discovered (gerhold et al., 2005). sarcocystis species was found in the tongues of 10% (n=4) of american marten examined from northeastern washington (foreyt and langerquist, 1993). antibodies to toxoplasma gondii were detected in 10.8% (n=15) of american marten in ontario. american marten in michigan were found to have a 58% seroprevalence (n=47), and there was no significant difference between the up and nlp (spriggs, unpublished data). t. gondii has been reported to cause mortality in the related black-footed ferret (mustela nigripes), captive-raised american mink (neovison vison) and southern sea otters (enhydra lutris) (dubey et al., 2003, burns et al., 2003, jones et al., 2006 coccidian parasites have been only rarely reported in american marten, but this is likely because few studies have used faecal flotation and/or histopathology to detect parasites. all coccidian parasites are obligate, intracellular parasites and undergo stages of asexual and sexual reproduction in the life cycle, which may be direct or indirect. coccidian oocysts from 5 american marten in this report were sporulated to allow identification to the genus level. eimeria species were identified in 2 of the 5 sporulated samples from american marten in the current study, and cystoisospora species in the remaining 3 samples. it is unknown whether coccidian oocysts seen in faecal samples were pass-through from prey species. taxonomy of coccidian parasites has been controversial; some have considered cystoisospora species to be synonymous with isospora species, while others believe it to be a distinct genus based on molecular and morphological characteristics (yi-fan et al., 2012). cystoisospora species were identified in american marten from michigan in this report based on morphological features of the sporulated oocysts. (2012) reported cystoisospora species in steppe polecats in china and suggested that previously reported isospora species in various other mustelids, including that of sable, should be reassigned to cystoisospora species. faeces from 33 american marten from eastern washington were examined, and 6% were found with coccidian oocysts (foreyt and langerquist, 1993). cryptosporidium and giardia species cysts were detected in the faeces of american marten from the up of michigan, both having a prevalence of 4% (n=5) (veine-smith et al., 2011). north american marten are infected with a wide variety of endoparasites, but information regarding the pathologic effects of parasitism remains limited. american marten infected with hookworms in the current study were found to be at risk for anaemia, and this association warrants further investigation. some parasites are infrequently reported in only a single location, while those reported in multiple locations typically have a varying prevalence. multiple ecological factors, including habitat, prey availability, sympatric carnivore community, and host adaptation, are likely involved in the variation of prevalence at different geographic locations. a number of parasites known to infect american marten have zoonotic potential. as american marten are frequently trapped as a furbearer species, this information could guide prevention of disease transmission to trappers and researchers working with the species. parasite infections could cause illness under conditions of stress and presumed immunosuppression associated with reintroduction programs (kimber and kollias, 2000). the majority of previous studies examined american marten carcasses for parasitism, which allows characterization and speciation of the adult parasite and information about intensity of infection. however, a non-invasive method of detecting endoparasitism is desired for reintroduction programs and our results provide baseline information about parasites detected by faecal examination from american marten in michigan. multiple faecal exams from individuals destined for relocation, including sedimentation and molecular techniques when available, are warranted to identify novel parasites and parasites with pathologic or zoonotic potential and to make appropriate treatment or management decisions.

the american marten (martes americana) was reintroduced to both the upper (up) and northern lower peninsula (nlp) of michigan during the 20th century. this is the first report of endoparasites of american marten from the nlp. faeces from live-trapped american marten were examined for the presence of parasitic ova, and blood samples were obtained for haematocrit evaluation. the most prevalent parasites were capillaria and alaria species. helminth parasites reported in american marten for the first time include eucoleus boehmi, hookworm, and hymenolepis and strongyloides species. this is the first report of shedding of sarcocystis species sporocysts in an american marten and identification of 2 coccidian parasites, cystoisospora and eimeria species. the pathologic and zoonotic potential of each parasite species is discussed, and previous reports of endoparasites of the american marten in north america are reviewed.

PMC4976135

pubmed-135

in korea, close to 86.8% of the elderly population (aged 65 or older) has chronic degenerative disease1. among these degenerative diseases, arthritis has the highest prevalence rate. osteoarthritis mainly occurs in the hip joints and knee joints, which are weight-bearing joints, and most elderly persons aged 65 years or older have this disease1, 2. osteoarthritis induces the growth of osteophytes, leading not only to pain but also to the loss of movement and often to a state of lethargy, in which the individual avoids walking1. this lethargy hinders the individual from performing functional activities, often resulting in muscle weakening and atrophy, including decrease in muscle force and motor unit activation of the muscles around the joint affected by osteoarthritis3. muscle weakening and atrophy further contribute to reduced walking and functional abilities required for daily living3. flexion-relaxation phenomenon (frp) refers to the appearance of muscular-electrical silence on the surface of the erector spine during complete trunk flexion4, which could be affected by several factors, including lumbopelvic postures5, repetition of tasks6, and muscle fatigue7. chronic osteoarthritis, therefore, often leads to stooped postures as a result of the tension experienced when assuming postures in which the erector spine is elongated3, 4. the erector spinae muscle is a posture-maintaining muscle that is used in all daily living activities in which trunk forward-tilting and straightening motions are performed. normal frp of the erector spinae is an important precondition for smoothly performing the functional activities of daily living and is an important measurement variable in the evaluation of treatment effects at clinics8. there are currently insufficient studies examining the effects of osteoarthritis on the frp of the erector spinae and on how the frp of the erector spinae observed in young adults is different from that of the elderly in whom osteoarthritis has occurred. therefore, the present study compared the frps of the erector spinae occurring during (1) trunk flexion, (2) complete trunk flexion, and (3) trunk extension motions in both healthy, young females and elderly females with chronic knee osteoarthritis. in addition, data regarding whether the frp of the erector spinae can be used as a method of evaluating the degree of pain in chronic osteoarthritis in the elderly will be presented. if the erector spinae flexion-relaxation rates can be used as a pain scale, it may assist healthcare professionals to improve elderly patients quality of life. this study was a randomized controlled trial, which included healthy adult females attending a university and elderly females aged at least 65 years diagnosed with chronic osteoarthritis in the leg, among the elderly community residing in a metropolitan area of chungcheongnam-do in south korea. the selection criteria for elderly subjects were as follows: those who had no orthopedic or neurologic disease affecting the leg other than chronic osteoarthritis, had not undergone surgical treatment of the leg within the last 6 months, had not experienced any fracture in the leg in the last 6 months, had corrected visual acuity not lower than 0.8 and had no blurred vision, could understand experimenters instructions and cooperate with the experimenters, and had understood the purpose of the present study and voluntarily agreed to participate. the study was approved by the institutional review board of hanyang university, and written informed consent was obtained from all patients prior to the experiments. the general characteristics of the subjects that participated in the present study are shown in table 1table 1.general characteristics of study subjects (n=30)elderly females with chronicosteoarthritis (n=17)healthy adult females (n=13)age (years), m sd 75.8 12.0*21.1 0.8height (cm), m sd153.5 6.3159.6 3.7weight(kg), m sd56.5 8.752.9 5.4*p<0.05. in the present study, surface electromyography (emg) (trigno wireless system, delsys inc., boston, ma, usa) was used to measure the muscle activity of the healthy adult females and elderly females with chronic knee osteoarthritis while they were performing trunk flexion, complete trunk flexion, and trunk extension. the emg signals measured by the trigno sensor and wirelessly transmitted to the trigno base station were analyzed using emgworks 4.0 (delsys inc., boston, ma, usa) software. all measured muscle activity values were calculated as percentages of maximal or submaximal voluntary isometric contraction values. the emg signal-sampling rate was 1,024 hz, and the signals were band-pass filtered within a range of 10500 hz. metronomes were used to enable the experimental subjects of the present study to perform trunk flexion, complete trunk flexion, and trunk extension for 5 s each over a total of 15 s. the beat was set to 60 bpm, and seconds were counted so that the subjects could hear and perform each motion for 5 s. before attaching the emg electrodes, sweat and foreign matter in the experimental muscle regions were removed in order to minimize skin resistance. the attachment points for measuring the thoracic erector spinae were 5 cm to the left and right of the spinous process of the t9, while the attachment points for measuring the lumbar erector spinae were 2 cm to the left and right of the spinous process of the l2. the manual muscle force postures for measuring of the maximal voluntary isometric contraction (mvic) in healthy adults and the submaximal voluntary isometric contraction in elderly persons with chronic knee osteoarthritis were determined following the method of osullivan et al6. the values of each subject were measured 3 times for 5 s, in succession, over a total of 15 s. measurements during the first and last seconds of each measurement period were excluded, and the maximum values during the middle 3 s were used for the quantification of the root mean square (rms). to minimize muscle fatigue, 1 the subjects were randomly measured in the order of voluntary participation. during the measurement of the flexion-relaxation rates, three motions were performed: (a) trunk flexion, (b) complete trunk flexion, and (c) trunk extension. posture 1 was a standing posture, posture 2 was a trunk-bending motion, and posture 3 was a maximum trunk-bending motion. in the complete trunk flexion section, the subjects were instructed to bend the trunk maximally within the range of bending with no pain before measurement. preliminary instruction was provided to the subjects by the experimenter, who performed the motions in front of the subjects and helped the subjects practice the motions at least one time. the flexion-relaxation rates were determined using both the values obtained by dividing the data for trunk extension by that of complete trunk flexion (c/b) and by dividing the data for trunk flexion by that of complete trunk flexion (a/b). the mean values of the three trunk flexion extension motions were used to determine the flexion-relaxation rates. the means and standard deviations of the general characteristics of the study subjects (age, gender, height, and weight) were calculated using descriptive statistics. in the present study, the independent variable was the presence or absence of chronic knee osteoarthritis, and the dependent variable was the frp of the erector spinae. independent t-tests were used to examine the erector spine flexion-relaxation rates according to whether the presence or absence of chronic knee osteoarthritis. to test the statistical significance, was set to 0.05, and the collected data were analyzed using pasw ver. the effect of chronic knee osteoarthritis on the frp of the erector spinae was first examined. the values obtained by dividing the data for trunk extension by that of complete trunk flexion were not different for the left and right lumbar erector spinae or right thoracic erector spinae; however, they were significantly different for the left thoracic erector spinae (p<0.05) (table 2table 2.flexion-relaxation phenomenon (frp) values obtained by dividing the data for trunk extension by those for complete trunk flexion from healthy adults and elderly individuals (units: %) musclesmean sdelderly females withchronic osteoarthritishealthy adultfemalesleft thoracic erector spine1.67 0.61*1.22 0.45right thoracic erector spine1.87 0.822.31 1.35left lumbar erector spine2.35 1.312.08 1.36right lumbar erector spine2.46 1.031.85 1.81*p<0.05). the values obtained by dividing the data for trunk flexion by that of complete trunk flexion, were not different for the left and right lumbar erector spinae and right thoracic erector spinae, but were significantly different for the left thoracic erector spinae (p<0.05) (table 3table 3.flexion-relaxation phenomenon (frp) values obtained by dividing the data for trunk flexion by those for complete trunk flexion from healthy adults and elderly individuals (units: %) musclesmean sdelderly females with chronic osteoarthritishealthy adult femalesleft thoracic erector spine1.47 0.55*1.12 0.31right thoracic erector spine1.41 0.491.99 1.43left lumbar erector spine2.00 1.082.58 2.75right lumbar erector spine1.76 0.901.62 1.31*p<0.05). in the present study, the frp of the erector spinae in elderly females with chronic knee osteoarthritis and healthy young females were measured to determine whether the erector spinae flexion-relaxation rates could act as a useful pain evaluation tool for patients with knee osteoarthritis. although no significant differences were evident in the flexion-relaxation rates of the left and right thoracic erector spinae or right lumbar erector spinae, significant differences were shown in the flexion-relaxation rates of the left thoracic erector spinae. degenerative arthritis develops in most people aged 65 or older, with a higher prevalence in females than in males. lower-limb osteoarthritis is associated with foot postures and affects the dynamic alignment of the lower limbs9. reilly et al.9 reported that patients with knee joint osteoarthritis showed changes in the ankle joint postures when compared with healthy individuals, and according to the study of hu et al.10, foot posture and stance widths affected the load-sharing mechanism of the lumbar muscle tissues. therefore, knee osteoarthritis was believed to affect the frp of the lumbar erector spinae. the frp can act as a quantitative measure for the evaluation of changes in the neuromuscular system functions11. varying flexion-relaxation rates among patients are a useful clinical tool that can help in diagnosing chronic lower back pain in patients3. this argument is supported by strong evidence that those subjects with low back pain do not exhibit the frp during complete trunk flexion12. watson et al.13 demonstrated the validity of measuring the frp of the lumbar vertebrae to diagnose lower back issues and reported high specificity and sensitivity. in addition, the flexion-relaxation rates are a valuable tool for distinguishing between patients with cervical pain and those with no cervical pain, and to indicate changes in the neuromuscular control in patients with cervical pain. the flexion-relaxation rates of the cervical spine were reported to be significantly lower in patients with cervical pain14. shin et al.15 advised that the knee angles and individuals flexibility levels affected the frp of the lumbar muscles. they reported that in the case of subjects with high flexibility, knee angles affected the flexion-relaxation rates when the trunk angle became 90, and in the case of those with moderate flexibility, the foregoing reactions appeared when trunk angles were 7090. they also reported that in the case of those with poor flexibility, knee angles did not affect the flexion-relaxation rates. according to the study by hashemirad et al.16, muscle activity pattern of the erector spinae varied with flexibility during trunk flexion/extension. the flexion-relaxation reactions are affected by several factors, including trunk loads, lumbosacral postures, trunk angular speed, number of task repetitions, and muscle fatigue6,7,8, 17. although previous studies were actively conducted on the effects of loads, angular speed, muscle fatigue, and postures on the flexion-relaxation rates, studies on the effects of changed lumbosacral postures of patients with chronic knee osteoarthritis on the frp of the erector spinae have been insufficient. therefore, the present study intended to examine the differences in the frp of the erector spinae between elderly persons with degenerative knee osteoarthritis and healthy adults. although not clinically significance, the results showed significant differences only in the left thoracic erector spinae, but not in the left and right lumbar erector spinae or right thoracic erector spinae. first, the study sample was small and was limited to females with chronic knee osteoarthritis second, although the same voice signals were given using a metronome during trunk flexion and extension, trunk speeds were different among individual subjects. third, the levels of knee pain were different among individual patients with chronic knee osteoarthritis, and the effects of medication and previous treatment could not be eliminated. to further determine the frp of the erector spinae in elderly females with chronic knee osteoarthritis, further studies that account for the limitations of the present study may be required.

[ purpose] this study investigated the flexion-relaxation phenomenon of the erector spinae in elderly women with chronic knee osteoarthritis and determined whether the flexion-relaxation phenomenon can be used as a pain evaluation tool in such cases. [subjects and methods] seventeen elderly females with chronic knee osteoarthritis and 13 healthy young females voluntarily participated in this study. they performed three postural positions in 15 s: trunk flexion, complete trunk flexion, and trunk extension, each for 5 s. while these positions were held, muscle activation of the thoracic and lumbar erector spinae were measured using surface electromyography. the flexion-relaxation rate was determined by dividing the values for trunk extension by those of complete trunk flexion and by dividing the values for trunk flexion by those of complete trunk flexion. [results] according to our results, the flexion-relaxation phenomenon was different between healthy young and elderly females with chronic knee osteoarthritis. specifically, there was a difference in the left thoracic erector spinae muscle, but not in the left and right lumbar erector spinae or right thoracic spinae muscle. [conclusion] our study demonstrated that the erector spinae muscle flexion-relaxation phenomenon can be used as a pain evaluation tool in elderly females with chronic knee osteoarthritis.

PMC4968486

pubmed-136

new-onset diabetes after transplantation (nodat) represents a common comorbidity after solid organ transplantation. nodat after kidney transplantation is associated with inferior outcomes, including higher risk of infections, decreased graft survival, higher rates of cardiovascular disease, and increased overall mortality [15]. risk factors for nodat include use of immunosuppressants, in particular corticosteroids and calcineurin-inhibitors, as well as traditional risk factors for type 2 diabetes including obesity, family history, age, and ethnicity [68]. metformin is the first-line agent of choice for the treatment of type 2 diabetes in the general population. though some data suggests metformin is safe in the setting of chronic kidney disease, the use of metformin in kidney transplant patients is still quite controversial due to the concern about lactic acidosis and lack of data regarding metformin use in this patient population [911]. therefore, it is important to identify an alternative first-line oral agent for the treatment of nodat in kidney transplant recipients. short-term studies have shown some oral antihyperglycemic agents to be effective in patients with nodat [1214]. however, use of these agents is limited by adverse effects including fluid retention and bone loss with pioglitazone and hypoglycemia and weight gain with insulin secretagogues [12, 15, 16]. sitagliptin, an oral dipeptidyl-peptidase-4 (dpp-4) inhibitor, was approved in the united states in 2006 for the treatment of type 2 diabetes. sitagliptin has a low incidence of hypoglycemia and does not promote weight gain, and the dosage can be adjusted based on renal function. additionally, in a 3-month trial of kidney transplant recipients, sitagliptin use did not alter immunosuppressant levels. however, evidence supporting the efficacy and safety of long-term use of sitagliptin in kidney transplant recipients is lacking. we hypothesized that in kidney transplant recipients sitagliptin would improve nodat control, as assessed by hemoglobin a1c (hba1c), with a favorable safety profile including no effect on immunosuppressant levels or graft function. in this single center study, we performed a retrospective analysis of kidney transplant recipients in the multidisciplinary transplant clinic at the university of nebraska medical center (unmc) between october 2006 (release date of sitagliptin in the united states) and december 2012. all subjects in this study received their kidney transplant at unmc. between 2009 and 2013, 125 to 149 kidney transplants were performed per year at unmc (http://optn.transplant.hrsa.gov/). we have previously reported an incidence of nodat of 18% in our kidney transplant population. the study was approved and monitored by the unmc institutional review board. a general query was performed to identify all kidney transplant recipients who had been prescribed sitagliptin during the study dates. data for the query and subsequent data collection for the study were obtained from review of the electronic medical records centricity (ge healthcare), ottr (ottr chronic care solutions), and epic (epic systems corporation). inclusion criteria for the study included diagnosis of nodat by the 2003 international consensus guidelines criteria (fasting plasma glucose 126 mg/dl or 7.0 mmol/l after no caloric intake for at least 8 hours or random plasma glucose 200 mg/dl or 11.1 mmol/l with symptoms of diabetes or 2 h plasma glucose in a 75 g oral glucose tolerance test (ogtt) 200 mg/dl or 11.1 mmol/l) and diabetes care received at the unmc diabetes center to allow for accurate record of diabetes medication changes and reporting of side effects. additionally, to specifically understand the efficacy and safety of sitagliptin for the treatment of nodat, patients included in the study either used sitagliptin as the initial agent for nodat or had other diabetes medications stopped prior to or at the time of sitagliptin initiation. exclusion criteria included diagnosis of diabetes prior to transplant and death or loss of followup prior to 12 months after initiation of sitagliptin. sitagliptin dosing was performed based on the patients ' renal function, as directed by the prescribing information for sitagliptin (https://www.merck.com/). initiation of sitagliptin therapy marked the start of followup for each patient and patients were followed up until discontinuation of sitagliptin or december 2012, whichever came first. the first was a 12-month followup to assess the subacute efficacy and safety of sitagliptin in terms of diabetes control, side effects, immunosuppressant levels, and graft function. the second endpoint was at discontinuation of sitagliptin or, for those patients who continued on sitagliptin through the entire study, in december 2012. this longer followup allowed for assessment of long-term efficacy and safety in terms of diabetes control, acute rejection episodes, allograft function, and other side effects. the patient medical records were reviewed in detail for a number of different diabetes and transplant-specific outcomes including dates of sitagliptin initiation/discontinuation; dates of initiation/discontinuation of any other diabetes medications; patient or physician-reported side effects; reason for discontinuation of sitagliptin; acute rejection episodes; graft loss; immunosuppressant regimens and dosages; opportunistic infections; and death. body mass index (bmi) was obtained at the time of transplant, at the time of sitagliptin initiation, after 12 months of sitagliptin therapy, and at the end of followup. as part of routine posttransplant and diabetes care, patients underwent fasting labs weekly to monthly at the clinical laboratory of the nebraska medical center including serum creatinine, tacrolimus and/or sirolimus trough levels (as appropriate), and fasting glucose levels. hba1c was performed every 3 months and fasting lipid panel every 3 to 6 months. serum creatinine, fasting serum glucose, hdl cholesterol, and ldl cholesterol measurements were performed using standard calibration protocols and dedicated analyzers and were assayed by colorimetric means. tacrolimus and hba1c was performed on a national glycohemoglobin standardization program (ngsp) certified high-pressure liquid chromatography (hplc) analyzer. estimated gfr (egfr) was calculated using the modification of diet in renal disease (mdrd) equation. a total of 65 patients were identified to have received sitagliptin after kidney transplant during the study dates. of these, 37 patients met criteria for nodat (figure 1). of these 37 patients, a total of 15 were excluded from the study: 9 patients who obtained their diabetes care at outside clinics and clear records of diabetes medication adjustments were not available; 1 patient who was deceased 8 months after sitagliptin initiation; and 5 patients because sitagliptin was added to other diabetes medications. the remaining twenty-two (22) patients met inclusion criteria and had at least one year of followup and were subsequently analyzed. this cohort of 22 patients does include long-term followup of eight of the fifteen patients analyzed previously at our center in a 3-month prospective study of sitagliptin for the treatment of nodat. baseline characteristics of the 22 patients included in the study are shown in table 1. of the 22 patients, nodat was diagnosed in 21 by fasting blood glucose 7.0 mmol/l on two occasions; one patient was diagnosed with random blood glucose>11.1 mmol/l with symptoms of diabetes. a majority of patients utilized tacrolimus-based immunosuppression with the addition of either sirolimus or mycophenolate mofetil (table 1). hepatitis c has been reported to be a risk factor for nodat; however, none of our subjects were hepatitis c positive. sitagliptin was the initial diabetes medication for a majority of the patients (16/22). a total of twenty-two patients were analyzed at the end of 12 months of sitagliptin therapy. of these, 19 patients remained on sitagliptin alone as their only diabetes medication, one patient required initiation of an additional oral diabetes medication, and 2 patients had sitagliptin discontinued in favor of other diabetes medications due to hyperglycemia. diabetes control, as noted by hba1c, was significantly improved at the end of 6 months and this effect persisted at 12 months (figure 2(a)). significance remained when analyzing just those patients (n=19) who remained on sitagliptin alone for the entire 12 months (data not shown). there was a modest but significant decrease in bmi from the start of sitagliptin to the 12-month followup (figure 2(b)), though certainly this weight loss may have been due to multiple factors including lifestyle modifications. ldl and hdl cholesterol values remained unchanged with sitagliptin therapy (figures 2(c) and 2(d)). at the 12-month followup, graft function as noted by serum creatinine and estimated gfr (egfr) was no different than at start of sitagliptin (figures 3(a) and 3(b)). we then reviewed immunosuppressant levels over the 12 months of followup and also meticulously reviewed medical records for immunosuppressant dose changes and, if changes to dose were made, the impetus for doing so. tacrolimus and sirolimus levels remained stable throughout the 12-month followup (figures 3(d) and 3(e)). in tacrolimus-treated patients, for the remainder of tacrolimus-treated patients only 3 patients required a single protocol dose adjustment and the rest maintained consistent tacrolimus doses. similarly, the patient with noncompliance required frequent sirolimus dose adjustments during the follow-up period while 3 patients had single, protocol-related sirolimus dose adjustments. to assess the long-term efficacy and risk for adverse effects of sitagliptin in kidney transplant recipients, we followed our cohort from the initiation of sitagliptin until december 2012 or discontinuation of sitagliptin, whichever came first (mean followup for all 22 patients=32.5 17.8 months). in the cohort, 17/22 patients remained on sitagliptin throughout the study period, for a mean duration of sitagliptin use of 37.9 16.5 months. of these 17 patients, 9 remained on sitagliptin alone for the entirety of the study (31.8 18.7 months). diabetes was well controlled in this group, with hba1c maintained below 7% (6.5 0.5%) at the end of followup (figure 4(a)). eight patients continued on sitagliptin for the duration of the study (44.9 10.9 months) but required addition of other diabetes medications to maintain glycemic control (oral agents, n=4; insulin, n=4). hba1c remained well controlled in this group (figure 4(b)) and two of the four patients on insulin required only basal insulin in addition to sitagliptin. therefore, five patients discontinued sitagliptin in favor of other diabetes medications after 14 4.2 months. of these, 4 patients discontinued sitagliptin due to worsening hyperglycemia (figure 4(c)) and need for intensive insulin therapy while one patient was switched from sitagliptin to a sulfonylurea due to cost. hemoglobin a1c was significantly lower at baseline in patients who were able to continue on sitagliptin alone for the duration of the study (n=9) compared to patients who discontinued sitagliptin and were switched to more aggressive diabetes management (n=5) (figure 4(d)). change in bmi, from sitagliptin initiation to the end of followup, was no different between these groups (sitagliptin alone: 0.8 2.2 kg/m versus sitagliptin discontinued: 1.1 1.7 kg/m, p=ns) suggesting the need for intensification of diabetes therapy in the sitagliptin discontinuation group was not necessarily related to weight gain. glucagon-like peptide-1 (glp-1) therapies have been implicated to potentially increase the risk of pancreatitis, a matter of significant controversy. in the current study, no episodes of pancreatitis were reported during the follow-up period. additionally, other transplant-specific adverse events were rare in our cohort, including one episode of acute rejection (47 months after sitagliptin initiation); two episodes of opportunistic infections (13 and 14 months after sitagliptin initiation); no graft loss; and one death (due to end-stage liver disease). our study represents the largest cohort investigating the safety and efficacy of sitagliptin for the treatment of nodat in kidney transplant recipients. though our study was retrospective, through meticulous review of the medical records of patients followed up primarily in our transplant endocrine clinic we were able to closely follow medication prescribing changes, laboratory values, and reports of potential side effects and transplant-related comorbid events. in our cohort, sitagliptin was efficacious with a majority of patients meeting a goal hba1c<7%. specifically, sitagliptin alone was adequate to improve and maintain glycemic control in a majority of patients (19/22) for 12 months after sitagliptin initiation, consistent with its efficacy in the nontransplant population [21, 22]. sitagliptin inhibits dpp-4 with several subsequent effects that improve blood glucose control including potentiation of insulin secretion and inhibition of glucagon secretion. in studies utilizing animal models of type 2 diabetes, sitagliptin has also been shown to reduce islet inflammation and protect beta cell mass [2325]. beta cells exposed to glp-1 in vitro are resistant to toxicities associated with immunosuppressants, suggesting another potential benefit to dpp-4 inhibitor therapy for the treatment of nodat. these beta cell-specific protective effects of sitagliptin may explain why, in our cohort, patients with lower baseline hba1c responded better to sitagliptin monotherapy as these patients may have been earlier into the disease and may have had more beta cell mass that was subsequently protected by sitagliptin. overall, these findings suggest that initiating sitagliptin therapy early in the treatment of nodat, when average glucose levels are only modestly elevated, may provide long-term benefits in terms of glycemic control. larger cohorts are needed to investigate this point further. in solid organ transplant recipients, drug-drug interactions and adverse effects of medications on graft function we set out to better define the safety profile of sitagliptin in kidney transplant recipients in terms of effects on immunosuppressant levels/dosing, graft function, and other side effects. renal function and tacrolimus and sirolimus dosing and trough levels remained stable during the initial 12-month follow-up period, indicating sitagliptin does not adversely affect renal function or interfere with immunosuppressant dosing. hypoglycemia was not encountered in our cohort, consistent with reports of sitagliptin use in the nontransplant population. the use of dpp-4 inhibitors for the treatment of hyperglycemia and nodat in kidney transplant recipients is gaining more interest. recently, a 3-month clinical trial of vildagliptin, another oral dpp-4 inhibitor, revealed that this agent improved oral glucose tolerance test outcomes and modestly improved hemoglobin a1c in kidney transplant recipients with impaired glucose tolerance (igt). similarly, a small, randomized control trial recently revealed vildagliptin to be a safe and effective therapy for the treatment of nodat in kidney transplant recipients. finally, a 24-week retrospective study of linagliptin suggests this agent may be beneficial for treating nodat, as well. however, data regarding sitagliptin for the treatment of nodat in kidney transplant recipients is scarce. a single pilot study of 15 patients followed up for 3 months revealed no significant effect of sitagliptin on renal function (as measured by estimated gfr) or tacrolimus or sirolimus levels. additionally, iuppa et al. presented an abstract discussing the use of sitagliptin in solid organ transplant recipients and, although most of the subjects were liver transplant recipients, 18 kidney transplant recipients were reported on with a median followup of all patients (kidney and liver transplant recipients) of 178 days. these small trials and a case report of a single kidney transplant recipient treated with sitagliptin for 2.5 years encompass the entire literature available on this subject. our study provides the most person-years of followup of any trial of sitagliptin for the treatment of nodat in kidney transplant recipients. additionally, though retrospective, our study provides the longest followup of any dpp-4 inhibitor used for the treatment of nodat in kidney transplant recipients. limitations of our study include the retrospective nature of our study and the small cohort size. however, large, prospective studies regarding glucose-lowering therapy for nodat do not exist currently (as reviewed) and our study represents the largest study to date examining the use of sitagliptin in the setting of nodat after kidney transplantation. our cohort was comprised mostly of caucasian males and steroids were not part of the maintenance immunosuppressant regimen. these factors may limit the ability to generalize our findings. finally, our mean time to diagnosis of nodat (56.3 57.7 months after transplant) was longer than many studies of nodat. this likely reflects that the patients in our cohort had slower, less aggressive development of nodat and did not require insulin therapy. kidney transplant recipients with viable grafts remain at higher risk of diabetes development, a significant portion of the risk being ascribed to immunosuppressant therapy. safe, effective therapies are needed for patients who develop nodat regardless of the timing of the diagnosis, and sitagliptin may be useful for this purpose given the favorable side effect profile and lack of interaction with immunosuppressant medications. in conclusion, we have shown that, in a small cohort of kidney transplant recipients who developed nodat, sitagliptin was efficacious as a single agent or in combination with other glucose-lowering medications. sitagliptin was also well tolerated and renal function and immunosuppressant levels and dosing were stable during 12 months of therapy. sitagliptin may be valuable as a first-line agent in kidney transplant recipients diagnosed with nodat who are candidates for oral therapy.

new-onset diabetes after transplantation (nodat) is a common comorbidity after renal transplantation. though metformin is the first-line agent for the treatment of type 2 diabetes, in renal transplant recipients, metformin is frequently avoided due to concerns about renal dysfunction and risk for lactic acidosis. therefore, alternative first-line agents for the treatment of nodat in renal transplant recipients are needed. sitagliptin, a dipeptidyl-peptidase-4 (dpp-4) inhibitor, has a low incidence of hypoglycemia, is weight neutral, and, in a small study, did not affect immunosuppressant levels. however, long-term sitagliptin use for the treatment of nodat in kidney transplant recipients has not been studied. we retrospectively analyzed renal transplant recipients diagnosed with nodat and treated with sitagliptin to assess safety and efficacy. twenty-two patients were started on sitagliptin alone. after 12 months of followup, 19/22 patients remained on sitagliptin alone with a significant improvement in hemoglobin a1c. renal function and immunosuppressant levels remained stable. analysis of long-term followup (32.5 17.8 months) revealed that 17/22 patients remained on sitagliptin (mean hemoglobin a1c<7%) with 9/17 patients remaining on sitagliptin alone. transplant-specific adverse events were rare. sitagliptin appears safe and efficacious for the treatment of nodat in kidney transplant recipients.

PMC4003765

pubmed-137

substantial improvement in survival of people living with hiv has been observed with the introduction of antiretroviral therapy (art) in sub-saharan africa. however, the introduction of art has led to new immune-mediated complications from dysfunction of the recovering immune system, termed immune reconstitution inflammatory syndrome (iris). in patients with cryptococcal meningitis (cm), a very common opportunistic infection in sub-saharan africa, iris is a frequent complication that is most often associated with exaggerated inflammatory responses in the central nervous system. although cm remains the most common cause of adult meningitis in the overall population in sub-saharan africa, there are only a few recognized, reported cases of gastrointestinal (gi) involvement with cryptococcus in the literature. an hiv-infected patient on art with a history of recent cm presented with chronic abdominal pain, thickened ileum, and abdominal lymphadenopathy. he was initially treated for abdominal tuberculosis (tb) but later, he was shown to have a histologically confirmed cryptococcoma in the ileum. the major objective of this case report is to highlight the challenges in diagnosis and management of intra-abdominal cryptococcosis, especially in the setting of recent initiation of art. a 37 year old hiv-positive male was initially diagnosed and treated for cm in may of 2009 with amphotericin induction therapy for 2 weeks followed by fluconazole 400 mg/day. he had a protracted hospital course lasting 4 weeks because of persistently high intracranial hypertension despite sterilization of his cerebrospinal fluid, and he, required repeated therapeutic lumber punctures. he started art (zidovudine, lamivudine, and efavirenz) on the 11th june 2009 with a baseline cd4 count of 5 cells/l. at day+21 of art, he reported abdominal pain with hypogastric tenderness that was empirically treated as urinary tract infection with a 5 day course of ciprofloxacin, and he noted some improvement. his cd4 count at the time had risen to 29 cells/l. at day+35 of art, his general exam was unremarkable, except for a tachypnea of 28 breaths per minute. the patient was managed as a possible atypical pneumonia with doxycycline, and his respiratory symptoms improved. however, the abdominal pain persisted intermittently with occasional vomiting. at day+84 of art and in view of the persistent abdominal pain and an occasional dry cough, another chest radiograph was performed to exclude tb, which was also unremarkable. at this time, his cd4 was only 14 cells/l, and the hiv-1 viral load was 22,000 copies/ml. he reported 100% adherence to his art, and pill counts verified his adherence. at day+112 of art, the patient still had similar complaints of abdominal pain and occasional vomiting. repeat cd4 was 8 cells/l, and the viral load was minimally decreased at 15,475 copies/ml. the patient initially declined an ultrasound-guided biopsy but consented to the procedure at day+140 of art. this second ultrasound revealed a thickened ileum up to 6 mm, with adjacent 1 cm lymph nodes. two biopsy specimens from the lymph nodes demonstrated no abnormality at histology. at day+168, the patient still had the same complaints with almost unchanged cd4 of 24 cells/l and viral load of 23,755 copies/ml. he was presumed to be failing art, possibly due to poor absorptive surface because of the thickened gut wall. a decision was made to initiate empiric anti-tb treatment for possible gastrointestinal tb. after one week of tb empiric therapy, the patient presented with an acute abdomen, having signs of focal peritonitis in the right iliac fossa. an upright abdominal radiograph demonstrated evidence of perforation with free air visible under the right hemidiaphram. an emergency laparotomy was performed, revealing fecal matter with purulent fluid, adhesions, pneumoperitonium, and intestinal perforation at 10 cm proximal to the ileocecal junction. the confirmatory histopathology report received 2 weeks later revealed a cryptococcoma in the ileal wall as the cause of the perforation with exuberant inflammation demonstrated by the multinucleated giant cell (figs. 2 and 3 on hematoxylin and eosin stain and figs. 4 and 5 on periodic acid-schiff stain). the patient's marked clinical improvement after surgery, the lack of any evidence of cryptococcal infection elsewhere in the body especially in the central nervous system and a well formed granuloma formed the basis for the patient's continuation with maintenance dose of fluconazole 200 mg/day under observation. at this point, his tb medications were stopped and he was switched to second line art with subsequent viral suppression. through december 2014, he continues to remain in care on second line art without any complaints. we have presented a 37 year old hiv positive male, with a history of recent cm who subsequently developed chronic abdominal pain, eventually manifesting as a cryptococcoma of the ileum. after treatment for cm and initiating art, he had presented with chronic abdominal pain and low grade fever without diarrhea. he subsequently developed an intestinal perforation and presented with an acute surgical abdomen requiring bowel resection. we suspected an iris phenomena, in accordance with the patient presentation shortly after initiation of art, recent history of cm, and exuberant inflammation in the granuloma on histology. although, the initial immune recovery coupled with falling hiv-1 viral loads is consistent with iris, the subsequent virological failure makes the diagnosis of paradoxical iris less clear. in cryptococcosis, ideally, intra-operative cultures would have been performed which could have helped distinguish iris from cryptococcal relapse, based on culture sterility vs. growth, respectively. cryptococcus organisms can be acquired in the gut primarily through hematogenous dissemination or less commonly through direct inoculation during paracentesis or via a neurosurgical shunt. the presentation in these gi cases of cryptococcal infection is usually vague, as seen in our patient, with subacute fevers, constitutional symptoms, asthenia, and anorexia. virtually every intra-abdominal organ has been reported to be affected by cryptococcal infection. the diagnosis of gi cryptococcosis requires a high index of suspicion, yet as in this case, clinicians may often initially focus on other common etiologies in immunocompromised persons, such as tb. although abdominal tb was found to be the most common diagnosis in patients with hiv/aids presenting with chronic abdominal pain and abdominal lymphadenopathy, these studies were conducted predominantly in persons without cryptococcosis. among persons with a known pre-existing opportunistic infection, such as cm, the pre-test probability changes as paradoxical iris enters into the differential diagnosis. in our case, the characteristics of granulomas found in hiv-infected persons varies depending on whether or not they are receiving art. in pulmonary cryptococcomas, persons not receiving art demonstrate yeast proliferation with a histiocytic response but only minor lymphocytic and neutrophilic components. conversely, cryptococcal granulomas in persons on art are characterized by the presence of cd4 t cells, greater response of histiocytes, and multinucleated giant-cell formation, as demonstrated in our patient. there is a paucity of evidenced-based data for the management of cryptococcomas. in our case, the initial abdominal lymph node biopsy (5 weeks prior to the perforation) did not reveal a diagnosis. the question raised is, if we had confirmed the diagnosis of gi cryptococcoma before the perforation, would we have been able to effectively intervene. to answer this question, it might be important to know if the cryptococcoma were due to iris or cryptococcal relapse. could the patient have benefited from immunosuppressive therapy to treat iris and perhaps, avoid the perforation, or would more enhanced fungal therapy be needed to eradicate the cryptococcus? two case reports have described cryptococcomas due to paradoxical iris; one in the brain and the other in the retroperitoneal abdomen. in both cases, they simply observed the patients but also emphasized the importance of confirming sterility of contents in the cryptococcoma by culture. in a case report by katchanov et al., a similar presentation of a central nervous system cryptococcoma was initially treated with antifungals exclusively with radiological worsening until steroids were added to direct therapy at paradoxical iris. we have previously reported the challenges and dangers of using corticosteroids for cm because they may be contraindicated in cases of fluconazole-resistant cryptococcal relapse. surgery, corticosteroids, and interferon-gamma have been tried in iris-like cryptococcomas due cryptococcus gattii. empiric tb therapy, including rifampin, could have induced the metabolism of fluconazole, possibly lowering plasma levels by ~50%. these lower levels may have removed the fungistatic control of the cryptococcus, precipitating the perforation. however, after the surgery, the patient was observed on secondary prophylaxis doses of fluconazole, and he did well. to treat a cryptococcoma in the setting of recent initiation of art, where iris versus relapse can not be determined due to the absence of culture results, treatment with a combination of enhanced antifungal therapy and anti-inflammatory therapy gi cryptococcosis has been described as a rare occurrence, with only a few published case reports. we have discussed an hiv-infected patient with profound immunosuppression and recent cm who developed a gi cryptococcoma during initial immune recovery followed by virological failure after initiation of art. the cryptococcoma was not identified and he developed perforation of the ileum, requiring surgery. we anticipate that with the roll out of art in sub-sahara africa, we are bound to see rare presentations of some of common conditions such as cm. we recommend that health workers have a high index of suspicion for unusual complications of opportunistic infections in the setting of art-associated iris. often treatment of iris requires only observation or anti-inflammatory drugs, but the presence of active infection needs to be excluded. the authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

the introduction of antiretroviral therapy (art) may lead to unusual paradoxical and unmasking presentations of opportunistic infections. intra-abdominal cryptococcosis is a rare manifestation of cryptococcus. we present the case of an hiv-infected patient on art, with a history of cryptococcal meningitis who presented with subacute, worsening abdominal pain during immune recovery. this evolved into chronic abdominal pain, with thickened bowel, and abdominal lymphadenopathy, while receiving empiric tuberculosis treatment. at 6-months, he developed intestinal perforation due to a histologically confirmed cryptococcoma.

PMC4389205

pubmed-138

gemcitabine is a modified cytidine analog having two fluorine atoms at the 2-position in the deoxyribose sugar moiety (scheme 1). for nearly 20 years, it has been widely used to treat specifically pancreatic cancer. it has been proposed that gemcitabine inhibits ribonucleotide reductase (rnr) activity as well as acting as a replication stop, thereby affecting dna synthesis and elongation. the two highly electronegative f-atoms at c2 substantially increase the acidity of h3 through the inductive effect. it is well established that in the absence of oxygen, thiyl radicals are able to abstract hydrogen (h) atoms to form neutral c-centered radicals. for example, h-atom abstraction by thiyl radicals has been shown to induce isomerization of cis-2,5-dimethyltetrahydrofuran to the trans-2,5-dimethyltetrahydrofuran. on this basis, stubbe et al., in their enzymatic and electron spin resonance (esr) studies with gemcitabine, have proposed that inhibition of the rnr activity by gemcitabine should occur via radical formation at the c3 site by direct h-atom abstraction to produce a c3 via a enzymatic thiyl radical (reaction 1). subsequently, the c3 intermediate has been proposed to form 3-keto c2 via hf loss. this c2 is stabilized by an oxy radical resonance contribution (reaction 2). c2 and its immediate precursor c3 (reactions 1 and 2) play a key role in the rnr inactivation.12 the h-atom abstraction reaction (reaction 1) is not only important in rnr activation but also plays a very key role toward stable product formation in other biologically damage processes in dna, such as oxidative intrastrand cross-link formation and in the formation of sugar radicals that are strand break precursors. it is noteworthy that pulse radiolysis experiments with a 1,4-anhydro-5-deoxy-6-thio-d-ribo-hexofuranitol detected the formation of ribosyl-based carbon-centered radical(s) after h-atom abstraction by thiyl radicals. these studies are supportive of reactions 1 and 2 but unequivocal, and direct detection of c3 and c2 employing esr or pulse radiolysis during rnr-catalyzed deoxygenation of the natural substrates or during inactivation by gemcitabine still remains elusive. in this work, we report the formation of c2 from a likely c3 in a gemcitabine analog which mimics the mechanism proposed above. from the structural formula of gemcitabine (scheme 1), it is expected that the negative inductive effect (i) of two highly electronegative f-atoms at c2 should increase the acidity of h3. from our previous work on nucleoside cation radicals, the gemcitabine cation radical formed upon one-electron oxidation is expected to produce c3 after deprotonation of the acidic proton h3. in this work, esr spectroscopy has been employed to investigate one-electron oxidation of gemcitabine and other 2-modified derivatives, for example, 2-deoxy-2-fluoro-2-c-methylcytidine (mefdc (psi-6130); scheme 2) and 2-fluoro-2-deoxycytidine (2-fdc, scheme 2), in order to test the influence of 2- substituent on radical site formation. it is noteworthy that mefdc is a well-known clinically efficacious inhibitor of hepatitis c virus. the esr results clearly identify the c3 formation in one-electron oxidized gemcitabine and the production of c2 in one-electron oxidized mefdc. these calculations show that in the case of one-electron oxidized mefdc, the lowest energy path is the rapid formation of c2 from c3 via f loss. this f loss is a barrierless reaction between the 2-f-atom and the proximate h3o which was formed via deprotonation of h3 in the cation radical. gemcitabine (scheme 1) and 2-fdc (scheme 2) were obtained from carbosynth ltd. mefdc (scheme 2) was prepared as described or purchased from adooq bioscience (irvine, ca). lithium chloride (licl) (ultra dry, 99.995% (metals basis)) was obtained from alfa aesar (ward hill, ma, usa). 2-deoxycytidine (2-dc) was obtained from sigma chemical company (st louis, mo, usa). deuterium oxide (d2o) (99.9 atom% d) was purchased from aldrich chemical co. inc. (paris, ky, usa). cytidine-5,6-d2 ([ 5,6-d, d]-cyd, 99 atom% d) was purchased from cdn isotopes (quebec, canada). homogeneous solutions of gemcitabine were prepared by dissolving 210 mg/ml either in 7.5 m licl in d2o or in h2o. solutions of other compounds (2-dc, 2-f-dc, mefdc, and [5,6-d, d]-cyd) were prepared by dissolving ca. k2s2o8 (616 mg/ml) was added as an electron scavenger so that only the formation of the one-electron oxidized species and its subsequent reactions can be followed by employing esr spectroscopy. the above-mentioned procedure for preparation of solutions is according to our ongoing studies on various model systems of dna and rna. the ph of gemcitabine in 7.5 m licl/d2o was adjusted to the range of ca. the ph of gemcitabine in 7.5 m licl/h2o and the ph of other compounds (2-dc, 2-f-dc, mefdc, and [5,6-d, d]-cyd) in 7.5 m licl/d2o was adjusted at ph ca. 10. these ph adjustments were performed by adding l amounts 1 m naoh as per our previous efforts. these solutions have high ionic strength (7.5 m licl); therefore, the ph meters would not provide accurate ph measurements of these solutions. instead, as per our previous works, ph values reported in this work were obtained using ph papers and are approximate measurements. as per our previous works, these ph-adjusted homogeneous solutions were thoroughly bubbled with nitrogen to remove the dissolved oxygen. immediately, these solutions were drawn into 4 mm suprasil quartz tubes (catalog no. buena, nj, usa) and were rapidly cooled in liquid nitrogen (77 k). the rapid cooling of these homogeneous liquid solutions at 77 k leads to the formation of transparent homogeneous glassy solutions. these glassy solutions were later used for the irradiation and subsequent progressive annealing experiments. all glassy samples were stored at 77 k in teflon containers in the dark. all samples were (co)-irradiated (absorbed dose=1.4 kgy) at 77 k and stored at 77 k in teflon containers in dark following our previous efforts. a variable-temperature assembly was employed which passed liquid nitrogen cooled nitrogen gas past a thermister and over the sample as described in our earlier studies. the glassy samples have been annealed anywhere from (140170) k for 15 min. annealing leads to one-electron oxidation of the solute by the matrix radical cl2 thus, forming only the cation radical of the solute, e.g., gemcitabine. following our earlier studies, immediately after -irradiation of the glassy sample at 77 k, the esr spectrum was recorded at 77 k. also, immediately after each annealing step, the sample was cooled to 77 k by immersing in liquid nitrogen (77 k), and the esr spectrum was recorded at 77 k which maximizes signal height and allows for comparison of signal intensities. a varian century series x-band (9.3 ghz) esr spectrometer with an e-4531 dual cavity, 9 in. magnet, and a 200 mw klystron was used, and fremy s salt (gcenter=2.0056, a(n)=13.09 g) was employed for the field calibration. all esr spectra have been recorded at 77 k and at 40 db (20 w). anisotropic simulations of esr spectra have been performed using the win-epr and simfonia programs of bruker as per our previous works. the simulated spectra thus obtained were compared to experimental spectra, and esr parameters were adjusted for the best fit (also supporting information figure s3). gaussview and jmol programs were used to plot the spin densities and molecular structures. the geometries of all the radicals considered in the present study were fully optimized using the b97x functional and 6-31g(d) basis set. we note here that b97x functional was developed by the group of head gordon and found to be very successful for the calculations of various properties of molecules in their different spin states. the hyperfine coupling constants (hfccs) of the radicals were calculated using the same method and basis set, i.e., b97x/6-31g(d) in the gas phase. in order to treat the effect of solvent on hf loss from the c3 in gemcitabine and in mefdc, we employ the integral equation formalism polarized continuum model (ief-pcm) as implemented in gaussian 09. in addition to pcm, for c3 in both systems a h3o is placed in the vicinity of the c3-oh bond for c3 in gemcitabine and for c3 in mefdc and have optimized the structures. the electronic energy profile of f dissociation from c2 site of c3 in mefdc as well as the electronic energy profile of f dissociation for each of the two f-atoms from c2 site of c3 in gemcitabine were obtained in the presence of a single water molecule at the same level of theory (supporting information figure s4c, d). furthermore, employing the wb97x/6-31++g(d, p) method along with the ief-pcm model for the solvent effect, the pka of the c3-oh group for the c3 of gemcitabine and also of the c3-oh group for the c3 of 2-dc was calculated. in figure 1a, we show the experimentally recorded (77 k) esr spectrum (green) of one-electron oxidized gemcitabine at ph (pd) ca. 7 in a homogeneous glassy 7.5 m licl/d2o solution. the one-electron oxidation of gemcitabine was induced by cl2 attack after annealing at 155 k in the dark. 912 showed identical spectra after one-electron oxidation of gemcitabine by cl2 on annealing at 150155 k. thus, only the spectrum obtained from the gemcitabine sample at pd ca. 10 is presented in figure 1b along with the simulated spectrum in blue. it is evident from figure 1a, b, the line shape, total hyperfine splitting, and the center of the simulated spectra match with those of the experimentally recorded spectra quite well. each of the spectra in figure 1a, b show two anisotropic -f-atom hyperfine couplings and a -h-atom hyperfine coupling. the -h-atom hyperfine coupling creates the doublet splitting in the line components in figure 1a, b. figure 1a is best matched with a simulation employing the two different anisotropic -f-atom (nuclear spin =1/2) hfcc values of (15.0, 15.0, 105) g and (15.0, 15.0, 69.0) g, one -h hfcc as (15.0, 15.0, 24.0) g, gxx, gyy, gzz (2.0080, 2.0050, 2.0020) along with a mixed (lorentzian/gaussian (1:1)) line-width of 14 g. the simulated spectrum in blue is superimposed on the experimentally recorded spectrum in figure 1a. on the other hand, the best fit for figure 1b is obtained employing the two identical anisotropic -f-atom (nuclear spin=1/2) hfcc as (17.0, 17.0, 86.0) g, one -h hfcc as (15.0, 15.0, 24.0) g, gxx, gyy, gzz (2.0060, 2.0050, 2.0020) along with a mixed (lorentzian/gaussian (1:1)) line-width of 10 g. following our work on the radicals produced in monomers of dna and rna, the a (i.e., the azz) component of each of the two anisotropic -f-atoms (see table 1) as well as the a of the -h are directly measured from the width of the experimentally recorded spectra with an uncertainty of 2 g (see supporting information figure s3). on the other hand, the theoretically obtained values of axx and ayy components of each of the two anisotropic -f-atoms and of the -h-atom in table 1 were adjusted to fit the experimentally recorded spectra with estimated uncertainty of 4 g (see supporting information figure s3). 7 show two nonequivalent anisotropic -f-atom hfccs, whereas, the one-electron oxidized gemcitabine spectrum at ph ca. the -h-atom hfcc does not show any observable change in the one-electron oxidized gemcitabine spectrum throughout the ph range ca. the coupling to two -f-atoms (c2) and one -h-atom (c4) is clear evidence for the generation of c3 after one electron oxidation of gemcitabine at 150155 k. the electron-withdrawing effect of the two electronegative f-atoms at c2 increases the acidity of h3, which leads to deprotonation (see supporting information table t2) and prevents observation of the initially formed cytosine base -cation radical (c) in gemcitabine as indicated in reaction 3. therefore, the mechanism of c3 formation due to one-electron oxidation of gemcitabine is proposed as follows: one-electron oxidation of gemcitabine results in the formation of metastable c, which is unstable even at ca. 155 k. the metastable c quickly deprotonates at c3 in the sugar moiety producing c3 (reaction 3) via a proton-coupled electron-transfer (pcet) mechanism.3 esr spectra obtained from matched gemcitabine samples [concentration of gemcitabine in each sample=2 mg/ml in 7.5 m licl/d2o] in the presence of the electron scavenger k2s2o8 (8 mg/ml in each sample). each sample has been -irradiated (absorbed dose=1.4 kgy at 77 k), subsequently annealed to 155 k for 15 min in the dark at various phs (a) ph ca. 7 (green) and (b) ph ranging ca. 912 (pink). here the blue spectra that are superimposed on the experimentally recorded spectra are the simulated spectra of c3. see text for the details of simulation. all esr spectra are recorded at 77 k. the three reference markers (open triangles) in this figure and in the subsequent figures show the position of fremy s salt resonance with the central marker at g=2.0056. the spacing separating the markers is 13.09 g. as is evident from the hfcc values of the spectra shown in figure 1 and also in table 1, the ph of the solution clearly affects the individual -f-atom anisotropic hfcc but not the sum of the two -f-atom anisotropic hfcc along with the c4 -proton hfcc (see section above). at ph ca. 912, the two -f-atom anisotropic hfccs are equivalent; whereas, at ph ca. 7, the sum of the two -f-atom anisotropic hfccs remain the same, but they individually differ. the presence of two 2-f-atoms in gemcitabine will lower the pka value of both h3 and c3-oh hydrogens. for example, the oh in 2,2-difluoroethanol has its pka lowered by 3.5 units in comparison with ethanol. further, radical formation has also been shown to lower the pka of the alcoholic oh group (e.g., pka (ch3)2choh=17.1, pka (ch3)2coh=12.03). based on these factors, the pka value of the c3-oh group for c3 in gemcitabine is estimated to be in the range of 79. employing dft/b97x/6-31++g(d, p) method along with the ief-pcm model for the solvent effect, the pka value of the c3-oh group for c3 in 2-dc has been calculated as 14.2. the same level of calculation for the c3-oh group of c3 in gemcitabine which replaces each of the two hydrogens at c2 with fluorine predicts a pka of 6.8 (see supporting information pages s8, s9). therefore, the two 2-f-atoms are predicted to lower the pka of the c3-oh group in c3 by 7 full units. considering the sensitivity of the calculations for predicting pka to the small changes in free energy, these results are very reasonable. furthermore, the theoretically calculated pka value 6.8 of the c3-oh group for c3 in gemcitabine is in good agreement with its experimentally estimated value (79). the spectrum in figure 1a (ph ca. 7) should therefore be for c3 in gemcitabine with a c3-oh group and the spectrum in figure 1b (ph ca. 912) should be for c3 with the deprotonated group, i.e., c3-o (reaction 4). thus, we attribute the variation of the two -f-atom anisotropic hfcc to the deprotonation of the c3-oh group at higher phs.4 esr spectral studies of one-electron oxidation of gemcitabine in h2o glasses (7.5 m licl/h2o) were performed and compared with the results found in d2o glasses (7.5 m licl/d2o). no observable difference in spectra other than a small line broadening was observed on formation of c3 in h2o glasses versus in d2o glasses. since c3 only has the c3-oh as an exchangeable proton at ph 7 and this does not contribute to a significant hyperfine coupling, the esr spectrum found on formation of c3 is not altered by a change of the solvent from d2o to h2o. similar experiments to those performed for gemcitabine were carried out for the methyl/fluoro analog mefdc (scheme 2). using mefdc, we investigated whether the formation of c3 observed in gemcitabine bearing geminal difluoro unit at c2 (figure 1) is affected by the substitution of one of the f-atoms (i) with a methyl (me) group (+ i). (a) esr spectrum (black) obtained from mefdc [concentration =2 mg/ml in 7.5 m licl/d2o] in the presence of the electron scavenger k2s2o8 (8 mg/ml), ph ca. 10, -irradiated to a dose of 1.4 kgy at 77 k and subsequently annealed to 155 k for 15 min. (c) spectrum (black) obtained after subtraction of 60% of spectrum (b) from spectrum (a). for comparison, the c spectrum (blue) in 2-dc (supporting information figure s2 and pp s3s5) is superimposed. (d) spectrum (black) assigned to c2 is obtained after subtraction of 50% of spectrum (c) from spectrum (a). the simulated c2 spectrum (for simulation parameters see figure 2 and text) is superimposed on the experimentally isolated spectrum for comparison. all the spectra are recorded at 77 k. shown in figure 2a is the esr spectrum (black) of a matched sample of mefdc that has been -irradiated (absorbed dose=1.4 kgy), subsequently annealed to 155 k for 15 min in the dark, and recorded at 77 k. figure 2b was obtained by annealing this sample for 15 min to 170 k. comparison of spectrum 2a with spectrum 2b shows clearly that a central doublet decreases along with an increase of the other line components upon annealing. therefore, the central doublet (black) shown in figure 2c is isolated by subtraction of 60% of the spectrum 2b from spectrum 2a. the doublet due to c spectrum (blue) in 2-dc (see supporting information figure s2 and its discussion (pp s3s5)) is superimposed on it for comparison. from the spectral similarities of both doublets, the doublet in black shown in figure 2c subtraction of 50% c spectrum 2c (black) from spectrum 2a results in the black spectrum shown in figure 2d. this overall quintet spectrum arises from 4 isotropic -proton couplings: three methyl -protons (ca. 25.5 g due to a -proton assigned to the c1-h (vide infra). the experimental (black) spectrum is simulated using the above-mentioned hfcc values along with a 10 g line-width and g-value=2.0033 (this g-value is typical for c-centered sugar radicals). the simulated spectrum (red) in figure 2d matches the overall line components of the experimental spectrum well. since the c2 (reaction 5) is the only likely radical structure that would explain the large hyperfine coupling to a methyl group and the additional -proton hyperfine coupling (assigned to c1), the experimental spectrum in figure 2d has been assigned to c2 (reaction 5). the spectra 2a and 2b are a composite of c (black, figure 2c) and c2 (black, figure 2d) in different amounts. under the same constant gain and constant microwave power and upon gradual and stepwise annealing of the sample from 155 k (spectrum 2a) to 170 k (spectrum 2b), no loss of spectral intensity was observed, and our analyses show an additional (ca. 20%) conversion of the c to c2. consideration of the results presented in figures 1 and 2 suggest that for mefdc, c is produced first and on annealing converts to a transient c3, which is not observed. in contrast, the line shape, line width, and the overall hyperfine splitting of the c3 spectrum in gemcitabine do not change upon annealing to ca. thus, unlike the rapid conversion of c3 to c2 found in one-electron oxidized mefdc, a similar conversion of c3 to c2 is not observed for one-electron oxidized gemcitabine at these low temperatures. the lack of observation of the transient c3 in one-electron oxidized mefdc and the low temperatures employed in these experiments implies a very low activation barrier for the conversion of c3 to c2; whereas, the activation barrier for the conversion of c3 to c2 for one-electron oxidized gemcitabine should be 4 kcal/mol. calculations suggest that the proximity of the lost h3 proton as h3o to the 2-f-atom quite likely provides the driving force for this rapid unimolecular reaction (see figure 3). therefore, we propose that c3 in one-electron oxidized mefdc readily converts to c2 via a barrierless f loss (see reaction 5, figure 3, and supporting information s5). the b97x/6-31g(d) calculated hfccs of c3 and c2 found in gemcitabine and in mefdc along with experimental hfccs (in gauss) are presented in table 1. it is evident from table 1 that experimental and theoretically calculated hfccs are in reasonably good agreement. estimated errors are of 2 g for azz and 4 g for axx and also for ayy. calculated in the presence of one water molecule only isotropic hfcc values have been considered. to explore the reaction mechanism of c2 formation from c3 in one-electron oxidized mefdc and gemcitabine, using the dft b97x/6-31g(d) method, we considered three possible reaction paths: (i) hf loss due to deprotonation of 3-hydroxyl group, (ii) hf loss due to fluorine dissociation, and additionally, (iii) hf loss in the presence of a hydronium ion (h3o). the electronic energy profile of hf loss from c3 in mefdc and also from c3 in gemcitabine in the presence of a water molecule is shown in figure s4 in the supporting information. from supporting information figure s4a, it is evident that for c3 of mefdc, the formation of c2 via hf loss with deprotonation of 3-oh has a significant barrier of ca. 18 kcal/mol. for c3 in gemcitabine, the hf loss associated with deprotonation of 3-hydroxyl group was calculated to be ca. we have also considered the dissociation of fluorine in c3 of mefdc and in c3 of gemcitabine and found that stretching the c2-f bond up to 1.8 needs ca. this shows that dissociation of fluorine for c3 in mefdc occurs at lower energy than dissociation of fluorine for c3 in gemcitabine (supporting information figure s4). alternatively, we consider the fact that deprotonation of h3 will form h3o initially in close proximity of the c2-c3 bond which may then induce hf loss (reaction 5). employing the b97x/6-31g(d) method and considering the full solvent effect through the polarized continuum model (pcm), this mechanism have been modeled by placing a h3o in the vicinity of the c3-oh bond for c3 in gemcitabine and for c3 in mefdc and have optimized the structures. from our calculations, we have observed that for c3 in gemcitabine, a minimum structure exists in the electronic energy profile in which the h3o stabilizes the f-atom through forming a hydrogen bond (1.57) (see figure 3a and supporting information figure s4c). a second minimum structure was also found in the electronic energy profile in which the h3o stabilizes the f-atom through forming a hydrogen bond of identical length, 1.57 (see supporting information figure s4d). a barrier of 5 kcal/mol and the overall reaction energy of 7 to 8 kcal/mol were found for hf formation in both cases (see figure 3a and supporting information figures s4c, d). however, for c3 in mefdc, the h3o reacts with the 2-f-atom without a barrier and forms hf and c2 (see figure 3b). the bond distances of c3-o3 and o3-h bonds for c3 in gemcitabine are calculated as 1.34 (primarily c o single bond character) and 0.97, respectively. the values of the corresponding bond distances of c3-o3 and o3-h bonds for c3 in mefdc are obtained as 1.28 (mainly double bond character and 1.0 respectively). thus, these calculations show that the hf loss from c3 in gemcitabine has a ca. 5 kcal/mol barrier (supporting information figure s4c, d) while for c3 in mefdc, the loss of hf is barrierless, and the c2 production is exothermic in nature as shown in figure 3. these findings support our experimental observations that in mefdc, c3 is too unstable to be observed, and only c2 is found. in contrast, in gemcitabine only c3 formation is observed without any conversion to c2 in the same temperature range. pcm-b97x/6-31g(d) calculated structures of c3 in (a) gemcitabine and in (b) mefdc. as indicated in (a) the c3 in gemcitabine involves a barrier of 5 kcal/mol (detailed electronic energy profiles are provided in supporting information figure s4c, d) to hf loss in the presence of h3o. in (b), the c3 in mefdc is unstable in the presence of h3o and reacts without a barrier to form c2 via hf loss. the animations (movies) of the optimization steps for reaction involving h3o for c3 in both gemcitabine (a) and mefdc (b) are provided in the supporting information (s5). our work has the following two salient findings: (i) one electron oxidation leads to cytosine base -cation radical (c) in 2-dc and 2-f-dc but to c3 in gemcitabine. as expected from the one-electron redox potentials of the bases and the backbone, one-electron oxidation of 2-dc and 2-f-dc leads to c formation as evidenced by the ca. 16 g doublet that is characteristic of c. however, gemcitabine (scheme 1) leads to the formation of c3 on one-electron oxidation. the two highly electronegative f-atoms at 2-position, through their negative inductive effect, lead to a substantial increase in the acidity of h3. therefore, c in gemcitabine is highly unstable toward the loss of h3 as deprotonation at 150155 k. this is evidenced by the free energy changes of the cation radical for the loss of h3 as deprotonation to the surrounding solvent (see supporting information table t2); this deprotonation shifts the unpaired spin from the cytosine base of metastable c in gemcitabine to sugar at c3 via a pcet process. (ii) c2 formation does not occur in gemcitabine but does in its analog mefdc. it has been proposed in the literature that in gemcitabine both c3 and c2 (reactions 1 and 2) play an important role in the rnr inactivation. conversion of c3 to c2 takes place via an irreversible f loss from c2 during rnr inactivation by gemcitabine. however, experimental and theoretical results shown in this work have clearly demonstrated that in our system (supercooled homogeneous glassy solutions), c3 in gemcitabine does not convert to c2 on annealing up to 170 k owing to theoretically predicted barrier of greater than 5 kcal/mol. theoretically, dft calculations support the mechanism involving a h3o induced barrierless conversion of c3 to c2 in one-electron oxidized mefdc. experimentally, c2 is observed in one-electron oxidized mefdc upon annealing to ca. 160170 k. thus, our study in one-electron oxidized mefdc provides the first evidence of formation of c2 (via the unstable intermediate c3 (reaction 5)) in a nonenzymatic system even at low temperature.5

gemcitabine is a modified cytidine analog having two fluorine atoms at the 2-position of the ribose ring. it has been proposed that gemcitabine inhibits rnr activity by producing a c3 intermediate via direct h3-atom abstraction followed by loss of hf to yield a c2 with 3-keto moiety. direct detection of c3 and c2 during rnr inactivation by gemcitabine still remains elusive. to test the influence of 2- substitution on radical site formation, electron spin resonance (esr) studies are carried out on one-electron oxidized gemcitabine and other 2-modified analogs, i.e., 2-deoxy-2-fluoro-2-c-methylcytidine (mefdc) and 2-fluoro-2-deoxycytidine (2-fdc). esr line components from two anisotropic -2-f-atom hyperfine couplings identify the c3 formation in one-electron oxidized gemcitabine, but no further reaction to c2 is found. one-electron oxidized 2-fdc is unreactive toward c3 or c2 formation. in one-electron oxidized mefdc, esr studies show c2 production presumably from a very unstable c3 precursor. the experimentally observed hyperfine couplings for c2 and c3 match well with the theoretically predicted ones. c3 to c2 conversion in one-electron oxidized gemcitabine and mefdc has theoretically been modeled by first considering the c3 and h3o+ formation via h3-proton deprotonation and the subsequent c2 formation via hf loss induced by this proximate h3o+. theoretical calculations show that in gemcitabine, c3 to c2 conversion in the presence of a proximate h3o+ has a barrier in agreement with the experimentally observed lack of c3 to c2 conversion. in contrast, in mefdc, the loss of hf from c3 in the presence of a proximate h3o+ is barrierless resulting in c2 formation which agrees with the experimentally observed rapid c2 formation.

PMC4227712

pubmed-139

fibromyalgia syndrome (fms) is a prevalent chronic pain condition among middle-aged females and is characterized by chronic widespread pain. various comorbid symptoms of fms include fatigue, cognitive disturbances, depression, sleep impairments, and weight gain, to name but a few. it is a challenging disorder, and thus assessment and diagnosis might pose some difficulties in various health care settings. patients may visit their general practitioners repeatedly with numerous symptoms before a diagnosis of fms is made1, 2. patients are encountered at not only primary but also secondary health care settings and by various subspecialities including rheumatologists, pain specialists, physiatrists, and psychologists. this has led to debate about whether fms is a clinical or epidemiological disease3. the 1990 american college of rheumatology (acr) criteria included 2 major sections: history of widespread pain and pain in 11 of 18 tender points on digital palpation. debates over reliability, validity, and number of tender points required to make a diagnosis were settled. many controversies arose over tender points4, and some authors argued against tender points, claiming that they are a measure of general stress3, 5, 6. it was then suggested that dealing with the symptoms rather than tender points would be more realistic and that use of 1990 criteria should be stopped7. the acr 2010 criteria eliminated the controversial tender point examination and included the following headings: widespread pain index, including 19 pain locations, and symptom severity score for 3 symptoms plus the extent of 41 somatic symptoms in general. 2010 criteria further modified to the 2011 modified criteria (2011modcr) with 6 self-reported symptoms instead of 41 somatic symptoms. the most recently developed criteria are the alternative diagnostic criteria (acr 2013altcr), which include more pain locations than the 2011modcr (28 instead of 19) and 10 symptoms instead of 6. compared to the 2011modcr, the acr 2013altcr have comparable diagnostic sensitivity, better specificity, and a smaller number needed to diagnose8. in addition to the search for best criteria, some other tools were developed for epidemiological studies such as the london fibromyalgia study screening questionnaire or survey criteria. however, they included only items related to pain and fatigue, neglecting other aspects of the condition9. to address these problems, some screening procedures have been suggested; however, they have been argued against due to psychometric validation problems and sensitivity and specificity issues10. thus, a need for a short, easy-to-use, psychometrically validated screening tool has arisen in both clinical and research settings. the french rheumatic pain study group decided to develop a short, psychometrically sound, self-reported screening tool considering the major symptoms and aspects of fms9. the original version of the fibromyalgia rapid screening tool (first) was demonstrated to have excellent discriminative properties, especially divergent validity in terms of psychological aspect, which is an important property for an fms screening tool9. the spanish version of the first was also demonstrated to have acceptable internal consistency, reliability, and criterion validity10. we aimed to study the reliability and validity of the turkish version of the first by correlating this tool with the acr 2013altcr and the hospital anxiety and depression scale (hads). two hundred and sixty-nine patients (257 females and 12 males) with an average age (years) of 48.29 12.78 (range 2279) were included in the study. the principles of the declaration of helsinki were followed and the study protocol was approved by the uludag university ethical committee (no: fr-hyh-19). subjects were recruited from outpatient physical medicine and rehabilitation clinics from 9 medical faculty hospitals and ministry of health research and training hospitals. a convenience sample of patients with chronic diffuse pain was included in the study. literate patients who could read and understand turkish and who were able to complete the questionnaire were invited to participate in the study. patients with psychiatric disorders (severe depression, schizophrenia) or systemic or neurological disorders that could adversely affect quality of life or social functioning (such as end-stage heart failure, hemiplegia, spinal cord injury, etc.) were excluded from the study. we obtained permission from mapi research trust (contact information and permission to use: mapi research trust, lyon, france. e-mail: proinformation@mapi-trust.org-internet: www.proqolid.org.) cross-cultural adaptation was accomplished according to the suggestions of the mapi research institute in 3 steps: forward translation, backward translation, and patient testing. the first was translated into turkish by 2 professional native turkish speakers bilingual in turkish and english. they discussed on the translated forms with the local project manager (r.c.) to resolve discrepancies and produced a pooled version, which is the first version of the translation (step 1). then, english back-translation was done by the professional native english-speaking translator bilingual in english and turkish. he translated the first version of the questionnaire back to english without access to the original questionnaire. the local project manager compared the backward version with the original during a meeting with the backward translator and prepared the second version (step 2). the second version was tested on 5 patients, all of whom were native turkish speakers, and comprehension was determined through face-to-face interviews. after this final step, a third version of the questionnaire patients were asked to complete the questionnaire including the first, 2013altcr, and hads. they completed the first twice; the time interval for the 2 first scales was 6 hours. the first includes 6 items, and a score of 1 is given for the response of yes and 0 if the response is no for each item. the total score is calculated as the sum of scores; the cut-off value is designated as 5/69. the examiners were physiatrists and they were blinded to the results of first and hads. we used the acr 2013altcr8, which includes the pain location inventory (pli) including 28 sites and the symptom impact questionnaire (siqr) consisting of 10 symptom items (pain; energy; stiffness; sleep; depression; memory problems; anxiety; tenderness to touch; balance problems; and sensitivity to loud noises, bright colors, odors, and cold). pli score is between 0 and 28, and the siqr range is 0100 divided by 2. for a patient to fulfill the acr 2013altcr criteria, the symptoms and pain locations should have been persistent for at least 3 months, pli17 and siqr21. one for anxiety and the other for depression and is a questionnaire completed by the patient. each item has 4 possible answers (range 03), and the maximum possible score is 21. the validity and reliability of the turkish version of the hads was demonstrated previously11. concurrent validity of anxiety subscale with spielberger s trait anxiety inventory, correlation coefficient was 0.7544 and of depression subscale with beck depression inventory it was 0.7237. testing the reliability of had scale, cronbach alfa coefficient for anxiety subscale was 0.8525 and for depression subscale it was 0.778411. we analyzed the data using the statistical package for the social sciences (spss) version 16 (chicago, il, usa). the reliability of the hads was tested using cronbach s alpha coefficient. for criterion validity of the first, we used the acr 2013altcr for comparison. the concordance between the acr 2013altcr and the first was evaluated using a mcnemar test. the sensitivity, specificity, and positive and negative likelihood ratios of the first were calculated according to acr 2013altcr criteria. we compared the 2 first measurements using wilcoxon signed rank test, and the 2 measurements were statistically similar (p=0.169). one hundred fifty-six (58%) patients had score of 5, which is the cut-off score for the first; 116 of these patients (74.4%) were diagnosed as having fms according to acr 2013altcr criteria. one hundred thirteen patients (42%) had first scores lower than 5, and 93 of these patients (82.3%) did not meet the 2013altcr criteria. the first was not statistically different from the acr 2013 altcr in defining patients with fms (table 1table 1.sensitivity, specificity, and positive and negative likelihood ratios of the first to discriminate patients with and without fms according to the 2013 altcrvalueconfidence intervalsensitivity83.8276.589.6specificity68.4259.876.2+lr2.652.33.0lr0.240.10.4lr: likelihood ratio). first total score was correlated with subscores of the acr 2013altcr, namely pli (r=0.619, p<0.001) and siqr scores (r=0.408, p<0.001). similarly, the first and hads were significantly correlated (r=0.424, p<0.001) (table 2table 2.the coefficient of determinations between first total score and acr 2013 subscores (pli and siqr score) and hads scores.plisiqrhadsfirst total score0.383*0.166*0.18*pli0.196*0.131*siqr0.194*data expressed as squared spearman s rho correlation coefficients. first: fibromyalgia rapid screening tool; hads: hospital anxiety and depression scale; pli: pain location inventory; siqr: symptom impact questionnaire,*p<0.001 statistically significant). first: fibromyalgia rapid screening tool; hads: hospital anxiety and depression scale; pli: pain location inventory; siqr: symptom impact questionnaire,*p<0.001 statistically significant logistic regression analysis was carried out to find the confounding effect of the hads on the first to discriminate the patients with fms. the model was able to discriminate patients with fibromyalgia and without fibromyalgia (2 log likelihood=274.82; =95.29, d.f=2; p<0.001; nagelkerke r= 0.4). the first global score explained 30% of the proportion of uncertainty; each point increase in first global score meant 10 times greater odds of experiencing fms. in this study, we showed that the turkish version of the first is a reliable patient-completed instrument for identifying patients with fms. the acr 2013altcr was used for comparison, and the first was similar to the acr criteria in terms of defining patients with fms. the first demonstrated high correlation with acr 2013altcr subscores and hads scores. in our study, we examined the consistency of the first over time. we used the acr 2013altcr because these criteria were equally efficient with somewhat better specificity, and a smaller number was needed to diagnose than in the 2011modcr8. the acr 2013altcr were also marginally more efficient in differentiating common chronic pain disorders from fms8. torres et al.10 used acr 1990 criteria, and perrot et al.9 stated that they diagnosed patients on the basis of acr criteria, referring to the article by wolfe et al., who used the symptom intensity scale, which is a combination of pain counts in 19 nonarticular regions with a visual analogue scale for fatigue12. torres et al. reported the sensitivity of the first as 90.5% and its specificity as 85.7%. the turkish version demonstrated similar sensitivity and specificity. in this study by torres et al. positive likelihood ratio was calculated as 1.99 and negative likelihood ratio as 0.2 for cut-off point of 5 which is the established score for the original version of first. in our study positive and negative likelihood ratio values were 2.65 and 0.24 respectively, with fairly narrow confidence intervals. our study group was similar to torres et al.10; the majority of the patients in the study by torres were female, as in our study group. in the original study of the first by perrot et al.9, first total score was not significantly correlated with the beck depression inventory, hads-depression, and hads-anxiety scores. in our study, we were able to demonstrate that first scores are correlated with hads scores; however, despite the correlation of first with hads scores, the first was still able to discriminate between patients with and without fms. different from previous studies, we included patients with various chronic pain problems at a tertiary care level. fitzcharles et al. argued that, if patients in a study have an established diagnosis of fms, they may express symptom severity at the extreme end of the spectrum, thus increasing construct validity13. similar to our study, bennett et al.8 included a wide range of common pain disorders as the dominating principle of their study and claimed to simulate everyday clinical practice. both rehabilitation specialists and physical therapists are dealing with various pain conditions. among these disorders fms is a prevalent condition and can be encountered secondarily as in case of rheumatologic disorders. first includes 6 items with either yes or no answer, thus enables easy and quick scoring. it can be used as an adjunct to physical examination or evaluation of patients undergoing physical therapy.. patients were recruited from tertiary care hospitals however study population is not limited to patients referred from primary care clinics. an important consideration for the first is ease of use and scoring in the settings involved with chronic pain patients. it can be completed in less than 3 minutes and seems to be acceptable and relevant for the patients10. since it is a single page and evaluation requires simple addition, use of the first may be advantageous in a busy clinical setting such as surgical units. it was demonstrated that patients with fms were more likely to have surgical interventions including back or neck surgery14. surgeons and interventionalists may also benefit from using an easy-to-administer patient-completed screening tool to avoid unnecessary procedures.

[ purpose] an easy-to-use, psychometrically validated screening tool for fibromyalgia is needed. this study aims to evaluate the reliability and validity of the turkish version of the fibromyalgia rapid screening tool by correlating it with 2013 american college of rheumatology alternative diagnostic criteria and the hospital anxiety and depression scale. [subjects and methods] subjects were 269 physical medicine and rehabilitation clinic outpatients. patients completed a questionnaire including the fibromyalgia rapid screening tool (twice), 2013 american college of rheumatology alternative diagnostic criteria, and the hospital anxiety and depression scale. scale reliability was examined by test-retest. the 2013 american college of rheumatology alternative diagnostic criteria was used for comparison to determine criterion validity. the sensitivity, specificity, and positive and negative likelihood ratios were calculated according to 2013 american college of rheumatology alternative diagnostic criteria. logistic regression analysis was conducted to find the confounding effect of the hospital anxiety and depression scale on fibromyalgia rapid screening tool to distinguish patients with fibromyalgia syndrome. [results] the fibromyalgia rapid screening tool was similar to the 2013 american college of rheumatology alternative diagnostic criteria in defining patients with fibromyalgia syndrome. fibromyalgia rapid screening tool score was correlated with 2013 american college of rheumatology alternative diagnostic criteria subscores. each point increase in fibromyalgia rapid screening tool global score meant 10 times greater odds of experiencing fibromyalgia syndrome. [conclusion] the turkish version of the fibromyalgia rapid screening tool is reliable for identifying patients with fibromyalgia.

PMC5333001

pubmed-140

vascular diseases are among the most common causes of morbidity and mortality, and both number and severity of morbid vascular conditions increase with age. regulations of angiogenesis, coagulation, and inflammation are very important issues in vascular biology, both in normal physiology and pathology. it is now well established that disruption of endothelial integrity represents a crucial event in the initiation and development of cardiovascular (cv) diseases. numerous studies have reported that microparticles (mps) play an important role in endothelial dysfunction. endothelial dysfunction occurs when a perturbed homeostatic endothelium disrupts vascular competency resulting in reduced vasodilatation and increased proinflammatory and prothrombotic properties of the vascular network. recently, mps originating from various cells have been found to be associated with several vascular related diseases. moreover, exposed procoagulant phospholipids and specific receptors at the surface of mps act as biomessengers linking inflammation, coagulation, and angiogenesis [35]. although mps were first described as cellular debris that are believed to have no biological significance, recent studies documented that mps of endothelial and other origins are biological effectors in inflammation, vascular injury, angiogenesis, and thrombosis [68]. mps isolated from granulation tissue are derived from endothelial cells, monocytes, platelets, erythrocytes [913], and myofibroblasts. they exchange biological signals and information intercellularly and each kind of mp carries the antigens and receptors of the cells they originated. mps may transfer part of their components and content to the selected target cells, thus mediating cell activation, phenotypic modification, and reprogramming of cell function. although 70% to 90% of all circulating mps in the peripheral blood of healthy individuals are derived from platelets, marked elevations of all kinds of mps have been observed in many vascular diseases. specifically, endothelium-derived microparticles (emps) represent a relatively small (515%) but very important subset of all circulating microparticles [1618]. this number may vary in different cardiovascular and inflammatory diseases [18, 19]. new insights into endothelial dysfunction and alterations in angiogenesis are emerging from studies of vascular microparticles, particularly endothelial microparticles in elderly populations. vascular aging with impairment of endothelial cell function leads to altered angiogenesis, a key factor in the etiology of various cardiovascular disorders. 73% of individuals aged 6079 have a cv disease, including stroke, hypertension, or heart failure, and at>79 years of age prevalence of these diseases increased to 86% in females and 82% in males (2012 nhlbi fact book). recently published data have shown that these diseases are the leading cause of death for individuals aged>65 and morbidity increased from 32% for individuals aged 66 to 48% for individuals aged 85. an important factor which significantly decreases the incidence of coronary heart diseases in postmenopausal women is estrogen [2224]. in women already having coronary artery disease or ischemic stroke, the therapeutic benefit of estrogen is not clear [25, 26] although it has been reported that estrogen induces rapid vasodilation, exerts anti-inflammatory activity, and regulates vascular cell growth, migration, and protection of cardiomyocytes from injury, all of which prevent atherosclerotic deterioration in vessels. this review focuses on the role of emps in angiogenesis, coagulation, and inflammation during age-related vascular diseases and the contribution of estrogen to these diseases. emps are small vesicles that are released from endothelial cells and can be found circulating in the blood. defined by their small size (0.1 to 1.0 m), they are a heterogeneous population of vesicles which are shed from plasma membranes in response to cell activation, injury, angiogenesis/neovascularization, and/or apoptosis. emps consist of a small amount of cytosol surrounded by a plasma membrane and display negatively charged phospholipids on their surface that can initiate and accelerate coagulation. circulating emps have been demonstrated as a marker of preeclampsia [29, 30], acute coronary syndromes, and severe hypertension [30, 32, 33] suggesting their association with pathological processes within the endothelium. furthermore, circulating emp levels are also implicated in the progression of atherosclerotic lesions, heart failure, arrhythmias, inflammatory vascular disease, sickle anemia, and endotoxemia. jimenez et al. demonstrated that the surface antigens of emps are distinctive depending on the type of endothelial cell injury, as in apoptosis versus activation. high levels of the surface antigens e-selectin, intracellular adhesion molecule-1 (icam-1), and vascular cell adhesion molecule-1 (vcam-1) are on emps derived from activated endothelial cells. in contrast, the low levels of these antigens are on emps derived from apoptotic endothelial cells. platelet cell adhesion molecule (pecam-1), endoglin, and vascular endothelial-cadherin (ve-cadherin) are at low levels on emps derived from activated ecs [3740] (figure 1). additionally, emps generated from apoptotic endothelial cells have higher levels of phosphatidylserine on their surface and different phospholipid composition and oxidation status compared with emps generated from activated endothelial cells [41, 42]. these data suggest that there are distinct mechanisms for the formation of emps in apoptotic and activated cells and several studies suggest that these types of emps have different functions in vascular diseases [40, 44]. both inflammatory cytokines and coagulation factors participate in the generation of emps (figure 2). recently, it has been shown that p38 mitogen-activated protein kinase (mapk) is a critical molecule in the production of proinflammatory emps and increased icam-1 production by endothelial cells, providing a paracrine loop to enhance the endothelial response to inflammation. in vitro studies have shown that the proinflammatory agent, tnf, activates endothelial cells and induces release of emps (figure 2). another potent stimulus for emp formation both in vivo and in vitro is angiotensin ii (ang ii). this effect is mediated by ang ii receptor type i that signals through nadph oxidase and rho kinase. furthermore, in ang ii-infused apoliprotein e (apoe /) hyperlipidemic mice, a model of significant endothelial dysfunction, ang ii has been shown to increase emp formation by a redox-sensitive and blood-pressure-independent process. another important factor pai-1 (plasminogen activator inhibitor type 1) plays an important role in the formation of emps. it has been shown by brodsky et al. that pai-1 promotes formation of emps with reduced transmembrane asymmetry of phospholipids in a dose dependent manner. these findings could possibly link elevated levels of pai-1 with endothelial dysfunction and tendency toward thrombosis [4850]. increased levels of pai-1 might serve as an initiator of emp formation followed by increased procoagulant activity and thrombin generation. in addition, it is also known that thrombin stimulates pai-1 synthesis suggesting constant production of these two factors. all these data indicate that formation of emps links together inflammation, coagulation, and angiogenesis and causes the impairment of the last two phenomena (figure 3). among many signaling molecules, t-cadherin (t-cad) on the surface of ecs might be upregulated and may serve as a characteristic marker of ec activation and stress. recently, philippova et al. have demonstrated a mechanism of t-cad-dependent signaling in the vascular endothelium. the authors identified that t-cadherin levels in plasma are increased in early atherosclerosis and correlate with endothelial dysfunction, which may lead to increased release of emps from ecs. increasing evidence has also accumulated to implicate an impaired coagulation system in many vascular diseases. this coagulation imbalance is the net result of activation of coagulation, impaired activity of natural coagulation inhibitors, and suppressed fibrinolysis. activation of coagulation proteases, for example, thrombin, is one of the earliest events following tissue injury. thrombin modulates tissue repair responses by altering vascular permeability, stimulating endothelial cell, fibroblast, and neutrophil migration, and promoting their spreading and adhesion. it activates various cell types and induces secretion of several proimmune, profibrotic, and proinflammatory factors [45, 56, 57]. recent studies by sapet et al. have shown that release of emps by endothelial cells in response to thrombin involves a group of genes that regulate angiogenesis and are linked to the cytoskeleton reorganization family. among these genes, rho-kinase rock-ii was transcribed at a high rate and was identified as a target of thrombin in emp generation. the involvement of caspase-2 in rock-ii activation, independent of cell death, points out a novel signaling pathway that emphasizes the proteolytic activity of caspase in emp generation in response to cell activation (figure 1). however, further studies are needed to determine the molecular mechanisms involved in emp release. emp release is initiated when thrombin binds to its receptor, proteolytically activated receptor-1 (par-1), which induces gene transcription that is mediated by thrombin via trail/apo2l, a cytokine belonging to the tumor necrosis factor alpha (tnf) superfamily. this mechanism of emp generation depends on the nuclear factor (nf) b activation and involves the soluble form of trail, which is secreted by the endothelial cells under thrombin or inflammatory stimulation [4, 59] (figure 2). phospholipids expressed on emps bind coagulation factors leading to a prothrombotic state and an increase in procoagulant activity of tissue factor (tf). these phospholipids are exposed on the outer membrane of mp and are considered to be the main initiators of the coagulation cascade. additionally, it has been demonstrated that sphingosine 1-phosphate (s1p) strongly potentiates thrombin-induced tf expression in ecs suggesting its role in blood coagulation. s1p has also been shown to be involved in the process of angiogenesis and inflammation [6264]. another important role of mps is their contribution to the development of platelet- and fibrin-rich thrombi at sites of vascular injury via the recruitment of cells and the accumulation of tf. data suggest that emp-mediated coagulation has clinical significance; for example, an association between the number of circulating mps and the risk of thrombolytic complication has been reported. because emps interact with coagulation proteins and with inflammatory or vascular cells, their role in cardiovascular diseases has been intensively studied. it has also been observed by jy et al. that emps carry von willebrand factor (vwf) and factor viii that promote platelet aggregates and increase their stability (figure 1). moreover, the authors postulated that emps released during vascular injury may arrest bleeding by rapid interaction with platelets via membrane-associated vwf multimers and adhesions to stabilized platelet aggregates in the microenvironment. sabatier demonstrated that emps also carry tf and bind to monocytes causing further tf expression and resulting in enhanced transmigration of monocytes through endothelial junction [66, 67]. one of the important key genes for aging-associated cardiovascular disorders is plasminogen activator inhibitor-1 (pai-1), a main inhibitor of fibrinolysis. the expression of pai-1 is not only elevated in the elderly but also significantly induced in a variety of pathologies associated with the process of aging. increased levels of pai-1 and its procoagulant activity have been recognized as hallmarks of endothelial dysfunction in vascular aging (figure 4). furthermore, elevated levels of pai-1 were found in werner syndrome, a disease characterized by premature aging [68, 69] and atherosclerosis, which in advanced stages may lead to myocardial infarction and death. recently, it has been shown that emps expressing both activators and inhibitors of coagulation have fibrinolytic properties that counteract their procoagulant activities, which may enable them to contribute to haemostatic balance. it has been observed that endothelial and leukocyte microparticles generate fibrinolytic activity, whereas erythrocyte and platelet microparticles do not have this property. additionally, different plasminogen activators were identified on leukocyte microparticles, urokinase-type plasminogen activator (upa), and emps where tissue plasminogen activator (tpa) has been found. the authors provide evidence that microparticles with plasminogen activators are rare in healthy populations but are observed more frequently in pathological conditions suggesting that plasmin generation on microparticles may be important in the modulation of hemostatic balance. therefore, complex functions of emps have an ambivalent role both in physiological and pathological conditions, either promoting or inhibiting coagulation, inflammation, or angiogenesis. inflammatory mediators increase several procoagulant factors, inhibit endogenous anticoagulants, and attenuate the fibrinolytic response. however, the interaction between these two systems is bidirectional, as coagulation is also capable of modulating inflammatory activity. thrombin mediated inflammatory molecules such as il-8 and il-1ra and il-1 participate in emp release [4, 59] (figure 2) and are key factors involved in coagulation, inflammation, and angiogenesis. inflammation and coagulation are linked processes in many diseases and emps may amplify the responses by activating the endothelium. it has been reported that in addition to activation of d-dimers and c-reactive proteins in coagulation, the inflammatory cytokine il-6 is associated with mortality, declines in all measures of function, and leads to the frailty phenotype in the elderly. recently, it has been shown that increased levels of il-6 are present in aged aortas and that aging induces a proinflammatory phenotype in vascular smooth muscle cells (vsmc) due in part to increased signaling of toll-like receptor 4 (tlr4) and its signaling adaptor myd 88. these observations support the notion of a high prevalence of proinflammatory conditions in advanced age. all of these factors lead to increased generation of emps and impaired coagulation, inflammation, and angiogenesis in cv diseases (figures 3 and 4). the process of angiogenesis is complex and requires endothelial cells (ecs) to detach from pericytes and the extracellular matrix (ecm), proliferate, invade the surrounding tissues, migrate, and differentiate to form capillary tubes that connect to newly developed vascular networks leading to vascular stabilization [7476]. defective angiogenesis has been found in many vascular diseases and it has been established that emps play an important role in this process. mps can act on angiogenesis directly through ligand/receptor interaction or indirectly by modulating production of soluble factors involved in endothelial cell differentiation, proliferation, migration, and adhesion. brodsky et al. have shown that in low concentration, emps did not affect the endothelium. however, increased levels of circulating emps are an important factor in the pathophysiology of cv diseases, directly affecting the endothelium and other circulating cells. brodsky et al. have demonstrated that emps directly impair vasorelaxation via diminishing production and/or bioavailability of nitric oxide. this result was correlated with increased superoxide levels in aortic rings isolated from rats and cultured endothelial cells treated with microparticles. other studies have demonstrated that mps of endothelial origin induce the expression of endothelial cyclooxygenase type 2, different adhesion molecules, release of cytokines, and impaired release of nitric oxide from vascular endothelial cells. a pathological concentration (10) of emps affects angiogenesis by diminishing the cell proliferation rate and decreasing the total capillary length of human umbilical vein endothelial cells (huvec) plated on a matrigel substrate. moreover, huvecs or human microvascular endothelial cells (hmvecs) treated with emps demonstrated disorganized tube formation in the presence or absence of vegf. impairments in the regulation of vascular tone, coagulation, and hemostasis contribute to damage of the vascular system and dysfunctional angiogenesis [8183]. recently, in vitro studies published by burger et al. have proved that a long term culture of mouse aortic ecs leads to a senescent phenotype with increased rock activity and formation of mps (figure 4). furthermore, it has been shown that mps promote premature ec senescence through the stimulation of endothelial cell ros production (figure 4). brodsky et al. demonstrated a significant increase in the number of circulating emps in obesity-induced diabetes rats as well as premature endothelial cell senescence and vasculopathy. this disorder was characterized by impaired vasorelaxation, nitric oxide production, and defective angiogenesis. an increased number of circulating emps have been identified in patients with certain diseases, such as hypertension, coronary artery disease, acute coronary syndrome, and stroke. in patients with established endothelial dysfunction, levels of circulating emps are inversely correlated with the amplitude of flow-mediated dilation, independent of blood pressure [11, 8587]. another study published by thomasow et al. has shown elevated levels of cd31 (pecam-1), which are suggestive of ec apoptosis, in severe and mild chronic obstructive pulmonary disease (copd) and emphysema. cd31 emps were positively related to emphysema and were inversely associated with pulmonary microvascular blood flow. in contrast, cd62e (e-selectin) emps indicative of endothelial activation were elevated in severe copd and hyperinflation. previous studies have demonstrated an impairment of cell proliferation, migration, tube formation, and sprouting in older individuals (> 65 years, male or female) when compared to their younger counterparts (< 65 years, male or female) suggesting that these changes contribute to the decrease in effective blood vessel growth and repair mechanisms in the elderly. a decrease of proangiogenic factors and loss of circulating endothelial progenitor cells (epcs) have also been observed with increased aging (> 50 years, male), which may lead to compromised angiogenesis. furthermore, age-related changes in epc number and function may directly correlate with the degree of senescent endothelial impairment. furthermore, in older men (> 60 years) with myocardial infarction, circulating microparticles selectively impair the nitric oxide transduction pathway in endothelial cells, which contributes to the general vasomotor dysfunction observed after myocardial infarction. additionally, an environmental alteration such as a decrease in ecm proteins particularly fibrillar collagen production and small leucine rich proteoglycans (slrps) and changes in the expression of matrix metalloproteinases (mmps) have also been observed with increased aging. emps are clearly implicated in the impairment of angiogenesis in vascular diseases associated with aging however, the specific pathways through which emps augment this process are unknown. moreover, emps may be one of the major factors leading to reduced effectiveness of therapies for treating impaired angiogenesis in humans and should be further explored. furthermore, estrogen levels have been connected to thrombin generation, a central molecule in the coagulation cascade in postmenopausal women. in particular, estradiol increases migration, proliferation, and formation of capillary-like networks of huvecs by the classic estrogen receptor (er) pathway [9698]. most reports have concentrated on the role of ers in mediating big vessel relaxation and contraction. in a rat model of acute myocardial infarction it has been shown that estradiol promotes myocardial angiogenesis by increasing microvascular density through estrogen receptors. furthermore, in ovariectomized rats it has been demonstrated that an increased number of genes in the aged heart, including tnf and map kinase-activating death domain protein (madd), play a role in the release of emps [100102] (figure 4). another in vivo study has shown that ovariectomy in female rats is associated with reduced pai-1 expression, while estrogen replacement counteracts this change promoting emp formation. in vitro studies other mechanisms have also been revealed to be involved in the proangiogenic effect of estrogen including increased expression of both vegf and its receptors [104, 105] and bfgf, as well as expression of vascular adhesion molecules. moreover, estrogen is known to enhance nitric oxide production and release by endothelial cells. studies published by reed and edelberg have suggested that a physiological decrease in the concentration of steroid hormones (e.g., estrogen and testosterone) as a result of menopause and chronological aging may contribute both directly and indirectly to subsequent deficits in the synthesis and function of the angiogenic growth factor tgf-. in humans endogenous estrogen contributes to the anticoagulant, anti-inflammatory, and antithrombotic properties of the endothelium. the numbers of endothelium, platelet, and monocyte-derived microparticles have been found to be elevated in low-estrogen menopausal women. the authors implied that increased numbers of procoagulant microparticles provide a resource to study mechanisms for cardiovascular risk development in newly menopausal women. on the other hand, studies demonstrated by rank et al. had shown that hormone replacement therapy in postmenopausal women increased the concentration of mps derived from platelets. the emp levels were unchanged excluding their primary role in the initiation of a thromboembolic event in these women. another study has shown that emp concentration was diminished in older patients (> 80 years, male or female) but mp procoagulant activity was preserved in comparison to younger patients. the authors suggested that a decreased emp level was associated with age and any effect of gender was ruled out by multivariate analysis. the study performed by mateos-caceres had shown an increased level of circulating emps in elderly (> 66 years) male and female patients with acute stroke and that tnf activated emps were the major player in stroke induction. furthermore, simak et al. demonstrated that circulating emp phenotypes may be associated with the severity, lesion volume, and outcome of acute ischemic stroke (ais) in male patients (> 78 years). on the other hand, studies published by williams et al. have shown that in elderly patients of both genders (> 66 years), emp levels were similar in ais and stroke mimic patients. moreover, they demonstrated that emps were generated via activation and not by apoptosis/necrosis of endothelial cells. this suggested that emps may not be an appropriate marker for ais, given the incapability to distinguish between ais and stroke mimic. the tree-city cohort studies have shown that increased thrombin generation is an independent predictor of ais in elderly women suggesting that hypercoagulability may play an important role in the pathogenesis of ais. indicated that elevated plasma pai-1 levels are a strong risk factor for stroke at old age in people of both genders; however, the 4g/5 g polymorphism variant of pai-1 is associated with reduced incidence of stroke. it has been shown that the single polymorphism pai-1 4g/5 g genotype is associated with higher central systolic, diastolic, and mean arterial blood pressure in women (> 70 years), while no association was found in men suggesting gender specific biology of pai-1 in addition to an advanced age specific factor. moreover, elevated levels of circulating mps have been reported in patients (> 58 years, male or female) with acute myocardial infarction and coronary artery disease. studies published by sinning et al. have shown that circulating emps, but not mps of other cellular origin, are a strong predictor of cardiovascular mortality and major cardiovascular events in patients (> 66 years, male or female) with coronary artery disease and pulmonary hypertension. all these data may indicate that estrogen probably does not exert its protective effects on cv diseases through the emp axis. however, more analyses are needed in order to confirm if a direct connection occurs between estrogen and emps in age-related vascular diseases (figure 4). endothelial microparticles, as pleiotropic factors, play a role in both physiological and pathological conditions and thus may contribute to regulation of vascular homeostasis. emps not only reflect the stage of disease but also play a causative role in the development of various vascular diseases. they can modulate coagulation, and their elevated levels have been observed in many conditions associated with inflammation and angiogenesis. the prothrombotic properties and proinflammatory effects of microparticles on endothelial cells affect vascular aging and lead to structural changes in the heart and other organs. thrombin and pai-1 seem to be key factors involved in emp generation in age-related vascular disease. furthermore, in age-related vascular diseases, steroid hormones are among the factors that have been shown to have an influence on vascular homeostasis. specifically, estrogen plays a regulatory function on vessel inflammation, injury, and repair. lack of estrogen has been suggested to be directly involved in the endothelial cell injury with emp release that is observed in ischemic diseases. however, the direct link between emp generation, emp release, and estrogen is understudied and the further investigation of cellular and molecular mechanisms of these correlations is imperative for understanding and providing a basis for new translational investigations. furthermore, circulating emps show great promise not only as biomarkers in the diagnostics of vascular diseases but also as a target for the treatment of these disorders, especially in elderly patients.

endothelial microparticles (emps) are complex vesicular structures that originate from plasma membranes of activated or apoptotic endothelial cells. emps play a significant role in vascular function by altering the processes of inflammation, coagulation, and angiogenesis, and they are key players in the pathogenesis of several vascular diseases. circulating emps are increased in many age-related vascular diseases such as coronary artery disease, peripheral vascular disease, cerebral ischemia, and congestive heart failure. their elevation in plasma has been considered as both a biomarker and bioactive effector of vascular damage and a target for vascular diseases. this review focuses on the pleiotropic roles of emps and the mechanisms that trigger their formation, particularly the involvement of decreased estrogen levels, thrombin, and pai-1 as major factors that induce emps in age-related vascular diseases.

PMC3830876

pubmed-141

. failed endotracheal intubation and inadequate ventilation with insufficient oxygenation may lead to serious complications, even death. management of an unexpectedly difficult airway consists of laryngeal mask ventilation, gum-elastic bougie and video laryngoscopy-assisted intubation. gum-elastic bougie is the easiest and cheapest tool used in case of an unexpected difficult intubation occurring in the operating room. a 53-year-old male patient with hypogonadotropic hypogonadism presented as an unexpected difficult intubation after the induction of anesthesia. a difficult airway has been described in patients with a variety of endocrine disorders, including pituitary diseases, but not with hypogonadism. there may be an unrevealed relationship between hypogonadism and difficult airway. gum-elastic bougie is still the most attainable and effective tool in the operation room in this situation. anesthesiologists are responsible for maintaining a patent airway in the anesthetized patient. failed endotracheal intubation and inadequate ventilation with insufficient oxygenation may lead to serious complications, as even a few minutes of deoxygenation can result in catastrophic outcome like brain damage or even death.1 anesthesiologists are occasionally faced and challenged with this significant problem in practice. a difficult airway has been described in patients with pituitary endocrine disorders such as acromegaly and dwarfism; however, airway problems with hypogonadism have not been well identified in the literature.2 a 53-year-old married man (weight: 85 kg, height: 187 cm, body mass index: 24 kg/m) presented with a history of nasal obstruction for two years. he had not had any prior operation under general anesthesia, so he did not have any history of difficult intubation, and he did not have any chronic systemic disease. the patient was evaluated for obstructive sleep apnea syndrome (osas) with a comprehensive questionnaire on his sleeping habits and medical history; no complaints or predictors pertaining to osas were identified. the patient s preoperative airway assessment was normal, mallampati class was ii, thyromental distance was 7 cm, inter-incisor gap was 5 cm, and head extension was>35. his physical examination was characterized by lack of secondary sexual characteristics and presence of fine facial wrinkles. although, as previously indicated, the patient was married, he had had no children. his hormone profile was: testosterone 0.3 ng/ml (reference range 1.757.81), free testosterone 0.91 (reference range 4.542.0), prolactin 1.31 ng/ml (reference range 2.6426.72), luteinizing hormone (lh) 0.33 miu/ml (reference range 1.24103.03). no other pathological finding was obtained as the result of magnetic resonance imaging of the pituitary gland. he was admitted to the operating theater, and following the induction of anesthesia with a dose of 5 mg/kg intravenous thiopental, bag-mask ventilation was barely sustained. fentanyl (12 gr/kg) and, as a muscle relaxant, rocuronium (0.6 mg/kg) were administered. while the patient s head was in the sniffing position, direct laryngoscopy and intubation of the trachea were attempted three times with different sizes of macintosh and miller blades by an assistant professor of anesthesiology with 5 years experience. however, unfortunately, the intubation failed. the lungs were then ventilated with 100% oxygen via a face mask in order to avoid desaturation. glottic visualization was assessed with cook s modification of the cormack lehane classification; a grade of 3a (with direct laryngoscopy, only the epiglottis can be visualized; the epiglottis can be lifted using an introducer or bougie) was assigned.3 the patient was subsequently successfully intubated with a gum-elastic bougie. after the operation, the patient was extubated successfully without any complication and then examined by otorhinolaryngologists via fexible laryngoscopy. the epiglottis was found to be in a slightly lower than normal position (figure 1). the overall incidence of unexpected difficult intubation is estimated to be 1%3%, while failed intubation incidence is 0.05%0.35% in europe.1 difficult endotracheal intubation has been described in patients with pituitary diseases like acromegaly, cushing s disease, lh/follicle-stimulating hormone-secreting adenoma, thyroid-stimulating hormone-secreting adenoma, nonfunctional adenoma and prolactinoma.4 difficult airway with dwarfism has also been described. however, difficult airway with a hypogonadotropic patient has not yet been clearly defined. in our case, further, magnetic resonance imaging of the pituitary gland did not reveal any adenoma or mass lesion.2 pulsatile release of follicle stimulating hormone and lh in puberty instigates the development of the male larynx and secondary sexual characteristics. the growth of laryngeal cartilages and maturation of the male larynx is also facilitated by androgen. high-affinity androgen receptors have been found in the human larynx.5,6 in this case, the patient s laryngeal development was compatible with his age and sex. only the epiglottis was located in a slightly lower position than normal, partially leaning toward the laryngeal passage. the patient was infertile and lacked secondary sexual characteristics due to insufficient exposure to androgens. the rate of difficult intubation has been found to be higher in osas patients than the normal, healthy population.7 body mass index, mallampati grading, cormack lehane classification, sternomental distance, and thyromental distance evaluation might be predictive factors for difficult airway in osas patients. as such, anesthesiologists must be aware of this fact and be prepared for difficult intubation in osas patients.7 however, the rate of difficult intubation has not been found to be related to the severity of osas.8 no significant relationship between the apnea hypopnea index and difficult intubation has been found.8 in our patient, no apnea and daytime sleepiness were present in his history. only snoring was present, which might well have been associated with nasal septal deviation. his body mass index was 24 kg/m, mallampati class was ii, thyromental distance was 7 cm, inter-incisor gap was 5 cm, and head extension was above 35. these findings did not suggest any evidence of osas or difficult airway. this multiparameter test reveals the presence and severity of osas.9 in this case, as there was no clinical index of suspicion for osas and to keep costs down, polysomnography was not required by the otorhinolaryngologists. thus, anesthesiologists must take into account difficult airway in endocrinological disorders like hypogonadotropic hypogonadism and be prepared for difficult intubation.

backgrounda critical aspect of safe general anesthesia is providing adequate ventilation and oxygenation. failed endotracheal intubation and inadequate ventilation with insufficient oxygenation may lead to serious complications, even death. anesthesiologists rarely encounter unexpected difficult airway problems in daily routine. management of an unexpectedly difficult airway consists of laryngeal mask ventilation, gum-elastic bougie and video laryngoscopy-assisted intubation. gum-elastic bougie is the easiest and cheapest tool used in case of an unexpected difficult intubation occurring in the operating room. casea 53-year-old male patient with hypogonadotropic hypogonadism presented as an unexpected difficult intubation after the induction of anesthesia. no pathological finding or predictor of difficult intubation was present. in addition, bag-mask ventilation was poor and inadequate. the patient was finally successfully intubated with a gum-elastic bougie. conclusiona difficult airway has been described in patients with a variety of endocrine disorders, including pituitary diseases, but not with hypogonadism. there may be an unrevealed relationship between hypogonadism and difficult airway. gum-elastic bougie is still the most attainable and effective tool in the operation room in this situation.

PMC3982982

pubmed-142

we reviewed the medical records of patients who had l. monocytogenes isolated from blood and body fluids from sterile sites during 19962008 at the national taiwan university hospital (ntuh), a 2,500-bed hospital in taiwan. we evaluated disease severity using modified acute physiology and chronic health evaluation ii scores (8). incidence of nontyphiodal salmonella bacteremia (ntsb) during 20002008 in ntuh was calculated for trend comparison of the 2 foodborne illnesses. only 1 episode was calculated during the same admission for ntsb to avoid the influence of repetitive bacteremia. isolates from patients with fetomaternal listeriosis (i.e., paired isolates from mother and neonate who had listeriosis) were considered to be the same and only 1 of them was analyzed. all isolates were analyzed for their serotype by pcr as described, and genetic relatedness was evaluated by pulsed-field gel electrophoresis (pfge) by using pulsenet standardized protocols and 2 restriction enzymes (asci and apai) (2,9). strains were considered to be of the same cluster if their bands had indistinguishable restriction patterns by both enzymes. strains with pfge patterns with>80% similarity by asci and apai profiles were considered to be closely related. a forward stepwise model with a p value of 0.1 was used, and p<0.05 was considered statistically significant in the multivariate cox proportional hazards model. during the study period, listeriosis was diagnosed in 48 patients, and 46 nonduplicated isolates were obtained for further microbiological analysis. average annual incidence increased from 0.0287 cases per 1,000 admissions during 19962004 to 0.118 cases per 1,000 admissions during 20052008 (figure 1). the increase in annual incidence of listeriosis was significantly correlated with years (p=0.0045). the average annual incidences of ntsb were 1.189 and 1.118 per 1,000 admissions during 20002004 and 20052008, respectively; it was not significantly correlated with years (p=0.50). age-specific incidence of listeriosis increased at both extremes of age, but especially among patients>80 years (figure 2). all of the patients with listeriosis lived in northern taiwan, and no obvious geographic correlation was observed between listeriosis patients in each year. incidence (cases per 1,000 admissions) of human listeriosis and serotype distribution of all isolates, national taiwan university hospital, taipei, taiwan, 19962008. forty-six isolates were available for analysis, including 2 serotype 4b isolates from fetomaternal transmission in 2005 and 2006 and 1 serotype 4b from a pediatric patient (2005). patient distribution and incidence of human listeriosis, by age group, national taiwan university hospital, taipei, taiwan, 19962008. all 43 patients had underlying predisposing conditions, and 18 (42%) were>65 years of age. of the 30 patients with malignancies, 23 (77%) one female patient had coexisting non-hodgkin lymphoma and colon cancer; 1 male patient had coexisting non-hodgkin lymphoma, gastric cancer, and bladder cancer. initial modified acute physiology and chronic health evaluation ii score, mean sd: 18.8 7.3. among the 46 isolates, serotype 1/2b was identified most frequently (46%), followed by 1/2a (28%) and 4b (26%). all 46 isolates were susceptible to ampicillin, ertapenem, meropenem, and vancomycin; 3 isolates were intermediately susceptible to trimethoprim/sulfamethoxazole; and 4 isolates were nonsusceptible to linezolid (10). sixteen (37%) patients received cephalosporin alone as initial treatment regimens and empirical treatment was effective for only 14 (33%). the presence of solid-organ malignancies was a significant negative prognostic factor for 14-day mortality in the univariate analysis (95% confidence interval [ci] 1.16516.694; p=0.029) but not in the multivariate analysis. the results of the multivariate analysis for 14-day mortality showed that hepatic decompensation at disease onset was a significant negative prognostic factor (hazard ratio 12.02, 95% ci 1.84278.470; p=0.009) and that the use of effective antimicrobial drugs after culture results were reported was a significant positive prognostic factor (hazard ratio 0.014, 95% ci 0.0020.131; p<0.001). log-rank tests performed to compare the difference in survival between patient groups for the 2 variables also had the same results (p<0.001). we observed an upsurge of listeriosis beginning in 2005 in ntuh. the increase might not be attributable to common-source outbreaks because no clustering was detected. the annual incidence of listeriosis has been on the rise in europe since 2000 (2,3,11). the reason is not clear because the increase could not be attributed to outbreak clusters and no increase in pregnancy-related listeriosis was observed (2,3). wong et al. found that l. monocytogenes was isolated in>50% of pork samples and chicken carcasses (6). semiready foods (dumplings and meatballs) and frozen dim sum examined also carried the pathogen (34.0% and 4.4%, respectively), and>60% of the isolates were serotype 1 or 4 (6). if served undercooked, these foods could be potential transmission sources. taiwan currently has no strict regulatory policy regarding listeriosis in the food industry and no disease surveillance system. in france, serotype 4b was the predominant serotype (42%56%), whereas serotype 1/2b was more common (46%) in our study (2). none of the isolates were resistant to the tested agents, except for 4 isolates, which were resistant to linezolid. the contributions of disease severity and antimicrobial drug treatment are difficult to evaluate in population-based studies (12). brouwer et al. reported that up to 30% of adults with l. monocytogenes meningitis did not receive initial adequate antimicrobial drug therapy, and they found no association between that variable and outcome (13). a high proportion (37%) of patients in our study initial disease severity and initial adequate antimicrobial drug therapy was not associated with overall mortality. we found that mortality was related to hepatic decompensation and effective antimicrobial drug therapy after culture results were reported. therefore, the incidence of and risk factors for human listeriosis in taiwan could not be determined precisely, and potential outbreaks might have been overlooked. the retrospective design of our study limited the possibility of identifying the potential vehicles and disease-acquiring behaviors. an increase of listeriosis was noted since 2005 in our hospital, and all of the affected patients had predisposing factors that hampered their immunity. dietary education and food management information should be provided to high-risk groups in taiwan. food monitoring and human disease surveillance systems need to be established in taiwan to control this potentially fatal foodborne disease.

during 19962008, a total of 48 patients with listeriosis were identified at a taiwan hospital. average annual incidence increased from 0.029 to 0.118 cases per 1,000 admissions before and after january 2005. serotype 1/2b predominated; serotype 4b emerged since 2004. food monitoring and disease surveillance systems could help control listeriosis in taiwan.

PMC3322081

pubmed-143

three cats, siamese or siamese cross, were presented with a chronic thoracic limb weightbearing lameness. previous anti-inflammatory administrations were unable to improve lameness consistently in the three cats. two of the three cats had undergone onychectomy several years before presentation. a permanent flexion of the proximal interphalangeal joint of one or more digits, associated with a difficult and painful extension of the proximal interphalangeal joint, for all cats, treatment consisted of a tenectomy or tenotomy of the superficial and deep digital flexor tendons in order to release the contracture. the three cats responded well to the surgical treatment and became sound around 24 weeks after surgery. it should be considered in a differential diagnosis of feline lameness whenever onychectomy has been performed in the past. the precise etiology that explains this tendon contracture is unknown, but trauma or breed predisposition could represent potential causes. digit lesions are most often associated with fractures, luxations, wounds, shearing injuries or tumors, and, less commonly, osteomyelitis or osteoarthritis. various surgical interventions are feasible, and digit amputation or luxation reduction is the most frequently performed treatment. feline onychectomy is also a common surgery in north america, despite debate over the ethics of this procedure. feline digital flexor tendon pathology, especially tendon contracture, is not well described. to our knowledge, the term contracture refers to an abnormal pathologic process resulting in fibrosis and permanent damage to a muscle, characterized by replacement of the muscle and/or associated tendon with fibrous connective tissue. this phenomenon leads to shortening of the tendon or the muscle, and can have functional consequences on the range of motion of adjacent joints. most contractures are associated with a previous trauma, weeks to months before the contracture occurs, but repetitive strains, infectious diseases, ischemia, compartment syndrome or neoplasia may also lead to contracture. this case series reports three different clinical presentations of digital flexor tendon contracture in three cats, all successfully treated by tenectomy. a 4-year-old neutered male siamese cat weighing 4.8 kg was presented to a referral hospital for chronic left forelimb weight-bearing lameness of 1 year s duration. the cat showed mild and transient lameness improvement with meloxicam (0.05 mg/kg po q24h metacam; boehringer ingelheim), but long-term medication did not show any additional benefits. the cat showed very mild lameness, with the left forelimb constantly non-weight bearing at rest. a permanent flexion of the proximal interphalangeal joint of the left forelimb second digit was noted. extension of the proximal interphalangeal joint was possible but very difficult and palpation of this digit was significantly painful. six months after initial presentation, the cat was presented for follow-up, without improvement. radio-graphic views of the left forelimb extremity revealed an abnormal positioning of the middle phalanx. indeed, the angulation between the middle and proximal phalanges was decreased and reached almost 90 between these two phalanges on the second digit. there was no evidence of retention of remnants, osteomyelitis or hyperostosis of the distal phalanx. following premedication with hydromorphone (0.1 mg/kg iv hydromorphone; summit) and acepromazine (0.02 mg/kg iv atravent; boehringer ingelheim), general anesthesia was induced with propofol (4 mg/kg iv diprivan; astrazeneca) and maintained with 2% isoflurane (forane; baxter) in 100% oxygen after orotracheal intubation. the cat was placed in dorsal recumbency, and the palmar surface from mid-radius to the extremity of the limb was clipped and aseptically prepared. surgery involved a palmar approach to the proximal interphalangeal joint of the second digit, with a midline skin incision extending from the distal aspect of the carpal pad to the proximal aspect of the metacarpal pad. following blunt dissection, the deep and superficial digital flexor muscle tendons were visualized and elevated, and a portion of the tendons (5 mm) were transected with a #15 scalpel blade (figure 1). the surgical wound was copiously lavaged with 0.9% sodium chloride (0.9% sodium chloride irrigation; baxter). the subcutaneous tissues were closed with a continuous pattern, using a 4-0 absorbable monofilament (poliglecaprone 25, monocryl; ethicon). the skin was closed with an interrupted pattern, using a 4-0 non-absorbable monofilament (polyamide 6, ethilon ii; ethicon). the patient was discharged from the hospital the day after the surgery with strict rest instructions for 3 weeks and meloxicam (0.05 mg/kg q24 h po) for 2 weeks. two weeks after surgery, the owner mentioned that the cat was very active, walking normally at home and was more playful than before surgery. upon follow-up examination no lameness was observed, and manipulation of the left proximal interphalangeal joint of the second digit was normal and pain free. two years after surgery the owner reported that the cat was totally sound, very active and had returned to its usual activity level. intraoperative plantar visualization of the flexor tendons of the third digit before tenectomy (black arrow), exposed with a periosteal elevator (*). left is distal, right is proximal, up is medial, down is lateral) a 7-month-old neutered female siamese weighing 3 kg was presented for a lameness of the left forelimb of 2 months duration. the owner reported that the lameness was most likely due to a trauma that occurred 2 months previously and was permanent since the incident. the cat received two different unknown non-steroidal anti-inflammatories before presentation at our hospital and did not show any improvement. the lameness was moderate at a walk and severe and non-weight bearing when the cat was running. at rest, a non-weight bearing stance was also obvious on the left forelimb. a permanent flexion of the proximal interphalangeal joint was noted on the fourth digit of the left forelimb. five months after initial presentation, the cat was presented for the same condition, without any improvement regarding lameness or comfort upon palpation. radiographic views of the left forelimb extremity revealed an abnormal positioning of the middle phalanx compared with the proximal phalanx, characterized by a decreased angulation between these two phalanges on the fourth digit. following premedication with butorphanol (0.1 mg/kg iv torbugesic; pfizer), general anesthesia was induced with propofol (4 mg/kg iv) and maintained with 2% isoflurane in 100% oxygen after orotracheal intubation. a tenectomy of the deep and superficial digital flexor muscle tendons was performed as previously described for the first case. the surgical preparation and operative technique were similar to those used in case 1, except that the surgical site was the tendons of the fourth digit. the cat was discharged from the hospital the day after surgery with strict rest instructions for 3 weeks and meloxicam (0.05 mg/kg q24h orally) for 2 weeks. at the 2 week re-evaluation, the cat still presented a mild lameness of the left thoracic limb, although the extension of the proximal interphalangeal joint of the fourth digit was improved compared with preoperative examination. one month after surgery, the cat was totally sound and manipulation of the digit was not painful. at a 1.5 year postoperative follow-up, the owner reported that the cat was not limping anymore, was pain free and had returned to its normal activity. a 7-year-old neutered male siamese cross weighing 6 kg presented with right forelimb lameness, which had appeared a month earlier. the owner also reported that the cat had undergone onychectomy at 6 months of age. the cat received a non-steroidal anti-inflammatory treatment (0.05 mg/kg q24h po meloxicam) for 2 weeks before presentation and did not show any improvement in lameness. upon examination, the cat s right forelimb was non-weight bearing at rest, and the cat was uncomfortable while walking on both forelimbs. a permanent flexion of the proximal interphalangeal joint was noted in all four digits of both forelimbs (figure 2). moreover, a 3 mm diameter white firm and painful callus was palpable at the craniodistal aspect, bilaterally, of the third and fourth digital pads. radiographic views of the forelimb extremity revealed an abnormal positioning on both limbs between the middle and the proximal phalanx. indeed, the angulation between these two phalanges was decreased and reached almost 90 in all digits. no bony or articular lesion or osteomyelitis of the proximal and middle phalanges was observed. remnants of the distal phalanx were not observed in the radiographs (figure 3). a digital flexor tendon contracture of both forelimb digits was then suspected, and, after discussion, the owner agreed to surgical treatment. flexor contracture of all digits can be visualized (left is distal, right is proximal, up is dorsal, down is plantar) forelimb oblique extremity radiographic view of the left limb in case 3. an abnormal positioning between the middle and the proximal phalanx is observed in the four digits. the angulation between these two phalanges is decreased and reached almost 90 in all digits following premedication with hydromorphone (0.1 mg/kg iv), general anesthesia was induced with alfaxalone (2 mg/kg iv alfaxan; abbott laboratories) and maintained with 2% isoflurane in 100% oxygen after orotracheal tube placement. a local regional anesthetic bloc was performed bilaterally with bupivacaine (0.5 mg/kg sc marcane 0.5%; hospira healthcare corporation). the surgical procedure was performed as described in case 1 for digits iii and iv of both forelimbs, and a tenotomy was performed on digits ii and v on both forelimbs (figure 4). the cat was discharged from the hospital the day after the surgery with strict rest instructions for 3 weeks, meloxicam (0.05 mg/kg q24h po) for 6 days and buprenorphine (20 g/kg q8h sublingually buprenorphine; chiron compounding pharmacy) for 7 days. perioperative dorsal view of an operated limb (ol) and a preoperative limb (pl) in case 3. flexor contracture is well visualized in pl compared with ol ol=on the left; pl=on the right at the 2 week follow-up, the cat was totally sound and manipulation of the forelimb digits was very comfortable. at rest, digits were in hyperextension (figure 5). histopathologic examination of some parts of the flexor tendons revealed dense and thick collagen bundles associated with a few non-reactive small fibroblasts. these observations were considered to be consistent with a chronic degeneration or trauma of this tendon. a definitive diagnosis of flexor tendon contracture was made (figure 6). thoracic limbs of case 3, 4 weeks after flexor tendon tenectomy and tenotomy photomicrograph of a tendon section from a domestic cat. note the presence of increased well-differentiated fibroblasts (large arrows) in the tendon accompanied by few small-caliber blood vessels (arrowhead) and thin collagen fibers (thin arrows). the three cats reported in this study presented with chronic mild forelimb lameness associated with reduction of the normal extension of the proximal interphalangeal joint of one or more digits. a contracture of the digital flexor tendon was suspected and confirmed by histopathologic analysis in one case. this case series is of particular interest because it describes three different presentations of digital flexor tendon contracture in cats. in case 1, which involved an onychectomized cat, tendon contracture involved only one digit, which is different from the two cases reported by cooper et al. in case 2, the cat developed a tendon contracture on a digit, although it had not undergone onychectomy. case 3 is more comparable to the cases reported by cooper et al because this case involved tendon contracture of all digits in both forelimbs after onychectomy. however, such an important delay, as seen in this case, between onychectomy and the development of digital flexor tendon contracture has not been previously reported. we elected to perform only tenotomy on digits ii and v in case 3 because of a satisfactory intraoperative contracture release after tenotomy. however, although we thought that tenectomy was not mandatory to relieve contracture in theses digits, it could have been a valuable option for treatment of contracture. the surgical outcome was excellent in all cats, as in the two cases reported elsewhere. flexor contracture can be painful and disabling and can induce abnormal contact on normally non-contact areas of the digits. contracture release by tenectomy or tenotomy seemed to improve the lameness quickly, while long-term anti-inflammatory treatments failed in each of the cases reported here. the deep and superficial digital flexor tendons provide digital flexion through contraction of the muscle bellies. more precisely, the proximal interphalangeal joint is flexed by the action of the superficial digital flexor and the distal interphalangeal joint is flexed by the deep digital flexor. the superficial digital flexor (flexor digitorum superficialis) tendon runs on the palmar surface of the deep digital flexor tendon (flexor digitorum profondus). it splits distally into four parts, which diverge to the second to fifth metacarpophalangeal joints, with the corresponding terminal tendons of the deep flexor tendon. each superficial digital flexor ends on the proximal aspect of the palmar surface of the middle phalanx after being perforated by its respective deep flexor tendon, which ends on the tuberosity of the distal phalanges of digits ii those superficial and deep tendons are bridged by three transverse ligaments, at the metacarpophalangeal joints and at the proximal and middle phalangeal joints, on each of the four main digits. in two of the cases reported here, tendon therefore, the cause of the contracture must have been distal to the common tendon. with the third cat, the contracture could have been located more proximally than the tendon division, but multiple contractures of the distal portion of each superficial digital flexor tendon were confirmed by histopathologic analysis. distal aspect of flexor tendon anatomy on a third thoracic digit (distal digital annular ligament has been removed).*deep flexor tendon; p1=proximal phalanx; p2=middle phalanx; p3=distal phalanx; (+)=superficial flexor tendon a precise etiology is unknown in these cats. however, a traumatic episode was reported by the owner of case 2, and this could have been the initial cause of the flexor tendon damage that led to a chronic problem. two cats presented for bilateral and painful flexor tendon contracture following onychectomy have been previously reported. both cats underwent onychectomy 6 weeks and 3 months before presentation, respectively, and had all digits of both front paws fixed in flexion. tenectomy of each deep digital flexor tendon successfully resolved the condition, and the cats were sound 2 months after surgery. the authors hypothesized that the postoperative contracture was the result of inflammation due to a suboptimal surgical technique (excessive or rough tissue manipulation, use of a dull scalpel blade, improper use of tissue adhesives or poor aseptic technique). these factors could elicit an abnormal inflammatory response and result in flexor fibrosis, adhesion formation and evolution toward flexor tendon contracture. tobias et al reported that the duration of the surgery, which was potentially secondary to a suboptimal surgical technique, was correlated with the occurrence of postoperative lameness. this association could also be observed with persistent long-term lameness but the number of cases observed was considered too low to determine such an association. the anatomic relation between the deep digital flexor tendon and the middle phalanx could explain the long-term contracture. indeed, traumatic resection of the distal phalanx could be the cause of an inflammatory reaction in the area of the distal extremity of the middle phalanx and the deep digital flexor tendon. in addition to contracture of the digital flexor, other complications have been associated in 040% of cases of onychectomy in cats, such as pain, hemorrhage, lameness, swelling, non-weightbearing, infection, claw regrowth, middle phalanx protrusion and palmigrade stance. lameness is usually an early postoperative complication and is associated with pain, which resolves in 2 days but can persist for up to 2 months. the postoperative flexor contracture was previously reported in the first months after onychectomy but long-term postoperative contracture after onychectomy could explain undiagnosed chronic pain in some cats and particularly in cats 1 and 3. thus, digital flexor tendon contracture can not be ruled out because of an increased delay from the onychectomy. a trauma was suspected for the second cat, as no previous onychectomy was performed on this patient. digital flexor tendon injuries in dogs and cats are uncommon and most often result from laceration by sharp or penetrating foreign objects. other conditions of digital flexor tendons are rare, and only a few cases have been reported. a report of a 10-month-old male great dane affected by an excessive non-painful exion of the digits of the rightforelimb (more pronounced on the fourth digit) has been published. this dog was lame for 2 months. restricted extension of the fourth digit was conrmed under general anesthesia, and a modied z-tenotomy was performed. surgery provided a very good outcome, as postoperative extension of the affected digit was possible and pain free, and no lameness was noted 7 months after surgery. a 5-month-old basset hound was also reported with simple incomplete syndactyly (fusion of the third and fourth digital pads on a hindlimb) and secondary contracture of the deep digital flexor tendon of the third and fourth digit. with this dog, the deep digital flexor tendon contracture was suspected to be secondary to the primary congenital anomaly and was treated by palmar tenotomy. the first two cats reported here were middle-aged indoor siamese cats, and the third case was a siamese cross. they are known to be predisposed to many diseases, including cardiovascular, dermatologic, endocrine, gastrointestinal, hematologic, infectious and musculoskeletal conditions, such as congenital myasthenia gravis, mucopolysaccharidosis vi or hip dysplasia. however, this hypothesis needs to be confirmed with additional cases and with tendon histopathologic analysis to find a more specific cause to the digital flexor contracture. this pathology is a flexor tendon entrapment of the digits that is characterized by locking of the fingers, with or without pain. the flexor entrapment is due to hypertrophy, narrowing and relative stenosis of the palmar retinacular sheath (most often the transverse ligament at the metacarpophalangeal joint), which progressively restricts the motion of the flexor tendon. the precise etiology is not well understood and repetitive finger movements or local trauma leading to a progressive loss of fingers extension is currently the most plausible hypothesis. different treatments, such as medical treatment, joint immobilization, or corticosteroid injections, have been tried to manage the disease but surgical treatment is indicated when conservative management fails to resolve the pain and clinical signs. the surgical treatment consists of resection of the metacarpophalangeal transverse ligament, with or without resection of the superficial flexor tendon, and is highly effective with low associated complication and recurrence rates. digital flexor contracture can affect an isolated digit or all digits of a limb and is characterized by a chronic lameness and a painful permanent flexion of the affected digit. in contrast to medical management, tenectomy of the deep and superficial flexor tendons is associated with a good-to-excellent surgical outcome for this condition. etiology of this contracture is unknown but trauma, whether related to an onychectomy or not, seems to predispose a cat to this condition. this pathology could therefore be considered as a long-term complication of onychectomy in some cases. however, further cases need to be reported to better understand the pathogenesis of this condition. digit evaluation seems to be of paramount importance when investigating cases of chronic lameness in cats.

case series summarythree cats, siamese or siamese cross, were presented with a chronic thoracic limb weightbearing lameness. previous anti-inflammatory administrations were unable to improve lameness consistently in the three cats. two of the three cats had undergone onychectomy several years before presentation. a permanent flexion of the proximal interphalangeal joint of one or more digits, associated with a difficult and painful extension of the proximal interphalangeal joint, was noticed during orthopedic examination. a digital flexor tendon contracture was suspected and confirmed with radiographic examination. surgical exploration was then performed. for all cats, treatment consisted of a tenectomy or tenotomy of the superficial and deep digital flexor tendons in order to release the contracture. the three cats responded well to the surgical treatment and became sound around 24 weeks after surgery.relevance and novel informationdigital flexor tendon contracture is rarely reported as a cause of lameness in cats. it should be considered in a differential diagnosis of feline lameness whenever onychectomy has been performed in the past. the precise etiology that explains this tendon contracture is unknown, but trauma or breed predisposition could represent potential causes.

PMC5362020

pubmed-144

one of them, adiponectin, also known as acrp30, adipoq, gbp28, and apm1, was discovered by four independent research teams in 1995/1996, [25] as the most abundant product of the adipose tissue. the hormone is a 244-amino acid protein with 30 kda molecular weight that circulates in the serum in different multimeric forms. actions of adiponectin are mediated by two types of receptors: adiponectin receptor 1 (adipor1) and 2 (adipor2). the receptors are highly related and share 67% sequence identity in mice, but they differ in their tissue distribution and the ability to bind various forms of adiponectin. adipor1 shows high affinity for the globular form of adiponectin, whereas adipor2 is characterized by intermediate binding affinity for both globular and full-length adiponectin. the highest levels of adipor1 expression are observed in skeletal muscles, whereas adipor2 is most highly expressed in the liver [7, 8]. due to the extensive distribution of adiponectin receptors in peripheral tissues and organs, adiponectin exerts pleiotropic effects on metabolism, including regulation of homeostasis by fatty acid oxidation, stimulation of glucose uptake and gluconeogenesis inhibition, which leads to intensified thermogenesis and weight loss. consequently, adiponectin level correlates negatively with body fat and positively with insulin sensitivity. the existing evidence points to the presence of a common endocrine system comprising several hormones, including ghrelin, leptin, and orexin that controls metabolism and reproductive functions [1215]. adiponectin mrna and protein were found in the ovaries of several species, including humans, rats, and cows [1619]. adiponectin mrna and protein were also detected in the ovaries of prepubertal but not sexually mature gilts. the influence of the hormonal status of swine related to the stage of the oestrous cycle on adiponectin expression in corpora lutea, granulosa, and theca interna cells remains unknown. studies indicating higher concentrations of adiponectin in female than in male blood suggest that ovarian steroids may regulate adiponectin secretion [20, 21]. similar conclusions can be drawn from varied plasma levels of adiponectin during the oestrous cycle in pigs. despite the above, the possible influence of adiponectin on the production of steroid hormones by porcine ovarian cells remains unexplored. therefore, the aim of this study was to investigate the expression of the adiponectin gene by real-time pcr, to determine the concentrations of adiponectin protein in the porcine ovary (corpora lutea, granulosa and theca interna cells) and to compare gene and protein expression levels during different stages of the oestrous cycle in pigs. additionally, we sought to determine the in vitro effect of adiponectin on the secretion of steroid hormones (progesterone, oestradiol, testosterone, and androstenedione) by ovarian luteal, granulosa, and theca interna cells of sexually mature swine. all experiments were carried out in observance of the ethical standards of the animal ethics committee at the university of warmia and mazury in olsztyn. the experimental material comprised mature gilts (large white and polish landrace) from a private breeding farm, aged 7-8 months and weighing 130140 kg. twenty gilts were divided into four experimental groups as follows: days 2-3, 1012, 1416, and 1719 of the oestrous cycle. the day of the second oestrus was designated as day 0 of the oestrous cycle. the phase of the oestrous cycle was also determined based on ovarian morphology. additionally, to fully confirm correctness of the evaluation of the oestrous cycle phase, the level of progesterone was determined. dissected corpora lutea (cls) from different stages of the oestrous cycle (days 2-3-corpora haemorrhagica, 1012-mature cls, and 1416-regressing cls) were either immediately frozen in liquid nitrogen and stored at 80c until rna and protein analysis or, similarly to the ovaries from days 1719 of the cycle, placed in cold pbs buffer and transported to the laboratory where luteal, follicular granulosa, and theca interna cells were isolated. granulosa and theca interna cells are precursor cells of large and small luteal cells, respectively. dissected corpora lutea from ovaries on days 2-3, 1012, and 1416 were minced into small fragments and dispersed in f-12 medium containing bovine serum albumin fraction v (bsa; 1%) and antibiotics. corpora lutea were enzymatically dissociated in 0.125% trypsin solution (46 times) at 37c, centrifuged (300 g, 10 min, 4c), and washed three times. isolated luteal cells were filtered through nylon mesh (40 m in diameter) and resuspended in fresh f-12 medium. the cells were counted using a haemocytometer, and their viability (~90%) was determined by 0.4% trypan blue dye exclusion. granulosa and theca interna cells were isolated from large follicles (diameter>6 mm) without signs of atresia. granulosa cells were aspirated with a syringe and additionally washed out with a strong stream of media directed to the internal wall of the follicle. the theca interna layer was scraped off from granulosa cells and enzymatically dispersed in 0.25% trypsin solution. dispersed cells were centrifuged (800 g for 10 min) and washed two and three times to isolate granulosa and theca interna cells, respectively. the cells were filtered through nylon mesh (40 m in diameter) and resuspended in eagle's medium enriched with bsa (5%) and antibiotics. the cells were counted using a haemocytometer, and their viability (~98%) was determined by 0.4% trypan blue dye exclusion. some of granulosa and theca interna cells (5 10 viable cells within each experiment) were immediately resuspended in trizol reagent (invitrogen, usa) and stored at 80c until processing for rna analysis. total rna was extracted from luteal tissues from days 2-3, 1012, and 1416 of the oestrous cycle using the absolutely rna miniprep kit (stratagene, usa). in the case of granulosa and theca cells approximately 1 g of rna was reverse-transcribed into cdna in a total volume of 20 l with 0.5 g oligo (dt)15 primer (roche, germany) using the omniscript rt kit (qiagen, usa) at 37c for one hour and was terminated by incubation at 93c for 5 min. quantitative real-time pcr analysis was performed using a pcr system 7300 (applied biosystems, usa). sense and antisense primers (adiponectin, cyclophilin a) were chosen according to lord et al. the chosen primers were as follows: adiponectin forward: 5atgatgtcaccactggcaaattc-3, reverse: 5-gaccgtgacgtggaaggaga-3; cyclophilin a, forward: 5-gcactggtggcaagtccat-3, reverse: 5-aggacccgtatgcttcagga-3; gapdh forward: 5-ccttcattgacctccactacatggt-3, reverse: 5-ccacaacatacgtagcaccagcatc-3. adiponectin primers (access no: ay135647) were complementary to positions 514536 (f) and 565584 (r) of pig adiponectin gene sequence; cyclophilin a primers (access no: ay266299) were complementary to positions 219237 (f) and 269299 (r) of pig cyclophilin a gene sequence, gapdh primers (access no: u48832) were complementary to positions 6185 (f) and 219243 (r) of pig gapdh. a constitutively expressed genes, cyclophilin a and gapdh, were used as the internal control to verify the quantitative real-time pcr. to ensure that cyclophilin a and gapdh were the suitable reference genes for this study, we revealed that there were no statistically significant differences in ct values between the examined ovarian structures throughout all investigated stages of the oestrous cycle. both of the housekeeping genes were also indicated as suitable reference genes (internal controls) in the independent studies. the pcr reaction included 20 ng cdna, 900 nm (adiponectin forward), 300 nm (adiponectin reverse, cyclophilin a forward and reverse) and 60 nm (gapdh forward and reverse) primers, 12.5 l sybr green pcr master mix (applied biosystems, usa), and rnase free water in a final volume of 25 l. quantitative real-time pcr cycling conditions were as follows: initial denaturation and enzyme activation at 95c for 10 min, followed by 40 cycles of denaturation at 95c for 15 s and annealing at 59 for 1 min. negative controls were performed in which water was substituted for cdna, or reverse transcription was not performed prior to pcr. the specificity of amplification was tested at the end of the pcr by melting-curve analysis. calculation of relative expression levels of adiponectin was conducted based on the comparative cycle threshold method (ct) and normalized using the geometrical mean of reference genes expression levels: gapdh and cyclophilin a. western blotting analysis was performed as described by smolinska et al.. briefly, equal amounts of porcine corpora lutea as well as granulosa and theca cells lysats (10 g) were resolved by sds-page on 12.5% polyacrylamide gel and then transferred to a nitrocellulose membranes (whatman, usa). blots were blocked for 5 h at 4c in 1 tbst containing 5% skimmed milk powder and then incubated overnight at 4c with the rabbit polyclonal adiponectin antibodies at the dilution of 1: 150 (santa cruz biotechnology, usa) or rabbit polyclonal actin antibodies (sigma, usa) diluted 1: 200, which were used as an internal control for equal loading and to quantify porcine adiponectin protein. to identify immunoreactive bands, membranes were incubated for 1.5 h at room temperature with mouse anti-rabbit igg for adiponectin (sigma, usa; diluted 1: 2000), goat anti-rabbit igg for actin (diluted 1: 5000) conjugated with alkaline phosphatase (santa cruz biotechnology, usa). nonspecific foetal calf serum (mp biomedicals, usa) was used instead of primary antibodies to produce negative control blots. the immunocomplexes were visualized using 4-nitroblue tetrazolium chloride (nbt) and 5-bromo-4-chloro-3-indolyl phosphate (bcip), according to the manufacture's protocol (promega, usa). the results of western blotting were quantified by densitometric scanning of immunoblots with gelscan for windows ver. 1.45 software (kucharczyk, poland). data were expressed as a ratio of adiponectin protein relative to actin protein in arbitrary optical density units. luteal cells (250000/1 ml medium) were resuspended in f-12 medium enriched with foetal calf serum (fcs; 20%), bsa (1%) and antibiotics and preincubated for 48 hours in a humidified incubator with 95% air and 5% co2 atmosphere. the serum-containing medium was discarded, and the cells were washed using serum-free f-12 medium. after washing, luteal cells were cultured for 24 hours in f-12 medium with bsa (1%) and antibiotics, with or without treatment agents. granulosa and theca interna cells (250000/1 ml medium) were resuspended in eagle's medium supplemented with 10% fcs, 5% bsa, and antibiotics. after 24 hours of preincubation, the medium was discarded, and the cells were washed and cultured for 24 hours in eagle's medium with 5% bsa and antibiotics, with or without treatment reagents. the cultured cells were treated with 1 or 10 g/ml of recombinant human adiponectin (biovendor, usa) alone or in combination with insulin (granulosa and theca interna cells; 10 ng/ml; sigma, usa), fsh (granulosa cells; 10 ng/ml; nhpp, usa) and lh (theca interna cells; 10 ng/ml; nhpp, usa), and combination of those treatments (insulin+fsh for granulosa cells and insulin+lh for theca interna cells). adiponectin doses used in the experiment were close to physiological concentrations of this hormone in the porcine blood. those cells are thought to be generally more autonomic than follicular cells which is a reason of luteal cells ' hard response to stimulators [3133]. the alamar blue test revealed that none of the treatments affected the viability of the cultured cells. following incubation, the media were harvested, centrifuged (800 g for 10 min), and the supernatants were collected and stored at 20c until analyses of progesterone (cultures of luteal, theca interna, and granulosa cells), oestradiol (cultures of theca interna and granulosa cells), androstenedione, and testosterone (cultures of theca interna cells). progesterone (p4) was analysed according to the method described by ciereszko et al., oestradiol (e2) was determined according to the method of hotchkiss et al. modified by kotwica, androstenedione (a4) as described by dziadkowiec et al., and testosterone (t) according to kotwica and williams. the specificity of the antibodies against a4, t, and e2 has been reported by ciereszko et al. and szafranska et al.. the sensitivities of the assays for p4 and a4 were 1 pg/ml and for e2 and t were 0.5 pg/ml. intra- and interassay coefficients of variation of the p4, e2, a4, and t assays were 0.91%, 0.7%, 0.81%, 0.97% and 8.5%, 10.1%, 14.2%, and 7.8%, respectively. data from real-time analysis and western blot were analysed by one-way anova and least significant difference (lsd) post hoc test and are reported as the means sem from five independent observations. all data concerning in vitro cell cultures were analysed by anova for repeated measurements and least significant difference (lsd) post hoc test and are reported as the means sem from five (for all types of cells) independent observations. each experiment was performed on different day using separate pool of luteal or follicular cells. the expression of adiponectin mrna was significantly higher in corpora lutea during all investigated days of the luteal phase than in theca interna cells isolated on days 1719 of the cycle (p<0.05). no significant differences were noted in adiponectin gene expression in granulosa cells compared with theca interna cells and cls (figure 1(a)). in general, adiponectin protein concentration in the porcine ovary was higher in the luteal phase than in the follicular phase. in particular, the adiponectin protein content was the greatest in cls from days 2-3 in comparison with cls and follicular cells from the remaining stages of the oestrous cycle (p<0.01). within the luteal phase adiponectin concentration was the lowest in cls during days 1012 (p<0.01). there was no significant differences in protein expression between granulosa and theca interna cells (figure 1(b)). treatment of luteal cells from days 1012 of the oestrous cycle with adiponectin at both doses (1 g/ml; 10 g/ml) resulted in significant (p<0.05) decrease in progesterone secretion (figure 2). adiponectin at any dose did not affect p4 secretion by luteal cells collected on days 2-3 and 1416 (data not shown). adiponectin at the higher dose (10 g/ml) in combination with insulin provoked the increase in p4 secretion in comparison with the cells stimulated by insulin alone (p<0.05). in contrast, there was no effect of adiponectin (both doses) on fsh- and fsh+insulin-induced production of p4 in porcine granulosa cells (figure 3). basal secretion of p4 was unaffected independently on adiponectin dose (data not shown). adiponectin at the higher dose (10 g/ml) increased basal secretion of e2 (p<0.05) (figure 4). adiponectin did not change secretion of e2 by granulosa cells cultured with insulin and/or fsh (data not shown). adiponectin at both doses reduced basal secretion of t by porcine theca interna cells (p<0.05) (figure 5). the effect of adiponectin on basal p4, e2, and a4 release was negligible (data not shown). adiponectin (10 g/ml) decreased lh+insulin-stimulated secretion of p4 by theca interna cells (p<0.05). there was no effect of adiponectin on lh- or insulin-induced production of p4 by these cells (figure 6(a)). adiponectin did not influence lh- or insulin-stimulated secretion of e2 by theca interna cells. however, lh+insulin-induced secretion of e2 by the cells was increased in response to the higher dose (10 g/ml) of adiponectin (p<0.05) (figure 6(b)). secretion of a4 by theca interna cells was inhibited by combination of adiponectin (10 g/ml) with insulin compared to insulin alone (p<0.05). adiponectin at the lower dose (1 g/ml) increased lh+insulin-induced a4 secretion by the cells (p<0.05) (figure 6(c)). induced secretion of t was not changed under adiponectin influence (data not shown). this is the first ever study to demonstrate the changes in adiponectin gene and protein expression in the porcine ovary throughout the oestrous cycle. our results indicate that adiponectin is more highly expressed in luteal cells derived from ovaries in all examined stages of the luteal phase than in follicular granulosa and theca interna cells. adiponectin was also found to affect basal and stimulated secretion of steroid hormones by porcine ovarian cells. in addition to porcine ovarian structures, adiponectin gene expression and the presence of the hormone protein were also found in woman theca interna cells and in theca interna cells, granulosa cells, corpora lutea, and oocytes of rats and cows [18, 19]. singh and krishna localized the adiponectin protein in bat ovarian structures that showed positive immunostaining in theca interna cells, oocytes of growing follicles, and the corpus luteum. the expression of adiponectin gene and protein was also determined in porcine granulosa cells of prepubertal gilts. the levels of adiponectin expression and also its receptors seem to vary subject to cell type and the stage of follicle and corpora lutea development. in the bovine ovary, the expression of adiponectin and its both receptors was lower in granulosa cells than in theca interna cells and oocytes. contrary results were presented by ortega et al. who observed the highest levels of adiponectin expression in granulosa cells of sheep ovaries. throughout follicular development, adiponectin mrna increased in granulosa cells and decreased in theca interna cells of cows. in the corpora lutea, bovine theca interna cells derived from large follicles revealed higher expression of both receptors than cells isolated from medium-sized and small follicles, indicating that follicular growth influences the transcript levels of adiponectin receptors. the synthesis of ovarian adiponectin and the expression of adipor1 and adipor2 are probably hormonally controlled, as suggested by an increase in adiponectin concentrations in ovarian follicular fluid of women administrated lh in the in vitro fertilization procedure. following pmsg pretreatment, an injection of hcg also significantly increased the expression of adiponectin and adipor1 (but not adipor2) genes in rat ovaries. in bovine theca interna cells, lh increased the concentrations of adipor2 mrnas, whereas igf-i suppressed the expression of the above gene. the results of the present study seem to confirm the hypothesis that adiponectin production is regulated hormonally. higher levels of adiponectin gene and protein expression during the luteal phase and lower expression levels during the follicular phase could point to the stimulatory effect of progesterone and the inhibitory influence of oestradiol on ovarian adiponectin production. in our previous study, adiponectin serum concentrations were higher during the luteal phase than the follicular phase, which suggests that ovarian steroids influence plasma adiponectin levels. in this study the results of our in vitro studies and the presence of both adiponectin receptors in porcine ovaries indicate that adiponectin may directly affect ovarian steroidogenesis. in fact, progesterone secretion decreased due to adiponectin's influence on luteal cells in mid-luteal phase (days 1012). greater variations in adiponectin action were observed in porcine follicular cells. induced progesterone production increased in granulosa cells and decreased in theca interna cells. basal testosterone output and insulin-induced androstenedione secretion were inhibited, while lh+insulin-stimulated release of androstenedione was enhanced by adiponectin. the effect of adiponectin on ovarian steroidogenesis was also suggested in studies of cows, rats, and humans. adiponectin was found to inhibit insulin-induced secretion of progesterone and oestradiol by bovine granulosa cells. in a study of theca interna cells of bovine ovaries, lagaly et al. observed that adiponectin decreased lh+insulin-induced production of progesterone. the above authors also noted that adiponectin inhibited the mrna expression of lh receptor in granulosa cells. granulosa cells of rats and women treated with igf-i responded to adiponectin by increasing progesterone and oestradiol secretion [16, 17]. in the cited studies, adiponectin did not influence fsh-induced production of progesterone and oestradiol in human and rat granulosa cells which is consistent with the response of porcine cells noted in this study. it seems that adiponectin affects ovarian functions by binding adipor1 and adipor2, in two ways. an experiment where rnai was used to block adipor1 and adipor2 expression in the kgn cell line derived from human granulosa cells contributed to new information about adiponectin's role in the ovaries. the absence of adipor1 in the analysed cells enhanced apoptosis, whereas the elimination of adipor2 reduced fsh- and igf-i-induced the production of progesterone and oestradiol and inhibited mitogen-activated kinase activity, relative to control, in response to adiponectin or fsh treatment. the above results suggest that adipor1 is more involved in the survival of granulosa cells, whereas adipor2 regulates steroidogenesis through mapk activation. the influence of adiponectin on the ovaries of sexually mature pigs has not been studied to date, but the response of granulosa cells derived from prepubertal gilts to the analysed hormone was described by ledoux et al.. the above authors observed higher levels of cyclooxygenase-2, prostaglandin e synthase, and vegf gene expression in cells primed with adiponectin, an increase in the expression of the star gene and a decrease in the expression of the p450 aromatase gene. adiponectin treatment contributed to an increase in progesterone levels and a decrease in androstenedione and oestradiol plasma concentrations in comparison with control bats. in the same study, adiponectin treatment increased p450scc and 3-hsd enzyme levels but decreased aromatase, star and lh-r levels in comparison with controls. an in vitro study by caminos et al. demonstrated that adiponectin significantly inhibited basal and hcg-stimulated testosterone secretion by testicular explants. in another study, adiponectin decreased corticosterone secretion by freshly isolated rat adrenocortical cells but did not affect aldosterone production. adiponectin treatment enhanced cortisol secretion, which was accompanied by increased expression of steroidogenic pathway genes, including star protein expression, via erk1/2 and ampk-dependent pathways. in addition to its direct effects on steroidogenesis in the ovary, adiponectin could also indirectly affect gonadal functions by controlling the secretory activity of the hypothalamus and pituitary. a study by wen et al. demonstrated the inhibition of gnrh release from gt1-7 hypothalamic gnrh neurons after the administration of adiponectin. in in vivo study by cheng et al. adiponectin also lowered gnrh secretion by activating the ampk and inhibiting the erk pathways. in the lower branch of the hpg axis, the release of lh from rat pituitary cells and the murine lt2 cell line was decreased after the administration of adiponectin alone and in combination with gnrh [53, 54]. in vivo observations also demonstrated an inhibitory effect of adiponectin on lh secretion: the intravenous administration of the adenovirus expressing the adiponectin gene to male mice decreased plasma lh levels without changes in fsh levels. the inhibitory influence of adiponectin on lh secretion could be attributed to a decrease in gnrh receptor gene expression in the pituitary. the presence of adiponectin mrna and protein in porcine ovaries observed in this study as well as the presence of adiponectin receptors 1 and 2 in the gonads noted in our previous work could provide evidence for auto/paracrine actions of the analysed hormone. the variations in adiponectin gene and protein expression during the oestrous cycle indicate that adiponectin expression is determined by the hormonal status of pigs. the effect of adiponectin on ovarian steroidogenesis suggests that this adipokine influences reproductive functions in pigs. yet for definitive conclusions to be drawn, especially concerning precise localization of adiponectin mrna and protein in different ovarian structures, intracellular mechanisms of adiponectin influence on the gonadal steroidogenesis and its possible effect on other functions of the ovaries, further studies are required to determine the role of adiponectin in ovarian physiology.

adiponectin is an adipose-secreted hormone that regulates energy homeostasis and is also involved in the control of the reproductive system. the goal of the present study was to investigate changes in adiponectin gene and protein expression in porcine ovarian structures during the oestrous cycle and to examine the effects of in vitro administration of adiponectin on basal and gonadotrophin- and/or insulin-induced secretion of ovarian steroid hormones. both gene and protein expression of adiponectin were enhanced during the luteal phase of the cycle. adiponectin affected basal secretion of progesterone by luteal cells, oestradiol by granulosa cells, and testosterone by theca interna cells. the gonadotrophin/insulin-induced release of progesterone from granulosa and theca interna cells and the release of oestradiol and androstenedione from theca cells was also modified by adiponectin. in conclusion, the presence of adiponectin mrna and protein in the porcine ovary coupled with our previous results indicating adiponectin receptors expression suggest that adiponectin may locally affect ovarian functions. the changes in adiponectin expression throughout the oestrous cycle seem to be dependent on the hormonal status of pigs related to the stage of the oestrous cycle. the effect of adiponectin on ovarian steroidogenesis suggests that this adipokine influences reproductive functions in pigs.

PMC3984813

pubmed-145

molecular and morphological evidence together support the idea that the anterior end of the amphioxus nerve cord contains regions homologous with vertebrate forebrain and hindbrain 1,2, though it is generally the ventral portion of these regions that are best represented 3. its most probable position, as defined by gene expression patterns, would be from somewhere forward of the caudal limit of otx expression, which in vertebrates extends through the midbrain, to a point close to the beginning of the zone of hox gene expression. in young amphioxus larvae, this corresponds with a region extending from the infundibular cells, which lie at a level roughly midway along somite 1, through the posterior part of the cerebral vesicle to a level somewhere near or just beyond the middle of somite 2 (fig. this domain begins with an anterior zone of ventral neuropile and commissural fibers followed, near the junction between somites 1 and 2, by a complex of ventrally-positioned somatic motoneurons and interneurons with caudal projections that initiate and control larval swimming behavior 4. the first members of the visceral motoneuron series lie further back, near the caudal end of somite 2. from there, visceral motoneurons recur at regular intervals along the anterior nerve cord and innervate the body via an extended series of peripheral nerves. any attempt to identify an amphioxus homolog of the vertebrate midbrain is hampered by the fact that we currently lack unambiguous criteria for recognizing its presence. the quintessential identifying feature in vertebrates is the dorsal optic tectum, but this is absent in amphioxus. in fact, except for a pineal homolog, amphioxus appears to lack all of the dorsal structures of the vertebrate brain. further, because the amphioxus nerve cord is of uniform dimension along its length, there are no morphological constrictions to separate sub-domains in the anterior cord from one another in the way vertebrate isthmus separates midbrain from hindbrain. the isthmus is notable as the site of an important organizing center, the midbrain-hindbrain boundary (mhb), characterized in vertebrates by the expression of a highly conserved set of gene, including fgf8, engrailed, pax2, and wnt1 5,6. the comparable site in amphioxus lies somewhere close to the caudal limit of somite 1, which is where the anterior zone of otx expression abuts that of gbx 7. however, though engrailed is expressed in small clusters of cells in the embryonic nerve cord 8, these lie further forward in the cerebral vesicle, at a level near the midpoint of somite 1. in addition, wnt1 is not expressed at all in the anterior cord, nor does the expression of the amphioxus pax2 homolog, amphipax2/5/8, match the vertebrate pattern. instead, the latter is expressed caudally through much of the nerve cord 9, and though there is a small anterior zone of later expression, it is too far forward for an mhb marker. there is thus no clear molecular evidence for a focal center in amphioxus with the expression profile of an mhb. this is perhaps not surprising, considering that the structures organized by the mhb are primarily dorsal ones not present in amphioxus. the mhb is, however, also required for normal organization of some ventral brain regions in vertebrates 10. since the ventral midbrain of vertebrates very likely combines vertebrate-specific neuronal cell types along with cell groupings with more primitive organizational features, it would be useful to know whether all of these are mhb-dependent or only the former. it may well be that only vertebrate innovations, whether dorsal or ventral, are under the specific control of the mhb. this leaves open the question of whether the amphioxus pattern differs from that of vertebrates because it reflects an earlier stage in the evolution of a vertebrate-type mhb 7, or whether amphioxus has secondarily diverged from a pattern that was once closer to the vertebrate one. in addition, the vertebrate midbrain marker dmbx is not expressed in the amphioxus nerve cord 11. the available molecular data thus argues against the presence, in amphioxus, of precise homologs of either the vertebrate midbrain or mhb. among tunicates, the other group of protochordates, it is the ascidians that are best studied, and for these there is again good molecular evidence for homologs of both forebrain and hindbrain in the larval cns 11,12, corresponding roughly with the sensory vesicle and caudal ganglion respectively. in addition, cells in the narrow neck region that separates these structures express at least some characteristic mhb genes (fig. data on pax2/5/8 led initially to the proposal that ascidians had an exact counterpart of the vertebrate mhb and that amphioxus, being a later offshoot of the chordate lineage, must have lost this feature secondarily 12. however, the precise spatial arrangement of the expression zones for several key genes in ascidians differs from that in vertebrates, e.g. fgf and dmbx in ascidian larvae are expressed in cells immediately caudal to those expressing pax2/5/8 and en, whereas in vertebrates, dmbx lies forward of the other three genes, whose expression overlaps. expression patterns of the same genes in larvaceans, another group of tunicates, is somewhat different yet again 13, which further complicates the problem of determining the nature of the ancestral pattern. the molecular data is thus somewhat inconclusive regarding protochordate homologs of either the vertebrate midbrain or mhb. if anatomical and functional considerations are taken into consideration, however, a somewhat stronger case can be made that amphioxus may have an approximate counterpart of the midbrain. the key point is that some of the cell types and neural circuits located in the caudal part of the zone of otx expression are similar to those found in the ventral midbrain in vertebrates. in amphioxus, as pointed out above, only ventral markers are available for comparison. of these, the infundibular cells probably mark the anterior limit of any prospective midbrain-like territory, as their homology with the ventral infundibular region of the vertebrate diencephalon seems to be fairly well accepted. immediately behind this point, in amphioxus, there is a zone of ventral neuropile in some ways comparable with the ventral tegmental commissure, which forms part of the early axonal scaffolding in embryonic vertebrate brains. this same region in amphioxus also contains the anterior-most motoneurons in the nerve cord along with populations of large interneurons with descending projections, features found in the tegmentum and the reticulospinal plexus of lower vertebrates beginning at midbrain level. the ventral midbrain in vertebrates is also where dopaminergic neurons with projections to the forebrain first develop, and these are a key component of the motivational circuitry linking basal brainstem centers with the forebrain. dopaminergic neurons are found in the cerebral vesicle in amphioxus and nowhere else in the nerve cord. two main populations develop, one in a dorsal position in the anterior cerebral vesicle, the other more ventrally near the junction between somites 1 and 2 14,15. further research is needed on these cells to determine their precise pattern of projections and function, but the more caudal of the two populations is well positioned to be a homolog of the midbrain dopaminergic neurons in vertebrates. if the anatomical and functional criteria outlined above are meaningful indicators that amphioxus does indeed have a midbrain homolog, the value of the molecular markers used to date to test this would have to be reconsidered. the same could be said of ascidian larvae, but for a different reason, for here there is an alternative explanation for the expression patterns observed. the cns of adult ascidians consists of a simple brain-like dorsal ganglion, from which nerves radiate to the body musculature and visceral organs. the ganglion is present in only a rudimentary form in the larva, however, and the source of its cells has never been clear. in the few species where this has been investigated in the past, the ganglion develops in contact with the neck region of the larval nerve cord near the site where it contacts the neurohypophyseal duct. the latter is partly a stomodeal derivative, which raises the question of whether a significant part of the ganglion might be derived from stomodeal ectoderm. an analysis of the salp ganglion, compared with the data available on compound ascidians 16,17, supports the idea that most if not all of the dorsal ganglion is of neural origin and that, in ascidians, it develops as part of the neck region. recent data on ciona 18 tends to support this interpretation, as its ganglion develops in contact with the base of an outgrowth that arises from the caudal part of the sensory vesicle very near the neck. more importantly, experimental work now in progress on ciona is confirming the neck region as the source of major classes of neurons within the adult ganglion, including motoneurons innervating the visceral organs [j.f. brunet, personal communication]. evidently then, the cells of the neck region in ascidian larvae serve as a pool of precursors from which most if not all post-metamorphic cns neurons are derived. assuming the genes expressed in the vertebrate mhb include major players in the overall process of neuronal specification and differentiation, one can argue that their expression in the neck region is to be expected, irrespective of any homology between this site and the mhb. one would predict the genes would be expressed in combinatorial patterns and in a few cells at most, which is precisely what is observed. current thinking on the nature of ancestral chordates favors the view that the separation of adult and larval tissues in ascidians is a secondary specialization, and that the ancestral body plan was a more fully integrated one, as in amphioxus 19,20. this may explain why the expression patterns of some key developmental control genes differ so dramatically between ascidians and amphioxus. consider pax2/5/8, which has an extended zone of expression in amphioxus, but a very restricted one in ascidians (cf. figs. paralleling these, there are differences in innervation patterns of, for example, the visceral organs. these are strictly adult structures in ascidians, and the cells responsible for their innervation arise from the neck region, whereas the hox-expressing part of the nerve cord, which innervates the tail, is entirely lost at metamorphosis. in amphioxus, in contrast, visceral motoneurons, along with the rest of the locomotory control system, arise from an extended region of the nerve cord extending well into the hox zone. whether the zone supplying visceral innervation corresponds precisely with that expressing pax2/5/8 has yet to be determined. one can nevertheless predict that any gene essential to the development of the visceral innervation will necessarily be expressed over a much greater length of the nerve cord in amphioxus than in ascidians. for at least some of the genes associated with the mhb, therefore, the reason their homologs have a very restricted expression zone in ascidian larvae likely has less to do with the presence of a vertebrate-type mhb, and more with the functional necessity of generating a full complement of adult neurons from a single site within the nerve cord. what one then wants to know, to determine whether the ascidian pattern and the vertebrate one are more than coincidentally related, is what functional role the genes play in each instance. with regard to pax2/5/8 specifically, a further clue might come from knowing whether its expression in hemichordate embryos is restricted, as in ascidians, or extended, as in amphioxus. if the latter, this would be further evidence for the view that the ascidian pattern is indeed the derived one. from the above it is clear that there is a certain plasticity in the way expression patterns of genes identified with the mhb have diverged among chordates. in fact, the vertebrates seem to be most conservative: it is their pattern that most closely resembles that of hemichordates 19,20, the closest available model for an ancestral deuterostome, and there are remarkably similar patterns in protostomes, e.g. drosophila. in hemichordates an mhb-like region can nevertheless be recognized, consisting of overlapping zones of en, pax2/5/8, fgf8 and wnt1 expression near the junction between the collar and trunk in a region where otx and gbx expression overlaps 21. if, however, as argued above, the specific organizer functions of the vertebrate mhb evolved with vertebrates, why are hemichordate expression patterns so close to vertebrate ones? it could be, that despite the anatomical differences in their nervous systems, homology dictates the position along the body axis at which particular neural functions and cell types are localized. this might be due, for example, to their association with conserved structures like the mouth or the first gill slit. too little is currently known of hemichordate neuroanatomy to speculate much further, though some essential aspect of ectodermal and/or neural patterning is presumably involved. a further problem is to discover why amphioxus and ascidians have altered their mhb-related expression patterns when they are elsewhere so well conserved. in the case of ascidians, there have evidently been major changes in the way key patterning genes, notably those of the hox cluster, are structured and regulated. this probably relates to the presence of alternative mechanisms for cell specification in ascidians, which has relaxed some constraints on genome organization 22. it is otherwise somewhat surprising that such comparatively distant relatives as vertebrates and hemichordates are so similar in terms of their mhb-related expression patterns when the main protochordate groups are both so different from vertebrates and from each other. there is a second issue integral to any consideration of chordate cns origins that relates to how the main organ systems of the body, including the nervous system, are positioned in relation to the dorsoventral axis. comparatively strong evidence now supports the idea that the body of chordates is dorsoventrally inverted relative to that of insects and the other main groups of protostomes. a full account of how this might have happened has been difficult to piece together, at least until now, because there was little relevant data on the basal offshoots of the lineage leading to chordates, namely hemichordates and echinoderms. their anteroposterior maps are very similar to vertebrates 21 and, while the data on dorsoventral patterning is more ambiguous, it appears that hemichordates are oriented the same way as protostomes, such that the mouth is ventral and the expression domain for homologs of the dorsoventral patterning genes bmp2/4 and bmp7 is dorsal 20. removal of all influence of the latter in hemichordates results in a much expanded mouth, while over-expression suppresses the mouth and generates radialized embryos. in vertebrates, bmp expression and the mouth are both ventral, but suppressing bmps has equally dramatic radializing effects 23. the genes thus appear to be performing essentially similar functions in these two groups, which implies that dorsal in basal deuterostomes has become ventral in vertebrates and, hence, in all chordates. inversion must therefore have occurred between the separation of the clade comprising hemichordates plus echinoderms from chordates, possibly in an organism that did not yet have an internalized cns. the transition is somewhat easier to imagine, in fact, if the starting point is an animal with circumferential expression zones of all the key patterning genes (fig. it should then be equally easy to concentrate both the expression zones and the structures they pattern either to the dorsal surface or the ventral one (fig. walter garstang's ideas about chordate origins are fairly typical of hypotheses that predate the renewed interest in dorsoventral inversion. he derived neural tube from the dorsal portion of an ancestral system of larval ciliary bands, in that way preserving the dorsoventral orientation of the ancestor (fig. if inversion did, in fact, occur, the brain and nerve cord would have had to come instead from the ventral surface of the ancestral body (fig. 2c), an alternative explored by claus nielsen in a 1999 analysis 24. a major premise of garstang's hypothesis, that the whole of the neural tube should to arise as a single entity, is no longer widely accepted 19, but it is still useful to consider the consequence of dorsoventrally inverting his hypothetical ancestor. as nielsen points out, so long as the brain arises at the anterior end of an originally ventral neuraxis, it must necessarily form in the postoral region, most likely immediately caudal to the mouth. this may seem counterintuitive, but the zone of expression for mhb-type genes, which mark a core brain region in vertebrates, is also postoral in hemichordates. the ancestral chordate in this scenario, in its inverted position, would have both its mouth and brain on the dorsal surface of the body. while this may seem peculiar what is then needed to generate the body of more advanced chordates like amphioxus and vertebrates is for differential growth of the ectoderm separating the mouth and brain to move the former forward, over the front or side of the snout, to what is now the ventral surface. the site of the ancestral apical organ must move as well, and will eventually find itself behind the now-ventral mouth, roughly in the position of the adhesive gland, which is also exactly the path the polar bodies follow from the apical pole of the egg during amphibian development 24. in consequence, the anterior most part of our brain can not be homologous with the anterior-most parts of protostome brains, because the latter are in part derived from apical structures. this is despite the supposed homology between the anterior otx-expressing regions of protostome and deuterostome brains, because in embryos and larvae in both groups, otx can be expressed both pre- and post-orally 25,26. in summary, though there is good reason to doubt that the chordate neural tube actually derives evolutionarily from larval ciliary bands 19, nielsen's point about the site of brain formation being post-oral, though counterintuitive, is largely consistent with current molecular data. in addition, the larvae of hemichordates and echinoderms have neurons at this location, and these form comparatively complex ganglion-like assemblages in some instances. the function of these simple neural centers is to innervate the larval oral region and pharynx, presumably to control basic feeding behaviors and digestion. if these did indeed serve in some way as the core of the evolving chordate brain, then the progressive incorporation of centers for locomotory control into the brain is yet another story, and one that would have unfolded quite independently of the evolutionary process by which a centralized brain and nerve cord arose in the protostome lineage. in this version of events, it is quite unlikely that the internalized neural tube of chordates can be explained by a simple inversion of a protostome-like ancestor with an already-internalized brain and nerve cord, as has sometimes been supposed. dorsal views of the larval nerve cords of (a) amphioxus and (b) ciona, a representative ascidian, showing expression domains for the main cns patterning genes. this is somewhat simplified, as the exact extent of the expression domains can vary with developmental stage, and the ascidian hox genes, in particular, are expressed in non-overlapping domains with some gaps. two alternatives for explaining the origin of a dorsally positioned brain in chordates, using the hemichordate embryo (a) as a starting point; indicates the mouth (m), anus (a), apical plate (orange), and the ancestral dorsal (a-dorsal) and ventral (a-ventral) surfaces; the light blue rectangle is the expression hot zone (hz) in which homologs of genes characteristic of the vertebrate mhb are expressed, typically in circumferential bands within ectoderm of the collar and anterior trunk. older explanations of chordate origins, e.g. garstang's hypothesis, retain an ancestral dorsoventral orientation (as in b). this allows the dorsal condensation of tissue that became the brain (dark blue) to form within the hot zone of mhb-like expression, co-opting the latter for neural patterning functions. with inversion (c, left side), the ancestral ventral surface becomes dorsal. in contrast with b, any brain-like condensation that forms on the new dorsal surface would necessarily then be post-oral in position, but it could still incorporate the mhb-like hot zone. then, to generate the vertebrate condition (c, right side), with mouth and brain on opposing sides of the body, one needs to move the mouth over the front or side of the snout by differential growth of an expansion zone (ez) located somewhere forward of the brain.

the mhb (midbrain-hindbrain boundary) is a key organizing center in the vertebrate brain characterized by highly conserved patterns of gene expression. the evidence for an mhb homolog in protochordates is equivocal, the " neck " region immediately caudal to the sensory vesicle in ascidian larvae being the best accepted candidate. it is argued here that similarities in expression patterns between the mhb and the ascidian neck region are more likely due to the latter being the principal source of neurons in the adult brain, and hence where all the genes involved in patterning the latter will necessarily be expressed. the contrast with amphioxus is exemplified by pax2/5/8, expressed in the neck region in ascidian larvae, but more caudally, along much of the nerve cord in amphioxus. the zone of expression in each case corresponds with that part of the nerve cord ultimately responsible for innervating the adult body, which suggests the spatially restricted mhb-like expression pattern in ascidians is secondarily reduced from a condition more like that in amphioxus. patterns resembling those of the vertebrate mhb are nevertheless found elsewhere among metazoans. this suggests that, irrespective of its modern function, the mhb marks the site of an organizing center of considerable antiquity. any explanation for how such a center became incorporated into the chordate brain must take account of the dorsoventral inversion chordates have experienced relative to other metazoans. especially relevant here is a concept developed by claus nielsen, in which the brain is derived from a neural center located behind the ancestral mouth. while this is somewhat counterintuitive, it accords well with emerging molecular data.

PMC1458436

pubmed-146

medicinal plants have been used for centuries in traditional medicine because of their therapeutic value. mentha piperita, (family lamiaceae) is a species found in iran and many parts of the world which has an economical value for its flavoring, odor, and therapeutic properties in foods and cosmetic industrial products. in addition, the leaves and flowers of m. piperita have medicinal properties [2, 3]. essential oils are valuable natural products used as raw materials in many fields including perfumes, cosmetics, aromatherapy, phototherapy, spices, and nutrition. peppermint (m. piperita) oil is one of the most popular and widely used essential oils, mostly because of its main components, menthol, and menthone. previous studies have shown antiviral, antibacterial [6, 7], antifungal [6, 810], antibiofilm formation [1113], radioprotective, antioedema, analgesic, and antioxidant activities of the eo and methanolic extracts of herbal parts and callus cultures of m. piperita. in addition, m. piperita eo has been shown to cause inhibitory effects against radial fungal growth and aflatoxin production by aspergillus species. in the past two decades, azole-resistant candida and aspergillus species are the top pathogens responsible for nosocomial or food-borne infections [18, 19]. in addition, the formation of biofilms by candida species have raised concerns due to their increased resistance to antifungal therapy and protects the microbial cells within biofilms from the host immune defenses [2023]. an alternative approach to overcome antibiotic resistance might be using natural products and phytochemicals. it has also been shown that some plant extracts efficiently inhibit the biofilm formation of c. albicans. moreover, eos especially with known antibacterial effects have the potential to be used in food industry as preservatives and to increase the shelf life of products. therefore, determining the antimicrobial properties of eos might help to overcome microorganism resistance to antibiotics and prevent food spoilage. the chemical composition of aromatic plants depends largely on the individual genetic variability and different plant parts [2527]. the presence and concentration of certain chemical constituents of eos also fluctuate according to the season, climatic condition, and site of plant growth [25, 26]. the goal of this study was to investigate the chemical composition and in vitro antifungal and antibiofilm activities of essential oils of the leaves of m. piperita collected in the region of fars from iran. at full flowering stage, the aerial parts of the m. piperita were hydrodistillated for 2.5 h, using an all-glass clevenger-type apparatus, according to the method outlined by the british pharmacopoeia. the sample oils were dried over anhydrous sodium sulfate and stored in sealed vials at 4c before gas chromatography and gas chromatography-mass spectrometry (gc-ms) analysis. the analysis was carried out on a thermoquest-finnigan trace gc-ms instrument equipped with a db-5 fused silica column (60 m 0.25 mm i.d., film thickness 0.25 mm). the oven temperature was programmed to increase from 60c to 250c at a rate of 4c/min and finally held for 10 min; transfer line temperature was 250c. helium was used as the carrier gas at a flow rate of 1.1 ml/min with a split ratio equal to 1/50. the quadrupole mass spectrometer was scanned over the 35465 amu with an ionizing voltage of 70 ev and an ionization current of 150 ma. gc-flame ionization detector (fid) analysis of the oil was conducted using a thermoquest-finnigan instrument equipped with a db-5 fused silica column (60 m 0.25 mm i.d., nitrogen was used as the carrier gas at the constant flow of 1.1 ml/min; the split ratio was the same as that for gc-ms. the oven temperature was raised from 60c to 250c at a rate of 4c/min and held for 10 min. the injector and detector (fid) temperatures were kept at 250c and 280c, respectively. retention indexes (ris) were calculated by using retention times of n-alkanes (c6c24) that were injected after the oil at the same temperature and conditions. the compounds were identified by comparing their ri with those reported in the literature, and their mass spectrum was compared with those reported in wiley library. the antifungal activities of the eo against 25 standard strains of fungi, including c. albicans (atcc 5982, 1912, 562, 1905, 1949, 10261, and 2730), c. tropicalis (atcc 750), c. krusei (atcc 6258), c. glabrata (atcc 863, 2192, 2175, 6144, and 90030), c. dubliniensis (cbs 8501, atcc 8500, 7987, and 7988), c. parapsilosis (atcc 4344), c. neoformance (atcc 9011), aspergillus flavus (atcc 64025), a. fumigatus (atcc 14110, cbs 144.89), a. clavatus (cbs 514.65), and a. oryzae (cbs 818.72) were determined. in addition, the antifungal activities of the eo against 35 clinical isolates of yeasts identified by polymerase chain reaction-restriction fragment length polymorphism (pcr-rflp) were also examined [29, 30]. the antifungal susceptibility of clinical isolates of the tested fungi against fluconazole was examined by microdilution and disk diffusion methods [31, 32]. minimal inhibitory concentrations of the eo against standard and clinical species of the fungi were determined by the broth microdilution method as recommended by the clinical and laboratory standards institute (clsi), with some modifications [31, 32]. briefly, the rpmi-1640 (with l-glutamine and phenol red, without bicarbonate) (sigma, usa) was prepared and buffered at ph 7.0 with 0.165 mol 3-(n-morpholino)propane sulfonic acid (mops) (sigma-aldrich, steinheim, germany). serial dilutions of the eo (0.06 to 16 l/ml) were prepared in 96-well microtiter trays using rpmi-1640 media (sigma, st. double dilutions of fluconazole were also prepared for each of the tested fungi with the final concentration of 0.25 to 128 g/ml. stock inoculums were prepared by suspending three colonies of the examined yeast in 5 ml sterile 0.85% nacl and adjusting the turbidity of the inoculums to 0.5 mcfarland standard at 630 nm wavelength (this yields stock suspension of 15 10 cells/ml). for moulds (aspergillus spp.), conidia were recovered from the 7-day-old cultures grown on potato dextrose agar by a wetting loop with tween 20. the collected conidia were transferred in sterile saline and their turbidity was adjusted to optical density of 0.09 to 0.11 that yields 0.45 10 conidia/ml. working suspension was prepared by making a 1/50 and 1/1000 dilution with rpmi of the stock suspension for moulds and yeasts, respectively. after the addition of 0.1 ml of the inoculums to the wells, the trays were incubated at 30c for 2448 h in a humid atmosphere. 200 l of the uninoculated medium was included as a sterility control (blank). in addition, growth controls (medium with inoculums and 5% (v/v) without the eo or fluconazole) were also included. mics were visually determined and defined as the lowest concentration of the eo that produced no visible growth. in addition, minimum fungicidal concentrations (mfcs) of all the examined agents were also determined by culturing 10 l from the wells showing no visible growth onto sda plates. mfcs were of the lowest concentration that showed either no growth or fewer than 4 colonies, which corresponded to 98% killing activity of the initial inoculums. mfcs were determined as the lowest concentration yielding no more than 4 colonies, which corresponds to a mortality of 98% of the fungi in the initial inoculums. according to behnam et al., c. albicans and c. dubliniensis strains were maintained on sabouraud dextrose agar (difco) plates. after 48 hrs one loop of the colonies was transferred to 20 ml sabouraud broth in 250 ml erlenmeyer flasks and incubated overnight in an orbital shaker (100 rpm) at 30c under aerobic condition. yeast cells were harvested and washed twice in sterile phosphate-buffered saline (pbs) (0.8% [w/v], nacl (merck); 0.02% [w/v], kh2po4 (merck); 0.31% [w/v], na2hpo4+12h2o (merck); 0.02% [w/v], kcl (panreac); ph 7.4). then, they were resuspended in rpmi 1640 supplemented with l-glutamine (gibco) and buffered with morpholinopropanesulfonic acid (mops) and the cell densities were adjusted to 1.0 10 cells/ml after counting with a hemocytometer. serial dilution of the eos (0.0158 l/ml) in rpmi 1640 was prepared in a presterilized, polystyrene, flat-bottom, 96-well microtiter plates (nunc). after the addition of 0.1 ml of the yeast inoculums to the wells, 200 l of the uninoculated medium was included as a negative control (blank). in addition, rpmi with yeasts but without the eos served as positive controls. a semiquantitative measure of biofilm formation was assayed using a 2, 3-bis(2-methoxy-4-nitro-5-sulfo-phenyl)-2h-tetrazolium-5-carbox-anilide (xtt) reduction assay. xtt (sigma chemical co.) was prepared as a saturated solution at a concentration of 0.5 mg/ml in ringer's lactate. this solution was filter-sterilized through a 0.22 m-pore-size filter, divided into aliquots and then stored at 70c. prior to each assay, an aliquot of the xtt stock solution was thawed and treated with menadione sodium bisulfite (10 mm prepared in distilled water; sigma chemical co.) to obtain a final concentration of 1 m of menadione. a 100 l aliquot of xtt menadione was then added to each prewashed wells. the plates were then incubated in dark for 2 hours at 37c, and the colorimetric change at 490 nm (a reflection of the metabolic activity of the biofilm) was measured with a microtiter plate reader (titertekplus-ms2 reader, uk). the qualitative and quantitative compositions of the eo of m. piperita are presented in table 1. gc/ms analyses showed that the main constituent of the eo was menthol (53.28%) followed by menthyl acetate (15.1%) and menthofuran (11.18%). the antifungal activities of m. piperita eo against the tested yeasts are shown in table 2. the eo inhibited the growth of all of the tested yeasts at concentrations of 0.124 l/ml. furthermore, the eo exhibited fungicidal activity (mfc) for all of the above-mentioned yeasts at concentrations ranging from 1 to 8 l/ml. no significant differences in inhibitory concentrations were found between azole-resistant and -susceptible strains. in addition, the eo inhibited the growth and killed the standard strain of cryptococcus neoformance at the concentration of 4 l/ml. all of the aspergillus standard strains were susceptible to m. piperita eo at concentrations of 0.54 l/ml (table 3). as shown in table 4, the eo completely inhibited the biofilm formation of c. albicans and c. dubliniensis at concentrations of 1 l/ml and 2 l/ml, respectively. the compositions of the eos might be affected by the developmental stages of the plant. although some authors reported alpha terpinen as the dominant component of m. piperita eo (19.7%), similar to the previous studies [4, 7, 33], we identified menthol as one of the main constituents of the eos. the higher concentration of menthol in this study as compared to some of those of previous reports [4, 34] may reflect variations due to geographical location from which the plants were collected. in this study, the eos exhibited fungistatic and fungicidal activities against both of the standard and clinical strains of candida species at concentrations ranging from 0.5 l/ml to 8 l/ml, which can be best compared to the previous investigations [6, 8, 9, 33]. one of the encapsulated yeasts, c. neoformance, is a well-known primarily opportunistic pathogen which produces chronic and life-threatening meningitis. according to the findings of this study, the examined oils killed the standard strain of c. neoformance at concentration of 4 l/ml. similar to the previous studies [10, 17] the eo of m. piperita exhibited a strong anti-aspergillus activity with mic values ranging from 0.5 to 4 l/ml. mfcs of the eo against the tested fungi were almost similar or two times greater than those of their corresponding mics. since the eos exhibited similar antifungal effect against the tested azole-resistant and azole-susceptible strains, it could be assumed that the mechanism of the action of the eos is different with those of the above-mentioned antifungal drug. one of the main characteristics of eos is their hydrophobicity, which enables their incorporation into the cell membrane. it has been shown that this phenolic monoterpene has a hydroxyl group around the phenolic ring and exhibits its antimicrobial activity through the disruption of the cytoplasmic membrane [35, 36]. biofilm formation by candida species is a phenomenon which helps the survival, pathogenesis, and drug resistance. the most commonly candida species associated with biofilm formation is c. albicans. in the present study, the formation of biofilm was inhibited completely at a concentration of up to 2 l/ml in a dose-dependent manner, which was comparable to the study of agarwal et al.. as the industries tend to reduce the use of chemical preservatives in their products, eo of m. piperita with potential active antimicrobial properties might be considered as a natural source for the maintenance or extension of the shelf life of products. in addition, delectable taste of the eo at the concentrations needed for antimicrobial properties was a bonus to its antimicrobial effects. on the other hand, these eos might also be considered for developing products for controlling fungal infections. as these tests have all been done in vitro, the next step may be further investigations in animal models to see if infection can be inhibited by the eo.

variations in quantity and quality of essential oil (eo) from the aerial parts of cultivated mentha piperita were determined. the eo of air-dried sample was obtained by a hydrodistillation method and analyzed by a gas chromatography/mass spectrometry (gc/ms). the antifungal activity of the eo was investigated by broth microdilution methods as recommended by clinical and laboratory standards institute. a biofilm formation inhibition was measured by using an xtt reduction assay. menthol (53.28%) was the major compound of the eo followed by menthyl acetate (15.1%) and menthofuran (11.18%). the eo exhibited strong antifungal activities against the examined fungi at concentrations ranging from 0.12 to 8.0 l/ml. in addition, the eo inhibited the biofilm formation of candida albicans and c. dubliniensis at concentrations up to 2 l/ml. considering the wide range of the antifungal activities of the examined eo, it might be potentially used in the management of fungal infections or in the extension of the shelf life of food products.

PMC3532871

pubmed-147

falls of the elderly always lead to serious health issues as the decline of their physical fitness. fracture is the most common injury in fall of an elderly and there is also a certain possibility to get coma, brain trauma, and paralysis. at most fall situations, the fall process is the main source of injury because of the high impact. but sometimes the late medical salvage may worsen the situation. that means the faster the salvage comes, the less risk the elderly will face. mems (microelectro mechanical systems) sensors have simplified the design and implementation of sensor system. location based service (lbs) makes it more convenient to locate the elderly in health monitoring. beside these cameras are distributed at limited space to offer pictures or videos of human activities to implement fall detection algorithm. external supports such as motion sensors could be used to enhance computer vision based fall detection method, and a data fusion algorithm can operate the validation and correlation among the two subsystems to raise robust performance of fall detection. these computer based methods work effectively in indoor environment, but they are hard to realize in outdoor environment as the deployment of cameras is always limited. there are several kinds of detection methods which differ in constitution of motion sensors and detection algorithms. a single triaxial accelerometer can provide object's accelerations in three directions which include the influence of gravity. the influence of gravity or dynamic acceleration is available by using a low pass filter or a high pass filter. some kinds of angular movement information can also be calculated based on the relationship between acceleration components and their vector sum. a triaxial magnetometer can detect magnetic strength in three directions, and it can also provide angular motion information in the horizontal plane. but the environment magnetic field may disturb the geomagnetic field which reduces the reliability of the magnetometer outputs, for instance, in some steel structure architecture or near some objects with strong electromagnetism. as angular information can also be extracted from accelerometer measurements, a state space filter such as the kalman filter is a commonly used technique to combine angular motion information. beside these, sensors such as barometer can also assist pure motion sensors at human gait recognition. but, in fact, using more sensors means more power consumption, and it is a challenge to design a proper algorithm to fuse different kinds of sensors. a single triaxial accelerometer is quite enough for human fall detection as sufficient information could be extracted from its measurements. besides this, the accelerometer coordinate does not have to be fixed if only the magnitude of sum vector is needed, and that is quite convenient for wearable application. in this paper, a fall detection system based on a wearable device is developed. the hardware and software realization of the device is mainly based on a single triaxial accelerometer and gps/gsm module. the device uses an efficient fall detection algorithm with less resource and power consumption, which means that it is a proper design for outdoor application. then it will get the elderly's geographic position and send fall alarm short message to caregivers. so the elderly who has fallen can get timely help to minimize the negative influence. information like linear movements (e.g., displacement, velocity, and acceleration) and angular movements (e.g., angle, angular velocity, and angular acceleration) could be obtained directly or indirectly. beside these, frequency domain parameters could be extracted from basic sensor measurements by techniques such as fft and wavelet [11, 12]. for single triaxial accelerometer application, accelerations and derived angular parameters could be used as recognition features. fall detection algorithm design according to the recognition feature, fall detection algorithms are classified as threshold based and machine learning based. for threshold based method, threshold of recognition feature is set by the designer before application which makes the algorithm have rapid response and less resource consumption. but the choice of threshold needs both rigorous schemes and adequate experiments. for machine learning based design, the classification of fall and normal activities is available with the assistance of technologies such as support vector machine (svm) and neural network [14, 15]. machine learning assistance may enhance system robustness to some extent, but its algorithm design is always high computing resource consumed which limits its application in wearable device. as the compact wearable device requires low power consumption and a single triaxial accelerometer could provide effective information, threshold based fall detection algorithm will be used in this system. algorithm used in this fall alarm system when a real fall happens, collision between human's body and ground will produce obvious peak value at the sum acceleration a which has magnitude as (1)a=ax2+ay2+az2, where ax, ay, and az present accelerometer measurements of three axes. the system uses the sum acceleration as the first step to distinguish high intensity movements from others. but normal motions such as jumping or sitting also produce peak values, which mean that additional detection features are required. as human's motion has low acceleration, it is feasible to get gravity component in each axis by using a low pass filter. if gravity components could be separated before and after human's fall, then it is possible to calculate the rotation angle of accelerometer coordinate in 3d space, which is also equivalent to the rotation angle of gravity vector relative to fixed coordinate. quaternion is an effective tool to describe rotation movement in human's gait change which also includes falling. a quaternion could be described as (2)q=q0+q1i+q2j+q3k which has magnitude as (3)q=q02+q12+q22+q32. unit quaternion which has magnitude q=1 can be described as (4)q=cos2+sin2qxi+sin2qyj+sin2qzk. as shown in figure 3, rotation angle of q equals. the rotation axis is orthogonal to the rotation plane and its direction is in accordance with right hand screw rule. qx, qy, and qz are three components of the unit vector which describes the orientation of the quaternion at the fixed coordinate. besides rotation movement, quaternion can also describe a vector in 3d space, such as the gravity vector g which could be described as a quaternion (5)g=0+gxi+gyj+gzk.gx, gy, and gz are three components of g which has quaternion magnitude as (6)g=gx2+gy2+gz2=g. a unit quaternion q is used to describe human's falling movement, which can also be divided into three rotation quaternions q1, q2, and q3 to simplify the calculation as shown in figure 4. with the help of gravity vector information before and after human's falling movement as shown in figure 3, these three separated quaternions are all available. q 1 could be expressed as (7)q1=cos12+sin12sini+sin12cosj which has rotation angle and rotation axis information as (8)1=arctangbefore, zgbefore, x2+gbefore, y2,sin=gbefore, ygbefore, x2+gbefore, y2,cos=gbefore, xgbefore, x2+gbefore, y2. quaternion q2 can be calculated as (9)q2=cos22+sin22k which has rotation angle as (10)2=arctan2gafter, ygafter, xarctan2gbefore, ygbefore, x. quaternion q3 is (11)q3=cos32+sin32sini+sin32cosj with rotation angle and rotation axis information as (12)3=arctangafter, zgafter, x2+gafter, y2,sin=gafter, ygafter, x2+gafter, y2,cos=gafter, xgafter, x2+gafter, y2. then the rotation of the fall movement can be expressed by quaternion multiplication as (13)gafter=qgbeforeq=q3q2q1gbeforeq1q2q3, where q=q0-q1i -- q2j -- q3k- is the conjugate quaternion of q. quaternion algebra is normally implemented based on basic matrix algebra. quaternion multiplication used above could be realized by matrix multiplication as (14)qgbefore=mq0gbefore, xgbefore, ygbefore, z=q0q1q2q3q1q0q3q2q2q3q0q1q3q2q1q00gbefore, xgbefore, ygbefore, z. the whole rotation quaternion can also be decomposed as (15)q=q3q2q1=mq3mq2q1.q1, q2, and q3 are all available based on gravity information before and after the falling movement. at last, it is possible to get four elements of quaternion q by the equation above and the rotation angle could be calculated as (16)=2arctanq12+q22+q32q0. when an object is falling, magnitude of will approach 90 which is also a character different from most normal activities. the wearable device will be mounted on human's waist at first to reflect the motion of human body closely, and the device will record gbefore while the elderly is standing still. there is no special requirement of the device orientation but only keep stationary during the wear. athreshold means the threshold of sum acceleration magnitude and tthreshold means the threshold of oscillation time duration after the break of athreshold. when measurements in three different axes have been acquired, the sum acceleration |a| will be calculated. when a real fall happens, sum acceleration will reach peak value of |a| athreshold. in a real falling, the fluctuation of acceleration will stop in time duration tthreshold and then the sum acceleration is |a| g as the elderly will lie on the ground. then the acceleration a is recorded as gafter., the system will consider it as a fall if the rotation angle || 90. ti's 16 bits mcu msp430f1611 is used to control the whole system and imply the detection algorithm. the measurement range of accelerometer could be set at 2 g, 4 g, 8 g, or 16 g, and the maximal sampling rate is 3.2 khz. as human's activities are normally at low frequency bands, 100 hz is a proper sampling rate for human fall detection. there is an inner digital filter in adxl345 which could weaken noise and reduce the burden of digital signal processing in mcu to some extent. the measurements will be sent through iic (interintegrated circuit) bus communication between the sensor and the mcu. sim908 can offer gps and gsm service on serial port communication with mcu, and it can also work in low power mode. each hardware component of the wearable device is working under low voltage and the detection algorithm does not need complex calculation resource, so the power consumption of the whole device is quite low. a 1200 mah, 3.7 v polymer lithium battery is quite enough to provide the need of the wearable device for a couple of days. hardware structure of the detection device is shown in figure 6, and the pcb board prototype is shown in figure 7. one of them is the software design in wearable device, and the other is in the caregiver's handset. after initialization of the system, gbefore would be extracted from acceleration measurements by using a low pass filter when the elderly is standing. if a fall has been detected, the wearable device will locate the user and send alarm short message to caregivers immediately. if the user withdraws the alarm by pressing a button manually, the device will get back to fall detection state and a short message will be sent to inform the caregivers. there is a url (universal resource locator) which links to a web map in the alarm short message. the fall location information will be highlighted on a web map when the caregiver opens this link. system test of the fall detection system has been conducted based on the system design described above. the sampling rate of accelerometer is set at 100 hz and the measurement range is 16 g with a maximum precision of 4 mg. mcu will read raw measurements from sensor's inner fifo and apply the detection algorithm. the test objects are three different volunteers at the ages of 23, 42, and 60, respectively. based on analysis of these volunteers ' experiment data, athreshold and tthreshold are set as 2 g and 2 s, respectively. in order to get g when standing and lying after the fall, sum acceleration a which has magnitude between (1 0.3) g and (1+0.3) g will be considered as gbefore and gafter. considering that the tilt of the ground or the lying posture of the elderly may affect the rotation angle, rotation angle between (90 30) and (90+30) will infer that the elderly has fallen. system test contains five kinds of activities of daily living (i.e., walking, jumping, squatting, sitting, and resting) and four kinds of fallings (i.e., forward, backward, leftward, and rightward). each kind of motion has been repeated 20 times on each volunteer, and the detection results of the proposed algorithm and an acceleration threshold based algorithm are listed in table 1. the sensitivity and specificity [21, 22] of the proposed system can be got from the test data in table 1. test results of acceleration threshold based algorithm show lower sensitivity and specificity at 91.6% and 88.7%, respectively. figure 9 shows the accelerations in different kinds of fallings which all trigger the fall alarm correctly and the corresponding rotation angles are 91.9, 100.5, 104.7, and 114.1. figure 10 shows acceleration during activity of lying down and resting which has rotation angle of 117.0 and similar waveform to falling, but the peak acceleration is much lower. they all do not have rotation about 90; even some of the peak values are quite high, so the fall alarm has not been triggered. an alarm sms (short message service) containing a map url has been received by the handset as shown in figure 12 when a fall has been detected. clicking the url will open a map in web browser on which the fall location will be displayed accurately as shown in figure 13. this paper developed a fall detection system based on a single triaxial accelerometer based wearable device. there is no special requirement of the device's mounting orientation because the algorithm does not claim the axes of accelerometer to be fixed strictly. the system has low power consumed hardware design and highly efficient algorithm which could extend the service time of the wearable device. as normal activity of resting also has similar rotation as falling, it may trigger fall alarm when the body hits ground heavily. so the choice of athreshold is quite important to distinguish falling from heavily lying activity. sufficient sample number collected from subjects with different age and gender will improve the reliability and robustness of the threshold. beside these, technologies such as svm and neural network are considerable to seek out a proper classification method based on the features used in this system.

fall detection is a major challenge in the public healthcare domain, especially for the elderly as the decline of their physical fitness, and timely and reliable surveillance is necessary to mitigate the negative effects of falls. this paper develops a novel fall detection system based on a wearable device. the system monitors the movements of human body, recognizes a fall from normal daily activities by an effective quaternion algorithm, and automatically sends request for help to the caregivers with the patient's location.

PMC4346101

pubmed-148

one of the key challenges in the development of novel materials is the ability to tune and control their macroscopic physical and chemical properties on a molecular level by external stimuli. such a degree of control is challenging but crucial for a wide range of applications ranging from catalysis to pharmacological and medical applications. in photoactive materials light absorbed by chromophores can be converted into directed functionality, typically by means of photoinduced isomerization of nitrogen or carbon containing double bonds and pericylic reactions. indeed, e z isomerization results in large amplitude changes in structure as well as chemical and physical properties. molecular motors based on overcrowded alkenes are particularly attractive due to the synthetically tunable properties, such as thermal stability, absorption spectra, etc., and therefore are readily applied to a wide range of functional systems. however, although the thermally activated step in the unidirectional rotary cycle is well understood and is now largely predictable, the photochemical properties and especially photochemical quantum yields are less well understood. hence both from a fundamental perspective and in achieving the goal of complete molecular design, gaining insight into the excited-state properties of light driven molecular-sized machines is essential. the overcrowded alkene-based molecular rotary motors are composed of a central carbon carbon double bond (the axle) embedded in an intrinsically chiral environment. the unidirectional rotational cycle starts with a photoinduced e z isomerization around the central c=c bond, generating a metastable isomer p*(figure 1), which relaxes thermally to the stable isomer p, which in the case of a symmetric stator unit is identical to i. this isomer marks half of the rotation cycle and is the starting point for a second photoinduced isomerization step that leads again to a metastable isomer. thermally activated conformational isomerization of this isomer brings the system back to its initial state. overall, the rotor part has then performed a complete rotation with respect to the stator unit of the molecular motor. although the rotation includes both photochemical and thermal steps that involve different parts of the motor, the structural evolution is largely governed by the excited-state properties of the central c=c group, which, in turn, are dictated by the potential energy surfaces of the excited states that are accessed upon electronic excitation. despite the large number of theoretical and experimental studies that have focused on characterizing this process, there are several key questions outstanding including identification of the main structural coordinates and the role of various electronic states involved in the excited-state dynamics. time-resolved studies are essential to elucidate these dynamics but have thus far focused on probing the change in the electronic structure after photoexcitation through uv/vis absorption and fluorescence studies. these techniques offer a high time resolution but provide only indirect information as to how the structure evolves spatially over time. in the present contribution we show that this information can be obtained through a combination of picosecond time-resolved vibrational spectroscopy of the electronically excited states together with quantum-mechanical calculations. the setup for the time-resolved infrared measurements has been described in detail previously. mid-ir probe pulses were generated using an amplified ti: sapphire system (spectra-physics hurricane, 600 j, repetition rate 1 khz) pumping a commercial bbo-based opa (spectra-physics opa-800c), the signal and idler output of which were difference-frequency-mixed in aggas2. uv pump pulses (400 nm, 1 j) were generated by doubling part of the output of the ti: sapphire laser. the diameter of the uv pump focus was 180200 m; that of the ir probe focus, 150 m. the sample cell with caf2 windows spaced by 500 m was placed in the ir focus. to avoid accumulation of the thermally unstable conformer p*during the measurements, the pump probe delay time was scanned by mechanically adjusting the beam path of the uv pump. the temporal resolution of 200 fs has been determined from the full width at half-maximum of the pump probe cross-correlation function. the pump pulse was chopped at 500 hz, and transient spectra were obtained by subtracting nonpumped absorption spectra from the pumped absorption spectra, both of which were recorded by spectrally dispersing the probe pulses using an oriel ms260i spectrograph and measuring the frequency-dependent ir intensity using a 2 32 hgcdte detector array (infrared associates). compound i was available from earlier studies (see ref (44)). in all experiments we investigate a 10 mm solution of compound i in deuterated cyclohexane (aldrich, 99.6 atom% d). for the investigation of the ground-state conformers (including vertical excitation energies and forces acting at the franck condon point) quantum mechanical calculations were performed using the turbomole suite of programs. geometry optimization and normal-mode analysis were performed by (time-dependent) density functional theory (( td)-dft) using the hybrid functional b3lyp. for the geometry optimization the d3 correction method of grimme et al. the cc-pvdz or aug-cc-pvdz basis sets were employed, respectively. post-hartree fock calculations were performed on the basis of spin-component scaled second-order mller plesset perturbation theory and the approximate coupled-cluster singles-and-doubles model cc2. all perturbation method calculations were performed using the resolution of identity (ri) approximation and the efficient ricc2 module implemented in the turbomole package together with the standard auxiliary basis sets. the gaussian09 program package was employed to study the excited-state properties in more detail and in particular to optimize the structure of the dark-state species. geometry optimization and normal-mode analysis were performed in the framework of td-dft at the b3lyp/cc-pvdz level. the structural evolution from the initial state i to isomer p* (figure 1) was considered first in terms of the spectral properties of the initial state and the first metastable product (p *). the steady-state uv/vis absorption spectra of the two isomers are distinct, reflecting a change in the conjugated system (figure 1a). the ftir spectra of the two isomers (figure 1c) show that the carbon carbon stretch and ring vibrations couple to a large degree as a consequence of the extended system; however, dft calculations enable us to assign the bands in the 15501650 cm range as being mainly associated with modes involving the central c=c double bond (supporting information). the metastable isomer p*shows a shift of these modes to lower frequencies confirming a decrease in bond strength. comparison of the optimized geometries of the two isomers (i (p *), cc bond length 1.369 (1.377); cc=cc dihedral angle 14.1 (29.5)) evidence the corresponding lower bond character as well. unidirectional motion of the unidirectional motor starting from the thermally stable conformer (i) via the product of the photoinitiated step (p *) to the thermally stable conformer (p) (optimized geometries on the b3lyp+d/aug-cc-pvdz level): (a) experimental and calculated (light color and dotted line) uv vis spectra of conformer i and p *; (b) molecular orbitals of the initial conformer; (c) experimental and calculated ir spectra (b3lyp+d/aug-cc-pvdz) of the initial state (blue) and final state (red). in both the measured uv/vis absorption and ftir spectra at the photostationary state (pss), i and p*are present in a 25:75 ratio. time-resolved vibrational spectroscopy was employed to achieve the required temporal resolution as well as structural sensitivity to elucidate the structural evolution that follows photoexcitation with a short uv-pump pulse (center wavelength 400 nm). the resulting structural evolution was followed by time-resolved differential absorption spectra in cyclohexane-d12 with a time resolution of 200 fs (figure 2). the transient ir spectra show, as expected, pronounced differences between the ir absorption spectrum of the molecule in the initial and excited states. a first point of note is that the spectrum does not evolve further after ca. 30 ps, and the difference spectrum corresponds perfectly with the difference spectrum obtained upon continuous wave excitation (figure 1); i.e., the metastable isomer p*has formed fully within the 30 ps after excitation. ftir and time-resolved infrared spectra of the molecular motor in cyclohexane-d12: (a) ftir spectra of the thermal stable conformer (initial, solvent corrected, top), uv-ump/ir-probe transient infrared spectra (uv=400 nm) (middle), and difference ftir spectra between the two ground-state conformers of the molecular motor; (b) kinetics of selected bands and corresponding results of the global fit; (c) species associated spectra (sas) of species 1 and calculated ir spectra (top) and sas of the pss (sp3) together with ftir spectra (bottom). negative bands indicate ground-state bleaching, and positive bands, species created after excitation. the time-resolved ir spectra obtained within the first 30 ps exhibit several remarkable features. the first and most striking is a broad and unstructured absorption over the entire mid-ir range (12003000 cm). this absorption, which decays rapidly, is particularly prominent at early time delays (< 5 ps). individual absorption bands with remarkably high integrated intensities in the 14001600 cm range are superimposed on the broad spectral feature. notably, these bands are significantly broader than the bleached bands in the transient spectra and bands in the ftir spectra. the solvent response and the dependence of the uv pump intensity (supporting information) confirm that these features are intrinsic to the compound and are not due to solvent or two-photon processes. the width and intensity of the broad excited-state absorption bands excludes that they arise from vibrational transitions. indeed, the absorbance is closer to that expected for electronic transitions, albeit these typically occur at much higher energies (in the uv/vis range). the initial state of the compound (i) shows an absorption band at 390 nm (figure 1), which is reproduced well by b3lyp/cc-pvdz calculations in the gas phase (403 nm; f=0.428). the s1 s0 transition has predominantly homo lumo character (figure 1). in contrast to previous assignments, however, we find that this electronic transition is not localized on the stator but involves to a significant extent excitation from the bonding orbital of the central double bond to the antibonding *orbital (figure 1). as a consequence, the double bond character of this bond is reduced as well as the barrier to rotation around this bond. in line with calculations on ethylene and its derivatives, we find a dark state (s2) associated with the homo1 lumo excitation at slightly higher excitation energies that is not directly accessible from the ground state (figure 1, table 1). because the homo1 orbital is localized on the aromatic stator unit, s2 has a significantly larger dipole moment than s1 (4.3 vs 2.2 d at the scs-cc2/cc-pvdz level). it should be emphasized that the description of the lower-lying electronic states in the compound studied here is thus entirely different from ethylene and its derivatives where, as discussed by salem and others, for torsion angles of around 90 the two low-lying electronic states have either a biradical or zwitterionic character depending on the occupation of the two central 2p-orbitals and require multireference methods for a proper description. in the present study, in contrast, we investigate the dynamics occurring at small torsional angles (vide infra) for which the employed single-reference methods not only have been validated. in addition we employ the results of multireference calculations on smaller motor molecules as reported by liu and morokuma to make a further comparison with our experimental results. for s0 the optimized structure on the b3lyp+d/aug-cc-pvdz level was used to calculate the vertical excitation energies. for vertical excitation they thus strongly suggest that the broad and structureless absorption feature observed in the time-resolved ir spectra is associated with the electronic s1 s2 transition. the presence of two close-lying states also explains why the induced absorption bands have such high intensities. our calculations show that the energy gap between the two states strongly depends on structural parameters such as the c=c bond length that are involved in the 14001600 cm normal modes. for these modes one therefore expects that their transition moments will be enhanced by vibronic coupling as is indeed observed. the conclusion that the excited-state dynamics of the molecular rotor should be described in a multistate model is further supported by recent multireference calculations on smaller rotor molecules that also find very small energy differences between the s1 and s2 states. the excited-state dynamics were elucidated further using a global analysis of the transient spectra, which shows that the spectra can be described well with two exponential decay terms with time constants of 1.53 0.03 and 12 1 ps. we note that our experiments have a time resolution of 150200 fs and therefore do not allow observation and confirmation of the ultrafast dynamics reported previously in fluorescence-upconversion studies. species-associated spectra (sas) (supplementary figure 2) were derived by using a two-step sequential kinetic model. the sas of the first species shows an overall background signal with broad and intense features superimposed on it that indicate vibronic coupling. furthermore, the increase (decrease) of absorbance in the 1550 (1600) cm region indicates a substantial change in bond character of the central double bond (figure 2c). this spectrum was related to the structure of this excited-state species using excited-state geometry optimizations. state without any structural constrains associated with the homo1 lumo excitation leads to a stable minimum that can be reached from the franck condon excited geometry by relatively small structural changes (supplementary figure 4), and an excited-state ir absorption spectrum that is in good agreement with the sas of species 1 (figure 2). it is notable that for a proper comparison with the experimental spectrum, the theoretically predicted stick spectrum needs to be convolved with 20 cm gaussian line shapes, suggesting that in the dark state a wide range of structures is sampled. our experiments and calculations thus demonstrate that excitation and excited-state decay involve two different electronic states. in earlier studies, time-resolved fluorescence and visible absorption data were interpreted in terms of a decay from a single, isolated electronic state decaying to the ground state after structural relaxation in the excited state. the present data show that the s1 state actually decays to an intermediate, dark electronic state, and from there to the ground state. in the sas of the second species (supplementary figure 2) the broad background is absent, and bands have widths comparable to those in the s0 state. the absence of the broad background indicates that this species is no longer in an electronically excited state but back in the (vibrationally hot) electronic ground state. indeed, the vibrational activity observed in the 1550 cm region follows closely the ir absorption spectrum of p*. in addition, repopulation of the original state (i) is observed also (i.e. the quantum yield for isomerization is less than unity), and the sas of the second species contains contributions from both vibrationally hot ground-state i and metastable p*isomers. vibrational cooling of these isomers leads to the sas of the final species, which is in excellent agreement with the steady-state ftir difference spectrum of room-temperature i and p*. the present experimental and theoretical data allow a complete picture of the mechanism by which the molecular rotary motor undergoes isomerization after electronic excitation (figure 3). photon absorption brings the motor to a bright state from which it decays on an ultrafast time scale and within the time resolution of the present experiments to a different electronically excited dark state. in line with previous calculations on similar systems, our calculations indicate that this is a barrierless process proceeding via a conical intersection. previously, it was assumed that structural evolution on the homo lumo potential energy surface is responsible for the observed ultrafast decay of the fluorescence, and (following commonly accepted models on photoisomerization of carbon carbon double bonds) that it primarily proceeds along torsional and pyramidalization coordinates. the present study, in contrast, leads to the conclusion that the fluorescence decay is mediated by the passage through the conical intersection of the homo lumo and homo1 lumo potential energy surfaces. inspection of the structural changes that occur upon geometry relaxation to the minimum on the homo1 lumo potential energy surface show that the central c=c bond length increases from 1.381 to 1.461 and that only relatively small changes occur in the torsional and pyramidalization coordinates. in combination with the forces that act on the molecule at the franck condon excited bright state (supplementary figure 3), this suggests that motion along the c=c stretch coordinate needs to be taken into account as well for understanding the decay of the fluorescence. proposed multistate dynamics of the photoinduced unidirectional rotation of the molecular motor starting from conformer i to conformer p*(projected into one dimension): dotted arrow, ultrafast process reported in previous work; fast (red arrow) and slow process (blue arrow) observed in the present time-resolved infrared study. (a) calculated energy profile along the torsion coordinate showing how the energies of the electronic states change as the molecules evolves to conformer p*. (b) schematic representation of the proposed model. hence, it can be concluded that internal conversion to the electronic ground state takes place from the dark state. the decay rate for this process indicates that it is mediated by conical intersections between the two states as has indeed been proposed in previous theoretical studies. these studies concluded, however, as well that to reach these intersections a barrier needs to be overcome that results from the steric repulsion of the methyl group of the rotor unit with the hydrogen of the stator unit. previous time-resolved fluorescence measurements reported an ultrafast damping mode at 113 cm that was speculated to arise from motion along a coordinate involving inversion/pyramidalization although no direct support could be found for such an assignment. interestingly, our calculations find in the dark state a mode at 119 cm (b3lyp/cc-pvdz; not scaled, supporting information) that involves motion of the methyl group with respect to the hydrogen of the stator unit. one might therefore wonder to what extent this mode is related to the oscillatory behavior of the fluorescence. our observed s2 decay constant of 1.5 ps matches the slow component of the overall fluorescence decay (0.91.5 ps). our calculation of the excitation energies of the bright and dark states along the 119 cm normal mode did not show a conical intersection between the two states, supporting the previous explanation of the oscillations observed in the fluorescence measurements by the movement of wave packets and suggesting a scenario in which a coherent oscillation in the dark s2 state periodically partly repopulates the fluorescent s1 state. however, our experimental methods do not provide the time resolution to confirm this. the photodynamics of a unidirectional molecular motor has been studied by time-resolved ir spectroscopy in which both vibrational and electronic structures are probed. in combination with quantum mechanical calculations, the high structural sensitivity and real-time character of the technique allows us to understand fundamental aspects of the operation mechanism. the results show that conversion of photon energy into directed motion proceeds on the potential energy surfaces of two different electronic states, which is the more important as it implies that the conical intersection between the dark electronically excited state and the ground state determines the efficiency of the motor. to rationally tune the performance of photoinitiated unidirectional rotation thus involves a multicoupled-state optimization of nuclear motion.

controlling the excited-state properties of light driven molecular machines is crucial to achieving high efficiency and directed functionality. a key challenge in achieving control lies in unravelling the complex photodynamics and especially in identifying the role played by dark states. here we use the structure sensitivity and high time resolution of uv-pump/ir-probe spectroscopy to build a detailed and comprehensive model of the structural evolution of light driven molecular rotors. the photodynamics of these chiral overcrowded alkene derivatives are determined by two close-lying excited electronic states. the potential energy landscape of these bright and dark states gives rise to a broad excited-state electronic absorption band over the entire mid-ir range that is probed for the first time and modeled by quantum mechanical calculations. the transient ir vibrational fingerprints observed in our studies allow for an unambiguous identification of the identity of the dark electronic excited state from which the photon s energy is converted into motion, and thereby pave the way for tuning the quantum yield of future molecular rotors based on this structural motif.

PMC5098230

pubmed-149

the patellofemoral joint is one of the most common sources of knee pain in younger people. maltracking and instability of the patellofemoral joint are responsible for the majority of symptoms and are associated with the development and progression of osteoarthritis1). the position of the patella relative to the trochlea of the femur is not fixed and changes as the knee moves from extension to flexion. differences in the morphology of the patellofemoral joint have been shown to be associated with altered kinematics and patellofemoral instability29). a variety of measurements have been described to identify abnormalities of the patellofemoral joint. on a lateral radiograph, or a sagittal magnetic resonance imaging (mri) scan, the insall-salvati index10) is measured to assess patella height by comparing the length of the patellar tendon with the length of the patella. the caton-deschamps index11) can also be used to determine patellar height and is calculated by comparing the length of the patellar articular surface with the distance from the postero-inferior border of the patellar and the anterior edge of the tibial plateau. on the axial view, the bisect offset can be used to assess medial or lateral displacement of the patella. patellar tilt is also assessed on the axial view and is normally 05 relative to a line connecting the posterior femoral condyles. the position of the knee and its weight bearing status have been shown to influence patellofemoral kinematics and measurement of patellofemoral indices1215). mri is commonly used in the investigation of patellofemoral pain and instability and in many cases is the investigation of choice in preference to plain radiography. mri provides additional information compared to radiographs, such as the condition of the articular surfaces, integrity of ligamentous stabilising structures (e.g. the medial patellofemoral ligament), and rotational alignment (tibial tuberosity trochlear groove), and facilitates better evaluation of trochlear dysplasia5,1620). whilst the patellofemoral indices described above were originally designed for radiographic measurements, they have been applied to mri which has been shown to be an excellent imaging modality for evaluating the patellofemoral joint with good correlation with plain radiographs2124). mri is usually taken with the patient in supine position and the knee in extension1,21). it has been demonstrated that patellofemoral instability typically manifests during the terminal 30 of knee extension with contraction of the quadriceps femoris muscle14). undergoing an mri scan can be an intimidating experience for patients, particularly those prone to claustrophobia25,26). such patients are likely to be anxious and tense during the scan and may inadvertently contract their quadriceps. this quadriceps contraction may alter the relationship of the patella to the femur, overestimating the degree of instability that may be present. the objective of our study was to determine the impact of knee position and quadriceps contraction on patellofemoral indices measured on mri. twenty patients undergoing mri scan of the knee were identified from a pool of referrals to the orthopaedic department at our institution. patients were selected based on the absence of patellar or patellofemoral symptoms documented in the clinical notes or on the mri request. inclusion criteria were 2540 years of age, a body mass index less than 30, a clinical diagnosis of non-patellar or patellofemoral pathology. exclusion criteria were known or suspected patellar or patellofemoral conditions, connective tissue disorders that could cause hyperlaxity, and previous surgery or injury to the knee. axial and sagittal mri sequences were performed with the knee fully extended and quadriceps contracted; knee fully extended and quadriceps relaxed; knee flexed 30 with quadriceps contracted; and knee flexed 30 with quadriceps relaxed. a triangular wedge was placed under the patient s knee to reproducibly create 30 of flexion. when quadriceps contraction was required, subjects were given a rest period between mri sequences to prevent muscle fatigue. bisect offset27) and patellar tilt angle28) were measured on axial mri images using the slice showing the widest view of the patella. the insall-salvati index and caton-deschamps index were measured on the sagittal view using the slice showing the widest view of the patella. 1) was determined by drawing a line connecting the posterior femoral condyles and a perpendicular line was then drawn through the deepest point of the trochlea groove to where it intersects the patellar width line. in cases where the trochlea was flattened, the bisect offset is defined as the proportion of the patella lying lateral to the midline as a percentage of the whole patellar width. patellar tilt was defined as the angle between a line connecting the posterior femoral condyles and the maximum patellar width (fig. the insall-salvati ratio was determined by comparing the length of the patellar tendon with the length of the patella. the caton-deschamps index was defined as the ratio of the distance between the lower edge of the patellar joint surface and the upper edge of the tibial plateau to the length of the patellar articular surface (fig. the student t-test (unpaired) was used to compare the difference between these values in the various states of knee flexion and quadriceps contraction. all 20 patients were assessed with the knee in extension and flexion, with and without quadriceps contraction. the mean values of the patellar tilt, bisect offset, insall-salvati ratio and caton-deschamps index of the patients are detailed in table 1. the mean patella tilt averaged 9 with the knee flexed and quadriceps in any state. patella tilt increased but remained within normal limits with the knee extended and quadriceps relaxed. however, when the quadriceps was contracted with the knee in extension, the mean patella tilt was 14.6, the upper limit of the normal range. the mean difference in patella tilt from the flexed, relaxed positon to the extended, contracted position was 5.6 (range, 9.8 to+25.9), but this did not reach statistical significance (p=0.06). the mean bisect offset angle in the flexed position increased from a normal range of 56% and 57% when the quadriceps were relaxed or contracted, respectively, to an abnormal value of 65% with the knee extended and quadriceps contracted (p=0.012). there were four patients who demonstrated normal patella tilt and bisect offset with the knee flexed and quadriceps relaxed, but abnormally high tilt and bisect offset were observed with the knee extended and quadriceps contracted. the mean values of the caton-deschamps index were within the normal range with knee flexed but were abnormally elevated with the knee extended, both with the quadriceps relaxed and contracted. the difference between the flexed relaxed position and extended contracted position was 0.05 (range, 0.15 to+0.31), which did not reach statistical significance (p=0.34). the mean values of the insall-salvati ratio were normal in all combinations of knee position and quadriceps contraction. the change in the insall-salvati ratio from the flexed, relaxed state to the extended, contracted state was 0.07 (range, 0.17 to+0.11), which was not statistically significant (p=0.97). mri evaluation of the knee forms an integral part of the investigation of young patients with knee pain. the patella begins to engage the trochlea during knee flexion, and patellofemoral instability typically manifests during the terminal 30 of knee extension. in the clinical setting of patellofemoral disorders, mri can provide useful information about the bony morphology of the femur and patella as well as the condition of the articular cartilage. numerous patellofemoral measurements or indices have been described to quantify abnormalities of the patellofemoral joint. many of these measurements were originally described on plain radiographs and their use has been extended to mri. they can be of some value when deciding on the most appropriate management for patients with patellofemoral symptoms. significant differences in these measurements exist between patients with patellofemoral instability and asymptomatic patients3,6). quadriceps contraction and weight bearing have been shown to alter patellar height and patellofemoral kinematics1215,29,30). for the majority of patients, mri of the knee is performed with the knee extended. patients undergoing mri scanning of the knee may be anxious and as a result involuntarily contract their quadriceps. this has the potential to lead to inappropriate management decisions or unnecessary surgery. in our study, we aimed to assess the influence of knee position and quadriceps activity on frequently measured patellofemoral indices. in our cohort of patients, none of whom had patellofemoral symptoms, an increase in the measured patellofemoral indices was observed with the knee extended and quadriceps contracted. the mean values of these indices increased above the normally accepted range in some cases with the knee in this position. in the case of the bisect this suggests that the flexed position protects against erroneous or exaggerated patellofemoral measurements caused by inadvertent quadriceps contraction as well as trochlea engagement. thus, it is important that potential confounders (e.g. quadriceps contraction and knee extension) are minimised in order to achieve more reliable measurements upon which surgical decision-making is based. we, therefore, recommend, when investigating patients with suspected patellofemoral pathology, mri of the knee should be performed in 30 of flexion to obtain a more accurate view of the patellofemoral joint and avoid the confounding effects of quadriceps contraction. patellofemoral indices measured on mri are affected by the position of the knee and quadriceps muscle activity. with the knee in extension and the quadriceps contracted, as may occur in an anxious patient, there was a tendency towards abnormal patellofemoral measurements in our cohort of asymptomatic patients. performing mri of the knee in 30 of flexion helps to reduce the confounding effect of quadriceps contraction and may result in more reliable radiological assessment of the patellofemoral joint.

purposethe purpose of this study was to investigate the impact of varying knee flexion and quadriceps activity on patellofemoral indices measured on magnetic resonance imaging (mri). materials and methodsmri of the knee was performed in 20 patients for indications other than patellar or patellofemoral pathology. axial and sagittal sequences were performed in full extension of the knee with the quadriceps relaxed, full extension of the knee with the quadriceps contracted, 30 flexion of the knee with the quadriceps relaxed, and 30 flexion with the quadriceps contracted. bisect offset, patella tilt angle, insall-salvati ratio and caton-deschamps index were measured. resultswith the knee flexed to 30 and quadriceps relaxed, the mean values of patellar tilt angle, bisect offset, insall-salvati ratio and caton-deschamps index were all within normal limits. with the knee extended and quadriceps contracted, the mean patellar tilt angle (normal value,<15) was 14.6 and the bisect offset (normal value,<65%) was 65%, while the caton-deschamps index was 1.34 (normal range, 0.6 to 1.3). with the knee extended and quadriceps relaxed, the mean caton-deschamps index was 1.31. conclusionsmri scanning of the knee in extension with the quadriceps contracted leads to elevated patellofemoral indices. mri taken with the knee in 30 of flexion allows more reliable assessment of the patellofemoral joint and minimises the confounding effect of quadriceps contraction.

PMC5134784

pubmed-150

the knowledge of mechanical materials behaviour is of great importance particularly for some innovative engineering applications, which involve a single material, bimaterials, or multiple materials. some bimaterials are obtained by means of a coating process and consist of coupled layers that may or may not contain filler elements, such as a foaming operation, or may be developed as welded substrates. usually, at the end of the process, the material is identified as a new single material. the coating procedure developed and studied in this work refers to the hot-dip galvanizing treatment, considered as a better treatment to fight against corrosion. the role of a hot-dip galvanizing treatment consists in the deposition of a protective external layer of metallic zinc obtained by immersing the steel in a zinc bath at a temperature of around 460c. when the material (i.e., steel) is introduced into the zinc bath and then removed, several changes in the chemical composition and in the mechanical structure can occur. these changes produce a new structural arrangement on zinc substrate and are usually revealed by the generation of cracks in the zinc layer. the behaviour of materials may change as a result of various events such as fatigue, fracture, wear, fretting fatigue, creep, hydrogen embrittlement, thermal shock processes, or atmospheric attacks. an important role in these failure processes is played by any discontinuity in the material that can appear during the manufacturing process or during working period, or as a result of inappropriate use. in our case it appears as a consequence of the hot-dip galvanizing treatment applied as described above in association with the action of the mechanical loading. recently, krishnan and xu focused on failure mechanics of adhesive joints (i.e., considered as bimaterials) using a fringe pattern concentrations technique to describe the bimaterials interface. as analytical model, they used the fracture mechanics approach, while to compute the stress singularity in the bimaterial layer they took into account the stress intensity factor in mode i. the formula used to express this stress intensity factor is (1)ki=rekai, where k is the stress intensity factor in the case of the bimaterial component: (2)k=ytaaiei, where t=p(3s/w) and y, are the calibrating factors that depend on a/w, b/w, respectively, dundurs ' parameters. then a, b, and w represent the length of the possible crack, the thickness, and the length of the specimen. is a function of dundurs ' parameters,, and is presented as (3)=12ln11+, where, dundurs ' parameters material, is expressed by (4)=112221211122+2121 in which 1 and 2 denote the material, while and are the shear modulus and poisson's ratio, respectively. the elastic fracture theory is a suitable tool to compute the mechanical behaviour in case of coatings, composites, and welded structures. the bimaterial produced by the reactions that occur during the hot-dip galvanized steel process must have the same conditions on the contact surface as the linear spring-like model. the discontinuity of displacement across the interface is assumed to be linearly proportional to the displacement at the interface of the constituent where the stress source is located. the present authors agree that the two materials that form the bimaterial should be considered as a functionally autonomous subsystem with a different young's modulus and poisson's coefficients. this implies a strain incompatibility between the two solids and the formation of a periodic distribution of tensile and compressive stress in checkerboard patterns under the uniaxial tensile test. a robust approach was proposed by yu et al. in order to formulate analytical solutions through the use of linear spring-like model. according to this theory we can define the type of contact between the surfaces by the fraction of the adherent area, applying the following formula: (5)=aacac, where is used to quantify the extent of bonding at the interface, a is the total area of the interface, and ac is the area covered by paper (see example on figure 2 from). according to the study made by panin et al., the interface of solid materials covers a sinusoidal surface layer due to a rotation of successive constraints in tensile and compression stress in the structure. this effect is described by the following equation: (6)=aysinxlxt2, where t is the thickness of the coating, x is the distance of crack propagation, y is the stress coefficient. this paper addresses two goals: first of all, to experimentally characterize the layer of zinc applied during the hot-dip galvanization process, in order to obtain necessary information about the uniformity of the zinc layer and the number of cracks and their length, and finally to estimate the behaviour of the cracks located in zinc layer when the mechanical loading is imposed. secondly, we proposed to corroborate the experimental results with analytical and numerical computations, ascertaining where the crack discontinuities spread while considering the three main possibilities of crack development: arrest at the bimaterial interface, crossing into the second material, in our case steel, and finally creating a deflection between the two materials. in the literature k. m. mrz and z. mrz predicted the behaviour of bi- and multimaterial interfaces according to a simplified approach using the mk-criterion based on the linear elastic fracture mechanics (lefm). in this criterion it is assumed that the crack growth follows the direction of minimum distortion energy density at a distance corresponding to a specified value of dilatation energy. figure 2 shows a specific case in which the crack is considered to propagate perpendicularly to the interlayer and make a bifurcation at the interface. the decohesion phase may present as one of the four possible scenarios whereby the crack will propagate as follows: (i) the plastically weaker material (wm) to the plastically stronger material (sm), wm-sm, (ii) the plastically weaker material (wm) to the plastically stronger interlayer (si), wm-si, (iii) the plastically stronger material (sm) to the plastically weaker material (wm), sm-wm, and (iv) the plastically stronger material (sm) to the plastically weaker interlayer (wi), sm-wi. in simple terms, the criterion for crack initiation and propagation along the interface could be considered, where the maximum stress, max, is expressed as (7)max=x+y2+x+y22+xy. to solve the problem of deflection at the interface of two materials, hutchinson proposed the following condition: (8)gcgc1<gdgp1, where g=gc represents release energy rate of the interface bimaterial. studies, related to the problem of cracks running perpendicular to a bimaterial, yields a different expression for the stress intensity factor that is connected to the stress tensor as follows: (9)ij=kr1fij. to determine the propagation energy of the crack running perpendicular to the interface, also called energy release rate, the following equation studied by madani et al. can be applied: (10)gd=(11)/1+(11)/24cosh2k12+k22gp=1222kp2. in (8), (10) gd and gp are the strain energy release rate for deflection and penetration; k1 and k2 are the stress intensity factors for the interface crack; kp is the value of stress intensity factor, for a particular case, when the crack from material 1 penetrates into material 2 (see figure 2). analytical techniques and the green function can be employed to describe the behaviour of bimaterial compounds by calculating numerical solutions of singular integral equations, as was applied by erdogan et al. and used by pruncu et al. and azari et al., which yield the following expression: (11)ki(a)=211+k1a0g(1)kib=211+k1a0g1. a more general form of such approach could be structured using an algorithm that describes the numerical procedure for obtaining the different values of the function g(ti) by the following. (2) for k ranging from 1 to n, we need a computing route for xk and f(xk). (3) for every xk and for i variants from 1 to (n 1), we have to calculate the first ti that is a weight function of the jacobi polynomials described as follows: (12)1ng(ti)1tixk+k(xk, ti)=0 withti=cos2i12n, i=1, ,nxk=coskn, k=1, ,n1. (4) the computation then yields a matrix relationship expressed as follows:(13)1t1x1+k(x1,t1)1t2x1+k(x1,t2) .... 1tnx1+k(x1,tn) .............................. 1t1xk+k(xk, t1)1t2xk+k(xk, t2) .... 1tnxk+k(xk, tn)gt1gt2 .... gtn=fx1fx2 .... fxk. g are obtained by multiplying the transposed of the matrix by the vector f(xi). one has the following: a0 is half-length of the crack; 1, 2 are shear modulus for materials 1 and 2; c is the distance from the middle of the crack at the interface plane; r, are polar coordinates, k=3 4 for the plane strain case and k=(3)/(1 +) for the plane stress case, is poisson coefficient, and g is the parameter that expresses the magnitude of the applied load. another analytical technique, which was employed by chen et al. using complex potential values, was obtained in the following manner: (14)ki(b)=limr02rx=22k2+1a0m=11mmki(a)=22k2+1a0m=1m, where a0 is half-length of the crack, m=m/b, m=0,1, 2,3,, b is the distance between the interface and the crack front, x is the distribution of stress in front of the crack, k=3 4 for the plane strain case and k=(3 4)(1 +) for the plane stress case, and 2 is shear modulus for the material in which the crack is located. because of its multiple properties, steel is one of the most versatile materials used in industrial engineering applications. the european standard (en) reveals different types of steel employed in fields such as the automotive industry and aeronautical design. in this work we considered two steel alloys: he360dr and s420mc. their mechanical characteristics are summarized in table 1. during the lifetime of service, in contact with the environment this metal may develop problems that could be prevented by applying the above-described process of hot-dip galvanization. the specimens obtained after hot-dip galvanization were submitted in laboratory to fatigue tensile test in order to detect their behaviour under fatigue conditions conforming to real life and to observe the changes that occurred in the metallic zinc layer. the fatigue tests were performed on a servohydraulic testing machine capable of applying axial loads up to 100 kn, using a sinusoidal load wave, with a frequency of 30 hz and a strength ratio r=0.1. after the fatigue test the specimens were experimentally analysed by optical microscopy and scanning electron microscopy (sem). during observation with the optical microscope, a sample of length 5328 m was considered. to simplify the management of these optical microscope observations, we divided the sample size into 16 units with a length of about 333 m. the main purpose of this was to analyse (i) the number of cracks per unit of length; (ii) whether the evolution of the number of cracks was constant over all layers applied; (iii) which material was prone to develop longer cracks, and finally if the zinc layer was constant over the whole steel surface. the first result was the average number of cracks per unit of length, as summarized in table 2. the letters b and h in table 2 indicate the time of immersion in the zinc bath, b being 3 minutes of immersion and h 7 minutes. the numbers 9, 8, 7, and 2 indicate the specimen number analysed. from table 2 we can observe that the average number of cracks per unit of length is about 6/11 for he360dr and 7/8 for s420mc. a first remark proves that the number of cracks increases with the time of immersion. the results are plotted in figure 3 and highlight the number of cracks for all 16 units of length. figure 3 shows that the number of cracks on the entire length of zinc layer that encloses each unit is overall scattered; however, on the local case of two/three consecutive units, the number of cracks per unit seems to be almost uniformly distributed. a key element for determination of the efficiency of the coating process may be deduced from the evolution of cracks lengths before and after the fatigue tests. according to the observations shown in figure 4, there was a significant change of crack length as a consequence of fatigue test. a gap of about 25 m in crack length before and after cyclic load was found due to the weakened structure of material. this observation was done in a useful sample area (ua) and then in the area where the test had less influence on the behaviour of the piece, marked as the nonuseful area (nua). the uniformity of the zinc layer was considered as another issue that can stimulate the crack behaviour., the zinc layer deposited over the steel alloy is uniformly distributed, having a value of 5080 m. the particularity of the size of substrate of he360dr h8 materials, that is, the thin thickness, may be explained as a consequence of immersion time. so, because the time of immersion within the bath of zinc was less than the time imposed by our methodology, the thickness of substrate was lower; this means that instead of 7 minutes we found that the real time of immersion was about 5 minutes. the optical measurements confirmed that the thickness deposited over the steel pieces was uniform and show that the zinc layer is composed of several multilayers. the substrates are denominated by gamma (), delta (), zeta (), and zinc eta (), as shown in figure 6. figure 6 proves that most of the cracks are located in substrate and may occur along the zinc grain boundaries. indeed, from our observations these cracks arise in this substrate and then spread toward the steel-zinc interface. however, the analysis indicates a decrease of the crack magnitude near the interface, which means the crack growth is interrupted before it reaches the interface. observations from scanning electron microscopy (sem) exhibit even more clearly that, during the hot-dip galvanized process (hdg), the quality of the bonded layers may influence the direction of the cracks, if the cracks touch the steel-zinc interface. this troublesome problem produces a sort of debonding area which forms a path for surface deflection of the cracks. the debonding area in steel-zinc adhesive layers is illustrated in figure 7, created by the propagation of cracks at the interface between the zinc and steel and into the zinc substrates zeta () and eta (). for bimaterials, the interface crack problems could be due to the nonhomogeneity of the materials, which develop in the direction parallel to the crack tip. from these preliminary findings we could confirm that during the hdg process the zinc layer is uniformly deposited and the average number of cracks is significant on this layer. it seems that during the fatigue process the cracks get longer and spread toward the bonding interface, arresting at the bimaterial interface. in the worst scenario, numerical computational technique was implemented by abaqus software, in order to corroborate the experimental data with analytical and numerical simulations and to highlight the effects of cracks that develop during the hot-dip galvanizing process. in order to implement the experimental data in the numerical model, besides, this value corresponds with the thickness measured under the s420mc h2 materials (see figure 5), and it allows making the assumption that the crack/cracks imposed in our models will spread only toward the interface steel/zinc. if we consider a smaller thickness, for example, the size of layer measured under he360dr b9 material, and we adopt in the numerical model the critical size of crack detected after the loading test (see figure 4), it will be obvious that the crack will cross all the coating substrate. but this issue is far from our experimental observation, since we had observed that the crack growth is only toward interface steel/zinc. experimental data were introduced in our numerical model as the thickness size of zinc layer (figure 5), while the contour of zinc layer on the entire material surface is considered homogenous and uniform (figure 5). an initial length of crack and the maximum length of crack (see figure 4) were imposed as constraint in the numerical program. the principles of linear fracture mechanics (lfm) were implemented in the numerical model in order to explain behaviour of crack at the interface steel/zinc that is assuming that all the materials contain a minimum flow that will grow during the mechanical loading. so, considering the crack located in zinc substrate (figure 5) that will develop perpendicular to the applied load, it is possible to denote this state by mode i fracture. it should be noted that in the numerical model a mechanical loading of 500 mpa corresponding to an average of ultimate tensile strength of galvanized materials (see table 1) was imposed. a value of about 30 m was selected as the initial length of the crack/cracks before propagation, in agreement with experimental data (figure 4). however, we know that the crack is bounded by two fronts, a and b. in this model, we assumed that the front of crack b was static and so it could not propagate, whereas the only front of crack a would spread. a basic model composed of two materials, m1 and m2, as shown in figure 8(a), which forms the bimaterial body, was implemented. m2 represents the steel and m1 the zinc layer, delimited by the following values: h1=0.08 mm, h2=19.84 mm, c=0.045 mm, w=15 mm, 2a0=0.030 mm, and =0.5 m and submitted to a mechanical load, =500 mpa. the applied load in this system will have direct consequence to the crack behaviour and define the presence of stress singularity on both fronts of the crack, tips a and b. the configuration for the crack fronts is shown in figure 8(b). settlement of the crack propagates performance was evaluated using the stress intensity factor (sif) parameter, derived from the singularity 1/r advanced in front of the crack tip. since the value of the stress intensity factor (sif) is obtained, we proceed to conclude if the crack crosses into the second material, ends at the bonded interface, or deflects between these two bodies. (a) model with one crack in the bimaterial: in this case one single crack of an initial size of 30 m was considered. then the length was increased by 3 m in each simulation up to the maximum of 60 m (i.e., close to the experimental analysis shown in figure 4). figure 9 shows how the stress distribution increases with the length of crack, assuming that the initial crack had the same stress value at both fronts a and b. two-dimensional finite-element meshes are virtually symmetrical near this bottom (crack fronts) and the symmetry showed almost the same value as the stress distribution, for each of the crack fronts, during the simulation. the shape of the stress-strain curve as a function of the crack length is illustrated in figure 10. the shape of the curve grows wide with the increasing of crack length in front of crack tip a. the effect of stress distribution in front of crack can be converted into basic parameters that show the impact of crack behaviour, that is, the stress concentration factor (scf). obviously, the stress concentration factor is the ratio of the maximum stress over the nominal stress, denominated kt and expressed as (15)kt=maxnom. while the front of crack b does change, the main role in this research was played only by the front of crack a located near the interface of the bimaterial. thus, figure 11 shows the effect of scf in the front of crack a. these results were corroborated with the theoretical stress concentration factor (scf) obtained with the online software. the results presented in figure 11 show a good agreement and underline that when the crack reaches the interface, there is a sudden increase in the stress distribution value. this sharp rise in values may result in the creation of a surface called a debonding area, as shown in figures 9(c) and 9(d). then, by assessing the crack propagation with lfm using (crack) stress intensity factors (sif), k, it is possible to establish where the crack stops. to achieve even better accurate results, a comparison between an analytical model reported by erdogan et al. and the difference between the numerical and analytical results is due to the use of a small number of constants in the analytical model. the results are shown in figure 12, demonstrating the trend of the (crack) stress intensity factors (sif) during applied stress, in front of cracks a and b. from the curves drawn below, it can be seen that the value of the sif increases with the crack length, and the crack propagates up to a length of about 50 m. then stabilization and even a decline of the sif value the value of sif will increase sharply only if the flow area denoted as well as since the value of the (crack) stress intensity factors (sif) is low for the front of both cracks a and b, it seems that the crack can not cross into the second material. (b) model with two or more cracks: in the second assumption, a multiple cracks model, namely, with 3 cracks, was implemented using almost the correspondent algorithm but specifying 3 initial cracks with an initial size of 30 m for each crack, and then each crack would increase by 3 m, up to the maximum size of 60 m. thus, the maximum cracks value is assigned when the cracks reach the steel-zinc interface. in this model with 3 cracks the applied load (500 mpa) was considered as statement from the case of the model with a single crack. the motivation to implement a model with three cracks aims to detect whether the situation changed due to the increased (crack) stress intensity factor (sif) values, as a result of the cumulative energy developed by these 3 cracks. related work has been reported by song et al. who declared that the interface crack will propagate if the principal maximum stress at the crack tip exceeds a critical value. thus, confirming our initial supposition, the results presented in figure 14 show an increase for maximum stress value within front of the cracks. at the same time, the surface denominated debonding area appears more pronounced. the tendency was confirmed from the development of the (crack) stress intensity factors (sif), k values, where the results are reported in figure 15. the shapes of the curves in figure 15 show a similar trend obtained by the one in the case with one crack except for the fact that crack 2 shows the highest influence of propagation, derived from the cumulated extension efforts from another two cracks. another thing to note is the gap difference of sif for crack lengths 57 m and 60 m. this difference could be explained by the appearance of the previously mentioned debonding areas (i.e., imposed length for debonding area considered in this research was a maximum of two initial crack lengths, because after this size the peeling processes occur). although the difference is evident, it does not exceed the critical value of mode i fracture toughness; for example, the value cited by ashby for steel is about 80170 mpa m. consequently, the crack will not cross into the steel material and in the worst case the crack/cracks will form a large bifurcation at the interface between these two materials. this research paper highlights by means of experimental, numerical, and analytical tool the behaviour of a bimaterial zinc/steel interface submitted to mechanical loading. in particular, the case of crack/cracks at the bimaterials interface was considered. the main objectives of this paper were to assess the behaviour of the crack/cracks generated at the end of the hot-dip process and to reveal that the numerical computations are in a good agreement with the experimental outcomes. optical microscopy and scanning electron microscopy (sem) techniques were involved to evaluate the experimental performance of the bimaterials compound. postmortem analysis of the fracture surfaces emphasized the uniformity of the zinc layer over the steel surface and provided accurate information related to the average of cracks length (figure 4). in addition, this technique allows quantifying the number of cracks (figure 3) that forms in the zinc layers. in the meantime, this assessment provides patterns about the evolution of crack from incipient phase, where the cracks arise, and how far they spread. in numerical computations, simulations of the model considered were run in two different situations, namely, when the bimaterial contains just one crack or else 3 cracks, in order to prove the agreement between computation and experimental outcomes. besides, to get even accurate results, the analytical model used by erdogan et al. was also confronted. the sif were calculated to obtain value of the stress singularity that characterizes the crack evolution in the bonding area of bimaterial, for both crack tip values, that is, the fronts of cracks a and b. the analytical, numerical, and experimental assessments prove that the crack/cracks that arise during the hot-dip galvanized steel process will propagate during the mechanical fatigue test. it was also established that the crack/cracks will stop near the steel-zinc interface at a distance of about 3 m and only in particular cases yield a deflection at the bimaterial interface. to summarize, the results may confirm that cracks reduce the life span of the bimaterial but are not responsible for a direct degradation of the steel. this method is therefore useful for employment in damage models that include the safety factor condition. finally, a nondestructive method should be employed to detect the behaviour of bimaterials for a better calibration .

the behaviour of materials is governed by the surrounding environment. the contact area between the material and the surrounding environment is the likely spot where different forms of degradation, particularly rust, may be generated. a rust prevention treatment, like bluing, inhibitors, humidity control, coatings, and galvanization, will be necessary. the galvanization process aims to protect the surface of the material by depositing a layer of metallic zinc by either hot-dip galvanizing or electroplating. in the hot-dip galvanizing process, a metallic bond between steel and metallic zinc is obtained by immersing the steel in a zinc bath at a temperature of around 460c. although the hot-dip galvanizing procedure is recognized to be one of the most effective techniques to combat corrosion, cracks can arise in the intermetallic layer. these cracks can affect the life of the coated material and decrease the lifetime service of the entire structure. in the present paper the mechanical response of hot-dip galvanized steel submitted to mechanical loading condition is investigated. experimental tests were performed and corroborative numerical and analytical methods were then applied in order to describe both the mechanical behaviour and the processes of crack/cracks propagation in a bimaterial as zinc-coated material.

PMC4897108

pubmed-151

epilepsy is a common and serious chronic neurological disease that affects over 50 million people worldwide. anti-epileptic drugs (aeds) are effective at controlling seizures in many patients, acting through a range of neuronal targets, including ion channels, neurotransmitter release, and receptor mechanisms.1, 2 however, a third of patients with epilepsy fail to achieve seizure freedom, and current aeds do not show disease-modifying properties. future treatments for epilepsy need to differentiate from currently marketed drugs, for example, by having a novel mechanism(s) of action or providing disease-modifying effects.1, 2 acquired epilepsy is thought to result from disturbances to the expression and function of neurotransmitters and their receptors, ion channels, and signaling components, as well as altered metabolism, neuronal and glial microstructure, neuroinflammation, and other mechanisms.3, 4, 5 it is likely that disease-modifying treatments will need to influence multiple genes within a given pathway or in various independent pathways. potential gene network control points were recently identified and include master regulators of transcription and neuroinflammation, epigenetic factors, and noncoding rnas. micrornas (mirnas) are a conserved family of endogenous small noncoding rnas that regulate protein levels in cells by post-transcriptional control of mrna stability and translation.9, 10 this is achieved by sequence-specific binding of the mirna to complementary bases in the mrna target. since this generally requires only a 7- to 8-nucleotide match, individual mirnas can potentially target large numbers of mrnas. this provides the ability to regulate entire gene networks or multiple biological processes and has been demonstrated in the brain. microrna-134 (mir-134) was identified as a brain-enriched, neuronally expressed mirna that controls dendrite spine morphogenesis, via repression of lim domain kinase 1 and other targets.14, 15 this is potentially important for disorders of hyperexcitability, since dendritic spines are contact points for excitatory communication and there is evidence that reorganization of dendrites is a feature of experimental and human epilepsy.16, 17 we identified mir-134 among upregulated mirnas profiled in areas of hippocampal damage following status epilepticus induced by intra-amygdala kainic acid (ka) in mice. expression of mir-134 is also upregulated after neuronal stimulation and seizures in various other in vitro and in vivo models,15, 19, 20, 21, 22 and mir-134 is overexpressed in the resected human neocortex from patients with intractable temporal lobe epilepsy (tle). silencing mir-134 by intracerebroventricular (i.c.v.) injection of locked nucleic acid (lna), cholesterol-tagged antagomirs (ant-134) reduced levels of mir-134 for at least a month and rendered mice refractory to the convulsant effects of both ka and pilocarpine.19, 22 consistent with known mir-134 targets, lim domain kinase 1 and levels of other mir-134 targets were higher in ant-134-treated mice after status epilepticus and the dendritic spine volume was increased.19, 22 notably, injection of ant-134 after status epilepticus suppressed the later occurrence of spontaneous recurrent seizures in the intra-amygdala ka model in mice. there is significant interest in developing mirna-based therapies.23, 24 there are also barriers to antisense-based approaches and there has been some disengagement of industry from pursuing such efforts. this is likely to be a problem for any new therapy for epilepsy, particularly one that is not based on traditional small molecule chemistry.1, 2 pre-clinical development of an mir-134-based treatment for epilepsy might be more attractive if additional important questions are answered. principally, work to date has only tested ant-134 in mouse models of status epilepticus. proof of seizure-suppressive effects of ant-134 in a non-status epilepticus model or in another species would bridge the gap in evidence and facilitate pre-clinical development of ant-134-based treatment for epilepsy.26, 27 here, we evaluated mir-134 expression in the resected hippocampus from patients with pharmacoresistant tle and we tested ant-134 in three different models. we used the pentylenetetrazol (ptz) model in mice, a popular method for screening putative anticonvulsive effects that triggers seizures via -amino butyric acid (gaba) blockade.26, 28 second, the perforant pathway stimulation (pps) model, a toxin-free model of acquired epilepsy based on nonconvulsive status epilepticus that avoids the confounding influence of exposing the brain to chemoconvulsants, was used in rats. finally, we used a high-potassium model of epileptiform activity, using ex vivo brain slices from rats pre-treated with ant-134. our results establish that targeting mir-134 offers broad anticonvulsant and possibly disease-modifying effects in experimental epilepsy, which may encourage pre-clinical development of ant-134 as a treatment for epilepsy. for this, we analyzed levels of mir-134 in the surgically obtained hippocampus from adults with pharmacoresistant tle and we compared findings to autopsy hippocampal samples from people who died of causes unrelated to neurological disease. these samples were used previously to analyze expression of other genes, and clinical data for both groups are briefly summarized in tables s1 and s2. there were no between-group differences in patient age, and each group included males and females. we detected higher levels (p =0.037) of mature mir-134 in the tle specimens compared to autopsy samples (figure 1a). this difference is unlikely to be an artifact of post mortem delay, since mir-134 levels did not decrease in simulated autopsy experiments lasting up to 12 hr. we began by establishing dosing parameters in the mouse ptz model. generalized tonic-clonic seizures were first reliably elicited at a dose of 60 mg/kg in c57bl/6j mice (figure 1b). a dose of 80 mg/kg elicited generalized tonic-clonic seizures in all mice and with a more consistent and shorter latency than with the 60 mg/kg dose (figure 1b). a dose of 100 mg/kg also produced rapid-onset tonic-clonic seizures in all mice but was associated with high mortality (figure 1b and data not shown). ordinal logistic regression analysis was used to explore the dose dependence of the ptz-induced convulsions. ptz dose was significantly associated with racine scores (figure 1c). a dose of 80 mg/kg was selected for further experiments. to obtain molecular evidence for ptz-induced seizure activity in the model, we measured expression of activity-regulated genes in the hippocampus. transcript levels of fbj osteosarcoma oncogene (fos), a calcium-dependent marker of neuronal activity and activity regulated cytoskeletal-associated protein (arc), another immediate early gene responsive to intense neuronal activity, were strongly increased in the hippocampus 30 min, but not at 4 hr, after ptz-induced seizures (figures 1d and 1e). there was no evidence of irreversible neuronal injury in tissue sections from mice after ptz, as assessed by fluoro-jade b (fjb) and neun (rna binding protein, fox-1 homolog [c. elegans] 3) staining (data not shown). expression of mir-134 is known to increase in various in vitro and in vivo seizure models.15, 19, 20, 21, 22 we therefore investigated whether ptz-induced convulsions alter mir-134 levels in mice. taqman mirna assays showed that levels of mature mir-134 were significantly increased in the hippocampus, but not in the cortex, 30 min after ptz-induced generalized tonic-clonic seizures in mice (figure 1f and data not shown). injection of antagomirs targeting mir-134 (ant-134) in mice.19, 22 previous work has established a dose of these antagomirs that reduces hippocampal mir-134 levels by over 90% by 24 hr after injection. accordingly, we tested ptz responses 24 hr after injection of ant-134 and compared them to responses in mice that received a scrambled antagomir (scr). in scr mice, delay to onset of first tonic-clonic seizure after ptz injection was similar to that observed before in control mice (figure 2a, and compare to figure 1b). thus, the control antagomir did not alter the normal response to ptz in the model. the time to first ptz-induced tonic-clonic seizure was significantly longer in mice injected with ant-134 compared to scr-injected animals (figure 2a). the severity of racine-scored ptz-induced seizures was also significantly lower in ant-134- compared to scr-injected mice (figures 2b and 2c). analysis of electrographically recorded seizure activity determined that electroencephalography (eeg) total power was lower in ant-134 mice compared to the control group after ptz (figure 2d). we next analyzed brain tissue samples from scr- and ant-134-injected mice for evidence of mirna silencing and differences in expression of activity-regulated genes. analysis of the hippocampus obtained after ptz-induced seizures confirmed that mir-134 expression was lower in ant-134 pre-treated mice compared to scr-treated animals (figure 3a). ant-134 had no effect on levels of an unrelated mirna (figure 3b). next, we assessed expression of arc and c-fos as molecular markers of recent neuronal activity to support the clinically scored behavior and eeg differences in ant-134 mice. quantitative real-time pcr analysis revealed increased c-fos expression in the hippocampus of scr-injected mice after ptz-induced seizures (figure 3c). in contrast, c-fos levels were lower in ant-134-injected mice, consistent with reduced seizure severity (figure 3c). this difference was also apparent in the neocortex from the same animals (figure 3c). expression of arc was increased in the hippocampus of scr-injected mice that received ptz. arc levels were not significantly different in ant-134 mice compared to scr-injected animals in the hippocampus and neocortex after ptz-induced seizures (figure 3d). we turned next to the pps model in rats, first investigating effects on mir-134 levels. taqman mirna assays showed that levels of mature mir-134 were not significantly modified in the hippocampus of rats at two different time points (figure 4a). next, we assessed the effect of silencing mir-134 before stimulation on seizure severity during status epilepticus. rats were pre-treated with ant-134 or scr (i.c.v.) 24 hr before the 8-hr stimulation protocol. analysis of electrographically recorded seizure activity determined that scr-injected rats presented a mean (sem) increase of 1,304.3% 94.9% in eeg total power relative to baseline. this was similar to animals that were stimulated but not receiving the oligonucleotide (data not shown). in rats pre-treated with ant-134, the severity of evoked seizures in the pps model was similar: eeg total power during seizures was a mean (s.e.m) of 1,244.6% 82.7% (percent of baseline). despite not seeing an acute anticonvulsant effect of ant-134 in the pps model, we were nevertheless interested in whether silencing mir-134 after status epilepticus in the model would alter the emergence of recurrent spontaneous seizures. a key prior finding was that silencing mir-134 after status epilepticus induced by intra-amygdala ka reduced the subsequent occurrence of spontaneous recurrent seizures by over 90%. for these studies, rats underwent 8-hr stimulation of the perforant pathway to induce epilepsy and the i.c.v. rats were then monitored with video-eeg until a first spontaneous seizure was recorded, typically 1025 days after pps, and they were then followed for a further 8 weeks (figure 4b). epilepsy developed in all scr-injected rats over the expected course, with the first spontaneous seizures appearing 14 weeks after status epilepticus (figures 4b and 4c). scr-injected rats averaged 20 spontaneous seizures recorded during the 8-week recording time (figures 4d and 4e). in contrast, no spontaneous seizures were detected over the 8-week period in six of seven rats injected with ant-134 after status epilepticus (figures 4d4f). epilepsy emerged in only a single rat treated with ant-134 (figures 4d and 4f). the fisher exact test determined that there was a significant difference in epilepsy development between the groups (p =0.005). in terms of effect size, ant-134 prevented 86% of the risk of epilepsy, with a 95% confidence interval (ci) of 12%98%. an analysis of the duration of spontaneous seizures (electrographically defined) revealed that when spontaneous seizures occurred, they were similar between groups. that is, the average duration of a spontaneous seizure in scr-treated rats was 53.7 14.4 s (n =20 seizures, from five rats), which was similar to the duration in epileptic rats in the pps model that did not receive an i.c.v. injection (49.4 15.9, n =20 seizures). in the ant-134 rat that developed epilepsy, the average duration of a spontaneous seizure was 52.3 16.2 s (from n =12 seizures). having observed a disparity between the acute anti-seizure effects of ant-134 pre-treatment in the ptz and pps models, we sought to examine the effect of ant-134 on naive, non-epileptic tissue and whether the effects were due to long range networks or if local circuitry was sufficient to mediate any seizure protection. we injected ant-134 in vivo in rats and subsequently prepared ex vivo brain slices (figure 5a). these slices were then exposed to a 9-mm k seizure challenge, to determine whether ant-134 protects against epilepsy in local circuits of the isolated slice in the absence of epileptogenesis. onset of activity was delayed in ant-134-treated slices by 176 s relative to the control (figures 5b and 5c). this effect was statistically significant (mann-whitney u test, p =0.002, =0.025, power =0.87). we also compared the power of epileptiform activity and duration of seizure-like events in these data; these effects were not statistically significant (power: t test, p =0.70; duration: mann-whitney u test, p =0.067). this finding suggests that ant-134 can confer seizure resistance in naive tissue and thus mediate its effect even in the absence of epileptogenesis. in addition, preservation of the seizure resistance in isolated slices indicates that at least some of the effects of ant-134 are due to local changes in activity. the present study provides important additional evidence of the anticonvulsant and disease-modifying effects of lna-based antagomirs targeting mir-134 in animal models of epilepsy. our study shows that ant-134 is an anticonvulsant in an acute chemoconvulsant model (ptz in mice) and ant-134 had anti-epileptogenic activity in the perforant pathway stimulation model of epilepsy in rats. ant-134 also confers resistance to epileptic activity in naive tissue, reflected as a delay to activity onset following a seizure challenge in ex vivo brain slices. we also report that mir-134 levels are elevated in the hippocampus of patients with pharmacoresistant tle. the therapeutic potential of targeting mir-134 in established epilepsy will require additional studies, but our findings may encourage further research or pre-clinical development of this mirna-based treatment for epilepsy. despite the recent introduction of two additional aeds (perampanel and brivaracetam), new drug development in epilepsy faces significant challenges.1, 2, 32 new targets are required that can treat pharmacoresistant patients or have disease-modifying effects that are not served by current therapies. mirnas have emerged as potential targets of the future via their influence on neuronal microstructure, gliosis, neuroinflammation, and ion channels.8, 33 silencing mir-134 has produced the most convincing anti-seizure effects to date, reducing status epilepticus in pre-treatment paradigms in the intra-amygdala ka and pilocarpine models and exerting potent long-term effects on spontaneous seizure development.19, 22 this mirna is also an attractive target, since studies show increased levels of mir-134 within the temporal lobe of adult and pediatric patients with intractable epilepsy.19, 20 we report here that mir-134 is also elevated in the hippocampus of adults with pharmacoresistant tle, although there are potential confounders with comparing resected material from patients to autopsy control samples. the present study has answered key questions that could facilitate pre-clinical development by showing that ant-134 has anticonvulsant effects in non-status epilepticus models and is disease modifying in another species. the first important finding was that pre-treatment with ant-134 strongly suppressed seizures in the mouse ptz model. effects on both clinical behavior, including delaying the time to first convulsive seizure, and electrographic seizure activity were seen. thus, lowering brain levels of mir-134 can exert anti-excitability effects, and this implies that mir-134 has a role in setting excitability thresholds in the brain. this is thought to be due to regulation of proteins that control dendritic morphology,14, 15 although other targets are known. ant-134 did not fully prevent seizures in the ptz model; rather, it delayed and minimized their severity, a finding most closely matching the effect of ant-134 in the pilocarpine model of status epilepticus. it may not be possible to fully prevent all seizures using ant-134 in chemoconvulsant models, but further adjustments to antagomir dose or delivery may yield optimal seizure-suppressive effects. ptz triggers seizures via gabaergic blockade; this differs from the mechanism by which status epilepticus is induced by ka and pilocarpine, which work by promoting glutamatergic and cholinergic transmission, respectively. this suggests that ant-134 may be effective for epilepsies of various etiologies, which, in patients, can vary considerably between trauma, stroke, infection, genetic, and other causes. our studies also show that ptz-induced convulsions increase brain levels of mir-134, transcription of which is probably mediated by myocyte enhancer factor 2c. we did not observe an increase in mir-134 after perforant pathway stimulation in the rat. this was surprising, although changes to mir-134 levels are not always detected after chemoconvulsive stimuli, and we can not rule out a technical explanation (e.g., the time points selected or a subfield-specific effect that was masked by the use of the whole hippocampus). our study included an analysis of the short-term effects of ant-134 on neuronal activity-regulated genes in the ptz model. expression of genes such as c-fos and arc is a well-established surrogate marker of recent seizure activity, the protein products of which are involved in coordinating synaptic plasticity and adaptation to excessive neuronal stimulation.38, 39 unexpectedly, only levels of c-fos, and not arc, showed the expected reductions in ant-134 mice after ptz seizures. it is known that c-fos induction is calcium dependent, whereas arc expression can be induced via calcium-independent pathways.38, 39 therefore, ant-134 treatment may have reduced seizure severity sufficient to prevent c-fos induction, such as by minimizing n-methyl-d-aspartate (nmda) receptor opening, but enough residual neuronal excitation remained to upregulate arc. these findings provide additional evidence of the scale and nature of seizure suppression by ant-134 and suggest molecular markers that can distinguish effects of mirna manipulations on different components of seizure responses. in the present study, we observed that pre-treatment of rats with ant-134 did not protect against perforant pathway stimulation-induced status epilepticus. while there are examples of anticonvulsants producing effects in some but not all models, these findings suggest that ant-134 may have the most clinical value as an anti-epileptogenic treatment. previous work showed that injection of ant-134 after status epilepticus in mice suppressed the later occurrence of spontaneous seizures by 90%, evidence of a disease-modifying effect in the intra-amygdala ka model. here, we found nearly identical anti-epileptogenic effects of ant-134 in a different model in rats. this is the only demonstration, to our knowledge, of any disease-modifying treatment in the pps model in rats. the pps technique induces hippocampal sclerosis and recurrent spontaneous seizures,29, 40 and it provides a means to trigger epilepsy without the bias or other issues associated with chemoconvulsants. ant-134 was injected shortly after triggering status epilepticus in order to model a reasonably realistic clinical scenario, such as a patient being treated shortly after an initial precipitating injury. ant-134 had dramatic and potent effects, with the majority of ant-134 rats (six of seven, 86%) never developing spontaneous recurrent seizures. notably, spontaneous seizures in the study with the intra-amygdala ka model did occur in all ant-134 mice, albeit with dramatically lower seizure frequency. this difference may relate to the extent of hippocampal injury or another aspect of the epileptic phenotype, such as the frequency of spontaneous seizures. thus, presently we see a possible additional therapeutic action of ant-134, whereby post-treatment is capable of fully preventing epilepsy at least in some models. we can not, of course, exclude that epilepsy might have developed in some of the ant-134 rats at some point in the future. however, we recorded for 8 weeks beyond the standard latent period. we further corroborated the anti-seizure effect of ant-134 by using an acute seizure challenge with high potassium in otherwise healthy (ex vivo) tissue. inhibitory neurotransmission is retained in this model (in contrast to ptz) and there is no hippocampal sclerosis (unlike pps), further suggesting that ant-134 can be therapeutic in multiple epileptic syndromes with varying mechanisms. we observed a delay in the onset of epileptiform bursts in brain slices that had been pre-treated with ant-134. this finding suggests that epileptogenesis is not required for ant-134 to mediate its effects on seizure onset. we did not see any significant changes in the power or duration of epileptiform activity; however, these parameters are highly variable in brain slices, which can obscure potential effects. in addition, we propose that ant-134 can mediate seizure protection in the hippocampus via effects on local circuitry, because long range connections would likely be severed during the slicing process. the anti-epileptogenic actions of ant-134 may be independent of the etiology of the initial precipitating injury, although this will require further testing (e.g., in models of trauma or infection-induced epilepsy). in addition, upregulation of mir-134 is not essential for ant-134 to produce anti-epileptogenic effects, since mir-134 levels were not altered after pps-induced status epilepticus. thus, epilepsy can be dramatically suppressed in two different in vivo models, and one in vitro, in two different species. this provides strong support for and is an argument for further development of ant-134 for epilepsy treatment or prevention. antagomirs targeting a liver-expressed mirna have been given to humans and were found to be well tolerated and effective against hepatitis c in clinical trials. there are concerns, obviously, that because ant-134 can alter dendritic spines, it could have effects on cognition. studies to date have not identified such problems, with natural exploratory behavior and performance in a hippocampus-dependent task found to be normal in mice a few days after i.c.v. injection of ant-134.19, 22 however, more demanding tests of cognition or learning will need to be performed. another factor that argues for general safety is that mice and rats have been recorded for at least 2 months after brain injections of ant-134. nevertheless, pre-clinical development will necessitate an extensive battery of toxicity and safety testing. work to date on ant-134 satisfies certain recommendations for testing and evaluating novel therapies for epilepsy, with seizure-suppressive effects demonstrated in five different models and two different species.1, 2, 43, 44 there are, however, additional seizure models that could be used during any future pre-clinical development. this includes kindling, a popular model that has been successful in identifying aeds with novel mechanisms of action. while this is not an essential step before pre-clinical development, sex differences in mirna inhibitor responses may be worth investigating in future studies and sexual dimorphism in mirna expression has been reported, although not for mir-134.46, 47 it will also be of value to understand how ant-134 produces its potent seizure-suppressive effects. the most likely mechanism is upregulation of one or more proteins due to de-repression of a mir-134 target. previous work has shown that mir-134 is uploaded into the rna-induced silencing complex after seizures, which facilitates targeting of mrnas, and in vitro studies suggest that the neuroprotective effects of ant-134 are due to de-repression of lim domain kinase 1. ant-134 treatment also increases dendritic spine volume and changes spine number in the hippocampus,19, 22 which could influence excitability and would also be consistent with a mechanism involving protection of mir-134 targets such as lim domain kinase 1 or pumilio rna-binding family member 2. altered spine volume and number is consistent with our observation of a robust local effect of suppressing mir-134 on delaying epileptiform activity, although additional effects on long range connections can not be ruled out. we must also consider that the acute seizure-suppressive effects and long-term anti-epileptogenesis effects may arise from different mechanisms. ultimately, in vivo studies will be necessary to determine the anti-seizure mechanism of ant-134 (e.g., by analyzing gene expression networks, quantifying the proteome, and applying techniques to validate antagomir-mirna targeting such as polysome shift assays). what are the next steps for translation or pre-clinical development? an obvious question is whether and how antagomirs could be given to patients. their large size precludes their passing an intact blood-brain barrier (bbb). recent work has explored methods to circumvent the bbb, including conjugating antagomirs with brain-penetrating peptides or administering antagomirs via intranasal injection.19, 51 the bbb may also be open after certain epilepsy-precipitating injuries or it can be physically breached, such as through use of ultrasound. another question is whether ant-134 injection into already epileptic animals could alter the frequency or duration of spontaneous seizures or attendant hippocampal pathology. success with that approach could provide novel treatment opportunities for the population of drug-resistant patients for whom surgery or other alternatives to aeds are either not possible or not effective currently. in summary, the present study provides important additional validation of the potent seizure-suppressive and possibly disease-modifying effects of ant-134 in two different animal models and one brain slice model. the effectiveness of ant-134 and the potency of seizure suppression suggest a target for drug development in epilepsy that could provide additional effects beyond those provided by any currently marketed drug for epilepsy. this study was approved by the ethics (medical research) committee of beaumont hospital of dublin (no. 05/18) and written informed consent was obtained from all patients. the control (autopsy) hippocampus (n =12) was obtained from 12 individuals. patients (n =12) were referred for surgical resection of the temporal lobe by an epileptologist (n.d.) following neurological assessment, video-eeg recording, and mri/neuroimaging. each patient was determined to have medically intractable tle with a history of recurring seizures (table s2). the hippocampus was obtained and a portion of each specimen was frozen in liquid nitrogen and stored at 70c until use. a pathologist (m.a.f.) assessed the hippocampus as part of the pathologic evaluation, addressed the degree of hippocampal sclerosis, and described other pathologic changes. all animal experiments were performed in accordance with the european communities council directive (2010/63/eu). procedures in mice were approved by the research ethics committee of the royal college of surgeons in ireland (rec-842), under license from the ireland health products regulatory authority (ae19127/001). procedures in rats were performed under authorization of the philipps university bioethics committee and were approved by the local regulation authority (regierungsprsidium gieen), or they were performed according to the uk animals (scientific procedures) 1986 act (ppl 70-7684) and approved by local ethical review (university college london). male adult c57bl/6j mice (2025 g) and male sprague-dawley rats (325350 g or 200300 g; all from harlan) were used in all studies. animals were housed in on-site barrier-controlled facilities having a 12-hr/12-hr light/dark cycle with ad libitum access to food and water. mice were equipped for eeg recordings under surgical anesthesia (isoflurane; 5% induction, 1%2% maintenance) in a mouse-adapted stereotaxic frame. body temperature was maintained within the normal physiological range with a feedback-controlled heat pad (harvard apparatus). after a midline scalp incision, partial craniectomies were performed and animals had skull-mounted recording electrodes placed and fixed with dental cement. a second cohort of mice had eeg electrodes and a guide cannula implanted to allow i.c.v. this cannula was placed on the dura mater with the following coordinates from the bregma: anterior-posterior (ap), +0.3 mm; lateral (l), +0.9 mm; and ventral (v), 2.0 mm. after recovery from surgery, mice were connected to the lead socket of a swivel commutator, which was connected to a grass twin digital eeg system. ]) with different doses of ptz (60, 80, or 100 mg/kg). lorazepam (8 mg/kg, i.p.) was administered after the first tonic-clonic seizure to reduce morbidity and mortality. mice were followed for 30 min or 4 hr after ptz administration for the appearance of seizures by electrographic and behavioral methods. after the observation period, mice were deeply anesthetized (pentobarbital) and transcardially perfused, and their brains were removed for analysis of gene expression or histological assessment. injection of 0.12 nmol/2 l 3-cholesterol-tagged locked nucleic acid oligonucleotide targeting mir-134 (ant-134) or its respective control, a non-targeting scrambled version of the antagomir (scr; 0.12 nmol/2 l) (exiqon a/s), as previously described.19, 22 twenty-four hours later, mice were connected to an eeg system and a baseline recording was obtained. next, mice were injected with ptz (80 mg/kg, i.p.). lorazepam (8 mg/kg, i.p.) was administered after the first tonic-clonic seizure to reduce morbidity and mortality. these mice were followed up for 30 min after ptz administration for the appearance of seizures. after this period, mice were deeply anesthetized (pentobarbital overdose) and transcardially perfused (pbs) for further assessments. under isoflurane (5% induction, 3% maintenance) anesthesia, bipolar stainless-steel stimulating electrodes (nex-200; rhodes medical instruments) were positioned in the angular bundles of the perforant pathway and custom unipolar recording electrodes (crafted from 796000; a-m systems) were lowered into the dorsal dentate gyrus. electrodes and ground screws were connected to miniature wireless transmitters (ft20; data sciences international) that were implanted subcutaneously on the animal s flank. plastic connectors (gs09plg; ginder scientific) joined the electrodes with stimulation/recording equipment. the pps protocol utilized a paradigm designed to evoke and maintain hippocampal seizure activity throughout the stimulation, but not convulsive status epilepticus, which consisted of continuous, bilateral 2-hz paired-pulse stimuli, with a 40-ms interpulse interval, plus a 10-s train of 20 hz single-pulse stimuli delivered once per minute, generated by an s88 stimulator (grass instruments). all pulses (0.1-ms duration) were delivered at 2024 v, as this voltage reliably evokes granule cell discharging without tissue-damaging hydrolysis.29, 40 the current associated with these voltages was typically between 15 and 30 a. no samples displayed any signs of hydrolysis (e.g., holes around the stimulating electrodes). as described previously, stimulation for 30 min (on 2 consecutive days) required only isoflurane to terminate seizures. eight-hour stimulation on the third day did not induce convulsive status epilepticus and, therefore, did not require pharmacological termination. rats were randomly divided in three cohorts to assess the following: (1) mir-134 expression after pps (24 hr, 4 days, and 14 days); (2) the effect of ant-134 on pps-induced status epilepticus, in which rats were pre-treated with ant-134 or scr (0.36 nmol/6 l, i.c.v.; exiqon a/s) 24 hr before the 8-hr stimulation; and (3) the effect of ant-134 on epileptogenesis, in which rats were injected with 0.36 nmol/6 l (i.c.v.) of ant-134 or scr (exiqon a/s) immediately after 8-hr stimulation. five rats were excluded from this study due to practical issues (e.g., blocked cannula). for statistical purposes, we pooled samples from 24 hr and 4 days after pps as an early time point, while 14-day samples were considered as the late time point. mouse eeg data were analyzed and quantified using labchart 8 software (ad instruments). ptz-induced seizures were defined as high-amplitude (> 2 baseline) high-frequency (> 5 hz) polyspike discharges lasting>5 s. for statistical purposes, we assigned a cut-off time of 1,800 s for those animals that did not present seizures during the observation period. from the eeg recordings, we calculated the delay to first seizure, the total power, and the percentage of total power/spectral bands, as previously described.19, 54 eeg total power was plotted as the percentage of baseline recording (each animal s eeg power post-seizure compared to its own baseline eeg). clinical behavior was scored using the following adapted racine scale: score 0, no seizures observed; score 1, rhythmic mouth and facial movement; score 2, rhythmic head nodding (bobbing); score 3, forelimb clonus; score 4, rearing and bilateral forelimb clonus; and score 5, rearing and falling (stay fallen on rear side; tonic-clonic seizures). the highest score reached during every 5 min during the 30 min after ptz was recorded. for studies in rats, eeg activity during and after pps was amplified and recorded digitally at 2 khz utilizing a powerlab 16/35 and labchart software versions 7 and 8 (ad instruments). spontaneous granule cell layer activity was recorded continuously (24 hr/day) and stored digitally and automatically in 3-hr epochs. each day, we analyzed the preceding 24 hr of recordings, as well as all events with amplitudes exceeding 120% of average baseline. continuous (24 hour/7 day) video monitoring utilized edimax 7010w infrared cameras. video files were captured at 1215 frames/sec and were time-stamped for integration with the electrophysiological data using securityspy surveillance software (ben software) and stored digitally. confirmed seizures were scored according to the racine scale. rats were anesthetized with isoflurane (5% induction,2% maintenance as appropriate) and mounted in a stereotaxic frame. we injected ant-134 (0.12 nmol) in 1 l te buffer (life technologies) at coordinates relative to the bregma: ap, 0.92 mm; medial-lateral (ml), +1.3 mm, and dorsal-ventral (dv), 3.3 mm to target the lateral ventricle. to allow the rats to fully recover from the analgesic drugs and to coincide with the maximal anti-epileptic effect seen in vivo sodium pentobarbital and transcardially perfused with ice-cold sucrose artificial cerebrospinal fluid (acsf; in mm: 205 sucrose, 10 glucose, 2.5 kcl, 0.1 cacl2, 5 mgcl2, 26 nahco3, and 1.2 nah2po4.h2o; osmolarity, 295 mosm). the brain was quickly dissected into ice-cold sucrose acsf and transferred to a campden 700 smz slicer (campden instruments). slices (400 m) were prepared in the horizontal orientation between the bregma at approximately 7.1 and 5.1 mm. for storage, slices were submerged in oxygenated normal acsf (in mm: 125 nacl, 10 glucose, 3 kcl, 1 mgcl2, 2 cacl2, 26 nahco3, and 1.25 nah2po4.h2o; osmolarity, 290 mosm) and allowed to recover at room temperature for at least 60 min prior to recordings. slice recordings were made using a membrane chamber (scientific systems design), a modified submerged chamber, which improves oxygen supply to the tissue and supports greater epileptiform bursts than conventional submerged recording chambers. slices were continually perfused with acsf, heated to 32c, at a flow rate of 16 ml/min. for local field potential (lfp) recordings, borosilicate glass recording micropipettes (resistance, 34 m) were placed into hippocampal ca1b stratum pyramidale and epileptiform activity was induced by raising the perfusing kcl concentration to 9 mm. total rna was isolated from brain samples using trizol (invitrogen), as described previously.19, 54 for mrna qpcr, 1 g total rna was used to generate cdna by reverse transcription using the superscript iii reverse transcriptase enzyme (invitrogen). the pcr amplification was performed for 50 cycles on a thermocycler (applied biosystems). quantitative real-time pcr was performed using a lightcycler 1.5 (roche diagnostics) in combination with quantitect sybr green pcr kit (qiagen) as per the manufacturer s protocol with 25 m of primer pairs used. specific primers for each gene assayed were purchased from sigma and sequences used were as follows: actin, beta (actb) (forward [f], ggttggccttagggttcagg; reverse [r], gggtgtgatggtgggaatgg); c-fos (f, cattcagaccacctcgacaa; r, ggaattaacctggtgctgga); and arc (f, agcagcagacctgacatcct; r, gtgatgccctttccagacat). data were normalized to actb and relative mrna transcript levels were quantified using the ct method. for mirna, 250 ng rna was reverse transcribed using stem-loop specific primers for mmu-mir-134 (applied biosystems) and real-time quantitative pcr was carried out on a 7900ht fast real-time system (applied biosystems) using taqman mirna assays. expression of rnu19 was used for normalization. a relative fold change in expression of mir-134 was determined using the ct method.19, 56 specific mirna assays were obtained from thermofisher scientific for mir-134 (i d 001186), mir-19a (i d 000395), and rnu19 (i d 001003). data were normalized to rnu19 and relative mirna expression levels were quantified using the ct method. statistical analysis was performed using graphpad prism and stata release 14 software, and a p value <0.05 was considered significant. latencies to tonic-clonic seizures were analyzed by the kruskal-wallis test, followed by the nonparametric dunn multiple comparison test when indicated. total time spent in seizures, mean amplitude, frequency, total power of eeg recordings, and mrna levels were analyzed by the student t test or one-way anova followed by the bonferroni test, depending on the experimental design. ex vivo brain slice data were analyzed using the mann-whitney u test. three comparisons were made from the same data and (significance level) was consequently reduced to 0.025 for these experiments., d.f.o., and n.d. provided human samples and data; c.r.r., s.s. wrote the paper and all co-authors contributed to data interpretation, review, and editing of the final paper. the royal college of surgeons in ireland filed for a patent on the inhibition of microrna-134 for the treatment of seizure-related disorders and other neurologic injuries.

current anti-epileptic drugs (aeds) act on a limited set of neuronal targets, are ineffective in a third of patients with epilepsy, and do not show disease-modifying properties. micrornas are small noncoding rnas that regulate levels of proteins by post-transcriptional control of mrna stability and translation. microrna-134 is involved in controlling neuronal microstructure and brain excitability and previous studies showed that intracerebroventricular injections of locked nucleic acid (lna), cholesterol-tagged antagomirs targeting microrna-134 (ant-134) reduced evoked and spontaneous seizures in mouse models of status epilepticus. translation of these findings would benefit from evidence of efficacy in non-status epilepticus models and validation in another species. here, we report that electrographic seizures and convulsive behavior are strongly reduced in adult mice pre-treated with ant-134 in the pentylenetetrazol model. pre-treatment with ant-134 did not affect the severity of status epilepticus induced by perforant pathway stimulation in adult rats, a toxin-free model of acquired epilepsy. nevertheless, ant-134 post-treatment reduced the number of rats developing spontaneous seizures by 86% in the perforant pathway stimulation model and ant-134 delayed epileptiform activity in a rat ex vivo hippocampal slice model. the potent anticonvulsant effects of ant-134 in multiple models may encourage pre-clinical development of this approach to epilepsy therapy.

PMC5363384

pubmed-152

it is a common discomfort making to the top ten list of complaints in ambulatory medical care, but our understanding of the epidemiology of headache disorders is still incomplete. most of the recurrent headache cases are due to benign chronic primary headache disorders, such as tension headache and migraine. less frequently, headache could be due to other underlying conditions such as infections, cerebral hemorrhage and brain lesions [5, 6]. the study of headache epidemiology can address a number of important questions such as variation in the occurrence and severity of headache in the population, and the relationship between headache and other medical disorders. in addition, these studies may provide clues to abortive treatments and preventive strategies for headache. it is well documented among adults that overuse of headache medication may contribute to the development of chronic headache [814]. epidemiologic studies indicate that chronic headache (> 15 days per month) is common in the adult population with a 25% prevalence rate [1521] and a prevalence of chronic headache associated with medication overuse of about 1% [18, 20, 21]. in general, self-medicating for headache is highly prevalent and self-care is likely to increase in the era of health-care reform [22, 23].. chronic and inappropriate use of over-the-counter drugs such as analgesics, particularly nonsteroidal anti-inflammatory drugs (nsaids), can lead to overuse syndromes and drug-induced headache [25, 26]. in the present study, we sought to estimate the association between analgesic use and headache among adults in a large sample of the jordanian population in relation to age, gender and headache frequency. in this study, participants (age range 1885) were approached at their work places, classes or homes., researchers asked every participant to nominate two other persons until the desired sample size was obtained. the study was ethically approved by the institutional review board (irb) at jordan university of science and technology and was carried out in accordance with the principles described in the declaration of helsinki, including all amendments and revisions. the study was conducted in various regions of jordan during the period from january 2007 to november 2008. the questionnaire was distributed, in person, by the researchers, and was completed in the presence of the researcher. each participant was provided with a full explanation of the study and how to complete the questionnaire. participants were informed that the researcher would be available for any required assistance during scoring of the questionnaire. for the small group of participants who were illiterate, the questionnaire was administered by the researcher in the form of an interview. data were aggregated into groups and only the authors and the investigator were allowed access to the collected data. the questionnaire gathered information that included demographic data, frequency and type of headache, and its impact on everyday activities, analgesic use, consultation of a doctor or pharmacist on the use, increase or decrease in the frequency of headache after painkiller usage, increase or decrease in painkiller dose and family history of headache. every person who was 18 years or older was allowed to complete the survey. retest reliability, 50 subjects were selected randomly; they answered the questionnaire twice with a 1-week interval. test for each item, correlation coefficients ranged from 0.79 to 0.86, suggesting that the questionnaire was reliable. the data were coded using the statistical package for the social sciences, version 15.0 (spss inc. the data were summarized using frequency tables and means and standard deviation for continuous variables. to estimate the prevalence of headache among adults in jordan, a sample of participants (4,836 participants; mean age 27 0.4 years, and male: female ratio of 59:41) was allowed to complete a self-conducted screening questionnaire. as shown in table 1, about half of the participants (49.2%) were university students and 78.3% were jordanian citizens. moreover, 70.7% participants were single and 47.4% were smokers. table 1the demographic data of the study samplevariablen (%) gender male2,870 (59.4) female1,966 (40.6)age 1829 years3,572 (73.95) 3039 years506 (10.46) 4049 years402 (8.32) 50 years356 (7.37)education illiterate83 (1.7) elementary school65 (1.3) secondary school213 (4.4) high school610 (12.6) diploma344 (7.1) university student2,378 (49.2) bachelor901 (18.6) masters181 (3.7) ph.d.61 (1.3)nationality jordanian3,787 (78.3) arab (non-jordanian)841 (17.4) foreign208 (4.3)marital status single3,422 (70.8) married1,304 (27.0) divorced55 (1.14) other55 (1.14)monthly income low (< or=400 jd)257 (5.3) medium (> 400 jd to<or=1,000 jd)3,831 (79.2) high (> 1,000 jd)748 (15.5)smoking smoker2,294 (47.4) non-smoker2,542 (52.6)1 jd is equivalent to about 1.4 us dollars the demographic data of the study sample 1 jd is equivalent to about 1.4 us dollars of the 4,836 participants, 82.3% complained of headache at least once per year. for both the 1829 and the 3039-year-old groups, the yearly prevalence of headache was found to be the same (82.8%), while it was 79.9 and 81.7% for the 4049 and older than 50-year-old groups, respectively. among the participants, 17.2% had daily headache attacks, while 25.7% had fewer than daily to weekly headaches, 21.6% had headaches on fewer than weekly up to monthly basis, 17.8% complained of headaches on a fewer than monthly basis and 17.7% of all participants did not experience headache attacks. moreover, 38.4% of the headache complainers did not know the exact type of headache they were experiencing, 36.9% complained of tension type headache and only 7.7% were diagnosed with migraine headache; 51.6% of complainers thought that headache affected their daily activities. a large number of participants stated that one or more of their family members complained of headache as well (table 2). table 2frequency, type, and family history of headachevariablen (%) headache frequency daily832 (17.2) fewer than daily to weekly1,243 (25.7) fewer than weekly to monthly1,043 (21.6) fewer than monthly to 1 year860 (17.8) no headache858 (17.7)type of headache migraine372 (7.7) tension1,749 (36.1) unknown1,857 (38.4) no headache858 (17.7)headache affects daily activities (if any) yes2,051 (51.6) no1,927 (48.4)other family members complaining from headaches father327 (6.8) mother545 (11.3) brothers or sisters552 (11.4) other relatives558 (11.5) more than one family member860 (17.8) none1,994 (41.1) frequency, type, and family history of headache of the migrainers, 37.7% (n=140) complained of daily headache, 35.6% (n=132) had fewer than daily up to weekly headaches, and 18.1 (n=67) and 8.6% (n=32) complained of headaches on a fewer than weekly up to monthly basis, and on fewer than monthly basis, respectively. additionally, about 75% (n=279) of migrainers thought that migraine adversely affected their daily activities. concerning tension type headache, 20.3% (n=348) complained of daily headache, 34.7% (n=594) had fewer than daily up to weekly headaches, and 24.1% (n=413) and 20.8 (n=356) complained of headaches on fewer than weekly up to monthly basis, and fewer than monthly basis, respectively. moreover, about 53% (n=907) indicated that tension type headache affected their daily activities. the stratified prevalence for both migraine and tension type headache according to age group and gender are shown in table 3. table 3stratified prevalence of migraine and tension-type headache according to age group and genderheadache typetension-type headachemigrainegendermale n (%) female n (%) male n (%) female n (%) age category (years) 1829652 (31.6)586 (39.0)158 (7.7)97 (6.5) 3039120 (36.1)73 (43.7)34 (10.2)11 (6.7) 404972 (31.7)68 (39.1)17 (7.5)18 (10.3) 50 and above92 (37.3)49 (40.8)28 (11.3)8 (6.7)total936 (32.6)776 (39.5)237 (8.3)134 (6.8) stratified prevalence of migraine and tension-type headache according to age group and gender only 17.3% of participants sought medical care for their headaches. the percentage of participants using analgesics on a weekly basis was 24.5%, less than monthly but more than weekly was 24.8%, monthly usage was 22.5%, and the percentage of participants who never use a analgesics was 14.6%. participants who used analgesics on the advice of a physician were 15.3%, while those who used analgesics on a pharmacist advice compromised 13.6%. those who used analgesics based on the experience of a family member or others were 34.8 and 47.4%, respectively (table 4). in addition, 13.1% of participants complained of increased headache severity or frequency on medication use. results also revealed that 22.0% of participants had increased their analgesic dose and 78.0% did not change their regimen. the most frequently used analgesic among participants was acetaminophen (78.00%), and to a lesser extent ibuprofen (7.49%) and aspirin (5.58%) (table 5). table 4approach to medication use among patients with headachevariablen (%) seeking medical help for headaches yes688 (17.3) no3,290 (82.7)advice on using analgesics physician609 (15.3) pharmacist541 (13.6) family1,383 (34.8) others (friends, co-workers, neighbors, etc.)1,887 (36.3)frequency of analgesics usage daily606 (15.2) fewer than daily to weekly974 (24.5) fewer than weekly to monthly985 (24.8) fewer than monthly to 1 year829 (22.4) no analgesics584 (14.6)increase in headache frequency after analgesic use yes520 (13.1) no3,458 (86.9)increase analgesic dose used over time yes877 (22.0) no3,101 (78.0)some participants have sought the advice of more than one categorytable 5frequency of analgesics use among headache patientsname of the analgesic usedn (%) acetaminophen3,103 (78.0)ibuprofen298 (7.5)aspirin222 (5.6)diclofenac sodium64 (1.6)naproxen25 (0.6)metamizole11 (0.3)mefenamic acid10 (0.3)ergotamine10 (0.3)others137 (3.5)note that some patients used more than one medication approach to medication use among patients with headache some participants have sought the advice of more than one category frequency of analgesics use among headache patients note that some patients used more than one medication in this study, we report for the first time an overall 1-year period prevalence of headache among adults in jordan. a sample (4,836) of participants were requested to complete a self-conducted screening questionnaire. as much as 82.3% of participants reported that they complained of headache at least once per year. this is much higher than the average global prevalence of headache (46%) [27, 28]. similar percentages were obtained from two studies conducted in other middle eastern countries namely oman and qatar, and from other developing and developed countries [3234]. on the other hand, one study conducted in oman showed a prevalence of headache of about 45%, however, that study was among university medical students and not the general population. in nearby saudi arabia, the prevalence of primary headaches ranged from 8 to 13% [30, 36, 37], which is much lower than that reported in all other studies from the middle east area. the higher prevalence of headache in jordan indicates that it is one of the major health problem. tension-type headache was found to be the most prevalent among other types of headaches (36.9% compared to 7.7% for migraine). the prevalence of tension-type headache, in this study, falls within the prevalence range previously reported from studies conducted in the middle east area (1139%) [29, 35, 38, 39]. additionally, the reported prevalence for tension-type headache, in this study, is lower than its global prevalence (about 42%), which seems to be the case for the whole middle east area. studies on migraine headache from other arab countries reported prevalence that ranged from 10 to 12.2% [29, 39, 40], which is higher than the migraine prevalence in our studied sample. as in the case of tension type headache, both the global migraine prevalence (about 11%), and the migraine prevalence in western europe (about 14%) is higher than that in jordan. therefore, jordan seems to have lower migraine prevalence than many other parts of the world. a recent study from nearby qatar reported a migraine prevalence of about 8.0%, which is very similar to the prevalence reported in the current study. the effect of headache on everyday activities was obvious in our study where a significant percentage (51.6%) of participants ascertained that headache adversely affected their daily activities. our results showed that 82.7% of participants did not seek medical attention for their headaches. in agreement with other s findings [29, 39], 75.6% of our population used analgesics and acetaminophen was the most popular (78.0%). the popularity of acetaminophen over other analgesics could be related to its availability as an over-the-counter medication, low price, and because it is known to be safe to the gastrointestinal tract. previous studies from jordan and surrounding countries reported smoking prevalence of about 2648%, depending on the gender, age and the specific population group studied [4144]. worldwide, the overall prevalence of smoking among adult males and females was estimated to ranges from 21 to 37% in the high-income countries, and 8.9 to 49% in low to middle income countries. therefore, the percentage of smokers obtained in this study is comparable to previous studies from the region and to low to middle income countries all over the world. according to data obtained form the jordanian department of statistics, about 38% of jordanian adult population falls into the age range of 1929 year, which is considered a high percentage of young adults. in this study, however, 74% of the studied sample falls within the range of 1829 years, and 47% of them were college students. therefore, the studied sample appears to be not population based, which is one limitation of the current study. another limitation is the fact that the sensitivity and specificity of the questionnaire was not tested. in summary, headache is a major health problem in jordan, where 82.3% of participants experienced troublesome headache attacks at least once per year. analgesic overuse without seeking medical advice is regarded as potential for development of chronic headache. these results indicate the need for public education to ensure safe practices and to make the use and selling of analgesics more stringent.

here, we investigated the prevalence of headache among adults in jordan. the study was conducted from january 2007 to november 2008. a sample of 4,836 participants were permitted to complete a self-conducted screening questionnaire. as much as 82.3% of participants complained from headache at least once per year. 36.1% were tension-type headache and 59% of the participants had other family members who suffered from headache. headaches affected everyday activities in 51.6% of the participants; 82.7% of participants did not seek medical attention for their headaches. among those who used analgesics (75.6%), acetaminophen was the most common (91.43%). in conclusion, headache and overuse of analgesics were prevalent in a significant part of the society. thus, there is a need to educate the public to ensure safe practices and to make the use and selling of analgesics more stringent.

PMC3451745

pubmed-153

posterior urethral valve (puv) is the most common cause of congenital bladder outlet obstruction in boys and causes renal failure in 25% to 30% of cases before adolescence. puv is associated with considerable morbidity, including urinary tract infection (uti), chronic renal failure, urinary incontinence, and even death [1-3]. the diagnosis is made on average in 1 in 1,285 fetal ultrasound screenings. as a result of recent prenatal diagnosis, improvements in respiratory support and resuscitation at birth, and adequate management of end-stage renal disease, the mortality rate in patients with puv has significantly decreased in the past four decades. endoscopic ablation of a puv is the current gold standard of therapy, but approximately 10% to 30% of patients require a second procedure to achieve satisfactory valve ablation [3,6-8]. as animal models have proven, even partial outlet obstruction can lead to structural and functional deterioration in the detrusor muscle and bladder if the obstruction is not released soon enough [9-11], which indicates the need for close follow-up after valve ablation. although studies about prognostic factors for outcome of renal function after puv ablation are available [8,12-15], to date, the effects of preoperative factors on the rate of residual valves have not been precisely addressed. in this study, therefore, we sought to evaluate any possible relationship between preoperative clinical and imaging findings of patients with puv and remnant leaflets after their valve ablation to identify high-risk patients and achieve purposive follow-up. we evaluated 64 patients with clinical evidence of puvs, confirmed by voiding cystourethrography (vcug), who were admitted between 2008 and 2012 at the shiraz university of medical sciences. preoperative evaluation included clinical examination, history of uti, serum electrolytes, urinalysis, complete blood count, urine culture, serum creatinine, and radiographic evaluation (vcug/ultrasonography and dimercaptosuccinic acid [dmsa] scan if necessary). of these patients, 9 did not participate in follow-up sessions and were excluded from our study. the median patient age at the time of diagnosis was 10.0 months (range, 5 days to 120 months). surgeon preference was to use an 11-fr pediatric resectoscope (karl storz gmbh&co. kg, tuttlingen, germany). when the urethra was too small for this instrument, a 3-fr ureteric catheter with a metal stylet was used. valves were ablated mainly at the 5, 7, and (in most cases) 12 o'clock positions. the end point of primary ablation was determined by visual assessment of destruction of the valve. a foley catheter was left in place and was removed 24 to 48 hours after valve ablation. we performed cystoscopy in all patients at a follow-up session, at least 3 months after valve ablation (range, 3-12 months). patients were divided into two groups on the basis of observation of obstructive residual leaflets in a second cystoscopy to analyze the possible preoperative factors that were related to obstructive remnant leaflets. group a had no evidence of obstructive remnant leaflets and in group b a second ablation was done owing to obstructive residual leaflets. we evaluated age at surgery, history of uti, level of serum creatinine and blood urea nitrogen, specific gravity of urine, hemoglobin, presence of scarring in the dmsa scan, vesicoureteral reflux (vur) and grade of reflux, renal parenchymal thickness, echogenicity of kidney, bladder wall thickness, renal cortical thickness, anteroposterior diameter of the renal pelvis, diameter of the distal ureter, and hydroureteronephrosis and side between groups. for statistical analysis, student t-test and mann-whitney test for quantitative numeric data comparison and chi-square test for categorical variables were adopted by using ibm spss ver. 19.0 (ibm co., armonk, ny, usa). follow-up cystoscopy was performed at least 3 months (range, 3-12 months) after primary valve ablation in 55 boys with a 6.75-f pediatric cystoscope (richard wolf gmbh, knittlingen, germany). a total of 37 patients (67.3%) had no significant remnant leaflets (group a), whereas 18 boys (32.7%) required a second ablation as a result of valve remnants. the valve remnants were ablated by use of an 11-f pediatric resectoscope (karl storz gmbh&co. kg) or a 3-fr ureteric catheter with a metal stylet. a pediatric resectoscope was used in 25 boys (67.6%) in group a and in 11 boys (61.1%) in group b, whereas in the other children a 3-fr ureteric catheter was applied. in both groups of patients, no significant statistical relationship was observed between method of ablation (resectoscope versus urethral catheter method) and remnant leaflets (p=0.764). the median ages at the time of ablation for groups a and b were 15 and 7 months, respectively (fig. 1). the mann-whitney test revealed a significant difference between the groups (p=0.017). other clinical data that we assessed demonstrated no significant differences in children with and without remnant leaflets after valve ablation and are summarized in table 1. radiographic characteristics of patients as shown by ultrasonography, dmsa scan, and vcug were collected retrospectively. sixteen patients had a dmsa scan and scarring was detected in all except one boy, with no significant predictive value for valve remnants (p=1). in vcug, vur and side and grade of reflux significant differences were shown in the presence of vur and grade 4 or 5 reflux (p<0.05). our review of the ultrasound studies showed that the echogenicity of the renal parenchyma separated into normal echogenicity and hyperechogenicity, and echogenicity was higher in 94.4% of the preoperative ultrasounds of patients with residual leaflets (p=0.000). data on renal parenchymal thickness, bladder wall thickness, renal cortical thickness (in the sagittal plane over a medullary pyramid, perpendicular to the capsule), hydroureteronephrosis and side of hydroureteronephrosis, anteroposterior diameter of the renal pelvis, and distal ureteral diameter demonstrated no influence on puv ablation outcome in our patients (table 2). most previous studies have focused on prognostic clinical and imaging factors in relation to the long-term outcome of renal function. to our knowledge, this is the first study to compare preoperative factors regarding the presence of postoperative obstructive leaflets. although endoscopic primary valve ablation is the preferred initial surgical treatment in most patients with puvs, the absence of obstructive residual valve remnants should be confirmed by careful clinical, radiological, and endoscopic evaluation after surgery. some investigators suggest vcug to confirm the adequacy of valve ablation, whereas others recommend cystoscopy follow-up in all patients. both methods have advantages and disadvantages such as transient dysuria, enuresis, hematuria, and toileting anxiety after vcug and the need for general anesthesia in cystoscopy and the more invasive nature of cystoscopy than repeated vcugs. whatever the method of follow-up, the necessity of post-ablation evaluation can not be undervalued owing to the high incidence rate of remnant leaflets of 10%-30% in most studies [3,6-8], even as high as 51.6% in one case series. to decrease the effect of technical components of the initial resection in the presence of residual valves, all surgeries in our study smeulders et al. reported that micturating cystourethrography alone is inexact for excluding residual valve tissue (positive and negative predictive value of 56% and 50%, respectively), so we routinely perform cystoscopy in all of our patients. given that there are no quantitative guidelines for the adequacy of valve ablation, our criterion was no visible obstructive residual valves in follow-up cystoscopy. the slightly higher rate of residual valves in our patients (32.7%) than in most cited studies (10% to 30%) [3,6-8] may have been because we applied follow-up cystoscopy in all patients after primary valve ablation, whereas others used follow-up cystoscopy only in cases with abnormal clinical or radiological findings. even though controversy exists about the role of age (at diagnosis and time of puv surgery), it has been mentioned as one of the predictive factors for renal outcome after valve ablation. we found no published studies that assessed age as a prognostic factor for remnant leaflets, but in our patients, age (at the time of surgery) showed a significant effect on the presence of residual leaflets in follow-up cystoscopy. the cause of this difference may be the narrower urethra in younger children, which limits the surgeon's visibility and complicates the endoscopic maneuver for puv ablation owing to fear of causing stricture. in any event, careful and closer follow-up in younger children seems necessary to achieve better long-term renal outcomes. besides age at diagnosis, of the other factors that we analyzed, echogenicity of kidney, presence of reflux, and grade of reflux differed significantly between the two groups (p<0.05). other studies have shown the hyperechogenicity of renal parenchyma as a factor that may help to predict long-time prognosis of renal insufficiency but did not comment on it as a factor affecting the consequences of valve ablation. in our patients, 17 boys (94.4%) with residual leaflets in follow-up cystoscopy showed increased renal echogenicity in comparison with 6 patients (16.2%) in the other group, with a p-value less than 0.05. in our patients, 33 children showed evidence of vur (16 boys in group a and 17 in group b) and the incidence of grade 4 and 5 reflux was significantly higher in patients with obstructive remnant leaflets (table 2). to exclude the tendency in infants to have more echogenic kidneys separate from renal function, we analyzed this factor in three age groups (under 12, 12 to 48, and over 48 months), which revealed a significant difference in the first two groups (p<0.05). we suppose that this statistical relationship may be due to longer and thicker valves preoperatively that caused more obstruction initially, which was followed by high grades of vur as well as hyperechoic kidney that persisted after the first ablation. the presence of vur and hyperechogenicity of the kidney can affect the long-term prognosis of renal function and should be considered in the management of patients with puv. method of ablation, renal parenchymal thickness, bladder wall thickness, renal cortical thickness, hydroureteronephrosis, anteroposterior diameter of the renal pelvis and ureter, serum creatinine, and history of uti demonstrated no relationship with residual leaflets in our patients. considering the lack of studies in this field, it seems that more research is inevitable to facilitate proper screening and the detection of patients with residual leaflets. the need for confirmation of complete resection of puv is undeniable because valve remnants may result in persistent outflow obstruction or renal failure through time and should be detected quickly to minimize the deterioration of kidney or bladder function. the timing of follow-up sessions in most studies is 3 to 6 months after ablation. however, owing to decreases in function and structural deformities in the bladder as a result of partial obstruction, even after as short a period as 2 weeks in animal models [9-11], earlier follow-up in the first month after ablation, especially in patients at high risk of residual valves, seems more advantageous. there may be other operative or preoperative factors, in addition to those we evaluated in our study, with the potential to affect the end result of initial valve ablation and residual leaflets. the results of such research can help to provide a better algorithm for management of puvs and achieve purposive follow-up for high-risk patients instead of invasive procedures. younger age at surgery time, hyperechogenicity of the renal parenchyma, presence of vur, and grade of reflux before surgery in our patients had a significant relationship with residual valves, but more research is needed to confirm these results. more studies may result in enhanced management of patients at high risk of residual valves after puv ablation, because the sooner the obstruction is entirely resolved, the better the long-term outcome.

purposeto find patients at high risk of obstructive remnant leaflets after valve ablation among boys with posterior urethral valve (puv), we evaluated any possible relationship between preoperative findings in our patients and residual obstructive leaflets after valve ablation. materials and methodswe retrospectively reviewed the medical records of 55 patients with puv that was treated by the same surgeon between 2008 and 2012. of these, 37 patients (67.3%) had no obstructive remnant leaflets (group a) and 18 patients (32.7%) had obstructive remnant leaflets (group b) in follow-up cystoscopy. preoperative clinical and radiological findings were evaluated and compared between the groups. resultsamong all the preoperative data we examined, the analysis revealed that age at the time of surgery (median age: group a, 15 months; group b, 7 months; p=0.017), echogenicity of kidneys (p<0.05), presence of vesicoureteral reflux (p<0.05), and grade of reflux (p<0.05) were significantly different between the groups. method of valve ablation, anterior-posterior diameters of the renal pelvis, renal cortical thickness, bladder wall thickening, and scarring on the dimercaptosuccinic acid scan showed no significant differences between the two groups. conclusionsin our patients, younger age at surgery time, hyperechogenicity of renal parenchyma, presence of vesicoureteral reflux, and grade 4 or 5 reflux before surgery had a significant relationship with residual valves. more studies may result in enhanced management of patients at high risk of residual valves after puv ablation, because the sooner the obstruction is resolved entirely, the better the outcome.

PMC3897633

pubmed-154

white spot lesions are areas of demineralized enamel that represent an early stage of caries, since they can progress to cavitated lesions if untreated. the demineralization process can be arrested or reversed by noninvasive means, including oral hygiene counselling and/or topical fluoride application [2, 3]. therefore, early detection of white spot lesions (wsls) is desirable since early preventive treatment can avert the need for future restorative treatment. new technologies such as the diagnodent and quantitative light fluorescence (qlf) devices have been developed for the detection of early carious lesions. these techniques are intended to be adjuncts to clinical decision making and aid in planning preventive treatment. despite the potential of these methods, the results from these tools are affected by confounding factors in the oral environment, thereby compromising the sensitivity and/or specificity of these techniques. for example with the diagnodent, stain, calculus, plaque, as well as developmental hypomineralization can produce a fluorescence output that results in false-positive readings. a review of the literature evaluating the diagnodent device found that, compared to visual assessment methods, the sensitivity was consistently higher but the specificity was lower, concluding that the increased risk of false-positives limits its clinical usefulness. for qlf, stain, plaque, fluorosis, or any developmental hypocalcification results in false-positives [811]. composite resins pit and fissure sealants as well as prophy pastes could also lead to false-positive results. clearly, a new technology is needed that will not be affected by factors in the oral environment. a new optical approach to detect white spot lesions clinically is jointly being developed at the national research council of canada-institute for biodiagnostics, the university of manitoba and dalhousie university, using a combination of optical coherence tomography (oct) and polarized raman spectroscopy (prs). oct is a nondestructive technique for high-resolution (1020 m) depth imaging that gives information about the morphology and depth of white spot lesions up to 3 mm into enamel. this method is similar to ultrasound technology, but instead of sound waves, light waves are utilized and the imaging is limited to near-surface tissues. changes in the refractive indices of structures cause light backscattering, creating an image that is different for sound enamel and demineralized enamel. prs is a noninvasive spectroscopic method that provides details on the biochemistry and molecular structure of white spot lesions. the energy difference between the incoming excitation light and scattered photons is proportional to the vibrational energy of molecules within the sample being studied, known as the raman effect. the caries process results in biochemical and structural changes that can be followed by prs, which uses scattered light to determine differences between the mineral matrix of sound enamel and demineralized enamel. our previous studies have shown that oct and prs can be used to distinguish sound enamel from white spot lesions (wsls) ex vivo [14, 15, 17]. however, the effects of calculus, hypocalcification, and stain on oct and prs have yet to be established. by combining oct and prs, false-positive results from one technology can potentially be eliminated, thereby increasing the sensitivity and specificity of the new method. calculus consists of an organic matrix with the inorganic components of dicalcium phosphate dehydrate (dcpd), hydroxyapatite (ha), octacalcium phosphate (ocp), and -tricalcium phosphate (tcp). raman spectra of human enamel are characterized by a main peak at ~959 cm arising predominantly from the symmetric phosphate groups in carbonated hydroxyapatite, the major mineral component of dental enamel [18, 19]. clinically, hypocalcification appears visually similar (chalky white) to a wsl and must be differentiated from a wsl since hypocalcification is a developmental defect that does not need to be treated. in hypocalcified enamel, the crystals are arranged normally but there are pores due to larger spaces between enamel rods. intrinsic stain occurs during tooth development due to alterations in the structure or thickness of enamel or dentin, extrinsic stain accumulates on the acquired pellicle, and internalized stain occurs when extrinsic stain is incorporated into areas of enamel defects after tooth development. the objective of this study was to determine whether calculus, hypocalcification, and stain are confounding factors affecting wsl detection with optical coherence tomography and polarized raman spectroscopy. postextraction, the teeth were rinsed with water and clinically examined by two clinicians independently. samples were separated into 5 groups: sound enamel, wsls, calculus, hypocalcification, and stained enamel. figure 1 is a diagrammatic representation of sample sizes and allocation criteria for the above groups. since patient histories were not available, it can not be determined if hypocalcified enamel was caused by excess ingestion of fluoride; therefore, this category is referred to as hypocalcification. figure 2 is a diagrammatic summary of data collection and analyses with oct and prs. a humphrey's system 2000 optical coherence tomography scanner (zeiss humphrey systems, dublin, ca, usa) operating at 850 nm was used for oct measurements. for all data, the laser was focused to the thinnest line on the tooth surface and the scan length was 2.0 mm. three scans were collected across the area of interest with the proximal surface of interest oriented perpendicular to the laser beam. three vertical scans were also taken of sound enamel on the same tooth surface for comparison. oct images had display resolutions of 500 100 pixels, and transverse resolutions of 1020 m. figure 3(a) displays a photo of a tooth being scanned with the oct system (laser scan line circled) with the corresponding 2-dimensional depth image of sound enamel (figure 3(b)). matlab software (the mathworks, natick, ma, usa) was used to plot oct images. a labramhr raman microspectrometer (horiba jobin yvon, edison, nj, usa) the laser excitation was 830 nm and a 10x microscope objective was used (power at the sample was 125 mw) with an acquisition time of 5 seconds and 6 accumulations. on each surface, point measurements were taken with parallel- (p1) and cross- (p2) polarizations at a minimum of three different points. raman data were analyzed using matlab software to calculate the depolarization ratios (i/i), where i is the area under the raman band from 9251000 cm for cross-polarization (p2), and i is the similar area for parallel-polarization (p1). this wavenumber range was used since it centres at 959 cm (the main peak due to phosphate groups such as those found in apatite). two-dimensional oct images are shown of sound enamel (figure 3(b)) and a wsl (figure 4(a)). in the sound enamel image, there is intense light backscattering at the tooth-air interface, and no significant signal with depth into the enamel. in contrast, the oct image of a wsl shows significant light backscattering beneath the surface with a triangular shape characteristic of a subsurface lesion as observed on histological sections. the two-dimensional oct image displayed as figure 4(b) shows a deposit of material on the tooth surface that is attributed to calculus. the oct image of hypocalcification in figure 4(c) shows diffuse light back-scattering and a more irregular subsurface pattern of scattering across the entire region scanned compared to sound enamel. the light back-scattering of hypocalcified regions is also more irregular than wsls, which have a characteristic triangular shape. the oct image of stained enamel in figure 4(d) demonstrates increased light backscattering when compared to sound enamel, but again there is no triangular-shaped subsurface light back-scattering as observed with wsls. average raman depolarization ratios () from the various groups are depicted in a box-and-whisker plot (figure 5). in order to determine whether the mean depolarization ratio values of the various groups were statistically significant from one another, a one-way analysis of variance (anova) followed by unequal n hsd post-hoc comparisons (statistica) was performed (table 1). it was determined that the mean values were statistically significant in all cases at p<.05 except for three cases. sound enamel was not statistically significant from hypocalcified enamel, carious enamel was not statistically significant from stained enamel, and lastly stained enamel was not statistically significant from hypocalcified enamel. in raman spectra acquired from areas of stain (figure 6), there is a large background sloping fluorescence that is not observed in spectra from areas of sound enamel or wsls without stain where these spectra have a flat background. the development of new technologies for wsl assessment requires that these devices undergo clinical validation prior to becoming an accepted clinical method. in addition to demonstrating the performance of these methods for providing high sensitivity for wsl detection, high specificity is also desirable. optical coherence tomography and polarized raman spectroscopy are methods that potentially can address the need for a technology with high sensitivity and high specificity. to date there are no studies outside our research group that investigate a combination of oct and prs to detect wsls, and in particular the effects of the calculus, stain, or hypocalcification on the utility of these two technologies. oct imaging allows differentiation of sound from demineralized enamel on the basis of the characteristic triangular shape of the back-scattered signal beneath the tooth surface in images of wsls. this subsurface scattering pattern is believed to be due to wsls having porous enamel matrices, allowing incident light to travel further into the enamel and causing more scattering to occur, which is detected by the oct system. when calculus is present, it appears clearly as a deposit in the two-dimensional oct image. similar to conventional caries assessment methods, scaling of calculus is recommended before an assessment is made using oct and prs. oct can possibly be used to alert the clinician when calculus is still present in the region of interest and that further scaling is necessary. oct images of hypocalcification can be differentiated from wsls, since the light back-scattering found with hypocalcification is more irregular than wsls and lacks the characteristic triangular shape. to some extent, hypocalcification can be differentiated from sound enamel with oct since hypocalcification has a more irregular pattern of scattering at the surface and subsurface compared to sound enamel. although areas of stain are not easily distinguishable from hypocalcified enamel or sound enamel with oct, they can be readily differentiated from wsls because areas of stain lack the subsurface triangular-shaped back-scattering pattern characteristic of wsls. further image analysis is required to nonsubjectively distinguish sound enamel from stained and hypocalcified enamel. statistical analysis revealed that mean raman depolarization ratios were statistically significant in all cases at p<.05 except for three cases: (a) sound enamel compared to hypocalcified enamel, (b) carious enamel compared to stained enamel, and (c) stained enamel from hypocalcified enamel. since hypocalcified enamel can be mistaken for wsls upon visual clinical examination, it is reassuring that the raman depolarization values from hypocalcified enamel are distinct from caries, thereby increasing the specificity of the method. based on the analysis focusing on the depolarization ratio of the 959 cm peak, hypocalcified enamel could not be distinguished from sound enamel. this observation indicates that, fundamentally, hypocalcified enamel is like healthy sound enamel and not in need of treatment. in order to make this separation, further studies are needed which include examining the peak positions and peak width of the phosphate hydroxyapatite peak, which have been shown to be affected by the mineral crystallinity. furthermore, other peaks could be surveyed to look for peaks characteristic of specialized forms of hypocalcification such as fluorosis. the analyses indicate that stain complicates the use of prs for discriminating stained sound enamel from carious enamel. in reviewing the raman spectra acquired from areas of stain, it is observed that stained sound enamel spectra show a large background fluorescence that is not found in spectra from areas of sound enamel or wsls without stain. in these preliminary analyses, a straight-line background in the region of the peak was simply subtracted for calculating the areas under the peak. clearly, this initial approach is not enough as the curved background confounds this calculation. further studies are consequently required using various algorithms to robustly fit the fluorescence background for elimination. in addition, there are various instrument-based methods proposed to suppress the background fluorescence in raman spectra. with fluorescence-based devices (diagnodent, qlf), stain chromophores from any source with prs, the fundamental basis of the method is the phosphate moieties specific to the dominant hydroxyapatite component from the mineral matrix. this peak itself is not due to staining and provides information on mineralization states as required for a method to detect demineralization in caries development. therefore, with improved methods for fluorescence background subtraction/suppression, it is anticipated that staining will no longer confound prs analyses. the statistical analyses also indicated that, based on the raman depolarization ratio, stained sound enamel can not be distinguished from hypocalcified enamel. this is also not surprising since both groups are overall noncarious intact enamel with one group containing extrinsic staining. the underlying biochemistry of the enamel matrix is largely similar in both cases as revealed by the raman spectra. subsequent analyses such as those described above for examining spectra of hypocalcified enamel could provide insights for discriminating these two groups. this result suggests that, like regions of demineralization, the apatite in areas of calculus has a disordered crystal structure and orientation as shown by higher depolarization ratio values. calculus is easily observed on the oct image, and therefore oct will be the first technology used with the fibre optic probe to screen for wsls and to determine whether prs analysis of the lesion is necessary. if calculus is detected on the oct image, the area will be scaled before the prs method is applied to determine the raman depolarization ratio. by combining oct and prs technologies, it is possible to rule out false-positive readings that might occur from using raman depolarization ratios alone. furthermore, according to the box- and whisker- plot (figure 4), setting a depolarization ratio threshold of ~0.18 can help discriminate carious enamel from enamel with a calculus deposit. it is important to note that this study was limited to extracted human teeth. in the oral environment, there will be a combination of many possible confounding factors present, and an additive effect may result in the oral cavity that was not observed when testing the possible confounding factors separately. these issues will be addressed in our subsequent studies as we transition to using fibre-optic-based devices for in vivo measurements with patient volunteers. in conclusion, calculus and hypocalcification stain does not influence wsl detection with oct. with improved analysis methods, the current limitations with prs analysis in the presence of stain the combination of oct and prs technologies can decrease the risk of false-positive reading and increase the potential for the detection of wsls with high sensitivity and specificity. this initial study has pointed out limitations that should be taken into consideration when using these methods and highlighted further analyses that need to be undertaken to better understand the effects of calculus, hypocalcification, and stain on oct and prs technologies .

optical coherence tomography (oct) and polarized raman spectroscopy (prs) have been shown as useful methods for distinguishing sound enamel from carious lesions ex vivo. however, factors in the oral environment such as calculus, hypocalcification, and stain could lead to false-positive results. oct and prs were used to investigate extracted human teeth clinically examined for sound enamel, white spot lesion (wsl), calculus, hypocalcification, and stain to determine whether these factors would confound wsl detection with these optical methods. results indicate that oct allowed differentiating caries from sound enamel, hypocalcification, and stain, with calculus deposits recognizable on oct images. anova and post-hoc unequal n hsd analyses to compare the mean raman depolarization ratios from the various groups showed that the mean values were statistically significant at p<.05, except for several comparison pairs. with the current prs analysis method, the mean depolarization ratios of stained enamel and caries are not significantly different due to the sloping background in the stained enamel spectra. overall, calculus and hypocalcification are not confounding factors affecting wsl detection using oct and prs. stain does not influence wsl detection with oct. improved prs analysis methods are needed to differentiate carious from stained enamel .

PMC2905912

pubmed-155

microglia account for approximately 10% of the adult brain cell population and represent the first and main form of immune defense in the central nervous system (cns; lawson et al. microglia become activated and they can be identified and distinguished from their resting phenotype based on a combination of morphological and immunophenotypic changes (dheen et al., 2007; ransohoff and perry, 2009). microglia initiate immune responses by enhancing the expression of toll-like receptors (tlr) and a wide range of pro-inflammatory mediators such as tumor necrosis factor-alpha (tnf), interleukin (il)-1 and il-6 for the removal of the cns threat (suzumura et al., 1996; microglia may also fulfill a neuroprotective role via the release of neurotrophic factors and promotion of neurogenesis for the restoration of normal physiology (stadelmann et al., 2002). hence, the acute inflammatory response is generally beneficial, as it tends to minimize injury and promotes tissue repair. however, chronic neuroinflammation is closely related to various neurodegenerative disorders such as parkinson s disease (pd), huntington s disease (hd), dementias, and multiple sclerosis (ms), although the consequences of sustained microglial activation in these diseases is unclear. activated microglia upregulate expression of the 18-kda translocator protein (tspo; chen and guilarte, 2008; cosenza-nashat et al. tspo are found in abundance throughout the body in peripheral organs (i.e., liver and adrenals), and hematogenous cells, but are present at very low levels in the normal healthy cns (banati, 2002). functionally, tspo has several biological functions including the control of cholesterol transport and neurosteroid synthesis (papadopoulos et al., 2006), and may also be involved in the release of pro-inflammatory cytokines during inflammation (choi et al., 2002; wilms et al., enhanced tspo expression can be detected in vivo by using positron emission tomography (pet) imaging with the selective tspo radioligand c-pk11195 (benavides et al., 1993; banati et al., 1999), with evidence that increases in c-pk11195 binding potential (bpnd) correspond to activation of microglia (stephenson et al., 1995; conway et al. although tspo is also expressed by reactive astrocytes, a c-pk11195 pet study of patients with hippocampal sclerosis, a condition histopathologically characterized by marked astrogliosis, did not yield results that were significantly different to healthy normal controls (banati et al. this is consistent with the view that reactive astrocytes, in vivo, do not significantly contribute to the c-pk11195 signal. therefore, in the absence of invading blood borne cells or severe focal leakage of blood-brain barrier, the increased pk11195 binding is likely to indicate the transition of microglia from a resting to an activated state, and is due to an increase in the number, rather than the affinity, of tspo (banati et al., 2000). hence, the measurement of tspo uptake using pet provides an in vivo tool to monitor progression and severity of neuroinflammation and is a useful indicator of active cns disease. this article aims to review the use of pet imaging to promote the understanding of activated microglia in neurodegenerative disease. parkinson s disease is the second most common neurodegenerative disorder of the elderly and is associated with the motor symptoms of tremor, bradykinesia, and rigidity. it is characterized by the extended loss of dopaminergic neurons in the substantia nigra pars compacta, resulting in a deficiency of dopamine in the striatum (braak et al., 2006), and the presence of alpha-synuclein (-synuclein)-containing lewy bodies. pd is the most common of a group of parkinsonian movement disorders that also includes multiple system atrophy (msa), corticobasal degeneration (cbd), and progressive supranuclear palsy (psp). the presence of activated microglia close to dopaminergic neurons in post-mortem pd patient brains (mcgeer et al., 1988a; mogi et al., 1994; langston et al., 1999; imamura et al., 2003), and pd animal models (czlonkowska et al., 1996; kim et al., 2009) suggests a close relationship between neurodegeneration and neuroinflammation in pd. numerous investigations have proposed a deleterious role of microglial activation in pd based on the vulnerability of dopaminergic neurons to various microglia-derived pro-inflammatory cytokines (ferrari et al., 2006; stone et al., 2009; de lella ezcurra et al., 2010), while -synuclein can directly induce activation of microglia (zhang et al., 2005). however, it seems that the plasticity of microglia must be considered with regards to their contribution in pd, and their role; whether beneficial or detrimental, it may depend on the stimuli present and the stage of disease (li et al., 2007; michelucci et al., 2009; sanchez-guajardo et al., further clues regarding the role of activated microglia has also come from in vivo pet imaging studies (table 1). significant microglial activation, as reflected by an increase in c-pk11195 bpnd was reported in the midbrain and putamen of pd patients when compared to controls, and was found to correlate positively with the motor severity of parkinsonism (ouchi et al., 2005; bartels et al., 2010 these findings suggest that activated microglia has a pathogenic importance in the disease and indicate that the early introduction of a neuroprotective drug to suppress microglial activation could be favorable in pd. additionally, pd patients exhibited significantly increased c-pk11195 bpnd in the basal ganglia, pons, and frontal and temporal cortical regions (gerhard et al., 2006a). in this study, the increased microglial activation remained unchanged for 2 years, while the patients deteriorated clinically during this period. hence, it is likely that microglia are activated early in pd, where they remain activated for longer periods and possibly drive progression of the disease (gerhard et al., 2006a). bpnd, binding potential; cbd, corticobasal degeneration; msa, multiple system atrophy; nc, normal control; pd, parkinson s disease; psp, progressive supranuclear palsy. multiple system atrophy is a sporadic neurodegenerative disorder involving a progressive akinetic-rigid syndrome, autonomic failure, and cerebellar dysfunction. it is associated by the appearance of abnormal glial cytoplasmic inclusions (gci) containing (-synuclein aggregates and neuronal loss within the nigrostriatal and olivopontocerebellar regions (lantos and papp, 1994). the presence of activated microglia is also a prominent feature of msa (schwarz et al., 1998). in an in vivo pet study of msa patients, significant c-pk11195 bpnd was observed in the putamen, pallidum, pons, substantia nigra pars compacta, and dorsolateral prefrontal cortex, reflecting the known distribution of neuropathological changes in msa (gerhard et al., 2003). although the role of microglia in msa is inconclusive, microglial activation localization correlated significantly with the locations of gcis in specific neuroanatomical systems affected in msa (ishizawa et al., 2004). a correlation between extent of microglial activation and dopaminergic neurodegeneration has also been reported (stefanova et al., 2007). progressive supranuclear palsy is an adult-onset progressive neurodegenerative disease of unknown cause, characterized by pd-like symptoms such as postural instability and bradykinesia. the pathological hallmark of the disease is neurofibrillary tangles consisting of hyperphosphorylated tau, accompanied by neuronal loss in the thalamus, basal ganglia, and specific brainstem regions (hauw et al. several early studies including immunohistochemical investigations have confirmed the possible involvement of activated microglia in psp (kida et al., 1992; komori et al., 1998; ishizawa et al., 2000; ishizawa and dickson, 2001). c-pk11195 pet have also reported significant levels of activated microglia in brain regions known to be affected by the disease process such as the midbrain, cerebellum, pons, frontal lobe, and basal ganglia (gerhard et al., 2006b). although these results were unable to support a direct causal contribution to neurodegeneration in psp, they are at least suggestive of a role of microglia in the disease. corticobasal degeneration is a neurodegenerative disorder that affects both cortical and basal ganglial regions, with considerable clinical heterogeneity between patients. typically, cbd features an asymmetric hypokinetic-rigid syndrome, coupled with alien limb phenomenon and cortical sensory impairment that is unresponsive to dopaminergic therapy (rebeiz et al., 1968; gibb et al., 1989 information on the association of activated microglia in cbd is limited, and mainly coming from immunohistochemical-based assessments (armstrong et al., 2000; ishizawa and dickson, 2001). however, more recent in vivo pet investigations have attempted to quantify microglial activation in cbd patients. increased c-pk11195 bpnd was observed in regions such as the caudate nucleus, putamen, substantia nigra pars compacta, pons, and pre- and post central gyrus (gerhard et al. 2004) that correspond to the expected neuropathological changes seen in cbd (ishizawa and dickson, 2001; dickson et al., 2002). huntington s disease is an autosomal, dominant inherited progressive neurodegenerative disorder associated with motor, cognitive, and psychiatric symptoms. it is caused by an abnormal polyglutamine-repeat expansion on the it15 gene that codes huntingtin, and involves the progressive loss of medium spiny dopaminergic receptor-bearing striatal gaba-ergic neurons (vonsattel and difiglia, 1998). although the role of chronic neuroinflammation in the hd pathogenesis is not fully understood, post-mortem assessments have reported high levels of activated microglia close to degenerating neurons (mcgeer et al. upregulated inflammatory cytokines have also been detected in the striatum and plasma, indicative of an inflammatory component in hd (dalrymple et al., 2007; imaging studies using c-pk11195 pet have found increased microglial activation in both premanifest hd gene carriers and manifest hd patients when compared to healthy controls (table 2; pavese et al., 2006; tai et al., 2007; politis et al., 2008, 2011). in premanifest hd patients, significant increases in c-pk11195 bpnd in the striatum and hypothalamus was reported, which correlated inversely with neuronal dysfunction as measured by c-raclopride; a marker of dopaminergic d2/d3 receptor availability (tai et al., 2007; politis et al., 2008). interestingly, microglial activation in the striatum, and regions related to cognitive function has been shown to predict the 5-year disease clinical onset in premanifest hd patients (tai et al. these results imply that microglial activation is an early event in the hd disease course, with a possible pathogenic involvement that is associated with a subclinical progression of the disease. bpnd, binding potential; hd, huntington s disease; nc, normal control. in manifest hd patients, significant c-pk11195 bpnd in the striatum, hypothalamus, and various cortical regions was found, that correlated with greater disease burden and higher motor disability (pavese et al. the cortical microglial activation is likely to indicate the involvement of cortical neurons in hd, a well-recognized phenomenon as the disease progresses. collectively, these findings are consistent with the post-mortem studies (messmer and reynolds, 1998; sapp et al., 2001) and suggest a detrimental microglial contribution to the ongoing neuronal degeneration in hd. dementias are a group of disorders that are expected to affect more than 100 million people by 2050 raising remarkable financial costs for healthcare (wimo et al., 2003). ad is the most common cause of dementia and is the most common neurological disorder of the elderly. ad is characterized by the presence of amyloid plaques, neurofibrillary tangles, and activated microglia (for review, see hardy and selkoe, 2002). there is a plethora of evidence from post-mortem human ad studies (mcgeer et al., 1988a; venneti et al., 2009) and animal models (frautschy et al., 1998; stalder et al, 1999; leung et al., 2011) reporting a high accumulation of activated microglia in close proximity with the amyloid plaques, and upregulated levels of pro-inflammatory cytokines (akiyama et al., 2000; eikelenboom et al., positron emission tomography enables a broad range of functional processes to assess the ad brain in vivo (table 3). c-pk11195 has been used to demonstrate increased levels of activated microglia in both ad animal models (venneti et al., 2009) and ad patients (cagnin et al., 2001; edison et al., 2008; yokokura et al., 2011). in ad patients, significant c-pk11195 bpnd was consistently observed in the temporal, parietal, and occipital cortices, regions known to be affected by ad pathology (cagnin et al., 2001; the increased activated microglia also inversely correlated with the patient mini-mental state examination (mmse) scores, which is compatible with a role of microglia in neuronal damage (edison et al., 2008). interestingly, elevated levels of activated microglia were also detected in patients with amnestic mild cognitive impairment (mci; okello et al., 2009a), although this was not observed in another study assessing mci patients (wiley et al. mci could represent an early precursor stage of ad, since it was found that mci patients with increased amyloid load were significantly more likely to clinically convert to ad within 3 years (okello et al., 2009b). therefore, microglial activation could be an early event in the ad pathogenesis that begins at the mci stage. ad, alzheimer s disease; bpnd, binding potential; ftld, frontotemporal lobar degeneration; mci, mild cognitive impairment; mmse, mini-mental state examination; nc, normal controls. despite the evidence suggestive of a pathogenic role of activated microglia in ad, it is hypothesized that the accumulation of amyloid plaques is actually due to a failure in microglial clearance mechanisms that would normally remove the protein (bornemann et al., 2001; this indicates a beneficial, rather than detrimental role of microglia in ad. notwithstanding the abundance of activated microglia close to senile plaques, they maybe inefficient in the clearance of amyloid, hence, resulting in aggregate formation (bolmont et al., 2008). it has been shown that in the presence of pro-inflammatory cytokines, phagocytic functions of microglia are compromised (koenigsknecht-talboo and landreth, 2005). therefore, microglia may confer a dichotomous role in ad, where early microglial activation is possibly neuroprotective involving the removal of amyloid. however, chronic neuroinflammation may downregulate amyloid clearance mechanisms, thus, promoting aggregation and progression of disease. frontotemporal lobar degeneration (ftld) which includes frontotemporal dementia is the name given to a group of pathologically, clinically, and genetically heterogeneous disorders involving focal atrophy of the frontal and temporal lobes, while unlike ad, with sparing of the parietal and occipital regions (neary et al., 1998). another important dissimilarity between ad and ftld pathology is the absence of amyloid plaque formation (paulus et al., 1993; rather, the key histopathological features of ftld, depending on subtype, includes tau deposition (including pick bodies) and ubiquitin-positive, tau-negative inclusions (munoz et al., 2003; uchihara et al., 2003). in vivo pet imaging of ftld patients detected enhanced microglial activation in the expected frontotemporal regions (cagnin et al., 2004). in the same study, significant c-pk11195 bpnd in the bilateral putamen is also consistent with previous neuropathological data showing the involvement of the basal ganglia in ftld (mirra and hyman, 2002). these observations indicate the presence of an active microglial response that reflects progressive neuronal degeneration. importantly, the detection of increased microglial activation in affected regions in ftld suggests that microglial responses occur independently of amyloid deposition, and that neuronal loss alone is enough to induce activation (cagnin et al., 2004). multiple sclerosis is a disease characterized pathologically by inflammatory demyelination and axonal transection, and is the most common cause of non-traumatic disability in young adults (compston and coles, 2008). the involvement of activated microglia has long been proposed in ms (benveniste, 1997). post-mortem investigations have detected activated microglia in the cortical gm of ms patients (de groot et al. 2002), while histopathological studies have implicated microglia in lesion pathogenesis (for review, see lassmann, 2008). an observed correlation between neuronal loss and microglial activation was reported in animal experimental ms (rasmussen et al., 2007). significant levels of activated microglia was also found in ms patients, especially in the progressive forms of disease that are associated with neurodegeneration (kutzelnigg et al., 2005; magliozzi et al., 2010), and selective ablation of parenchymal microglia was able to prevent demyelination and axonal damage (heppner et al., 2005). pathological aspects of ms such as neuroinflammation, demyelination, and neurodegeneration may be explored in vivo with pet (for review, see kiferle et al., 2011). pet with c-pk11195 and other tracers has demonstrated inflammatory processes with microglial involvement in ms (figure 1; table 4). in animal experimental ms and human post-mortem brains it has been shown that c-pk11195 uptake corresponds to the distribution pattern of activated microglia (banati et al., 2000). it has also been demonstrated that there is increased c-pk11195 bpnd in areas of focal pathology identified by t1- and t2-weighted mri (vowinckel et al., 1997; banati et al., 2000) and in gadolinium-enhanced t1-weighted mri (debruyne et al., 2003). increased c-pk11195 bpnd was observed in normal-appearing gray and white anatomical structures (banati et al. this is in line with the hypothesis that inflammatory processes initiated by microglia early in ms may constitute the real burden of disease, associated with invisible microglia-mediated damage that occur independently of relapses (kesselring, 1990; confavreux et al., 2000). a positive correlation has been suggested between ligand uptake and disease duration, disability, and brain atrophy (banati et al., 2000; however, recent data from our group found a significant association between high c-pk11195 bpnd in the cortical gray matter and disability in patients with secondary progressive ms, and with higher c-pk11195 bpnd in the secondary progressive group than the relapse-remitting ms group (politis et al. enhanced microglial activation in ms has also been detected using the more recently developed tspo tracers c-vinpocetine and c-pbr28 (vas et al., 2008; oh et al., 2011). positron emission tomography images showing increased c-pk11195 bpnd in a multiple sclerosis patient (a) when compared to a healthy normal control (b). color bar represents intensity of c-pk11195 tracer binding (bpnd). bpnd, binding potential; gm, gray matter; mri, magnetic resonance image; ms, multiple sclerosis; nawm, normal-appearing white matter; nc, normal control; pp, primary progressive multiple sclerosis; rr, relapse-remitting multiple sclerosis; sp, secondary progressive multiple sclerosis. microglial activation may contribute to the mechanism of axonal injury via the release of soluble factors that may either directly or indirectly cause neuronal dysfunction (peterson et al., 2001; barnett and prineas, 2004; dutta and trapp, 2006; zipp et al., 2006; dal bianco et al., 2008; lassmann, 2008; magliozzi et al., 2010), however, activated microglia may also exert protective functions with ms through the release of neurotrophic factors (stadelmann et al., 2002; napoli and neumann, 2009), and triggering of remyelination mechanisms (li et al., 2005; setzu et al., c-pk11195 was the first tracer to be consistently used for the study of activated microglia and neuroinflammation in vivo. however, limitations associated with the application of c-pk11195 include a high level of non-specific binding (petit-tabou et al., 1991), and a poor signal to noise ratio, which complicates its quantification (boutin et al., 2007). this has prompted the search for novel pet tracers (termed, second generation radioligands) with improved capacities to quantify tspo expression. radioligands such as c-pbr28, c-daa1106, f-fedaa1106, and f-pbr111 have recently been developed to image tspo in vivo (gulys et al., 2002; ikoma et al., 2007 ;, 2011; for a review, see chauveau et al., 2008). published data using the second generation ligands c-daa1106 (ikoma et al., 2007) and f-fedaa1106 (fujimura et al., 2006) in humans were promising, with both tracers showing significantly higher cerebral uptake than c-pk11195. furthermore, increased c-daa1106 binding was reported in ad patients (yasuno et al., 2008) that were similar to the previous studies that used c-pk11195 (cagnin et al., 2001). the only published study using the second generation radioligand c-pbr28 found areas of focal increases in radiotracer binding in the brain of ms patients (oh et al., 2011) interestingly, the increased focal c-pbr28 binding preceded the development of some gadolinium-enhancing lesions. brain parenchymal c-pbr28 binding in ms patients was positively correlated with the duration of the disease, however it was not significantly higher than that of healthy volunteers. interpretation of these results is limited by the lack of characterization of the binding affinity pattern, which might have significantly affected the comparison between subjects. it has been recently demonstrated that there are three different affinity patterns for second generation tspo ligands in healthy volunteers as well as patients with ms, which was evident with all the ligands tested (c-pbr28; c-pbr06; f-pbr111; owen et al., 2010). this presents a methodological problem, as differences in pet signal across subjects can not be safely interpreted as differences in target density, but may reflect differences in the affinity pattern. a possible approach to solve this problem is based on the use of peripheral binding affinity, which can be characterized to classify subjects into one of the groups, as differences in affinity status between individuals have been shown to be present on peripheral cells as well (owen et al. interestingly, the difference in binding patterns observed with second generation radioligands was not observed with c-pk11195. also, in vitro autoradiography data using c-pk11195 suggest a receptor density (bmax) significantly higher than that found using second generation ligands. it could be speculated that c-pk11195 and newer ligands bind to distinct sites within the tspo molecule. although, data obtained from first generation studies have been promising and suggested that c-pk11195 could be useful to image acute inflammatory lesions and microglial activation in ms, a conclusive demonstration of the potential of tspo imaging for the application as disease biomarker, indicative of microglial activation in ms, is still lacking. furthermore, despite second generation ligands constituting a potential improvement relative to c-pk11195 at least from a methodological point of view, a clear advantage in their clinical application as disease biomarkers has not been demonstrated yet. for these reasons, we aim to characterize a second generation tspo pet radioligand in vivo in humans, and to evaluate its application as a disease biomarker in ms. among second generation tspo tracers, f-pbr111 presents different advantages, as there is low difference in its affinity for tspo between high, medium, low affinity binders. also, it could be potentially used in clinical applications as it is labeled with fluorine-18. promising preclinical data, and ongoing studies in neurological patients, suggest it could be a good choice amongst second generation tspo ligands to progress into studies in ms patients. inflammation coupled with the presence of activated microglia seems to be a common feature of a wide range of cns diseases. however, despite a large number of research studies, the exact role of microglia in chronic neurodegenerative diseases remains uncertain. in line with the high plasticity of microglia that allows them to perform numerous cns functions, microglia are likely to play a dichromatic role in disease, depending on signals present in their microenvironment and the duration of activation. while early microglial activation could represents a beneficial response (i.e., removal of cns threat, promoting tissue repair and removal of misfolded protein), chronic exposure could induces detrimental effects by promoting neuronal death (i.e., through the sustained release of neurotoxic factors), thus, contributing to progression of disease. pet imaging with the use of tspo radioligands provides a valuable tool that allows us to track the progression and severity of neuroinflammation in the living brain, and is a useful indicator of active cns disease. therefore, the early detection of microglia using pet could offer opportunities for pharmacological interventions to limit the potential disruptive effects of chronic microglial activation. furthermore, with the development of newer tspo tracers, the potential for pet imaging research to promote our understanding of activated microglia in cns disease can only increase. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

microglia constitute the main immune defense in the central nervous system. in response to neuronal injury, microglia become activated, acquire phagocytic properties, and release a wide range of pro-inflammatory mediators that are essential for the annihilation of the neuronal insult. although the role of microglial activation in acute neuronal damage is well defined, the pathophysiological processes underlying destructive or protective role to neurons following chronic exposure to microglial activation is still a subject of debate. it is likely that chronic exposure induces detrimental effects by promoting neuronal death through the release of neurotoxic factors. positron emission tomography (pet) imaging with the use of translocator protein (tspo) radioligands provides an in vivo tool for tracking the progression and severity of neuroinflammation in neurodegenerative disease. tspo expression is correlated to the extent of microglial activation and the measurement of tspo uptake in vivo with pet is a useful indicator of active disease. although understanding of the interaction between radioligands and tspo is not completely clear, there is a wide interest in application of tspo imaging in neurodegenerative disease. in this article, we aim to review the applications of in vivo microglia imaging in neurodegenerative disorders such as parkinson s disease, huntington s disease, dementias, and multiple sclerosis.

PMC3361961

pubmed-156

rheumatoid arthritis (ra) is a chronic systemic inflammatory disease affecting predominantly joints, synovial membranes, articular cartilages, and subchondral bones. disease progression is attributed to increases in reactive oxygen species (ros) and oxidative stress (os) in the lesion sites. proinflammatory cytokines, such as tumor necrosis factor- (tnf-), interleukin-1 (il-1), and il-6, regulate the inflammatory and immune responses and play a pivotal role in the disease. overproduction of nitric oxide (no), as a result of induction of inducible nitric oxide synthase (inos) due to enhanced production of these cytokines, is associated with persistent inflammation and tissue destruction in experimental arthritis models, including rheumatoid arthritis [4, 5]. a number of inflammation stimuli, including tnf-, il-1, il-6, or ros, can activate proinflammatory pathways involved in ra pathogenesis, concerning predominantly nuclear factor-b (nf-b), mitogen activated protein kinases (mapks), or janus kinases/signal transducers and activators of transcription (jak/stat1/3) [68]. this results in translocation of relevant downstream transcription factors from the cytoplasm to the nucleus, where they activate messenger rna (mrna) expression of target genes, including il-1, tnf-, inos, and 12/15-lipoxygenase (lox), leading to overproduction of corresponding proteins. cytokines released into the synovium reach also the systemic circulation and act in other tissues and organs such as lungs, vascular tissue, liver, and heart. several recent investigations reported damage of vital organs with various degrees of impairment, considered to be secondary complications of ra and a major predictor of mortality in ra patients. increasing evidence is pointing to the critical role of the liver in modulating the immune response in autoimmune and chronic inflammatory diseases including ra [5, 11, 12]. the hepatic biochemical and immunological alterations are associated with and influenced by changes in the oxidative state of liver cells. adjuvant-induced arthritis (aa) in rats not only is an experimental model of polyarthritis but also induces pathological changes in a variety of other tissues, including the liver and spleen. it is a useful tool to study immunopathologic processes, autoimmune chronic inflammation, and inflammatory cachexia in rodents. in addition, at the molecular level, mrna profiling suggests that this model is also similar to human ra, particularly in tissue gene expression and in the activation of regulatory pathways [11, 14]. numerous studies reported natural polyphenols as potential therapeutic agents of diseases caused by os and inflammation [1517]. n-feruloylserotonin (n-f-5ht, n-feruloyl-5-hydroxy-tryptamine) is a conjugated serotonin, a member of the indole hydroxycinnamic acid amides, with serotonin (5-ht) and ferulic acid (fa) as representative components of its structure. hydroxycinnamic acid amides of serotonin, synthesized by serotonin n-hydroxycinnamoyltransferase, are present in several vegetables and wild-growing plants whose seeds are used in herbal medicine in eastern countries [1820]. in cell-based studies, under short-term high-glucose conditions, n-f-5ht exerted an inhibitory effect on overproduction of mitochondrial superoxide by acting as scavenger of superoxide. n-f-5ht attenuated the upregulation of mrna and proteins of ros-dependent adhesion (vascular cell adhesion protein-1 (vcam-1)) and migration factors (monocyte chemoattractant protein-1 (mcp-1)), crucial in early atherosclerosis lesions in human aortic endothelial cells, and inhibited the activation of transcription factor nf-b. furthermore, n-f-5ht showed a protective effect on ros-related neuronal damage by decreasing the activity of proapoptotic caspase-3. n-f-5ht isomers isolated from seeds of leuzea carthamoides were shown to inhibit protein kinase c/ii activation and decrease the oxidative burst of human whole blood and isolated neutrophils in vitro. n-f-5ht was also found to have a protective effect against ldl oxidation and atherogenesis in experimental animals and in human studies [2426]. methotrexate (mtx), used as a standard drug in our study, represents the most frequently used pharmacotherapy of ra in clinical practice. its administration is, however, limited due to its toxic side effects [27, 28]. yet application of a combination therapy of mtx with other potential immunomodulators, synthetic drugs or natural substances [3032], might elevate the therapeutic efficacy: decrease the dose of mtx and thus its side effects. in our previous study, we showed that administration of n-f-5ht to mtx-treated arthritic rats lowered the dose of mtx for the required sustained antirheumatic impact. in this study, we focused on the therapeutic impact of n-f-5ht and mtx administered in monotherapy and on details of the inflammatory state in the arthritic rat liver with the aim to elucidate the molecular mechanisms of their effect. one of the possible clarifying approaches is to study the mrna expression of key proinflammatory markers (il-1, tnf-, and inos) in the liver of treated and untreated arthritic rats. further, it is of particular interest to expand our knowledge on the effect of n-f-5ht and mtx in the aa model, which in turn should allow extrapolations of these results to ra patients. to this aim we evaluated also conventional arthritic parameters (hpv, arthritic score, body weight change, and weight of the liver) along with changes in plasmatic levels of il-1 and crp and the activity of 12/15-lox in the liver. adult male lewis rats weighing 160180 g were obtained from charles river wiga, germany. the experimental protocol was approved by the ethics committee of the institute of experimental pharmacology and toxicology and by the slovak state veterinary and food administration in accordance with the european convention for the protection of vertebrate animals used for experimental and other scientific purposes and was in line with slovak legislation. to induce a rat model of adjuvant arthritis (aa), rats were intradermally injected with a suspension of heat-inactivated mycobacterium butyricum in incomplete freund's adjuvant (difco laboratories, detroit, mi, usa). the third group comprised adjuvant arthritis rats treated with methotrexate (methotrexat ebewe sol inj 20 mg/2.0 ml) in oral dose of 0.4 mg/kg twice a week (aa-mtx). the fourth group comprised adjuvant arthritis rats treated with n-feruloylserotonin dissolved in suspension of methylcellulose tween 80 at a dose of 3 mg/kg/day orally (aa-n-f-5ht). drugs were administered orally by gastric gavage from day 0 (the day of treatment) to day 28 of the study. blood for plasma preparation was taken by retroorbital puncture on day 14 and by cardiac puncture on day 28 under deep ketamine/xylazine anesthesia. after the animals had been sacrificed under deep ketamine/xylazine anesthesia, tissues for liver and spleen homogenate preparation were taken at the end of the experiment (day 28). blood in heparinized tubes for plasma preparation was centrifuged at 3000 rpm for 15 minutes at 4c. fraction of four isomers of n-f-5ht (table 1) was isolated from the seeds of leuzea carthamoides (wild) dc by solvent extraction. this was then followed by column chromatography on silica gel and hplc separations under conditions previously reported [35, 36]. the hind paw volume (hpv) was recorded on days 14, 21, and 28 with the use of an electronic water plethysmometer (ugo basile, comerio, varese, italy). calculation of the increase in hind paw volume in ml assessed the intensity of the edema. the arthritic score was measured as the total score of hpv (ml, max. points 5)+diameter of scab in the site of mb application, measured in parallel to the spinal column (mm, max. body weight change (bwc; g) was measured on days 1, 14, 21, and 28. bwc was calculated as the difference of the body mass measured on days 14, 21, and 28 to the body weight measured at the beginning of the experiment (day 1). for the determination of rat crp concentration in plasma (g/ml), the elisa kit from immunology consultant laboratories, inc. the reaction of secondary biotin-conjugated anti-rat crp antibody was evaluated by streptavidin-hrp. the tetramethylbenzidine reaction with hrp bound to immune complex was measured at 450 nm (microplate reader, labsystems multiskan rc). for the determination of il-1 concentration in plasma, the elisa kit from r&d systems quantikine was used. rat cytokine present in the samples binds to anti-rat cytokine antibodies absorbed in the microwells. the reaction of secondary biotin-conjugated anti-rat cytokine antibody is evaluated by hrp. the tetramethylbenzidine reaction with hrp bound to immune complex was measured at 490 nm in comparison with the reference wavelength of 620 nm (microplate reader mrx ii). concentration of proteins in liver homogenates was determined by using the bradford method and expressed in mg/ml of enzyme preparation (cytosolic fraction from rat lung and liver tissues). linoleic acid (99%, sigma-aldrich, usa) was used as a substrate prepared in solubilized state as described in the concentration of 0.2143 100.7143 10 m. the assay of lox was monitored for 60 seconds as an increase in the absorbance at 234 nm, reflecting the formation of hydroperoxylinoleic acid. for the lox activity assay, an uv/vis spectrometer perkin-elmer lambda 35 (usa) was used. the reaction medium contained a 50 mm tris-hcl buffer (ph 7.0), 2.5 l of the enzyme, and solubilized linoleic acid. total rna was isolated from the rat liver and spleen using rnazol rt (sigma-aldrich) and converted into complementary dna (cdna) using the primescript rt reagent kit (takara) following the protocols of the manufacturers. amplification and detection of cdna of reference and target genes were performed on a 7300 real-time pcr system (applied biosystems) using hot firepol evagreen qpcr mix plus (rox) (solis biodyne). relative mrna expressions of il-1, tnf-, and inos were analyzed using the ct value method. the sequences of the primers were designed and checked using primer3 and oligo analyzer 1.0.3 (table 2). mean and sem values were calculated for each parameter in each group (810 animals in each experimental group). statistically significant differences among treated, untreated, and control groups were tested using parametric analysis of variance (anova). post hoc tests (tukey-kramer (anova)) were applied in situations where differences among groups were significant at the level of significance =0.05. after post hoc testing, the following significance levels were specified: extremely significant (p<0.001), highly significant (p<0.01), significant (p<0.05), and not significant (p>0.05). antioxidant properties of polyphenols including n-f-5ht have been reported [21, 40, 41]. nevertheless, the n-f-5ht impact on chronic inflammatory and os-inducing arthritis, which could widen the possibilities of the ra therapy, remains to be elucidated. in our previous study in the model of aa, n-f-5ht in the dosage of 15 mg/kg markedly potentiated the therapeutic effect of low-dose (nontherapeutic dose) mtx (0.3 mg/kg) on arthritic (hind paw volume and arthritic score) and inflammatory parameters (il-17, mcp-1, and crp), yet it resulted in insignificant effect in monotherapy. as data about the optimal n-f-5ht dose in the rat model are scarce, we decided to study two doses of n-f-5ht: (i) when 15 mg/kg exceeded the physiologically acceptable concentration, we used 3 mg/kg, and (ii) when 15 mg/kg was too low to reach the maximal effect, we used 30 mg/kg. unexpectedly, contrary to the lower dose of n-f-5ht, the higher dose exhibited minor effect on the parameters examined and/or these varied strongly among the animals. for this reason, this report shows only the data evaluating the lower dose of n-f-5ht. in this study, we used the therapeutic dose of mtx (0.4 mg/kg) with the intention to compare each mechanism of action of mtx and n-f-5ht, both evaluated in monotherapy. the significant rise in arthritic parameters, arthritic score, and hpv confirmed the arthritis in our model in rats. the arthritic score showed an increase in the untreated arthritic group compared to the control group on all days monitored (aa versus co, day 14, p<0.01; day 21 and day 28, p<0.001; table 3). at the end of the experiment, the arthritic score was almost doubled in the aa group compared to controls. a trend toward reduction was observed after administration of n-f-5ht to aa animals on day 28, but the effect was not statistically significant. the treatment with mtx significantly reduced the arthritic score on observation days 21 and 28, compared to the untreated arthritic group, proving the therapeutic potential of the applied dose of mtx (aa-mtx versus aa, day 21, p<0.05; day 28, p<0.01; table 3). similarly, the change in hpv showed an increase in the untreated arthritic group compared to the control group on days 21 and 28 (aa versus co, day 21, p<0.01; day 28, p<0.05; table 3). the administration of n-f-5ht induced no modification of hpv of the arthritic animals on any day monitored. mtx therapy significantly reduced the observed swelling on days 21 and 28 compared to the untreated arthritic group (aa-mtx versus aa, day 21 and day 28, p<0.001; table 3). the muscle wasting condition due to high catabolic activity, known as rheumatoid cachexia, occurring in approximately two-thirds of all patients with ra, is mediated by tnf- and il-1 in ra. papers published over the past years confirmed that oxidative metabolism was considerably enhanced in the liver of adjuvant-induced arthritis in rats [4346]. rats used in this study revealed signs of cachexia (table 3). a significant decrease in body weight change (bwc) the bwc of the arthritic rats was 56% on day 14, 19% on day 21, and 27% on day 28 (aa versus co, days 14, 21, and 28, p<0.001; table 3) of the bwc of healthy controls. n-f-5ht treatment led to a significant increase of bwc on day 28 (aa-n-f-5ht versus aa, p<0.05; table 3). the administration of n-f-5ht in arthritic animals did not change these parameters on any of the days observed. the liver weights were significantly lower (aa-mtx versus aa, p<0.05; table 3) only in the group of rats treated with mtx. the reduced weight of the liver in mtx-treated rats was assumed to be the result of inhibition of the pathway of de novo dna synthesis by mtx [47, 48]. in summary, the statistical significance of 3 mg/kg of n-f-5ht treatment was determined only for bwc. the arthritic score revealed a trend toward the positive effect increasing with time, indicating a late onset of n-f-5ht action (table 3). as expected, significant differences were found in the arthritic score and hpv in the arthritic animals treated with the therapeutic dose of 0.4 mg/kg mtx compared to those treated with the low dose of 0.3 mg/kg mtx. il-1, a prototypic proinflammatory cytokine, is a major mediator of the inflammatory cascade in ra, which is involved in the mechanisms leading to progressive joint destruction. in the model of aa, the early phases of the disease seem to be characterized by a systemic increase of il-1. the plasmatic level of il-1, a protein of multiorgan origin, was significantly increased in arthritic animals compared to the control group in the early phase of aa, on day 14 (aa versus co, p<0.001; figure 1(a)), ascertaining the presence of inflammation. administration of mtx did not lead to a significant change of plasmatic il-1 concentration; only a trend toward reduction was observed on day 14. it is noteworthy that n-f-5ht treatment resulted in a significant decrease of il-1 level in plasma (aa-n-f-5ht versus aa, p<0.05; figure 1(a)). this result is interesting, as this molecule was reported to be relevant in driving the transition from the acute phase to the chronic irreversible phase of the disease and it has been suggested that it could be the target of early intervention to stop the course toward the chronic form of the disease. the blocking il-1 protects bone and cartilage from progressive destruction in ra and its inhibition could be effective in the treatment of this disease. activation of t and b cells, macrophages, and inflammatory mediators tnf-, il-1, and il-6 aggravates the oxidative damage of the vital organs in rheumatoid arthritis, such as the liver. the liver, in turn, influences the systemic inflammation via producing inflammatory cytokines and mediators such as tnf-, il-1, il-6, no, crp, and lox. il-6, il-1, and tnf- promote the synthesis of crp in hepatocytes via stat3 [51, 52] and nf-b pathways. the level of the systemic inflammatory parameter crp in plasma, resulting from liver synthesis, was increased significantly in the group of arthritic animals compared with control animals in the chronic phase of the disease on experimental day 28 (aa versus co, p<0.001; figure 1(b)). administration of n-f-5ht and mtx significantly reduced the plasmatic levels of crp on day 28 compared to the untreated group of arthritic animals (aa-n-f-5ht versus aa, p<0.05; aa-mtx versus aa, p<0.05; figure 1(b)). interaction of crp with fc-gamma receptors (fcr) fcri and fcriia is known to promote the production of proinflammatory cytokines, resulting in the amplification loop of inflammatory reaction. these processes are initiated through the induction of the receptor activator of nuclear factor-b ligand (rankl) protein and direct stimulation of osteoclastogenesis, causing a loop between inflammation and bone destruction in ra. crp enhances both the proinflammatory response and bone destruction. in the treatment of ra, a lowered crp level thus not only is a significant parameter in terms of disease progression elimination but also has a direct impact on decreasing the degree of bone destruction. alterations in the oxidative state lead to the activation of nf-b and nf-b-dependent genes, such as lox. the enzyme 5-lox catalyzes the conversion of arachidonic acid to leukotrienes, whose production has been associated with inflammation in arthritis. suppression of 5-lox expression ameliorates clinical parameters in ra and aa [56, 57]. increased levels of nf-b in the lung and liver as well as increased activity of lox in the lung highlight the importance of extra-articular manifestations of aa. in our experiment, liver 12/15 lox activity increased in arthritic animals in comparison to healthy animals (aa versus co, p<0.001; figure 1(c)). the effect of n-f-5ht on the activity of 12/15-lox in liver homogenate was comparable with that of mtx. after administration of mtx or n-f-5ht, a significant decrease to control levels was assessed in the liver of the aa group (aa-n-f-5ht versus aa, p<0.001; aa-mtx versus aa, p<0.001; figure 1(c)). thus the anti-inflammatory effect of n-f-5ht in aa was supported by the ability of the molecule to inhibit 12/15-lox activity. similar to this result, recent observations also reported that several other flavonoids may act as lox inhibitors. in aa, the gene expression levels of tnf- and inos produced in the liver were reported to increase [60, 61]. also, in our study, the levels of tnf- and inos mrna expressions were significantly increased in arthritic animals (both p<0.001, aa versus co; figures 2(a) and 2(b)). it was proposed that these modifications in the liver of arthritic rats not only were a consequence of the metabolic alterations caused by the disease, especially the increased oxidative metabolism, but also depended on increased inflammatory parameters in the liver. the same agents that increase oxidative metabolism, tnf-, il-1, il-6, and others, are responsible for increasing the activity of inos in several tissues. an increase of inos activity as a consequence of elevated inos mrna expression was considered to play a dominant role in the pathogenesis of ra. no generation by inos induced in chondrocytes in the initial stage of aa may play a key role in triggering the subsequent events in arthritis. in general, the use of nos inhibitors has been shown to exert beneficial effects in experimentally induced arthritis. however, which types of cells expressing inos are associated with the induction or progression of adjuvant-induced arthritis via no generation remains uncertain. mrna expression of inos in rat liver was reduced following mtx (aa-mtx versus aa, p<0.001; figure 2(a)) and n-f-5ht treatment (aa-n-f-5ht versus aa, p<0.01; figure 2(a)). the effect of mtx treatment on tnf- protein and mrna expression differs among studies, depending on the conditions of the given study, concerning gender of patients, type of cell line, duration of treatment, mtx dose, and so forth. in our study in the rat aa model, administration of mtx attenuated significantly the mrna expression of tnf- (aa-mtx versus aa, p<0.01; figure 2(b)). in many patients, however, mtx treatment does not result in lower tnf- plasma concentration. when mtx fails to produce an adequate response, newer therapies are used in combination with mtx. blocking tnf- with anti-tnf- monoclonal antibodies significantly decreased the signs and symptoms of ra compared to placebo in ra patients with active disease receiving mtx [65, 66]. thus, the n-f-5ht-driven significant reduction of tnf- mrna expression (a-n-f-5ht versus aa, p<0.01; figure 2(b)) suggests an intriguing effect on ra treatment, calling for deeper investigation. increase of mrna expression was observed for il-1 in the liver of arthritic animals (aa versus co, p<0.001; figure 3(a)) as expected. administration of mtx did not lead to significant attenuation of il-1 transcription in the liver. this is in concert with previous studies of mtx function in different types of cells (e.g., human peripheral blood mononuclear cells and murine peritoneal and splenic cells) [67, 68]. on the other hand, mtx exhibits another mechanism of il-1 function inhibition, which involves blocking the binding of il-1 to il-1 receptor in the membrane of peripheral blood cells (monocytes, lymphocytes, and granulocytes). contrary to mtx, treatment with n-f-5ht led to a substantial inhibition of il-1 gene expression (aa-n-f-5ht versus aa, p<0.01; figure 3(a)). further, we examined il-1 mrna expression in the main immunocompetent organ, in the rat arthritic spleen, which has not been studied previously in terms of the aa model, related to il-1 expression. we observed il-1 mrna expression activation comparable to that in the liver (aa versus co, p<0.001; figure 3(b)). interestingly, both mtx and n-f-5ht exhibited a significant and remarkably stronger inhibition of il-1 mrna expression in comparison to that in the liver (aa-mtx versus aa, p<0.01; aa-n-f-5ht versus aa, p<0.001; figure 3(b)). in the spleen of n-f-5ht treated rats, the relative mrna expression decreased even to control level. besides other events, mtx treatment leads to suppression of nf-b, a heterodimer consisting of two subunits p65 and p50, one of the most prominent inflammatory transcription factors activated in ra. this was confirmed in our previous work, along with the finding that also n-f-5ht (15 mg/kg) suppressed the activation of nf-b (p65) in the arthritic rat liver [21, 33]. interestingly, combination therapy (mtx+n-f-5ht) potentiated the effect of a single drug, suggesting different mechanisms leading to nf-b inhibition. mtx driven reduction of cytokine transcription was attributed to abrogation of ib kinase activation and thereby suppression of ib (nf-b inhibitor) phosphorylation and degradation, resulting in retaining the inactive nf-b form in cytoplasm. however, the contribution of n-f-5ht to nf-b pathway suppression needs to be further investigated. studies of the proposed pathways involved in the transcription of tnf-, il-1, and inos in ra could help evaluate the mechanism of action of these drugs [68, 71, 72]. the gene expression of inos is mostly under the control of synergistically activating nf-b (il-1 and tnf- stimulated) and stat1 (ifn- stimulated) key proinflammatory signals in the liver. in contrast to inos, tnf- does not contain the stat binding element in its promoter region. the inhibition of tnf- and inos transcription observed in our study might be mostly attributed to the suppressed nf-b pathway for both mtx and n-f-5ht [33, 64, 70]. however, the contribution of ap-1 to tnf- and stat1 for inos can not be excluded. mtx-dependent suppression of nf-b was reported [33, 70, 73, 74], but in other cases mtx was not found to be effective in the attenuation of arthritic-increased mrna expression of il-1 [68, 75]. taking into account our results, where mtx treatment did not lead to inhibition of il-1 mrna expression in the arthritic liver in contrast to the significant n-f-5ht impact, yet treatment of both mtx and n-f-5ht decreased the presumably nf-b-dependent lox activity and inos and tnf- transcription to a similar extent, the involvement of n-f-5ht in another pathway for transcription regulation of this cytokine in the arthritic liver should be considered. after analysis of the reported pathways involved in the regulation of il-1 mrna expression, we hypothesized that tnf--driven ap-1 transcription factor activation or jak/stat3 pathway activated via il-6 or ifn- might play a role ([ 7, 8, 71, 72, 76, 77], figure s1 in supplementary material available online at http://dx.doi.org/10.1155/2016/7509653). papers reporting involvement of other polyphenols in anti-inflammatory regulation, for example, resveratrol, claim that these compounds exhibit their anti-inflammatory effect through suppression of nf-b and jak/stat signaling pathways [78, 79]. the enhanced influence of mtx and n-f-5ht on il-1 transcription in the spleen in comparison to the liver may be the consequence of different predominance of inflammatory pathways in this organ, presumably with a stronger nf-b contribution. details about the relevance of these pathways and the role of n-f-5ht in the transcription regulation of il-1, inos, and tnf- in the liver and other organs in ra are to be further elucidated. the present study contributed additional evidence about the beneficial effect and mechanism of action of n-f-5ht and of mtx on a systemic inflammatory process in the liver and its association with the pathogenesis of adjuvant arthritis. n-f-5ht treatment led to amelioration of inflammatory parameters tested (plasmatic crp and il-1 protein levels, liver lox activity, and liver and spleen cytokine expression). however, this did not result in a significant change of hpv, although a trend of improvement of the arthritic score was observed after 28 days. a synergistic effect of tnf- and il-1 was shown to influence the balance between protein degradation and protein synthesis causing among others an increase in resting energy expenditure and net efflux of amino acids from muscle to liver. the significant increase of bwc in n-f-5ht treated rats, probably sign of the partial improvement of rheumatoid cachexia, might be the result of lowered mrna expression of tnf- and il-1 determined in the arthritic liver. moreover, taking into account the reported association of weight loss with the il-1 production by splenic cells, the n-f-5ht mediated attenuation of increased il-1 mrna expression in the arthritic spleen might contribute to this complex process. the contribution of the affected expression of tnf- and il-1 originating from other organs can not be excluded and is to be further elucidated. unexpectedly, chronic daily treatment with a high concentration of n-f-5ht (30 mg/kg) exhibited either a minor effect on the parameters examined and/or a strong variation among the animals (not shown) and that in contrast to a much lower concentration (3 mg/kg). since n-f-5ht possesses a serotonin (5-hydroxytryptamine, 5-ht) moiety, the question if there might be some interplay between effects of these two molecules on ra pathogenesis is to be raised. since n-f-5ht inhibited the increase of cytosolic free ca concentration in rat vascular smooth muscle cells induced by serotonin mediated by 5-ht2 receptors, it was hypothesized that at a sufficient concentration n-f-5ht may act as a competitive antagonist, which displaces serotonin from its binding site. intake of a high concentration of a 5-ht2 receptor antagonist may lead to a variety of effects: it may influence the receptor density, even enhance the effect of serotonin, or lead to desensitization and with time to receptor resistance (through inhibitory feedback due to binding-induced enhanced production of serotonin). interestingly, serotonin is known not only as a neurotransmitter. increasing but contradictory reports associate serotonin with immunoinflammatory pathways in the periphery. serotonin, via its 5-ht2a, 5-ht2b, and 5-ht3 receptors, has been implicated to have both proinflammatory and anti-inflammatory roles in a number of studies of rheumatoid arthritis [8488]. the reported effects of 5-ht receptor antagonist on macrophage-like synovial cells encourage the interest to study the effect of n-f-5ht from this point of view. to confirm this hypothesis, a precise characterization of interaction between n-f-5ht and 5-ht receptors is to be done. on comparing the effects of the two drugs, administration of mtx (0.4 mg/kg) or n-f-5ht (3 mg/kg) was found to lead to a decrease of the main plasma marker of systemic inflammation crp, the liver origin protein, and to inhibition of proinflammatory lox in the liver. the impact of mtx and n-f-5ht on mrna expression of tnf-, il-1, and inos in the liver and on the level of crp in plasma was mentioned at the conference. mtx and n-f-5ht reduced the arthritis-increased transcription of tnf- and inos in the liver to a comparable extent. we suppose that the inhibition of tnf- and inos transcription might be mostly attributed to the suppressed nf-b pathway for the two drugs [21, 33, 70]. as previously reported [67, 68] and also proven by our study, mtx was not able to diminish the arthritic-induced il-1 mrna transcription in the liver. this handicap might be compensated by coadministration of n-f-5ht, since this drug was shown to lower the level of proinflammatory cytokine il-1 in plasma in the acute phase of aa and to attenuate significantly the elevation of il-1 mrna expression in the arthritic rat liver and spleen in the chronic phase. detailed studies are required to confirm the hypothesis that n-f-5ht might function through potentially different mechanisms of inhibition of the inflammatory pathway nf-b and not through mtx, as well as the possibility of an additional pathway influencing il-1 transcription under control of n-f-5ht but not mtx. the confirmation would support n-f-5ht as a promising agent for the treatment of ra in combination therapy with mtx. the positive effect was shown in our previous study, where n-f-5ht markedly potentiated the therapeutic effect of low-dose mtx. as the therapeutic dose of mtx was used in this study and the purpose of combination study is to lower the mtx dose to decrease the side effects of this drug, the effect of combination therapy was not included. oral daily intake of n-f-5ht could overcome the inconvenient administration and high costs of biological therapy using il-1 monoclonal antibody, which was shown in clinical trials to be superior to placebo in combination with mtx in reducing signs, symptoms, and radiographic progression in patients with advanced ra [91, 92]. future studies of n-f-5ht mechanisms of action should shed more light on the immunomodulatory function of this natural polyphenol. it is to be expected that n-f-5ht is able to positively affect the activity of other markers of inflammation and oxidative stress not only in the liver and spleen but also in other organs (lung, brain, etc.), a hypothesis to be tested by future work. however, to establish the optimal dosing in light of the effects achieved is of primary importance.

rheumatoid arthritis (ra) is a chronic inflammatory disease, leading to progressive destruction of joints and extra-articular tissues, including organs such as liver and spleen. the purpose of this study was to compare the effects of a potential immunomodulator, natural polyphenol n-feruloylserotonin (n-f-5ht), with methotrexate (mtx), the standard in ra therapy, in the chronic phase of adjuvant-induced arthritis (aa) in male lewis rats. the experiment included healthy controls (co), arthritic animals (aa), aa given n-f-5ht (aa-n-f-5ht), and aa given mtx (aa-mtx). n-f-5ht did not affect the body weight change and clinical parameters until the 14th experimental day. its positive effect was rising during the 28-day experiment, indicating a delayed onset of n-f-5ht action. administration of either n-f-5ht or mtx caused reduction of inflammation measured as the level of crp in plasma and the activity of lox in the liver. mrna transcription of tnf- and inos in the liver was significantly attenuated in both mtx and n-f-5ht treated groups of arthritic rats. interestingly, in contrast to mtx, n-f-5ht significantly lowered the level of il-1 in plasma and il-1 mrna expression in the liver and spleen of arthritic rats. this speaks for future investigations of n-f-5ht as an agent in the treatment of ra in combination therapy with mtx.

PMC4983360

pubmed-157

although studies on the effects of children s use of computers are still undetermined, some initial studies showed positive and negative effects in this regard. children commonly use computers for playing games, completing school assignments, sending/receiving e-mails, and connecting to the internet. this may sometimes interfere with other activities such as homework or normal social interchange (1). studies showed that internet addiction positively correlated with depression, novelty seeking, harm avoidance, and reward dependence. on the other hand, internet addiction negatively correlated with persistence, self-directness, cooperativeness, and self-transcendence. in several studies it was demonstrated that significant factors affecting internet addiction were depression, gender, novelty seeking, and self-transcendence (2, 3). computer game addiction is excessive or compulsive use of the internet, computer, and video games that may interfere with daily life. it is not clear whether internet and video game playing meets the diagnostic criteria of diagnostic and statistical manual of mental disorders, 4 edition (dsm-iv) (4). previous studies about internet addiction have investigated several associated psychological variables such as shyness, loneliness, self-consciousness, anxiety, depression, and interpersonal relations (5). some studies revealed a significant association between internet addiction and depressive symptoms in adolescents and high school students. many investigations suggest the necessity of the evaluation of the potential underlying depression in the treatment of internet-addicted adolescents (6). moreover, the level of internet addiction correlated positively with the level of depression and suicidal ideation among high school students. based upon several studies, there were significant positive correlations among internet addiction, depression, and suicidal ideation in adolescents (7). kim et al. showed that the levels of depression and suicide ideation were highest in the internet-addicts group than other students. they advised future studies to investigate the direct relationship between psychological health problems and internet dependency (8). in this study we tried to investigate the prevalence of internet, computer games, and dvd and video addiction among high school students in southern iran, shiraz, and its relation to depression and anxiety during the years 2008 and 2009 and in a cross-sectional study 1020 high school students (males and females) were selected randomly by area and cluster sampling from different areas of shiraz in southern iran. an informed consent was received from each participant and they were assured of the confidentiality of the data. the students were given a full explanation of the reasons for the implementation of the study and were informed that their responses would be confidential. they were asked to express their personal comments and recommendations at the end of the interview. special attention was paid to ensure that the students clearly understand the instructions of the interview. in addition, they were asked not to say their name or student number in order to encourage them to provide more open and honest answers. demographic data (age, sex, and economic status according to income of the family), duration of internet usage, computer games playing, tv and satellite watching, dvd and video cd usage, and the reasons of the usages were asked at the interviews. the students were interviewed for addiction, generalized anxiety disorder, and major depressive disorder according to the dsm-iv criteria. mild depression: decreased mood, presence of anxiety symptoms, and increased symptoms in the afternoon, without suicidal idea. moderate depression: decreased activity, depressed mood, agitation, decreased energy, and decreased concentration, sense of guilt, hypochondriacs, sleep disturbance, depersonalization symptoms, decreased appetite, and decreased sexual activities. dependent: dysfunctional, and withdrawal symptoms (restlessness, anxiety, decreased concentration, insomnia, irritability, fatigue, and craving) after discontinuing. the obtained data were analyzed using descriptive indices and the analytic methods of the chi-squared and pearson regression. the data were analyzed with statistical package for social sciences (spss) for windows15.0 (chicago, il. 277 students (27.2%) were in the first year of high school, 242 (23.7%) were students of the second year, and 501 (49.1%) were in the third year of high school. 140 students (13.7%) had low economic status (defined as family monthly income of less than 3000000 rials income), 807 (79.1%) had moderate economic status (3000000-1000000 rials income per month), and 62 (6.1%) had high economic status (more than 10,000,000 rials income per month). table 1 shows the prevalence of depression and anxiety among students according to sex, economic state, and internet, computer, or dvd usage, and history of medical disease. 13 students (1.3%) were computer games abusers, and 634 students (85%) reported playing computer games for amusement. 215 (21.1%) of student did not use dvd or video cd. 1 student (0.1%) was dvd or video cd abuser, and 576 students (77.7%) reported using dvd or video cd for amusement. 22 (2.2%) students did not watch tv or satellite, 4 students were abusers, and 190 (18.6%) students were dependent to tv or satellite. 455 (53.6%) students reported watching tv or satellite for film and football, and 306 (36.2%) for amusement. 94 students (9.2%) had medical problems, and 71 (7%) used some medications regularly. prevalence of anxiety and depression were significantly higher in females (p<0.05). the prevalence of anxiety and depression was significantly lower in students of the third year compared to other grades (p<0.05). the prevalence of anxiety was significantly higher in students with lower family monthly income status (p<0.05). the prevalence of depression was significantly higher in students with lower economic status (p<0.05). the prevalence of depression was significantly higher in students who were internet abusers or dependents (p<0.05), but we did not detect a significant relation between anxiety and internet usage. the prevalence of anxiety was significantly higher in the students who used the internet for chatting, amusement (such as downloading music, films, and pictures), and reading the news compared to the students who used the internet for other reasons (p<0.05). there was no significant correlation between depression and reason of internet use among the students. the prevalence of anxiety and depression were significantly higher in students who were computer games abusers or dependents (p<0.05). the prevalence of anxiety and depression did not show a relationship with the reason of playing computer games. the prevalence of anxiety was significantly higher in students who were dvd or video cd dependents(p<0.05). the prevalence of depression did not relate to the level of dvd or video cd use. students who used dvd or video cd for resting had higher levels of anxiety and depression (p<0.05). the prevalence of depression and anxiety did not relate to the usage of tv or satellite (p<0.05). students who watched tv or satellite for film, football, and music had lower levels of anxiety (p<0.05). students who watched tv or satellite for film and football had lower levels of depression (p<0.05). the students who used some medications regularly or had medical problems had higher rates of depression and anxiety (p<0.05). the problem of excessive computer and internet usage is increasing more rapidly and it can occur together with other kinds of addiction. the causes of internet addiction do not have only habitual bases, but also demographic and socioeconomic aspects. the behaviors related to internet addiction may be a symptom of depressive disorders in adolescents (9-11). prevalence of depression and anxiety among students according to sex, economic state, and internet, computer, or dvd usage, and history of medical disease batthyany et al. reported excessive computer playing and internet usage corresponding to addictive behaviors were found in 12.3% of the adolescents in austria (12).. showed the rate of internet addiction in the high school students to be about 7% which was more prevalent among males (13). hur in study on korean adolescents reported significant correlations among internet addiction, depression, and suicidal ideation (14). ha et al. found that almost one third of subjects in their study diagnosed as internet addicts had a significant level of depressive symptoms that required psychiatric intervention (15). these users use the internet to such an extent that it interferes with their academic studies and they are very much preoccupied with it. it is still very much a matter of debate whether internet addiction is a distinct disorder or a behavioral problem secondary to another disorder. suggested that internet communication with people can alleviate depression, at least among socially isolated and moderately depressed populations such as college students (11). they added that the behaviors related to internet addiction may be a symptom of depressive disorders in adolescents. educationists and parents should try to understand the root causes of any isolation in the youth. it is alarming that excessive internet users are more likely to report having felt sad or depressed most of the days in the past year. they opined that the possible co-morbidity of major depressive disorder among internet-dependent adolescents could be explained by the internalizing tendency of the adolescents. internalized depressive adolescents can escape from the reality or problems of the real world by losing themselves in the cyber world. purposeful activities on the internet, which are focused, for example on academics-related research or discussing a project online, can be completed in relatively shorter periods of time through good planning. however, use of the internet for entertainment may not have a time limit and some activities like multi-player games can be highly compulsive. parental rules in such situations can set the limit, and thereby reduce excessive use and limit negative outcomes. the rate of internet, computer games, and dvd addiction in our study were significantly lower than reports from other parts of the world. the prevalence of anxiety was significantly higher in students who did not use the internet. these abnormal results may be due to lower economic states among the students who did not use the internet. the prevalence of anxiety was significantly higher in the students who used internet for chat, amusement, and news. similar to other studies, the prevalence of anxiety and depression was significantly higher in students who were computer game abusers or dependents, although it did not have any relation with the reason of playing of the computer games. for example, ha et al. reported that one third of subjects in their study diagnosed as internet addicts had a significant level of depressive symptoms that required psychiatric intervention (15). while internet addiction is a new phenomenon, it has already become a subject of numerous studies. on the other hand, it is a very complicated problem and it is difficult to state whether it is more accurate to treat the problem totally as an addiction or not (15-17). in summary, it can be concluded that the results presented in this study are for the most part in accordance with those of other authors and other studies on this subject. some differences could be the result of different conditions, instruments, and differences in the number and structure of the studied group. ja conceived and designed the evaluation and helped to draft the manuscript and its revision and re-evaluated the clinical data. aa participated in the evaluation and collection of the clinical data, and helped to draft the manuscript. agh participated in conceiving and designing the evaluation and helped to draft the manuscript and re-evaluated the clinical data. mkh, zkh, and zgh participated in the evaluation and collected the clinical data. declaration of interest: none. citation: ahmadi j, amiri a, ghanizadeh a, khademalhosseini m, khademalhosseini z, gholami z, et al. prevalence of addiction to the internet, computer games, dvd and video and its relationship to anxiety and depression in a sample of iranian high school students.

objective: the objective of this study was to assess the prevalence of addiction to the internet, computer games, dvd, and video and its relationship to anxiety and depression in a sample of iranian high school students. methods: in this cross-sectional study 1020 high school students (males and females) were selected randomly from different areas of shiraz city in southern iran. they were interviewed according to the diagnostic and statistical manual of mental disorders, 4th ed (dsm-iv) criteria. results: about 50% of the students were females, 277 students (27.2%) were studying in the first year of high school, 242 (23.7%) were in the second year, and others in the third year. the prevalence of anxiety was significantly higher in females than in males (p<0.05). the prevalence of anxiety was lower among students of the third year (p<0.05). the prevalence of depression was significantly higher in students with lower economic status defined as family monthly income. internet dependence was seen only in 5 students. the prevalence of anxiety was significantly higher in the students who used internet for chatting, amusement, and reading news (p<0.05). the prevalence of anxiety was significantly higher in students who were dvd or video cd dependents (p<0.05). the students who used especial drugs or had especial diseases had higher rates of depression and anxiety (p<0.05). conclusion: internet addiction may cause depression and anxiety in high school students. it seems necessary to develop an internet addiction prevention program for adolescents taking into account the psychological factors such as depression and internet use habits.

PMC4105607

pubmed-158

, it must develop tolerance to paternal antigens to avoid a lethal immunologic attack against the fetus. on the other hand, it must preserve the ability to fight infections from a multitude of commensal and environmental pathogens. disruption of this balance can have devastating consequences, including preterm labor and death of the fetus and/or mother. the normal maternal immune response to pregnancy is increasingly recognized as a dynamic process, with changes in the maternal pro/anti-inflammatory profile occurring at different stages of gestation [13]. despite this recognition, a complete, longitudinal immunologic profile of normal such analyses are critical for understanding the response to specific infectious and immunologic diseases that show disproportionately negative outcomes during pregnancy, such as influenza and ulcerative colitis. one approach to such immune profiling is through the use of multiplex cytokine arrays, allowing for simultaneous quantification of many proteins with a very small amount of plasma or serum. others have used multiplex arrays to study the maternal cytokine milieu, but the studies have been predominantly limited time point cross-sectional [68] or case-control [911] in design. the results of some longitudinal studies have been published in recent years, although results have been based on relatively few time points (5 or fewer) [13]. in this study, we applied the multiplex array approach to evaluate the changes in 42 cytokines in rich detail during pregnancy. the samples are from a cohort of 16 pregnant women, with each subject sampled a median of 18 times. because this represents a significant increase in the number of tests per subject compared to previous studies, we also describe a strategy addressing within-subject correlation with repeated measurements using unconditional growth modeling. with this approach, we have been able to detail the typical longitudinal variation of serum cytokines throughout pregnancy in this cohort of women. each participant had a serum sample collected and cryopreserved biweekly from study enrollment during the first trimester (average of 9.7 weeks ' gestation for first samples) until 34 weeks ' gestation, then weekly from 34 weeks until delivery. as a result of this repeated sampling, a median of 18 samples per participant were obtained longitudinally throughout pregnancy. samples were collected under a protocol approved by the mayo clinic institutional review board (irb) that accrued participants from 1987 to 1988. information regarding date of the blood draw, date of delivery, outcome of the delivery, and any major complications that the woman experienced during pregnancy (hypertensive disorders, preterm labor, and infections) was available and helped identify appropriate participants to include. only women who carried their pregnancies to term and experienced no pregnancy complications were included in this study. we only used samples from subjects who had specimens obtained throughout the entire course of pregnancy and whose complete, longitudinally collected specimens appeared intact and nondesiccated. most cytokines are stable in storage at 80 degrees c for up to 2 years, but stability beyond that time is not well known. therefore, before proceeding with studies on the samples of interest, we first tested protein levels of a small number of individually stored serum aliquots from other subjects archived on this protocol. since we found detectable levels of cytokines in the pregnant serum samples that were within range of control samples, we proceeded with the entire study involving a cohort of 16 healthy, primigravid women who completed a term pregnancy without any significant complications. samples were assayed when freshly thawed to avoid freeze-thaw cycles, which are known to degrade cytokines. contemporary plasma samples from 11 nonpregnant control subjects were collected under a separate irb-approved protocol for collection of biospecimens from healthy individuals within the same health system in 2010 and similarly assessed on the same 96-well plates for comparison and as a quality control measure. for contemporary nonpregnant control samples, peripheral venous blood was drawn into heparinized vacutainer tubes that were processed and separated into plasma and peripheral blood mononuclear cells (pbmcs) following gradient centrifugation using ficoll-paque (ge healthcare, uppsala, sweden). plasma was collected and immediately frozen at 80c in 1 ml aliquots until use. protein levels for 42 cytokines, chemokines, and growth factors (table 1) were measured using the milliplex map human cytokine/chemokine kit (millipore, billerica, ma, usa) per manufacturer's instructions. to minimize the potential for interassay variability, each subject had all of their longitudinal specimens analyzed on the same plate. protein concentrations were determined using a linear regression standard curve from each plate generated using the high pmt concentrations with sensitivity from 3.2 to 2,000 pg/ml. all samples were tested in duplicate with the mean value of the measurements used for statistical analyses. comparison of baseline (first trimester) and end of pregnancy levels of cytokines/growth factors was carried out between the 16 primigravid subjects and the 11 nonpregnant control subjects using the kruskal-wallis tests. there were extremes of values that fell outside of the limits of the multiplex array. for cytokines below the limit of detection (ld), we assigned a value that was half the lowest detectable value for the assay as previously described. analytes above the detectable range were assigned a threshold concentration. to obtain a visual representation of overall patterns in the highly dimensional raw data as an additional multivariate technique to identify patterns within the data, principle components analysis (pca) was also completed on the raw values obtained from the multiplex array. to assess the within-subject correlation, we determined change of cytokines and growth factors from a baseline time point the values obtained from the participants ' first blood draw in the first trimester by taking the log of 1 plus fold change from the baseline value: log(1+x), where x=(cytokine concentration of the sample of interest/cytokine concentration of the baseline sample) to analyze trends over time. first, we graphically assessed the growth trajectory for the 42 cytokines using smoothing splines. we then fit unconditional mean models (umm) for the 42 cytokines in order to estimate the variance components: the within-subject variance () and the between-subject variance (0). estimating the two variance components helps to determine whether there is sufficient variation to warrant further analysis and enabled computations of the intraclass correlation coefficient,, which describes the proportion of the total outcome variation that lies between subjects. next, we fit unconditional growth models (ugm), which allowed random slope but not random intercept because the starting value of all patients was the same (baseline value=0.3) due to normalization to each individual's baseline value. as both gestational age in weeks and trimester can be used as the time covariate for growth curve models, and as the trimester can be treated as either a continuous or a categorical variable (depending on whether we assume linear relationship between trimester and outcome variables), six different models were fitted for each cytokines as follows: (1) model with only the gestational age in weeks as the time covariate, (2) model with only the trimester (continuous) as the time covariate, (3) model with only the trimester (categorical) as the time covariate, where the variance-covariance pattern was assumed to be autoregressive, (4) model with both gestational age in weeks and continuous trimester as covariates, allowing random slope for gestational time in weeks, (5) model with both gestational age in weeks and continuous trimester as a covariate, allowing random slope for trimester, and (6) model with both gestational age in weeks and continuous trimester as a covariate, allowing random slopes for both gestational age in weeks and trimester. we then compared the six models and the unconditional mean model for each of the cytokines based on logic and statistical fitness, using akaike information criteria (aic). because of the exploratory nature of this study, there was no correction for multiple comparisons. the multiplex was designed to assess 42 factors, but the limits of detection were exceeded with three factors, and there were 5 cytokines that fell below the limit of detection in>50% of the samples. pdgf-aa, pdgf-ab/bb, and rantes had cytokine levels above detection limits of the assay in 9.9%, 11.2%, and 34.9% of the samples, respectively (table s1; see supplementary material available online at http://dx.doi.org/10.1155/2015/952571). il-2, il-3, il-4, il-13, and tnf had>50% of the samples below the detection limit (table s1). differences in cytokine profiles between baseline (first trimester) pregnancy samples and nonpregnant control samples could be identified by pca (figure 1). specifically, we identified significantly higher levels of gro, tgf, egf, pdgf-aa, and pdgf-ab/bb and significantly lower levels of scd40l, ip-10, il-6, il-17, il-13, and mcp-1 in the baseline pregnancy samples (table 1). when all longitudinal samples were included in a pca, no difference next, we evaluated whether those differences apparent in early gestation were also present at the end of pregnancy. when comparing the final independent samples obtained at the end of pregnancy to the healthy control samples, the following remained significantly elevated in pregnant women: egf (330.6 versus 24.8 pg/ml, p=0.0013), gro (1,153.6 versus 341.6 pg/ml, p<0.001), sil-2ra (17.9 pg/ml versus lld, p=0.02), and tgf (15.8 versus 1.8 pg/ml, p=0.0006) meanwhile, only eotaxin was lower in women at the end of pregnancy compared to normal controls (33.4 versus 330.0 pg/ml, p<0.001). to begin to assess within-subject variation, we clustered the raw data (figure 2), where the issue of correlation within subjects becomes visually apparent. empirical growth plots demonstrated that the within-subject variation differs among different women (figures 3 and 4 show a representative example using il-15, and the remainder of the plots can be viewed in supplementary figures). for example, patient o displays very large variation in the majority of the cytokines tested, whereas patients b, c, f, and g have comparatively steady levels for most cytokines. also, high variability in one cytokine does not imply high variability in other cytokines for the individual women. high interclass correlation (0.7) was observed for scd40l, rantes, il-10, tnf, il-7, and gm-csf (table s2). this means that the majority of the variability in these cytokines is attributed to variance between subjects. the interclass correlations were comparatively low (< 0.3) for il-3, il-4, mcp-3, and ip-10, suggesting more variation within subjects for these cytokines. the final model for mdc (table 2) was ugm with gw, with a decreasing trajectory. the estimated variance for the random slope is 0.000001632, suggesting that the variability of slope among patients is quite small. on the other hand, the average scatter of an individual's outcome around her own trajectory is larger (the estimated variance is 0.000937, p<0.0001), suggesting that there might be some other important covariates that are not included in the model. however, including gestational age in weeks as a covariate does substantially improve the fit of the model. when comparing the estimated within-subject variance of the ugm with that from the umm, we found that the linear gestational age in weeks helps to explain 34% of the within-subject variation in mdc. the estimated fixed effect suggests that mdc decreases over time (the estimated slope is 0.00163, with p 0.0001, suggesting that the slope is significantly lesser than 0, figure s2). eight other cytokines demonstrated statistical significance, although with increasing trajectories, with ugm and gw as a covariate: il-1, il-6, il-8, il-12p70, il-13, il-15, ip-10, and flt3-ligand (table 2). six cytokines showed association with trimester as a linear variable: il-1ra, il-3, il-9, il-12p40, ifn2, and scd40l (table 3). il-1ra showed the greatest percent explanation by inclusion of linear trimester in the model. when comparing the estimated within-subject variance of the umm with that from the ugm, we found that the linear trimester helps to explain 27% of the within-subject variation in il-1ra. seven other cytokines showed significant associations with trimester as a categorical variable: il-4, ifn, g-csf, tgf-, tnf-, sil-2ra, and mip-1 (table 4). the final model for both egf and vegf was umm with intercept only, leading to the conclusion that both egf and vegf do not change over time. time-dependent ugm models were identified but did not meet statistical significance for the following cytokines: il-2, il-5, pdgf-aa, pdgf-ab, mip-1, gro, mcp-1, mcp-3, rantes, il-17, il-7, eotaxin, fgf-2, il-10, tnf, il-1ra2, fracktalkine, and gm-csf. therefore, approximately 50% of cytokines measured by multiplex array did not show any association with gestational week or trimester. our results suggest that the third trimester of pregnancy is characterized by an increasingly inflammatory (e.g., il-1, il-6, il-12, il-15, ip-10, and scd40 ligand) as well as counterregulatory (e.g., il-1ra and flt3-ligand) milieu compared to earlier stages of pregnancy. our superimposed growth curves of il-15 (figure 4) and il-1 (figure s3), the cytokines with the strongest association with gestational week as a linear covariate, suggest that this change begins at approximately week 20 and peaks just after week 30. this is consistent with other reports of systemic immune activation as well as counterregulation in the latter part of pregnancy [3, 1719]. increasing il-1 and il-15 may predominantly be related to production from placental tissues [20, 21] or mononuclear phagocytes [22, 23] in late gestation. the precise immunologic mechanisms responsible for this shift can not be determined by our study, but if the source of these cytokines is predominantly the innate immune system, one potential stimulus to these cytokines ' secretion is cell-free fetal dna. a recently proposed model links rising circulating levels of fetal dna to maternal innate immune activation via toll-like receptor- (tlr-) 9 on neutrophils and macrophages, leading to increasing inflammatory cytokine release, that may result in an immune cascade ultimately leading to parturition. a novel finding of this study is the decline in mdc levels throughout pregnancy (figure 5). mdc is chemoattractant for immature dendritic cells and type 2-biased t cells, and it is possible that decreasing mdc levels may reflect a gradual shift away from a self-amplifying type 2 immune response as pregnancy progresses. il-9 is cytokine that has been recognized for decades but only recently had its cell of origin identified: the innate lymphoid cell (ilc). the role of il-9, which has historically been categorized as a th2 cytokine prior to the recognition of ilc, is currently unknown in normal pregnancy. because only serum was available for analysis, we can not confirm the cellular source of the changes observed with this cohort. nonetheless, increasing transcription levels of several innate immune components, including cd14, multiple tlr genes, and il-1b, have been observed in peripheral blood leukocytes of women in the third trimester, suggesting that the changes in concentrations of the cytokines identified in our study could plausibly be due to changes in peripheral blood cellular composition. further studies will be necessary to determine whether placental tissues, circulating leukocytes, stromal cells, or other sources also contribute to the changes reflected in our results. although these results show statistical significance, it is also noteworthy that the slopes of the variance were all fairly small for each of the analytes and that gestational week did not explain any more than 40% of the variation observed in any of the cytokines. pregnancy clearly alters the maternal immune milieu, but the changes from baseline in the setting of normal pregnancy are subtle and more variable in some women than in others. what clinical factors contribute to this variation observed between women in the setting of a normal first pregnancy is not entirely known. blood draws and resulting data were relatively sparse in the first trimester due to women not returning as frequently for study blood draws, even though they were scheduled per protocol, relative to the second and third trimesters. it is also important to note that many analytes were not detectable in samples; therefore, it is possible that a different method besides multiplex array on serum or plasma, for example, elisa for individual cytokines/growth factors, may be more sensitive to detect change over time. previous longitudinal studies of maternal cytokines during pregnancy have shown some concordance with our results. investigated the change of maternal plasma cytokines from early to midgestation in a large cohort (approximately 1,000 patients) and found that il-12 and ifn levels increased, while il-2 and gm-csf levels decreased as pregnancy progressed. our results confirmed increasing il-12 levels, as well as an increase of ifn in the third trimester compared to the first. however, kraus et al. published maternal multiplex elisa results from 50 women tested at each trimester as well as postpartum and showed that ifn levels decreased throughout gestation. denney et al. also found that basal levels of ifn decreased throughout gestation, as did levels of tnf, il-1, and il-6 in serum samples of 45 healthy pregnant women collected during each trimester. another recent study demonstrated decreasing il-1 levels throughout gestation. while our study did not confirm any time-dependent change of tnf, we instead observed increases in il-1 and il-6 throughout pregnancy, in contrast to these studies. clearly, individual heterogeneity exists, and our smaller sample size may account for some of these differences with prior studies. although not the original focus of this study, we also identified several differences in cytokine/growth factor milieu when comparing pregnant women to healthy controls. notably, the first trimester of pregnancy was characterized by an increase in several growth factors (gro, egf, tgf, and pdgf) and a relative decrease in inflammatory markers (scd40l, il-6, il-17, ip-10, eotaxin, and mcp-1). eotaxin, a potent chemoattractant for eosinophils during allergic reactions, has been similarly described to be suppressed during pregnancy by kraus et al.. overall, the tolerance induction required for successful pregnancy at the level of the fetomaternal interface may also be observed in a relatively tolerogenic, growth factor-rich maternal systemic environment. the difference in sample source when comparing the archived samples from healthy pregnant women (serum) and normal controls (plasma) may contribute to these findings. for example, eotaxin, pdgf, egf, vegf, and soluble cd40 ligand have previously been shown to be significantly different in serum postclotting as compared to plasma samples. because of this potential source of variation in comparing our historical to contemporary samples, our results will require validation with similarly processed samples of the same source. however, egf levels have been reported to be approximately 65 pg/ml in serum of healthy individuals, well below our median 489.4 pg/ml in our samples obtained from pregnant subjects, suggesting that our results may hold true despite differences in sample source. similarly, serum levels of cd40l have been shown to be 830-fold higher in serum as compared to plasma, suggesting again that the very low levels identified in the serum of our cohort of pregnant women may indeed be reflective of the pregnancy state. our study is unique in that the longitudinal samples were obtained frequently throughout the course of pregnancy. because of this, our study has the potential to more richly describe individual maternal immune variation over time. however, our study is limited by the relatively small sample size, the lack of pre- or postpartum samples, and potentially the age of the specimens. to address these limitations, we have recently conducted a larger longitudinal study of maternal immune changes during pregnancy, with peripheral blood samples obtained monthly throughout gestation as well as 6 weeks postpartum. tolerance at the fetomaternal interface is complex and technically challenging to study in humans longitudinally. as a result, many recent studies have sought to understand how pregnancy changes maternal systemic immunity. the possibility exists of maternal peripheral blood not completely or accurately reflecting the local changes within decidual tissues. an example of such a discrepancy in our study is that of ip-10, which was low in first-trimester pregnancy compared to healthy controls in this cohort. ip-10 is secreted by decidual natural killer cells and is key to trophoblast migration and thus has previously been shown to be elevated during pregnancy [31, 32]. on the other hand, the decidual t cell compartment at parturition has recently been shown to closely reflect that of peripheral blood, suggesting that for some components of the immune system the maternal peripheral blood is reasonable to study. furthermore, sampling maternal peripheral blood is much more feasible to perform longitudinally as compared to more invasive means and may still lend insight into the maternal adaptation to pregnancy. successful pregnancy has previously been described as predominantly a type 2 immune response-biased phenomenon [3436]. in light of the collective evidence, it seems that the description of pregnancy in terms of type 2 immune responses may be oversimplified, both in the overall description of key cytokines/growth factors as well as in the temporal dynamics, and it is in need of further refinement.

several recent studies have shown differences in the maternal immune milieu at different phases of pregnancy, but most studies have been cross-sectional or of relatively few time points. levels of 42 cytokines were determined using a multiplex bead-based assay on archived serum from a cohort of pregnant women (n=16) at median of 18 time points tested, from the first trimester through to parturition, per woman. unconditional growth modeling was then used to determine time-dependent changes in levels of these cytokines. macrophage-derived chemokine (mdc, aka ccl22) decreases as pregnancy progresses. il-1, il-6, il-8, il-12p70, il-13, il-15, ip-10, and flt3-ligand increase as a function of gestational weeks, and ifn2, il-1ra, il-3, il-9, il-12p40, and soluble cd40 ligand increase as a function of trimester. as pregnancy normally progresses, a maternal shift away from a type 2-biased immune response and toward an inflammatory/counterregulatory response is observed.

PMC4381731

pubmed-159

endocarditis of the right side of the heart is uncommon by virtue of the low hemodynamic pressure and lack of isolated or significant right-sided valvular deformities. the valves fall prey to an infective process in settings of congenital heart disease or endothelial injury. pulmonary arterial endarteritis is a rare event, even in patients with congenital heart disease (chd). further, a combination of pulmonary endarteritis with a systemic suppuration in chd invites greater attention. a 4-year-old male child, born from a non-consanguineous marriage, was admitted with the history of fever and progressive right-sided weakness for 1 week and cyanosis noted since 6 months of age. the patient's mother had noted dyspnea on feeding since 1 year of age. on admission, the patient had dyspnea on exertion (grade iii/iv, ats grading). the cardiac apex was at left 5 intercostal space, 3 cm outside the mid-clavicular line. an ejection systolic murmur (grade iii/vi) was audible in the pulmonary area. a right-sided complete hemiparesis with extensor plantar was noted. an ecg revealed right atrial enlargement, extreme right axis, and poor progression of r wave. chest x-ray revealed cardiomegaly with reduced pulmonary vascular markings [figure 1]. a full-segmental echocardiography revealed a single ventricle of the double-inlet left ventricle type [figure 2]. a rudimentary right ventricle was connected to the main ventricle by a non-restrictive foramen. the aorta arising from the rudimentary chamber and pulmonary artery from the main chamber [figure 3]. a 7 mm 5 mm fixed structure on the wall of the main pulmonary artery with erratic movement, indicative of a vegetation, suggested pulmonary endarteritis [figure 4a and b]. a small osteum-secundum atrial septal defect was present, but patent ductus arteriosus was not present. ct scan of the brain revealed bilateral multiple cerebral abscesses [figure 5], with the largest one present superficially in the left parietal region. chest x-ray showing cardiomegaly with decreased pulmonary flow echocardiography (subcostal anatomically corrected view) showing both mitral and tricuspid valves opening into a single ventricle of lv morphology. a rudimentary rv type of ventricle is also visualized echocardiography (subcostal anatomically corrected view) showing aorta arising from a rudimentary right ventricle which is connected to the left ventricle through a nonrestrictive foramen (a) and (b) shows the pulmonary vegetation suggesting pulmonary endarteritis ct scan of the brain showing bilateral cerebral abscesses the child was started on parenteral ceftriaxone 80 mg/ kg/day (plus, gentamicin 3 mg/kg/day for 2 weeks) for the endarteritis and was continued for 6 weeks for optimal treatment of the cerebral abscess. an attempted drainage of the largest cerebral abscess resulted in some improvement of the hemiparesis. the patient became afebrile in 2 weeks and was able to walk after 4 weeks of therapy. repeat echo before discharge showed substantive decrease in size of the pulmonary artery vegetation and cardiac symptoms. the patient has been referred to the cardiac surgery department for corrective surgery for single ventricle. the risk of infective endocarditis is considerably increased in children with congenital heart disease, and the disease can occur with almost any lesion, more so with cyanotic congenital heart disease (cchd). right-sided infective endocarditis is rare by virtue of the low hemodynamic pressure and lack of isolated or significant right-sided valvar deformities. in adults, right-sided infective endocarditis usually follows prolonged intravenous catheterization or intravenous drug-abuse, affecting the tricuspid valve alone or in combination with the pulmonary valve. a similar valvar involvement also occurs in infants and in children, but here congenital cardiac anomalies with their accompanying interventions are important pre-disposing factors. pulmonary endarteritis as an entity of right-sided endocarditis is rare, even in patients of congenital heart disease. most of the reported pulmonary endarteritis cases have been associated with a patent ductus arteriosus (pda). there are less than 30 reported cases of pulmonary endarteritis associated with pda in the adult, and overall incidence has dramatically decreased over the last 30 years. bilge et al., in their case report of pulmonary endarteritis in pda, underlines the importance of echocardiography in not only making this rare diagnosis but also as an effective means of following up such a case. apart from pda, a single report exists of pulmonary endarteritis occurring after anatomical correction of complete transposition of the great arteries. to the best of our knowledge and available resources, our case report of pulmonary endarteritis in a child of single ventricle is probably the first such so far. the onset of pulmonary endarteritis and the formation of vegetation can be explained by several factors, including an obstacle of a valve or bloodstream jet and venturi effect, the formation of a platelet fibrin thrombus, transient bacteremia, and adhesion factor for infection. in the present case, an untreated infection in the child could have led to multiple episodes of bacteremia. the presence of multiple, bilateral cerebral abscesses is a corroborative evidence to the bacteremia. the pulmonary artery in this case arose from the main ventricle (morphological double-inlet lv) and was hypoplastic. turbulent blood flow distal to the stenotic lesion may increase the risk of developing infective endarteritis in an already hypoplastic pulmonary artery. the intima is also damaged in these areas, predisposing to formation of platelet fibrin thrombus, and thus making the region more susceptible to colonization by pathogens. congenital heart disease (chd) has a reported incidence of 9596/million live births (0.95%), out of which 14.5% (1391/million live births) have cyanotic congenital heart disease (cchd). single ventricle (106/million live births) accounts for 7.6% of cchds and 1.1% of all chds. meticulous full-segmental echocardiographic approach is required to diagnose and delineate the specific type of single ventricle. single ventricle is a complex cchd and is considered a high risk condition for an infective endocarditis. trans-thoracic echocardiography (tte) is more sensitive in the pediatric population than in the adult population for detection of vegetation. tte is more likely to identify vegetations in children with normal anatomy or isolated valvular pathology than in those with complex cchd. the importance of a carefully-performed tte or trans-esophageal echocardiography is, therefore, essential in a complex cchd like single ventricle states. cyanotic heart disease accounts for 12.8%-69.4% of all cases of brain abscesses, with the incidence being higher in children. the incidence of brain abscess in patients with cyanotic heart disease has been reported to range between 5 and 18.7%. in our case, bacteremia from an unknown source could have bypassed the pulmonary circulation by entering the double-inlet lv (the dominant ventricle) and moved through the aorta and seeded in the brain. patients with cyanotic heart disease could have low-perfusion areas in the brain due to chronic severe hypoxemia and metabolic acidosis as well as increased viscosity of blood due to secondary polycythemia. these low-perfusion areas commonly occur in the junction of gray and white matter, and they are prone to seeding by microorganisms that may be present in the bloodstream. the advent of ct scans and their use in the management of these abscesses has resulted in a fourfold decrease in the mortality rate in patients with brain abscesses, secondary to cyanotic heart disease-from 40%-60% in the pre-ct era to ~10%. the threshold for ct scans in a cchd should be low, and regular ct scans should be obtained to monitor the size of the abscess. in conclusion, this case report aims to highlight the considerable and varied morbidity associated with cyanotic congenital heart diseases (cchd). the presence of a relatively common infectious complication (cerebral abscesses) and a rare infectious complication (pulmonary endarteritis) in the same child with a cchd (single ventricle) validates the need for a heightened clinical awareness and a prompt and meticulous investigational approach for diagnosis and therapy in this group of patients.

endocarditis of the right side of the heart is otherwise uncommon in children. pulmonary endarteritis as a complication of congenital heart disease is even rarer. herein, we report the case of pulmonary endarteritis with a 7 mm 5 mm vegetation, involving the main pulmonary artery in a 4-year-old male child, with cyanosis and a 1-week history of fever and rapidly-progressive hemiparesis. a full segmental echocardiography demonstrated a double inlet left ventricle with left-sided subaortic hypoplastic right ventricle (van praagh's a-iii type single ventricle). additionally, ct scan of the brain revealed bilateral cerebral abscesses. to the best of our knowledge, the occurrence of pulmonary endarteritis and cerebral abscesses in a case of single ventricle is hitherto unreported. this article underlines the importance of heightened clinical awareness and meticulous echocardiography in cases of congenital heart disease so that relatively rare complications may not be missed.

PMC3425033

pubmed-160

most commonly affects people of african descent. in nigeria, sickle cell anaemia affects about 1-3% of the nigerian population. individuals who have only one copy of the mutation are said to have sickle cell trait.12 these people are usually healthy but can transmit the disease to their children.3 sickle cell anaemia is characterised by acute episodes of pain (in the abdomen, chest or joints) and exhibits a range of severity.45 sickle cell disease is a condition which alters the shape of the red blood cells from round to sickle shape, causing them to block small blood vessels and interfere with normal blood flow. children affected with sickle cell disease experience chronic episodes of pain and an increased susceptibility to potentially life-threatening conditions, including bacterial infections and organ failure. at the present time, there is no cure for sickle cell anaemia. although there are some altering therapies such as hydroxyurea and hematopoietic cell transplantation for the management of sickle cell disease, but these can have serious side effects and are very risky the average life expectancy for people with sickle cell anaemia is less than 50 years. the first deoxyribonucleic acid (dna) diagnostic procedure for prenatal purposes was reported more than thirty years ago.6 subsequently, it was recognised that the mutation itself affected the cleavage site of a restriction enzyme, ddei, that could recognize the dna sequence of ctnag (n=a, t, c, or g). while dna from a normal allele (ctgag) would be digested by the enzyme, dna from an affected allele in which a is substituted by t (ctgtg) would not.78 the resulting differences between dna fragment sizes can then be recognised by electrophoresis, thus forming the basis for diagnosis. with the advent of polymerase chain reaction (pcr), rapid dna analysis methods have become available, and these techniques are now widely used for prenatal diagnosis.910111213 pre-implantation genetic diagnosis (pgd) is a procedure that has emerged against the backdrop of in vitro fertilisation (ivf) technology. in nigeria, this process of ivf was first introduced by ashiru et al.14 following their pioneering work, we were able to advance this technique for patients with infertility,1516 and now for patients with advanced maternal age and sickle cell disorders with the use of pgd. with pgd, the genetic status of an embryo can be determined before transfer into the uterus after ivf, thus almost completely eliminating the risks of bearing a child with the disease17(pgd is not 100% accurate). the most common form of pgd involves the extraction of one or two cells from the pre-implantation embryo, often around the 8-cell stage. couples at risk for the transmission of genetic diseases can now choose ivf and pgd to avoid the problem of selective abortion that is associated with pre-natal diagnosis during pregnancy. the patient was a 29-year-old woman and spouse with heterozygous genotype (as). couple already have a 2-year-old child who is affected with sickle cell anaemia. prior to ovarian stimulation, hysterosonogram (hsn) was done which revealed normal uterine cavity. the protocol was also approved by the research and ethics committee of the centre. following 3 weeks of oral contraceptive use, the patient was down-regulated using a gnrhanalog (leuprolide). super ovulation was achieved with the use of recombinant follicle stimulating hormone (fsh). when three or more leading follicles measured>18 mm in diameter, the patient was triggered with human chorionic gonadotropin (hcg) 5000 iu. the surrounding cumulus and corona cells were then removed and the nuclear maturity of the oocytes was assessed under an inverted microscope. only metaphase ii oocytes were injected with morphologically normal motile spermatozoa. further culture of injected oocytes was done in 20 l microdrops of culture medium under lightweight paraffin oil. fertilisation was confirmed after 16-18 hours by the observation of two distinct pronuclei (2pn). oocytes with 2pn were assessed on day 2 after injection for embryonic development. on day 3, a single blastomere was biopsied for embryos at 6-8 cell stage with less than 50% fragmentation [figures 1 and 2]. blastomere showing nucleus fifteen biopsied cells were sent for genetic screening and analysed using pgd/pcr technique [figure 3]. results provided after 48 hours showed that 5 (33%) of the biopsied cells were of genotypes unaffected by sickle cell anemia; of these, three were heterozygous carriers of hb s (as) and two were homozygous for hba (aa). three unaffected embryos (two heterozygous normal and one homozygous) were transferred on day 5 at blastocyst stage. endometrial lining was prepared for fet using increasing doses of estradiolvalerate from 2 mg daily up to 8 mg with weekly monitoring of the endometrium. two vitrified normal embryos (one hbas and one hbaa) were thawed both at hatched blastocyst stage and transferred [figure 4]. the advent of ivf as a treatment for infertility has created the opportunity to study the chromosomal constitution of surplus human pre-implantation embryos. cultured human pre-implantation embryos have been used to develop methods which allow pgd analyses by pcr on biopsied blastomeres from an embryo.18 beta-thalassaemia and sickle cell anaemia are -globin chain quantitative and structural disorders that lead to anaemia syndromes. until recently, the only alternative for couples with a high genetic risk was to undergo prenatal diagnosis followed by termination of an affected pregnancy. the pgd of -thalassaemia and sickle cell anaemia is an alternative that avoids therapeutic abortion by diagnosing embryos for -globin defects before implantation into the mother's womb.19 on a world-wide scale, pgd for -thalassaemia and/or sickle cell anaemia has already been applied on single blastomeres20 and on the first and second polar bodies.21 the molecular strategies used were dna amplification followed by genetic diagnosis by denaturing gradient gel electrophoresis analysis,20 restriction enzyme digestion, the creation of a new restriction enzyme recognition sequence involving the ivs1 nt 110 mutation2122 and the use of fluorescence pcr.22 in the present study, pgd was applied clinically for sickle cell anaemia on a fertile carrier couple with previous experiences of therapeutic abortion for affected foetuses, and a sickle cell disease child. despite the fact that sickle cell anaemia is one of the most common genetic disorders and detailed genetic information is available,23 unaffected pregnancies following pgd for sickle cell anaemia previously have not been reported. lack of previous success in this area presumably is due to the length of time and effort required to overcome technical difficulties inherent in these procedures, as well as lack of available research funding.17 our results demonstrate that sickle cell anaemia can be detected in single cells by pcr and restriction enzyme analysis and that unaffected pregnancies can be established by the transfer of embryos of known genetic makeup that have undergone biopsy. in total, one pgd cycle with a frozen embryo transfer cycle were carried out. the goal of pgd is to reduce the risk of having children born with genetic diseases from a priori risk of 25% to a value significantly less. patients undergoing pgd should be advised that if a pregnancy does occur from this treatment, they should consider undergoing chorionic villi sampling (cvs) or amniocentesis to confirm these micro-genomic results. in summary, this is the first unaffected pregnancy and delivery after successful pgd for sickle cell anaemia. our results demonstrate that pgd for the detection of sickle cell anaemia is a powerful diagnostic tool for carrier couples who desire a healthy child but wish to avoid the difficult decision of whether to abort an affected foetus. the procedure, successfully used in this case, may also be applied to other monogenic disorders and further supports the notion that pgd is destined to be an integral aspect of assisted reproductive technology. given the current methods and relatively high cost of the procedure, it is unlikely that pgd will totally replace prenatal testing. however, it is conceivable that with further refinements, pgd will certainly become an invaluable and powerful diagnostic modality.

a couple, both carriers of the sickle cell anaemia trait (genotype hbas) with an offspring already affected with the genetic disease underwent a pre-implantation genetic diagnosis/polymerase chain reaction screening of biopsied blastomeres. dna analysis of single blastomeres was carried out to find out indicated a viable intra-uterine pregnancy with embryos which carried the sickle cell mutation, which resulted in a livebirth (hbas). pgd/pcr in combination with ivf appears to be the most suitable treatment plan for patients who are at a higher risk of reproducing offspring affected with inheritable genetic diseases.

PMC4071672

pubmed-161

obesity is a worldwide phenomenon, with an incidence increasing in parallel with obesity-associated diseases such as insulin resistance, type 2 diabetes mellitus, and hypertension. the combination of obesity and hypertension places patients at a higher risk of hypertensive end-organ damage and vascular events [2, 3]. blood pressure (bp) is subject to diurnal variation, and studies using ambulatory bp monitoring (abpm) have demonstrated the clinical significance of disturbances in the diurnal bp profile and have associated nondipping with a progression in end-organ damage [4, 5]. moreover, a nondipping pattern of bp has been reported to occur in several conditions that are frequently associated with obesity. although body mass index (bmi) is associated with the severity of ambulatory hypertension and an increase in daytime bp, bmi does not reflect body fat distribution. epicardial adipose tissue is related to visceral fat, rather than total adiposity, and shares microcirculation with myocardial tissue and coronary vessels [6, 7]. because elevated bp is associated with ectopic fat accumulation in the intrathoracic and epicardial areas, a possibility of association of epicardial adipose tissue with hypertension as well as diurnal bp patterns [10, 11] has been found in some recent studies [8, 9]. epidemiological studies have found that epicardial fat is two to three times more common among females than males and that excessive body weight increases the risk of diabetes mellitus (dm) and cardiovascular diseases approximately one-and-a-half to two times higher in women than it does in men. furthermore, a higher prevalence of hypertension among overweight adults is found in women than in men, which may indicate different susceptibilities based on gender. given these facts, we aimed to investigate the influence of obesity on the association between epicardial fat thickness (eft) and circadian bp changes in patients with recently diagnosed essential hypertension (eh), with a gender subgroup analysis. this cross-sectional observational single-center cohort study included patients who underwent 24 h abpm and echocardiography between january 2008 and october 2013. demographic characteristics recorded at the first visit included age, sex, height, weight, medication, smoking history, and other diseases. blood was drawn for measurement of total serum cholesterol, triglycerides, high-density lipoprotein (hdl) and low-density lipoprotein (ldl) cholesterol, blood glucose, creatinine, uric acid, and high sensitivity c-reactive protein (hs-crp). body mass index (bmi) was calculated as the ratio of dry weight in kilograms to height squared (in square meters). a total of 441 consecutive patients, who underwent office bp measurements, 24-hour abpm, and laboratory measurements for cardiovascular risk factors and echocardiography, were analyzed. following the recommendations of the european society of hypertension, a normotensive state was defined as a mean daytime ambulatory systolic and diastolic bp<135/85 mmhg by abpm, associated with true ht was assigned if the average daytime bp was higher than 135/85 mmhg and the average nighttime bp was above 120/75 mmhg. obesity was defined as a bmi above 25 kg/m, as per the korean society for the study of obesity. the patients with the following diseases were excluded from the study: secondary hypertension, significant liver disease, neurologic disorder, malignant disease, valvular heart disease, heart failure, and history of acute coronary syndrome, myocardial infarction, coronary revascularization procedure, carotid revascularization procedure, ischemic leg ulcer, peripheral revascularization, or amputation. because the presence of type 2 dm is known to be associated with increased eft regardless of obesity [6, 7], we also excluded overt type 2 dm from the analysis to avoid its possible confounding impact on the association between eft and circadian bp variability in our hypertensive patients with or without obesity. office bp measurements were performed using an automated device (easy x 800 (r/l), jawon medical, seoul, korea). measurements were taken after patients had rested for 10 min in a sitting position, with the arm comfortably placed at the heart level. each set of two measurements was averaged to give the office systolic and diastolic bp. abpm was performed on each patient's nondominant arm using an automatically oscillometric device (tonoport v, par medizintechnik, berlin, germany) on a normal working day. all subjects were instructed to rest or sleep between 10:00 pm and 7:00 am (nighttime) and to continue their usual activities between 7:00 am and 10:00 pm (daytime). the accuracy of the device was checked against the standard auscultatory method to ensure that the difference in bp measurements between methods did not exceed 5 mmhg. the device was set to obtain bp readings at 20 min intervals during the day (7:00 am10:00 pm) and at 40 min intervals during the night (10:00 pm7:00 am). each abpm dataset was first automatically scanned to remove artifactual readings according to preselected editing criteria. data were edited by omitting all readings of zero, all heart rate readings<20 or>200, diastolic bp readings>150 and<40 mmhg, systolic bp readings>240 and<70 mmhg, and all readings where the difference between systolic and diastolic bps was less than 10 mmhg. the following abpm parameters were evaluated: average ambulatory 24-hour systolic and diastolic bp levels, average ambulatory daytime systolic and diastolic bp levels, average ambulatory nighttime systolic and diastolic bp levels, and mean ambulatory 24-hour, daytime, and nighttime bps. additionally, for both sbp and dbp, the magnitude of the nocturnal decline in bp (nocturnal decline) was calculated as follows: daytime average bp minus nighttime average; the percentage change in bp from day to night (% day night bp) was calculated as (daytime bp nighttime bp) 100/daytime bp. with this latter data, a normal dipper pattern was diagnosed when the reduction in the average sbp and dbp during the nighttime was 10% of the average daytime values. the nocturnal bp status was also assessed and expressed as either nocturnal normotension or hypertension, with nocturnal hypertension defined as a nighttime bp of 120/70 mmhg. standard two-dimensional (d) and strain echocardiography were performed on all subjects while lying in the left lateral decubitus position using a 3.5 mhz transducer (philips ie33, philips medical systems, bothell, wa, usa), and the echocardiography examiners were blinded to patient information. measurements of the thickness of interventricular septum and posterior wall, the diameter of the lv cavity, and the lv mass index (lvmi) were performed according to american society of echocardiography criteria. pulsed wave doppler of the transmitral lv inflow was performed in an apical 4-chamber view with the sample volume placed at the level of the mitral valve tips, and the following measurements of global lv diastolic function were determined: peak early (e) and late (a) diastolic mitral flow velocity, and their ratio, e/a; early (ea) diastolic mitral annular velocity; deceleration time of the e wave; and lv isovolumetric relaxation time (ivrt). echocardiographic assessments of the eft were measured perpendicularly from the free wall of the right ventricle at end-systole in three cardiac cycles according to the method previously described by iacobellis et al. epicardial fat was described as the echo-free space between the outer wall of the myocardium and the visceral layer of the pericardium. the maximum eft was also measured from the point on the free wall of the right ventricle along the midline of the ultrasound beam perpendicular to the aortic annulus as the anatomic landmark (figure 1(b)) and from the apical 4-chamber view focused on the right ventricle (figure 1(c)), because one of the critical issues in eft measurement is the inconsistency in the measurement location, and mean eft was averaged from the parasternal long axis, parasternal short axis, and apical 4-chamber view images. the offline measurement of eft was performed by two cardiologists (ik shim and ki cho) who were unaware of the clinical data. statistical analyses were performed with the commercially available computer program spss 18.0 for windows (spss inc. values are expressed as mean standard deviation or as a percentage (%). parameter differences among the 3 groups were evaluated using the one-way anova test for normally distributed variables and the kruskal-wallis test for non-normally distributed variables. values are expressed as means (standard deviation) if numerical variables or as the number of subjects and their percentages (%), if categorical. pearson correlations analysis was performed to determine factors that potentially influenced bp and hr variability. multivariate logistic regression models for bp variability were built to determine which variables were independently associated with this status. a total of 441 patients with eh (male/female, 236/205; mean age, 50.7 13.8) and 83 normotensive normal weight patients (controls, male/female, 42/41; mean age, 51.0 13.3) were analyzed, and their clinical features and ambulatory blood pressure parameters according to gender are given in table 1 (male) and table 2 (female). circadian bp profile and bp variability assessed by 24-hour mean bps variation were increased in hypertensive patients, especially in hypertensive obese patients, without gender difference (all p's<0.05). moreover, the proportion of patients with a nondipping pattern was the highest among the hypertensive obese patients. although there were no significant differences in hr variability among the groups, hypertensive obese patients had higher daytime and 24-hour mean hr and male hypertensive obese patients also had higher nighttime hr than control patients (all p's<0.05). although total cholesterol levels were higher in hypertensive obese patients of both genders than in the controls, male hypertensive obese patients had higher triglycerides and female hypertensive obese patients had lower hdl cholesterol than controls (all p's<0.05). although there was no significant difference in systolic function, hypertensive patients showed significantly increased wall thickness and enlarged left atrial diameter, which were more prominent among hypertensive obese patients, without gender difference (tables 3 and 4). interestingly, eft was higher in female than in male patients (7.0 2.5 versus 5.9 2.2 mm, p<0.001). among women, eft was highest in the obese eh group (7.5 2.6 mm) whereas that of the control was 6.4 2.8 mm and that of the nonobese eh group was 6.7 2.8 mm; however, eft did not vary significantly among males (5.9 1.9 versus 6.0 2.7 versus 5.9 2.4 mm, resp., p=0.937). when we compared the 24-hour abmp parameters and eft between male and female patients, female patients had significantly higher eft (7.0 2.6 versus 5.9 2.2 mm, p<0.001) and a greater daytime bp variation (15.1 4.72 versus 13.6 4.45 mmhg, p<0.001) than male subjects; males had higher 24-hour mean bp (138.8 14.7 versus 137.3 15.3 mmhg, p=0.043) and hr variability (15.6 7.45 versus 14.3 6.02, p=0.023) than female subjects (table 5). variable circadian bp profiles and la size were significantly related to bmi in both females and males (all p's<0.05, figures 2(a) and 2(b), table 6). however, eft was significantly correlated with 24-hour mean bp (both day and night) as well as variability (mainly night) only in female patients (figure 2(c)). when we investigated the association of quotient of eft/bmi with bp values, eft/bmi showed positive correlation with 24-hour systolic bp (r=0.172; p=0.009), 24-hour mean bp (r=0.134; p=0.041), day systolic bp (r=0.150; p=0.022), day systolic bp variation (r=0.133; p=0.043), night systolic bp (r=0.217; p=0.001), night systolic bp variation (r=0.181; p=0.006), night diastolic bp (r=0.132; p=0.047), and night diastolic bp variation (r=0.179; p=0.007). however, no correlation was shown between eft/bmi and 24-hour abpm parameters in male. multivariate logistic regression analysis demonstrated that the 24-hour mean bp variability was associated with sbp (standardized coefficient=0.199; p=0.018) and eft (standardized coefficient=0.175; p=0.016) in female patients, but not in male ones (table 7). when we performed binary logistic regression analysis to identify the independent determinants of nocturnal nondipping bp pattern, eft was independent contributor to the nondipping pattern only in female (odds ratio 7.034, 95% confidence interval 2.258 to 21.909, p=0.001) (table 8). the most relevant information obtained from this study is that relationships among eft, obesity, and circadian bp variability are affected by gender in different manners. although circadian bp profile and bp variability were increased in hypertensive obese patients without gender differences, female patients had significantly higher eft and greater daytime bp variability than male subjects. bp variability was associated with sbp and eft only in female patients; therefore, eft may be a more valuable parameter in the evaluation of bp severity and obesity in women than in men. bmi is known to be associated with the severity of ambulatory hypertension and increased daytime bp. in the present study, we investigated the relationship between the parameters derived from 24-hour abpm (24-hour sbp and dbp, and bp variability) in nondiabetic hypertensive patients with or without obesity. in general, bmi is correlated with bp level, and individuals with abdominal obesity have increased bp levels or are at risk for hypertension [3, 5]. the mechanism behind obesity-related bp elevation has not been fully established. obesity may induce autonomic dysfunction secondary to the elevation of plasma insulin concentration, because hyperinsulinemia has been associated with sympathetic activation [18, 19] and marked increases in hr. vice versa, sympathetic hyperactivity is also an independent contributor to the insulin resistance associated with obesity [21, 22]. thus, it is possible that mean arterial pressure and nighttime hr might remain at daytime levels as a consequence of sustained elevation of plasma insulin concentration. our hypertensive obese patients had higher proportions of nondipping patterns and higher daytime and 24-hour mean hr; moreover, male hypertensive obese patients also had higher nighttime hr than the controls. these findings are similar to the report of antic et al., who showed that the normal dipping pattern of bp and hr is rapidly lost following a switch to a high fat diet, without affecting daytime values. moreover, obesity suppresses nighttime parasympathetic activity and increases nighttime hr values. because diurnal variations in mean arterial pressure and hr appear to be autonomically mediated, the loss of nocturnal dipping of mean arterial pressure and hr in our obese patients must represent an underlying change in autonomic function. since the nighttime mean bp was altered in obese patients, the presence of hypertension in obese patients might be missed by office bp measurements that were made only during the daytime. thus, our results emphasize the importance of continuous 24-hour monitoring of cardiovascular variables, especially in obese patients. regarding gender differences, obese females showed a higher tendency towards bp variability than obese males. one interesting finding was that females showed a significant relationship between increased eft, obesity, and bp variability, but this was not the case in males. still yet, there is no consensus in the literature on the impact of gender on the amount of epicardial fat. iacobellis et al. showed bigger size of eft in males than in females, and our result showed the greater values of eft in females. recent study by akilli et al. showed larger eft in females than in males. thus, these findings may indicate different gender susceptibilities related to obesity and the regional differences in fat distribution, especially eft distribution. several studies have reported gender differences regarding the effects of obesity and change in body weight on bp [13, 26] and cardiovascular outcome [12, 27]. it has been reported that obese women have a higher relative risk of diabetes and heart failure with increasing abdominal circumference than men and that obesity has an association with diastolic dysfunction and lvmi only in women. from these results, women can be considered to be more susceptible to cardiovascular adverse effects related to obesity. in our study, accentuated bp variability in obese hypertensive women may have indicated a role in cardiovascular vulnerability. however, the exact explanation for these gender differences is still unclear. one possible mechanism is that such gender differences result from abrupt hormonal and body fat composition changes after menopause. thus, obese females have a greater amount of visceral adipose tissue which may lead to insulin resistance. insulin resistance and changes in the autonomic nervous system as a result of redistribution of body fat may have an impact on the cardiovascular system in obese women. excess fat has traditionally been understood to be found in intra-abdominal organs such as the liver and in subcutaneous tissue. recently, however, epicardial adipose tissue has been found to reflect visceral adiposity and has been proposed as a new cardiometabolic risk factor. increased plasma fatty acid levels may stimulate the cardiac autonomic nervous system activity through an increase in plasma catecholamine concentrations, which may be related to impaired diurnal bp patterns. several reports have found a relationship between bp pattern and eft [10, 31], and echocardiographically assessed elevated eft was independently associated with impaired diurnal blood pressure profiles in hypertensive individuals. also, increased eft has been reported to be associated with diastolic dysfunction and la dilatation due to local or systemic effects in untreated hypertensive patients. in our results, variable circadian bp profiles and la size were significantly related tobmi in both males and females, but eft was significantly correlated with la diameter and 24-hour mean bp with variability as well as nocturnal nondipping bp pattern, only in female patients. the present study suggests that there would be a sex-dependent regulation of bp associated with epicardial adipose tissue, and a recent study demonstrated a sex-dependent regulation of diet-induced lvh associated with sexual dimorphic expression of adipocytokines in epicardial adipose tissue. although our patient sample seems sufficiently large compared to other studies in the literature, in this cross-sectional study we observed predictive factors and outcome variables simultaneously and had no follow-up data., although we suggested that the hyperinsulinemia would be the possible main cause of elevated nighttime hr levels, we did not measure the plasma insulin levels. because both pre- and postmenopausal women were included in the study, we can not assume the impact of estrogen on epicardial fat. finally, all participants were korean, and we thus can not generalize our results to populations of other ethnic groups. in conclusion, the relationship among eft, obesity, and circadian bp variability was affected by gender in different manners. eft may be a more valuable parameter in the evaluation of bp severity and obesity in women than in men.

this study aimed to investigate the effects of gender on the association between epicardial fat thickness (eft) and circadian blood pressure (bp) changes in patients with recently diagnosed essential hypertension (eh). a total of 441 patients with eh (male/female: 236/205, mean age: 50.7 13.8) and 83 control patients underwent 24-hour ambulatory bp monitoring and echocardiography. obese eh patients had higher circadian bp profile with bp variability, wall thickness, and left ventricular mass than nonobese eh patients and controls (all p's<0.05) without gender differences. eft was higher in female than in male patients (7.0 2.5 versus 5.9 2.2 mm, p<0.001) and higher in the obese female eh group (7.5 2.6 mm) than in the control (6.4 2.8 mm) or nonobese eh group (6.7 2.8 mm) among women, whereas eft did not vary among males (5.9 1.9 versus 6.0 2.7 versus 5.9 2.4 mm, p=0.937). multivariate logistic regression analysis demonstrated that the 24-hour mean bp variability was associated with sbp (p=0.018) and eft (p=0.016) in female patients, but not in male patients. the relationships among circadian bp variability, obesity, and eft were affected by gender in different manners. eft may be a more valuable parameter in the evaluation of bp severity and obesity in women than in men.

PMC4430675

pubmed-162

pancreatitis, the commonest adverse event following endoscopic retrograde cholangiopancreatography (ercp), has been found to occur at widely varying rates, in 1% to 15.1% of pateints.14 post-ercp pancreatitis (pep) has been found at lower rates in recent studies because noninvasive methods, such as magnetic resonance cholangiopancreatography (mrcp) and endoscopic ultrasonography (eus), have superseded diagnostic ercp.5 despite improvement of our knowledge, equipment, and methods for ercp, complications are still a significant hazard with this procedure. pep is the most common severe complication.1,6,7 numerous studies have looked at risk factors for pep,14,616 with varied results, possibly because of different study designs, different candidate predictor variables, and differences between settings. precise identification of risk factors is of great importance for recognition of high-risk cases in which ercp should be avoided if possible or protective modalities should be considered to minimize patients risk of morbidity and mortality. we know that inflammatory biomarkers are useful at 2448 hours post procedure in predicting pep, and a few studies have evaluated pre-procedure inflammatory markers, especially c-reactive protein (crp) elevation, as predictors of pep.1723 none of the previous studies has focused on pre-ercp erythrocyte sedimentation rate (esr) as a potential risk factor for pep. despite the importance of identifying risk factors for pep, the present study examined prospectively the potential patient- and procedure-related risk factors, including esr, for pep in iranian population. during a four-year period (20082012), 780 patients who underwent ercp in a tertiary care hospital were analyzed in this prospective study. the patients were referred to this center from different parts of iran, which enhances the ability to generalize the findings for the iranian population. all patients gave their written informed consent to participate in this research before the ercp procedure, and the study protocol was approved by the ethics committee of the research center for gastroenterology and liver diseases, shahid beheshti university of medical sciences. indications for ercp were determined by participating endoscopists before the procedure, on the basis of generally accepted diagnostic indications for ercp.5 laboratory evaluations, including those of alkaline phosphatase (alp), alanine transaminase (alt), aspartate aminotransferase (ast), bilirubin, and serum amylase, were performed on the first day of hospitalization, and the results were used as pre-ercp laboratory parameters. patients in acceptable condition were discharged one to two days after ercp; otherwise, they received longer inpatient care based on the severity of their complications and illness. all the patients had a follow-up visit two weeks after discharge from hospital. patient- and procedure-related data, including demographics, characteristics, clinical information and technical details, and findings from ercp procedures were recorded prospectively on a detailed data sheet. exclusion criteria were a history of biliary sphincterotomy or pre-cut sphincterotomy, pre-procedure active pancreatitis, pregnancy, mental disability, and refusal to participate. ercp procedures were performed by a total of eight expert endoscopists, almost always with a trainee performing at least part of the procedure. during the procedures, patients were under conscious sedation using a combination of intravenous lidocaine, midazolam, and propofol. successful cannulation was defined as free and deep instrumentation of the biliary tree, and a cannulation attempt was defined as sustained contact with the cannulating device and the papilla for at least five seconds.17 difficult biliary cannulation was defined as the failure of biliary access despite 10 minutes of attempted biliary cannulation or more than five attempted unintentional pancreatic cannulations.18 any complications taking place during or following the procedure were also entered into the records. pep was diagnosed according to the generally accepted criteria defined by cotton et al,6 ie, presence of upper abdominal pain 24 hours after an ercp procedure and a serum amylase level more than three times the upper limit of normal. results were expressed as the mean standard deviation (sd) for quantitative variables and percentages for categorical variables. multiple linear regression analysis was used to develop an optimal model for predicting pep with the presence of confounders. the performance of the model was assessed with the hosmer lemeshow goodness-of-fit test. all the statistical analyses were performed using spss version 16.0 (spss inc.) for windows. between 2008 and 2012, 780 patients (male: female ratio 393:387, mean age 57.5 years) underwent diagnostic and therapeutic ercp with the primary diagnosis of hepatobiliary disorders. of these 780 ercps, 105 procedures (13.5%) were carried out in patients with invasive cancers (pancreatic ductal adenocarcinoma, biliary carcinoma, metastastic tumor with biliary obstruction, hepatocellular carcinoma, ampullary carcinoma) because of obstruction and 675 (86.5%) were performed in patients with benign diseases, which included 313 procedures (40.1%) to remove bile duct stones and 362 (46.4%) for benign biliary stricture. the patients included 393 men (50.4%), and 448 (57.5%) were more than 65 years old. previous cholecystectomy had been performed in 36.3% of patients and 9.0% had undergone previous ercp. a total of 80 patients had history of biliary stone diagnosed by a similar procedure. also, history of confirmed pancreatitis and hepatitis was observed in 27 (3.5%) and 10 (1.3%) patients, respectively (table 1). regarding laboratory parameters (table 2), serum amylase was found to be elevated to more than 200 units/l in 102 patients (13.7%) three hours after ercp and more than 800 units/l in 60 patients (7.7%). in all, 446 (70%) participants underwent wire-guided cannulation and others (30%) underwent sphincterotome biliary cannulation using contrast injection as the conventional method. successful biliary cannulation was technically achieved in 82.5% of all patients at ercp, although in 13.0% of them, cannulation failed. regarding pathologic changes in papilla, tumoral features and ulcerative changes were found in 3.3% and 0.6% of patients. of the 780 patients who underwent diagnostic or therapeutic ercp, pancreatitis developed in 26 patients (3.3%). significant bleeding occurred in two patients; the only predictor in multivariable analysis was biliary sphincterotomy. we diagnosed cholangitis (using the criteria of transient worsening of clinical states and liver function tests consistent with cholangitis) in four subjects, all of whom had common bile duct (cbd) stones with biliary stent placement. table 3 shows the frequency of pep and raised esr according to indication for ercp. in the multivariable risk model for predicting pep (table 4), significant risk factors with adjusted odds ratios (ors) were age<65 years (or=10.647, p=0.023) and esr>30 (or=6.414, p<0.001). female gender, history of recurrent pancreatitis, pre-ercp hyperamylasemia, and difficult or failed cannulation could not predict pep. regarding the cannulation techniques, there was no difference in the incidence of pep between guide wire-assisted ercp or conventional contrast-assisted cannulation. we have identified two risk factors for the development of pep: age<65 years and esr>30. several studies have focused on younger age as an independent predictor of pep.14,617 so in younger individuals, it is important to perform ercp only when the indication is very strong and there is no other noninvasive substitute for ercp. another risk factor for the development of pep in our study was increased esr level before ercp (esr>30). we found that raised esr>30 mm/hour is a significant factor that independently predicts increased risk of pep. although some studies have evaluated the level of post-ercp inflammatory markers, especially post-procedure crp elevation, as predictors of development of pep,1923 it seems that none of the previous studies have focused on pre-ercp esr level as a potential risk factor for pep. however, the findings of previous studies suggest that inflammatory biomarkers are helpful at 2448 hours post-procedure, so they are not early predictors. although it seems that our study is the first study to evaluate pre-ercp esr level as a risk factor for developing pep, many other studies have evaluated the role of pharmacologic agents in reducing the incidence or severity of pep.2,10,2227 several agents, most of which have an anti-inflammatory effect, have been tested in clinical trials. in terms of attenuating the inflammatory response, the most promising results have been with non-steroidal anti-inflammatory drugs (nsaids), and some standard guidelines recommend the routine use of nsaids to prevent pep.28 most of these studies are experimental clinical trials, but it is possible that the main beneficial effect of these drugs is limiting systemic inflammatory response and lowering the level of esr as a potential risk factor for pep. this study could be a guide for future clinical trials on rectal nsaids for the prevention of pep; the effect of these drugs in prevention of pancreatitis, with attention to the level of esr before ercp, should be evaluated. other risk factors such as female gender, younger age, sphincter of oddi dysfunction, cannulation difficulty, prolonged procedure time, and repeated injection to the pancreatic duct were not assessed because ercp procedures were done by an expert and because of the absence of manometry. also, other factors such as pre-ercp bacterial infections might increase esr level. some studies on both human and animal models, performed to evaluate the potential role of antibiotics in preventing pep, found reduced rates of pep in patients receiving antibiotic prophylaxis prior to ercp when compared to placebo.26 however, most studies did not find any role for infections in pep, except in cases of severe pancreatitis with necrosis. the main limitation of this study was the absence of combined evaluation of crp and esr before ercp. esr will be raised in almost all patients with any systemic inflammation, so our study is also limited because patients with systemic inflammation were not excluded. to date, many risk factors for pep have been reported from high-volume centers. these have included female gender, younger age, sphincter of oddi dysfunction, cannulation difficulty, prolonged procedure time, and repeated injection to the pancreatic duct. not all of these factors were analyzed in our study, and our results were not fully consistent with the previous results. performing ercp may be safer in the elderly and in patients with low levels of serum esr because they may be less at risk of pep. using pre-ercp anti-inflammatory pharmacologic agents like nsaids might be beneficial, by lowering esr level and reducing related risk of pep.

backgroundpancreatitis remains the most common complication of endoscopic retrograde cholangiopancreatography (ercp), resulting in substantial morbidity and occasional mortality. there are notable controversies and conflicting reports about risk factors of post-ercp pancreatitis (pep).aimto evaluate the potential risk factors for pep at a referral tertiary center, as a sample of the iranian population. materials and methodsbaseline characteristics and clinical as well as paraclinical information of 780 patients undergoing diagnostic and therapeutic ercp at taleghani hospital in tehran between 2008 and 2012 were reviewed. data were collected prior to the ercp, at the time of the procedure, and 2472 hours after discharge. pep was diagnosed according to consensus criteria. resultsof the 780 patients who underwent diagnostic ercp, pancreatitis developed in 26 patients (3.3%). in the multivariable risk model, significant risk factors with adjusted odds ratios (ors) were age<65 years (or=10.647, p=0.023) and erythrocyte sedimentation rate (esr)>30 (or=6.414, p<0.001). female gender, history of recurrent pancreatitis, pre-ercp hyperamylasemia, and difficult or failed cannulation could not predict pep. there was no significant difference in the rate of pep in wire-guided cannulation versus biliary cannulation using a sphincterotome and contrast injection as the conventional method. conclusionsperforming ercp may be safer in the elderly. patients with high esr may be at greater risk of pep, which warrants close observation of these patients for signs of pancreatitis after ercp.

PMC4426942

pubmed-163

the ras association domain family (rassf) consists of 10 members: rassf1-10. importantly, all isoforms contain a ras association (ra) domain either in their c-terminal (rassf1-6) or n-terminal (rassf7-10) regions. to date, no known catalytic activity has been described for this family, and the general consensus supposes that rassf proteins function as scaffolds to localize signaling in the cell. rassf1 isoform a (rassf1a) is the most characterized member of the rassf family. the rassf1 gene encodes multiple splice variants, including the two predominant isoforms, rassf1a and c. the rassf1a isoform is the longest variant of the rassf1 gene. structurally, rassf1a is a product of exons 1, 2/, 3, 4, 5, and 6, while rassf1c consists of exons 2, 3, 4, 5, and 6. both isoforms contain a c-terminal ra domain; however, rassf1a has an additional c1 domain that is not present in rassf1c. this short arm of chromosome 3 is known to exhibit loss of heterozygosity in many tumor models and is thought to harbor tumor suppressor genes. as the literature has shown, rassf1a fits this description. the rassf1a promoter contains a cpg island that shows a high frequency of hypermethylation in tumors, thereby silencing rassf1a expression in many human cancers including lung, breast, ovarian, renal, and bladder [47]. rassf1a expression is also lost in numerous cancer cell lines, while rassf1c expression is seemingly unaffected. interestingly, recent work suggests that rassf1c may actually promote tumor progression [8, 9], further distinguishing these two splice variants. all rassf proteins have an ra domain, which is thought to necessitate their binding to activated, gtp-bound ras proteins. while rassf5 (nore1) is thought to bind ras directly, whether rassf1a is able to associate with ras is less clear. it has been shown that rassf1a binds k-ras in vitro, and an interaction between ectopically expressed rassf1a and activated k-ras has been observed in hek293 cells [11, 12]. however, other work has found that this interaction only occurs in the presence of nore1, arguing for an indirect association. importantly, to our knowledge, there are no reports demonstrating the interaction of endogenous rassf1a and ras proteins. it has been implicated in the negative regulation of cell cycle progression, cell proliferation, and cell survival. rassf1a has been shown to localize to microtubules of proliferating cells, increasing microtubule stability and inhibiting cell division [14, 15]. this may be mediated through direct binding or though interaction with microtubule-associated proteins such as c19orf5. rassf1a has also been shown to inhibit proliferation by inhibiting the accumulation of cyclin d1 and arresting cell division [17, 18]. rassf1a also promotes apoptosis, which can reportedly occur through multiple mechanisms and is likely cell-type dependent. one mechanism that mediates the apoptotic function of rassf1a involves protein interaction with modulator of apoptosis-1 (moap-1 or map-1). moap-1 is normally sequestered in an inactive form in healthy cells. upon death receptor stimulation, rassf1a binds moap-1, causing its activation and subsequent association with bax, which leads to apoptosis. previous work has also demonstrated enhancement of rassf1a/mst-mediated cell death by the scaffold cnk1. rassf1a can also elicit inhibitory effects on growth and survival through engagement of the hippo pathway. the hippo signaling pathway is a highly conserved kinase cascade that was originally discovered in drosophila and has been shown to be a critical regulator of cell proliferation, survival, and organ growth. three members of this pathway, drassf, salvador and hippo, contain the sarah (salvador-rassf-hippo) domain, which is conserved in its mammalian counterparts rassf1-6, ww45, and mst1/2, respectively. while the drosophila ortholog drassf is known to antagonize hippo activation in the fly, it has been demonstrated that rassf1a promotes phosphorylation and activation of mst 1/2 by inhibiting the phosphatase pp2a in mammalian systems [29, 30]. the biological relevance of rassf1a-mediated activation of hippo signaling has also been investigated. reported a rassf1a-mst2-yap-p73-puma signaling axis that promotes apoptosis in mammalian cells. hippo signaling is also important for maintaining intestinal homeostasis and tissue regeneration in response to injury. mouse models with conditional disruption of either mst1/2 or sav1 in the intestinal epithelium displayed hyperactivation of yes-associated protein (yap), increased intestinal stem cell (isc) proliferation, and increased polyp formation following dextran sodium sulfate (dss) treatment [32, 33]. similarly, loss-of-function mutations of hippo components in the fly midgut caused increased isc proliferation. these findings suggest that perhaps hippo signaling serves a more global role in regulating organ integrity, structure, and response to injury, and that perturbation of this pathway can lead to aberrant growth and dysfunction. in 2005, two independent groups generated and published findings regarding the systemic deletion of the rassf1a gene variant in mice [35, 36]. both described similar phenotypes involving the spontaneous generation of tumors, particularly in aged mice, thus further supporting the notion that rassf1a is a bona fide tumor suppressor [35, 36]. not surprisingly, nearly all studies involving rassf1a to date are related to cancer biology with few reports related to the cardiovascular field. rassf1a is ubiquitously expressed and has been detected in heart tissue [3, 37, 38]. initial investigation into the role of rassf1 gene products in a cardiac context came from the neyses laboratory. their findings demonstrated that both rassf1a and rassf1c could associate with the sarcolemmal calcium pump, pmca4b, in neonatal rat cardiac myocytes. this interaction was shown to mediate the inhibition of erk, and subsequent elk transcription and suggested the possibility that rassf1a could modulate cardiac myocyte growth. five years later, the same group demonstrated that rassf1a does in fact negatively regulate cardiac hypertrophy in vivo using rassf1a mice. although these mice have increased susceptibility to spontaneous tumorigenesis, no apparent cardiovascular phenotype was observed under basal conditions, that is, no differences in heart size, morphology, or function compared to wt. however, when rassf1a mice were challenged with pressure overload, they responded with an exaggerated hypertrophic response, evidenced by significantly greater increases in heart weight/body weight and hypertrophic gene expression (anp, bnp, -mhc). cardiac myocytes of rassf1a mice were significantly larger, which explains the augmented heart growth. chamber dilation of rassf1a mouse hearts was observed by echocardiography, consistent with eccentric hypertrophic remodeling. hemodynamic analysis of wt and rassf1a mice showed a rightward shift in pv loops following pressure overload in rassf1a hearts, yet dp/dtmax, dp/dtmin, and fractional shortening were not altered in rassf1a mice compared to wt. to examine rassf1a function in cardiac myocytes, oceandy et al. utilized a neonatal rat cardiac myocyte (nrcm) culture and the forced expression of rassf1a through adenoviral gene transfer. increased rassf1a expression inhibited phenylephrine-(pe-) induced cardiac myocyte growth and suppressed raf-1 and erk1/2 activation by pe treatment. conversely, both raf-1 and erk1/2 phosphorylation were increased in rassf1a hearts following pressure overload, suggesting negative regulation of mapk signaling by rassf1a. deletion mutants of rassf1a revealed an important function of the n-terminus of rassf1a that disrupts the binding of active ras and raf-1, thus preventing erk activation and cardiac myocyte growth. to better understand the function of rassf1a in cardiac myocytes in vivo, we crossed genetically altered mice harboring a floxed rassf1a allele with mice harboring the cre recombinase transgene driven by the -mhc promoter. this strategy disrupted endogenous rassf1a gene expression and ensured cardiac myocyte specificity [38, 40]. similar to the rassf1a mice, rassf1a-cre mice had no obvious baseline cardiac phenotype. although we also found exaggerated heart growth in the rassf1a mice in response to pressure overload, the rassf1a-cre mice unexpectedly had attenuated hypertrophy, that is, smaller hearts and cardiac myocytes, compared to rassf1a and -mhc-cre controls. furthermore, rassf1a-cre mice had significantly less fibrosis and myocyte apoptosis, and better cardiac function following pressure overload. this was in stark contrast to the rassf1a mice, which presented significantly more fibrosis and a decline in cardiac function comparable to the levels found in wt mice. as an alternative approach we also generated two different cardiac-specific transgenic mouse lines: the first expressing wild-type rassf1a and the second expressing a rassf1a sarah domain point mutant (l308p) that renders it unable to bind mst1. interestingly, we found that increased rassf1a expression in the heart caused increases in mst1 activation, cardiac myocyte apoptosis, and fibrosis, and led to worsened function following pressure overload. conversely, rassf1a l308p tg mice had significant reductions in mst1 activation, apoptosis and fibrosis, while cardiac function was preserved after stress. these opposing phenotypes strongly implicate mst1 as a critical effector of rassf1a-mediated myocardial dysfunction. in cultured nrcms, increased rassf1a expression elicited activation of mst1 and caused mst1-mediated apoptosis. however, in primary rat cardiac fibroblasts, rassf1a had a more pronounced effect on inhibition of cell proliferation rather than survival. additionally, rassf1a depletion led to an upregulation of nf-b-dependent tnf- expression and secretion in cardiac fibroblasts, while no change in il-1, il-6, or tgf-1 was observed. through conditioned medium transfer experiments, we demonstrated that tnf- secretion from fibroblasts promotes cardiac myocyte growth. furthermore, treatment of rassf1a mice with a neutralizing antibody against tnf- was able to rescue the augmented heart growth and fibrosis observed following pressure overload. these data strongly implicated tnf- as a critical paracrine factor influencing the cardiac myocyte growth response to stress in vivo. this work also demonstrated the cell-type specificity of rassf1a signaling in the heart and highlighted a novel signaling pathway downstream of rassf1a/mst1 that mediates a paracrine effect in vivo (see figure 1). this mechanism involving multiple cell types, and paracrine signaling among them is rather unique and contrasts with more established signaling paradigms of cardiac hypertrophy including calcineurin/nfat, hdac/mef2 and mek/erk pathways, which have been elucidated in the cardiac myocyte. using genetically altered mouse models we showed that increased expression of mst1, and subsequent activation of the hippo pathway, caused increased apoptosis, dilated cardiomyopathy, and premature death. interestingly, expression of mst1 also attenuated cardiac myocyte hypertrophy thereby impairing the heart's ability to appropriately respond to stress. in contrast, expression of a kinase-inactive mst1 mutant (dn-mst1) prevented cell death and protected the heart from insult. lats1/2 kinases (mammalian homologs of warts) are targets of mst1/2 that can phosphorylate and inactivate yap, thereby inhibiting yap-mediated gene transcription. similar to our findings related to mst1, we demonstrated that transgenic expression of lats2 in the heart led to inhibited growth and worsened function. conversely, kinase-inactive lats2 (dn-lats2) transgenic mice had larger hearts both at baseline and following pressure overload and displayed attenuated cardiac myocyte apoptosis in response to stress. taken together, these results provide further evidence that activation of hippo signaling, via increased mst1 or lats2 expression, inhibits cardiac myocyte growth and promotes apoptosis in the adult heart. furthermore, selective inhibition of hippo signaling in the cardiac myocyte (dn-mst1 or dn-lats2 tg) confers protection against insult, similar to what we observed in the cardiac myocyte-specific rassf1a deleted mice. however, the hypertrophic response in these two models was opposite, which may result from a hippo-independent pathway(s) downstream of rassf1a. it should be pointed out that studies of adult mouse models using cardiac myocyte-restricted deletion of mst1/2, lats1/2 or yap have not been published. findings from these models should be helpful in further elucidating the role of hippo signaling components in the adult murine heart. recent work from the martin laboratory demonstrated the importance of mammalian hippo signaling during cardiac development and cardiac myocyte proliferation. conditional deletion of salvador (sav1) in the embryonic heart, driven by nkx2.5-cre expression, caused increased myocyte proliferation and cardiac enlargement and was mediated by hyperactivation of yap and subsequent wnt/-catenin-regulated gene expression. in a similar vein, direct targeting of yap expression in the developing mouse heart further demonstrated its role in governing both myocyte proliferation and heart growth. interestingly, both reports described an interaction between yap and wnt signaling, highlighting additional hippo signaling crosstalk in the heart. fueled by the initial reports described herein, investigation into the role of rassf1a in cardiovascular biology has begun to accelerate. yet many questions remain outstanding. among them, what are the upstream inputs that regulate rassf1a function? what is the mechanism responsible for rassf1a cell-type-specific what are the molecular constituents of the rassf1a complex? does rassf1a have additional mst1-independent functions in the heart, as has been demonstrated in tumor cell lines? recent work identified activated k-ras as a promoter of rassf1a signaling in colorectal cancer cells. this finding begs the question of whether k-ras or additional ras isoforms regulate rassf1a in other systems and cell types. based on our findings in rassf1a-deleted mice, we speculate that the difference in proliferative capacity between cardiac myocytes and fibroblasts may explain the distinct effects of rassf1a signaling in the heart. there may also be differences in the expression or localization of signaling components, thereby modulating their ability to effectively signal in certain cell types. exposure to diverse signals and cues in the extracellular milieu may also contribute to varied outcomes downstream rassf1a. as we continue to elucidate the role of rassf1a and hippo signaling in the heart our work has shed light on the importance of cell type specificity rassf1a in determining pathological outcomes. we also defined a paracrine mechanism functioning downstream of rassf1a in response to cardiac stress. it is likely that additional complexities remain to be uncovered and will ultimately influence possible interventions to manipulate rassf1a and treat heart disease. rassf1a signaling is diverse and our knowledge regarding rassf1a function is rapidly expanding. given that a bridge from cancer to cardiovascular biology is in place, it is likely that as additional rassf1a mechanisms of action are discovered, its impact on cardiac biology will continue to grow.

the rassf proteins are a family of polypeptides, each containing a conserved ras association domain, suggesting that these scaffold proteins may be effectors of activated ras or ras-related small gtpases. rassf proteins are characterized by their ability to inhibit cell growth and proliferation while promoting cell death. rassf1 isoform a is an established tumor suppressor and is frequently silenced in a variety of tumors and human cancer cell lines. however, our understanding of its function in terminally differentiated cell types, such as cardiac myocytes, is relatively nascent. herein, we review the role of rassf1a in cardiac physiology and disease and highlight signaling pathways that mediate its function.

PMC3337625

pubmed-164

mirizzi syndrome is a rare complication of cholecystolithiasis characterized by jaundice due to compression of the common hepatic duct. the diagnosis may not be immediately apparent, and management is controversial with open surgery still recommended by some authors. a case is detailed herein of a 67-year-old man who presented with abdominal pain, fever, and jaundice. a dilated bile duct was found on ultrasound, but the gallbladder could not be seen. the diagnosis of mirizzi syndrome was made at ercp, and a stent was placed through the papilla. laparoscopic retrograde (fundus first) cholecystectomy was carried out utilizing a laparoscopic liver retractor. in this particular case, it was not possible at ercp to get a guidewire and stent past the obstruction. a stent was left through the papilla, below the obstruction and this allowed primary duct closure during surgery. acute mirizzi syndrome should be suspected when a patient presents with acute cholecystitis and jaundice with dilated intrahepatic ducts on ultrasound. ercp is useful to confirm the diagnosis and allows stenting to alleviate the jaundice and facilitate the subsequent operation. laparoscopic ultrasound is useful to locate the impacted stone and to partially replicate the touch of the surgeon's hand, which is not available in laparoscopic surgery. mirizzi syndrome (ms) is biliary obstruction from compression of the common hepatic duct (chd) by a gallstone impacted in the cystic duct. mcsherry classified the syndrome into 2 groups: type i where extrinsic compression of the bile duct occurs and type ii where erosion occurs of the wall of the chd by the stone with formation of a cholecysto-choledochal fistula. csendes further subdivided type ii depending on the size of the fistula and the degree of destruction of the wall of the chd. the syndrome was initially described in 1948 by pablo luis mirizzi, professor of surgery in cordoba, argentina, and he erroneously postulated that the extrinsic pressure and inflammation induced spasm of the chd. precise diagnosis may be difficult initially because the condition may be confused with choledocholithiasis and cholangitis. the classical ultrasound findings are of a contracted gallbladder, dilated intrahepatic ducts, and a normal common bile duct (cbd). although a rare condition, many controversial aspects still surround the definition and management of ms. to illustrate the true ms and the value of a combination of endoscopic retrograde cholangiopancreatography (ercp) and laparoscopic surgery, a case a 67-year-old man was admitted to the emergency department with a 3-day history of gradually worsening upper abdominal pain associated initially with vomiting and anorexia. the patient had a history of hypertension and polymyalgia rheumatica. he was noted to be jaundiced with a temperature of 38 celsius and right upper quadrant tenderness and guarding. his liver function tests were markedly deranged with bilirubin 106 mol/l [range, 3 to 22], alkaline phosphatase 159 iu/l (range, 20 to 110), and alanine transaminase 770 iu/l (range, 5 to 65). this showed dilated intrahepatic ducts with the cbd reported as also being dilated and measuring 9 mm in diameter. subsequent imaging showed that the ultrasound had actually detected a dilated chd as the cbd was not dilated. at ercp, contrast filled a nondilated cbd up to an obstruction due to a stone (figure 1). attempts were made to pass a guidewire beyond the obstruction up into the chd and intrahepatic ducts but without success. the guidewire kept going into the gallbladder, and it became apparent that there was an ms with the obstructing stone in the cystic duct causing compression of the chd (figure 2). after the guidewire had been manipulated for a time, some pus came out of the papilla signifying a gallbladder empyema. a 10 french straight plastic stent was placed through the papilla without papillotomy with its proximal tip lying below the obstruction and, as expected, no bile or intrahepatic contrast drained. the stone is impacted in the cystic duct, which is anterior and parallel to the common hepatic duct. note the narrow common bile duct and the dilatation of the common hepatic and intrahepatic ducts. a computed tomogram (ct) scan was done and showed a contracted gallbladder with a calcified stone causing biliary obstruction (figure 3). at laparoscopic cholecystectomy, an acutely inflamed a liver retractor was used to elevate the liver and maintain exposure of the bile duct (diamond-flex, cardinal health, snowden-dencer mis products, tucker, ga, usa) (figure 4). it was possible to feel the stone via a grasper, and its position was definitely confirmed by laparoscopic ultrasound (figure 5). the duct was incised to release the impacted stone with a single-use cbd blade (espiner medical ltd. the cbd was examined with a 5-mm flexible choledochoscope showing that the duct was clear distally with the stent in place (figure 7). it was not possible to retroflex the choledochoscope to examine the common hepatic or intrahepatic ducts. the gallbladder was excised, the opening in the cystic duct sutured with continuous 40 vicryl (ethicon inc., somerville, nj, usa) and a 20 french nonsuction tube drain placed in the subhepatic space near the bile duct. the stent was removed at ercp 6 weeks later and a check cholangiogram showed a normal bile duct with no filling of any residual cystic duct and no stricture. during 18 months of follow-up, no delayed sequelae have occurred. computed tomograpic scan showing a calcified stone causing bile duct obstruction with the proximal end of the stent just below the stone. residual contrast from the ercp is present in the gallbladder (somatom volume zoom, 4 slice, siemens ag, erlangen, germany). the gallbladder (gb) has been dissected from the liver retrograde, and the liver retractor is in place. the arrow points to surgicel (ethicon, somerville, nj, usa) in the gallbladder bed of the liver. laparoscopic ultrasound image showing the impacted stone (arrow) in a thickwalled duct (aloka inc. choledochoscopy using a 5-mm scope showing a clear bile duct with the stent visible (insert). ms is a rare cause of jaundice due to extrinsic compression of the chd and is present in approximately 0.35% of cholecystectomies. many series report much higher rates; however, this may represent differing views on what constitutes a case of ms. kwon and inui recently reported a prevalence of 1.2%, but only a third of their patients were jaundiced, and despite this the majority still underwent open surgery. similarly, planned open operation for mirizzi syndrome is accepted and, in fact, is still advocated by many. many surgeons do not view conversion as detrimental and therefore do not persist laparoscopically when cholecystectomy is difficult. conversion or an open operation allows the use of proprioception or the touch of the surgeon's hand and is generally accepted as a way to improve the safety of any operation, especially one in which severe inflammation is present. to replicate this, however, open surgery is associated with significant short- and long-term morbidity, and a difficult operation is not necessarily easier or safer when performed open. a degree of tactility is possible via instruments although not by currently available robotic systems, and laparoscopic ultrasound is very useful in stone disease. it is generally accepted that an increased risk of bile duct injury exists during surgery for ms, and laparoscopic surgery may increase this risk. operative cholangiography is advocated to improve the safety of cholecystectomy, but an accurate transcystic cholangiogram will not be possible in ms. a standard technique in open surgery for the difficult laparoscopic cholecystectomy was the fundus-first approach. this can be replicated in laparoscopic surgery by the use of a liver retractor and means that exposure does not rely on traction on the fundus of the gallbladder. in ms, the gallbladder is often fibrosed and contracted so that fundic traction gives relatively poor exposure of the hepatobiliary triangle. also once the gallbladder is freed from the liver, the obliterated calot's triangle can be more easily evaluated. the magnified view combined with modern instrumentation ercp may provide definitive treatment for ms; however, the impacted stone can create real difficulties. more often, ercp is used to make the diagnosis and insert a stent to alleviate the jaundice and allow planning of an elective operation. if ercp is to be used as definitive treatment, sophisticated techniques may be needed for these cases, including the use of a mother and baby scope and electrohydraulic or laser lithotripsy. in the case described herein, i could have tried to break up the stone with an over the wire mechanical lithotripter, although engaging the stone in the basket may have been difficult. alternatively, a mother and baby scope and contact lithotripsy (laser or electrohydraulic) could have been tried but would not have been possible in my opinion because the actual cbd was not dilated and may not have taken the 5-mm baby scope. because i was planning to remove the gallbladder anyway, i preferred to leave the choledochal sphincter intact to avoid longer term risk of choledocholithiasis from a colonized biliary tract and papillary stenosis. in this case, i could not stent the obstruction from below but a percutaneous transhepatic approach could have been used. this would have been relatively straightforward as the hepatic ducts were dilated and might have been a useful strategy if this patient had been unfit for surgery. there is purportedly a 5 times higher rate of gallbladder malignancy in mirizzi sydrome compared with that in uncomplicated gallstone disease. prasad et al found 5.3% of patients with ms had gallbladder cancer compared with 1% in non-ms cases, and most were diagnosed on histology after cholecystectomy. if the patient is fit for surgery, the optimal management of ms should include cholecystectomy. the technique described leaves the choledochal sphincter intact and does not require intraoperative antegrade stenting or use of t-tubes. in ms as described herein, it would not have been easy to insert these tubes properly as the opening is into the cystic duct rather than the bile duct proper. the preoperative endoscopically placed transpapillary stent temporarily overcame the outflow resistance of the sphincter and allowed safe primary duct closure although periductal drainage was needed. in ms, even if an operation is planned, preoperative ercp and stenting should be considered because this approach should simplify and improve the safety of the operation. in addition, the fitness of the patient for surgery and the complexity of the pathology are important for planning the therapeutic approach. in my opinion, ms should ideally be treated by a combination of ercp and stenting with laparosocopic stenting overcomes the resistance of the choledochal sphincter, and even if accurate closure of the opening in a friable and inflamed duct is not possible, it should avoid the development of a significant biliary fistula. careful planning combined with modern equipment should allow most cases to be managed without t-tubes, destruction of the choledochal sphincter, or open surgery.

background: mirizzi syndrome is a rare complication of cholecystolithiasis characterized by jaundice due to compression of the common hepatic duct. the diagnosis may not be immediately apparent, and management is controversial with open surgery still recommended by some authors. method:a case is detailed herein of a 67-year-old man who presented with abdominal pain, fever, and jaundice. a dilated bile duct was found on ultrasound, but the gallbladder could not be seen. the diagnosis of mirizzi syndrome was made at ercp, and a stent was placed through the papilla. laparoscopic retrograde (fundus first) cholecystectomy was carried out utilizing a laparoscopic liver retractor. results:in this particular case, it was not possible at ercp to get a guidewire and stent past the obstruction. a stent was left through the papilla, below the obstruction and this allowed primary duct closure during surgery. conclusion:acute mirizzi syndrome should be suspected when a patient presents with acute cholecystitis and jaundice with dilated intrahepatic ducts on ultrasound. ercp is useful to confirm the diagnosis and allows stenting to alleviate the jaundice and facilitate the subsequent operation. laparoscopic ultrasound is useful to locate the impacted stone and to partially replicate the touch of the surgeon's hand, which is not available in laparoscopic surgery.

PMC3015902

pubmed-165

the maxillary posterior area contains cancellous bones with low bone density and thin cortical bones, the quantity and quality of which are lower than those of the mandibular bone. this is due to the small implant-to-bone contact area and the inferior bone quality.123 moreover, the severe bone loss caused by sinus pneumatization or chronic periodontitis, which leads to a reduction in the height of the remaining residual ridge, can further increase the implant failure rate.4 in addition, the occlusal load in the posterior area is 3-5 times higher than that in the anterior area.5 to address these problems, various bone graft techniques to augment the insufficient bone volume and thereby ensure the success of maxillary posterior implants have been proposed.6 such surgical methods have been accepted as clinically meaningful procedures. however, these procedures have a number of disadvantages, such as the invasiveness of the surgery, high cost, and long treatment duration after bone graft and implant installation.6 in addition, because bone resorption occurs after a bone graft, the increase in vertical height is unpredictable. microscopic studies by wallace et al.7 suggested that it was difficult to obtain bones with optimal strength from a bone graft. rosen et al.8 asserted that the success rate of the implant placement after the bone graft depended on the residual ridge height. this was supported by aka et al.9 who showed that stress applied on the implant was concentrated on the upper part of the implant and that, hence, the stress was not transferred to the grafted bone. given the above facts and the disadvantages, success rate of bone grafting in a severely atrophied maxilla is not very promising. studies have reported that this method may allow new bone formation without the need for bone graft.1011 however, winter et al.12 stated that the amount of new bone generated by sinus augmentation alone was insufficient and the results were not satisfactory considering the complexity of the technique. this approach offers many advantages, which include a shorter treatment time, less cost, fewer complications in patients, and minimal surgical invasiveness. since the introduction of short implant for installation in atrophied residual ridge,13 many previous studies have defined a short implant as measuring 7 mm or less.141516 although short implants have been reported to have a lower survival rate than standard implants due to the small bone-contact area,1415 their survival rates have increased gradually with advancements in surface treatment technologies.16 as a finite element analysis (fea) shows that stress transfer at the implant-bone interface is limited to the upper 2-3 mm, the long implant is thought to be biomechanically unnecessary.917 therefore, a short implant may be used for achieving primary implant stability in the case of unfavorable bone quantity and may be used as an alternative for surgical approaches such as bone graft or sinus augmentation. replacement of a missing molar with a single implant may cause various mechanical failures such as screw loosening, screw fracture, and implant fracture.1819 in a severely atrophied maxillary posterior area, using a single wide implant or splinting multiple implants is a way to overcome the unfavorable crown/root ratio of short implants.202122 two-implant-supported maxillary molars with implants installed in buccal and palatal positions were suggested by balshi and wolfinger.23 the 2 short implants (2si, fig. 1) technique can be used to reconstruct a multi-rooted molar by installing 2 short narrow implants without the need for an additional surgical approach. the 2si approach is a minimally invasive procedure that solely utilizes residual bones to overcome unfavorable bone quantity and quality in the maxillary posterior area. it can yield stable treatment results while minimizing the need for additional procedures and reducing the cost and treatment time. a 5-year clinical study demonstrated the clinical success of 2sis.24 the purpose of this study was to compare the stress distribution of various types of 2sis that were installed and restored in severely atrophied maxillary molar sites. an internal connection implant with an 11-degree taper interface was used (gs, osstem, seoul, korea). internal connection implants (length, 7.0 mm) with narrow platform (np 3.5 mm), regular platform (rp 4.0 mm), and wide platform (wp 5.0 mm) were modeled. three-dimensional image data of the human maxillary first molar from ct images were transformed into fea meshes and the connecting area between the crown and implant was smoothened. a gold crown on the abutment (rigid, osstem, seoul, korea) was connected with the implant. abutment for each implant diameter was connected, and the occlusal surface area of the definitive prosthesis was constructed to have the same shape. an implant was designed to be installed on the missing maxillary first molar area on the maxilla with a pneumatized sinus, 0.5 mm cortical bone on top and bottom, and 3 mm cancellous bone (fig. 2). for the boundary conditions, bottom and mesio-distal parts of the maxillary bone the mechanical properties of the bone, gold, and titanium were set as previously described (table 1).2526 the implant bone interface was constructed with 100% contact for complete stress transfer to the surrounding bone. they were broadly categorized into 3 groups of 2si and 4 groups of single implants. the 2si groups were categorized into 1) np oblique (two narrow implants were obliquely installed), 2) np vertical (two narrow implants were installed in palatal residual bone due to the resorption of buccal bone), and 3) np horizontal (two narrow implants were installed in distal residual bone due to the mesial bone resorption). single implant installation groups were set to 1) rp-cantilever (a rp implant was installed in stepped bone due to resorption of the mesial bone), 2) wp-cantilever (a wp implant was installed in stepped bone due to resorption of the mesial bone), 3) rp-center (a rp implant was installed in a flat bone), and 4) wp-center (a wp implant was installed in a flat bone). meshing and pre-processing were performed using hyper-mesh 10.0 (altair engineering inc., troy, mi, usa) and visual crash for pam version 10.5 (esi group, paris, france). the average occlusal force, a 250 n static axial load, was applied to the center of the occlusal surface (axial loading). to simulate an oblique loading condition, a 250 n oblique load with a 45 angulation from the implant axis was applied on the center of the buccal cusp (oblique loading). the von mises stress was measured in the interface of implant-bone, implant/abutment complex, and at the bone of the peri-implant area in all models. to assess the stress distribution the processing and post-processing procedures were performed using pam-medysa v2014 (esi group, paris, france) and hyper-view v10.0 (altair engineering inc., troy, mi, usa). analyses of stress distribution in the implant-bone interface of an implant in the buccal side (np-1) showed an evenly distributed stress pattern in the np-horizontal and np-oblique groups, whereas the np-vertical group exhibited a relatively high stress pattern in the top and center areas of the interface (fig. similar stress distribution was observed in the np-horizontal and np-oblique groups, while a different stress pattern was observed in the np-vertical group (fig. stress distribution at the bone of the peri-implant area showed a different pattern to that observed in the interface. the np-horizontal and np-vertical groups showed a large stress concentration in stepped areas between different bone levels, while an even stress distribution was observed in the np-oblique group with flat bone level (fig. few differences in stress distribution of the implant/abutment complex were observed in each group and all stress was concentrated on the interface between the abutment and inner surface of implant (fig. 4d). when oblique loading was applied, similar stress distribution was observed at the bone-implant interface of the buccal (np-1) and palatal (np-2) implants in the np-horizontal and np-oblique groups (fig. although the np-vertical group showed slightly higher stress concentration, the difference was not as evident as with axial loading (fig. an evenly distributed stress pattern at the peri-implant bone was noticed in the np-oblique group compared with the np-vertical or np-horizontal groups (fig. the stress distribution of the implant/abutment complex showed virtually no difference in each group, and the amount and location of stress concentrations were similar to those in axial loading (fig. when axial loading was applied, the wp implant showed lower and evenly distributed stress at the implant-bone interface than the rp implant (fig. 6a). however, the stress difference was not large between the center and cantilever positions. as for the stress on the peri-implant bone, a more even stress distribution was observed in the center position implant than in the cantilever position implant. lower stress was observed in the wp implant than in the rp implant (fig. stress patterns at the implant/abutment complex of single implants were similar to that of the 2si groups (fig. when oblique loading was applied, the largest von mises stress was observed in the rp implant. the wp implant showed a relatively even stress distribution pattern and had a similar level of von mises stress to that of 2si groups (fig. the stress distribution on the peri-implant bones was similar to that in axial loading but the level of stress was higher. stress exerted on the implant/abutment complex was very large; a high amount of stress was placed on the abutment and implant in both rp and wp implants. additionally, larger and wider stress distribution was observed in the implant/abutment contact area on the opposite side of the loading point (fig. the stress distribution at the implant-bone interface was compared by categorizing the bone levels into two (flat and stepped). when axial loading was applied, higher von mises stress was observed on the implant-bone interface in the rp implant than in the wp implant or 2si implants. the highest stress was concentrated on the region with discontinuity between the different bone levels (stepped area) (fig. the 2si groups showed the lowest von mises stress compared with the rp and wp implants. the area between the implants showed lower stress distribution than the outer side of the implant in 2si group. the 2sis showed the most even stress distribution and rp implant showed the largest stress pattern on the peri-implant bones (fig. when applying oblique loading, the largest stress pattern was noted at the buccal side. higher stress was observed in the rp implant than in the wp implant or 2 np implants (fig. stress distribution of the peri-implant bones was relatively small and even in the 2si groups. a high level of stress was concentrated in the stepped area of the bone (fig. differences in stress distribution based on implant diameter, number, or position could be observed, but no differences related to types of bone levels were observed (flat bone vs. stepped bone) (fig. to identify the biomechanical effectiveness of 2sis, various bone levels and bone morphologies were assumed and implants were positioned on the basis of the bone condition. the residual maxillary bone bed was designed with a total length of 4.0 mm and 0.5 mm of cortical bone on the top and bottom for bicortical engagement. hence, when load was applied on the implant prosthesis, a large stress concentration was observed in certain regions on the bottom cortical bone located on the maxillary sinus side, unlike the result in another fea study.9 similarly, in clinical situations, stress may be concentrated on the bottom cortical bone as well as on the top portion in the case of severely atrophied bone. in this study, the von mises stress distribution on the bone away from the implant-bone interface was also considered. this is because it was difficult to estimate the effect of stress distribution solely based on the stress pattern at the localized implant-bone interface in case of a severely atrophied bone. in addition, stress on the implant-abutment complex was analyzed to estimate the risk of fracture in a narrow implant. the single rp implant group showed the highest level of stress at the implant-bone interface. as the diameter of implant used for restoring the maxillary molar is larger in wp, stress is more evenly distributed and general stress amount (in mpa) tends to be lower. however, two np implants exhibited more favorable stress distribution than a single wide implant; this confirms the biomechanical advantage of 2sis. in the 2si groups, the level of stress was not much different between palatal and buccal positioned implants. meanwhile, np-vertical, which is a buccal-only or palatal-only positioned condition, exhibited a higher level of stress in the form of a bending moment when axial loading was applied. however, under oblique loading, a similar level of stress was exhibited by the three implant positions (np-oblique, np-horizontal, and np-vertical). these trends arose because oblique loading induced lopsided loading on the buccal or palatal sides. therefore, the bending moment could be generated in a variously positioned implant, whose diameter is smaller than the roots of a natural tooth. the stress distributions in the center and cantilever positions of the rp and wp implants did not show a large difference. it may be because adjacent teeth were not modeled and both axial and oblique loading were applied on the mesio-distal center. these results are consistent with previous studies, which showed that the buccal cantilever was the most unfavorable and the mesio-distal cantilever was unfavorable only in terms of oral hygiene.2728 stress distribution of the peri-implant bone showed similar trends, where von mises stress was lower in implants of 2si groups than in rp or wp implants. this may be explained by the contact area between the implant and bone tissue, as placing multiple np implants is an effective way to increase the contact area. since installation of a wp implant is difficult in atrophied bones, 2sis can provide better initial osseointegration and its subsequent maintenance with effective stress distribution. stress on the implant/abutment complex was lower than that in the implant-bone interface or peri-implant bones. the stress was concentrated on the contacting surface of abutment and the inner part of implant when oblique loading was applied on rp or wp implants. clinically, fractures are common in the geometric discontinuity between the upper conical part and the lower hex part of the abutment in internal conical connection implants.29 moreover, multiple implants can be advantageous since single molar implants exhibit occasional mechanical failures such as screw loosening, screw fracture, and implant fracture,28 and the oblique loading generated even in physiologic mastication can be detrimental to single maxillary implants. in a previous clinical study on 2sis, none of the np implants using the 2si method was fractured.24 the trend of the presence of higher von mises stress around rp implant than around wp or np implants did not differ by the bone levels. prominently, the highest level of stress was exhibited on the stepped area of the bones. this can be viewed as a limitation of the fea study; stress concentration on the discontinuous area of features is unavoidable in the interpretation of the fea. in clinical situations, however, these phenomena are not likely to occur as bone loss occurs continuously. in preliminary modeling, however, real bone images can distort the result when comparing the effect of implant diameter and number. therefore, over-interpretation of the importance of stress concentration at the discontinuous region should be avoided. as an alternative to bone graft on a severely atrophied maxillary posterior area, single wide implant or splinting of multiple implants can be performed.2123 the results from the this study showed that, multiple implants, even with a short length and narrow diameter, offer a favorable implant-bone interface, peri-implant bone, and implant-abutment complex. the use of 2sis, which place np implants in the most dense bone area in the buccal and palatal sides and utilize residual bones per se without surgical difficulties, is a procedure allowing enhanced osseointegration and favorable stress distribution. however, 2si could not be used in the case with narrow mesio-distal space. the results from the fea study can be the consequence of restricted stress transfer within the 2-3 mm of the top of the bone.9 further, as adjacent teeth were not predetermined, the replication was not identical to the actual situation. moreover, clinical efficacy can not be validated solely by a biomechanical study, as only a relative comparison is possible. however, this study is important in that it supports the findings of the clinical study that showed favorable clinical success rates of 180 2sis.24 the stress distributions based on various bone levels and implant installation conditions in a severely atrophied maxillary posterior area were analyzed. when axial loading or oblique loading was applied, the highest level of stress was observed on the implant-bone interface and peri-implant bones in a single rp implant and the lowest stress distribution was exhibited in 2si conditions. the highest level of stress was concentrated on the implant/abutment-contacting surface of the single wide implant and the lowest level of stress was on the implant/abutment complex of 2sis.

purposethe aim of this study was to investigate the stress distribution of 2-short implants (2sis) installed in a severely atrophic maxillary molar site. materials and methodsthree different diameters of internal connection implants were modeled: narrow platform (np), regular platform (rp), and wide platform (wp). the maxillary first molars were restored with one implant or two short implants. three 2si models (np-oblique, np-vertical, and np-horizontal) and four single implant models (rp and wp in a centered or cantilevered position) were used. axial and oblique loadings were applied on the occlusal surface of the crown. the von mises stress values were measured at the bone-implant, peri-implant bone, and implant/abutment complex. resultsthe highest stress distribution at the bone-implant interface and the peri-implant bone was noticed in the rp group, and the lowest stress distribution was observed in the 2si groups. cantilevered position showed unfavorable stress distribution with axial loading. 2si types did not affect the stress distribution in oblique loading. the number and installation positions of the implant, rather than the bone level, influenced the stress distribution of 2sis. the implant/abutment complex of wp presented the highest stress concentration while that of 2sis showed the lowest stress concentration. conclusion2sis may be useful for achieving stable stress distribution on the surrounding bone and implant-abutment complex in the atrophic posterior maxilla.

PMC4993844

pubmed-166

hydatid disease (echionococcosis; hydatidosis) is a parasitic disease, endemic in many sheep raising countries (australia, south america, mediterranean countries, russia, middle east, and central asia). adult cestodes of echinococcus granulosus inhabit the small intestine of a definitive host (dogs, foxes, and wolves) and produce infective eggs. through the feces, either cestode segments or free eggs these are ungulates (sheep, goats, pigs, and horses) but in some cases accidental ingestion of eggs, usually shed by dogs, could lead to human cystic echinococcosis (ce). contaminated food, water, or hand-to-mouth transmission are usual modes of infection in humans [2-4]. so far, once ingested by the intermediate host, in its intestinal tract, parasite eggs transform into the oncosphere. oncospheres penetrate the intestinal wall, enters the portal vein, and reaches the liver where they usually are trapped and become the hydatid cyst. liver involvement has been described as the most common location of ce, varying from 59% to 78% of all cases [1,5-8]. some larvae pass the liver and reach the lungs where they develop into pulmonary hydatidosis. lung involvement is present in 15-27% of all cases [1,5-8]. not so often, larvae may pass these filters and form cysts in the brain, skeletal muscles, bones, kidneys, spleen, or other tissues. theoretically, they can occur at any site except the teeth, nails, and hairs. epidemiological studies have been conducted in some countries, while in serbia, montenegro, bih, and albania no information is available about the precise incidence in humans. the aim of this retrospective study was to investigate the skeletal manifestations of hydatid disease in serbia, it's demographic distribution, site involvement, complications, and bone tissue comorbidities. the study was conducted by reviewing the medical database of institute for pathology (faculty of medicine in belgrade) which is a reference institution in serbia for bone pathology. materials in the study comprised all the cases with histologically verified bone hydatidosis during the period between 1971 and 2010 in the territory of serbia. data obtained from medical records included the age at the moment of diagnosis, sex, localization of hydatid cyst, copresence of hydatid cyst in localizations other than the bone tissue, presence of skeletal complications, bone comorbidities, and diagnosis based on radiographies. in order to standardize the data, the radiological assessment was made on standard radiography, having in mind the length of the study period and diagnostic procedures available for that time. changes in the bone structure were classified as tumefaction (sharply or unshapely demarcated area of altered bone structure), cysts (sharply demarcated lytic bone lesion with geographical borders), or fractures (in cases where fracture line occured). in some patients, altered bone structure was able to be classified as cyst or tumefaction preceding the pathological fracture, while in other cases, no alteration of the bone structure was radiologically visible aside of the fracture line. the age of the patients at the time of diagnosis was from 7 to 77 years. the mean age of all patients was 40.918.8 years. in order to explore the age distribution of ce, we grouped patients into 5 age categories: i (1-18 years), ii (19-36 years), iii (37-54 years), iv (55-73 years), and v (> 73 years). in group the mean age of adult patients (more than 18 years old) was 44.716.6 years. a total of 24 male patients presented 58.5% of all cases, while 17 female patients presented 41.5%. the spine was the most commonly involved site with the predominance of the thoracic segment. analysis of standard radiographies revealed that fracture was by far the predominant radiological diagnosis, followed by tumefaction and cyst (table 2). pain was the symptom in 41.5% of patients, while some patients demonstrated complications such as paraplegia (22.0%), pathologic fracture (48.8%), and scoliosis (9.8%). the pathological fracture was most frequently found in the spine (75.0%) followed by the femur (20.0%) and tibia (5.0%). however in addition to the bone involvement, 2 patients demonstrated extraskeletal hydatid cysts: 1 in the liver and 1 in the lungs. bone tissue comorbidities refer to bone tuberculosis in a patient with spinal hydatid disease (2.4%) and to presence of fistula detected in 2 patients (4.9%), 1 with spinal and 1 with pelvic hydatidosis. serbia is recognized as an endemic country for ce, but so far, no epidemiological study has been conducted. since echionococcosis is subjected to an obligatory disease for reporting, the data on the number of reported patients were available through the annual report on infectious diseases on the territory of republic of serbia published by serbian institute for public health, serbia. in the study period, a total of 727 patients with ce the frequency was relatively high compared to the reports from other endemic countries, being 0.5-4.0%. this frequency can be explained at least partially by a larger total number of patients due to careless reporting of echionococcosis by physicians, which was even noted in the official annual reports from 1978 to 1989 of serbian institute for public health, serbia. studies in other endemic countries showed that the prevalence of ce increases with age, resulting that the most of the patients belong to the adult population. the mean age at the moment of diagnosis, including all localizations, was from 33 to 52 years [13-18]. in our study, the mean age of the patients with skeletal manifestation of ce was 40.918.8 years, but among the adults the mean age was 44.716.6. higher frequency in aged people could be due to the fact that older people have more chances to be infected with e. granulosus during life, and also, the clinical signs of ce are more probable to appear later in life, as the disease progresses. as it was reported in previous studies [15,19-21], no significant difference between sex was found. in our study, 12.2% of patients were under 18 years, with the mean age being 13.04.2 years. it was consistent with the results of a previous report on the frequency of echinococcosis among children in serbia. although boys to girls ratio was 1.5:1.0, no significant difference in the positive rate between sex was found. some other studies reported slight predominance of boys, which could probably be explained by their outdoor playing, closer contact with animals, and low level of personal hygiene, compared to girls. symptoms associated with bone ce are not specific and often missing, making the diagnosis difficult and sometimes overlooked. our results showed that 19.5% of patients did not report any symptoms and did not develop any complications. these asymptomatic patients are not surprising in consideration that hydatid disease is anywhere in the body and often discovered as an incidental finding. radiological diagnosis of osseous hydatid disease is also difficult because of non-specific findings. radiography usually reveals single or multiple osteolytic lesions and in some cases shows cortical thinning, osteosclerosis (fig. intraosseous foci of hydatid disease predominate in spongious bone tissues and consist of small, separate, and thin-walled cysts. while these cysts expand, they destroy the surrounding trabeculae and can reach a considerable size. due to cyst enlargement and consequent cortical thinning, pathological fractures may occur. in the case of connective tissue proliferation and bone sclerosis, presentation of ce can be unclear, consisting of mixed radiological signs (table 2). therefore, preoperative diagnosis of skeletal hydatid disease is difficult, and conclusive diagnosis is often made intraoperatively and by histological verification [26-28]. histological examination of the cyst wall usually reveals an outer chitinous (or fibrous laminar) and an inner germinal layer, surrounded by either granulation tissue or fibrous capsule (fig. osseous ce is almost invariably related to primary infection and is not the result of extension from neighboring soft tissue lesions. however, some authors report that around 30-45% of bone hydatidosis is co-present with the hydatid cysts in other localizations. we have reported just in 4.9% of cases the presence of hydatid disease in the liver or lungs; however, there is no statement in our database about the radiological surveys for the possible diagnoses of hepatic or pulmonary hydatidosis. therefore, it is impossible to exclude the presence of secondary cysts without a whole body scan. in patients with bone ce, spine is the most commonly affected site with the frequency of appearance 35-50% [24,29, 33-36]. our findings (table 1) are in concordance with the ones reported by other authors, with the exception of the cervical region. it is considered to be relatively silent, slowly progressive disease with a latent period of many years. early symptoms appear when the small cyst expands and produces significant mechanical compression on surrounding vital structures. at this stage, intermittent pain can be present as a symptom. as the disease progresses and the cyst enlarges, patient starts suffering from persistent backache, gradually leading to severe neurologic deficit and varying degrees of weakness of limbs. pain was present in 50% of patients with spinal hydatidosis in our study (table 3) with the frequency of appearance similar to the ones reported by other authors. paraplegia is the most serious complication of vertebral hydatidosis appearing in up to 75% of patients with spinal ec. this compressive effect of spinal ce was present in 37.5% of patients in our study (table 3). paraplegia is a neurological complication, occurring as a result of invasive intradural and extradural growth of the cyst. cysts invade the spinal canal either by direct compression or by ischemic changes in the spinal cord. radicular pain usually precedes paraparesis by few weeks, progressing rapidly to paraplegia in the thoracic spine, but slowly in the lumbar spine. our results show that, in some patients, paraplegia can be developed as a compressive effect not just of the cyst, but of the spinal pathological fracture that ce can lead to, as well. all these data indicate that once formed in the spinal column, hydatid cyst is likely to result in paraplegia during the progression of the disease. in long-term hydatidosis, apart from pain and paraplegia, some cases can result in secondary infections and fistula formation.. their presence can resolve the disease in the term of surgical treatment, while bacterial superinfection can lead to sterilization of the parasite, limiting the bone destruction. interestingly, in our study, 1 male patient was reported with bone ce and tuberculosis super-infection. despite ce shows the spinal tropism causing severe complications, the therapy of spinal ce is still poor. they are applied in order to retard the recurrences and control the disease but radical surgery is still the keystone. data from the literature reported that the recurrence rate of bone ce, even after several operations, varied from 30% to 100%. moreover, the mortality rate of spinal ce is unacceptably high, varying 14-58%. when ce is affecting long bones, it is generally the metaphyseal region, extending later to the diaphyses and nearby bones. the incidence of long bone involvement in our study (table 1) was similar to the results reported by other authors. therapy is surgical resection, performed if lesion is segmental, otherwise, amputation or disarticulation are the only solutions. our results (table 1) did not differ from the ones obtained by other authors. it's progression is infiltrating and diffuse and may lead to pain, swelling, and stiffness of the hip joint. this disease is hematogenously seeded along the trabeculae and through the medullar canal, leading to extensive bone lesions. our results reported that these lesions were mostly complicated with pathological fracture (48.8% of all cases). our results reported primary involvement of the spine (75%), with the predominance of lumbar over thoracic segment. in patients with bone ce, bone tissue destruction develops through 3 mechanisms; as the consequence of the cystic lesion expansion and its compression on surrounding tissues, ischemic processes through compression and obstruction of nutrient vessels, and cellular processes like osteoclast proliferation around the compressed bone tissue. in the absence of pericyst formation, the wall of the cyst is thin and can not overcome the rigid bone nature. therefore, the cyst can not assume it typical, spherical shape, and it enlarges irregularly along the path of least resistance. in patients with skeletal ce, bone destruction lead to its thinning, extension into soft tissues and, as the worse case, can lead to fracture. therefore, some authors suggest that all the pathological fractures in endemic countries should be considered as a possible case of ce.

although serbia is recognized as an endemic country for echinococcosis, no information about precise incidence in humans has been available. the aim of this study was to investigate the skeletal manifestations of hydatid disease in serbia. this retrospective study was conducted by reviewing the medical database of institute for pathology (faculty of medicine in belgrade), a reference institution for bone pathology in serbia. we reported a total of 41 patients with bone cystic echinococcosis (ce) during the study period. the mean age of 41 patients was 40.918.8 years. in 39% of patients, the fracture line was the only visible radiological sign, followed by cyst and tumefaction. the spine was the most commonly involved skeletal site (55.8%), followed by the femur (18.6%), pelvis (13.9%), humerus (7.0%), rib (2.3%), and tibia (2.3%). pain was the symptom in 41.5% of patients, while some patients demonstrated complications such as paraplegia (22.0%), pathologic fracture (48.8%), and scoliosis (9.8%). the pathological fracture most frequently affected the spine (75.0%) followed by the femur (20.0%) and tibia (5.0%). however, 19.5% of patients did n't develop any complication or symptom. in this study, we showed that bone ce is not uncommon in serbian population. as reported in the literature, therapy of bone ce is controversial and its results are poor. in order to improve the therapy outcome, early diagnosis, before symptoms and complications occur, can be contributive.

PMC3770877

pubmed-167

worldwide, head injury is the single largest cause of death and disability following an injury. the burden of head injury is greatest in low- and middle-income countries (lamic), where 85% of the world's population live. the world health organization estimates that almost 90% of deaths due to injuries occur in these settings. head injury is the leading cause of disability in people under 40, severely disabling 150200 people per million annually. in 2005, road traffic injuries resulted in the death of an estimated 110,000 persons, 2.5 million hospitalizations, 89 million minor injuries and economic losses to the tune of 3% of the gross domestic product in india. the accident rate of 35/1000 vehicles in india is also amongst the highest in the world. however, resources have not been diverted adequately by governments toward prevention, management and rehabilitation of head injuries in lamic such as india. most patients with severe traumatic brain injuries (tbi) in developing countries are discharged to home-based care due to lack of rehabilitative facilities and health insurance. those patients who are discharged in an unconscious state are particularly difficult to manage at home and are prone to decubitus ulcers, respiratory infections, inadequate nutrition, and physiotherapy. however, data is lacking on the actual load of vegetative patients and their outcomes, especially from developing countries. patients, who remain unresponsive to the environment even though their eyes may be open, are considered to be in a vegetative state (vs). a persistent vs has been defined as a vs still present 1 month after acute traumatic or nontraumatic brain damage. as by definition, vs requires a minimum period of 1 month of remaining unconscious, most patients who remain unconscious are not labeled as vegetative at discharge. however, there are no studies assessing conversion to vs, specifically in this group of patients. in this retrospective study carried at one trauma center in india, a prospectively maintained neurotrauma registry was queried from may 2010 to february 2013 for patients who had severe traumatic brain injury glasgow coma score (gcs 8) at admission and had a motor response of m5 or lower on the gcs at discharge. unconsciousness was described as patients with a motor score of m5 or lower on the gcs irrespective of the verbal (v) or eye (e) response. demographic and clinical data was analyzed, and outcome assessed at 6 months after injury using a telephonic questionnaire. the questions asked were: (1) is the patient alive? (2) if alive, is the patient responding to commands (conscious)? (3) if the patient is conscious, is he able to perform activities of daily living like feeding himself, going to toilet independently and going to preinjury occupation? if the family members replied that patient had gone back to preinjury occupation it was considered as glasgow outcome scale (gos) 1, if patient was able to perform activities of daily living, but not able to go back to work it was considered as gos 2, if patient was conscious but not able to do activities of daily living, it was considered as gos 3. if a patient remained unconscious, it was gos 4 and if the patient had died it was gos 5. gos 13 was considered as the unfavorable outcome and gos 45 was considered as a good outcome. of these 166 (10.9%) were unconscious (motor response m5 on the gcs or lower) at discharge from the hospital. average hospital stay was 24.31 days (range: 864 days) and was 16.71 days for m5, 20.63 days for m4, 26.33 days for m3, 30.59 days for m2 and 16.3 days for m1 patients [table 1]. mortality and outcome at 6 months with respect to motor scores at the time of discharge the discharge motor score was m5 in 32 (19.3%), m4 in 44 (26.5%), m3 in 59 (35.5%), m2 in 44 (26.5%) and m1 in 9 (5.4%). 54 (52.9%) patients had died and 32 (31.4%) remained unconscious (vegetative) at 6 months. 100% of m1, 90.6% of m2, 94.3% of m3, 72.2% of m4, and 60% of m5 patients had an unfavorable outcome at 6 months. only 16 patients (15.7%) had a good outcome (gos 12) at 6 months post injury. incidence, as well as the severity of head injuries, the, is rising in developing countries due to rapid industrialization with a lag in legal, healthcare, and safety reforms. delhi with a population of around 15 million has the dubious distinction of having the largest number of road traffic accidents of any city in india. the enormity of burden can be assessed by the fact that our study had more than 1500 severe head injured patients in <3 years and was conducted at only one hospital! one of the reasons for the step-motherly attitude by policy makers toward head injury prevention, management, and rehabilitation, is the lack of hard statistics of the actual burden of disease which head injuries carry. in spite of the improvement in care for head injured patients, there has not been a marked decline in the mortality rates for severe head injuries. kagan and baker found that mortality rates were between 26.7% and 41.4% for severe tbi patients in level 1 trauma centers. fakhry et al. in their study found 28.8% mortality rate of severe tbi patients. it has also been shown that developing (low and middle income) countries have a pooled mortality rate of 51% for severe tbi as compared to 30% for high-income countries. nevertheless, in-hospital mortality tells only part of the story on the outcome of these patients. six months outcome is often poorer due to lack of rehabilitative care and facilities, especially in developing countries. most of the patients are discharged to home-based rehabilitation with tracheostomy and oro-gastric tube in situ. in our center, unconscious patients with severe tbi are discharged with tracheostomy tube in situ after ensuring that patient can maintain oxygen saturation on room air and after training relatives regarding care of tracheostomy tube, suctioning, and home-based rehabilitation. interestingly, however, there are no studies on the outcome of patients who are discharged from the acute care facility in this unconscious state. furthermore, a significant number (10.9% in our study) are discharged in the unconscious state. as all studies are based on admission gcs, it is also often not possible to assess how many patients remained unconscious at the time of discharge and became vegetative at 6 months. the outcomes of these patients have also not been studied properly. in our study, patients with m2 motor response had the longest hospital duration with unfavorable outcome occurring in 90% of these patients at 6 months. gcs has remained a robust scale for assessment and prognostication in tbi and the motor score (m response) continues to have the highest predictive value within the gcs. we, therefore, decided to use motor response as criteria to differentiate unconscious and conscious patients. it may be sometimes difficult to differentiate unconsciousness from dysphasia as both disease states may show a motor response of 5. however, left sided contusion in the posterior frontal and/or temporal regions along with the presence of gaze fixation are clues towards dysphasia. our study had a reasonable follow-up of 61.4% of the patients at 6 months and showed the poor outcomes in this subgroup of patients. 54 (52.9%) patients (who were unconscious at discharge) had died and 32 (31.4%) remained unconscious (vegetative) at 6 months with only 16 patients (15.7%) having good outcome (gos 12) at 6 months. this study also shows that the majority of the patients (nearly 85%) who are discharged in an unconscious state will either die or become vegetative. this is the only study of its kind on patients who remain unconscious at discharge following severe tbi and reveals that around 50% will die, and another 30% become vegetative within 6 months of discharge.

introduction: it is well-known that severe traumatic brain injuries (tbi) have a poor outcome. however, what is not well-known is the outcome for those who survive but remain unconscious at the time of discharge from the hospital.aims and objectives: to assess the outcome of severe tbi patients who have a motor response of m5 or lower on the glasgow coma score (gcs) at discharge from a single centre in india. materials and methods: in this retrospective study carried at one trauma centre in india, a prospectively maintained neurotrauma registry was queried from may 2010 to february 2013 for patients who had severe traumatic brain injury (gcs 8) at admission and had a motor response of m5 or lower on the gcs at discharge. demographic and clinical data were analyzed, and outcome glasgow outcome scale (gos) assessed at 6 months using a telephonic questionnaire.observations and results: there were a total of 1525 patients with severe tbi in the study period. of these 166 (10.9%) were unconscious (motor response m5 or lower on the gcs) at discharge from the hospital. 139 were males and 27 females with a mean age of 33.9 years. after a mean hospital stay of 24.31 days, the discharge motor score was m5 in 32 (19.3%), m4 in 44 (26.5%), m3 in 59 (35.5%), m2 in 44 (26.5%), and m1 in 9 (5.4%). telephonic follow-up was available in 102 (61.4%) of the patients. 54 (52.9%) patients had died and 32 (31.4%) remained unconscious (vegetative) at 6 months. only 16 patients (15.7%) had a good outcome (gos 12) at 6 months following an injury. conclusions:this is the only study of its kind on patients who remain unconscious at discharge following severe tbi and reveals that around 50% will die and another 30% remains vegetative at 6 months of discharge. only a small percentage (15% in our study) will become conscious and partially integrated in the society.

PMC4692009

pubmed-168

their marbling has been increased over many decades to meet domestic consumer preferences. in both countries, highly marbled beef is greatly prized for traditional meat cooking methods such as sukiyaki for japanese and gogigui for korean. because of these demands, the use of heifers and steers instead of bulls, intensive feeding system, and genetic ability of wagyu and hanwoo cattle have resulted in greater fat deposition in these breeds compared to european breeds. as intramuscular fat (imf) improves beef quality at least in juiciness and flavor (hornsterin and wasserman, 1987; wheeler et al., 1994) it is assessed in abattoirs by meat graders in various countries, including usa, australia, japan, and korea. like other kinds of foods, meat has three functions: 1) it provides nutrition; 2) it provides deliciousness; and 3) it prevents disease. although beef has these three functions, the main food in both japan and korea is boiled rice while beef is a side dish. therefore, these two countries have developed the quality of beef rather than its quantity. this is quite different from foreign countries where meat is consumed as a main dish. in japanese and korean cuisine, soft and delicious beef with imf and a good red color in the past, fat was not given a good image in its role towards human health, although fat is an important energy resource for human. recently, fat has been reported to have fewer adverse effects on health than carbohydrates, especially simple carbohydrates. in fact, meat has played a crucial role in human evolution of a healthy and well balanced diet (pereira and vicente, 2013). furthermore, meat plays a pivotal role in nutritious diets. high quality marbled beef not only has excellent eating quality, but also contains a lot of beneficial fatty acids (troy et al., 2016). in this regard, the current paper reviews the characteristics and health benefit of highly marbled beef from wagyu and hanwoo cattle. it has well known that wagyu cattle have high potential of accumulating imf and producing highly marbled beef. hanwoo cattle are also known for their high imf for marbled beef similar to wagyu beef. highly marbled wagyu loin contains more than 40% of imf, sometimes more than 60% (horii et al., 2009), while quality grade 1 hanwoo, the highest quality grade, has approximately 28% of imf in longissimus thoracis muscle (hwang and joo, 2016). wagyu cattle include four types of japanese cattle: the black, brown, short horn, and polled breeds. numerous studies have investigated the meat quality, quantity, and muscle physiology of crossbreed wagyu (japanese black cattle) in foreign countries (cafe et al., 2006; cafe et al., 2009; greenwood et al., 2006; greenwood et al., 2009; may et al., 1993). they are identified by different coat color: brown (major hanwoo), black face (heukwoo), black (jeju heukwoo), and tiger color (chickso) (jo et al., 2012). in this review, wagyu and hanwoo are used to describe the japanese black breed and the brown coat color hanwoo, respectively. all four types of wagyu cattle have played important roles locally and in the history of mixed farming. they also played important roles in the synergies between cattle and crops, especially rice. farmers gradually began to replace the role of cattle as draft animals and started to use industrial fertilizers approximately 50 years ago. in recent years, japanese wagyu cattle have been raised more specifically for beef production. the famous brand name wagyu not only includes the japanese black cattle produced in japan, but also includes animals or even cross-bred japanese black cattle produced in foreign countries such as australia and the united states. similarly, the utilization of hanwoo cattle as an edible meat had been minimal for long time. full-scale production of hanwoo as meat-type cattle has started since the 1970s. because hanwoo cattle have maintained stable traits through pure breeding, the current blood lineage is very valuable. it is mainly spread in the korean peninsula (kim and lee, 2000). recently, hanwoo beef has been reported to have highly marbled imf similar to wagyu beef. especially, hanwoo beef has relatively thin muscle fiber and minimal content of connective tissues (kim et al., 1994). it has less subcutaneous fat depth with greater ossification scores and marbling scores than those of australian angus (cho et al., 2005). in 2013, a total of 2.64 million heads of cattle were fed for beef production in japan. approximately 1.71 million heads were japanese black cattle (maff, 2013), and approximately 873,400 were holstein cattle., the number of farmers producing beef was 613,000, but 86.5% of these farmers fed less than 50 heads of cattle. the mean body weight and carcass weight of beef at slaughter (26-30 mon of age) were 725 kg and 470 kg, respectively. high performance marbled beef production has caused japanese black cattle to comprise the greatest share of japan s wagyu cattle population (albrecht et al., 2011; recently, the imf percentage of beef from japanese black cattle has an average value of greater than 30% (albrecht et al., 2011; horii et al., the total number of slaughter cattle was 1,007,000, including 883,593 hanwoo cattle, 66,485 holstein cows, and 56,923 holstein heifers and bulls (kape, 2015). the number of cattle farming households was 99,858, including 89,403 hanwoo farmers (kape, 2015). during the last decade, the number of households raising hanwoo cattle has drastically decreased from 186,000 households in 2006 to 89,403 households in 2015 (kape, 2016). the average live and carcass weights of hanwoo cattle at slaughter (26-30 mon of age) were 719 kg and 430 kg, respectively (kape, 2015). wagyu carcasses are evaluated by accredited graders from the japan meat grading association (jmga) in accordance with beef carcass grading standards. first established in 1988, the present grading system assigns both yield grade (a, b, and c) and meat quality grade (1, 2, 3, 4, and 5) (jmga, 2014). in korea, all cattle carcasses should be evaluated by korean carcass grading system. established in 1992, the korean carcass grading system presently has three levels of yield grade (yg) for meat amount (a, b, and c) and five levels of meat quality grade (qg) (1, 1, 1, 2, and 3) (kape, 2016). for beef quality grading in japan, all cattle carcasses are graded at the 6 to 7 rib section at least one hour after ribbing. the following four items are independently evaluated: beef marbling; meat color and brightness; meat firmness and texture; and fat color, luster, and quality. meat quality grade of the carcass is then assigned according to the lowest grade of these four items. korean beef quality grading is also estimated based on several factors, including marbling score, meat color, fat color, firmness and texture of lean meat, and maturity of the exposed loin muscle at the 13 rib interface. this means that marbling score is the most dominating determinant in korea because korean consumers have an extraordinary preference for high marbled meats. in 1988, wagyu marbling levels were assigned by the beef marbling standard (bms) using a plastic model made from silicone resin. this standard was calculated based on the circumference and area percentage of marbling particles in the rib eye section (longissimus thoracis). in october 2008, a new marbling standard using carcass photographs replaced the 1988 standard. in march 2014, an even newer marbling standard 1). graders now determine the bms number (1 to 12) by comparing the actual carcass marbling to the standard photograph of marbling. during this process, any larger inclusions of fat at the periphery of the rib eye are not considered as marbling according to the japanese grading system. the bms of korean carcass grading system has been changed by the addition of marbling number. in 1992, when the carcass grading system was established for the first time in korea, the bms had only 5 numbers (1 to 5) with 3 qg (1, 2, and 3). however, in 1997, new qg 1 was added with new bms no. 6 and no. furthermore, in 2004, another new qg 1 was added with new bms no. 8 and no. hanwoo beef with qg 1 or 1 is considered as a premium class of beef in korea. of hanwoo cattle slaughtered in 2015, 10.0% were qg 1, 26.4% were qg 1, and 31.4% were qg 1 (kape, 2016). the plentiful marbling of wagyu and hanwoo beef has attracted attention. in both japan and korea, the value of cattle carcasses is determined by a qg which considers marbling as a decisive determinant. since the liberalization of beef importation, marbling has been greatly emphasized to differentiate domestic beef from imported beef (hirooka, 2014; hwang et al., 2010). the high content of imf can improve the texture and juiciness of hanwoo beef and thereby its acceptability (jung et al., 2016). korean consumers prefer qg 1 or 1 beef because of its high imf content (kim et al., 1999). 2015) have demonstrated that an increase in crude fat content (range 23.8-48.6%) can increase the tenderness, juiciness, and fattiness. however, they also reported that an increase in crude fat content can reduce the crude protein content and slightly reduce the content of umami components such as nucleic acid and glutamic acid. it is well known that imf content varies depending on feeding time, finishing diet, and breed type. to produce high qg beef, great attention has been paid to more accumulation of imf in wagyu and hanwoo muscle. one of good strategy to increase imf content in beef muscle is to extend slaughtering age. although the marbling score is increased and reached a plateau at about 24 mon of age (choi et al., 2002), the slaughtering age of hanwoo has been extended to increase the bms score (jo et al., 2012). in korea, the marketing age of hanwoo has been extended to an average of 31 mon with weight of 719 kg to fatten the cattle (kape, 2015). however, average daily gain is decreased due to increased slaughtering weight (paek et al., 1993). recently, cattle in china are fed for unusually long periods of time before slaughter as wagyu and hanwoo. this might have contributed to their high imf and oleic acid contents (smith, 2016; tanaka, 1985). it is clear that imf increases with feeding time for grain-fed and pasture-fed cattle. however, the rate of imf increase in grain-fed cattle is faster than that in pasture-fed cattle (smith et al., 2009). it has been reported that wagyu fed on a high-concentration diet have higher expression of adipogenic transcription factors in the subcutaneous and intramuscular adipocytes than those fed on a high-rough-age diet (yamada and nakanishi, 2012). the imf content and the numbers of preadipocytes and adipocytes are reported to be higher in wagyu than those in angus (duarte et al., 2013). (2009) have reported that the imf contents in the longissimus muscle of wagyu, german angus, belgain blue, and holstein friesian are 23.3%, 4.4%. the wagyu and european cattle breeds did not differ in their mechanisms of postnatal fat accretion. however, they differed in their efficiency of accretion of imf (gotoh et al., 2009). for every 1% increase of imf in the longissimus muscle, the increase amounts of subcutaneous adipose tissue in wagyu, holstein friesian, german angus, and belgain blue were 3.0, 4.3, 7.9, and 10.7 kg, respectively (gotoh et al., 2009). although imf content is the most dominating determinant of beef quality, the imf content is not the only parameter that decides the quality grade of beef carcass. marbling is called shimo-furi in japanese and sang-gang in korean. it literally means frosting. in japan, marbling with a fine appearance resembling frost is highly valued, but coarse marbling is not (motoyama et al., recently, korea also began to discriminate between fine and coarse marbling in hanwoo beef. this marbling quality contributes to the tenderness of beef because imf deposits are found mainly between muscle fiber bundles, resulting in the disorganization of perimysium connective tissue (nishimura, 2015; sasaki et al., 2012). therefore, the sensory of tenderness could be qualitatively affected by histological difference in marbling due to difference in tissue disorganization extent. there are several types of fatty acids: 1) monounsaturated fatty acids (mufa), 2) polyunsaturated fatty acids (pufa), and 3) saturated fatty acid (sfa). pufa such as linoleic acid, -linolenic acid (n-3), -linolenic acid (n-6), arachidonic acid, and so on contain many important compounds such as essential fatty acids. the fatty acid that has the highest amount in beef is oleic acid (c18:1n-9). it has been reported that fatty acid compositions are different depending on breeds (smith et al., 2006 the fatty acid compositions in highly marbled wagyu and hanwoo are considerably different from those in other cattle breeds. highly marbled wagyu beef has a higher percentage of mufa within fat compared with other breeds (yang et al., 1999a). (2006) have investigated oleic acid concentrations in the subcutaneous adipose tissues of wagyu, hanwoo, australian crossbred, angus (corn-fed), angus (hay-fed), and angus (weaned) and found that they are 52.9%, 47.3%, 39.8%, 39.8%, 34.6%, and 32.9%, respectively. a higher percentage of mufa will lead to a lower fat-melting point which contributes to the softness of beef fat and favorable beef flavor. it may decrease the circulating concentration of ldl cholesterol in consumers (melton et al., 1982; rudel et al., 1995; smith, 1994). therefore, fatty acid compositions of beef have recently become important in the beef industry, especially in highly marbled wagyu and hanwoo cattle (1995) have investigated the effect of breed type (including japanese black) and sex on fatty acid compositions of subcutaneous and intramuscular lipids in finishing steers and heifers of pure japanese black and holstein as well as crossbred japanese black, holstein, japanese brown, and charolais. they have reported that the japanese black is genetically predisposed to producing carcass lipids containing higher concentrations of mufa than holstein, japanese brown, or charolais steers (zembayashi et al., 1995). 1992) have also concluded that beef from purebred wagyu cattle raised in japan is rich in mufa. (2011) have compared intramuscular fatty acid composition of longissimus muscle in 26-month-old japanese black steers and holstein steers reared and fattened using a standard fattening system (table 1). in the longissimus muscle of japanese black steers, a higher percentage of unsaturated fatty acid was found than that in holstein steers (gotoh et al., 2014) 2011) have also compared the imf content and fatty acid compositions of 21 major skeletal muscles using the same animals. muscles from the japanese black cattle contained a greater proportion of numerous fatty acids, particularly mufa such as c16:1, c18:1, and c20:1 compared to fatty acids in holstein cattle. in japanese black cattle, the proportion of sfa including c18:0 was much lower compared to that in holstein cattle. sfa: saturated fatty acids, mufa: monosaturated fatty acids, pufa: polysaturated fatty acids. 2005) have investigated the fatty acid compositions of hanwoo and australian angus beef and found a significant difference in fatty acid compositions between these two cattle breeds (table 2). especially, angus beef had significantly higher n-3 pufa while hanwoo beef contained greater n-6 pufa in three different muscles (cho et al., 2005). the difference in fatty acid composition might be attributed to the influence of different diets, forage, and grain feeding, although fatty acid profile in ruminants is not a direct reflection of the dietary fatty acid composition due to hydrogenation by rumen microorganism (enser et al., 1998). sfa: saturated fatty acids, usfa: unsaturated fatty acids, mufa: monosaturated fatty acids, pufa: polysaturated fatty acids. f-ratio statistic:*if p<0.05,** if p<0.01,***if p<0.001. therefore, it can be easily anticipated that hanwoo beef has a fatty acid profile similar to that of high concentratefed animals (jo et al., 2012). recently, hwang and joo (2016) have evaluated the fatty acid profile of ten muscles from high marbled (qg 1) and low marbled (qg 2) hanwoo carcass and found significant differences in fat content and fatty acid composition among 10 muscles and between high and low marbled hanwoo beef. in particular, high marbled hanwoo muscles had significantly higher proportion of mufa due to higher oleic acid (c18:1) proportion, while low marbled hanwoo muscles had higher proportion of sfa due to higher proportion of stearic acid (c18:0) (hwang and joo, 2016). stearoyl-coa desaturase (scd) was first identified and reported as one of the genes associated with beef fatty acid composition (taniguchi et al., the composition of fatty acids stored in fat depots reflects the earlier action of scd on substrates such as stearic acid and palmitic acid (kim and ntambi, 1999). 1999b) have reported interesting correlations between scd enzyme activity and fatty acid composition in bovine adipose tissue. although the adipogenic mechanism is extremely complicated, several genes have been identified and confirmed as either associated with or responsible for the fatty acid composition in wagyu cattle (gotoh et al., 2014). it is generally accepted that the concentration of oleic acid in beef adipose tissue is dependent on scd expression and activity. wagyu cattle are genetically disposed to produce more oleic acid (smith et al., 2006). very high heritability has been reported for oleic acid in wagyu cattle (nogi et al., 2011). higher levels of concentrated feed in the later fattening period can lead to higher mufa concentration in the subcutaneous adipose tissues of wagyu steer (kimura et al., interest in beef fat and fatty acids has been increasing, especially in highly marbled beef such as wagyu and hanwoo because fatty acids composition in the diet have impact on human health. consumption of fat and cholesterol has been reported to be linked to cardiovascular disease, obesity, and cancer (micha et al., 2010; consequently, reduction of total fatty acid intake and replacement of sfa with pufa have been recommended. ulbricht and southgate (1991) have demonstrated that stearic acid has no effect on plasma cholesterol level and that oleic acid can lower serum cholesterol similar to pufa. furthermore, pavan and duckett (2013) have suggested that a higher proportion of oleic acid in beef is desirable because the consumption of high-oleic acid ground beef can increase hdl-cholesterol concentration (gilmore et al., 2011). according to smith (2016), the amount of fat consumed in a typical portion of beef will not increase risk factors for cardiovascular disease. clinical trials have demonstrated that ground beef containing elevated oleic acid can increase the concentration of hdl-cholesterol or at least has no negative effect on the concentration of hdl-cholesterol. in earlier research on oleic acid, the major mufa in beef, grundy et al. (1988) have found that it can lower ldl-cholesterol without affecting beneficial hdl-cholesterol. (2014) have reported that mufa can normalize or improve lipid metabolism and maintain the balance in cardiac muscle. these have implied that mufa have little effect on total cholesterol and that they are heart-healthy dietary fat that can lower ldl-cholesterol and increase hdl-cholesterol (lahey et al., 2014). this effect is repeatable when natural foods are used to supplement diets with oleic acid. in this regard, smith (2016) have concluded that beef cattle should be raised under production conditions to increase the concentration of oleic acid in their edible tissue, i.e., by grain feeding over extended periods of time. it is obvious that consumer in the world has an overwhelmingly negative attitude toward animal fats, especially saturated fat in meat for the last several decades (ngapo and dransfield, 2006; williams and droulez, 2010). according to higgs (2000), the per capita decline in beef consumption in the us and other western countries has been attributed in large part to animal fat phobia. consumers have been warned to reduce saturated fat in their diet and to avoid meat cuts containing high fat content. these health recommendations are obviously in conflict with the health of highly marbled wagyu and hanwoo beef. many research studies have shown that the imf of wagyu and hanwoo beef contains a lot of mufa that could prevent arteriosclerosis. researches have also demonstrated that high-oleic acid ground beef may reduce risk factors for cardiovascular disease (adams et al. thus, although some consumers in japan and korea consider highly marbled wagyu and hanwoo beef as being unhealthy, there is no scientific evidence to indicate that beef that is high in oleic acid will increase risk factors for diseases (smith, 2016). consequently, the role of animal fats in the diet should be re-evaluated because scientists around the globe increasingly doubt the validity of the so called diet-heart hypothesis it is now generally accepted that diets with low fat, high carbohydrate failed to curb obesity (drewnowski, 2015). on the other hand, more recent functional medicine research studies have suggested that the intake of fat has positive effect on human health (saito, 2016). it is essential to consume fats containing good quality fatty acids while reducing the consumption of food high in simple carbohydrates. excessive intake of simple carbohydrates is detrimental to health because they have negative effects on the body (yu et al., 2013). in this regard, inclusion of high fat foods with superior sensory properties in a balanced diet such as highly marbled wagyu and hanwoo beef is likely to gain wider acceptance as a well-being food in the near future. in japan and korea, highly marbled wagyu and hanwoo cattle are greatly prized for traditional meat cooking methods. many researches have shown that wagyu and hanwoo cattle have high potential of accumulating imf and producing highly marbled beef. the beef quality grading system in both countries is primarily determined by marbling score with bms and additionally adjusted by other carcass traits. literature suggests that imf content varies on the basis of feeding time, finishing diet, and breed type. great attention has been paid to more accumulation of imf to produce high quality grade beef. the rate of imf increase in grain-fed cattle is faster than that in pasture-fed cattle. highly marbled wagyu and hanwoo beef have higher proportions of mufa due to higher concentrations of oleic acid. they are heart-healthy dietary fat because they can lower ldl-cholesterol while increasing hdl-cholesterol. clinical trials have also indicated that highly marbled beef does not increase ldl-cholesterol and that beef high in oleic acid can consistently increase hdl-cholesterol. finally, literatures have concluded that high-oleic acid beef such as wagyu and hanwoo beef may reduce risk factors for cardiovascular diseases.

this review addresses the characteristics and health benefit of highly marbled wagyu and hanwoo beef. marbling of wagyu and hanwoo beef has been increased in japan and korea to meet domestic consumer preferences. wagyu and hanwoo cattle have high potential of accumulating intramuscular fat (imf) and producing highly marbled beef. the imf content varies depending on the feeding of time, finishing diet, and breed type. imf increases when feeding time is increased. the rate of imf increase in grain-fed cattle is faster than that in pasture-fed cattle. fatty acid composition are also different depending on breeds. highly marbled wagyu and hanwoo beef have higher proportions of monounsaturated fatty acid (mufa) due to higher concentrations of oleic acid. mufas have little effect on total cholesterol. they are heart-healthy dietary fat because they can lower low-density lipoprotein (ldl)-cholesterol while increasing high-density lipoprotein (hdl)-cholesterol. clinical trials have indicated that highly marbled beef does not increase ldl-cholesterol. this review also emphasizes that high oleic acid beef such as wagyu and hanwoo beef might be able to reduce risk factors for cardiovascular disease.

PMC5243954

pubmed-169

n-acetyl-l-cysteine (nac) is an endogenous aminothiol present both in human plasma and in urine. n-(2-mercaptopropionyl)glycine (mpg), also known as tiopronin, is a synthetic aminothiol antioxidant. nac has been in clinical use for more than 40 years, primarily as a mucolytic agent in a variety of respiratory illness. intravenous and oral administration of nac have been extensively used in the management of paracetamol (acetaminophen) poisoning. mpg is primarily used in the treatment of cystinuria, but studies have shown that mpg can be used as a chelating, cardioprotecting, and radioprotecting agent, as well as an antidote to heavy metal poisoning. a number of electrochemical [59], fluorometric [1012], chemiluminescence [1315], and liquid chromatographic [1618] methods have been developed for the determination of nac and mpg in biological samples and pharmaceuticals. spectrophotometry is the most widely used technique in pharmaceutical analysis because it is simple, economic, and easily available to most quality control laboratories. spectrophotometric methods have also been reported for the determination of nac and mpg in pharmaceutical formulations [1925]. a coupled redox-complexation reaction has been reported for the spectrophotometric analysis of nac and mpg using 1,10-phenanthroline as the chromogenic reagent. in the present work, we report a simple and cost-effective spectrophotometric method for the reliable analysis of nac and mpg in pharmaceutical formulations. the method is also based on the coupled redox-complexation reaction between nac or mpg and fe(iii) but uses 2,4,6-tripyridyl-s-triazine (tptz) as the chromogenic reagent. collins et al. have introduced tptz as chromogenic reagent for determination of fe(ii). the fe(ii) complex with tptz has a twice higher molar absorptivity coefficient (2.2 10 l mol cm) than the fe(ii) complex with 1,10-phenanthroline (1.1 10 l mol cm). all spectrophotometric studies were carried out on an ultraviolet-visible, double-beam spectrophotometer (uv-1601 shimadzu, kyoto, japan), and using 1 cm quartz cells. measurements of ph were carried out with a mettler toledo sevenmulti potentiometer (mettler toledo, schwerzenbach, switzerland) equipped with a combined glass electrode mettler toledo in lab 413. a thermostated water bath (mgw lauda, germany) was used to keep a constant cuvette temperature of 25 0.5c. all chemicals were of analytical-reagent grade, and solutions were prepared in milliq deionised water. separate 10 mm stock solutions of nac and mpg were prepared by dissolving 163.2 mg (1 mmol) of nac (merck, darmstadt, germany) or 163.2 mg (1 mmol) of mpg (sigma-aldrich, st. louis, usa) in deionised water up to 100.0 ml volume and stored in the dark bottle at 4c. dilutions were prepared daily in deionised water. stock solution of fe(iii) (10 mm) was prepared by dissolving 270.3 mg (1 mmol) of fecl3 6 h2o (kemika, zagreb, croatia) in 50.0 ml deionised water. then 0.5 ml of concentrated hcl was added and the volume was adjusted to 100.0 ml with deionised water. a stock solution of 10 mm tptz (merck, darmstadt, germany) was prepared by dissolving 312.3 mg (1 mmol) tptz in 2.0 ml of a 6.0 m hcl, followed by addition of deionised water up to a total volume of 100.0 ml. m) was used to cover the ph range 3.24.0. for solutions of ph 1.0 and 2.0, two different pharmaceutical formulations of nac were analysed by the present spectrophotometric method, that is, fluimukan 200 mg granules, and fluimukan akut 600 mg dispersible tablets (lek, ljubljana, slovenia). an accurately weighed portion of the powder containing about 200 mg of nac was transferred into a 500 ml volumetric flask, and nac was dissolved in and diluted to the nominal volume with deionised water. ten tablets of the mpg-containing drug captimer (mit gesundheit gmbh, germany) were weighed and pulverised. a powder quantity equivalent to 100 mg of mpg was dissolved in 300 ml of deionised water, filtered through filter paper (blue ribbon, s&s, germany), and the filtrate collected in a 500 ml volumetric flask was diluted by deionised water to the nominal volume. it is noteworthy that such solutions are not stable and should be analysed within 24 hours. these solutions were further diluted quantitatively with water to obtain suitable concentrations for the analysis by the proposed spectrophotometric method. acetate buffer (20.0 ml, ph 3.6) was pipetted into a 25.0 ml calibrated flask. then 1.25 ml of 10.0 mm fe(iii), 1.25 ml of 10.0 mm tptz, and 1.0 ml of nac or mpg solutions were added. the flask with reaction solution was filled to the nominal volume with deionised water, mixed well, and kept at room temperature (about 25c) for 30 min (mpg) or 60 min (nac). the absorbance of the produced fe(ii)-tptz complex was measured at =593 nm against a blank solution, prepared in the same manner with 1.0 ml water instead of 1.0 ml sample solution. nac and mpg concentrations in pharmaceutical preparations were determined by using daily prepared calibration curves. the eleven solution of every analyte were prepared for the concentration range from 1.0 m to 100.0 m. the proposed method is based on the coupled redox-complexation reaction. in the first (redox) step of the reaction (see (1)), rsh compound (nac or mpg) reduces fe(iii) to fe(ii) whereas rsh molecules themselves oxidize to thiyl radicals rs which combine to form the disulfide rssr. in the second step of the reaction (see (2)), in situ formed fe(ii) is immediately complexed by 2 molecules of tptz to form the deep-blue coloured, highly stable fe(tptz)2 complex which absorbs light at max at 593 nm. the net overall reaction can be expressed by reaction (3): (1)fe3++rshfe2++h++rs (2)fe2++2 tptzfe(tptz)22+ (3)2 fe3++2 rsh+4 tptz2 fe(tptz)22++rssr+2 h+ krishnamurti and huang have reported that the complexation of tptz is specific for fe(ii) so that this reaction can be performed in the presence of large amounts of fe(iii). the results of the present study confirm these previous results for the drugs nac and mpg serving as the reducing agents. in the literature, we were not able to find the standard reduction potential for nac and mpg. however, the calculated formal potential of the fe(iii)/fe(ii) couple of 0.578 v, equations (4) and (5) indicate that its oxidizing power in solution with tptz is more negative than in solution with 1,10-phenanthroline (1.197 v). this means that the proposed method with the tptz is selective for the determination of nac and mpg. thiols or other reducing substances with standard (formal) potentials higher than 0.6 v would not interfere in the proposed method (see (6)); (4)e10=efe3+/fe2+00.05922log (fe2+fe3+[tptz]2)2, (5)e10=0.771 v0.0592log 1.2651050.077(3104)2=0.578 v (6)e20=erssr/rsh00.0592ph. in previous work, we found that the initial redox-complexation reaction rate is higher with mpg compared to nac [28, 29]. in the coupled redox-complexation reaction with mpg, the steady state value of the absorbance is reached after 30 min while in the reaction with nac the steady state value of the absorbance is reached after 60 min. with both thiols ,. equation (6) indicates that the potential for the redox system rsh/rssr depends upon the ph value of the reaction mixture. the effect of the ph was therefore investigated over the range 1.04.0 using 0.1 m hcl for ph 1, 0.01 m hcl for ph 2, and acetate buffer for the ph values 3.2, 3.5 and 3.6. in this experiment mpg the absorbance at 593 nm increased with increasing ph up to the value of 3.6. however, precipitation of iron hydroxide occurred at the ph above 3.8. therefore, a buffered reaction medium of ph 3.6 was chosen as a compromise for keeping fe(iii) in solution and achieving quantitative formation of the fe(tptz)2 complex which is stable in the ph range 3.45.8. the influence of the fe(iii) concentration on the determination of nac and mpg at the fixed concentration of 40 m each was studied in the concentration range from 20 m to 400 m, allowing a molar ratio fe(iii)/rsh from 0.5 to 10. in figure 2, the absorbance measured at 593 nm is plotted versus the molar fe(iii)/rsh ratio for nac and mpg. figure 2 shows that the reaction can be forced to completion by increasing the fe(iii)/rsh ratio, for instance by increasing the fe(iii) concentration. the influence of the tptz concentration on the analysis of nac and mpg at the fixed concentration of 40 m rsh compound was studied in the range from 20 m to 400 m allowing a tptz/rsh molar ratio of 0.5 to 10. figure 3 shows that absorbance increased with increasing tptz/rsh molar ratio, that is, with increasing tptz concentration, to reach its maximal value at a molar excess of five. the effect of the reaction temperature on the signal intensity was examined by varying the temperature from 25c to 40c using the thermostated water pump. we found that the reaction rate increased by elevating reaction temperature (see [28, 29]). since the proposed method is an equilibrium method, signal is recorded when the reaction reaches the state of equilibrium. the signal intensity in the state of equilibrium is the same for all the examined temperatures. the linearity of the method was investigated under the optimized conditions for nac and mpg in the concentration range from 1.0 to 100.0 m. straight lines were obtained from linear regression analysis of the absorbance at 593 nm and the drug concentration (table 1). the lowest quantifiable concentration of nac and mpg by this method was 1.0 m each. the effect of some possible interfering cations and anions on the analysis of a fixed concentration of 40.0 m for nac and mpg was investigated for the maximum molar ratio of foreign ions. the influence of excipients that can commonly accompany nac and mpg in pharmaceutical formulations was also studied. the tolerance is defined as the foreign-ion/excipient concentration causing an error smaller than 5% for the determination of the analyte of interest. the tolerable concentration of kno3 and na2so4 was 40.0 mm (molar ratio, 1000: 1). the tolerable concentration of glucose, fructose, sucrose, boric acid, and acetic acid was 20.0 mm (molar ratio, 500: 1). thus, the commonly excipients glucose, fructose, and sucrose do not interfere with the analysis of nac and mpg because they essentially do not react with the oxidizing agents. it should be emphasized that the contaminant/analyte concentration ratios studied in the present work are much higher than those normally found in commercial pharmaceutical products. the tolerable concentration of some other thiols, that is, d-penicillamine, l-glutathione, and l-cysteine, was 40.0 m (molar ratio, 1: 1). thiols or other reducing substances with standard (formal) potentials higher than 0.6 v would not interfere in the proposed method. in order to evaluate the potential of the proposed method to the analysis of real samples, the method was applied to three pharmaceutical formulations of the drugs nac and mpg. the results of these analyses are presented in tables 2 and 3. for comparison, the spectrophotometric method reported by raggi et al. these authors used 1,10-phenantroline as an chromogenic reagent, instead of tptz which is used in the present work. as shown in table 2, there were no significant differences between the values obtained by the reported method and those obtained by the proposed method (p>0.1, student t-test). this actually suggests that the proposed method is accurate and precise as the earlier reported method. the accuracy of the method was further ascertained through the recovery studies. to the drug solutions of the granules or the tablet powder, the standard solutions of the synthetic nac or mpg these results indicate that the proposed method is accurate for the determination of nac and mpg in their commercially available pharmaceutical preparations without any significant interference by common pharmaceutical excipients which do not absorb light in the visible region. performance characteristic of existing equilibrium spectrophotometric methods [19, 2124] and the proposed method are compared in table 4. the proposed method is free from drastic experimental conditions such as heating unlike some of reported methods. some other thiol compounds do not interfere in the proposed method at molar ratio 1: 1. it is also worth mentioning that the proposed method was performed in the visible region (= 593 nm) away from the uv-absorbance of the uv-absorbing interfering excipient materials, which might be dissolved from pharmaceutical formulations. undoubtedly, hplc is one of the most widely used techniques in routine analysis of pharmaceuticals, but it involves expensive instrumental set which many laboratories in developing and underdeveloped countries can not afford. the proposed equilibrium spectrophotometric method based on the coupled redox-complexation reaction of the thiol drug nac or mpg with fe(iii) and tptz can be applied in every analytical laboratory as a reliable method for the determination of nac or mpg in pharmaceutical preparations. due to the use of tptz the coloured fe(tptz)2 complex is stable in an extended period of time up to 24 hours. regular excipients and additives present in the pharmaceutical preparations of nac and mpg do not interfere in this method.

a simple spectrophotometric method for the determination of n-acetyl-l-cysteine (nac) and n-(2-mercaptopropionyl)glycine (mpg) in pharmaceutical preparations was developed, validated, and used. the proposed equilibrium method is based on a coupled two-step redox and complexation reaction. in the first step, fe(iii) is reduced to fe(ii) by nac or mpg. subsequently, fe(ii) is complexed with 2,4,6-tripyridyl-s-triazine (tptz). several analytical parameters of the method were optimized for nac and mpg analysis in the concentration range from 1.0 m to 100.0 m. regression analysis of the calibration data showed a good correlation coefficient (0.9999). the detection limit of the method was 0.14 m for nac and 0.13 m for mpg. the method was successfully applied to quantify nac and mpg in pharmaceutical preparations. no interferences were observed from common pharmaceutical excipients.

PMC3103845

pubmed-170

using water as solvent in the organic reactions is one of the most important targets to organic chemists because of the easy availability, nontoxicity, and ecofriendly nature of the water [17]. in this endeavour, a number of chemical reactions such as diels alder, hetero diels-alder, 1,3-dipolar cycloaddition, oxidations, reductions, and others are performed successfully in water [13]. also, it is reported that in few cases addition of the water increases the rate and the yield of a reaction and also enhances the enantioselectivity in a chiral synthesis. but the main problems associated with water as a solvent is its poor ability to solubilise organic reactants and incapability to create anhydrous condition for moisture sensitive organic compounds and catalysts. to overcome the solubility problem, generally a surfactant is introduced to the reaction mixture. the surfactant, due to its hydrophobic and hydrophilic nature, forms micelles with water insoluble organic compounds and promote the desired reactions to occur inside the hydrophobic ambience of the micelle core [9, 10]. cleavage of the c=n bonds is a very important transformation in organic synthesis as the c=n functionality is widely used to protect both the carbonyl and amines. there are a number of methods used for the cleavage of c=n bonds which include acidic reagents [1113], oxidizing agents, metallic salts [15, 16], (phseo)2o, nahso3, and others. most of these methodologies suffer from serious drawbacks like involvement of strong lewis and bronsted acids, use of toxic and costly transition metals (i.e., cr, pd, co), low temperature, longer reaction time, low yield, and difficulties in isolating the products. therefore, development of efficient, mild and environment friendly reagents are always necessary. on the other hand, bisindoles are recently emerging as extremely important class of compounds because of their novel antibacterial and anticancer activities [1921]. that is why a number of methodologies have also been postulated for the synthesis of bisindoles [2229]. in our previous communications, we reported that surfactant- (sds-) mediated cleavage of c=n bonds could be achieved with acetic anhydride and surfactant-i2-water can be used for the deprotection of imines to carbonyls. we have also shown that bis- and tris (indolyl)alkanes can be synthesized in presence of bronsted acid in water. in continuation of our research in hydrated media, herein, we wish to disclose the dual catalytic activity of the system i2-sds-h2o which behaves as a lewis acid for the cleavage of 2,3-diaza-1,3-butadiene, 1-aza-1,3-butadienes, and oximes to produce carbonyls and amines, and the resulting reaction mixture reacts with indoles to produce bis (indolyl)alkanes in situ at room temperature under neutral conditions. for an initial study, molecular iodine was added to a mixture of 1,4-diphenyl-2,3-diaza-1,3-butadiene (1a) (1 mmol) and indole (2a) (2 mmol) in water. it was presumed that the activated imine should produce carbonyl compound in the reaction mixture which might be trapped with indole. but only a trace amount of 3,3-bis(indolyl)phenylmethane (3a) was found to be formed in the reaction. we envisioned that the poor yield of the product may be due to the insolubility of organic substrates in water. accordingly, we added a surfactant (sds) to the reaction flask. to our delight, the reaction produced isolable amount of 3a as a brown solid but half of the 1,4-diphenyl-2,3-diaza-1,3-butadiene (1a) left unreacted in the reaction mixture. so amount of indole (2a) was doubled (4 mmol) and the same reaction condition successfully produced quantitative amount of 3a. the product was filtered out and the filtrate was treated with freshly distilled benzaldehyde (0.05 mmol) in ethanol which furnished 1a (m.p. this infers the simultaneous involvement of two c=n bonds of bis-anils, leaving behind hydrazine in the reaction mixture. also, no self-reaction of individual starting materials leading to indole dimer (4) or pyrrole formation (5) were observed under the same reaction conditions (scheme 1). optimization of the reaction conditions was undertaken by employing different catalyst loadings under various surfactant conditions. it was found that the best result was obtained by the application of 15 mol% of i2 containing sodium dodecyl sulphate (sds) and water at room temperature (entry 1, table 1). in absence of the catalyst no formation of 3a was observed even after stirring for 24 hours (entry 5, table 1). to study the scope and limitations of the reaction, i2-sds-h2o system was applied to the reaction of indole (2) and 2,3-diaza-1,3-butadiene derivatives (table 2, entries a the bisindoles were formed in excellent yields under the reaction condition. it was observed that the reaction was relatively faster when an electron withdrawing substituent, for example, no2, was present in the phenyl ring of the 2,3-diaza-1,3-butadienes (table 2, entry e) in comparison to the electron donating groups, for example, ome and oh (table 2, entries b and f). identical results were obtained when 2-methylindole (2a) was used in place of indole (2) (table 2, entries g and h). all the products were characterized by their ir, h nmr, c nmr, and mass spectral data and also by comparison with the literature report (scheme 2) [24, 25]. in order to further explore the efficiency of the i2-sds-h2o system the reaction of the oximes 6 and indoles 2 was studied. when oximes (1 mmol) and indole (2 mmol) were allowed to react under the same reaction condition described earlier, bis-indolylalkanes formed (table 3). the product was filtered off and the filtrate was treated with benzaldehyde in ethanol. the resulted product was benzaldoxime, which proved the liberation of hydroxylamine during the reaction. it was found that no michael addition product was formed and only a trace amount of indole dimer 5 could be identified. the system was also applied to the reaction of 1-aza-1,3-butadienes 7 with indole (2) which produced bis (indolyl)alkanes 8 in very good yield eliminating aryl amine in the reaction mixture (table 4). all the products were well characterized by comparison of their spectral and mass data with that of the reported value [24, 25]. in conclusion, we have shown the dual catalytic activity of i2-sds-h2o system which deprotects the azadienes, oximes, and azabutadienes and produces bis (alkyl)indoles in situ when indole is present in the reaction medium. the two-step reaction can be carried out without using acid, transition metals, and organic solvents. besides, the reaction condition is mild and can be done in water under neutral condition which contributes to the criteria of green chemistry. h nmr spectra were recorded on avance dpx 300 mhz ft-nmr spectrometer. chemical shifts are expressed in units relative to tetramethylsilane (tms) signal as internal reference. ir spectra were recorded on ft-ir-system-2000 perkin elmer spectrometer on kbr pellets or in chcl3. the solvents for chromatography were distilled before use. in a 50 ml round bottom flask, 15 mol% of i2 was first dissolved in water (10 ml). 2,3-diaza-1,3-butadiene (1 mmol) and indole (4 mmol) were added and stirred in the presence of sodium dodecyl sulphate (sds) (0.02 g) for the stipulated time. the product formed was filtered off and washed with water, dried, and recrystallized from ethanol. identical reaction condition was followed when 1-aza-1,3-butadienes and oximes were used as reactants. in this case, 2 mmol of indoles were used to react with 1 mmol of imines. colorless solid; mp: 150152c; ftir (kbr): 3418, 3058, 1623, 1611, 1445, 1093 cm; h nmr (300 mhz, cdcl3): 5.95 (s, 1h, ar ch), 6.73(s, 2h), 7.06 (t, 2h, j=6.8 hz), 7.187.27 (m, 3h), 7.317.36 (m, 2h), 7.367.42 (m, 6h), 7.98 (br, s, 2h, nh); c nmr (75 mhz, cdcl3): 40.7, 111.2, 119.1, 119.5, 120.4, 122.1, 123.8, 126.9, 126.9, 128.2, 129.1, 136.8, 144.8; hrms calcd for c23h18n2 (m): 322.2851, found 322.2832; anal.calcd.: c, 85.70; h, 5.59; n, 8.69; found c, 85.75; h, 5.56; n, 8.56. pink solid; mp: 76-77c; ftir (kbr): 3415, 3060, 1491, 1465, 1095 cm; h nmr (300 mhz, cdcl3): 5.91 (s, 1h, ar ch), 6.76 (s, 2h), 7.08 (t, 2h, j=8.3 hz), 7.22 (t, 2h, j=7.9 hz), 7.287.42 (m, 8h), 8.01 (br, s, 2h, nh); c nmr (75 mhz, cdcl3): 39.8, 111.5, 122.6, 123.8, 127.1,128.4, 129.8, 130.1, 130.9, 131.0, 131.6, 137.2, 143.5; hrms calcd for c23h17n2cl (m): 356.7371; found 356.7324; anal.calcd.: c, 77.52; h, 4.77; n, 7.86; found c, 77.48; h, 4.72; n, 7.80. brown solid; mp: 323325c; ftir (kbr): 3420, 1720, 1455, 1258 cm; h nmr (300 mhz, cdcl3): 5.98 (s, 1h, ar-ch), 6.85 (s, 2h), 7.107.55 (m, 11h), 8.05 (br, s, 2h, nh), c nmr (75 mhz, cdcl3): 34.8, 107.0, 110.0, 111.5, 117.8, 119.9, 120.0, 122.5, 124.8, 127.1, 136.8, 142.2; hrms calcd for c21h16n2o2 (m): 312.2621; found 312.2611; anal.calcd. c, 80.84; h, 5.12; n, 8.97; found c, 84.05; h, 5.15; n, 8.94. the spectral data of the compounds are available in the supplementary material available online at doi: 105402/2012/635835.

a novel catalytic system consisting of i2-sds-h2o has been developed which cleaves 2,3-diaza-1,3-butadiene, 1-aza-1,3-butadienes, oximes and in presence of indoles in the medium uses the corresponding aldehyde products to produce bis(indolyl)alkanes in situ. this one pot simple and mild dual catalytic system works in water at room temperature under neutral conditions.

PMC3767350

pubmed-171

in industrialized countries, cardiovascular disease (cvd) remains the predominant cause of morbidity and mortality. it is current scientific opinion that cvd occurs as a part of a series of events that form a continuum. the first stage of this continuum corresponds to the presence of risks factors that predispose to tissue injury, such as hypertension, dyslipidemia, and diabetes. these risk factors usually activate a complex range of pathogenic pathways leading to the development of atherosclerosis and ischemic heart disease. failure to effectively manage any stage of this continuum results in ventricular hypertrophy, heart failure, end-stage heart disease, and cardiovascular death. one of the molecular pathways that could be activated in response to these risk factors and be involved in cvd development is that of osteoprotegerin (opg) and tnf-related apoptosis-inducing ligand (trail), as reviewed in. opg and trail are both members of the tnf superfamily, and they are widely expressed in different tissues, including the heart and the vessels, in health and disease states [4, 5]. although initially opg actions seemed to be limited to bone metabolism and those of trail to host defense against tumors, recent studies have suggested that both molecules might actually be involved in cvd development and progression. epidemiological studies have shown that there is an association between circulating opg, trail, and cvd. opg was found to be directly correlated [5, 8, 9], while trail was inversely correlated, with cardiovascular morbidity and mortality [10, 11]. likewise, opg was significantly associated with the level of c-reactive protein, which is an independent predictor of acute vascular events and adverse outcomes, while trail was negatively correlated with it. recently, secchiero and colleagues have shown that patients with coronary artery disease have an increased opg/trail ratio, which further increases in patients developing heart failure. consistent with this epidemiological data, experimental studies suggest that opg and trail have opposite actions, as opg has proinflammatory and proatherogenic effects [14, 15], while trail seems to be anti-inflammatory [16, 17] and antiatherogenic [1820]. based on these premises, we hypothesized that dyslipidemia and diabetes, which are two well known risk factors for cvd, could modify the vascular and cardiac expression of opg and trail, leading to an increased opg/trail ratio at a tissue level. the aim of this study was to explore the vascular and cardiac changes of opg and trail in experimental models of dyslipidemia and diabetes. a total of 12 male c57bl/6j (cnt) mice and 24 male apolipoprotein e null (apoe) mice on a c57bl/6j background, aged 6 weeks, were studied for 14 weeks. at 6 weeks of age, apoe mice were further randomized to saline (apoe) or streptozotocin (apoe+dm), which were delivered intraperitoneally in five consecutive daily doses. the daily dose of streptozotocin (stz) (sigma-aldrich) was 55 mg/kg of body weight. after one week, blood glucose was checked and only the mice with blood glucose levels greater than 15 mm were included in the apoe+dm group. during the study period, all the mice were fed with a standard diet. the animals were kept in a temperature-controlled room (22 1c) on a 12 h light/12 h dark cycle with free access to food and water and they were fed ad libitum for the length of the study. after 14 weeks, the animals were anesthetized with an intraperitoneal injection of thiobutabarbital sodium (inactin, sigma-aldrich) (60 mg/kg body weight) and sacrificed by exsanguination via cardiac puncture. all the animal experiments were approved by the animal ethics committee of the university of trieste (i d 28.0.2008) and the italian ministry of health, conforming to the guide for the care and use of laboratory animals. at the end of the study, we measured body weight and systolic blood pressure (sbp). in particular, sbp was assessed by a computerized noninvasive tail cuff system in conscious mice. glucose, total cholesterol, hdl cholesterol, and triglycerides were measured in the sera by autoanalyzer technique (hitachi 917, tokyo, japan). circulating levels of opg and trail were measured in the sera by elisa (r&d systems duoset #dy459 and #dy1121). in half of the animals in each group, aortae were collected and placed in 10% neutral-buffered formalin for atherosclerosis quantification, before being processed for immunohistochemical analyses. in the other half, aortae were snap-frozen in liquid nitrogen and stored at 80c for rna extraction and gene expression analyses. briefly, aortae were cleaned of excess fat and stained with sudan iv-herxheimer's solution. images were acquired with a dissecting microscope (olympus bx-50) equipped with a high-resolution camera (sony xc-77ce). digitized images were then evaluated with an image analysis system (image-pro plus 6.3 software, media cybernetics). total plaque area was quantified as the percentage area of aorta stained red. as for the hearts, they were divided and half was put in formalin and half was put in liquid nitrogen. the part that was fixed in formalin was embedded in paraffin, cut in 4 m thick sections, and stained with hematoxylin and eosin (h&e) in order to evaluate cardiomyocyte hypertrophy. cardiomyocyte hypertrophy was assessed by measuring the shortest diameter of 200 cells, which were selected when they showed the spindle-shaped transverse section including the elliptical nucleus. the shortest transverse diameter was measured 3 times per cell, and the values were averaged, as reported by. the other half that was snap-frozen in liquid nitrogen was used either for gene expression analyses or for immunohistochemical stainings. gene expression of opg and trail was determined by real-time quantitative rt-pcr (reverse transcription-polymerase chain reaction) in aortic and cardiac tissue. in order to isolate mrna from the aorta and the heart, tissue was homogenized and processed as previously reported. then, mrna was treated with the dnase inactivation reagent (ambion dna-free product #am-1906), and 3 g of treated mrna was subsequently used to synthesize cdna with superscript first strand synthesis system for rt-pcr (gibco brl). the gene expression of opg and trail was analyzed by real-time quantitative rt-pcr using the taqman system (life technologies) for opg and the sybr green system (life technologies) for trail. fluorescence for each cycle was quantitatively analyzed by an abi prism 7900ht sequence detection system (applied biosystems). gene expression of opg was normalized to 18s mrna, while that of trail was normalized to rps9. results were reported as ratio compared with the level of expression in untreated controls, which were given an arbitrary value of 1. the presence of opg and trail in the aortae was evaluated by immunostainings on 4 m thick paraffin sections. in particular, after antigen retrieval in citrate buffer (ph6) endogenous peroxidase was quenched for 10 minutes using 3% h2o2 in pbs. to localize opg, we used a biotinylated goat anti-opg antibody (r&d systems, 1: 10 dilution) followed by a catalyzed signal amplification system (dako). to localize trail, we used a monoclonal mouse anti-trail antibody (r&d systems, 1: 50 dilution), applied overnight at 4c. biotinylated goat anti-mouse immunoglobulins (vector laboratories, dilution 1: 200) were then used as secondary antibody, followed by streptavidin-hrp (dako). the presence of opg and trail in the hearts was evaluated by immunostaining on 5 m thick frozen sections. after neutralization of endogenous peroxidase, sections were incubated overnight with the goat anti-opg antibody (r&d systems, 1: 10 dilution) and the monoclonal mouse anti-trail antibody (r&d systems, 1: 50 dilution). biotinylated immunoglobulins, diluted 1: 200, were then applied as secondary antibodies, followed by streptavidin-hrp (dako). in both tissues, after counterstaining with hematoxylin, all the sections were examined by light microscopy (olympus bx50wi) and digitized using a high-resolution camera (q-imaging fast 1394). the proportional area of brown staining was measured by an image analysis system (image-pro plus 6.3 software, media cybernetics) in order to quantify opg and trail expression in aortae and hearts. apoe mice had higher levels of total cholesterol and triglycerides as compared to the cnt mice. in line with the study protocol, the mice in the apoe+dm group were hyperglycemic. moreover, diabetes was associated with a significant reduction of body weight and a significant increase of total cholesterol as compared to nondiabetic apoe mice. apoe mice had a significant increase in total plaque area, which increased further after the induction of diabetes (figures 1(a) and 1(b)). as for cardiac changes, dyslipidemia was associated with a significant increase in cardiomyocyte size (figures 1(c) and 1(d)), indicating cardiomyocyte hypertrophy, with no further increase after the induction of diabetes. in the aorta, the induction of diabetes was associated with a significant increase in opg gene expression and in the opg/trail ratio, while dyslipidemia had no effect on opg/trail ratio as compared to controls (figure 2(a)). by contrast, in the heart, dyslipidemia was the major determinant of opg/trail tissue changes, not only by increasing opg but also by reducing trail gene expression. so dyslipidemia increased significantly cardiac opg/trail ratio, with no further differences after the induction of diabetes (figure 2(b)). immunostainings showed that diabetes significantly increased aortic opg expression as compared to the other groups, while trail was unchanged (figure 3). on the other hand, in the heart, it was dyslipidemia that significantly increased opg protein expression, with no further changes after the induction of diabetes. as for cardiac trail, trail protein expression decreased in the apoe and apoe+dm groups (data not shown). the levels of circulating circulating opg was 1.91 0.21 ng/ml in the control group, 2.05 0.1 ng/ml in the apoe group, and 3.1 0.19 in the apoe+dm group, such that opg increased significantly in diabetic mice as compared to the other groups (p<0.05, apoe+dm versus cnt and versus apoe group). as for trail, we were unable to measure its circulating levels, as they were below the detection levels of the elisa we used. it has already been argued that opg, which circulates at much higher levels than its ligands (rankl and trail), may be a more stable overall measure of opg/trail activity than trail. patients with coronary artery disease have an increased opg/trail ratio, which further increases in the group of patients who develop heart failure. dyslipidemia and diabetes, we evaluated the effects of dyslipidemia, alone and in combination with diabetes, on aortic and cardiac opg and trail expression and found that while diabetes is the major determinant of opg/trail tissue changes in the vessels, dyslipidemia is it in the heart. this data is in line with previous experimental works showing that diabetes increased opg expression and the opg/trail ratio in the aorta and that the onset of diabetes was associated with an increase of circulating opg. consistent with these observations, in our study, we found that aortic and circulating opg increased significantly only in the group of mice with diabetes. taken together, these findings seem to support the hypothesis that the vessels might be the source of increased circulating levels of opg in patients with diabetes and/or cvd. it has to be noted that the increase of circulating and tissue opg could be not only a risk marker but also a risk factor for atherosclerosis and cvd development. firstly, animal models point to a role for opg in glucose metabolism regulation, as opg injections increased significantly glucose levels [12, 26], which represent one of the risk factors for cvd. this effect could be mediated by trail blockade, as trail lowers glucose levels. by offsetting trail effects, opg could also promote body weight gain and dyslipidemia, as well as atherosclerotic plaque development [18, 20]. secondly, several studies have shown that opg has proinflammatory and profibrotic effects on the vasculature. consistent with these actions, our group has shown that opg increases leukocyte adhesion to endothelial cells, that it increases tgf-beta-mediated fibrogenesis and proliferation in vascular smooth muscle cells, and that it increases atherosclerosis extension in diabetic apoe mice. by contrast, dyslipidemia alone did not affect opg/trail ratio in the vasculature. this data is consistent with a few in vitro studies showing that oxidized ldl did not change opg expression in human coronary artery smooth muscle cells and lymphocytes. nevertheless, in our study, we found that dyslipidemia significantly increased opg/trail ratio in the heart, while diabetes had no additional effect on it. it has been shown that dyslipidemia is independently associated with left ventricle (lv) hypertrophy [5, 30, 31]. this was confirmed by experimental studies on apoe mice, where dyslipidemia was associated with increased lv mass in the absence of hemodynamic stress. consistent with previous reports, here we found that dyslipidemia was associated with cardiomyocyte hypertrophy. it has been demonstrated that triacylglycerol overload and the increased availability of other lipid intermediates, such as ceramides, diacylglycerol, and oxidized phospholipids, can all activate inflammatory pathways and oxidative stress, leading to cellular apoptosis and myocardial scarring [33, 34]. it is possible that the increase in cardiac opg/trail ratio that was associated with dyslipidemia represents one of the mediators of lipid-induced cardiac remodeling. as for opg, a recent study has demonstrated that opg delivery induced lv hypertrophy, while, in vitro, cardiomyocytes transfected with aav-opg increased dramatically the expression of hypertrophy-related proteins, such as anp, -mhc, and troponin i. in the cardiac fibroblast, by contrast, we showed that trail administration to mice with diabetic cardiomyopathy had cardioprotective effects, as it reduced cardiac fibrosis and apoptosis, which are generally contributing to cardiac remodeling. in conclusion, here we found that both dyslipidemia and diabetes affect opg/trail ratio in the cardiovascular system. this could contribute to the changes in circulating opg/trail which are observed in patients with diabetes and cvd. most importantly, these changes could mediate/contribute to atherosclerosis development and cardiac remodeling.

background. dyslipidemia and diabetes are two of the most well established risk factors for the development of cardiovascular disease (cvd). both of them usually activate a complex range of pathogenic pathways leading to organ damage. here we hypothesized that dyslipidemia and diabetes could affect osteoprotegerin (opg) and tnf-related apoptosis-inducing ligand (trail) expression in the vessels and the heart. materials and methods. gene and protein expression of opg, trail, and opg/trail ratio were quantified in the aorta and the hearts of control mice, dyslipidemic mice, and diabetic mice. results. diabetes significantly increased opg and the opg/trail ratio expression in the aorta, while dyslipidemia was the major determinant of the changes observed in the heart, where it significantly increased opg and reduced trail expression, thus increasing cardiac opg/trail ratio. conclusions. this work shows that both dyslipidemia and diabetes affect opg/trail ratio in the cardiovascular system. this could contribute to the changes in circulating opg/trail which are observed in patients with diabetes and cvd. most importantly, these changes could mediate/contribute to atherosclerosis development and cardiac remodeling.

PMC5192341

pubmed-172

compounds 14, 7, 8, and 11 were synthesized following our previously reported synthetic routes. saturated derivatives 5 and 6, unique to this work, were synthesized via the hydrogenation of diastereomers 1 and 2, respectively. palmyrolide alcohol (9) and acid (10) were prepared exploiting the known acid-catalyzed ring opening of 1, followed by treating the resultant aldehyde with either nabh4 (for 9) or naclo2 (for 10). alcohol 12 could be accessed in a similar manner from 14-epi-palmyrolide (2). in order to detect an interaction of ()-palmyrolide a and its analogues with voltage-gated sodium channels (vgscs), we examined the ability of these compounds to antagonize veratridine-stimulated na influx in murine primary cerebrocortical neurons. we previously demonstrated that veratridine is a partial agonist at neurotoxin site 2 on the vgsc subunit. murine cerebrocortical neurons were loaded with the na-binding benzofuran isophthalate (sbfi), and the ability of palmyrolide analogues to block veratridine-induced elevation of neuronal [na]i was determined. sodium influx was monitored with sbfi (340/380) responses to veratridine in the absence and presence of ()-palmyrolide a and its analogues. the compounds shown are (a) ()-palmyrolide a (1); (b) 17,18-dihydropalmyrolide a (5); (c) (+) -palmyrolide a (3); (d) 17,18-dihydro-14-epi-palmyrolide a (6); (e) [c-5(r),c-7(s),c-14(r)]-palmyrolide (8); and (f) [c-5(r),c-7(s),c-14(s)]-palmyrolide (7). data shown are from a representative experiment performed in 2 or 3 replicates for each concentration. in total 47 experiments nonlinear regression analysis of concentration response data for active analogues of ()-palmyrolide a. a three-parameter logistic fit of the palmyrolide a analogue inhibition of the response to veratridine is shown for each active compound. the compounds shown are (a) ()-palmyrolide a (1); (b) 17,18-dihydropalmyrolide a (5); (c) (+) -palmyrolide a (3); (d) 17,18-dihydro-14-epi-palmyrolide a (6); (e) [c-5(r),c-7(s),c-14(r)]-palmyrolide (8); and (f) [c-5(r),c-7(s),c-14(s)]-palmyrolide (7). data points shown represent the mean sem of 25 experiments performed with 210 replicates each (a f). values represent mean sem of 25 experiments each performed with 210 replicates. naturally occurring ()-palmyrolide a is a neuroactive macrolide that was previously shown to block veratridine-induced sodium influx in neuro-2a cells (ic50=5.2 m) and to display significant inhibition of ca oscillation in murine cerebrocortical neurons, with an ic50 value of 3.70 m (2.295.98 m, 95% ci). we have confirmed and extended these original findings by demonstrating that synthetic ()-palmyrolide a (1, figures 2a and 3a) and its enantiomer (3, figures 2c and 3c) produced concentration-dependent antagonism of veratridine-induced increase in neuronal [na]i. the concentration response curves for these compounds were best fit by a three-parameter logistic equation. this analysis yielded an ic50 value (95% confidence interval) of 2.1 m (1.23.1, 95% ci), which was in good agreement with the ic50 value reported earlier for natural ()-palmyrolide a. we found that ()-palmyrolide a (1) and macrolide analogues 5 and 3 were approximately 39-fold more potent than the other analogues tested (figures 2a the observation that saturated congener 5 showed a comparable ic50 to synthetic ()-palmyrolide a suggests that the enamide double bond is not essential for activity. it is moreover noteworthy that acyclic analogues of ()-palmyrolide a with the natural absolute configuration were inactive as blockers of veratridine-stimulated na influx. these data indicate that the three-dimensional molecular shape of ()-palmyrolide a was crucial for the interaction with vgscs. in order to support these observations and to better understand how structure relates to biological function, an exhaustive nmr and computational analysis was next conducted on 1 and three diastereomers (i.e., 2, 7, and 8). saturated derivatives 5 and 6 exist as a mixture of rotational isomers and precluded precise nmr assignments from being made. chemical shift assignments of ()-palmyrolide a (1) and synthetic diastereomers 2, 7, and 8 were made using dqf-cosy, hsqc, hmbc, and h2bc spectra. the chemical shifts of these four diastereomeric compounds follow the same general trends but differ slightly, indicating that the conformations of the macrolide ring are different. for example, in each diastereomer a different methylene group exhibited degenerate chemical shifts for its two protons. stereospecific assignments were made for most of the prochiral atoms that possessed nondegenerate shifts. the noesy spectra provided 74 nonredundant distance restraints for 1, 83 for 2, 84 for 7, and 77 for 8. h coupling in the h nmr spectra and from the heteronuclear couplings measured by the hetloc experiments (see supporting information for all restraints). applying the distance and torsion restraints during simulated annealing calculations produced fairly well-defined ensembles of structures. table 2 summarizes the inputs and results of the structure calculations. to test the specificity of the restraints and their ability to discriminate between the four diastereomers, restrained simulated annealing calculations were performed for all 16 combinations of starting structure and restraint set. if the restraints correctly discriminated between conformations, then the correct combination should have the least restraint violations and the lowest energy. for all four structures we found the best restraint set for each starting structure was the correct one, namely, the restraints derived from nmr spectra of that compound (table 3). this confirms that the restraint sets were able to correctly discriminate between the diastereomers. the four ensembles generally have the same overall conformation, with the major differences being due to the orientations of the substitutents. all four diastereomers have a cisoid configuration of the n-methyl group (n-ch3) and the adjacent carbonyl despite the starting structures having a transoid configuration. examining the trajectories reveals that the configuration converts early in the simulated annealing as the restraints take effect. the driving force in these simulations appears to be noes between h-18 and the h-2 methylene group. to quantify differences between the ensembles, we calculated root-mean-square deviations (rmsd s) between the representative structures of each ensemble (table 4). the rmsd s were calculated using the differences in the positions of the carbon, nitrogen, and oxygen atoms of the macrolide ring after aligning the structures to minimize these differences. representative structures were selected as the structure having the smallest rmsd among all other structures in its ensemble. the rmsd s between all four representative structures were similar (table 4), with 2 having the lowest values overall, suggesting that this ensemble is the most central in comparison to the other diastereomers. visual inspection of the ensembles shows that the macrolide ring is relatively flat, but the orientation of the tert-butyl and methyl groups alters the global shape (figure 4). in 1 the tert-butyl and methyl groups lie close to the plane of the ring, but in 7 the tert-butyl group projects almost perpendicular to the plane of the ring, and in 8 the two methyl groups project in opposite directions above and below the ring. examining the surface electrostatic potential of the representative structures (figure 5) we find that 8 is the most similar to the active compound 1. however, the c-14 methyl group in 1 projects to the side, whereas in 8 it is situated above the macrolide ring. taken together, these differences between diastereomers may account, at least in part, for the observed differences in biological activity. in addition, due to the highly flexible nature of the macrolide, as evidenced through computational modeling, the minimized ligand ensembles reported here may not necessarily reflect the structure these molecules adopt when bound to their molecular target. further consideration and investigations into structure activity relationships are ongoing and will be reported in due course. number of diastereotopic hydrogens for which stereospecific assignments were obtained, and total number of protons with nondegenerate chemical shifts. the three numbers reported for each combination of starting structure and restraint set are number of selected structures, average amber energy, and average violation energy. the italic cells indicate the best set of restraints for each starting structure, with respect to amber energy and violation energy, and also correspond to the correct pairing. the final row is the sum of the three rmsd s above, a measure of the total difference from the other structures. the four structures in the top row are shown in a similar orientation to figure 4. in the lower row the structures have been rotated 180 about the horizontal axis to show the rear face. the electrostatic potential ranges from red (2 kcal/mole) through white (0) to blue (+ 2 kcal/mole). these findings suggest that both synthetic ()-palmyrolide a and its enantiomer function with equal potency as vgsc antagonists to block veratridine-induced sodium influx. with regard to identification of the pharmacophore of this natural product, it appears that the intact macrolide is required since acyclic versions were inactive as inhibitors of vgscs. moreover, analogues lacking the enamide double bond were of high potency in this assay, and thus this functionality appears unnecessary for blocking vgscs. finally, using detailed nmr and computational approaches with the natural product and three diastereomeric analogues, it was found that the c-5c-7 anti/c-7c14 syn arrangement of stereocenters produces a unique combination of three-dimensional shape and electrostatic potential that is responsible for the potent biological activity of the natural product. in an effort to understand the similar biological activity found for the natural stereoisomer and its enantiomer, continued investigations in this area will focus on uncovering the specific molecular target and associated binding site, which may also assist in future analogue development of novel sodium channel blocking analgesics derived from palmyrolide a. unless otherwise noted, reactions were performed in flame-dried glassware under an atmosphere of dry nitrogen. reaction solvents (ch2cl2, thf, and et2o) were purified before use in a solvent purification system under a flow of dry nitrogen. all other solvents and reagents were purchased from commercial suppliers and used as received, unless otherwise specified. thin-layer chromatography (tlc) was performed using plates precoated with silica gel 60 f-254 (250 m) and visualized by uv light, kmno4, or anisaldehyde stains, followed by heating. ir samples were prepared by evaporation from chcl3 or ch2cl2 on nacl plates and run on a perkinelmer spectrum one ft-ir spectrometer. for the synthetic studies, h and c nmr spectra were recorded at 300 and 75 mhz (oxford magnet with a varian 300 console), at 400 and 100 mhz (oxford magnet with a varian unity 400 console), and at 600 and 150 mhz (magnex magnet with a bruker avance iii 600 console), respectively, and are reported relative to residual solvent peak (h 7.26 and c 77.0 for h and c in cdcl3). high-resolution mass spectra were obtained using positive electrospray ionization on a bruker 12 t apex-qe fticr-ms with an apollo ii ion source at the cosmic laboratory facility at old dominion university, va. to a solution of (s, e)-6-iodo-2-methylhex-5-enoic acid (0.096 g, 0.37 mmol) in thf (3.7 ml) was added diisopropylethylamine (0.100 ml, 0.60 mmol) followed by the yamaguchi reagent (0.071 ml, 0.45 mmol). the mixture was allowed to stir at room temperature for 3 h before being concentrated in vacuo. the resultant mixed anhydride was dissolved in toluene (7.4 ml) and then added, via cannula, to a flask containing (5r,7r)-7-hydroxy-5,8,8-trimethylnonanamide (0.051 g, 0.23 mmol) and dmap (0.046 g, 0.37 mmol). after stirring at room temperature (rt) for 12 h, the reaction mixture was diluted with ch2cl2, washed with a saturated aqueous solution of nahco3, dried over mgso4, and concentrated. purification via flash column chromatography (1:1 hexanes/etoac) afforded 0.088 g (81%) of the coupled product as a colorless oil: []d22.5+13.3 (c 1.98, chcl3); ir (neat, thin film) 3429, 3351, 3203, 2962, 2934, 2868, 1725, 1665, 1607, 1461, 1380, 1366, 1259, 1181, 1119, 1067, 957, 935 cm; h nmr (300 mhz, cdcl3) 6.49 (dt, j=7.2, 14.4 hz, 1 h), 6.02 (d, j=14.4 hz, 1h), 5.88 (bs, 1 h), 5.46 (bs, 1 h), 4.79 (dd, j=4.5, 6.3 hz, 1 h), 2.45 (sextet, j=6.9 hz, 1 h), 2.232.15 (m, 2 h), 2.122.05 (m, 2 h), 1.861.69 (m, 2 h), 1.611.25 (m, 6 h), 1.17 (d, j=7.2 hz, 3 h), 1.110.99 (m, 1 h), 0.910.87 (overlapping doublet/singlet, 12 h); c nmr (75 mhz, cdcl3) 176.5, 175.8, 145.6, 79.0, 75.5, 39.3, 37.7, 35.7, 34.79, 34.77, 33.9, 32.3, 29.2, 26.1, 22.8, 21.1, 17.5; hresims m/z 474.1471 [m+na] (calcd for c19h34ino3na, 474.1476). to the coupled product (0.088 g, 0.19 mmol) in thf (19.0 ml) was added cui (0.005 g, 0.03 mmol) and cs2co3 (0.100 g, 0.30 mmol). the mixture was first degassed using nitrogen (10 min) before n, n-dimethylethylenediamine (0.050 ml, 0.46 mmol) was added. the rubber septum was quickly replaced with a glass stopper, and the reaction mixture heated to 60 c for 19 h. after cooling to rt, the reaction mixture was diluted with etoac, filtered through a short plug of silica, and concentrated. the crude product was purified via flash column chromatography (8:2 7:3 1:1 hexanes/etoac) to yield the n-h enamide intermediate (0.022 g), which was immediately dissolved in thf (0.7 ml) and cooled to 0 c. to this was added nah (0.014 g, 0.34 mmol, 60% in mineral oil) in a single portion. the reaction mixture was allowed to stir for 20 min before mei (0.100 ml) was added dropwise, followed by removal of the ice water bath. after being allowed to stir at rt for 20 min, the reaction mixture was again cooled to 0 c before being quenched with h2o, extracted using etoac, dried over mgso4, and concentrated. the crude product was purified via flash column chromatography (9:1 hexanes/etoac) to yield 14-epi-palmyrolide a (0.016 g, 25% over two steps) as a colorless oil: []d24.5 11.4 (c 0.58, chcl3); ir (neat, thin film) 2959, 2927, 2873, 1728, 1675, 1646, 1466, 1413, 1384, 1366, 1333, 1298, 1240, 1205, 1193, 1171,1121, 933 cm; h nmr (400 mhz, cdcl3) 6.63 (d, j=13.6 hz, 1 h), 4.92 (ddd, j=5.2, 8.8, 13.6 hz, 1 h), 4.85 (dd, j=2.0, 9.6, 1 h), 3.05 (s, 3 h), 2.602.42 (m, 3 h), 2.32 (dt, j=7.2, 13.6 hz, 1 h), 2.242.17 (m, 1 h), 2.031.95 (m, 1 h), 1.841.74 (m, 1 h), 1.681.54 (m, 2 h), 1.491.30 (m, 4 h), 1.26 (d, j=7.2 hz, 3 h), 1.030.93 (m, 1 h), 0.89 (d, j=6.4 hz, 3 h), 0.86 (s, 9 h); c nmr (100 mhz, cdcl3) 175.4, 172.8, 129.8, 110.2, 76.5, 37.2, 36.6, 35.4, 34.3, 33.6, 31.0, 29.8, 29.5, 27.3, 25.9, 24.9, 20.0, 19.2; hresims m/z 360.2504 [m+na] (calcd for c20h35no3na, 360.2509). to a solution of ()-palmyrolidea (0.008 g, 0.022 mmol) in anhydrous meoh (1 ml) was added 10% palladium on carbon (0.005 g). the atmosphere in the flask was replaced with hydrogen, and the reaction mixture was allowed to stir at rt for 18 h before being filtered through a short plug of silica. after rinsing several times with ether, the filtrate was concentrated and purified via column chromatography (8:2 hexanes/etoac) to afford compound 5 (0.006 g, 77%) as a mixture of rotational isomers (2:1 ratio): []d23+35.6 (c 0.48, chcl3); ir (neat, thin film) 2954, 2931, 2871, 1720, 1651, 1269, 1250, 1073 cm; h nmr (300 mhz, cdcl3, mixture of rotational isomers with mostly overlapping peaks, making the assignment of major and minor components difficult) (major isomer) 4.82 (d, j=10.0 hz, 1 h), 3.30 (t, j=5.0 hz, 1 h), 2.98 (s, 3 h), 2.532.65 (m, 2 h), 2.212.33 (m, 2 h), 1.211.73 (m, 14 h), 1.18 (d, j=6.9 hz, 3 h), 0.94 (d, j=5.9 hz, 3 h), 0.86 (s, 9 h), (minor isomer, partial) 4.92 (d, j=10.8 hz, 0.6 h), 2.89 (s, 1.5 h), 0.91 (d, j=6.1 hz, 1.5 h); c nmr (75 mhz, cdcl3, mixture of rotational isomers) 175.5, 174.8, 173.5, 77.8, 77.2, 48.9, 46.3, 40.4, 40.0, 38.3, 37.2, 35.2, 35.0, 33.6, 33.2, 32.98, 32.96, 31.2, 39.7, 27.9, 27.6, 27.0, 26.0, 25.9, 25.4, 23.5, 23.2, 22.2, 20.4, 20.1, 18.0, 16.5; hresims m/z 362.2660 [m+na] (calcd for c20h37no3na, 362.2665). the crude product was purified via column chromatography (8:2 hexanes/etoac) to afford compound 6 (0.006 g, 96%) as a mixture of rotational isomers (2:1 ratio): []d23+42.1 (c 0.5, chcl3); ir (neat, thin film) 2956, 2930, 2872, 1727, 1647, 1459, 1192, 1156 cm; h nmr (300 mhz, cdcl3, mixture of rotational isomers with mostly overlapping peaks, making the assignment of major and minor components difficult) (major isomer) 4.86 (d, j=10.5 hz, 1 h), 3.513.42 (m, 1 h), 3.233.14 (m, 1 hz), 2.88 (s, 3 h), 2.312.48 (m, 2 h), 2.182.31 (m, 2 h), 1.971.79 (m, 2 h), 1.231.66 (m, 15 h), 1.19 (d, j=7.0 hz, 3 h), 0.92 (d, j=5.8 hz, 3 h), 0.86 (s, 11 h), (minor isomer, partial) 4.83 (d, j=11.6 hz, 0.6 h), 2.91 (s, 1 h), 1.15 (d, j=7.2 hz, 1.5 h), 0.96 (d, j=5.7 hz, 1.5 h); c nmr (75 mhz, cdcl3, mixture of rotational isomers) 176.8, 176.6, 173.3, 173.0, 77.2, 49.1, 46.0, 40.6, 40.1, 38.0, 37.3, 35.2, 34.0, 33.9, 33.2, 33.1, 33.0, 31.3, 29.7, 28.9, 27.2, 25.9, 24.8, 23.9, 22.8, 19.9, 19.8, 19.2, 19.1; hresims m/z 362.2659 [m+na] (calcd for c20h37no3na, 362.2665). to a solution of 1 (0.007 g, 0.021 mmol) in chcl3 (2 ml) was added a 6 n aqueous hcl solution dropwise until tlc analysis showed complete consumption of the starting material. the reaction mixture was then quenched with a saturated aqueous solution of nahco3, followed by extraction using etoac. the resultant crude aldehyde was dissolved in anhydrous meoh (1 ml) and treated with nabh4 (0.015 g, 0.39 mmol). the reaction mixture was allowed to stir at rt for 1 h before being quenched with h2o, extracted using etoac, dried over mgso4, filtered, and concentrated. the crude alcohol was purified by column chromatography (100% etoac) to afford alcohol 9 (0.006 g, 73% over two steps) as a colorless oil: []d24.3+26.8 (c 0.20, chcl3); ir (neat, thin film) 3296, 2956, 1728, 1651, 1562, 1462, 1366, 1164 cm; h nmr (300 mhz, cdcl3) 6.10 (bs, 1 h), 4.76 (dd, j=2.2, 9.5 hz, 1 h), 3.63 (t, j=6.4 hz, 2 h), 2.79 (d, j=4.8 hz, 3 h), 2.392.51 (m, 1 h), 2.002.23 (m, 2 h), 1.91 (bs, 1 h), 1.631.80 (m, 2 h), 1.221.60 (m, 10 h), 1.16 (d, j=7.0 hz, 3 h), 0.87 (d, overlapped, 3 h), 0.86 (s, 9 h); c nmr (75 mhz, cdcl3) 176.8, 174.0, 78.6, 62.5, 40.2, 37.6, 36.2, 34.5, 33.3, 32.5, 28.8, 26.2, 25.9, 25.9, 23.5, 23.0, 20.8, 17.4; hresims m/z 380.2764 [m+na] (calcd for c20h39no4na, 380.2771). approximately 0.3 ml of an oxidant solution prepared via the mixing of naclo2 (0.060 g) and nahpo4 (0.040 g) in h2o (1 ml) was added to a solution of palmyrolide aldehyde (prepared as above, 0.006 g, 0.016 mmol) in tert-butanol (0.25 ml) and 2-methyl-2-butene (0.1 ml). the reaction mixture was allowed to stir for 30 min before being quenched with water, extracted with etoac, dried over mgso4, filtered, and concentrated. the crude acid was purified by column chromatography (100% etoac) to afford acid 10 (0.002 g, 25%) as a colorless oil: []d23+10.8 (c 0.10, chcl3); ir (neat, thin film) 3306, 2960, 1727, 1633, 1164 cm; h nmr (300 mhz, cdcl3) 6.04 (bs, 1 h), 4.78 (dd, j=10.2, 1.9 hz, 1 h), 2.82 (d, j=4.8 hz, 3 h), 2.48 (q, j=6.9 hz, 1 h), 2.312.41 (m, 2 h), 2.022.23 (m, 3 h), 1.601.82 (m, 4 h), 1.211.59 (m, 6 h), 1.19 (d, j=7.0 hz, 3 h), 0.921.05 (m, 1 h), 0.88 (d, overlapped, 3 h), 0.87 (s, 9 h); c nmr (75 mhz, cdcl3) 176.4, 78.5, 40.1, 37.6, 36.2, 34.6, 34.4, 33.0, 29.7, 28.7, 26.3, 26.0, 23.0, 22.7, 20.7, 17.2; hresims m/z 394.2558 [m+na] (calcd for c20h37no5na, 394.2563). the crude product was purified via column chromatography (100% etoac) to afford compound 12 (0.004 g, 94%): []d25.5+30.8 (c 0.24, chcl3); ir (neat, thin film) 3304, 2950, 1729, 1649, 1560, 1462, 1366, 1163, 1074 cm; h nmr (300 mhz, cdcl3) 6.25 (bs, 1 h), 4.76 (dd, j=9.9, 1.6 hz, 1 h), 3.553.70 (m, 2 h), 2.77 (d, j=4.8 hz, 3h), 2.372.50 (m, 1 h), 2.27 (bs, 1 h), 2.002.20 (m, 2 h), 1.631.83 (m, 2 h), 1.211.60 (m, 10 h), 1.16 (d, j= 7.0 hz, 3 h), 0.921.04 (m, 1 h), 0.86 (d, overlapped, 3 h), 0.85 (s, 9h); c nmr (75 mhz, cdcl3) 177.0, 174.1, 78.4, 62.2, 40.0, 37.5, 36.2, 34.6, 34.5, 33.1, 32.4, 28.8, 26.1, 25.9, 23.6, 23.1, 20.7, 17.7; hresims m/z 380.2764 [m+na] (calcd for c20h39no4na, 380.2771). primary cultures of cerebrocortical neurons were obtained from embryonic day 17 swiss-webster mice as described elsewhere. briefly, pregnant mice were euthanized by co2 asphyxiation, and embryos were removed under sterile conditions. cerebral cortices were collected, stripped of meninges, minced by trituration with a pasteur pipet, and treated with trypsin for 25 min at 37 c. the cells were then dissociated by two successive trituration and sedimentation steps in soybean trypsin inhibitor and dnase-containing isolation buffer, centrifuged, and resuspended in eagle s minimal essential medium with earle s salt (mem) supplemented with 1 mm l-glutamine, 10% fetal bovine serum, 10% horse serum, 100 iu/ml penicillin, and 0.10 mg/ml streptomycin (ph 7.4). cells were plated onto poly-l-lysine-coated 96-well (9 mm), clear-bottomed, black-well culture plates (midsci) at a density of 1.5 10 cells/well. cells were then incubated at 37 c in a 5% co2 and 95% humidity atmosphere. the culture media was changed every other day, starting from day 5 in vitro using a serum-free growth medium containing neurobasal medium supplemented with b-27, 100 iu/ml penicillin, 0.10 mg/ml streptomycin, and 0.2 mm l-glutamine. all animal use protocols were approved by the institutional animal care and use committee (iacuc) of creighton university. [na]i measurement and full in situ calibration of sodium-binding benzofuran isophthalate fluorescence ratio were performed as described previously. cells were grown in 96-well plates and washed four times with locke s buffer (8.6 mm hepes, 5.6 mm kcl, 154 mm nacl, 5.6 mm glucose, 1.0 mm mgcl2, 2.3 mm cacl2, 0.1 mm glycine, ph 7.4) using an automated microplate washer (biotek instruments). after measuring the background fluorescence of each well, cells were incubated for 1 h at 37 c with dye-loading buffer (100 l/well) containing 10 m sbfi-am (invitrogen) and 0.02% pluronic f-127 (invitrogen). cells were washed five times with locke s buffer, leaving a final volume of 100 l in each well. the plate was then transferred back to the incubator for 15 min to allow the cells to equilibrate after washing and placed in a flexstation ii (molecular devices) chamber to detect na-bound sbfi emission at 505 nm (cells were excited at 340 and 380 nm). fluorescence readings were taken once every 5 s for 60 s to establish the baseline, and then 50 l of different concentrations of ()-palmyrolide a and/or veratridine was added to each well from the compound plate at a rate of 26 l/s, yielding a final volume of 200 l/well. after correcting for background fluorescence, sbfi fluorescence ratios (340/380) and concentration each palmyrolide a analogue was dissolved in dmso at a stock concentration of 50 mm and stored at 20 c until used. on the day of an experiment, this dilution in locke s buffer resulted in palmyrolide a analogue solutions that were 4 times the desired final concentration. ()-palmyrolide a (1) and analogues (2, 7, and 8) were dissolved in cdcl3 at a concentration of 2.5 mg in 50 l and transferred to a 1.7 mm nmr tube. the noesy mixing time was 500 ms, the hmbc delay was set to 6.25 ms (8 hz), and the hetloc used a dispi-2 spinlock of 60 ms duration. chemical shift assignments were based on analysis of the dqf-cosy, hsqc, and hmbc 2d experiments using ucsf sparky. topspin (bruker biospin) was used to analyze coupling constants in the h nmr and hetloc spectra. noesy peak heights were converted to upper distance restraints of 3, 4, 5, or 6 using in-house perl scripts. where restraints involved a group of atoms, pseudoatom corrections were applied by the amber restraint generation tools. force field parameters were estimated using the gaff force field and the antechamber program in the amber 14 package. molecular dynamics simulations were nonperiodic, vacuum simulations with a distance-dependent dielectric term. using sander in the amber 14 package each starting structure was energy minimized, then subjected to 20 ps of simulated annealing with the nmr-derived restraints in which the temperature was raised from 10 k to 600 k then cooled to near 0 k. the simulated annealing was run 20 times for each structure with a different random number seed each time. each collection of 20 structures was sorted by restraint violation energy, and outliers were discarded. to align structures, the selected ensemble was superimposed on c17, o12, c1318, and n19 using cpptraj. to stereospecifically assign pairs of diastereotopic hydrogens, pairs of noes that involved the diastereotopic atoms and had differential intensities were identified, then compared with the distances between these atoms in the ensemble of selected structures. if the ensemble mean of one distance was more than one standard deviation from the alternative, then the diastereotopic hydrogens were stereospecifically assigned.

a small library of synthetic ()-palmyrolide a diastereomers, analogues, and acyclic precursors have been examined with respect to their interaction with voltage-gated sodium channels (vgscs). toward this goal, the ability of ()-palmyrolide a and analogues to antagonize veratridine-stimulated na+ influx in primary cultures of mouse cerebrocortical neurons was assessed. we found that synthetic ()-palmyrolide a and its enantiomer functioned as vgsc antagonists to block veratridine-induced sodium influx. a detailed nmr and computational analysis of four diastereomers revealed that none had the same combination of shape and electrostatic potential as exhibited by natural ()-palmyrolide a. these data indicate that the relative configuration about the tert-butyl and methyl substituents appears to be a prerequisite for biological function. additional testing revealed that the enamide double bond was not necessary for blocking veratridine-induced sodium influx, whereas the acyclic analogues and other macrolide diastereomers tested were inactive as inhibitors of vgscs, suggesting that the intact macrolide was required.

PMC4251536

pubmed-173

the online version of this article (doi:10.1007/s00414-009-0352-9) contains supplementary material, which is available to authorized users. microbes can negatively interfere with the postmortem assessment of alcohol abuse and in this way pose problems for forensic investigators. however, microbial forensics is often chiefly associated with the detection of highly pathogenic microbes to which humans are deliberately exposed in cases of biological terrorism [2, 3]. however, human fingertip microflora left behind on touched objects at crime scenes may potentially contain forensically relevant information that may be useful for human host inferences accessible via microbial dna fingerprinting of physical fingerprints. for example, if endogenous microbial skin species/strains with a geographically restricted distribution could be retrieved from touched objects via microbial dna analysis, the geographic origin of the human host individual could be determined indirectly. information about the geographic region of origin can be relevant in suspect-less forensic cases where the evidence dna sample does not match either a suspect s dna profile or any in a criminal dna database. in such cases, geographic information derived from crime scene samples is expected to reduce the potential pool of suspects by allowing police investigations to concentrate on specific groups of people, i.e., those from a restricted geographic region. numerous human genetic markers have been suggested for inferring human genetic ancestry mostly to the continental level [47], and a recent study indicated that inferring the subregion of origin of an unknown european may be feasible from autosomal genetic data. however, direct ancestry inference based on human genetic markers is currently far from perfect, initiating the question whether microbial dna may be used to supplement human dna markers in reliable ancestry reconstruction of unknown persons. recently, it has been shown that the gastric pathogenic bacteria helicobacter pylori has intimately coevolved with its human host [9, 10]. although this example may be of limited direct relevance for forensics, because samples containing h. pylori are usually not found at crime scenes (with the exception of bodies in cases of missing persons), it shows that in principle human geographic signatures are inferable from microbial genomes. the human skin is a complex microbial ecosystem consisting of multiple niches, which can differ drastically from each other. interactions between skin microbes and the human host, as well as between the microbial occupants, are still poorly understood. the current knowledge on skin microbiota primarily derives from cultivation-based studies [12, 13], although molecular fingerprinting techniques have been employed more recently [14, 15]. if a comparable relationship exists between humans and their skin microbiota, as has been observed for h. pylori, new methods for human geographic origin determination could be developed based on dna analysis of fingertip microflora, with interesting new applications to molecular analyses of physical fingerprints left at crime scenes. volunteers and microbiological procedures five dutch european subjects from rotterdam and three volunteers from dhaka, bangladesh, placed their right index finger on a colombia iii blood agar plate (biomerieux, marcy-letoile, france). fingerprint sampling for dutch volunteers was performed in rotterdam whereas that of bangladeshi volunteers was performed in dhaka. after washing this finger with hospital soap and air drying, another fingerprint, from the same finger, was placed next to the first. whereas the first fingerprint was expected to provide a mixture of transient and resident microbiota, the second one was assumed to provide resident microbiota only as soap removes the upper dead-skin layers including their transient microflora. after overnight incubation at 37c, colonies with different morphologies were isolated, with 20 per fingerprint (two each) from the five dutch individuals (n=200 strains). three weeks later, this procedure was repeated for assessment of bacterial persistence in the dutch volunteers. agar plates from bangladeshi volunteers were shipped by courier to rotterdam after overnight incubation at 37c for further analyses. given the diversity in genotypes encountered in the time-wise resampling experiments using dutch volunteers (see below), this procedure was not repeated for the volunteers from bangladesh. gram staining and the determination of catalase activity were applied for the identification of staphylococci using commercially available test kits (biomrieux, marcy-letoile, france). staphylococcus epidermidis sensu stricto was identified among the isolates by a species-specific polymerase chain reaction assay as described elsewhere. a coagulase test with slidex staph plus (biomrieux, marcy-letoile, france) was performed to detect staphylococcus aureus isolates. were classified with the i d 32 staph api system (biomrieux, marcy-letoile, france). genotyping bacterial isolates in order to generate dna fingerprints for the most relevant bacterial isolates, all staphylococcal isolates were subjected to pulsed-field gel electrophoresis (pfge). pfge can be used to electrophoretically separate dna restriction fragments ranging in length between 50 and 1,000 kb. after lysostaphin and proteinase treatment and smai macrorestriction, pfge was performed in a 1% incert agarose (fmc) gel in 0.5 tbe at 14c, using a constant electric field of 6 v cm with pulse ramping from 0.1 to 30 s at a 60/60 angle for 18 h. pfge patterns were analyzed for levels of similarity with bionumerics 4.5 (applied-maths, sint martens latem, belgium). developing forensic dna markers for human host inferences from physical fingerprints relies on the examination of the transient exogenous microflora left behind together with the physical fingerprint. however, any human host inference from fingertip microflora using physical fingerprints would require that the transient microflora is representative of the resident endogenous microflora of the same individual and is not simply reflecting microbial species/strains picked up from the environment. to test this prerequisite, we investigated and compared by means of dna fingerprinting techniques the transient superficial skin microbiota and the resident endogenous microflora of human fingertips within several individuals. in addition, we collected data at two time points to investigate time-wise microflora persistency within individuals. to this end, we used samples from five dutch volunteers and gram staining as well as catalase activity testing revealed that all bacterial skin isolates that were selected were gram-positive cocci. most isolates were staphylococcus spp., a small number of colonies represented micrococci (~5% of total isolates), and the vast majority (97%) of staphylococci were coagulase negative. healthy skin is known to harbor gram-positive pleomorphic bacilli, including corynebacterium, brevibacteria, and propionibacteria sp., but these were not detected here. pfge is the most discriminatory typing method that is currently available for typing of staphylococci. transient microflora (tm) was collected from physical fingerprints before washing with soap and endogenous microflora (rm) after soap washing (see materials and methods the tm showed higher numbers of pfge types than those seen in the rm in three of the five dutch subjects (table 1). this can be explained by nonendogenous species picked up from the environment and being transferred. significant variability between the subjects was seen for both the tm and rm, as has been previously reported for other skin areas [10, 13]. notably, the rm types encountered after washing were very similar intraindividually but very different interindividually. this suggests that certain types of bacteria are able to efficiently and persistently colonize the skin of a given individual. within the rm, all dutch subjects had one or two dominant types, mostly staphylococcus warneri species. these types were also present within the tm of three of the five subjects, while s. epidermidis was present at various time points in all of the subjects tm. only one subject (subject 1) showed the major rm type as the major tm type. in several subjects, the dominant rm type did not appear at all in the tm, although there was considerable overlap in nondominant species between the tm and rm in many subjects. in general, pfge types within the rm and within the tm for the same subject appeared consistent over time. although the degree of variability changed in the 3-week period for every subject, in some subjects, it changed more drastically than in others. at time point 1, overlapping pfge types were seen in four of the five subjects in the tm and rm. however, by time point 2, only one subject (subject 4) showed any overlap. in one subject (subject 4), the major rm type did not occur in the tm of the same sampling time point 2 but was present in considerable frequency in the tm of the earlier time point 1. thus, although we see some resemblance between rm and tm as well as some time-wise consistency, the pattern detected is far from perfect. by viewing our results only qualitatively (ignoring type frequencies), rm signals were detectable from the tm analyses in only 50% of the dutch experiments (combining individuals and time points), which appears discouraging as basis for developing molecular markers for forensic applications to infer individual host information. table 1staphylococcus species and pfge types from dutch fingerprints before washing with soap representing elements of the transient (tm) microflora and after washing representing resident fingertip microflora (rm) staphylococcus species and pfge types from dutch fingerprints before washing with soap representing elements of the transient (tm) microflora and after washing representing resident fingertip microflora (rm) we chose geographic inference as a test example for the type of human host information that would be interesting to retrieve from physical fingerprints by means of microbial dna analysis for forensic applications. a prerequisite for developing microbial skin markers for inferring human geographic origins would be that the endogenous fingertip microflora of humans from different parts of the world shows differences in their genetic diversity and that retrievable microbial genotypes cluster according to geographic origin of the host individuals. to test this, we obtained fingerprint microflora from native inhabitants of bangladesh collected in dhaka, bangladesh, and compared their microbiological profiles with those of the dutch volunteers. fingertip microflora of three bangladeshi volunteers were isolated and processed in the same manner as for the dutch volunteers, although only at one time point (three individuals, two fingerprints each and 20 bacterial isolates per fingerprint, hence 3 2 20=120 strains; table 2). correspondence between rm and tm was observed in two of the three subjects for one pfge type, although the persistent pfge type found differed between the subjects. notably, subject 3 from bangladesh showed an unexpectedly higher variety of staphylococci in the rm compared to tm. comparing pfge types between dutch and bangladeshi subjects revealed some differences, e.g., bangladeshi skin microbiota contained less s. warneri and much less s. epidermidis types compared with the dutch ones. were found among the tm in bangladeshi (45%) than among the dutch (7%). furthermore, none of the pfge types from the bangladesh fingerprints were seen in the dutch collection, indicating extensive geographic heterogeneity within the staphylococcus species. however, when each pfge type obtained during this study was subjected to dice-based cluster analysis for visualizing geographic structure in the skin staphylococci (see supplementary material fig. 1), the bangladeshi pfge patterns efficiently mixed with the dutch ones. hence, information about geographic origin of the dutch and bangladeshi donors was not obvious among genotype data of the staphylococci inhabiting the human fingertip skin. although in general a limited number of five and three persons tested would not allow for cluster analysis, the full absence of clusters as identified in the present study already shows that individual geographic inferences for forensics purposes is not possible using the approach employed here. table 2staphylococcus species and pfge types from bangladeshi fingerprints before washing with soap representing elements of the transient (tm) microflora and after washing representing resident fingertip microflora (rm) staphylococcus species and pfge types from bangladeshi fingerprints before washing with soap representing elements of the transient (tm) microflora and after washing representing resident fingertip microflora (rm) to conclude, we see only limited geographic differentiation between microbial dna fingerprints from dutch europeans and bangladeshi south asians, indicating that geographic inferences of human hosts from fingertip microbial dna analysis is not feasible. furthermore, our results from dna profiling of transient and resident fingertip microflora show that human fingertip microflora is too dynamic and thus does not fulfill the criteria required for forensic marker developments to infer any human host information from physical fingerprints.

human fingertip microflora is transferred to touched objects and may provide forensically relevant information on individual hosts, such as on geographic origins, if endogenous microbial skin species/strains would be retrievable from physical fingerprints and would carry geographically restricted dna diversity. we tested the suitability of physical fingerprints for revealing human host information, with geographic inference as example, via microbial dna fingerprinting. we showed that the transient exogenous fingertip microflora is frequently different from the resident endogenous bacteria of the same individuals. in only 54% of the experiments, the dna analysis of the transient fingertip microflora allowed the detection of defined, but often not the major, elements of the resident microflora. although we found microbial persistency in certain individuals, time-wise variation of transient and resident microflora within individuals was also observed when resampling fingerprints after 3 weeks. while microbial species differed considerably in their frequency spectrum between fingerprint samples from volunteers in europe and southern asia, there was no clear geographic distinction between staphylococcus strains in a cluster analysis, although bacterial genotypes did not overlap between both continental regions. our results, though limited in quantity, clearly demonstrate that the dynamic fingerprint microflora challenges human host inferences for forensic purposes including geographic ones. overall, our results suggest that human fingerprint microflora is too dynamic to allow for forensic marker developments for retrieving human information.electronic supplementary materialthe online version of this article (doi:10.1007/s00414-009-0352-9) contains supplementary material, which is available to authorized users.

PMC2955242

pubmed-174

helicobacter pylori is a gram-negative, spiral and microaerophilic microorganism that was first isolated from the stomach of patients afflicted with peptic ulcer (1, 2). this bacterium can cause gastritis and peptic ulcer in the short-term and carcinoma of the stomach in the long-term (3, 4). polymerase chain reaction (pcr) is the desired method of proving the presence of h. pylori in tissues due to its high sensitivity and specificity (5, 6). it was previously thought that the human stomach was the sole source of h. pylori; however, it was later found that they are present in human dental plaques, mouth, saliva, tonsils, adenoids, middle ear, nasal polyps and sinus mucosa (7). it is believed that gastroesophageal reflux is involved in many cases of upper respiratory tract disorders including pharyngoesophageal disorders, croup, oropharyngeal dysphagia, rhinosinusitis, otalgia and different forms of otitis media (8, 9). samples from tonsil and adenoid tissues showed that they might be sources of h. pylori (10, 11). researchers have proved that there is a connection between chronic tubotympanal disorders and gastroesophageal reflux, but the mechanism is unknown (12, 13). it is suspected that gastroesophageal reflux is involved in the pathogenesis of chronic otitis media. evidence showed that stomach pepsin is present in the middle ear cavity of patients afflicted with chronic otitis media, as compared to the control group, supports this suspicion (14, 15). gastroesophageal reflux results in the appearance of otolaryngology symptoms in children and anti-reflux treatments reduce frequency of infection in the middle ear (16). many studies have been conducted on otitis media with effusion and on its correlation with h. pylori (15, 17-19). however, the correlation between chronic suppurative otitis media and its various aspects, such as tympanosclerosis in which deposition of acellular hyaline and calcified deposits accumulate in the lamina propria of the middle ear has not been sufficiently studied (20, 21). so, we decided to use the pcr technique to determine the role of h. pylori in tympanosclerosis. this case-control and cross-sectional study was conducted on patients who were diagnosed with chronic infection of the middle ear and were candidates to undergo surgery in the imam khomeini or apadana hospitals of ahvaz in 2013. patients who had operations for chronic infections of the middle ear and those who had ventilation tube inserted into their ears in the past were excluded from the study. the middle ear mucosa of the patients was examined during the surgical operations and based on this clinical evaluation, they were placed in one of the four types of normal, edema and hypertrophy, hyalinized and sclerotic and polyploid with or without cholesteatoma and this classification was recorded in the questionnaire. during the operations, samples were taken of the middle ear mucosa of the patients. in patients with sclerotic plaques, the samples were kept under sterilized conditions at 20 degrees centigrade, and were eventually sent to the laboratory of jundishapur university of medical sciences, ahvaz, iran. in the laboratory, dna was extracted using the roche high-pure template pcr kit (roche, germany) according to the manufacture protocol. primers used to amplify the typing region were va1-f (a3436) 5-atggaaatacaacaaacacac-313 and va1-r (c1226) 5-ctgcttgaatgcgccaaac-313 for amplified 286-bp band and vag-f 5-caatctgtcaatcaagcgag-14 and vag-r 5-ctagcgtcaaaataattccaagg-314 for amplified 630-bp. the extracted dna was amplified using 5 l dna template, 0.3 l taq polymerase, 1 l dntp, 0.25 l each forward and reveres primers, 2 l mgcl2 and 5 l 10x pcr buffer, all mixed in a micro-tube and the ultimate volume reach to 50 l using nuclease-free distilled water. after activation of reaction in 95c for 5 minutes, amplification performed for 35 cycles. cycle program for first pair primers was as: 94c for 60, 52c for 60 and 72c for 90 seconds. a final extension 72c for 5 minutes was the ultimate step of cycles. for the second pair primers, cycle program was as: 94c for 30 seconds, 56c for 60 seconds and 72c for 90 seconds. the chi-squared and the independent-samples t-test were also used to analyze the data. the selected level of significance was p<0.05. fifty-six patients participated in this study, of whom 29 (51.8%) were men and 27 (48.2%) women. the biopsy samples of the middle ear mucosa of 31 (55.4%) patients were h. pylori-positive. of the 29 male patients, 15 cases were (51.7%) h. pylori-positive, while of the 27 female patients 16 cases (59.3%) were h. pylori-positive. this difference was not significant in pearson s chi-squared test (p=0.571). the average age of h. pylori-positive patients was 30.3 years old (standard deviation=7.6), while the average age of h. pylori-negative patients was 33.4 years (standard deviation=9.7). this difference was not significant in the independent samples t-test (p=0.571). therefore, there was no significant correlation between the presence of h. pylori and the age and gender of the patients. the most common pathological type of middle ear mucosa was hyalinized and sclerotic type in 19 cases (33.9%). the polyploid type with or without cholesteatoma type was reported in 15 (26%) cases and the edematous and proliferative type with 12 (21%) cases. examination of the middle ear mucosa of the 19 patients of the hyalinized and sclerotic type revealed that 16 (84.2%) were h. pylori-positive (figure 1) and 3 (15.8%) were h. pylori-negative; while of the 37 patients whose middle ear mucosa was not sclerotic,15 cases (40.7%) were h. pylori-positive (figure 2) 22 (59.3%) h. pylori-negative. this was a significant difference (p=0.002), which means there was a correlation between the presence of h. pylori and tympanosclerosis of the middle ear (table 1). as for other types of middle ear mucosa (normal, polypoid with or without cholesteatoma and edema with hypertrophy), there was no significant correlation between them and the presence of h. pylori. l=ladder (100 bp), p=positive control, lanes are numbered in the following order from 1 to 2: case h. pylori-positive (286 bp), case h. pylori-negative. l=ladder (100 bp), p=positive control, lanes are numbered in the following order from 1 to 3: case h. pylori-positive (630 bp), negative control, case h. pylori-negative. results showed that 26 (46.4%) of 56 patients had dry ears for at least three months before surgery. of the 30 patients who did not have dry ears, 13 cases (34.3%) were h. pylori-negative and 17(56.7%) were h. pylori-positive. this was not a significant difference in pearson s chi-squared test (p=0.832). 40 (45.2%) of the 31 patients with perforations of more than 50% were h. pylori-negative and 17 (54.8%) were h. pylori-positive. h. pylori was not significant in pearson s chi-squared test (p=0.931). therefore, there was no correlation between the presence of h. pylori and the size of the perforation or dryness of the middle ear. zollner (22) was the first to use the term tympanosclerosis in 1956 to describe a common complication resulting from middle ear infections. tympanosclerosis is an abnormal condition in the middle ear cavity in which lime particles accumulate in the tympanic membrane, tympanic cavity and ossicular chain (23, 24). it is a long-term complication of infections of the middle ear (4, 25-27). in available reports, the prevalence of tympanosclerosis varies from 14.1% in bhaya s report (28) to 35.64% in wu s study(21). despite the extensive available information on the clinical, histologic and pathologic aspects of tympanosclerosis, tympanosclerosis is observed as irreversible changes in the temporal bone (13, 24). it is thought that gastroesophageal reflux may be involved in the pathogenesis of otitis media and evidence indicating the presence of stomach pepsin in the middle ear cavity of patients with otitis media, as compared to the control group, confirms it (14, 29). gastroesophageal reflux results in the appearance of otolaryngology symptoms in children and anti-reflux treatments make frequent middle ear infections go away (16). many studies have been conducted on otitis media with effusion and on its correlation with h. pylori (15, 17, 18); however, the correlation between chronic suppurative otitis media and its various aspects such as tympanosclerosis has not been sufficiently investigated. in tympanosclerosis, the process of deposition of acellular hyaline and calcium deposits in the lamina propria of the middle ear takes place, following which it is even possible for fixation of ossicles to occur leading to conductive hearing loss (20). the exact etiology and pathogenesis of tympanosclerosis are not completely known (9). in some studies, tympanosclerosis has been observed also as a complication of frequent otitis (21, 29). in a recent research, it has been suggested that h. pylori is the pathologic factor in tympanosclerosis (21). in our research, designed to study the correlation between h. pylori and tympanosclerosis, we found that h. pylori has a prevalence of 84.2% among patients with suppurative infection of the middle ear, while its prevalence was 40.5% in patients without tympanosclerosis. this difference (p=0.002) indicates that h. pylori plays a role in the pathogenesis of tympanosclerosis. (26) showed that there are similar risk factors, such as increased homocysteine levels, between coronary artery atherosclerosis and tympanosclerosis. although tympanosclerosis and atherosclerosis are two separate pathologies, they have similar histological and pathophysiologic elements and the same genetic reason has been proposed for both (2). (30) studied evidence concerning the development of inflammation caused by h. pylori in 38 patients with atherosclerotic plaques who had undergone endarterectomy and found that in most of these patients h. pylori was correlated to the inflammation, which indicated the correlation between h. pylori and atherosclerosis. (31) show that contact with h. pylori increases the risk of cardiovascular diseases even in the absence of other risk factors. our findings suggest that h. pylori probably plays a role in the development of tympanosclerosis. (26) carried out a case-control study and found that 100% of the patients with tympanosclerosis were h. pylori-positive while only 26.9% of the patients not suffering from tympanosclerosis were h. pylori-positive (p<0.01) (21). results of our study, while confirming those of iriz et al. (26) used the campylobacter-like organism (clo) test in h. pylori identification, while we employed the pcr method. since the pcr method is more accurate than the clo test, our results are probably more acceptable than those iriz et al. (26), both show that there is a correlation between the presence of h. pylori and tympanosclerosis, and suggest the presence of h. pylori as the etiology for this disease; however, neither study can consider h. pylori as the definite pathogenesis for tympanosclerosis. to prove this correlation, a study should be designed to evaluate the correlation between tympanosclerosis and h. pylori by considering those pathological changes found in the examination of the middle ear mucosa that attribute the presence of inflammatory symptoms to the activity of h. pylori in the middle ear. this study offers a better understanding of the etiological and pathogenic aspects of h. pylori in tympanosclerosis that can be used in designing new treatment methods for this disease.

background: tympanosclerosis is a condition caused by calcification of tissues in the middle ear mucosa that sometimes results hearing loss. helicobacter pylori is one of the pathological and etiologic factors in the development of tympanosclerosis. objectives:the purpose of this study was to show the role of h. pylori in the different aspects of chronic suppurative otitis media using the polymerase chain reaction (pcr) technique. patients and methods: this case-control and cross-sectional study was performed on all patients with chronic otitis media, candidates for surgical operations, in 2013. they were allocated into the case group with tympanosclerosis and the control group without tympanosclerosis. during the surgical operation, biopsy was done from middle ear and the samples were studied to see if they contained h. pylori using the pcr method. results:from a total of 19 patients with tympanosclerosis, 16 cases (84.2%) were h. pylori positive, while in the control group 15 (45.4%) cases out of the 37 cases were h. pylori positive, which showed a significant difference (p=0.002). age and gender of the patients, ear dryness and perforation size were not correlated with the presence or absence of h. pylori. conclusions:there is a significant correlation between tympanosclerosis and h. pylori (p=0.002). this correlation can single out h. pylori as a pathological factor in the development of tympanosclerosis; however, further studies are needed to prove this correlation.

PMC4640059

pubmed-175

trigeminal neuralgia (tn) is a disorder of cranial nerve (cn) v that results in severe episodes of shock-like or lancinating pain in one or more of its three divisions (v1v3). idiopathic tn and cases due to vascular compression of cn v are categorized as classical tn. patients diagnosed with symptomatic tn experience trigeminal-related facial pain secondary to a brain tumor, skull deformity, or multiple sclerosis (ms). evidence suggests that the majority of cases of tn are the consequence of focal compression of the entry zone of the root of the trigeminal nerve, while only 2% of cases are observed in patients diagnosed with ms. other than excruciating facial pain, there are no other direct medical symptoms associated with tn, and the condition does not decrease life expectancy. however, many patients with tn struggle with accomplishing tasks that affect quality of life, which is how this disorder elicits a negative impact on the social and mental wellness of the patients who suffer from this illness. following the diagnosis of tn however, many patients experience only limited relief from medication or are unable to endure the side effects of the prescribed drugs, and in turn seek neurosurgical intervention. currently, surgical approaches include microvascular decompression (mvd) or a number of techniques that target the trigeminal ganglion or root which involve the destruction or blockage of portions of those anatomical structures [1, 2]. although the neurosurgical modalities are preferred in many clinical situations and have proven to be effective in achieving initial pain control, they are known to come with a variety of complications, and facial pain recurrence is likely. stereotactic radiosurgery (srs) has proven to be an effective management approach for patients with medically and surgically refractory tn as a primary and repeat treatment modality. the use of radiosurgery in the treatment of tn dates back to sweden in the 1950 's, where professor lars leksell performed radiogangliotomies directed at the gasserian ganglion. since the time of leksell, advancements in radiosurgery and imaging technologies has led to the increasing popularity of srs as a treatment option for patients with tn. one form of srs that can be delivered to a patient is through a machine called the gamma knife (gk). the gk device is a cobalt-60-based machine, with 201 separate 4 to 18 mm collimator openings, that emits multiple gamma rays that converge on a target specified by computer planning. for specific medication intolerable patient subsets, gamma knife radiosurgery (gkrs) can be used as an initial management approach, or as a secondary management approach following radiosurgery or one or more of the various surgical modalities. as the evidence examining the role of gkrs in the management of patients with tn is increasing, it is of utmost importance for physicians to understand the criteria associated with gkrs, so that the optimal course of treatment for their patients can be prescribed. an evidence-based review on the evaluation and treatment of tn by gronseth et al. found level c evidence indicating that gasserian ganglion percutaneous techniques, gkrs, and mvd may be considered for facial pain management for medically refractory patients. however, questions remain regarding optimal treatment modalities in specific patient subsets. for this reason, the goal of this paper is to provide a modern review of the literature thoroughly analyzing the efficacy of gkrs in the treatment of patients with tn, as well as evaluating the treatment planning and methods associated with this evolving modality. to identify contemporary studies assessing the clinical outcomes of patients treated with gkrs for tn, a pubmed search from 2006 to april 2011 was performed. keywords for search included gamma knife or gamma knife radiosurgery or stereotactic radiosurgery trigeminal neuralgia or tic douloureux. studies analyzed in this review included retrospective cohort studies and prospective cohort studies with 5 evaluated patients. studies published only in abstract form and studies published in a language other than english were excluded from our analysis. due to our broad search strategy and the vast amount of world literature, we reviewed a total of 19 studies [4, 5, 925] analyzing the efficacy of patients with tn who were treated once with gkrs (table 1). thirteen of the 19 evaluated studies [4, 5, 919] utilized the barrow neurological institute (bni) pain intensity scale as a measurement of response to treatment (see section 3). of these 13 studies, only two [9, 13] analyzed patients treated with gkrs as an initial management approach. with a median followup of 31 months, sheehan et al. classified 87% of patients in bni class i-iiib, while chen et al. classified 91% of patients in bni class i-iiib (median followup=15 months). chen et al. also reported that five of the 44 patients (11%) treated with gkrs developed hypoesthesia following the procedure. the other 11 bni pain intensity scale studies we reviewed included patients where previous surgical procedures were performed in a fraction of patients [4, 5, 1012, 1519] or all patients. of the 10 studies where previous surgical procedures were performed in a fraction of patients, nine reported outcomes in terms of categorizing patients in bni class i-iiib [4, 5, 1012, 1518]. classified 58.6% of patients in bni class i-iiib (median followup=48 months), kondziolka et al. classified 71% of patients in bni class i-iiib at three years, dhople et al. classified 72% of patients in bni class i-iiib (median followup=29 months), han et al. classified 76.7% of patients in bni class i-iiib (mean followup=58 months), dhople et al. classified 81% of patients in bni class i-iiib (median followup=5.6 years), matsuda et al. classified 82% of patients in bni class i-iiib (median followup=37 months), little et al. classified 83% of patients in bni class i-iiib (median followup=6.3 years), dellaretti et al. classified 89.5% of patients in bni class i-iiib (mean followup=20.3 months), and park and hwang classified 94% of patients in bni class i-iiib with a minimum followup of 3 years. reported clinical outcomes with respect to bni class i, which contained only 5.7% of patients. the study that evaluated gkrs where previous surgical procedures were performed in 100% of patients classified 85% of patients in bni class i-iiib, with a median followup of 36 months. we also reviewed two studies that used the excellent-good-fair-poor (egfp) categorical scale to assess patient outcomes [20, 21] (see section 3). treated 30 patients with tn with gkrs at iran gamma knife center between 2006 and 2007. the authors reported that 40% of patients had an excellent outcome, 10% of patients had a good outcome, 33% of patients had a fair outcome, and 17% of patients had a poor outcome following the procedure. after surgery, 15 patients (54%) reported an excellent outcome, one patient (4%) reported a good outcome, two patients (7%) reported a fair outcome, and 10 patients (36%) reported a poor outcome. the complications from mvd included facial numbness in six patients (21%), dysesthesias in three patients (11%), and delayed facial palsy in one patient (4%). four of the 19 studies we evaluated [2225] used other methodologies in determining the effectiveness of gkrs. in a prospective controlled trial, rgis et al. analyzed 100 patients with tn treated with gkrs and reported that 83 patients (83%) were completely pain free, 58 of which (58%) discontinued all medication following the procedure (minimum followup=12 months). ten patients (10%) experienced radiation-induced complications, which included facial paresthesia or hypesthesia. performed a study investigating the short-term efficacy of gkrs in 67 patients with medically refractory tn. overall, 77.6% of patients witnessed some degree of pain relief, with 32.6% of those patients becoming completely pain free. of the 67 patients, 10 (14.9%) experienced complications from the procedure, which included hypoesthesia and paresthesia. sixty eight patients (42.5%) underwent prior invasive treatments. in clinical analysis, it was found that 61% of patients were pain free without medication, 29% of patients were pain free with medication, and 10% of patients did not respond to gkrs. thirty eight patients (49.4%) exhibited some level of pain improvement following gk treatment, with 23 of those patients (29.9%) reporting a pain-free outcome. twelve patients (15.6%) experienced complications, which were reported to be mild facial sensory changes and mild facial nerve dysfunction. as gkrs has proven to be an effective initial treatment for tn, numerous reports have been published analyzing patients treated on multiple occasions (> 1) with gkrs. we reviewed six studies evaluating patients treated more than once with gkrs [2732] (table 2). of these six articles, two [29, 32] utilized the bni pain intensity scale. sixteen patients (76.2%) exhibited compelling improvements and were placed in bni class i-ii. huang et al. analyzed 65 medically refractory patients with tn who were treated with gkrs as a second treatment modality. of these 65 patients, 30 (46%) had undergone gkrs as an initial management approach. the authors placed 22 patients (34%) in bni class i, 11 patients (17%) in bni class ii, four patients (6%) in bni class iiia, and five patients (8%) in bni class iiib. overall, with a median followup of 64 months, 65% of patients reported successful results in terms of pain control rates. a total of three of the six reviewed studies evaluated patients using the egfp categorical scale [28, 30, 31]. analyzed 37 patients treated a second time with gkrs for recurrent tn and reported that 17 patients (46%) achieved excellent pain relief, nine patients (24%) achieved good pain relief, five patients (14%) achieved fair pain relief, and six patients (16%) achieved poor pain relief. however, the authors concluded that 57% of patients experienced some form of trigeminal dysfunction following repeat radiosurgery., huang et al. treated 28 patients with repeat gkrs and reported that 12 patients (43%) exhibited excellent pain relief, five patients (18%) exhibited good pain relief, and two patients (7%) exhibited fair pain relief. in addition, the authors found a statistically significant (p=0.047) correlation between cumulative radiation doses>115 gy and facial numbness. in a separate study, huang et al. specifically, a total of eight patients underwent mvd a mean of 7.6 months following repeat gkrs. of the eight patients, seven (87.5%) were completely pain free at a mean of 21 months following neurosurgery. this data supports the use of mvd if multiple gk procedures are deemed ineffective. kimball et al. treated 53 patients with repeat gkrs and analyzed the patients not lost during followup using the marseille scale, which categorizes patients into one of five classes, with a higher class statistically indicating a worse prognosis for the patient. with a mean followup of 42 months, 20 patients (43.5%) were categorized in marseille class i-ii, six patients (13%) were categorized in marseille class iii-iv, and 20 patients (43.5%) were categorized in marseille class v. the authors also reported a statistically significant (p=0.047) correlation between facial numbness and superior long-term pain relief. a total of 22 patients (48%) experienced trigeminal dysfunction of any kind, while 21 patients (46%) experienced numbness in the face. since gkrs can be performed as both initial and salvage treatment options for patients who suffer from tn, its efficacy has been compared in patients who undergo one versus multiple radiosurgery procedures. we reviewed eight studies to further examine this matter [3, 3339] (table 3). four of the eight studies utilized the bni pain intensity scale to evaluate patient outcomes [3, 3335]., it was reported that 75%, 60%, and 58% of patients with idiopathic tn had bni scores of i iiib at 1, 3, and 5 years, respectively. the 1-, 3-, and 5-year-bni scores of i iiib in patients with ms-related tn were 56%, 30%, and 20%, respectively. the authors concluded that repeat gkrs exhibited similar success rates when compared to the initial procedure. similar to verheul et al., park et al. did not find differences in terms of time to initial response, time to pain recurrence, and overall pain relief when comparing patients who underwent one versus two gk treatments. however, it was observed that patients who received two gk treatments were more likely to have facial sensory changes when compared to patients treated a single time with radiosurgery. little et al. performed a study where 79 patients with typical tn were treated with gkrs as a salvage procedure. approximately five years following salvage gkrs, the authors reported that 50% of patients experienced pain relief and 20% of those patients were completely pain free. in addition, a statistically significant (p=0.029) correlation between gkrs failure and prior mvd was found. treated 37 patients (78% had failed prior surgery) with ms-related tn with gkrs. nine patients (24%) underwent gkrs as their first procedure. the reported 1, 3, and 5 year bni scores of i iiib were 82.6%, 73.9%, and 54%, respectively. the other four studies we reviewed utilized the egfp categorical scale as a measurement of response to treatment [3639]. two of the evaluated studies [36, 37] were conducted by fountas et al. and analyzed patients treated with gkrs for idiopathic tn based on whether or not they had undergone previous surgical or radiosurgical procedures for facial pain control. one of the studies evaluated 106 patients (19 previous radiosurgery procedures) and concluded that the treatment group without a previous history of surgical or radiosurgical procedures exhibited superior clinical outcomes, with 1-year and 2-year complete pain relief rates of 82.5% and 78%, respectively. the 1-year and 2-year complete pain relief rate in the patient group with a history of surgical or radiosurgical procedures was 69.4% and 63.5%, respectively. as expected, similar results were found in the other study by fountas et al.; however, no prior radiosurgical procedures were performed in the patient group with a history of prior procedures. huang et al. conducted a study where 89 patients with idiopathic tn were treated with gkrs as an initial management approach, 20 of which underwent a subsequent gkrs procedure for facial pain recurrence. following the initial radiosurgical procedure, 50 patients (56%) had an excellent response, 12 patients (13.5%) had a good response, and 7 patients (7.9%) had a fair response. following the second radiosurgical procedure, 11 patients (55%) had an excellent response and one patient (5%) had a good response. in a separate study, huang et al. assessed 21 patients with benign tumor-related tn who were treated with gkrs as an initial or repeat procedure. following the initial gk procedure to the tumor, 12 patients (57%) had an excellent response and 1 patient (5%) had a good response. a total of eight patients were treated with a subsequent gkrs procedure targeted at the ipsilateral trigeminal root or ganglion due to facial pain recurrence. following the second radiosurgical procedure, the authors reported four patients (50%) with an excellent response. we identified six studies comparing patients treated with gkrs with patients treated with one of the various surgical modalities [2, 4044] (table 4). the authors of this review acknowledge the importance of percutaneous techniques in the management of tn; however, our modern literature search predominantly yielded comparison studies analyzing the efficacy of mvd when compared to gkrs. specifically, four of the six studies [2, 4042] analyzed patients treated with gkrs against patients treated with mvd. specifically, 36 were treated with mvd (45%), while 44 were treated with gkrs (55%). the mvd treatment arm statistically differed from the gkrs treatment arm with respect to age (median of 54 versus 74 years), preoperative symptom duration (median of 2.6 versus 7.5 years), and the presence of major comorbidities (2.8 versus 58.3%). the authors reported that patients treated with mvd exhibited superior levels of initial (100%), 2 year (88%), and 5 year (80%) actuarial pain-free rates when compared to the patients treated with gkrs (78, 50, and 33%, resp.), with a p value of 0.0002. in addition to increased levels of patient satisfaction, as reported by required patient surveys, the mvd treatment group also had a decreased level of permanent mild (5.6%) and severe sensory loss (0%) when compared to the gkrs treatment group (6.8% and 2.3%, resp.). two patients (5.6%) in the mvd group experienced permanent mild paresthesias or numbness, one (2.8%) patient experienced a cerebrospinal fluid leak from the wound, and one patient (2.8%) experienced hearing loss and diplopia. three patients (6.8%) in the gkrs group experienced permanent mild paresthesias or numbness, one patient (2.3%) experienced a more permanent sensory numbness, and one patient (2.3%) experienced a transient headache and nausea following the gk procedure. all patients were diagnosed with typical tn and did not undergo previous gk or mvd procedures. it was reported that patients treated with mvd exhibited superior levels of complete pain relief at 12 (68%) and 18 months (68%) when compared to the gkrs group, who's complete pain relief rate was 58% at 12 months and 24% at 18 months (p=0.089). the treatment arms did not statistically differ in terms of 90% pain relief at 12 and 18 months. this study could be criticized due to the large difference in the number of patients constituting the two treatment arms. oh et al. evaluated a total of 45 elderly patients (> 65 years of age) diagnosed with idiopathic tn who were treated with either mvd (27 patients) or gkrs (18 patients). it was reported that three mvd patients (11%) and three gk patients (17%) underwent previous percutaneous procedures. the mean followup period was reported to be 35.9 months for the mvd group and 33.1 months for the gkrs group. according to the bni pain intensity scale, the mvd group had a superior prognosis, with 17 patients (63%) classified in bni class i-ii compared with the 10 patients (56%) in the gkrs group classified in bni class i-ii. the observed complications following mvd included constant headache in 11 patients (40.7%), facial paresthesia in five patients (18.5%), paresthesia of the tongue in two patients (7.4%), infection at the site of incision in one patient (3.7%), an acute subdural hemorrhage in one patient (3.7%), temporary hearing loss in one patient (3.7%), and otitis media with cerebrospinal leakage in one patient (3.7%). two patients (11%) in the gkrs group experienced paresthesia. compared the clinical outcomes of 19 patients treated with mvd with 15 patients treated with gkrs. nine gk patients (60%) and four mvd patients (21%) underwent previous surgical procedures. the treatment arms statistically differed (p=0.0005) with respect to mean patient age, with the mean age of the gkrs group exceeding the mvd group by 13 years (74 versus 61 years). in addition, patient satisfaction was graded on a scale of 1 (unsatisfied) to 10 (completely satisfied). it was reported that the mean tn complexity grade was statistically different (p<0.001) between the treatment arms (gk=5.8; mvd=3). the average response following the procedure was determined to be 3.4 for the mvd group and 2.4 for the gkrs group (p=0.017). also, it was found that the satisfaction score for the mvd group was superior to the gkrs group (8.7 versus 6.4), with a p value of 0.02. the authors reported a statistically significant correlation between tn complexity grade and clinical response (p<0.001), as well as tn complexity grade and patient satisfaction (p<0.001). to date, no randomized trials have been conducted analyzing the outcomes of patients with tn who are treated with mvd compared to gkrs. in a large review on tn management, zakrzewska and linskey found evidence that mvd is an effective treatment for long-term facial pain relief but comes with an increased risk of ipsilateral hearing loss. in addition, the authors concluded that single-dose srs is an effective treatment for long-term facial pain relief but puts patients at risk for facial numbness or facial paresthesias. investigation into this matter in the form of a randomized controlled trial would provide the best evidence in terms of facial pain relief and procedure-related complications. in addition, we reviewed two studies comparing patients treated with gkrs with patients treated with posterior fossa exploration (pfe) [43, 44], both of which were conducted by pollock and colleagues at the mayo clinic college of medicine. one of the studies was a specific prospective comparison of 91 patients treated with pfe and 49 patients treated with gkrs for idiopathic tn as an initial management approach. the treatment arms statistically differed in terms of age (gkrs=67.1 years; pfe=58.2 years), with a p value<0.001. it was reported that patients treated with pfe were more likely to be pain free and off medications at 1 year (84%) and 4 years (77%) when compared to the gkrs group (66 and 56%, resp.) retreatment for recurrent facial pain was performed in 15% of the patients in the pfe treatment arm and 35% of patients in the gkrs treatment arm (p=0.009). also, it was found that nonbothersome facial numbness occurred more frequently in the gkrs group (p=0.04). an additional study from the mayo clinic evaluated patients with recurrent tn who underwent 3 or more surgical procedures. the authors reported that patients treated with pfe exhibited superior levels of complete pain relief at 3 years of followup when compared to patients treated with gkrs, balloon compression, and glycerol rhizotomy (p<0.01) and underwent additional surgery for recurrent facial pain less often when compared to patients treated with the other modalities (p=0.02). clinical 006futcomes did not differ between patients treated with gkrs and patients treated with the percutaneous techniques. srs can be performed by a variety of tools, which include gkrs, cyberknife technology, and linear accelerator (linac)-based treatment. our analysis yielded one study whose primary endpoint was to devise a method using cyberknife treatment planning that would mimic the dosimetric characteristics of the gk treatment plan in five patients undergoing radiosurgery for tn. both the isodose lines and critical structures were identified using the gkrs treatment plan and were transferred to the cyberknife treatment planning system. it was reported that the average length of the trigeminal nerve receiving a dose of 60 gy was 4.5 mm for the gk, 4.5 mm for the nonisocentric cyberknife, and 4.4 mm for the isocentric cyberknife. the authors found it more difficult to minimize the dose to critical structures when using cyberknife technology. also, the dose falloff of gkrs was found to be steeper when compared to cyberknife technology due to, what the authors hypothesized, the large number of gamma rays produced which converge on the focal point with precision. as previously mentioned, the gk machine's primary functional unit is cobalt-60, which is used to emit photon energy through 201 separate 4 to 18 mm collimator openings that converge on a target specified by a treatment planning system. balamucki et al. performed a study examining if the half life of cobalt (5.26 years) relates to the outcomes for patients being treated for tn with gkrs. the authors collected data on 239 gkrs procedures performed at their institution between 1999 and 2004. patient surveys were used to measure responses to radiosurgery. with the followup time ranging from one to six months, it was reported that 80% of patients experienced some degree of pain relief and that 56% of those patients were pain free. the authors concluded that clinical outcomes remained consistent during the first half life of cobalt-60. an area of controversy in the treatment of patients with tn is defining the optimal maximum radiosurgery dose that can be delivered to specific patient subsets. we analyzed five studies whose primary endpoint was to assess gkrs-dosing efficacy [4852]. kim et al. utilized the bni pain intensity scale to assess 66 tn patients treated with a gk maximum dose of 80 gy and 44 tn patients treated with a gk dose of 85 gy. although the two groups did not statistically differ in terms of facial rain relief and procedure-related complications, the authors did report that patients treated with a gk dose of 85 gy experienced a more rapid response to treatment when compared to the patients treated with a gk dose of 80 gy. arai et al. analyzed 165 patients with tn treated with a gkrs dose of 80 gy. specifically, the authors divided the patients into two groups, which differed in the radiation dose rate received (low-dose rate=1.212.05 gy/min; high-dose rate=2.063.74 gy/min). using the bni pain intensity scale as a clinical evaluation method, it was reported that the low-dose-rate group and the high-dose-rate group did not statistically differ in terms of initial pain relief, maintenance of pain relief, and clinical complications. patients in group one were treated with a gk dose<90 gy with no beam channel plugging, patients in group two were treated with a gk dose equal to 90 gy with no beam channel plugging, and patients in group three were treated with a gk dose equal to 90 gy with beam channel plugging. although the trend did not reach full statistical significance (p=0.054), patients in group three exhibited the highest level of pain relief, while patients in group one exhibited the lowest level of pain relief. the authors also observed that the three groups statistically differed (p<0.0001) in terms of trigeminal nerve dysfunction, with patients in group three experiencing the highest rate of mild and bothersome complications and patients in group one experiencing the lowest rate of mild and bothersome complications. similar to the results of massager et al., morbidini-gaffney et al. reported positive outcomes in patients treated with gk doses>85 gy. the authors also found that patients treated with two isocenters were more likely to have superior bni pain intensity scale scores during their course of followup when compared to patients treated with a single isocenter. the median initial dose was 80 gy, and the median retreatment dose was 45 gy. although the authors did not report any predictors in terms of facial pain control and patient morbidity, they did compare the results of their study with seven published retreatment articles and found that successful levels of pain control (> 50%) were significantly correlated with cumulative gkrs doses>130 gy, as well as new trigeminal nerve dysfunction (> 20%). in addition to dose selection efficacy in select patient cohorts, the radiosurgical target of cn v is another subject matter that requires further clinical investigation. we reviewed three studies [5355] analyzing specific gkrs targeting methods in the treatment of tn and one study that examined the accuracy of gkrs to its image-guided target. compared patients treated with gkrs targeted at the dorsal root entry zone (59 patients) with patients whose radiosurgical target was the retrogasserian zone of the trigeminal nerve (41 patients). with a median followup of 30 months, the dorsal root entry target group exhibited statistically superior levels of initial complete pain remission (p=0.003) and experienced less complications than the retrogasserian zone group (p=0.009). chen et al. also reported positive results with the dorsal root entry zone-targeting approach, with a success rate of 82.8% and a complication rate of 15%. park et al. compared the dorsal root entry zone and retrogasserian zone-targeting methods in the treatment of 39 patients with medically refractory tn. the authors reported that the two treatment arms did not statistically differ in treatment success (bni class i-iiib) with respect to the bni pain intensity scale. however, patients treated with the retrogasserian zone-targeting method experienced a substantially shorter time of response to gkrs than patients treated with the dorsal root entry zone-targeting method (p=0.044). although the two groups did not statistically differ with regard to treatment-related morbidities, it was found that the patients whose targeting approach was the dorsal root entry zone experienced a greater amount of bothersome complications than the retrogasserian zone group. massager et al. analyzed the targeting accuracy of gkrs in 65 patients treated for tn whose six month followup mri showed focal contrast enhancement of the trigeminal nerve. the authors found that the median deviation of the coordinates between the intended radiosurgical target and the center of contrast enhancement was 0.91 mm in euclidean space. the median radiation dose fitting into the contrast enhancement region was determined to be 77 8.7 gy. this small deviation from the gkrs target explains the high accuracy and precise nature of the machine. the two most common methods of measuring patient outcomes from gkrs in the management of tn are the barrow neurological institute pain intensity scale (table 5) and the excellent-good-fair-poor (egfp) categorical scale (table 6). the bni pain intensity scale divides patients into one of five classes, with a higher class indicating a worse prognosis for the patient. patients in bni class iiia do not experience trigeminal pain but require the use of medication. patients in bni class iiib experience some trigeminal pain that can be satisfactorily managed with medication. patients in bni class iv experience some trigeminal pain that is not satisfactorily managed with medication. patients in bni class excellent outcomes are defined as complete pain relief without the need of medication. good outcomes are defined as complete pain relief with the need of medication. poor outcomes are defined as a<50% pain relief rate or treatment failure. for patients with medically refractory forms of tn, gkrs has proven to be an effective initial and repeat treatment option. cumulative research suggests that patients treated a single time with gkrs exhibit similar levels of facial pain control when compared to patients treated multiple times with gkrs. however, patients treated on multiple occasions with gkrs are more likely to experience facial numbness and other facial sensory changes when compared to patients treated once with gkrs. although numerous articles have reported mvd to be superior to gkrs in achieving facial pain relief, the findings of these comparison studies are weakened by the vast differences in patient age and comorbidities between the two studied groups and can not be considered conclusive. further evidence in the form of a phase iii-randomized trial is needed to confirm the clinical outcomes of patients treated with either modality. questions remain regarding optimal gkrs dosing and targeting strategies, which warrants further investigation into this controversial matter.

since its introduction by leksell, gamma knife radiosurgery (gkrs) has become increasingly popular as a management approach for patients diagnosed with trigeminal neuralgia (tn). for this reason, we performed a modern review of the literature analyzing the efficacy of gkrs in the treatment of patients who suffer from tn. for patients with medically refractory forms of the condition, gkrs has proven to be an effective initial and repeat treatment option. cumulative research suggests that patients treated a single time with gkrs exhibit similar levels of facial pain control when compared to patients treated multiple times with gkrs. however, patients treated on multiple occasions with gkrs are more likely to experience facial numbness and other facial sensory changes when compared to patients treated once with gkrs. although numerous articles have reported mvd to be superior to gkrs in achieving facial pain relief, the findings of these comparison studies are weakened by the vast differences in patient age and comorbidities between the two studied groups and can not be considered conclusive. questions remain regarding optimal gkrs dosing and targeting strategies, which warrants further investigation into this controversial matter.

PMC3202097

pubmed-176

a 55-year-old caucasian female was undergoing elective coronary artery bypass surgery following a recent myocardial infarction. intravenous midazolam was given to the patient in the holding area, and the right radial artery was cannulated. in the operating room, intraoperative monitors, included five-lead electrocardiography, pulse oximetry, a radial artery catheter, capnography (etco2), and bladder temperature. the patient was intubated without any difficulty after routine intravenous induction with etomidate, sufentanil, and rocuronium. the right internal jugular vein was cannulated with the patient in the trendelenburg position, and a pulmonary artery catheter was advanced to the wedge position without difficulty. additional monitors included a pulmonary artery catheter with venous saturation and continuous cardiac output monitoring as well as central venous pressure. an adult multiplane 6.0 mhz transesophageal echocardiography (tee) probe (acuson, siemens, washington, dc, usa) was placed. systematic tee images were obtained according to the american society of echocardiography-society of cardiovascular anesthesiologists guidelines. as the cardiac surgeon harvested the left internal mammary artery, the first assistant harvested the saphenous vein from the left leg via an endoscopic approach (stryker endoscopy, san jose, ca, usa) using co2 insufflation at 4 l/min and a pressure of 14 mmhg. approximately 20 minutes after endoscopic vein harvesting started, we noticed the patient's end-tidal co2 (etco2) had increased from 36 to 44 mmhg followed by increasing pulmonary artery pressure from 42/20 to 60/39 mmhg within 1 minute. subsequently, systemic blood pressure dropped from 101/60 mmhg to 65/30 mmhg while o2 saturation remained at 100%. the cardiac index dropped approximately 15% from 2.2 to 1.9 l/min/m, but heart rate and central venous pressure were only slightly elevated. the inspiratory oxygen concentration fraction was adjusted from 50% to 100%, and vasopressors were administered to support the pressure. mid-esophageal four-chamber and mid-esophageal aortic valve long-axis views were examined, but no new mitral or aortic regurgitation was noted. however, the mid-esophageal right ventricular inflow-outflow view revealed a massive snowflake appearance suggestive of gas bubbles from the right atrium to the right ventricle (fig. however, mild dilatation of the right ventricle was noted. at that time, all intravenous fluids through the central line were stopped, and all intravenous connections were checked to make sure no intravenous fluids were running. despite these maneuvers, the snowflake appearance suggestive of gas bubbles was still present. we concluded that the gas bubbles were not caused from turbulence due to intravenous fluids or from a disconnected intravenous line, so a co2 embolism was suspected. after this observation, we kept the patient in the trendelenburg position and increased the ventilation rate to expire more co2. a nitroglycerine drip was started to lower pulmonary artery pressure, and phenylephrine boluses were administered to maintain systemic blood pressure within an acceptable range. further examination of tee in the mid-esophageal bicaval view revealed that the gas bubbles were originating from the inferior vena cava (fig., we concluded that the source of the gas embolism was most likely from co2 insufflation. the surgical team was informed of these findings and they reassured us that the proximal saphenous vein was completely ligated and confirmed that most branches were adequately cauterized. the surgical team requested 5 additional minutes to complete vein harvesting based on patient stability. our hemodynamic assessment revealed that the patient was stable, and the tee examination revealed a significant reduction in air bubbles, so the decision was made to proceed with the endoscopic vein harvesting. over that course, the patient remained on 100% fio2, and a higher ventilation rate. the nitroglycerin drip was discontinued and intermittent small epinephrine boluses were administered for inotropic support, and phenylephrine or ephedrine were administered to maintain systemic blood pressure>90/50 mmhg. the patient's hemodynamic status improved shortly after vein harvesting was completed, and co2 insufflation was discontinued. we noted the patient's etco2 had returned back to 35 mmhg, pulmonary artery pressure had decreased steadily back to a baseline level of 40/20 mmhg, and continued down to 30/18 mmhg, whereas systemic blood pressure stabilized at 100/60 mmhg without vasopressor support. a tee examination in the mid-esophageal right ventricular inflow-outflow view and mid-esophageal bicaval view revealed no further evidence of gas embolism. coronary artery bypass grafting was completed without further events, and the patient recovered without any adverse neurological sequelae. our case not only confirms the vital role of tee in the quick and accurate diagnosis of a co2 embolism during endoscopic vein harvesting but also allowed us to focus on the mid-esophageal bicaval view, a view not commonly used to identify a co2 embolism. further review of the mid-esophageal right ventricular inflow-outflow view revealed that gas was entering the right side of the heart, but we could not determine whether the bubbles originated from the superior vena cava or the inferior vena cava. using the mid-esophageal bicaval view, we were able to confirm that the gas embolism originated from the inferior vena cava, and that the lower extremity endoscopic site was the most likely suspect. the era of minimally invasive surgery started two decades ago and has extended its influence into cardiac surgery. the first endoscopic vein harvesting was described by lumsden et al. in 1994. the endoscopic technique is associated with a shorter time (51.07 vs. 75.94 min), better leg wound healing, and a lower incidence of wound infections (12.0% vs. 8.8%) compared to those of conventional open vein harvesting. other advantages of endoscopic vein harvesting compared to conventional open vein harvesting include a smaller incision, less post-operative pain, a shorter hospital stay, and better cosmetic appearance. the endoscopic vein harvesting procedure requires co2 insufflation at a flow of 4 l/min and pressure of approximately 14 mmhg to create a potential subcutaneous space. in contrast, there have been reports of co2 embolism, pneumothorax, subcutaneous emphysema, and hypercarbia. the reported incidence rate of co2 embolism ranges from 1-200 cases in every one million laparoscopic surgeries. the incidence of a co2 embolism during endoscopic saphenous vein harvesting with co2 insufflation procedures decreases as the severity of clinical symptoms and the volume of embolized gas increases. the incidence of venous co2 embolism of any size is 17.1%, whereas the incidence of massive gas emboli is only 0.5%. the incidence of a co2 embolism is even lower when an endoscopic approach is used to harvest arterial conduits. in our hospital, the endoscopic vein harvesting technique has been used in approximately 1,500 cases since 2005, with no reported incidence of a co2 embolism. manifestations of a co2 embolism include hypotension, reduced cardiac output, and decreased mixed venous oxygen saturation, along with elevated pulmonary artery and central venous pressures. however, this sign may not be as dependable as was the case in our patient, as we observed an initial rise in etco2 instead of a reduction. a drop in etco2 is an indication of increased dead space and insufficient pulmonary perfusion. this condition does not generally occur unless the trapped gas in the pulmonary vascular system or the right ventricular outflow prevents blood from flowing into the lung, a condition that is generally observed with a massive embolism. whenever co2 is used for endoscopic insufflation, co2 can directly enter the injured saphenous vein or its branches, resulting in elevated etco2. furthermore, a smaller amount of co2 embolized to the right heart could be released acutely, resulting in elevated etco2. as was seen in our case, treatment for a co2 embolism includes immediate discontinuation of co2 insufflation, placing the patient in the trendelenburg position, increasing fio2 to 100%, and aspirating the central line. the latter intervention is less successful with a pulmonary artery catheter and may divert the attention of the anesthesia team from other rescue efforts. furthermore, inotropic agents should be started to support cardiac output to push the co2 embolism into the lungs. cardiac massage and even urgent cardio-pulmonary bypass or extracorporeal membrane oxygenation have also been described if the patient does not respond to initial resuscitation efforts. in our case, we choose to allow continued co2 insufflation to complete saphenous vein harvesting based on the patients stabile hemodynamics and on the observation that a reduction in gas entry to the right heart occurred shortly after detecting the co2 embolism. this finding was interesting, as the surgical team did not reduce insufflation flow or pressure. we believe that the source of co2 absorption was eliminated at this point, as the surgical team cauterized the open vascular structures. in summary, the use of endoscopic vein harvesting for the saphenous vein has become increasingly more common and awareness and prevention of the potential for a co2 embolism is important. as seen in our case, tee played a vital role in detection, and we believe that the mid-esophageal bicaval view should be used as the standard view during endoscopic vein harvesting. it has been suggested that the surgical team should pay special attention when cauterizing or ligating all vein branches to reduce the potential for co2 entry into the venous system to prevent further co2 embolisms. although we allowed endoscopic vein harvesting to continue after confirmation of the co2 embolism with direct inspection of the saphenous-femoral vein junction and meticulous closure of the tears were confirmed, further investigation into the safety of this practice is warranted.

a carbon dioxide (co2) embolism during endoscopic vein harvesting is a rare but potentially fatal complication. early and accurate diagnosis is crucial for limiting the extent of the embolism and stabilizing the resulting cardiovascular compromise. we report a case of co2 embolization during endoscopic vein harvesting. transesophageal echocardiography was instrumental in the diagnosis and management of this patient by further improving the decision making process, which resulted in the best outcome. mid-esophageal bicaval view is the best view to determine whether a co2 embolism is coming from the upper or lower extremities.

PMC3427810

pubmed-177

drywood termites cause significant damage to wood in structures in the united states, with two species, incisitermes minor (hagen) and cryptotermes brevis (walker), being responsible for the majority of damage (su and scheffrahn, 1990; grace, 2009). the economic cost of control and repair of damage is second only to that for subterranean termites (su and scheffrahn, 1990). remedial control of drywood termites in the united states relies primarily on either (1) fumigation of the entire structure with a toxic gas or heated air, or (2) localized chemical or physical treatments designed to eradicate small, localized colonies (lewis and haverty, 1996; lewis, 2008; lewis and rust, 2009). fumigation treatments are likely to kill all of the termites in a structure, while localized treatments can destroy all termites in a colony, provided the treatment is delivered to the entire gallery system. the size, number, and dispersion of drywood termite colonies in a structure can vary greatly, depending on the age of the infestation and the success of preventative or remedial treatments. drywood termite colonies also are considered single piece nesters, i.e., they nest within their food source and do not forage from the nesting site to a food source (abe, 1987). in fact, large, dispersed colonies (or even small colonies) can live in a single piece of wood or in multiple pieces of wood that are joined together (grace et al., drywood termites are cryptic, seldom leaving obvious or visible external signs of their presence in wood. a commonly used sign for determining the presence of drywood termites is the occurrence of fecal pellets, ejected through a kick-out hole in the external surface of wood from the internal galleries (ebeling, 1975). these pellets often are found as conical piles or are scattered on horizontal surfaces below infested wood. these hexagonally sided pellets are diagnostic for drywood termites, and can be used to distinguish damage from that by other wood-destroying insects (ebeling, 1975; moore, 1992). grace and yamamoto (2009) demonstrated the relationship between the cellulose and lignin content of the food utilized by small groups of c. brevis and incisitermes immigrans (light), and the quantity of fecal pellets produced over time. they also discussed the use of the size and number of fecal pellets for estimating both size and age of drywood termite colonies. drywood termites excrete feces in the form of hard, even-shaped fecal pellets. these fecal pellets contain the same mixture of hydrocarbons as the insects that produced them, albeit in slightly different proportions (haverty et al., 2005). because cuticular hydrocarbons are species specific in termites (page et al., 2002) rather than simply signaling the general presence of termites or providing a diagnosis of the species of termite inhabiting the wood, we postulated that these pellets could be chemically characterized so as to determine the status of a colony as active (alive) or inactive (dead). here, we report quantification of the hydrocarbons in pellets of i. minor aged for up to 1 year after they were produced. we document the changes in proportions of selected hydrocarbons as an indication of the length of time since the pellets were excreted. collection of termites and preparation of termite containment unit termites, i. minor, were removed from one naturally infested board (98.9 13.3 271.8 cm) collected on 19 july 2006 from lakeview, california, and stored at the university of california richmond field station. the board was cut across the grain into pieces, 58 cm thick, and stored at room temperature. a wood chisel was used to separate pieces of wood into smaller pieces, 0.51.0 cm thick. all remaining live termites, including soldiers and primary reproductives (alates), were placed in a termite containment unit (tcu). termites thus collected were likely from a large mixed colony (booth et al., 2010) or from multiple colonies. we were not able to assign the various galleries in the wood to any particular colony.fifteen birch tongue depressors were bundled together, and three equally spaced holes drilled across the length of the bundle using a 2.8-mm bit. bamboo skewers, 1013 cm in length, were inserted into each of the three holes in the bundle of tongue depressors. spaces, 36 mm, were left between each tongue depressor allowing termites access to all tongue depressors. two sets of skewered tongue depressors were placed into a clean plastic container (17.5 12.5 6 cm), one on top of the other, such that the tongue depressors on the top layer fit into the gaps created by the tongue depressors on the bottom layer. tongue depressors were lightly misted with water, and then 6,662 drywood termites (a mixture of pseudergates or workers, alates, and soldiers) were placed in the tcu. tcus, with termites, were maintained in a dark cabinet in the laboratory under ambient conditions prior to collection of fecal pellets. a single colony or a mixture of two or more colonies, representing a single location within california, was prepared in this manner. pellet collection and aging process after all the tcus had acclimated to laboratory conditions over several weeks, new holding chambers were prepared. all wood debris, pellets, dead termites, and damaged tongue depressors were discarded. the termites in the new holding chambers were maintained in the laboratory under ambient conditions for 2 weeks. at the end of this period, all pellets were removed, and sub-samples collected and readied for the aging study. concurrently, three samples of 20 workers, three samples of 20 alates, and one sample of 20 soldiers were also collected for hydrocarbon analysis. live termites were placed in a 20-ml scintillation vial and frozen until extraction.fecal pellets were separated from debris by sequentially sifting them through successively smaller sieves (haverty et al., 2005). thus, all substances such as hand lotion, lip balm, parafilm, and waxed paper were kept away from the work area. gloves were worn when handling pellets, and implements that came in contact with pellets were wiped with a paper towel dampened with absolute ethanol to remove any oils or waxes. pellets were separated from fine debris by removing individual pellets with forceps or with an aspirator, until a sample weighing approximately 200 mg was obtained.in developing this protocol we made one estimate and one critical assumption. the estimate was that at least 1,000 pellets were needed for each hydrocarbon analysis (based on preliminary analyses of pellets collected from drywood termites maintained in our laboratory). (1997) using c. brevis and i. snyderi (light) from southern florida. in that study, 40 i. snyderi (pseudergates or workers) produced 573 pellets over 4 weeks, slightly less than 150 pellets/wk or about 3.5 pellets/individual/wk. in a study with small groups of c. brevis and i. immigrans, grace and yamamoto (2009) found that these species produced 4.9 to 7.0 pellets/individual/wk. for our study, we assumed that i. minor would produce pellets at roughly the same rate and, therefore, we needed about 3,000 to 5,000 individuals in a tcu for this study. we prepared one tcu to collect the requisite quantity of fecal pellets.four sub-sampling intervals, each replicated three times, were used: 0, 30, 90, and 365 days from the initial collection date. sub-samples were stored in clean, 20-ml scintillation vials, sealed with 1.5 1.5 mm mesh screen. vials were stored in a dark cabinet at the university of california richmond field station at ambient temperature.voucher samples of i. minor pseudergates or workers and soldiers from this study (fresh, not dried) were preserved in 85% ethanol and deposited in the essig museum, university of california at berkeley (haverty et al., extraction procedure and characterization of hydrocarbons hydrocarbons from workers, alates, soldiers, and fecal pellets of i. minor were extracted, characterized, and quantified as previously reported (haverty et al., 2005). frozen termite samples were thawed and dried at 70c for approximately 1 h before extraction. each sub-sample of fecal pellets or termites was placed in a 20-ml scintillation vial, and immersed in 10 ml of n-hexane for 10 min. after extraction, hydrocarbons were separated from other compounds through 4 cm of activated sigma silica gel (70230 mesh) in pasteur pipette mini-columns. the resulting hydrocarbon fractions were evaporated to dryness under a stream of nitrogen and redissolved in 60 l of n-hexane for gas chromatography-mass spectrometry (gc-ms) analysis. a 3-l aliquot was injected into the gc-ms.gc-ms analyses were performed on an agilent 6890 gas chromatograph interfaced with an agilent 5973 mass selective detector, using agilent chemstation data analysis software (g1701ca version c.00.00). the gc-ms was equipped with an hp-1ms, fused silica capillary column (30 m 0.25 mm i.d, 0.25 m film thickness), and was operated in split mode (split ratio of 30:1), using helium as carrier gas. the column oven was programmed from 200320c at 3c min, with a final hold of 11 min. electron impact (ei) mass spectra were obtained at 70 ev.all chemicals of interest were identified by their retention times and mass spectra. mass spectra of methyl-branched alkanes were interpreted as described by blomquist et al. olefins were identified by their mass spectra, although double bond positions were not determined (haverty et al., 2005).in the text, tables, and figures, we use shorthand nomenclature to identify individual hydrocarbons or mixtures of hydrocarbons. this shorthand uses a descriptor for the location of methyl groups (x-me), the total number of carbons (cxx) in the hydrocarbon component excluding the methyl branch(es), and the number of double bonds following a colon (cxx: y). thus, pentacosane is represented as n-c25, 11-methylnonacosane as 11-mec29, 13,17-dimethylhentriacontane as 13,17-dimec31, and heptatriacontatriene as c37:3. hydrocarbons are presented in the tables for each caste and worker fecal pellets in the order of elution from our gc-ms system. statistical analysis gc-ms peak (some peaks contained more than one compound or a mixture of positional isomers) areas were converted to percentages of total hydrocarbon fraction, enabling mean (sd) relative amounts of each hydrocarbon peak for workers and alates, and overall mean (sd) of each hydrocarbon peak for the fecal pellets, to be calculated.the percentage of each hydrocarbon peak for pellets of each aging period was transformed to the log of the percentage (dependent variable y) and regressed against the days of aging (independent variable x). hydrocarbons with slopes different from 0 (= 0.05) were separated into two groups: those with a significant positive slope and those with a significant negative slope. for each aging period (0, 30, 90, and 365 day), an index of age (iage) was created by subtracting the sum of the percentages of the hydrocarbons with a negative slope over time from the sum of the percentages of the hydrocarbons with a positive slope over time [iage= (peakpositive) minus (peaknegative), for each aging period]. the iage for each aging period then was regressed against the aging period (r development core team, 2004). the cuticular hydrocarbons for i. minor pseudergates and fecal pellets were characterized previously (haverty et al., 2000, 2005). the composition of the hydrocarbon mixture for this species and the hydrocarbons from their fecal pellets in the present study are displayed in fig. 1total ion chromatogram of cuticular hydrocarbons from a workers of incisitermes minor (hagen) and b from fecal pellets from the same collection. acronyms for hydrocarbons are derived as follows: x-me location of methyl groups, the total number of carbons cxx in the hydrocarbon component excluding the methyl branch(es), and cxx: y the number of double bonds following a colontable 1relative abundance of hydrocarbons from pseudergates, alates, soldiers, and fecal pellets of incisitermes minor (hagen)hydrocarbonspseudergates n=3alates n=3soldiers n=1fecal pellets n=122-mec220.06 (0.02)0.08 (0.02)0.090.11 (0.02)n-c231.30 (0.06)1.34 (0.05)1.481.35 (0.18)2-mec231.45 (0.40)1.72 (0.35)2.112.13 (0.28)3-mec231.31 (0.38)1.38 (0.30)1.712.06 (0.29)n-c240.46 (0.01)0.43 (0.02)0.480.32 (0.05)2-mec240.13 (0.03)0.19 (0.03)0.190.15 (0.02)3-mec240.08 (0.02)0.10 (0.02)0.120.11 (0.02)n-c2516.35 (0.16)11.75 (0.40)12.648.65 (1.05)2-mec250.18 (0.01)0.27 (0.01)0.240.14 (0.02)3-mec250.23 (0.04)0.36 (0.04)0.340.26 (0.03)n-c262.25 (0.15)1.17 (0.07)1.510.87 (0.12)2-mec260.14 (0.01)0.13 (0.01)0.140.07 (0.01)n-c2714.04 (0.55)6.81 (0.31)10.055.91 (0.65)2-mec270.13 (0.01)0.09 (0.01)0.130.06 (0.01)3-mec270.20 (0.01)0.19 (0.01)0.250.12 (0.01)n-c280.43 (0.05)0.17 (0.01)0.350.15 (0.03)n-c293.38 (0.33)1.27 (0.07)2.971.38 (0.18)11-mec290.06 (0.01)0.15 (0.01)0.100.09 (0.01)9,13-dimec290.70 (0.02)0.82 (0.01)0.910.63 (0.06)9,13,17-trimec290.11 (0.02)0.27 (0.00)0.160.22 (0.03)n-c300.04 (0.00)0.07 (0.00)0.100.0013-mec300.01 (0.02)0.08 (0.00)0.040.0010,14-dimec300.64 (0.06)1.45 (0.02)0.880.90 (0.03)10,14,18-trimec300.18 (0.02)0.43 (0.01)0.240.28 (0.02)n-c310.14 (0.01)0.10 (0.01)0.200.09 (0.01)15-; 13-; 11-; 9-mec310.36 (0.03)0.82 (0.01)0.420.49 (0.02)13,17-; 11,15-dimec317.45 (0.68)13.74 (0.52)8.5510.67 (1.80)9,13,17-trimec310.57 (0.05)1.19 (0.02)0.720.89 (0.06)7,11,15-trimec310.54 (0.04)0.99 (0.01)0.720.81 (0.09)14-; 12-mec320.17 (0.01)0.33 (0.02)0.190.27 (0.03)12,16-dimec322.01 (0.14)3.57 (0.05)2.222.97 (0.28)10,14,18-; 8,12,16-trimec320.46 (0.03)0.80 (0.02)0.610.82 (0.06)15-; 13-mec330.93 (0.05)1.57 (0.03)0.921.30 (0.08)13,17-; 11,15-; 9,13-dimec334.63 (0.31)6.87 (0.11)5.117.41 (1.03)9,13,17-trimec331.30 (0.08)2.02 (0.02)1.863.47 (0.33)7,13,17-trimec330.21 (0.02)0.32 (0.01)0.320.47 (0.07)c35:31.01 (0.03)2.93 (0.17)1.641.76 (0.17)c35:22.31 (0.06)4.46 (0.14)2.713.55 (0.15)12,16-dimec34; c35:10.68 (0.02)1.16 (0.03)0.851.40 (0.10)10,14,18-; 8,12,16-trimec340.28 (0.00)0.50 (0.04)0.450.89 (0.14)15-; 13-; 11-mec350.56 (0.02)0.85 (0.05)0.671.11 (0.09)13,17-dimec351.27 (0.09)1.96 (0.02)1.833.95 (0.46)9,13,17-trimec350.14 (0.01)0.28 (0.03)0.270.93 (0.14)c37:31.74 (0.06)3.33 (0.16)2.723.28 (0.34)c37:21.67 (0.06)2.55 (0.08)2.182.90 (0.10)12,16-dimec360.17 (0.01)0.34 (0.02)0.280.71 (0.08)c37:10.78 (0.02)0.76 (0.03)0.810.83 (0.06)10,14,18-trimec36; c37:10.44 (0.03)0.35 (0.05)0.430.58 (0.10)13; 11-mec370.71 (0.01)0.60 (0.04)0.770.89 (0.14)13,17-; 11,15-dimec370.87 (0.05)1.27 (0.01)1.252.13 (0.22)9,13,17-trimec370.09 (0.01)0.13 (0.01)0.130.30 (0.06)c39:30.09 (0.02)0.18 (0.02)0.290.49 (0.16)c39:3; 12-mec380.49 (0.04)0.56 (0.03)0.761.03 (0.18)14,18; 12,16-dimec380.02 (0.03)0.14 (0.01)0.140.24 (0.04)c39:1; 10,14,18-trimec382.73 (0.19)1.73 (0.04)2.531.74 (0.23)13-; 11-mec391.75 (0.09)1.03 (0.03)1.701.26 (0.20)13,17-; 11,15-dimec390.90 (0.01)1.04 (0.14)1.361.44 (0.08)9,13,17-trimec390.41 (0.03)0.17 (0.09)0.110.20 (0.03)12-; 10-mec400.38 (0.05)0.20 (0.01)0.350.26 (0.07)12,16-dimec400.27 (0.00)0.27 (0.02)0.340.32 (0.05)c41:13.31 (0.27)1.70 (0.04)2.791.58 (0.25)13-; 11-mec412.78 (0.20)1.45 (0.06)2.591.74 (0.31)13,17-; 11,15-dimec413.34 (0.13)2.90 (0.15)4.003.33 (0.19)9,13,17-trimec410.79 (0.02)0.30 (0.02)0.330.42 (0.19)12-; 10-mec420.30 (0.03)0.15 (0.01)0.250.26 (0.27)12,16-dimec420.48 (0.04)0.37 (0.02)0.520.47 (0.12)c43:12.72 (0.28)1.25 (0.06)2.271.31 (0.26)15-; 13-mec431.00 (0.14)0.46 (0.05)0.870.61 (0.16)13,17-dimec431.99 (0.16)1.18 (0.16)1.931.68 (0.28)14,18-dimec440.12 (0.02)0.07 (0.01)0.120.13 (0.06)c45:10.42 (0.09)0.16 (0.02)0.330.21 (0.07)13-mec450.000.000.000.04 (0.03)13,17-dimec450.37 (0.08)0.18 (0.02)0.340.43 (0.13)mean percent (sd) of total hydrocarbon composition. compounds are listed in elution orderacronyms for hydrocarbons are derived as follows: location of methyl groups (x-me), the total number of carbons (cxx) in the hydrocarbon component excluding the methyl branch(es), and the number of double bonds following a colon (cxx: y)these hydrocarbons were not reported for i. minor pseudergates or fecal pellets in haverty et al. (2005)an isomeric mixture or two or more compounds co-eluted in this peak total ion chromatogram of cuticular hydrocarbons from a workers of incisitermes minor (hagen) and b from fecal pellets from the same collection. acronyms for hydrocarbons are derived as follows: x-me location of methyl groups, the total number of carbons cxx in the hydrocarbon component excluding the methyl branch(es), and cxx: y the number of double bonds following a colon relative abundance of hydrocarbons from pseudergates, alates, soldiers, and fecal pellets of incisitermes minor (hagen) mean percent (sd) of total hydrocarbon composition. compounds are listed in elution order acronyms for hydrocarbons are derived as follows: location of methyl groups (x-me), the total number of carbons (cxx) in the hydrocarbon component excluding the methyl branch(es), and the number of double bonds following a colon (cxx: y) these hydrocarbons were not reported for i. minor pseudergates or fecal pellets in haverty et al. (2005) an isomeric mixture or two or more compounds co-eluted in this peak hydrocarbons from termites n-alkanes and dimethylalkanes were the predominant classes of hydrocarbons in all castes and in fecal pellets (table 2), as previously reported by haverty et al. n-alkanes comprised from 23.12% to 38.39%, unsaturated components from 15.21% to 19.03%, terminally branched monomethylalkanes from 3.90% to 5.32%, internally branched monomethylalkanes from 7.70% to 9.01%, and dimethylalkanes from 25.25% to 36.18%, of the total hydrocarbon content. there was also a homologous series of trimethylalkanes, representing 8.26% to 9.48% of the total hydrocarbon content. table 2relative abundance of hydrocarbon classes from pseudergates, alates, soldiers, and fecal pellets of incisitermes minor (hagen)hydrocarbon classpseudergatesalatessoldiersfecal pelletsnormal alkanes38.3923.1229.7718.71olefins18.3821.1120.3120.66terminally branched methylalkanes3.904.495.325.19internally branched methylalkanes9.017.708.888.33dimethylalkanes25.2436.1829.7937.40trimethylalkanes5.097.405.929.71percent of total hydrocarbon compositionall peaks with co-eluting olefins and saturated compounds are summarized as olefinsthe hydrocarbons of i. minor characterized in this study included all of the compounds reported by haverty et al. (2005), as well as 18 additional hydrocarbons (table 1). these additional hydrocarbons were not abundant, never representing more than 0.85% of the total hydrocarbon (as for the mixture of 12,16-dimec34 and c35:1 in soldiers) content, and usually much less. the detection of these additional hydrocarbons in this study are likely due to the greater concentration of the extracted hydrocarbons used or, possibly, colony to colony variation. relative abundance of hydrocarbon classes from pseudergates, alates, soldiers, and fecal pellets of incisitermes minor (hagen) percent of total hydrocarbon composition all peaks with co-eluting olefins and saturated compounds are summarized as olefins hydrocarbons from termite fecal pellets in general, the hydrocarbons from whole-body extracts of i. minor were represented in extracts of fecal pellets. as with whole-body extracts of i. minor, dimethylalkanes were the predominant class of hydrocarbon, followed by olefins and normal alkanes (table 2). 1) were found in termites and not in fecal pellets, but these were present in small quantities, less than 0.1% of the total hydrocarbon content. the lack of these two hydrocarbons in fecal pellets may be a function simply of the concentration of the extracts. changes in hydrocarbons of fecal pellets over time we identified 73 hydrocarbon peaks in fecal pellets of i. minor (table 1). of these peaks (data from non-significant slopes not reported), 19 of 73 (26%) had a significant change, either positive (five) or negative (14), over time (fig. 2). this is a much higher number of statistically significant slopes (different from 0), than would be expected by chance alone (5% of 73 peaks is<4 peaks). 2changes in percent content of individual hydrocarbons, over time, from fecal pellets of incisitermes minor workers. a hydrocarbons with significant (= 0.05) negative slopes, and b hydrocarbons with significant positive slopes. acronyms for hydrocarbons are derived as follows: x-me location of methyl groups, the total number of carbons, cxx in the hydrocarbon component excluding the methyl branch(es), and cxx: y the number of double bonds following a colonthe index, iage, for each of the three replications (a, b, and c at 0, 30, 90, and 365 day) was plotted against the associated number of days (fig. the fitted line, with a 95% confidence interval for the means to show the variability of the replicates, had a high adjusted r (= 0.888) value, suggesting that it might be possible to predict fecal age by the index. 3fitted line and 95% confidence intervals for a plot of the mean of index of age (iage) against age. values for 30 day are jittered a small amount so that all three data points can be seen changes in percent content of individual hydrocarbons, over time, from fecal pellets of incisitermes minor workers. a hydrocarbons with significant (= 0.05) negative slopes, and b hydrocarbons with significant positive slopes. acronyms for hydrocarbons are derived as follows: x-me location of methyl groups, the total number of carbons, cxx in the hydrocarbon component excluding the methyl branch(es), and cxx: y the number of double bonds following a colon fitted line and 95% confidence intervals for a plot of the mean of index of age (iage) against age. values for 30 day are jittered a small amount so that all three data points can be seen we do not know the basis by which peaks increase or decrease over the 1-year period. in general, those that increased in relative abundance tended to have higher initial relative abundances; i.e., mono-, di-, or tri-methylalkanes with carbon chains of 31, 32, or 33. those that decreased were represented in five of the six classes of hydrocarbons, ranging from c26 to c45. the composition of the hydrocarbon mixture of insects is genetically controlled (toolson and kuper-simbrn, 1989; kaib et al., 1991; page et al., 1991; coyne et al., 1994). this composition can be slightly affected by diet and environmental conditions (hadley, 1977; espelie et al., 1994; chapman et al., 1995 (1996) demonstrated significant seasonal variation in quantities of some hydrocarbons of coptotermes formosanus shiraki from hawaii; these differences were small and associated with the production of alates. however, the qualitative mix of hydrocarbons has been shown to be stable over decades among species of cone beetles in the genus conophthorus (page et al., 1990). the motivation for our study was to devise a method for the evaluation of the success or failure of drywood termite treatments, including fumigation and local application methods. with the recent classification of sulfuryl fluoride (the only fumigant active ingredient registered in california) as a greenhouse gas (mhle et al., 2009) and the anticipated increase in local treatments, we felt that there would be considerable interest by the industry, regulatory agencies, and consumers for a simple and accurate means to determine whether or not a targeted colony/infestation is still in a structure. our method, based on changes in hydrocarbon chemistry over time, shows promise to this end. future research includes: (1) validating these findings for additional species of drywood termites and geographic populations of the same species, (2) validating these findings at different times of the year, and (3) exploring seasonality in pellet production and hydrocarbon quality in pellets.

hydrocarbon mixtures extracted from fecal pellets of drywood termites are species-specific and can be characterized to identify the termites responsible for damage, even when termites are no longer present or are unable to be recovered easily. in structures infested by drywood termites, it is common to find fecal pellets, but difficult to sample termites from the wood. when fecal pellets appear after remedial treatment of a structure, it is difficult to determine whether this indicates that termites in the structure are still alive and active or not. we examined the hydrocarbon composition of workers, alates, and soldiers of incisitermes minor (hagen) (family kalotermitidae) and of fecal pellets of workers. hydrocarbons were qualitatively similar among castes and pellets. fecal pellets that were aged for periods of 0, 30, 90, and 365 days after collection were qualitatively similar across all time periods, however, the relative quantities of certain individual hydrocarbons changed over time, with 19 of the 73 hydrocarbon peaks relatively increasing or decreasing. when the sums of the positive and negative slopes of these 19 hydrocarbons were indexed, they produced a highly significant linear correlation (r2=0.89). consequently, the quantitative differences of these hydrocarbons peaks can be used to determine the age of worker fecal pellets, and thus help determine whether the colony that produced them is alive or dead.

PMC2980652

pubmed-178

there is a need for computer methods that can calculate the aqueous solvation free energies of solute molecules accurately and efficiently. explicit-solvent models provide a physically accurate and atomistically detailed model of solvent, but they can be computationally expensive. boltzmann (pb), generalized born (gb), and weighted surface area (wsa) approaches, are computationally efficient because they treat water as a continuum. however, they are sometimes inaccurate, smearing out the particulate nature of water molecules, and they may have limited transferability to situations for which they have not been optimized. solvation modeling has often been improved by combining the advantages of implicit- and explicit-solvent models. one such approach is the semi-explicit assembly (sea) water model. in the sea approach, water s solvation behavior is precomputed in explicit-solvent simulations of water around model spheres that are then combined together as building blocks to represent any given solute structure at run time. the solvation free energy gsolv for a target solute molecule is calculated from a sum over solvating waters. sea has been shown to predict efficiently the air-to-water transfer free energies (ghyd) of small-molecule solutes in both prospective and retrospective studies with reasonable accuracy. even so, the sea model does not give accurate solvation free energies of ions or solutes having high charge density. here, we describe field-sea, a considerable improvement over sea, which gives accurate free energies of transfer of ions and charged solutes, at no additional computational cost and with no degradation of the predictions for nonpolar and uncharged polar solutes. in overview, we studied full md simulations of ionic and neutral solutes in tip3p water, described below, and found that the results could be captured by using a solvation free-energy field surface (in field-sea), instead of using precomputed waters (as in sea). moreover, we found that a weakly charged solute atom that is adjacent to a strongly charged solute atom retains some of the restrictions of its solvating water molecules that its neighboring charge has; see figure 1. field-sea captures this effect using an adaptive boundary method. a solvent water molecule around a solute molecule. on the left, each solute atom (weakly charged) has a predefined radius, irrespective of its neighboring solute atoms, leading to the locus of water centers shown by the black dashed curve. on the right, one solute atom is strongly charged, leading to two consequences: its own solvating water molecule is pulled in tightly, and neighboring solute atoms have tighter water interactions too. such effects may not be captured in simplified solvation models that treat atoms as having fixed radii, independent of neighboring atoms. below, we describe the field-sea approach to computing solvation free energies. the original sea model is described elsewhere, and our related explicit-solvent and linearized poisson boltzmann equation modeling (lpbe) are described in the supporting information (si). in both the original sea and the new field-sea described here, first, in a precomputation step, various model spheres are solvated in an explicit-solvent model, such as tip3p. this provides a database of component free energies that are used in the second step. in the second step, at the run time, any given solute molecule of interest is assembled from an appropriate concatenation of these spheres. the solute s solvation free energy is computed by summing the component sphere free energies. on the one hand, this approach provides the speed advantages of simple additivity-based models as we only need to perform the first step once for a given solvent model. on the other hand, this procedure is more accurate than additivity-based approaches because (1) sea sums are regional, not local, and (2) the database encodes the microscopic response observed in explicit-solvent simulations. the new field-sea instead captures the solvation free energy using a continuous solvation field. to do this, the charging free energies for a series of lennard-jones (lj) spheres solvated in tip3p water were calculated with thermodynamics integration (ti) in the set of precomputations (see explicit solvent free energy calculations in the si). we construct a free-energy contour (see si figure s1) as a combination of the electric field at the first solvation shell boundary (e=q/rw, where e is the signed magnitude of the electric field, q is the sphere s charge, and rw is the distance from the sphere center to the first peak of the water oxygen s radial distribution function, rdf, around the given sphere), the curvature c=1/rw at this boundary, and the charging free energy of the spheres. within each charge step (q), all of the data of free energy, electric field, and curvature were fitted to a formula, which can be taken as an expansion of the born model1 equation 1 will be used to calculate the free energy associated with any surface spot on an arbitrary solute solvent boundary (esub). this free energy could also be calculated from interpolation between data points on the free-energy contour. in addition to a charging free-energy contour, we also need a contour for estimating the explicit-solvent-accessible surface of a given solute molecule. to generate this, we calculated the rdf of water oxygen around each charged sphere and picked the first peak in the rdf, denoted as the boundary-sphere distance rw. all of the rw values from these spheres and their charge and lj parameters (lj and lj) were used to build an rw contour. to generate a solvent-accessible surface for a given solute, an rw for each atom is first calculated from interpolation with its partial charge, lj, and lj on the rw contour. a lee richards surface is then constructed from the nonoverlapping sections of these rw spheres centered on their associated atom sites. the fixed rw boundary is dependent upon only the individual parameters of the surface atoms. for solute molecules with multiple partial charge sites (especially molecular ions, where strong electric fields are involved), a more physical representation of the explicit-solvent-accessible surface would be one that responds to the whole solute s electric field. in other words, the surface atom distance, rw, is determined not only by the surface atom s partial charge, but also by neighboring atoms charges. taking into account such collective electrostatic effects, we adjust the fixed rw boundary in an adaptive manner, described by the following three-step procedure: (1)we cull all surface segments within 1.4 of any solute atom. as we are starting with a lee richards solvent-accessible surface, the minimum rw possible in the surface construction is half of a water molecule diameter (corresponding to a solute atom with a 0 radius). this partial-culling process simply removes potential numerical instabilities from surface sites overlapping solute atom centers while providing some adjustable starting surface sites that penetrate within the fixed rw boundary. we calculate the electric field at a given dot a about atom a2where n is the number of solute atoms, ria represents a vector from atom i to surface dot a, and ria is its length; signa=1 when raai=1n (qi/ria3)ria 0, and signa=1 when raai=1n (qi/ria3)ria<0, and raa is the vector from atom a to dot a. from the electric field, we calculate the corresponding charge by3where raa is the length of vector raa. we interpolate with this new charge and atom a s lj parameters to get a new rw, rw, new. in addition, we assume that rw can not expand (if rw, new>rw, original, we let rw, new=rw, original). this nonexpansion assumption is supported by solute solvent boundary plots of model diatomic solutes (see si figure s2). finally, the rw, new s of all atom s potential surface dots are averaged to yield an rw for this atom, used in the later culling process. (3) we cull the buried dots adaptively. because each dot atom distance (e.g., daa) is adjusted independently in the above procedure, the shell of potential surface dots about an atom will no longer be spherical. thus, culling buried dots is no longer a simple process of eliminating dots within a neighboring atom s rw, and an adaptive culling process is needed. to adaptively cull buried surface dots, when we check whether a given dot a is buried by a neighboring atom b, we first determine a corresponding charge at dot a from the electric field at this dot. this is used along with atom b s lj parameters to get a new rw, rw, badp, following the above rw adjustment procedure. atom distance, dab, with rw, badp, to determine if the dot is buried in atom b. if dab is less than rw, badp, it is removed from the set of potential surface dots. we call the new dot surface resulting from the above culling procedure the adaptive boundary. our term field-sea refers both to the field and to the adaptive boundary. the adaptive nature of the boundary only pertains to multiatom solutes; the adaptive and fixed rw boundaries are identical for single-atom solutes, like monatomic ions. while our adaptation procedure could, in principle, be applied iteratively, we found no further improvement after a single calculation. the charging free energy can be calculated for any given field-sea surface via4where ndot is the total number of surface-exposed dots, mi is the total number of dots (exposed+occluded) for corresponding atom i (each surface dot, j, of atom i, only corresponds to 1/mi of this atom sphere s total surface area or total solvation free energy), and esub, j is the subenergy associated with exposed surface dot j, calculated from the free-energy contour. here, esub, j is calculated from eq 1 using the signed magnitude of the electric field, ej, and the curvature at dot j, 1/rij. ej is defined as negative when ejrij<0, where ej is the electric field (vector) at dot j, rij is the vector from atom i to its surface dot j, and rij is this vector s length. now, we take the total solvation free energy to be the sum of polar and nonpolar components5 assuming the polar component of the free energy of transfer (gpol) can be uniquely described by both the surface electric field and geometry of the solute, this molecular gpol can be accurately calculated from the simple summation of the surface dots energies process described above. we consider the gsolv of monatomic ions as an initial test. for molecular solutes, to account for the role of solute conformation in the solvation free energy, we average gsolv results from calculations on 50 conformations (though 10 conformations are usually enough; see the si). these solute conformations were generated from 5 ns tip3p water md simulations with a 100 ps snapshot interval. we developed field-sea because of the errors that we observed in simpler methods in solvating ions; see figure 2. the explicit-solvent curve shows the hydration asymmetry discussed by others, where positively charged solutes are less favored than negatively charged solutes of similar size. gsolv as the function of a model lj sphere (= 0.22 nm, =0.06538 kj/mol) charge for tip3p, lpbe, and field-sea. for comparison at infinite-dilution conditions, an ewald correction is applied to the tip3p and field-sea results. here, we tested field-sea on the solvation free energies of monatomic ions using ion parameters developed by aqvist or joung and cheatham (table s2, si). these ions have different sizes and charges; therefore, they have different charge densities. table 1 and figure s3 (si) show the results of field-sea calculations, compared with lpbe and tip3p. lpbe results using the lj surface do not capture quantitatively the gsolv of ions with high charge densities. in contrast, field-sea reproduces the tip3p gsolv values regardless of the specific lj parameters and charges. these results indicate that field-sea is accurately reproducing explicit-solvent free energies of solvation of monatomic ions, provided that their charge and lj parameters are near or encompassed within the range of the rw and free-energy contours. a common approximation in simplified solvation models is to suppose that atoms have fixed atom types, where any particular solute atom has a given value of charge and radius, independent of its atomic neighbors. however, our tip3p explicit-solvent simulations described below show that this approximation is a source of error. how the solvation surface is constructed our explicit-solvent simulations show that the solvation shell is not just a simple union of the spherical surfaces of all of the atoms making up the solute molecule. imagine a diatomic solute with partially charged atom a covalently connected to partially charged atom b. our tip3p simulations show that when atom a attracts water molecules, it also shrinks the solvation shell of waters around atom b. in this way, the solvation surface around the diatomic molecule a b can be more complex than the simple union of independent spherical solvation shells around atoms a and b. to address such situations, we developed an adaptive method that gives a more explicit-like solvation boundary. to test our adaptive boundary method, we made up 22 fictitious diatomic solutes (see si table s4), computed their solvation free energies, and compared to their solvation in tip3p. we constructed these solutes by taking pairs of ordinary simulation atom types, placing them at fixed covalent bond distance apart, and giving each atom a charge and radius that we could vary systematically over the series. because of the fictitious charges that we give them, these are not molecules observed in nature however, they are physically plausible molecules that provide us with a systematic series for learning about how explicit-solvent models handle solvated charges. figure 3 shows the computed free energies of these diatomic solutes from field-sea when using the fixed rw and adaptive boundaries in comparison to explicit-solvent tip3p simulations. lpbe and original sea results are shown in the si instead of here for the sake of simplicity. in summary, we find that when the tip3p gsolv is weak, for example, when the charge density of solute atoms is low, the fixed rw boundary works fairly well. when the gsolv grows to 100 kcal/mol and larger (more negative), it becomes increasingly important to use an adaptive boundary. these strongly solvated model molecules often have large, unbalanced partial charges on the solute atoms, and these situations lead to exaggerated distortions of the explicit solvation shell. field-sea gsolv for model diatomic solutes (triangles: fixed rw; circles: adaptive boundary) compared to tip3p simulations. figure 4 shows how a neighboring solute atom can affect the solvation shell about another atom. the fixed rw and adaptive boundaries are identical in figure 3a as both carbon atoms are weakly charged and there is only minor collective electrostatic perturbation on the boundary. however, when the solutes are more highly charged and large charging energies are involved, as in figure 3b, the weakly charged carbon atom s solvation shell will be distorted by its neighboring highly charged oxygen atom. in this case, water molecules penetrate more deeply into the carbon s solvent-accessible surface to better solvate the oxygen charge (the right part of the white curve in the dark blue region). also, water molecules pack more tightly around the carbon atom and reduce its apparent rw (the left part of the white curve in the blue and light blue regions). both of these effects are captured well by adaptive field-sea boundaries, leading to field-sea charging energies that are in excellent agreement with explicit simulation results. oxygen density around (a) weakly charged and (b) strongly charged diatomic solutes. the blue contours indicate water density greater than the bulk value, with the darker blue regions indicating the enhanced water probability density. the black line shows the nonadaptive fixed rw boundary. for the weakly charged diatomic, the adaptive and nonadaptive boundaries coincide. the adaptive and nonadaptive boundaries differ. in order to establish that the accuracy of field-sea is not degraded relative to sea on nonionic solutes, we applied field-sea with both fixed rw and adaptive boundaries to a standard set of 504 neutral small molecules. this set contains an alchemically diverse range of functional groups, for which solvation free energies are available from experiments and tip3p simulations. figure 5 shows 504 neutral solutes solvation free energy from tip3p simulation, from the lpbe (white diamonds) and field-sea (white circles) (see si figure s4 for nonadaptive fixed rw field-sea results). field-sea shows a rmse (root-mean-square error) of 1kt with a negligible mse (mean-signed error), comparable to the original sea and considerably better than the lpbe, which bears a systematically negative error. while the fixed rw boundary field-sea results are comparable to the lpbe (table 1), it overestimates the free energy when weakly charged c atoms are neighbored by highly charged o or n atoms, as in the cases of alcohols, amines, ethers, and esters (si table s5). these errors arise because the fixed rw boundary can not capture water molecule penetration into the c atom s solvent-accessible surface (see figure 4b), situations the adaptive boundary handles directly. therefore, while these are simply neutral solutes, collective solute interactions still play a clear role in their overall hydration. figure s5 (si) compares the total solvation free energy from field-sea with experimental results. the mse/rmse of field-sea to experimental solvation free energy (0.67/1.45 kcal/mol, table s6 (si)) is comparable to that of the much more computationally expensive tip3p water model (0.66/1.22 kcal/mol). these results indicate that field-sea can accurately compute solvation free energies over the full range from charge-dense ions to neutral polar and nonpolar molecular solutes. here, we test field-sea on an expanded set of molecular ions and biomolecules (e.g., acetate, butylammonium, etc.; see si table s7 for the complete list and results). these are ions that are larger and more complex than the simple atomic and diatomic ions described above and should better test the need for adaptive boundary considerations. figure 5 compares solvation energies from lpbe (orange diamond) and field-sea (orange circle; see si figure s6 for field-sea results with a fixed rw boundary) with tip3p results for 35 molecular ions. the errors for both lpbe and field-sea with a fixed rw boundary are around 10 kcal/mol (table 1). while this might be regarded as acceptable in light of the nearly 100 kcal/mol span of free energies covered in the tip3p simulations, using an adaptive boundary with field-sea has half of this rmse. field-sea also performs well in multivalent molecular ion solvation (si figure s7) and is as accurate as explicit-solvent calculations compared to experimental values for ionic solute solvation (table s6 and figure s8, si). md simulations of gsolv for 504 neutral solutes (white), 35 molecular ions (orange), and 22 capped amino acid dipeptides (cyan) in tip3p water, compared to (a) lpbe and (b) field-sea. we also tested our methods on 22 capped amino acids (n-acetyl-x-methylamide, x=glu, arg, leu, etc.; si table s8), which are widely used biological models in both theoretical studies and experiments. these are useful precursor structures for the foundation of hydrophobicity scales, used in estimating the solvation of larger biomolecular structures. here, we investigate the solvation free energies of a full series of capped amino acids with field-sea. as the size of solute increases, computing the total solvation show, lpbe (cyan diamond) and field-sea (cyan circle) both yield solvation free energies that agree well with tip3p calculations. again, the adaptive boundary helps field-sea considerably, cutting the rmse to half of that seen from the lpbe or fixed rw cases. these results indicate that the accuracy of field-sea does not degrade as the solute size further increases. the solvation boundaries in field-sea are made from a set of surface dots. above, we used 80 dots/atom, the same as was used in previous sea studies. what is the minimum number of grid dots that we need to properly represent the first-shell boundary? to investigate this, we performed an analysis of accuracy versus relative computational time as a function of the granularity of the boundary. this analysis indicates that the rmse for field-sea results on the 504 neutral molecule set is essentially uncompromised even down to a granularity of 5 dots/atom, without increasing the rmse above 1 kcal/mol (figure s9 and s10 (si), the granularity does not affect the accuracy for charged solutes either). at 5 dots/atom, field-sea is roughly 5-fold faster than dipolar sea at 80 dots/atom, the minimum surface granularity recommended for this method. these results indicate that while field-sea is sensitive to the physicality of the solvation boundary, it is less sensitive to the granularity of its depiction. we have described field-sea, a method for computing solvation free energies of solutes in water. it improves upon an earlier method called sea (semi-explicit assembly). sea captured the physics of solvation by presimulating toy spheres in explicit water, collecting a database of structural and energetic properties of those waters and then assembling at run time the solvation physics as sums over appropriate toy spheres to properly represent a given solute. in field-sea, this procedure differs in using a solvation free-energy field, rather than explicit waters. furthermore, field-sea uses an adaptive boundary, allowing solvating waters to approach a solute atom to different degrees depending on neighboring atoms. relative to sea, field-sea captures the solvation free energies of ions and charged solutes accurately, is faster to compute, and has no degradation of performance on nonpolar and polar solutes. both sea and field-sea offer advantages over implicit-solvent modeling in that they entail no adjustable solute atom radii parameters. sea and field-sea are built upon a corresponding force field and explicit-solvation model. here one of the key observations that arises from our md simulations of charged solutes in tip3p water, which is captured by field-sea, is that atoms that are adjacent to charged atoms in solutes acquire partial characteristics of those charged atoms. for example, a weakly charged atom s solvation shell is shrunk by its neighboring big charges. an implication of this for implicit-solvent modeling is that atomic radii should not be treated as fixed for solvation in water; an atom s radius in implicit-solvent modeling can depend on the nature of its neighboring atom.

previous work describes a computational solvation model called semi-explicit assembly (sea). the sea water model computes the free energies of solvation of nonpolar and polar solutes in water with good efficiency and accuracy. however, sea gives systematic errors in the solvation free energies of ions and charged solutes. here, we describe field-sea, an improved treatment that gives accurate solvation free energies of charged solutes, including monatomic and polyatomic ions and model dipeptides, as well as nonpolar and polar molecules. field-sea is computationally inexpensive for a given solute because explicit-solvent model simulations are relegated to a precomputation step and because it represents solvating waters in terms of a solute s free-energy field. in essence, field-sea approximates the physics of explicit-model simulations within a computationally efficient framework. a key finding is that an atom s solvation shell inherits characteristics of a neighboring atom, especially strongly charged neighbors. field-sea may be useful where there is a need for solvation free-energy computations that are faster than explicit-solvent simulations and more accurate than traditional implicit-solvent simulations for a wide range of solutes.

PMC4065164

pubmed-179

the risk of stroke and myocardial infarction is considerably increased in subjects with diabetes. already at the time of diagnosis of type 2 diabetes, many patients have manifest cardiovascular disease (cvd). this could be due to a long presymtomatic period with increased glucose level as evident by the increased cvd risk already present with impaired glucose tolerance (igt). thus, interest has focused on factors, not only glucose levels, in the prediabetic state that would increase the atherothrombotic process. a common, possibly genetic, antecedent of both type 2 diabetes and cvd has been proposed as the " common soil " hypotheses. recently, markers of inflammation, such as highly sensitive c-reactive protein, have been found to predict type 2 diabetes in long-time follow up of population samples, although adjusting for measurements of obesity attenuates the relationship [8-12]. such markers are weakly related to variables reflecting endothelial function such as adhesion molecules and von willebrant factor. in a large population-based study, also increased plasma levels of plasminogen activator inhibitor-1 (pai-1) were strongly related to the development of diabetes independent from insulin resistance and obesity. the possibility of elevated pai-1 being a very early risk marker of the insulin resistance syndrome and diabetes was raised. furthermore, haemostatic variables related to endothelial function, such as von willebrant factor and factor viii, also predicted diabetes, especially in women. data are lacking regarding other aspects of the fibrinolytic system and the development of diabetes, such as the activities of pai-1 and tissue plasminogen activator (tpa) or the mass concentration of the endothelial-derived tpa (" tpa antigen "), factors related to cvd [15-19] thus, there are two questions related to fibrinolytic variables and the development of diabetes. firstly, do subjects with normal glucose tolerance, who later convert to diabetes, have disturbances in the fibrinolytic system and endothelial function that could explain their increased risk of cvd even before diabetes ensues? if so, do these changes predict future diabetes, independent of the influence of the insulin resistance syndrome, thereby pointing to other pathways to the diabetic state such as endothelial dysfunction? we studied fibrinolytic activity, as measured by tpa and pai-1 activity, and a marker of endothelial dysfunction, as measured by tpa antigen, in a population sample with normal glucose tolerance at baseline and analysed data according to conversion to diabetes or not over nine years of follow-up. this study was performed within the framework of the northern sweden monica study. in 1990 a total of 2,000 randomly selected subjects aged 25 to 64 years were invited. in all, 1,583 persons participated (79.2%). a 75-gram oral glucose tolerance test (ogtt) was performed after an overnight fast in a randomly selected subset of subjects without known diabetes. venous plasma glucose samples were analysed by the hexokinase method (boehringer mannheim automated analysis for bm/hitachi system 717). glucose tolerance was classified according to who criteria from 1999: normal glucose tolerance (ngt) fasting glucose<7 mmol/l and post load glucose<7.8 mmol/l, impaired glucose tolerance (igt) fasting glucose<7 mmol/l and post load glucose 7.811.0 mmol/l, and diabetes fasting glucose 7.0 weight was measured with a balance scale to the nearest 0.2 kg, and height was measured to the nearest centimetre. bmi was calculated as total body weight (kg)/height (m). waist circumference was measured midway between the lower rib margin and the iliac crest, which in most occasions was identical with the level of the umbilicus. all measurements were done in a standing position while breathing normally, and participants were asked to wear light underwear and remove shoes. for the measurement of waist circumference, the recording was done after a gentle breath-out. tpa and pai-1 activities were determined by chromogenic assays, spectrolyse/fibrin and spectrolyse/pl kit (biopool ab, ume, sweden), respectively. tpa antigen was measured by an enzyme-linked immunosorbent assay method (tintelize tpa, biopool ab). serum insulin was determined by radio immunoassay with a double-antibody solid-phase technique (phadaseph insulin ria, pharmacia diagnostics ab, uppsala, sweden) in 1999, all participants, alive and still living in the area, were recalled for a follow-up examination. the same questionnaire and anthropometrical measurements as in the baseline survey were used. altogether 1,148 (72.5 %) subjects turned up for re-examination. subjects who previously had performed an ogtt with normal or impaired glucose tolerance, and answered no to the question " participants, who denied having diabetes in the baseline survey and answered affirmative to the question " do you have diabetes mellitus? " at follow up, were defined as incident cases of known diabetes mellitus according tho the who criteria from 1999. in november 2002, a questionnaire exploring details related to the diagnosis of diabetes, and to the type and duration of current hypoglycaemic treatment was sent to them. case records were scrutinised to confirm diabetes diagnosis and time for start of insulin therapy. subjects that started their insulin treatment within two years of diagnosis were classified as type 1. however, for subjects fulfilling these criteria but with a age of 40 or above at onset, current bmi had to be<27 to be classified as type 1. the research ethics committee of ume university and the national computer data inspection board have approved the northern sweden monica study. means or medians are given for those who remained non-diabetic and those who converted to diabetes. because the distributions for serum triglycerides, insulin and the fibrinolytic variables are highly skewed, we used logarithmically transformed values (i.e. geometric means). the risk of incident diabetes was compared across quartiles of the fibrinolytic variables, calculated from the total sample. logistic regression was used for calculation of odds ratios and 95% confidence intervals (ci) for the development of diabetes comparing the quartile with highest risk with the other three pooled quartiles. stepwise adjustment for age and sex, waist, serum insulin, triglycerides and diastolic blood pressure was used. five hundred and fifty-one subjects who initially had normal glucose tolerance returned for re-examination. a new ogtt was done in 477 of those with normal glucose tolerance and without clinically diagnosed diabetes. thus, there was no repeated ogtt in 13 %, mostly due to logistic reasons such as not being able to turn up in the morning after an over night fast. among persons with initially normal glucose tolerance, in all 15 subjects (2.7 %) had type 2 diabetes diagnosed, either clinically (n=4) or by ogtt (n=11) after a 9-year follow-up or 4,959 person years. fifty-one subjects (10,7 %) worsened from normal glucose tolerance to impaired glucose tolerance. converters from ngt to diabetes were 7 years older and had higher bmi and waist circumference. diastolic blood pressure did not differ but both fasting triglycerides, insulin, fasting and post load plasma glucose were higher in subjects with subsequent diabetes. plasma levels of tpa antigen and pai-1 activity were higher and tpa activity was lower. baseline characteristics of subjects with normal glucose tolerance according to diabetes or not during 9 years of follow-up data are means (sd), median (interquartile range) and [geometric means]. the risk of developing diabetes increased with increasing quartiles of tpa antigen and pai-1 activity and decreased in a similar way for tpa activity (figure 1). in the highest quartile of tpa antigen (above 8.7 g/l) nearly 9% had incident diabetes compared to none in the lowest quartile. incidence of type 2 diabetes over nine years in subjects with normal glucose tolerance according to baseline quartiles of fibrinolytic variables. the number of cases in each quartile for tpa activity was 7, 4, 3 and 1. corresponding numbers for tpa antigen was 0, 1, 2 and 12 and for pai-1 activity 2, 1, 3 and 9, respectively. p values for x(linear by linear association) were 0.026 for tpa activity,<0,001 for tpa antigen and 0,007 for pai-1 activity. logistic regression was performed with an initial model adjusting for age and sex. in a second model, waist circumference was added and in a third model, also diastolic blood pressure, serum insulin and triglycerides were added. quartiles 13 of tpa antigen and pai-1 activity were contrasted with the fourth quartile and, for tpa activity, the first quartiles with quartile 24 (table 2). logistic regression analysis for fibrinolytic variables at baseline with incident type 2 diabetes as the dependent variable. the lowest quartile of tpa activity was associated with a 3-fold increase in the risk of diabetes, which was attenuated after adjustment for waist circumference. after further adjustment for diastolic blood pressure, fasting insulin and triglycerides, no prediction from low tpa activity on diabetes development was seen. subjects in the highest quartile of tpa antigen experienced more than a ten-fold increase in risk, although the confidence intervals were wide due to few cases. taking waist circumference into account, the odds ratio diminished to 6.7 and diminished further to 5.5 when adjusting for blood pressure, triglycerides and insulin. this lead to somewhat higher age- and gender adjusted odds ratio (7.4; ci 1.830, p value 0.005). exchanging diastolic with systolic blood pressure did not change the findings. furter adjustment for leisure time physical activity reduced the odds ratio from 5.5 to 5.1 (p value 0.03). high pai-1 activity increased the risk of diabetes four-fold, although the result was attenuated to an insignificant or of 2.0 when all factors were adjusted for simultaneously. the risk of developing diabetes or igt during follow up (n=66) increased stepwise across quartiles of tpa antigen, from 7.8% to 19.8% (p=0,003, test for linear trend). when adjusted for age and sex, the odds ratio for the highest vs. the three lower quartiles of tpa antigen was 1.9 (ci 1.011.6, p=0.04) but diminished further when also waist circumference was adjusted for, or=1.3 (ci 0.636.5, p=0.5). subjects with normal glucose tolerance, who subsequently develop type 2 diabetes over the ensuing nine years, are already at baseline characterised by impaired fibrinolysis and endothelial dysfunction. low tpa activity and high pai-1 activity is mainly explained by the presence of abdominal obesity but also by other metabolic disturbances characteristic of the insulin resistance syndrome, such as high serum levels of triglycerides and insulin. a novel finding, in this context, is that a high plasma level of the endothelial-derived tpa is only slightly explained by such factors. thus, the development of type 2 diabetes is preceded by many years of perturbations in fibrinolytic and endothelial function, which increases the risk of atherothrombotic disease long before overt diabetes is present. pa1-1 is partly synthesised in fat cells and its activity is strongly related to abdominal obesity as mirrored by high waist circumference or whr. high circulating levels of pai-1 inhibit tpa released from the vessel walls and lead to low levels of free tpa, i.e. low tpa activity and impaired capability of thrombolysis. the only report of an association between fibrinolysis and the development of diabetes is a recent study where pai-1 antigen was an independent predictor of diabetes in american-mexicans that were followed up to 5 years. there is no known pathway whereby impaired fibrinolysis would increase insulin resistance or decrease insulin release and our finding that high pai-1 and low tpa activity precedes diabetes probably mirrors the strong relationship with intraabdominal fat and circulating levels of free fatty acids. a recent experimental study show an almost three fold increase in the level of pai-1 antigen with an infusion of triacylglycerol in healthy subjects without any impact on tpa. this effect was noted with constant levels of insulin and glucose and also increased levels of soluble vascular cell adhesion molecules-1 was found. this support our findings that adjustment for baseline triglyceride levels, which were increased in converters, did not significantly change the relationships noted for tpa antigen but did decrease those for pai-1. it is thus possible that also tpa concentration is an inflammatory marker although we found low correlations between tpa antigen and fibrinogen and highly sensitive crp (own unpublished data). recently, it was described in type 2 diabetes patients, that increased levels of tpa antigen, among other endothelial markers, predicted the development of urinary albumin excretion, a strong marker for cvd risk. these findings should be related to recent reports where inflammatory markers predict the development of diabetes in longitudinal studies. in most cases, pro-inflammatory substances derived from abdominal fat tissue may be the common background for these findings. we therefore find it plausible that the relation between high tpa and diabetes is a marker of some early disturbance in the vascular wall that operates independent of obesity and inflammation. already borderline hypertension is associated with high concentrations of tpa antigen, even after adjustment for abdominal obesity, insulin and triglycerides. thus, tpa mass may mirror an endothelial dysfunction that is not causally related to the insulin resistance syndrome but acts by a parallel pathogenetic mechanism leading to atherothrombosis [30-32]. insulin resistance, on the other hand, is associated with endothelial dysfunction and impaired vasodilatation due to defects in endothelium-derived nitric oxide. taken together, these findings put focus on the role of the vessel walls in the pathogenesis of type 2 diabetes. the relevance of impaired fibrinolysis, i.e. low activity of tissue plasminogen activator (tpa) or high activity of its inhibitor (pai-1), as independent risk factors for cvd is unclear, as these variables seem to mirror most components of the insulin resistance syndrome. in some studies, decreased fibrinolysis, as measured by high pai-1 activity, has been associated with cardiovascular events. high levels of tpa antigen independently predict cardiovascular events both in a healthy population and in patients with prevalent coronary disease. the major shortcoming of our study is the small number of incident cases of diabetes leading to wide confidence intervals. on the other hand, the odds ratios for tpa antigen are high and consistent and based on a truly representative population sample where basal normal glucose tolerance was well defined, as were the incident cases of diabetes. thus, the risk of bias due to selection or case ascertainment should be low. admittedly, the lack of a renewed ogtt in 13% of the subjects could contribute to some misclassifiaction and dilute the results somewhat. the early prediabetic state, with normal glucose tolerance, is characterised by both impaired fibrinolysis and endothelial dysfunction years before glucose levels increase. changes in endothelial function are independent from the insulin resistance syndrome and point towards a distinctly different pathway both for cardiovascular disease and for the development of diabetes. to answer a classical question from 1990 yes, the clock for coronary heart disease seems to start ticking before the onset of clinical diabetes! bmi=body mass index ci=confidence interval crp=c-reactive protein cvd=cardiovascular disease igt=impaired glucose tolerance monica=monitoring of trends and determinants of cardiovascular disease ngt=normal glucose tolerance ogtt=oral glucose tolerance test pai-1=plasminogen activator inhibitor-1 tpa=tissue plasminogen activator me drafted the research on fibrinolysis within the monica project, performed the statistical analysis and drafted the manuscript. bs and bl participated in the design of northern sweden monica study and participated in its design and coordination. supported by grants from norrbotten and vsterbotten counties, by the joint committee of northern sweden health care region, the swedish public health institute and the swedish medical research council.

backgroundimpaired fibrinolysis is found in impaired glucose tolerance and type 2 diabetes, associated with components of the metabolic syndrome. there are no data concerning fibrinolysis in subjects with normal glucose tolerance that convert to diabetes. methodswe studied the activities of tissue plasminogen activator (tpa) and plasminogen activator inhibitor-1 (pai-1) and the levels of tpa antigen (a marker of endothelial dysfunction) in 551 subjects with normal glucose tolerance in 1990 in relation to incident diabetes during nine years of follow-up. resultssubjects with diabetes at follow-up (n=15) had significantly lower baseline tpa activity and higher pai-1 activity and tpa antigen than non-converters. the risk of diabetes increased linearly across quartiles of pai-activity (p=0.007) and tpa antigen (p<0.001) and decreased across quartiles of tpa activity (p=0.026). the risk of diabetes with low tpa activity or high pai-1 activity persisted after adjustment for age and sex but diminished to a non-significant level after further adjustments. the odds ratio of diabetes for high tpa antigen was 10.4 (95% confidence interval 2.740) adjusted for age and sex. after further adjustment for diastolic blood pressure, waist circumference, insulin, triglycerides, fasting and post load glucose the odds ratio was 6.5 (1.333, p=0.024). conclusionsimpaired fibrinolysis and endothelial dysfunction are evident in subjects with normal glucose tolerance who later develop diabetes. high tpa antigen is predictive of future diabetes independent from the metabolic syndrome.

PMC328088

pubmed-180

adverse drug reactions (adrs), including interactions, in older people are a common cause of admission to hospital1 and are also a common cause of disease in hospitalized patients. frail elderly patients appear to be particularly at risk of adrs. in some cases, this is because insufficient account is taken of the effect of age and frailty on the pharmacokinetic and pharmacodynamic of the drug, especially in relation to hepatic2 and renal elimination.3 although many adrs are recognized during the drug development process and before licensing, this is not always the case, especially when they are uncommon or rare.3 moreover, patients with severe cognitive impairment may not be able to refer symptoms related to an adr, making the recognition of this clinical condition a medical problem.4 rhabdomyolysis is a clinical and laboratory syndrome that is caused by various etiologies, involving the skeletal muscle.5 rhabdomyolysis is characterized by the leaking of myoglobin and other intracellular proteins and electrolytes into the circulation, and may be associated with a wide variety of diseases, injuries, medications, and toxins.5 it is important to recognize drug-induced rhabdomyolysis because clinical effects are usually reversible.4 rhabdomyolysis related to macrolide-statin interaction has previously been described.68 clarithromycin, like other macrolides, is an inhibitor of cyp450 3a4, the major enzyme responsible for the metabolism of several drugs, in particular some statins like simvastatin and atorvastain.69 to date, rhabdomyolysis related to clarithromycin has been reported in only one previous case report.10 we report the case of a 90-year-old caucasian male, admitted to the university hospital of pisa for dyspnea, who experienced rhabdomyolysis related to clarithromycin treatment. a 90-year-old caucasian male was admitted to the university hospital of pisa for dyspnea. he had experienced dyspnea for 2 weeks, and showed signs of pneumonia after a chest x-ray was performed. the patient was affected by alzheimer s disease, in advanced phase, and did not take any home-medication as referred by his general physician. at admission in the emergency room, clinical workup revealed mental confusion (the relatives referred progressive cognitive impairment for several months), sinus tachycardia (115 beats per minute), basilar wheezes, and rhonchi. body temperature was 36.6c with normal systemic blood pressure (140/80 mmhg), diuresis, and blood oxygen saturation (so2% 96.2%). routine laboratory exams, including complete blood cell count, thyroid hormones, liver (aspartate aminotransferase and alanine aminotransferase) and muscle (creatine kinase [ck ]) enzymes, as well as the coagulation pattern, resulted within normal limits. serum brain natriuretic peptide was measured and a cardiac markers curve (including myoglobin) was also started, ruling out cardiogenic dyspnea. blood potassium and creatinine concentrations were 4.96 meq/l (reference range 3.55 meq/l) and 122.8 mol/l (reference range 4590 a diagnosis of acquired pneumonia was made and treatment with ceftriaxone (1 g four times daily, intravenous), hydration (crystalloid 1.5 l/day), aerosol with salbutamol and oxitropium, o2 inhalation (3 l/minute), and dalteparin (2500 ui, subcutaneous) was started. after the geriatric ward admission, clarithromycin (500 mg two times daily, intravenous) was also started. on the second day of hospitalization, for continuing sinus tachycardia, in the absence of any evident causes (fever, hypotension, arterial-venous fistula, thyrotoxicosis, suspected drug treatments, etc) beta-blocker treatment (bisoprolol 1.25 mg, daily) was added and a cardiac markers curve was restarted (figure 1). the second point of the curve, almost 6 hours after the third clarithromycin dose, revealed a huge myoglobin increase (1144 ng/ml; 8.5 times the upper normal range [28138 ng/ml ]) without electrocardiogram modifications. u/l; 6.5 times the upper normal range [38180 u/l ]) along with a mild creatinine increase (152.9 mol/l), in the absence of liver enzyme alterations (aspartate aminotransferase, alanine aminotransferase). urine color concomitantly changed toward dark brown and hemogasanalysis revealed a slight respiratory insufficiency type 1 with normal ph. a diagnosis of rhabdomyolysis was made and clarithromycin was stopped, while the concomitant therapy with ceftriaxone, bisoprolol, and aerosol with salbutamol and oxitropium was continued. the patient was immediately treated with intravenous crystalloid hypotonic solution (80 ml/hour) and corticosteroid (40 mg methylprednisolone, intravenous). serum ck and myoglobin levels decreased within a few days and a chest x-ray showed significant improvement. the patient was discharged home on the sixth hospital day (figure 1) with the diagnosis of iatrogenic rhabdomyolysis and acquired pneumonia of unknown etiology. indeed, serum and urinary antigen and antibody exams excluded the presence of legionella pneumophila, streptococcus pneumoniae, and mycoplasma pneumoniae while virus infection assessments were not performed. clarithromycin, like other macrolides, is an inhibitor of cyp450 3a4, the major enzyme responsible for the metabolism of several drugs, in particular some statins as simvastatin and atorvastatin.3,69 rhabdomyolysis related to macrolide and statins interaction has previously been described; however, rhabdomyolysis related to clarithromycin has been reported in only one previous case report.8,10 in our case, there was an evident temporal sequence between clarithromycin exposure-withdrawal and the onset-recovery from rhabdomyolysis biochemical signs, while other potential causes of muscle damage were reasonably excluded. accordingly, the naranjo probability scale confirmed a probable relationship (score 6/9).13 a general physician and a nurse followed the patient at home, thus we are confident the home care was carried out in a correct manner, ruling out mistakes and accidental drug intake. moreover, an interaction with other concomitant medications was improbable considering the rapid resolution after clarithromycin withdrawal and the elimination pathways of the concomitant drugs (both bisoprolol and ceftriaxone have hepatic and renal elimination routes).11,12 in addition, bisoprolol was administered at the minimal dose (1.25 mg) and both bisoprolol and ceftriaxone, as single therapy, were never related to an adverse drug reaction like rhabdomyolysis. we ruled out infection as the possible cause of muscle damage considering the sequence of the events. in fact, the patient was admitted to the hospital for dyspnea developed at home since 2 weeks, while serum ck suddenly increased 2 days after hospital admission. if rhabdomyolysis had been caused by the infection we would have expected that serum ck increased earlier, thus being already evident at hospital admission. moreover, the diagnosis of rhabdomyolysis, unless there is a high index of suspicion, can be missed since muscular pain, swelling, and tenderness may not be prominent or even absent. the definitive diagnosis should be made by laboratory tests including serum ck and urine myoglobin.5 in our case, the patient had advanced cognitive impairment making him unable to easily refer any symptom, and the diagnosis was made by the huge elevation of biochemical markers (6.5 times the upper normal value for ck, 8.5 times for myoglobin). overall, these findings allowed us to make the diagnosis of rhabdomyolysis with sufficient warranty. although clarithromycin associated rhabdomyolysis is mainly due to pharmacokinetic interactions, a direct muscle toxicity might be postuled.5,10

rhabdomyolysis is a clinical and laboratory syndrome that is caused by various etiologies, involving the skeletal muscle. clarithromycin, like other macrolides, is an inhibitor of cyp450 3a4, the major enzyme responsible for the metabolism of several drugs, in particular some statins. rhabdomyolysis related to macrolide statin interaction has previously been described. to date, rhabdomyolysis induced by clarithromycin has been described in only one previous report. we describe the case of a 90-year-old caucasian male, admitted to the university hospital of pisa for dyspnea, who developed rhabdomyolysis associated with clarithromycin administration.

PMC3325014

pubmed-181

haemotropic mycoplasmas (haemoplasmas) are bacterial organisms without cell walls that attach to and grow on the surface of red blood cells. three feline haemoplasma species are described: mycoplasma haemofelis (mhf), candidatus mycoplasma haemominutum (cmhm), and candidatus mycoplasma turicensis (cmt). these feline haemoplasmas are the causative agents of infectious anemia in cats and in several mammalian species. there is also potential interspecies transmission of some of these agents as recorded from cats to immunocompromised dogs. their zoonotic potential has recently been substantiated by the molecular identification of a feline haemoplasma isolate (mhf) in an hiv-positive immunocompromised human patient. the three feline haemoplasma species have different pathogenicities, mhf often resulting in haemolysis and severe anaemia in contrast to cmhm and cmt which are less pathogenic. although several studies worldwide have reported on the epidemiology of feline hemoplasmosis in sick or healthy client-owned pet cats with prevalences ranging from 7.2% to 45.8% [519] and few studies have focused on stray cat (with prevalences from 11.5% to 60% [2024]), there have been no studies investigating stray cats in northern italy. information on regional prevalence of haemoplasmas could be used to limit the spread of diseases in feline populations and for predicting the likelihood of infection in cats presented with anemia. the vector potential of ctenocephalides felis has been demonstrated in experimental mhf infections, and stray cats may play a role in multiplying the organism in fleas that then infest pet cats and dogs and human beings. direct transmission, by aggressive interaction of cats, or interspecies transmission might play a role in the epidemiology of these organisms. in addition, haemoplasmas can be directly transmitted through intravenous infusion of infected blood [4, 26] and have been shown to survive for up to 1 week in stored blood products. as administration of fresh or stored whole blood becoming more common in feline medicine, the knowledge of the regional prevalence of blood transmitted pathogens in owned and stray cats that share the same environment and parasites is increasingly important. this would provide useful information for evaluating the risks of transmission of blood-borne infections from potential blood donors and in the development of optimal screening protocols in blood donors. the aim of this study was to evaluate, using a conventional pcr assay, the prevalence of mhf and cmhm infections in stray cats from colonies in milan and to identify possible risk factors for these infections. during a 2-year collection period (january 2008 to january 2010), blood samples were taken from 260 stray cats from urban colonies in milan (northern italy), under a trap-neuter-release (tnr) program approved by the local authority of the city council. age (estimated based on dentition, animals<6 months of age were considered juvenile, whereas all others were considered adult), gender (male or female), origin (provenance area of colonies), and body condition score (bcs 46, indicating normal weight, 13 underweight) were recorded together with data obtained from physical examination of the cats (healthy or unhealthy). unhealthy cats were defined as cats with one or more of the following clinical abnormalities: lymph node enlargement, pale mucous membranes, stomatitis, or signs of ocular and respiratory infections. the seasonal analysis based on the date of sample collection was grouped as follows: winter (january, february, and march), spring (april, may, and june), summer (july, august, and september), autumn (october, november, and december). the cats were not systematically examined for the presence of ticks or fleas and so rates of ectoparasitism were not recorded. blood samples were collected aseptically from the jugular vein while cats were anaesthetized for neutering and placed in edta-treated tubes and in serum separator tubes. within 24 h of sample collection, a complete blood count (cbc) was performed on whole blood using an advia 120 system (siemens healthcare diagnostics, milan, italy). cats were categorized in terms of presence or absence of anaemia (hct<24%), leukopenia (wbcs count<10,570/l), leukocytosis (wbc>14,390/l), and thrombocytopenia (plt<200,670/l). following separation, serum samples were tested for antibodies to fiv (relative to gp40 and p24 fiv antigens) and for felv p27 antigen with a commercial enzyme-linked immunosorbent assay (elisa) kit (snap felv/fiv combo plus test; idexx laboratories, hoofddorp, the netherlands). toxoplasma gondii sera igg antibodies were detected using indirect fluorescent antibody tests (ifat) performed with a commercial kit (fuller-laboratories, fullerton, ca, usa). titres 1: 64 were considered seroreactive and, therefore, indicative of t. gondii exposure. the results of these serological tests have been already published and were reanalyzed with the present results. conventional pcr was performed on blood samples to amplify dna associated with haemoplasmas (mhf and cmhm). the reaction mixture included 2 l of template dna, 0.25 mm dntps, 0.4 mm of each primer, 1x reaction buffer, and 2.5 u tap dna polymerase (gotaq dna polymerase, promega, madison, wi, usa). primers were used that target part of the 16s rrna gene, producing a 170 base pair (bp) product from mhf and 193 bp amplicon from mchm (forward primer, 5-acg aaa gtc tga tgg agc aat a-3 and reverse primer 5-acg ccc aat aaa tcc gra taa t-3) [6, 31]. pcr products were resolved using 2% agarose gels and fragment size was estimated using a dna molecular weight marker (50 bp dna ladder; promega madison, wi, usa). control reactions were done in the absence of template dna to rule out contaminations during pcr. association between the three groups of haemoplasma status (haemoplasma positive, mhf positive only, and cmhm positive only) and categorical variables (age, gender, colony of origin, bcs, season of sampling, health status, presence or absence of selected clinical and cbc abnormalities, felv/fiv status, and t. gondii test results) were analysed by univariate analysis using the chi-squared test (cell frequencies of>5) or fisher's exact test (cell frequencies of 5). any parameters statistically linked to positive pcr results were used in a logistic regression model to test for independent risk factors associated with infection. descriptive statistics (including minimum, maximum, mean, median, and standard deviation (sd)) were obtained for the continuous variables rbcs count, hct, hb, wbc count, and plt count values. distribution of the data for normality was assessed with kolmogorov smirnov test, and a t-test or a mann-whitney u test, respectively, was used to test the differences between the feline haemoplasma positive and negative cats depending on whether data was normally distributed or not. associations were considered statistically significant when p<0.05. both the p value and odds ratio (or) with 95% confidence interval (ci) are reported. haemoplasmic dna was detected in 33.1% (86/260, 95% ci 26.540.9%) of blood samples. of the positive samples, 28 cats (10.8%, 95% ci 7.215.6%) were infected with mhf and 58 cats (22.3%, 95% ci 16.928.8%) were infected with cmhm. characteristics of the population and association between risk factors and haemoplasma pcr status (negative or positive) are reported in table 1 and between mhf alone and cmhm alone positive results in table 2. none of the risk factors were associated with the pcr results for haemoplasmas (tables 1 and 2), with the exception of negative associations at univariate and multivariate analysis between winter season of sampling and haemoplasma positive status (p=0.01, or=0.29, 95% ci=0.140.61, p=0.001) and cmhm positive status (p=0.01, or=0.29, 95% ci=0.120.70, p=0.01). no significant associations were found with cbc abnormalities and haemoplasma pcr-positive results (figure 1) or in the number of anaemic and nonanaemic cats using a t-test. we present the first study investigating the prevalence of haemoplasmas in urban stray colony cats from the city of milan in northern italy. the prevalence of haemoplasma infection in our sample showed a similar pattern to that reported worldwide in client-owned [57, 915, 1719] and stray cats [1923]. cmhm infection is reported to be the most common infection, ranging from 8% in arizona to 41.6% in portugal; mhf infection was less common ranging from 0.5% in switzerland to 12.8% in portugal and dual infection was absent or rare (no more than 5.4% as found in korea). the prevalence of haemoplasmas in stray cats in our study (33.1%) was higher than that reported in other studies on stray cats performed worldwide (table 4). differences in prevalence among countries can be explained by geographical variation, such as climate, vector distribution, and the cat population surveyed. moreover, direct comparisons of prevalence results are of limited value because of the characteristics of sample of cat populations investigated (number of cats included in the study, healthy versus sick cats), inclusion criteria, diagnostic techniques (molecular tools versus microscopical detection), different statistical methods, stage of infection (acute versus chronic), or a combination of all them, resulting in differences between studies. stray cats in this study had higher rates of infections than those reported for pet cats in northern italy, in which 18.9% of pcr tested cats were reported to be haemoplasma positive. a high incidence of haemoplasmas in stray cats is not surprising as outdoor access is a recognized risk factor for infection. for example, in a study on haemoplasma in client-owned cats from barcelona (spain), outdoor access was found to be a risk factor for infection (or=3.8). additionally, in a study involving feline blood donors from the usa, the prevalence of haemoplasmas was 19.7% in domestic cats with outdoor access and only 3.6% in domestic cats not allowed outdoors. free-ranging cats may have more exposure to bloodsucking arthropods and exhibit a higher fighting activity than owned indoor cats; thus they might experience a higher infection risk for haemoplasmas. in our study there was a negative statistical association between sampling in the winter season and haemoplasma pcr-positive status and cmhm positive status. this may be due to reduced outdoor activity of fleas in winter seasons, although this hypothesis is purely speculative. there were no statistically significant differences or any relationship between the presence of haemoplasma infection and anaemia status or hct levels between positive and negative haemoplasma group. this finding was somewhat surprising and was in agreement with studies undertaken in client-owned cats in switzerland and in italy, which also found no association between haemoplasma infection and anaemia or hct variations. in addition, other studies have failed to demonstrate a significant difference in prevalence rates of haemoplasma between healthy and anaemic cats [10, 32]. these results could be explained by the higher prevalence of cmhm (a less pathogenic species than mhf) in this and previous studies or by the fact that the stage of infection is not known in our cats with a positive pcr result, since chronically infected cats that recover from acute illness may be asymptomatic. another explanation for the lack of association between infection status and the presence of anaemia in the present study could be that the hct was known only for 150 of the 260 cats tested. epidemiological data on haemoplasma are particularly important in areas where feline blood donor programmes are active, as in milan where a donor programme has been running since 2010 at university veterinary transfusion unit (rev, reparto di medicina emotrasfusionale veterinaria). feline haemoplasmas can be directly transmitted by intravenous infusion of fresh edta-anticoagulated blood, heparinized blood, and by infusion of blood stored in cpda-1 solution for 1 h (mhf) and 1 week (cmhm). cats do not reliably eliminate the organism following infection and most infections with cmhm are chronic and asymptomatic. a significant number of asymptomatic cats are positive for haemoplasma infection and may play a role, along with infected cats, in the maintenance of haemoplasma infection within a population. all these characteristics of feline haemotropic mycoplasma infection need to be considered when choosing potential blood donors. the limitations of this study include the lack of information on candidatus mycoplasma turicensis in our study population. lastly, statistical analysis was limited in some groups because of the sample size and so some conclusions or associations may be affected by type i errors; that is, no difference between haemoplasma positive and negative groups was observed due to insufficient sample size; for example, no association was recorded between anaemia and a positive haemoplasma result because of the low number of mhf positive cats (28/260). regardless of these limitations, we believe that this study provides new and useful information on feline haemoplasma infections in stray cats in italy. from this study it can be concluded that feline haemotropic mycoplasma mhf and cmhm are common in the stray cat population of milan. indeed, pet cats with outdoor access in this region should be regularly monitored and treated for ectoparasites to minimize health risks. importantly, feline blood donors in this area should undergo pcr screening for these infections before donations and preferably donors should be drawn from exclusively indoor cats that receive regular flea control.

this study investigated the prevalence of feline haemoplasma infections in a number of stray cat colonies in milan, northern italy. blood samples from 260 stray cats were evaluated, with conventional pcr, for the presence of dna associated with mycoplasma haemofelis (mhf) and candidatus mycoplasma haemominutum (cmhm). odd ratios (or) were calculated to identify risk factors for haemoplasma infections. pcr was positive in 86 out of 260 subjects (33.1%), with a prevalence of 10.8% (28/260 cats) for mhf and 22.3% (58/260 cats) for cmhm. no coinfections were registered. there were significant associations between infections and season of sampling, that is, a negative association between winter sampling and a haemoplasma positive status (or=0.29, p=0.001), or cmhm positive status (or=0.29, p=0.01). haemoplasma infections are common in stray cats in milan. thus, domestic cats with outdoor access should be routinely monitored and treated for ectoparasites to minimize risks of disease acquisition. moreover, as these infections are transmitted via blood, feline blood donors from this area should be screened by pcr and preferably be drawn from a population of indoor cats regularly treated for fleas.

PMC3953429

pubmed-182

crh is a 41-amino-acid peptide hormone synthesized in the paraventricular nucleus of the hypothalamus. its function in the central nervous system is to stimulate the hypothalamic-pituitary-adrenal (hpa) axis as part of the stress response. crh is also produced in peripheral tissues including the placenta of humans and hominine primates [13]. placental crh secretion results in an exponential rise of crh concentration in maternal plasma during the third trimester of gestation. the rate of the increase is related to gestational length, since the rise of crh level is accelerated in pregnancies ending with preterm birth, while the increase is retarded in pregnancies that continue after term. because of this relationship, it is believed that the regulation of placental crh production is linked to the mechanism that determines the length of pregnancy and triggers labour and delivery. the mechanism regulating the exponential increase in placental crh expression remains unclear although positive feedback by glucocorticoids and increasing numbers of syncytial cell nuclei are suggested explanations [5, 6]. spontaneous and agonist-induced syncytium formation by cytotrophoblasts is associated with crh expression with camp being a strong stimulant of both syncytial differentiation and crh gene activity. molecular studies using crh promoter-reporter constructs indicated that transcription factor complexes bound to a consensus cyclic-amp response element (cre) at 224 bp upstream of the major transcription initiation site mediated the camp-stimulation, although a nonconsensus second promoter site was also implicated in the cyclic nucleotide response [811]. it has been suggested that these molecular interactions are involved in the gestational age dependent control of crh gene activity. epigenetic chromatin modifications define cell-specific gene expression potential and alter gene expression patterns during cell differentiation and development. methylation of cytosines at cpg dinucleotides in dna is a well-characterized epigenetic chromatin modification generally associated with closed chromatin structure and gene repression. furthermore, methylation of cpg sites within particular transcription factor binding sequences may modify transcription factor binding affinity and alter regulatory changes in gene expression [1417]. the human crh proximal promoter contains 9 cpg dinucleotides with one located within the methylation sensitive cre sequence. in addition, the promoter is within 1000 bp distance from an intragenic cpg island, which corresponds to a cpg island shore region, the methylation of which is related to tissue specific gene expression. therefore, in the present investigation we have explored the possibility that methylation of the promoter contributes to the control of crh expression in trophoblast cells. we used the bewo choriocarcinoma cell line in the experiments, which is a well-characterized trophoblast model exhibiting dynamic dna methylation as well as ability to syncytialise and increase crh expression when stimulated with camp [1921]. the bewo human choriocarcinoma-derived cell line was obtained from the american type culture collection (manassas, va, usa) (atcc #ccl-98). the culture medium was dmem/f12 (with hepes and l-glutamine, without phenol red) supplemented with 10% (v/v) fetal bovine serum (fbs) and 1x antibiotic-antimycotic (gibco/life technologies, mulgrave, vic, australia). cells were cultured at 37c in a humidified atmosphere of 5% co2 in air. at approximately 80% confluence cells were detached with trypsin/edta solution (gibco), washed, counted, and transferred into six-well plates at a density of 0.8 10 cells/well. cultures reaching 50% confluence were incubated with fresh medium with or without 8-br-camp (8-bromoadenosine-3,5-cyclic monophosphate, 2.5 10 mol l) and/or 5-aza-dc (5-aza-2-deoxycytidine, 5 10mol l) (sigma-aldrich, sydney, nsw, australia) followed by harvesting for rna and dna isolation. drug concentrations were optimised in previous studies and showed no toxic effects in bewo cells at the concentrations and exposure times employed [19, 22, 23]. rna was extracted from cells using the rneasy mini kit (qiagen, chadstone centre, vic, australia) according to the manufacturer's protocol. rna was eluted from the rneasy spin columns with 30 l of rnase-free water and quantified using a nanodrop 1000 spectrophotometer (thermo fisher scientific australia, scoresby, vic, australia). contaminating dna was removed by dnase treatment using the turbo dna-free kit (ambion/life technologies) following the routine protocol. the total reaction volume was 20 l including 2 l of 10x dnase buffer, 1 l of dnase, and up to 2 g of rna. rna integrity in all samples was assessed by agarose gel electrophoresis. prior to reverse transcription, the rna samples were spiked with 5 10 copies of alien rna transcript (supplied with the alien qrt-pcr inhibitor alert kit, stratagene/integrated sciences, chatswood, nsw, australia) per microgram rna. the alien rna transcript served as a reference rna of equal abundance in all samples and pcr runs. rna was reverse transcribed using the superscript iii first-strand synthesis system for rt-pcr (invitrogen) with random hexamer primers. real-time pcr was performed using an applied biosystems 7500 real-time pcr system with reagents supplied by the manufacturer (applied biosystems/life technologies). the amplification reaction contained template cdna from 20 ng of reverse-transcribed rna, 6 10 moles l forward and 3 10 moles l reverse primer, sybr green master mix, and milliq water to a total volume of 25 l. the crh cdna primers were designed and optimised by sehringer et al. and are listed in table 1. primer sequences for amplifying alien cdna are proprietary and were used according to the manufacturer's instructions (stratagen/integrated sciences). the temperature sequence was 50c for 2 min, 95c for 10 min, 40 cycles of 95c for 15 s, and 60c for 1 min, followed by melting curve analysis. no-template control and no-reverse transcriptase controls for all samples were included to detect residual genomic dna. expression levels of the crh mrna were determined relative to alien rna according to the ct method. cells grown in six-well plates were collected in 750 l pbs (phosphate-buffered saline; 137 10mol l nacl, 2.7 10 mol l kcl, 8 10mol l na2hpo4, and 2 10 mol l kh2po4, ph 7.4) using cell scrapers and centrifuged for 5 min at 300 g. cell pellets were resuspended in 200 l of pbs and processed for dna isolation as per the manufacturer's instructions. genomic dna was eluted from the mini spin columns with 200 l milliq water, quantified using the nanodrop 1000 spectrophotometer, and stored at 4c. up to 300 ng of genomic dna was bisulfite-converted and purified using the methylseqr bisulfite conversion kit (applied biosystems). the crh proximal promoter regions were pcr-amplified using the toptaq master mix kit (qiagen) and two sets of nested primers designed with the methyl primer express software v.1.0 (applied biosystems). pcr reactions contained purified bisulfite-converted dna template, 25 l of 2x toptaq master mix, 4 10 mol l of each primer, and milliq water up to 50 l final volume. the conditions for the first pcr amplification included an initial step at 94c for 3 min, followed by 30 cycles of 94c for 30 s, 54c for 30 s, and 72c for 1 min and a final extension step at 72c for 10 min. one microliter of a 20-fold diluted aliquot of the first pcr reaction was used as template for the second pcr amplification using the nested primer set. pcr conditions were 94c 30 min, 30 cycles of 94c for 30 s, 50c for 30 s, and 65c for 1 min and an extension step at 65c for 10 min. following amplification, 20 l of the pcr reaction mixture was separated by agarose gel electrophoresis and the amplification product was visualised with ethidium bromide. the gel slice containing the amplified dna fragment was excised, extracted, and purified using the wizard sv gel and pcr clean-up system (promega, auburn, vic, australia). the dna was collected in 50 l milliq water by the centrifugation of the sv minicolumn. the bisulfite-converted and pcr-amplified dna was ligated into the pgem-t easy vector using reagents provided by the manufacturer (promega). the 10 l reaction mixtures contained ligation buffer, 3 weiss units of t4 dna ligase, 50 ng of pgem-t easy vector, and pcr product at 3: 1 insert: vector molar ratio. a positive control using the control dna provided and a negative control (no pcr product) were also included. the ligation mixture was used subsequently to transform jm109 competent cells (promega) according to the manufacturer's protocol. fifty l of transformed cell suspension was spread onto duplicate lb/ampicillin/iptg/x-gal plates and incubated at 37c overnight. the white streak colonies were picked the next day and cultured in 5 ml luria broth at 37c overnight. plasmids were isolated from the minicultures using the genelute plasmid miniprep kit (sigma-aldrich, castle hill, nsw, australia). the presence of inserts was verified by digesting an aliquot from each plasmid preparation with ecor i (promega) followed by agarose gel electrophoresis. plasmids containing the expected size inserts (300 bp) were sequenced from both directions by the australian genome research facility (agrf, brisbane, qld, australia). the sequencing primers were designed by promega and produced by invitrogen/life technologies (forward: 5-tatttaggtgacactatag-3, reverse: 5-tatttaggtgacactatag-3). quality control was automatically performed and any sequence with an unacceptably low conversion rate or high number of sequencing errors was excluded. ten randomly selected clones, representing individual gene copies, were processed for methylation frequency analyses from each dna sample using the chi-square test and fisher's exact test as appropriate. significant one-sided tests are reported in cases when the two-sided tests showed borderline significance. the stata (college station, tx, usa) software package was used for the statistical calculations. as shown in figure 1, abundance was not significantly different between 0 h and 24 h and between 24 h and 28 h of incubation. between 48 h and 72 h, a 2.9-fold increase (p=0.029) was observed, which was coincident with the reported spontaneous syncytialisation of bewo cells. in the presence of 8-br-camp (2.5 10 mol l), a powerful stimulant of syncytial differentiation, significant increases of crh mrna level were detected between 0 h and 24 h (p<0.0001), 24 h and 48 h (p=0.03), and 48 h and 72 h (p=0.049, one-sided t-test) with a maximum at 72 h, which was 23.2-fold higher than the 0 h level (figure 1). in cultures treated with the dna methyltransferase inhibitor 5-aza-dc (5 10mol l) a slight, but significant, increase of crh mrna abundance was observed between 0 h and 24 h (1.43-fold, p=0.028, one-sided t-test), but there was no further change between 24 h and 48 h and between 48 h and 72 h. combined treatment with 8-br-camp and 5-aza-dc resulted in robust increases of crh mrna levels between 0 h and 24 h (p<0.0001), 24 h and 48 h (p=0.0026), and 48 h and 72 h (p=0.039) reaching a 86.4-fold rise at 72 h compared to 0 h (figure 1). 8-br-camp increased crh mrna abundance relative to vehicle at all time points (24 h, p=0.0042; 48 h, p=0.0066; 72 h, p=0.0004; figure 1), which confirmed previous findings of the stimulatory effects of 8-br-camp on crh gene expression in bewo cells. 5-aza-dc treatment had no effect at 24 h and 48 h and reduced crh mrna abundance relative to vehicle at 72 h, effectively blocking the increase seen between 48 h and 72 h in vehicle-treated cells (p=0.0021, figure 1). combined treatment with the cyclic nucleotide and the dna methyltransferase inhibitor upregulated crh mrna expression at all time points beyond the level reached in response to 8-br-camp alone (24 h, p<0.0001; 48 h, p=0.0002; 72 h, p=0.0029; figure 1). the significant effects of 5-aza-dc on crh mrna expression suggested that dna methylation was involved in the control of crh gene activity. to explore this further, we have determined the effects of 8-br-camp and 5-aza-dc on the methylation of the 9 cpg sites present in the crh proximal promoter. bisulfite sequencing revealed partial methylation (38% of the 9 cpg sites combined) at 0 h, before treatments commenced (figure 2), which increased spontaneously to 57% (p=0.001) by 72 h of culture. treatment with 8-br-camp (250 m) resulted in a similar increase of methylation (to 61%), not significantly different from the vehicle-treated control. treatment with 5-aza-dc for 72 h reduced promoter methylation to 23%, which was significantly less than the control (p=0.001). combined treatment with 5-aza-dc and 8-br-camp increased the level of methylation compared to 5-aza-dc alone (to 33%, p=0.011) but did not reach the methylation level observed in cells treated with 8-br-camp only (p=0.001, figure 2). clonal bisulfite sequencing determines cytosine methylation with single base resolution in individual alleles (gene copies). the technique enabled us to determine the particular cpg sites that undergo methylation changes under the treatment conditions that influence methylation levels overall, as presented in figure 2. the scheme in figure 3 shows the positions of the 9 methylatable cpg dinucleotides in the human crh proximal promoter. the two major transcription initiation sites and the two sequence regions implicated in the camp-response are also indicated with cpg2 residing within the cre [811, 29]. the heatmap in figure 4 illustrates the methylation levels of the 9 cpgs under the treatment conditions employed. methylation levels were significantly different among the cpg sites ranging from 10% to 70% at 0 h and from 13% to 80% at 72 h of culture (p<0.001, figure 4) indicating site-specific differential methylation. the methylation level of cpgs 1, 2, 3, and 7, but not of cpgs 4, 5, 6, 8, and 9 increased significantly during the 72 h culture period demonstrating that methylation was dynamic at these sites. figure 5 shows the methylation of each cpg in the cloned copies of the crh proximal promoter. the scattered distribution of methylated and unmethylated cpg sites suggests that the partial methylation observed was allele independent both at 0 h and at 72 h of culture. cells treated with 8-br-camp and 5-aza-dc had similar scattered distribution of methylated cpgs in individual alleles (not shown). in cells treated with 8-br-camp for 72 h, the cpg sites remained differentially methylated (from 23% to 73%, p=0.004), and the methylation levels of individual cpgs were not significantly different from the corresponding sites in the vehicle-treated control (figure 4). treatment with the dna methyltransferase inhibitor 5-aza-dc decreased methylation at all cpg sites compared to vehicle, except for cpg 4, where methylation was relatively low. furthermore, 5-aza-dc abolished the differences between the methylation levels of the individual cpgs. the methyltransferase inhibitor eliminated the methylation differences among individual cpgs in the presence of 8-br-camp as well (figure 4). cotreatment with 8-br-camp prevented, however, the demethylating action of 5-aza-dc at cpgs 1, and 8, but not at cpgs 2, 3, 5, 7, and 9 (camp versus camp+aza in figure 4). finally, no individual cpg site exhibited a statistically significant methylation difference in 8-br-camp+5-aza-dc-treated cells compared to treatment with the methyltransferase inhibitor alone (aza versus camp+aza in figure 4) despite the small, but significant, overall increase in methylation (aza 72 h versus camp+aza 72 h, in figure 2). the aim of this study was to explore the involvement of promoter methylation in crh gene regulation in human trophoblast cells. placental crh expression is predictive of gestational length and is influenced by pregnancy disorders [4, 30]. dna methylation is a developmentally regulated epigenetic modification influenced by environmental inputs [31, 32], which can potentially control crh gene expression during pregnancy and in response to pathogenic factors. in our experiments we used the choriocarcinoma-derived bewo cell line, which is a well-characterized trophoblast model exhibiting increased crh gene expression during spontaneous and camp-induced syncytial differentiation similar to normal trophoblasts. our dna sequencing data show that the crh proximal promoter sequence is identical in bewo cells and in normal trophoblasts including all reported transcription factor response elements and the methylation sensitive cpg sites (figure 3). we have shown by clonal bisulfite sequencing that the cpgs within the crh proximal promoter are partially methylated with significant differences among the individual sites. the size of the analysed sequence (261 bp) and the methylation level correspond to an intermediate methylation region, which is a genomic feature implicated in tissue specific epigenetic gene regulation. this is similar to normal trophoblasts, which also exhibit allele independent partial and differential methylation in the crh promoter region. dna methylation increases in bewo cells during culture and the dna methyltransferase inhibitor 5-aza-dc changes cell phenotype and gene expression levels [21, 22, 35]. our results show that the crh promoter follows this general trend, which is different from primary trophoblasts, where crh promoter methylation does not change in culture and remains unaltered by 5-aza-dc and 8-br-camp under the conditions where bewo cells show methylation changes. for this reason, bewo cells are uniquely suited to explore the relationship between crh promoter methylation level and gene activity. methylation of cpg island promoters is associated generally with the repression of gene activity [12, 14, 21]. the crh promoter is located in a cpg island shore region relative to a crh intragenic cpg island (chr8:67,089,250-67,089,962 in the grch37/hg19 assembly, ucsc genome browser). our results showed, however, that neither the spontaneous nor the 8-br-camp-evoked increase of crh gene activity was associated with the demethylation of the crh promoter (figures 1 and 2). treatment with 5-aza-dc decreased crh promoter methylation and abolished the cpg site-specific methylation differences as expected (figures 2 and 4), but it also blocked the spontaneous increase of crh gene expression in culture (figure 1). 8-br-camp-stimulated crh expression strongly in the presence of 5-aza-dc (figure 1), but the cyclic nucleotide actually increased methylation in 5-aza-dc-treated cells (aza 72 h versus camp+aza 72 h in figure 2). thus, crh expression was directly, and not reciprocally, related to promoter methylation under these conditions. this relationship may be unexpected in view of the well-documented global association between gene repression and promoter methylation, but genome wide trends do not necessarily predict the behavior of individual genes. in fact, the methylation level of the cpg-poor class of promoters was found to be uncorrelated with gene activity. the crh promoter falls into the cpg-poor class according to established criteria, with partial methylation in both the hypothalamus and the trophoblast [34, 37, 38] (figure 2). methylation reduces crh gene expression in the hypothalamus as expected; in trophoblastic bewo cells, however, promoter methylation appears to have the opposite effect as detailed before. there is evidence to suggest that this cell-specific regulation may result from the methylation-dependent change of the functional properties of the camp-response element (cre) in the crh promoter (figure 3). the cre is critical in regulating the activity of transfected crh promoter-reporter constructs in trophoblast cells [911]. it contains a cpg dinucleotide that, when methylated, reduces the affinity of cre to its cognate transcription factor, creb, and renders it unresponsive to camp-stimulation [15, 39]. at the same time, the methylated cre has increased affinity to bind the transcription factor c/ebp-alpha, which often activates tissue specific genes during differentiation. the cpg within the cre was 30% methylated under basal (0 h incubation) conditions (cpg2 in figure 4). culturing for 72 h increased cpg2 methylation to 60% concomitantly with enhanced gene expression, while treatment with 5-aza-dc reduced cpg2 methylation to 23% and diminished crh gene activity (figures 1 and 4). considering that c/ebp-alpha is expressed in bewo cells, it is reasonable to conjecture that methylation-evoked changes in the transcription factor binding specificity of the cre may have contributed to the enhanced crh expression observed in association with increased promoter methylation. the cpg2 in the cre was partially methylated under all experimental conditions, which suggests that the unmethylated portion could have mediated stimulation by 8-br-camp using the canonical, creb-dependent pathway. moreover, the crh proximal promoter contains a second, noncanonical camp-response element (figure 3), which contributes to the regulation of the gene specifically in the trophoblast [9, 11]. methylation of the cre may thus function to influence the relative contribution of the two camp-response elements, their associated transcription factors, and the coupled signaling pathways to the overall activity of the crh gene under basal and camp-stimulated conditions. cotreatment with 5-aza-dc strongly augmented the stimulation of crh mrna expression by 8-br-camp, although the dna methyltransferase inhibitor alone had no stimulatory effect under the same culture conditions (figure 1). cotreatment with 5-aza-dc, however, decreased cpg methylation in the cre (cpg2, figure 4) to 43.3% from 70% measured after 8-br-camp treatment (p=0.034, fisher's exact test, one-sided). the increased proportion of unmethylated cres in the cell population could explain, at least partially, the augmented response to 8-br-camp-stimulation. moreover, 5-aza-dc decreases dna methylation globally increasing or repressing the activity of numerous genes [4143]. this suggests the possibility that 5-aza-dc may potentially influence crh expression indirectly through intervening gene products generating synergy between 8-br-camp and 5-aza-dc. although gene activation occurs in 5-aza-dc-treated bewo cells [22, 23, 35], it remains to be established whether transcription factors or other gene products controlled by dna methylation regulate crh expression in trophoblasts. we have utilized the dynamic changes of dna methylation in the bewo cell line to explore the relationship between this epigenetic chromatin modification and crh gene expression in a trophoblastic cell type. clonal bisulfite sequencing revealed the cpg site-specific and allele independent partial methylation of the crh proximal promoter and classified it as an intermediately methylated region of the genome. the data suggest that promoter methylation determines the contribution of the cre, its various associated transcription factors, and a trophoblast specific alternative camp-response element to crh gene regulation. furthermore, our results are consistent with the possibility that dna methylation controls crh expression indirectly, but any intervening factor that may regulate crh expression by a dna methylation-dependent mechanism remains to be determined.

corticotropin releasing hormone (crh) production by the human placenta increases exponentially as pregnancy advances, and the rate of increase predicts gestational length. crh gene expression is regulated by camp in trophoblasts through a cyclic amp-response element (cre), which changes its transcription factor binding properties upon methylation. here we determined whether methylation of the crh proximal promoter controls basal and camp-stimulated crh expression in bewo cells, a well-characterized trophoblastic cell line. we treated the cells with 8-br-camp and the dna methyltransferase inhibitor 5-aza-2 deoxycytidine (5-aza-dc) and determined the effects on crh mrna level and promoter methylation. clonal bisulfite sequencing showed partial and allele independent methylation of cpgs in the crh promoter. crh mrna expression and the methylation of a subset of cpgs (including cpg2 in the cre) increased spontaneously during culture. 8-br-camp stimulated crh expression without affecting the increase in methylation. 5-aza-dc decreased methylation and augmented 8-br-camp-stimulated crh expression, but it blocked the spontaneous increase of crh mrna level. we conclude that the crh promoter is a dynamically and intermediately methylated genomic region in bewo cells. promoter methylation did not inhibit crh gene expression under the conditions employed; rather it determined the contribution of alternative camp-independent pathways and camp-independent mechanisms to crh expression control.

PMC4589633

pubmed-183

in 1985, smith pioneered phage display technology, an in vitro methodology and system for presenting, selecting and evolving proteins and peptides displayed on the surface of phage virion. since then, phage display has developed rapidly and become an increasingly popular tool for both basic research such as the exploration of protein-protein interaction networks and sites [24], and applied research such as the development of new diagnostics, therapeutics, and vaccines [510]. usually, the protein used to screen the phage display library is termed as target and the genuine partner binding to the target is called template. peptide mimicking the binding site on the template and binding to the target is defined as mimotope, which was first introduced by geysen et al.. one type of the most frequently used targets is monoclonal antibody. in this situation, the template is the corresponding antigen inducing the antibody, and the mimotope is a mimic of the genuine epitope.. goes a mimotope is defined as a molecule able to bind to the antigen combining site of an antibody molecule, not necessarily identical with the epitope inducing the antibody, but an acceptable mimic of the essential features of the epitope. mimotopes and the corresponding epitope are considered to have similar physicochemical properties and spatial organization. the mimicry between mimotopes and genuine epitope makes mimotopes reasonable solutions to epitope mapping, network inferring, and new diagnostics, therapeutics, and vaccines developing. powered by phage display technology, mimotopes can be acquired in a relatively cheap, efficient and convenient way, that is, screening phage-displayed random peptides libraries with a given target. however, not all phages selected out are target-specific, because the target itself is only one component of the screening system. from time to time, phages reacting with contaminants in the target sample or other components of the screening system such as the solid phase (e.g., plastic plates) and the capturing molecule (e.g., streptavidin, secondary antibody) rather than binding to the actual target are recovered with those target-specific binders (displaying mimotopes) during the rounds of panning. peptides displayed on these phages are called target-unrelated peptides (tup), a term coined recently by menendez and scott in a review. the results from phage display technology might be a mixture of target-unrelated peptides and mimotopes, and it can be difficult to discriminate tup from mimotopes since the binding assays used to confirm the affinity of peptides for the target often employ the same components as the initial panning experiment. therefore, target-unrelated peptides might be taken into study as mimotopes if the researchers are not careful enough. obviously, target-unrelated peptides are not appropriate candidates for the development of new diagnostics, therapeutics, and vaccines. for mimotope-based epitope mapping, if tup is included in the mapping, the input data is improper and the result might be misleading. there are now quite a few programs for mimotope based epitope mapping, none of them, however, has a procedure to scan, report and exclude target-unrelated peptides [1523]. in this study, we describe a web server named sarotup, which is an acronym for scanner and reporter of target-unrelated peptides. sarotup was coded with perl as a cgi program and can be freely accessed and used to scan peptides acquired from phage display technology. it is capable of finding, reporting, and precluding possible target-unrelated peptides, which is very helpful for the development of mimotope-based diagnostics, therapeutics, and vaccines. the power and efficiency of sarotup was also demonstrated by preliminary tests in the present study. recently, menendez and scott reviewed a collection of target-unrelated peptides recovered in the screening of phage-displayed random peptide libraries with antibodies. they divided their collection into several categories according to the component of the screening system to which target-unrelated peptides bind. very recently, brammer et al. reported a completely new type of target-unrelated peptides. in the review of menendez and scott, target-unrelated selection is due to the binding to contaminants or components other than target; however, in the report of brammer et al., target-unrelated selection is due to a coincident point mutation in the phage library [12, 13]. we compiled a set of 23 tup motifs from the above two references [12, 13], including 12 motifs specific for the capturing agents, 5 motifs specific for the constant region of antibody, 3 motifs specific for the screening solid phase, 2 motifs specific for the contaminants in the target sample, and 1 motif for a mutation in phage library (table 1). the sarotup was implemented as a free online service, powered by apache and perl. three pages are designed and integrated into a tabbed web interface with cascading style sheets codes. the core program of sarotup was sar.pl, a cgi script coded with perl. in this script, the 23 tup motifs were converted to regular expressions, which were then used to match each input peptide sequence. we constructed two-test data sets from [12, 13, 1523, 25, 26]. the first data set contains 8 cases; 6 of them are sourced from test cases used in extant programs for mimotope-based epitope mapping [1523]; the left 2 are cases studies published recently [25, 26]. as shown in table 2, the target of each case in the first data set is monoclonal antibody and the structure of corresponding antigen-antibody complex has been resolved, which is used to derive its structural epitope as the golden standard for evaluation. for each case if target-unrelated peptides were found, a new panel of peptides excluding tup was produced. the old and the new panel of peptides were then used to predict epitope using mapitope or pepsurf [15, 21, 22]. finally, the results were compared to show if sarotup could improve the performance of mimotope-based epitope mapping. the second data set is composed of 100 peptides in raw sequence format. the first group has 77 sequences compiled from the first data set without any known tup motifs; the second group has 23 sequences sourced from [12, 13] with various tup motifs. the mixture of the two groups of sequences made the second data set, which was then used as the sample input and can be used to evaluate the efficiency of sarotup. as a free online service, the web interface of sarotup has successfully been implemented as a tabbed web page. the left tab is the default page, providing a brief introduction to this web service. the users can either paste a set of peptide sequences in the text box or upload a sequence file to the sarotup server for scanning. as shown in figure 1, a panel of peptides in raw sequence format taken from the b12 test case was pasted in the text box. besides the raw sequences however, only the standard iupac one-letter amino acid codes are accepted at present. the lower section of the form has a series of options (figure 2). it includes three drop lists for the screening target, screened library, and screening solid phase, respectively. it also has two groups of check boxes for the capturing reagents and contaminants in the target sample or screening system. by default however, the users can customize their scan according to their experiment at this section. after the users submit their request, the scanning results of sarotup will be displayed on the middle tabbed page. if any target-unrelated peptides are found, they will be reported in a table. at the same time, a new panel of peptides excluding target-unrelated peptides is produced and can be downloaded from the hyperlink created by the sarotup server (figure 3). the file of the new panel of peptides will be stored on the server for a month and then automatically deleted. we have tested sarotup on the internet explorer (version 6.0), mozilla firefox (version 3.5.2), and google chrome (version 3.0). although sarotup looks a little bit different among different browsers, it works normally on all browsers tested. as shown in table 2, the first test data set has 11 panels of peptides acquired from phage display libraries screened with 8 targets. in the 11 panels of peptides sarotup scanned, there were target-unrelated peptides in 3 panels from cetuximab, 80r, and b12 test case, respectively (table 3). this result suggested it was not rare that target-unrelated peptides sneaked into biopanning results and then were taken as mimotopes in study. in all, 7 target-unrelated peptides were found; 4 of them were due to binding to plastic; the left 3 were due to binding to the fc fragment (table 3). for the above 3 cases, the genuine epitopes recognized by cetuximab, 80r, and b12 monoclonal antibodies are compiled according to the ced records and pdbsum entries. mapitope or pepsurf [15, 21, 22] were used to perform mimotope-based epitope prediction with or without sarotup procedure. for mapitope and pepsurf algorithm,; the stop codon modification was set to none; and all other options were in default. the cluster with best score was taken as the predicted epitope. in the cetuximab case, pepsurf was used because there are only four or three peptides in the panel, statistically too few for mapitope. in the case of 80r and b12, mapitope was used because many peptides in the two cases exceeding the length limit of pepsurf, that is, 14 amino acids. if a predicted residue is identical with a residue in the true epitope, it is underlined (table 4). as shown in table 4, the number of true positives improved from zero to four in the cetuximab case with sarotup procedure. when it came to the b12 case sarotup did not improve the number of true positives in the 80r case when the parameters are same to the cetuximab and b12 cases. however, when the distance parameter was adjusted from default (i.e., 9) to 10, sarotup did increase the number of true positive residues from eight to eleven. these results indicate: (1) epitope prediction based on mimotope will be interfered if target-unrelated peptides are taken as mimotopes; (2) sarotup can improve the performance of mimotope based epitope mapping through cleaning the input data. the second data set has 100 peptides, varying from 6 to 22 residues long. suppose that matching each pattern to each peptide manually costs 10 seconds, then it would take a researcher more than 6 hours (23,000 seconds) to look through the second data set for target-unrelated peptides, even if he is as prompt during the whole period. besides, a table of target-unrelated peptides and a new panel of peptides excluding tup was produced at the same time by sarotup. it is true that some target-unrelated peptides can be identified through control and binding competition experiments. however, using sarotup first will certainly save a lot of labor, money, and time for researchers in this area. although the target of all tests described previously were monoclonal antibodies, sarotup can be customized and used in scanning the results from phage display technology using other targets such as enzymes and receptors. for the same reason, we can also expect that sarotup will extend its use to other similar in vitro evolution techniques, such as ribosome display [2931], yeast display, and bacterial display [3335]. furthermore, sarotup will not only benefit the mimotope-based epitope mapping, but also the development of new diagnostics, therapeutics, and vaccines. target-unrelated peptides are not appropriate candidates for mimotope based diagnostics, therapeutics, and vaccines, since they are mimics to components or contaminants of the screening system rather than target. therefore, it is reasonable to find and exclude possible target-unrelated peptides from the candidate list of new diagnostics, therapeutics, and vaccines. screened a phage-displayed random peptides library with the cetuximab and got four different peptides, that is, qfdlstrrlk, qynlssralk, vwqrwqksyv, and mwdrfsrwyk. as described previously, we scanned the four mimotopes with sarotup and the result suggested that the peptide vwqrwqksyv might be a tup. indeed, the dot blot analysis of riemer et al. showed that qynlssralk bound the cetuximab with high affinity but vwqrwqksyv was less reactive with the cetuximab. trying to develop a mimotope vaccine, riemer et al. after immunization mice with these constructs, they found that either the cetuximab or the antibodies induced by the qynlssralk vaccine construct inhibited the growth of a431 cancer cells significantly. the inhibition of the antibodies induced by the vwqrwqksyv vaccine construct however, was not statistically significant when compared with the inhibition caused by the isotype control antibody. sarotup must be used with caution since it is a tool only based on pattern matching at present. as these tups are not embedded in sarotup at present, it is possible that a true tup can not be detected by sarotup. to reduce this kind of false negatives besides the motif-based search, the database-based search can find out the known tup without known motifs. it is also possible that a sarotup predicted target unrelated peptide is actually target-specific. to decrease this kind of false positives, the users should customize the scan according to their experiment at the section of advance options. for example, the user should select antibody without fc fragment as the target if fab was used in biopanning; this will prevent sarotup from reporting peptides bearing the fc-binding motifs as tup. as described above, sarotup in future will also provide an exact match tool based on database search. in this way, a match might mean that different research groups have isolated the same peptide with a variety of targets. thus, the false positive rate of sarotup can be decreased further when its new feature become available. at last, we must point out that the controlled experiment is still the gold standard to distinguish tups from the specific mimotopes. sarotup, a web application for scanning, reporting and excluding target-unrelated peptides has been coded with perl. it is also useful in the development of diagnostics, therapeutics, and vaccines. to our knowledge

as epitope mimics, mimotopes have been widely utilized in the study of epitope prediction and the development of new diagnostics, therapeutics, and vaccines. screening the random peptide libraries constructed with phage display or any other surface display technologies provides an efficient and convenient approach to acquire mimotopes. however, target-unrelated peptides creep into mimotopes from time to time through binding to contaminants or other components of the screening system. in this study, we present sarotup, a free web tool for scanning, reporting and excluding possible target-unrelated peptides from real mimotopes. preliminary tests show that sarotup is efficient and capable of improving the accuracy of mimotope-based epitope mapping. it is also helpful for the development of mimotope-based diagnostics, therapeutics, and vaccines.

PMC2842971

pubmed-184

as is the most common cause of left ventricular outflow obstruction in children and adults. it is most common type of valvular heart disease in europe and north america, occurring in 27% of the population over 65 years of age. medical therapy alone is not effective for the long-term management of aortic valve disease, thus valve replacement remains the standard of care in patients with an acceptable risk profile. we present a case of critical as with significant symptom manifested as chest pain that was managed successfully without surgical avr or tavr. we will also briefly review incidence, etiology, grading of as and current guidelines for avr. a 91-year-old gentleman with history of hypertension, dyslipidemia and as presented to our office on 7/2015 with complaints of new onset sub sternal burning pain of 6 weeks duration. prior to 6 weeks patient could walk 2 blocks on level ground without shortness of breath or chest pain. blood pressure was 140/90 mm hg and pulse was regular at 60 beats per minute. cardiovascular exam revealed a grade 4/6 ejection systolic murmur best heard in the right second intercostal region radiating bilaterally to the neck. ecg revealed left ventricular hypertrophy (lvh) with non specific st-t wave changes in inferior leads (figure 1). echocardiography (echo) done in may of 2014 had revealed critical as with aortic valve area of 0.6-0.7 centimeter square and ejection fraction of 65 percent. the aortic valve (av) was heavily calcified. aortic valve peak velocity (av vmax) 4.66 m/s (figure 2). the patient was directly referred for a cardiac catheterization to evaluate his coronary anatomy prior to avr. hemodynamic measurement revealed left ventricle (lv) pressure 240/0 with left ventricular end diastolic pressure (lvedp) of 10. pulmonary artery wedge pressure (pawp), mean of 24, right atrium (ra) mean of 8, right ventricle (rv) 60/10 with an right ventricular end diastolic pressure (rvedp) of 14, pulmonary artery (pa) 60/17. the aortic valve area was calculated at 0.6 centimeter square, which was unchanged from echo done may 1, 2014. the left ventriculogram in the right anterior oblique (rao) view revealed normal lv systolic motion and ejection fraction of 55-60 percent. left main coronary artery revealed a common ostium-giving rise to the left anterior descending (lad) and the circumflex. right coronary artery (rca) revealed a 99% ostial narrowing (figure 3). lad revealed a 60% narrowing in its proximal segment and a 90% ostial diagonal narrowing (figure 4). after a detailed discussion involving the patient, his son, interventional cardiologist and the cardio thoracic surgeon, patient requested that only pci of the rca be considered, as the chest pain was of recent duration with no change in aortic valve finding. thus, a successful pci was done in the proximal rca with a bare metal stent (figure 6). patient did extremely well after pci of the rca and the patient has remained asymptomatic to date. thus, this new onset chest pain in patient with critical as was due to concomitant coronary artery lesion and was amenable to stenting and thus spared this elderly patient from the aortic valve replacement which would have been a high risk surgery for him. as is the most common valvular heart condition in the developed world, affecting 3% of people between ages 75 and 85 and 4% of people over age 85. congenitally unicuspid, bicuspid, tricuspid, or even quadricuspid valves may be the cause of as. in adults who develop symptoms from congenital as the main causes of acquired as include degenerative calcification and, less commonly, rheumatic heart disease. other, infrequent causes of as include obstructive vegetations, homozygous type ii hypercholesterolemia, paget disease, fabry disease, ochronosis, and irradiation. based upon a variety of hemodynamic and natural history data, clinicians generally grade the severity of stenosis as mild, moderate, severe, or critical. grading of as are as follows: i) mild: valve area exceeds 1.5 cm; transvalvular velocity 2.0 to 2.9 m/s; mean gradient<20 mmhg; ii) moderate: valve area of 1.0 to 1.5 cm; transvalvular velocity 3.0 to 3.9 m/s; mean gradient 20 to 39 mmhg; iii) severe: valve area is less than 1.0 cm; transvalvular velocity 4 m/s; mean gradient 40 mmhg. the term critical stenosis was defined based upon theoretical considerations showing that the aortic valve area must be reduced to one-fourth of its natural size before significant changes in circulation occur. as a result, since the triangular orifice area of the normal (adult) aortic valve is approximately 3.0 cm, an area exceeding 0.75 cm would not be defined as critical. avr and tavr remain the only treatment proven to reduce the rates of mortality and morbidity in this condition. under current guidelines, the onset of symptoms of exertional angina, syncope and dyspnea in a patient who has severe as is a class i indication for surgery. the annual rate of sudden death in patients with this condition is estimated at 1% to 3% but the surgical mortality rate in avr has been as high as 6%. with improvements in surgical techniques and prostheses, mortality rates have been reduced to 2.42% making a case for earlier intervention. tavr has become widely available, but further investigation into its use in this patient cohort is warranted. while assessing the cases of asymptomatic as we have both traditional as well as novel markers at our disposal now. left ventricular ejection fraction (lvef)<50 percent, peak aortic jet velocity>4.0 m/s, valve area<1 cm and mean pressure gradient>40 mm hg are the traditional markers to denote severe as in asymptomatic patients. while, indexed left atrial size>12.2 cm/m, lvh with wall thickness>15 mm, global left ventricular longitudinal strain<15.9, bnp (b-natriuretic peptide) level>130 pg/ml and increase in mean pressure gradient of>20 mm hg during exercise testing are the novel markers of asymptomatic severe as. bnp level does not appear to be significantly associated with the degree of as severity but does reflect heart failure status. the american college of cardiology and american heart association (acc/aha) have issued the following recommendations for avr, based on the severity of stenosis and on whether the patient has symptoms: i) severe stenosis, with symptoms: class i recommendation (surgery should be done). without surgery, these patients have a very poor prognosis, with an overall mortality rate of 75% at 3 years; ii) severe stenosis, no symptoms, in patients undergoing cardiac surgery for another indication (example coronary artery bypass grafting, ascending aortic surgery, or surgery on other valves): class i recommendation for concomitant aortic valve replacement; iii) moderate stenosis, no symptoms, in patients undergoing cardiac surgery for another indication: class iia recommendation (i.e., aortic valve replacement is reasonable); iv) very severe stenosis (aortic peak velocity>5.0 m/s or mean pressure gradient 60 mm hg), no symptoms, and low risk of death during surgery: class iia recommendation; v) severe stenosis, no symptoms, and an increase in transaortic velocity of 0.3 m/s or more per year on serial testing or in patients considered to be at high risk for rapid disease progression, such as elderly patients with severe calcification: class iib recommendation (surgery can be considered). on revisiting the above case description we realize that the patient did have critical as but was asymptomatic. his chest pain was only due to concomitant coronary artery disease but was not due to as per se. age and comorbidity of the patient posed a high risk for coronary artery bypass graft (cabg) with avr. besides, the patient s symptoms were of new onset and subsequent cardiac catheterization revealing critical rca stenosis and the patient s preference for treating the cause of his recent symptoms, encouraged us to think otherwise. the decision to perform pci alone with the belief that this chest pain and cad would be amenable to the minimal risk procedure paid dividends. in addition, patient received a bare metal stent with the option of undergoing surgical avr if symptoms were not relieved. awareness amongst physicians about the fact that all critical aortic stenosis with chest pain may not require aortic valve replacement is important. this can lead to less invasive treatment tailored to the need of the patient especially in those with advanced age, significant comorbidities and an extremely high risk for cabg with avr and can also result in decreased cost of care. pharmacological nuclear stress testing may be another modality that can be used to differentiate etiology of the symptoms.

aortic valve replacement (avr) remains the cornerstone of treatment for symptomatic critical aortic stenosis (as). it is a class i indication that symptomatic patients with critical as undergo either surgical or transcatheter aortic valve replacement (tavr). we present a patient with critical as and new angina that was managed successfully with percutaneous coronary intervention (pci) of the right coronary artery. physicians should consider that not all patients with critical as and angina necessarily require avr. concomitant pathology leading to the symptoms should be carefully ruled out. this leads to a less invasive, cost effective care plan especially in patients with advanced age and comorbidities for which any type of surgical valvular intervention may pose high risk.

PMC5136738

pubmed-185

the various blood cell lineages in mammals arise from a multipotent haematopoietic stem cell via particular differentiation pathways. one of these pathways, erythropoiesis, leads to the production of red blood cells (rbcs), which transport oxygen and carbon dioxide around the body by means of the intracellular metalloprotein haemoglobin (hb). hb is a tetramer, consisting of two -globin and two -globin subunits. in mammals, these globin chains are encoded by two gene loci: the -globin locus and the -globin locus. in humans, the -globin locus consists of the embryonic-and adult -globin genes, and the -globin locus comprises the embryonic -, foetal-and -, and adult-and -globin genes [1, 2]. the globin genes expressed from these loci differ from embryonic to adult erythropoiesis in order to meet varying oxygen demands and facilitate placental transfer of oxygen from mother to embryo. there are a number of severe diseases caused by the disruption of adult globin genes, including thalassaemias and certain types of anaemia. according to the world health organisation, approximately 5% of the world's population carry genes involved in hb disorders, and as such, they present an enormous health burden. thalassaemia is caused by a reduction or abolition of the expression of one or more globin genes, resulting in an imbalance of-and -globin chains in red blood cells and consequent anaemia [1, 4]. sickle cell anaemia is another prevalent haemoglobinopathy and is caused by a mutation in the adult -globin gene which generates a single glutamic acid to valine amino acid substitution. this mutation leads to the polymerisation of globins in venous circulation [5, 6], which can trigger a rigid and sickled cell phenotype [7, 8] and results in a number of acute conditions such as vaso-occlusion, splenic sequestration, and haemolytic anaemia. there are currently a number of treatments available for patients suffering from thalassaemia and sickle cell anaemia. the most common is packed red blood cell transfusion, but this is associated with a number of problems, such as sufficiency of supply, bacterial and viral infection, biochemical and biomechanical changes during storage (red blood cell storage lesions), and the risk of immune rejection from the patient [10, 11]. furthermore, blood transfusions are ongoing throughout a patient's life and often lead to a potentially fatal buildup of iron and associated reduction in organ activity. residual production of foetal -globin persists naturally throughout life, and levels vary between individuals [12, 13]. this persistent expression allows two -globin chains to combine with two adult -globin chains to form what is known as foetal hb (hbf). as only the adult -globin gene is mutated in sickle cell anaemia, affected infants are protected from severe symptoms until they reach several months of age, due to the large amount of hbf still in circulation at birth. furthermore, patients who have inherited alleles associated with increased levels of hbf, known as hereditary persistence of foetal hb (hpfh), are protected into adulthood. similarly, a more asymptomatic disease phenotype has also been shown in patients with -thalassaemia who exhibit higher levels of hbf. together, these observations indicate that increased foetal -globin is able to compensate in part for the loss of adult -globin function and thus ameliorates the symptoms of certain adult haemoglobinopathies. accordingly, a number of drug treatments for -thalassaemia and sickle cell disease, for instance, 5-azacitidine, hydroxyurea, and butyrate, all act by nonspecifically reactivating foetal -globin gene expression by various mechanisms. there is evidence that long-term administration of these drugs has chronic side effects, consistent with their lack of specificity [8, 17]. as the existing methods of treatment for these haemoglobinopathies remain inadequate, alternative forms of therapy are currently being sought, and stem cell therapies should be considered. this paper will discuss progress in utilising novel cellular reprogramming techniques to treat rbc diseases. stem cells, both embryonic and adult, have the ability to differentiate into various cell types, making them a potentially attractive treatment option. embryonic stem cells (escs) and adult stem cells (ascs) each have their own strengths and disadvantages in these strategies. escs are more easily grown in culture and are pluripotent, meaning that they are able to differentiate into any cell of the body. the practicality of widespread esc use for therapeutic purposes, however, has been questioned due to issues of supply and ethical and legal considerations. moreover ascs, on the other hand, overcome some of these problems as they can be harvested from each individual patient. they are not abundant and are difficult to obtain, often being harboured in internal organs such as the gut and bone marrow. they have proven difficult to culture in vitro, and furthermore, they are widely believed to be multipotent rather than pluripotent and are thus only able to differentiate into certain cell types. cellular reprogramming potentially overcomes these issues and may offer new treatment methods for a range of diseases, including those of rbcs. takahashi and yamanaka were the first to show that it is possible to take differentiated somatic cells and transform them into cells with pluripotent potential. they began by identifying a pool of 24 transcription factors which are important in maintaining stem cell traits and used retroviral transduction to express these factors in murine embryonic and adult fibroblasts. they found that these cells then displayed characteristics and properties comparable to those of pluripotent escs. they were able to further refine the required transcription factors by setting up numerous combinations to determine which were essential to this process and identified four factors, oct4, sox2, klf4, and c-myc, needed to transform a somatic cell to an induced pluripotent stem cell (ipsc). takahashi et al. then applied these four factors to human cells and transformed neonatal and adult human fibroblasts into human ipscs (hipscs). this was a valuable subsequent step as it showed that this process can be reproduced with human cells and could thus potentially be utilised for stem cell-based therapies of human disease. several other transcription factor combinations have since been shown to be sufficient to reprogram somatic cells [2224] and one particular combination, involving oct4, sox2, nanog, and lin28, is particularly efficient and is now widely utilised. for example, a number of the transcription factors used to generate these cells, including c-myc, klf4, and lin28, are oncogenes, and their misexpression can lead to cancer [2628]. in order for ipscs to be differentiated into a cell type of choice, the retrovirally transmitted genes need to be switched off or removed to reduce the possibility of their inducing tumours [22, 29]. another potential issue is that the transplantation of any cells that have not been fully differentiated from the ipsc state could lead to the formation of cancerous teratomas. any cells remaining which are still in a pluripotent state could multiply and, without the appropriate growth controls, would have the potential to result in tumours in transplant patients. to potentially avoid the issue of tumour formation and uncontrolled proliferation of ipscs, an alternative methodology known as transdifferentiation is also being considered as a potential treatment strategy. transdifferentiation is achieved by introducing various exogenous factors into a differentiated cell, such as a fibroblast, to directly convert it into another type of differentiated cell, thereby bypassing the pluripotent state (figure 1(b)). as early as 1990, choi et al. were able to convert various cells types, including dermal fibroblasts and chondroblasts, into mononucleated, striated myoblasts that were indistinguishable from normal myoblasts in vivo this was achieved through the expression of the myogenic regulatory factor myod, a transcription factor known to be involved in the determination of muscle cells. shortly after this, another group showed that it was possible to turn myeloid 416b cells into mast cells through the forced expression of gata-2 and gata-3, two transcription factors which play important roles in haematopoiesis. investigated the effects of ectopically expressing the gene eyeless (ey), an orthologue of the mammalian pax6 gene, in drosophila and found that eye structures formed in places such as the wings and legs. since takahashi and yamanaka's pioneering studies in cellular reprogramming, the field of transdifferentiation has advanced considerably. zhou et al. investigated the effects of expressing ngn3, pdx1, and mafa, transcription factors involved in -cell differentiation, on exocrine cells of the adult pancreas. they found that the coexpression of these factors was able to convert the exocrine cells into -cells. the induced -cells were identical to endogenous -cells in morphology and showed similar expression of genes associated with -cell function. these cells can also rescue the phenotype of hyperglycaemia, as they are able to secrete insulin and remodel surrounding vasculature. in other work, utilised the neural-specific transcription factors, ascl1, brn2, and myt1l, to rapidly convert both murine embryonic fibroblasts and adult fibroblasts directly into functional neurons. these induced neuronal cells express neuron-specific proteins, generate action potentials, and form functional synapses. a further advance has shown that it is also possible to transdifferentiate fibroblasts into functional neural progenitor cells by transient induction of oct4, sox2, klf4, and c-myc in cells cultured in a defined neural reprogramming medium. this process bypassed the generation of ipscs and gave rise to multipotent progenitors with the capacity to expand and differentiate into a number of neural lineages. all of these experiments indicate that it is possible to direct a differentiated cell to another cell fate through the application of extragenic factors. advances in cellular reprogramming have raised the attractive possibility that this technology could be utilised to generate a limitless source of immune-matched, pathogen-free erythrocytes for transfusion. they found that hipscs are capable of generating haematopoietic cells with phenotypic and morphological characteristics similar to those derived from hescs; however, these hipsc-derived cells exhibited a dramatically reduced capacity (by greater than 1000-fold) to generate erythroid cells. a subsequent study by lapillone et al., however, showed that it was indeed possible to produce significant numbers of mature erythroid cells from hipscs in vitro. this group employed the methods outlined by thomson's group using oct4, sox2, nanog, and lin28 to convert fibroblasts to hipscs. they then cultured these cells in medium containing the cytokines scf, tpo, flt3 ligand, rhu bmp4, rhu vegf-a165, il-3, il-6, and erythropoietin (epo). they analysed the expression profiles of these cells over 20 days of culture and found that pluripotent stem cell markers decreased whilst the erythroid markers cd36, cd235a, and cd71 increased. cells at day 20 were found to have a high erythroid potential and were plated in sequential cocktails of cytokines comprising scf, il-3, and/or epo. erythroid maturation was achieved after another 25 days and was confirmed by morphological examination and by flow cytometric analysis of erythroid markers (cd235a, cd71, and cd36). furthermore, these erythroid cells were able to enucleate, albeit with reduced capacity compared to hesc-derived erythroid cells, and were found to express functional hb (predominantly hbf). these hipsc-derived erythroid cells were compared to those differentiated from hescs, and no significant differences were detected in terms of erythroid commitment, expression of erythroid markers, and type and functionality of hb. revealed that while functional rbcs could be generated from hipscs, when compared to hescs, hipscs were shown to have reduced (approximately 8-fold) amplification potential in producing mature erythroid cells. a recent study has set out to determine whether this reduced efficiency is an intrinsic property of hipscs, or whether it can be increased by altered culture conditions. this study showed not only that it is possible to generate rbcs from hipscs with similar efficiency to hescs, but also that these cells can be differentiated from hipscs generated using episomal vectors, obviating the need for potentially deleterious retroviral transfection. this group cultured hipscs derived from human fibroblasts with the op9 bone marrow stroma line to induce hematopoietic differentiation and followed this with selective expansion of erythroid cells in serum-free media with cytokines supporting rbc differentiation. the erythroid cultures established in this study consisted of a pure population of cd235a+ cd45 leukocyte-free rbcs which had robust expansion capabilities, as well as a long lifespan of up to 90 days. these hipsc-derived cells can enucleate and were shown to express foetal-and embryonic -globin demonstrating successful reprogramming of the -globin locus. the results from this study show that it is possible to produce significant numbers of erythroid cells from fibroblast-derived hipscs, and that thus cellular reprogramming could contribute to the treatment of haemoglobinopathies. furthermore, since these rbcs are generated from transgene-free hipscs, they circumvent problems associated with genomic integration and undesired reactivation of reprogramming factors. another recent study has shown that it is possible to use transdifferentiation to produce haematopoietic cell lineages, including mature erythrocytes. in this work, szabo et al. transduced human dermal fibroblasts with oct4 alone and showed that these cells then express the panhaematopoietic marker cd45 but lack the pluripotency marker tra-1-60. they then cultured these cells in a haematopoietic cytokine cocktail containing scf, g-csf, flt3lg, il-3, il-6, and bmp-4 supplemented with epo and observed an emergence of cells expressing adult -globin protein and the red blood cell marker glycophorin-a. in addition, the authors noted that these erythroid cells express adult rather than embryonic globins, unlike cells derived from human pluripotent stem cells [39, 40], perhaps suggesting that they have indeed been transdifferentiated from adult fibroblasts, bypassing the hipsc stage. as the techniques used in this study avoid the pluripotent state as well as have a high yield, expansion capacity, and clinical feasibility, this strategy could provide a reasonable basis for autologous cell replacement therapies. these studies demonstrate that it is possible to differentiate hipscs into mature erythrocytes in vitro for transfusions. in order to utilise these methods to treat rbc diseases successfully, fibroblasts could potentially be taken from either a healthy immunomatched individual, or a universal donor, and be converted to erythrocytes via the hipsc state. a study has already developed hipscs from an individual with a bombay phenotype of the abo blood group system, where the abh antigen is not expressed on rbcs, and blood can be donated to anyone. this group has further demonstrated that it is possible to differentiate haematopoietic lineages from these cells although they have not explicitly shown mature erythrocyte differentiation. this possible treatment method circumvents many of the problems associated with current transfusions, such as questionable quality, lack of supply, and immune-rejection. however, issues still remain, such as cost and the risk of iron overloading. in order to cure, rather than treat, rbc diseases, healthy progenitor cells must be transplanted into patients and subsequently repopulate the haematopoietic system. a promising study has already shown that it is possible to use reprogrammed cells to treat sickle cell anaemia in mice. hanna et al. took cells from the tail tips of a humanized sickle cell anaemic mouse model, in which the mouse -globin genes have been replaced with human -globin, and the mouse -globin genes have been replaced with human and (sickle) globin genes, and through adaptation of the protocol developed by takahashi and yamanaka, who reprogrammed these cells into ipscs. once this was accomplished, they were able to correct the mutant -globin gene by replacing it with a copy of the wildtype human -globin gene through homologous recombination. following this, the ipscs were differentiated into haematopoietic progenitors through the ectopic expression of hoxb4, and by growing in haematopoietic cytokines on an op9 bone marrow stroma cell line. this group then carried out extensive testing to determine whether the treated mice displayed any further signs of the disease. firstly, functional correction was evaluated by electrophoresis for the human -globin proteins and, and they found a significant increase in-and a decrease in -globin. blood counts were also performed 12 weeks after transplant, which showed that treated mice had increased rbcs, hb, and packed cell volume as well as reduced reticulocytes, a common indicator of sickle cell disease and severity. lastly, they examined symptomatic indicators of sickle cell anaemia such as urine concentration, body weight, and breathing rate and found that all three of these parameters were ameliorated in the treated mice. this study thus provides an important proof of principle that cellular reprogramming can be employed to correct erythroid disorders, albeit in this case, in conjunction with gene therapy. normal erythropoiesis is dependent upon the correct expression of globin genes. where globin genes are incorrectly expressed, or are mutated, anaemia or thalassemia results. current therapy for these disorders involves packed red blood cell transfusions, which are limited by supply, risk of infection, expense, and patient rejection. drug-based therapies involve the nonspecific reactivation of foetal globins and have long-term side effects. in seeking alternative strategies, recent advances have shown that cellular reprogramming can now generate large quantities of red blood cells in culture, potentially for use in transfusions. furthermore, these strategies have been successfully combined with gene therapy to treat a sickle cell anaemia mouse model, suggesting that cellular reprogramming will provide a realistic future alternative to conventional treatment of haemoglobinopathies.

haemoglobinopathies such as thalassaemia and sickle cell disease present a major health burden. currently, the main forms of treatment for these diseases are packed red blood cell transfusions and the administration of drugs which act to nonspecifically reactivate the production of foetal haemoglobin. these treatments are ongoing throughout the life of the patient and are associated with a number of risks, such as limitations in available blood for transfusion, infections, iron overload, immune rejection, and side effects associated with the drug treatments. the field of cellular reprogramming has advanced significantly in the last few years and has recently culminated in the successful production of erythrocytes in culture. this paper will discuss cellular reprogramming and its potential relevance to the treatment of haemoglobinopathies.

PMC3146985

pubmed-186

he had a left ventricular ejection fraction of 42% and regional wall motion abnormalities compatible with multi-vessel territories. coronary angiography findings revealed total occlusion at the proximal left anterior descending artery (lad), 50-75% stenosis at the mid to distal left circumflex artery, and 90% stenosis at the mid right coronary artery (rca). cardiac surgery was performed through a median sternotomy, and the heart was displaced using a deep pericardial retraction suture, gauze swab, and tissue stabilizer. after confirming the lack of atheroma burden in the ascending aorta by epiaortic ultrasound examination, the left radial artery was connected to the ascending aorta. after completing the lad grafting using the left internal thoracic artery, the patient was in the trendelenburg position, and norepinephrine was infused at a dose of 0.15 g/kg/min. after stabilizer application, there was a temporary deterioration in the patient's hemodynamic status, which was stabilized without the aid of incremental doses of norepinephrine dosage. after opening the anastomotic site at the om branch, the surgeon informed us the patient was bleeding from the arteriotomy site despite placement of a proximal snare. the co2 blower was more aggressively used to aid grafting at a flow rate of 3-5 l/min. bleeding was replaced by colloid solution, and all hemodynamic variables were stable: systemic blood pressure 121/58 mmhg, heart rate 59 beats/min, pulmonary arterial pressure 24/11 mmhg, cardiac index 2.6 l/min/m and mixed venous oxygen saturation 82%. approximately 5 minutes after the commencement of grafting, the surgeon decided to insert an intracoronary shunt for better visualization. suddenly, the patient's systemic blood pressure decreased to 64/56 mmhg despite increasing the norepinephrine dose from 0.05 g/kg/min to 0.30 g/kg/min. the pulmonary arterial pressure increased to 34/20 mmhg, and the mixed venous oxygen saturation decreased to 66%. vasopressin 0.6 iu was quickly administered intravenously, and the transesophageal echocardiography (tee) revealed a massive gas floating at the orifice of the rca (fig. although the patient remained in normal sinus rhythm, complete heart block occurred within minutes, and ventricular pacing was commenced. over the next several minutes, ventricular fibrillation developed; despite aggressive treatment, including defibrillation, epinephrine, and direct manual cardiac massage, adequate circulation could not be restored, and cardiac massage was continued. upon preparing for emergent conversion to cardiopulmonary bypass (cpb), epinephrine 300 g was injected directly to the aortic root by the surgeon using a 26-gauge needle. subsequently, manual cardiac massage was continued for several cycles, and spontaneous recovery of unspecified cardiac rhythm was observed. then the patient's systemic mean arterial pressure gradually rose from 38 to 103 mmhg, and recovery of normal sinus rhythm and contractile performance followed immediately. the remaining grafts were performed successfully without conversion to cpb, and no sign of bleeding was observed at the puncture site in the aorta. the patient had an unremarkable postoperative course without neurologic deficits and was discharged 10 days after the surgery. despite using a proximal coronary snare, this method of hemostasis can be incomplete in the presence of severe atheroma or calcification, causing bleeding through the arteriotomy site. cardiac displacement invariably causes hemodynamic deterioration, and when the diastolic systemic blood pressure decreases below the pressure generated by the co2 gas blower, gas may migrate in a retrograde fashion to the aortic root. even in the presence of a proximal snare, the proximal coronary lumen may not be completely obstructed due to the presence of calcified atheroma, as evidenced by continued bleeding from the arteriotomy site after application of the snare. as the rca ostium is in the highest position of the sinus of valsalva, gaseous materials would be prone to migrate into the rca, causing embolic infarction. a minor gas embolism may pass unnoticed or be overcome with supportive measures to aid emboli clearance. however, in the case of a massive embolism with the possible introduction of room air due to venturi effect, hemodynamic collapse can occur and may require aggressive treatment, such as cardiopulmonary resuscitation (cpr) with aspiration of the air by direct puncture of the aortic root. it may even require emergent conversion to cpb, which is known to be associated with increased morbidity and mortality. therefore, when bleeding from the arteriotomy site persists despite the use of a proximal snare or intracoronary shunt, anesthesiologists should be aware of the possibility of a gas embolism and advise the surgical team to stop or limit the use of the co2 blower. when a gas embolism results in hemodynamic deterioration, supportive measures should be immediately undertaken to increase the coronary perfusion pressure and facilitate emboli clearance. gas embolism should also be confirmed with tee, and a pacemaker should be at hand given that complete heart block due to atrioventricular nodal ischemia may occur in the case of an embolism involving the rca. finally, in the case of failure of supportive measures such as drug administration to the venous side, direct aortic injection of the drugs can be attemped before initiating cpb. in coronary artery bypass graft surgery, direct cardiac massage may not be aggressively and effectively performed due to the fear of disrupting the previously grafted conduits, limiting the drug delivery from the venous side to the systemic circulation. prior to the 1960s, intracardiac injection of medications was used blindly or directly, but this approach was abandoned due to the devastating complication of lacerating the epicardial coronary arteries and cardiac tamponade. however, direct injection to the aortic root following a sternotomy appears to be feasible and may be life-saving, as severe right ventricular dysfunction may limit systemic drug delivery injected through the venous side despite the performance of direct cardiac massage. in the current case, intra-aortic injection of epinephrine may have resulted in a more effective increase in the systemic vascular resistance, thereby increasing the coronary perfusion pressure and thus facilitating emboli clearance. in conclusion, in the rare case of a gas embolism occurring during opcab occurs, the potential for catastrophic results necessitates immediate and appropriate managements including supportive measures, needle aspiration of gas, and cpr with direct cardiac massage. in refractory cases, while considering emergent conversion to cpb, direct injection of drugs to the aortic root can be attempted before initiating cpb. this may be a simple, relatively safe, and life-saving approach for the management of a gas embolism during opcab because a sternotomy has already been conducted.

although compressed gas (co2) blowers have been used safely to aid accurate grafting during off-pump coronary bypass surgery, hemodynamic collapse due to gas embolism into the right coronary artery may occur. supportive measures to facilitate gas clearance by increasing the coronary perfusion pressure have been reported to be successful in restoring hemodynamic stability. however, right ventricular dysfunction and atrioventricular nodal ischemia may hinder effective systemic delivery of the vasoactive medications, even when performing resuscitative measures such as direct cardiac massage. we herein report a case of cardiac arrest that was caused by a right coronary gas embolism and that could not be restored by cardiac resuscitation. when supportive measures fail, direct aortic injection of epinephrine to increase the coronary perfusion pressure can be attempted before initiating cardiopulmonary bypass, and this approach may be life-saving in situations that limit systemic drug delivery from the venous side despite the performance of direct cardiac massage.

PMC3888851

pubmed-187

multiple sclerosis (ms) is a chronic progressive inflammatory and neurodegenerative disease of human central nervous system (cns) which usually affects young adults, with a reported median age of onset of approximately 30 years.1 in approximately 85% of patients with ms, the disease is initially recognized by a relapsing-remitting course which may eventually lead to a progressive deterioration of neurological status along with significant loss of neurological function.2 neuropathologically, ms presents with various patterns, however, inflammatory demyelination and oligodendrocyte loss and neuronal and axonal degeneration3 constitute salient features of microscopic examination of ms lesions. currently, the cause and cure for ms remain elusive and in many cases ms ends with significant neurological disabilities. while massive activation of the inflammatory arm of the immune system against putative cns antigen(s) such as myelin basis protein plays a major role in the pathogenesis of the demyelinating process of ms, the neurodegenerative process prevails in the long run and causes significant cognitive and functional deterioration in affected patients. electrophysiologic examination of demyelinated lesions indicates conduction block as the predominant feature of these lesions. the pathophysiologic basis of such conduction block in ms rests on segmental demyelination with loss of whole internodes of myelin. in normal individuals, blocking the voltage-gated potassium channels does not have any significant impact on conduction of the action potential since these channels are enclosed by layers of myelin sheath. however, loss of myelin during pathogenesis of ms, exposes the potassium channels and interferes with production and conduction of the action potential. in fact, the impulse conduction fails specifically at the site of demyelination, while the normal segments of the axons on both sides continue their impulse conduction normally. certain features which determine the impulse conduction block in demyelinated axon consist of the size of demyelinated area, extent of myelin loss along the internode, and the time elapsed since demyelination happened. the duration of demyelination is an important factor since myelin loss sets a number of adaptive axonal responses in motion. for example, development of a revised group of ion channels along the demyelinated membrane may result in restoration of impulse conduction. the size of the demyelinated lesion is another significant factor since axons repair centripetally inside the lesion and extensive lengths of demyelination are repaired slowly which in turn reflects the fact that the chance of functional recovery correlated inversely with the lesion size. it appears that myelin loss involving the paranodal area is stronger factor in blocking conduction than a comparable loss of distributed along the internode. apart from the segmental demyelination which is associated with conduction block, histopathologic examination of ms tissue has shown that some node are inappropriately wide in ms lesions due to paranodal demyelination or retraction of the paranodes.4 another salient feature of demyelinated axons is abnormal reorganization of the ion channels. the speedy conduction velocity and uninterrupted transmission of electric signals in mammalian myelinated axons rest on the appropriate spatial distribution ofion-selective channels. na channels are gathered at nodes of ranvier in concentrations which are ~25 times that of internodal regions.5 these clusters are essential for efflux of ion currents at nodes and allow fast saltatory conduction. on the contrary, other studies have demonstrated that k currents appear only after loosening of the myelin sheath from the axonal membrane.6 k channels are located only in paranodal and internodal areas and normally they do not contribute to generation of the action potential.7 scientific studies which have focused on action potential propagation in normal and demyelinated axons have revealed a reorganization of axolemmal ion channels, which in turn leads to conduction impairments. loss or decrease of sodium channels from the nodes of ranvier8 causes the nodes to be inexcitable and leads to conduction block. sherratt et al9 demonstrated that in demyelinated regions sodium channel concentrations are reduced, while voltage-sensitive potassium channels (which are not active on normal myelinated axons) become detectable. this exposure of k channels at juxtaparanodal region leads to efflux through fast k channels and causes axonal conduction block by preventing sufficient depolarization and initiation of the action potential at the node of ranvier.10 demyelination also exposes slow k channels, further interrupting normal hyperpolarization and blunting normal repetitive impulse release from the presynaptic area terminals.11 in 1981, bostock et al12 demonstrated that potassium channel blockers dendrotoxin and 4-aminopyridine improved conduction impairments in experimentally demyelinated axons and laid the scientific rationale for clinical studies of potassium channel blockers in ms patients. fampridine (or 4-aminopyridine [4-ap ]) is a broad-spectrum blocker of voltage-sensitive potassium channels, which has been demonstrated to improve conduction and propagation of the action potential along the demyelinated axons. in addition, fampridine increases the duration of the pre-synaptic action potential and amplitude which in turn leads to increased transmitter release.13 apart from being a voltage-activated potassium channel blocker, 4-aminopyridine potentiates synaptic and neuromuscular transmission by affecting the beta subunit of voltage-activated calcium channels.14 this novel mode of action of 4-aminopyridine which occurs independent from its blocking effect on the potassium channels, provides another rationale for its positive effect on the neuromuscular function in patients with spinal cord injury, myasthenia gravis and ms. hawthorne, ny, usa) is one of the three isomeric amines of pyridine with chemical formula h2nc5h4n, which acts a selective potassium-channel blocker. dalfampridine, which is a sustained-release oral form of fampridine, is rapidly and completely absorbed from the gastrointestinal tract, however, its absolute bioavailability has not been determined. compared to an aqueous oral solution, the extended release tablet shows a relative bioavailability of 96%, with a delayed absorption pattern which provides a less rapid rise to a lower maximum plasma concentration. in healthy volunteers who took a single 10 mg dose of dalfampridine, peak serum concentrations were reached 3 to 4 hours following oral administration and it was almost completely and rapidly eliminated by urinary excretion. the elimination half-life of dalfampridine is 6.4 hours in healthy individuals. as a lipid-soluble agent, dalfampridine passes through the blood brain barrier and blocks potassium channels in both the central and peripheral nervous systems.15 daldampridine binds reversibly to the cytoplasmic side of potassium channels, blocking the ion conductance pathway which in turn prolongs the action potentials in unmyelinated nerve fibers and enhances neurotransmitter release at synaptic endings.16 dalfampridine has been studied extensively in symptomatic treatment of ms patients with walking impairment. impairment of ambulation is a major neurological deficit in ms patients and significantly interferes with their quality of life. it is hypothesized that dalfampridine improves clinical symptoms of ms by restoring conduction in demyelinated axons through voltage-dependent potassium channel blockade.15 in addition, dalfampridine has been used for treatment of lambert-eaton myasthenic syndrome,17 where it prolongs neurotransmitter release at the neuromuscular junction. studies involving animal models have demonstrated that can reverse tetrodotoxin toxicity.18 pharmacokinetic assessmentsof both immediate-release and sustained release formulations of fampridine have been done in normal individuals as well as those patients with ms and spinal cord damage. uges et al19 performed a pharmacokinetic study involving 9 healthy individuals (7 men and 2 women) to assess immediate-release fampridine in intravenous, entric-coated, and uncoated oral formulations. the bioavailability of the enteric coated tablets was calculated from the area under the serum concentration curve 95% 29% (mean sd), which was not much different from that calculated from urinary excretion 98% 8%. there was no evidence that metabolism of fampridine involved glucoronidation, sulfonation, or n-acetylation. investigators reported that 89.6% 7.5% of the medication was excreted in the urine unchanged after 24 hours of the intravenous formulation and 86.1% 2.7% with the entric coated formulation. one dose-ranging pharmacokinetic study included 12 ms patients who received increasing doses of sustained-release fampridine from 7.5 to 25 mg every 12 hours.20 the investigators reported a mean time to peak concentration of 5 hours and mean serum half-life of 5.2 hours. vollmer et al21 studied the pharmacokinetics of dalfampridine in clinical trials of ms patients and found that multiple dosing of this medication was associated with its accumulation. in addition, the investigators noted that the steady-state pharmacokinetic profile of fampridine sustained-release 20 mg bid administered for 2 weeks appeared to support the administration of twice-daily dosing in this population. dalfampridine (ampyra) is available as 10 mg extended release tablets with relative bioavailability of 96%, peak of plasma concentration of 34 hours and half life of 5.26.5 hours. the major goals of treating ms patients consist of prevention of exacerbations, limiting disability progression, and improving cognitive decline. the available treatments for ms fall under two categories: disease modifying agents such as beta-interferons and glatiramer acetate and medications for symptomatic treatment such as baclofen for treatment of spasticity and dalfampridine which is used to restore the impulse conduction along the demyelinated axons and improve muscle strength and walking ability. in january 2010, dalfampridine was approved by the fda for symptomatic treatment of ms patients with specific indication for improving walking. in the past 4-aminopyridine has been used as an experimental agent which presumably enhances nerve conduction of demyelinated axons through its effects on potassium channels for treatment of fatigue in ms. sheean et al22 reported that use of fampridine in ms patients was associated with improvements in fatigue as well motor and visual symptoms. in addition, dalfampridine has been assessed and studied in other cohorts of ms patients in the context of various clinical trials to determine its efficacy in improving ms patients ambulation. in this manuscript only some of the more significant clinical trials have been cited and discussed. using quantitative measures of motor function, schwid et al23 performed one of the earlier clinical trials of sustained-release fampridine-sr in ms patients. this was a randomized, double-blind, placebo-controlled, crossover clinical trial included 10 patients with clinically definite ms, limb weakness and stable motor deficits (edss 6.07.5). study subjects were randomized to be treated with sustain-release fampridine 17.5 mg orally twice daily for a period of one week or placebo for a period of one week. study outcomes included time to walk 8 meters, time to climb four stairs, maximum voluntary isometric contraction measured quiantitatively, manual muscle testing, grip strength, edss, and the patient s global impression. of these outcomes, only timed gait progressed on sustain-release fampridine compared with placebo in 9 of the study participants. seven participants preferred the medication over placebo based on the findings from the patient s global impression. goodman et al24 reported the results of a four-center randomized, double-blind placebo-controlled study of controlled release aminopyridine in 31 ms patients. the study participants were treated with increasing doses of 20 to 80 mg of aminopyridine daily in divided doses. a total of 25 participants received the active medication and 11 participants were treated with placebo. outcome measures of this clinical trial consisted of timed ambulation, manual testing of leg strength, paced auditory serial addition task, 9-hole peg test, and a fatigue diary. the results of this clinical trial indicated a statistically significant and dose-related enhancement of timed ambulation in ap-treated patients compared to those who received placebo. a significant enhancement of leg strength was also observed in approximately 11% of ap-treated participants compared with a 4% worsening of placebo-treated participants, p=0.01. the reported side effects consisted of dizziness, insomnia, paresthesia, nausea, headache, tremor, pain and anxiety. on daily doses of 60 and 70 mg a phase 2, multi-center, randomized, double-blind, placebo-controlled, parallel-group, dose-comparison (10, 15, or 20 mg twice daily orally) clinical trial of sustained-release fampridine in ms patients demonstrated significantly more consistent responders as determined by improvement in ambulation as compared to the placebo-group: 36.7% versus 8.5%.25 fampridine was generally well tolerated and serious and severe adverse effects were more common in those patients who received the highest dose. a multi-center randomized, double-blinded, placebo-controlled phase 2 dose-raning clinical trial was conducted by goodman et al which assessed the concept that whether the dose of fampridine-sr could be safely elevated to 80 mg/daily in patients with ms.26 a cohort of 36 ms patients were randomized in a 2 to 1 ratio to be treated with an increasing dose of fampridine-sr for a period of 8 weeks. the dosage of fampridine-sr was escalated from 10 to 40 mg twice daily by increments of 5 mg twice daily on a weekly schedule. a group of evaluations were done once a week which included ms functional composite (msfc), fatigue questionnaires, and lower extremity manual muscle testing. the objectives of this clinical trial included assessment of the safety of higher doses of fampridine-sr as well as the efficacy and dose-response to this drug by ms patients. five study participants were terminated from fampridine-sr due to adverse events at doses larger than 25 mg and these events consisted of seizures in two individuals at doses of 30 and 35 mg twice daily. no subjects in the placebo arm of the study dropped out due to the adverse events. in the group which was treated with fampridine-sr compared to the group which was treated with placebo showed improvement in the lower extremity muscle strength (prospective analysis) and walking speed (post-hoc analysis). the investigators concluded that future clinical trials should restrict the dose of fampridine-sr to 20 mg twice daily and walking speed and lower extremity muscle strength tests are potential efficacy measurements. another phase 3 multicenter clinical trial of dafampridine which was controlled and double-blind included 301 ms patients of different types (27% with relapsing-remitting ms and 73% with progressive ms). during the 14 weeks duration of this trial, participants were assigned in a ratio of 3 to 1 to be treated with dalfampridine 10 mg (n=229) or placebo (n=72) orally twice daily for a period of 14 weeks.27 the primary aim of this study included steady progress on timed 25-foot walk to define responses with proportion of timed walk responders in each arm. the investigators reported a higher proportion of timed walk responders in the fampridine-treated arm (78/224 or 35%) compared to those who were treated with placebo (6/72 or 8%). based on the results of this study, treatment of ms patients with fampridine was associated with gait improvement with a decrease in patient s gait impairment. a more recent executed phase 3 multi-center double-blind clinical trial of extended-release dalfampridine in patients with definite ms of any clinical course assessed the efficacy, safety, and pharmacodynamics of extended release oral dalfampridine in these patients.28 the length of this study was 9 weeks and the participants were randomized to be treated with dalfampridine (10 mg twice daily; n=120) or placebo (n=119) for a period of 9 weeks. the primary aim of this study consisted of constant progress on the timed 25-foot walk, with percentage of time walk responders (twrs) in each treatment arm. the last on-treatment assessment collected information from 8 to 12 hours postdose, to assess and determine the persistence of the impact of the medication. the results of this clinical trial indicated that the quantity of twrs was higher in the dalfampridine-treated group (51/119 or 42.9%) compared to the placebo-treated group (11/118 or 9.3%. the average enhancement of walking speed among the dalfampridine-treated twrs during the 8-week efficacy assessment period was 24.7% compared to baseline; the mean enhancement during the finalon-treatment visit was 25.7%, reflecting continuation of the impact of medication over the interdosing phase. the authors concluded that this clinical trial generated class 1 evidence that treatment of patients with definite ms with extended-release dalfampridinetablets caused meaningful enhancement of walking ability in and the effect of the medication continued persisted between doses. based on the animal studies, dalfampridine demonstrates properties of a powerful convulsant stemming from its broad-spectrum suppressing activity on the potassium channels in the peripheral and central nervous systems.11 based on a number of clinical trials of 4-ap side effects consist of dizziness, insomnia, paresthesia, nausea of mild to moderate intensity, tremor, pain, anxiety and seizures.2934 dalfampridine is neither a substrate for nor an inhibitor of the p-glycoprotein transporter, therefore its pharmacokinetics is not affected by the medications which suppress this transporter. it does not interact with the medications which are substrates for the p-glycoprotein transporter. dalfampridine is contraindicated in patients with history of epilepsy or history of severe renal insufficiency.35 the reason that dalfampridine use is not recommended in epileptic patients is that epilepsy is characterized by abnormal neuronal depolarization with excessive inhibition on potassium channels, hence a further reduction of potassium channel activity by dalfampridine is not advised. pathogenesis of ms involves loss of oligodendrocyte/myelin complex which turn results in re-organization of axolemmal ion channels which leads to conduction abnormalities including conduction delay or block. pharmacological agents which block potassium channels have been investigated in the context of clinical trials with positive impact on impulse conduction in experimentally-induced demyelination as well as in patients with ms. dalfampridine (which is marketed as ampyra), is an extended release form of fampridine (4-aminopyridine), which has been recently approved by the us fda for symptomatic treatment of ms patients. while this new oral blocker of voltage-gated potassium channels does not have any impact on the underlying pathology of ms, it has been demonstrated to improve fatigue and walking ability in these patients.

multiple sclerosis (ms) is a progressive immune-mediated neurodegenerative disease of human central nervous system (cns), which causes irreversible disability in young adults. the cause and cure for ms remain unknown. pathophysiology of ms includes two arms: inflammatory demyelination and neurodegeneration. the inflammatory demyelination of ms which is mainly promoted by a massive activation of the immune system against putative cns antigen(s) leads to loss of oligodendrocyte/myelin complex which slows down or halts impulse conduction in denuded axons. practically, loss of myelin significantly reduces signal conduction along the demyelinated axons through alterations in the distribution of axonal ion channels. dalfampridine (4-aminopyridine or 4-ap) is an oral potassium channel blocker, which was recently approved by fda for symptomatic treatment of ms. dalfampridine, which acts at the central and peripheral nervous systems, enhances conduction in demyelinated axons and improves walking ability of ms patients. a number of clinical trials have evaluated the safety and efficacy of fampridine in ms patients with the degree of gait improvement as the main outcome. the objective of this manuscript is to provide an overview of the pharmacology, pharmacokinetics, clinical trials, side effects and interactions of dalfampridine used in treatment of ms patients.

PMC3663610

pubmed-188

the human cytomegalovirus (cmv) or human herpesvirus 5 is one of the major causes of congenital infections. its clinical manifestations range from asymptomatic forms (90% of cases) to severe fetal damage and, in rare cases, death due to abortion. furthermore, 10%15% of the children who are asymptomatic at birth may develop late sequelae, especially hearing defects, after a period of months or even years. latency following a primary infection (first contact with the virus) may be punctuated by periodic reactivations that give rise to recurrent infections, and in utero transmission may occur during either primary or recurrent infections. actually recurrent infections may be due to reinfection with a new strain or to reactivation, but it is likely that most recurrent infections are due to reinfection. the risk of congenital infection is much higher during primary infection [25], when the rate of transmission from mother to fetus is 30%40% [1, 6], as against 0.15%2.2% during reactivations or reinfections [1, 69] when, furthermore, most of the newborns are asymptomatic. symptomatic cases are due more to reinfection than reactivation [2, 10]. it has been reported that the risk of fetal damage is greater if the primary infection occurs during the first trimester of pregnancy [1113]. the prevalence of congenital infection ranges from 0.2% to 2.5% in different populations [1420], in which the risk factors include particular races or ethnic groups, a low socioeconomic status, premature birth, and admission to an intensive care unit [6, 17]. furthermore, the prevalence of congenital infection varies with the prevalence of the infection in the population. the seroprevalence of cmv among women of childbearing age ranges from 35% to 95% in different countries [12, 2124] and, as well as increasing with age, may also depend on sexual activity and occupation, particularly occupations involving close contacts with children in a community setting. in the case of parents, contact with the urine or saliva of their children is a major source of infection [2527]. the incidence of primary infection among pregnant women ranges from 0.5% and 4% [28, 29]; the rate of seroconversion during pregnancy ranges from 0.4% to 2% [12, 13, 30, 31] and depends on the seroprevalence of the infection in the population, being 3.7% among women belonging to populations with a low seroprevalence (55%) and 1.0%1.6% among those belonging to populations with a high seroprevalence (85%). the risk of acquiring infection during pregnancy is 0.71.38 100 pregnancies [23, 29] among seronegative women, and 0.20.8 100 pregnancies among women as a whole. as far as prevention is concerned, in addition to health education campaigns, the serological screening of pregnant women has been proposed. however, there is no consensus in the scientific community concerning the implementation of screening, and it is not recommended by any public health system because of its cost/benefit ratio, although many doctors in israel, belgium, and france do test their pregnant patients. furthermore, although the current public health legislation in italy (law decree 245 of 10 september 1998) does not include free cmv antibody screening during pregnancy, it is prescribed by many general practitioners. the aim of this study was to assess the incidence and risk of acquiring cmv infection in pregnant women in an urban area in northern italy in the period 20052007. during the three years 20052007, the microbiology unit of hospital of legnano, received samples for the detection of cmv antibodies from 2817 pregnant women (mean age 32 years, range 1546; 2522 (89.5%) were italian and 295 (10.5%) of foreign origin). forty-eight women (1.7%) were 20 or less than 20 years of age, 928 (32.9%) women were aged between 21 and 30, 1750 (62.1%) aged between 31 and 40, and 91 (3.2%) between 41 and 50. 2318 women (82.3%) underwent their first screening in the first trimester (group a), 316 (11.2%) in the second trimester (group b), and 183 (6.5%) in the third (group c). the requests were made by the general practitioners as part of the routine screening required during pregnancy. all of the samples were analyzed for the presence of anti-cmv igg and igm antibodies by means of an enzyme-linked immunosorbent assay (elisa) (eti-cytok-g-plus, eti-cytok-m reverse plus, diasorin, saluggia, italy). the cutoff value used to determine igg was 0.4 iu/ml, whereas the samples were considered igm-positive when their absorbence was equal to, or greater than the control cutoff value. the igm-positive samples were confirmed using an enzyme-linked fluorescent assay (elfa) (vidas cmv igm, biomrieux, lyon, france) and were considered positive when their index was 0.90, borderline when their index was between 0.70 and 0.90, and negative when their index was >0.70. as igm anti-cmv antibodies may test positive for more than 12 months and may be produced during reactivation or reinfection, the samples that were igm-positive at elisa were also tested for igg avidity (liaison cmv igg avidity, diasorin saluggia, italy), which was considered low if the index was <0.2, moderate if it was between 0.2 and 0.3, and high if it was 0.3. low igg avidity levels strongly suggest an infection contracted less than three months before, whereas a high avidity tends to exclude this .the elisa igm-positive samples were also tested for the presence of rheumatoid factor (arthri-slidex, biomrieux, lyon, france). in the case of positivity for igm, the patients ' general practitioners were contacted and advised to evaluate the case and refer patients to a reference center. at the first screening, the elisas showed that 1925 women (68.3%; 95% ci: 66.6%70.0%) were positive for anti-cmv igg (positive or negative for igm) and 26 (0.9%; 95% ci: 0.55%1.25%) were positive for igm antibodies (25 in the first trimester, and one in the second trimester for whom no previous data were available as she did not undergo screening during the first trimester). table 1 shows the results of igm and igg elisa by trimester of first screening (groups a elfa of the 26 elisa igm-positive samples showed that 17 (65.4%) were positive or borderline, and nine were negative (34.6%), including the sample that was igm-positive at elisa screening in the second trimester. none of the differences in the prevalence of igg and igm between contiguous age classes was statistically significant. of the 892 women who were anti-cmv antibody negative at first screening, 687 (77.0%) were in the first trimester of pregnancy (group a), 131 (14.7%) in the second trimester (group b), and 74 (8.3%) in the third (group c). three hundred and seventy-four of the women of group a (54.4%) were also screened in the second trimester, and 258 (37.6%) were also screened in the third (table 2). of these, two became positive for igm (confirmed by elfa) and igg, one in the second trimester (0.3%), and one in the third (0.4%), for a mean seroconversion rate of 0.32%. of the 131 women of group b, 64 (48.9%) were also screened in the third trimester; there were no cases of seroconversion (table 2). of the 1899 women who were anti-cmv igg antibody positive (and negative for igm) at first screening, 1606 (84.6%) were in the first trimester of pregnancy (group a), 184 (9.7%) in the second trimester (group b), and 109 (5.7%) in the third (group c). one hundred and fifteen of the women of group a (7.2%) were also screened in the second trimester, and 66 (4.1%) were also screened in the third. of the 184 women of group b, 20 (10.9%) were also screened in the third trimester (table 2). nineteen of the 28 igm-positive samples at elisa (67.9%) were confirmed as being igm-positive by means of elfa, and 13 (46.4%) showed low or moderate igg avidity. the 19 elfa-confirmed cases (17 first screened in the first trimester, and the two seroconversions) included six (31.6%) with a high degree of igg avidity, five (26.3%) with moderate avidity, and eight (42.1%) with a low degree of avidity (table 3). table 4 shows the results of the confirmatory igm elfa and igg avidity tests by trimester of pregnancy. in particular, of the five cases showing moderate avidity, one was recorded in our files as having been seronegative for both igg and igm four and a half months before (i.e., about two months before conception), and another was the case of seroconversion in the third trimester after being seronegative in the first and second. in the remaining three cases, the only data available were those of the initial positive sample, but the general practitioner of one of these women, who was contacted after the detection of igm positivity, reported symptoms compatible with ongoing cmv infection. no symptoms were reported by the general practitioners in any of the other two cases nor additional information was available. all of the 13 cases with low or moderate igg avidity were therefore considered as having primary infection: 11 (84.6%) occurring in the first trimester, one (7.7%) in the second, and one (7.7%) in the third (both seroconversions). unfortunately there were no data regarding the transmission of infection to the fetus because the igm-positive women were all referred for further investigations to reference centers throughout the area. the cumulative incidence of cmv infection (new cases observed during pregnancy) calculated on the basis of the 13 cases with low or moderate igg avidity was 1.4% (95% ci: 0.971.83), and the risk of infection during pregnancy, calculated on the basis of all of the women (seronegative and seropositive), was 0.5 100 pregnancies (95% ci: 0.240.76). the differences in incidence and risk by age was not statistically significant. to take into account the loss to follow-up within the groups and different admission to the study of women during different trimester, there were also calculated the density incidence as cases/pregnant woman-trimester and the correlated risk for all women (seronegative and seropositive): they were, respectively, 0.8% (95% ci: 0.471.13) and 0.4% (95% ci: 0.170.63). the overall prevalence of anti-cmv igg antibodies in our pregnant women was 68.3% (95% ci: 66.670.0), without any significant differences between age classes. as first pregnancies in italy generally occur later than they did in the past, the majority of women have already recovered from primary infection by the time they reach childbearing age and almost certainly by the time of their first pregnancy. moreover, in this study 95% of the women had an age between 21 and 40 years while age classes of 20 or less than 20 and over 40 years were under-represented; so this could be a further cause of the lack of difference in seroprevalence. on the basis of the results of the igg avidity test, the cumulative incidence of cmv infection was 1.4% (95% ci: 0.971.83%), the density incidence was 0.8% (95% ci: 0.471.13), and the risk of infection was 0.5% (95% ci: 0.240.76%) without any significant differences by age. seroconversion or clinical data indicating acute infection were available for three of the five cases with moderate avidity in this study, thus moderate avidity was considered as a potential marker of acute infection. moderate and low igg avidity were considered together, and both were included in the calculation of incidence. however, the incidence may be an underestimate because only about half of the seronegative women underwent further screening in the second trimester and about one-third in the third, and so some cases of seroconversion may have been missed. for the same reason, the proportion of primary infections (84.6%) occurring in the first trimester may be overestimated; however, assuming the same rate of seroconversion among the seronegative women who did not undergo further screening, the majority of primary infections occurred in the first trimester. the fact that 84.6% of the primary infections occurred in the first trimester may have been due to different behaviors before the pregnancy was recognized, whereas greater care during pregnancy may lead to less exposure. the fact that there were no differences related to the age of the women indicates the same type of behavior at different ages. it is therefore important to start screening in the first trimester of pregnancy, when there is a greater risk of infection and in order to have initial findings to compare with subsequent follow-up. in the absence of baseline data, the presence of igg without igm in women undergoing their first screening in the third trimester raises doubts as it may be the result of a previous infection occurring at any time in life before the pregnancy; however, although this is statistically the most probable situation, the possibility of an infection occurring in the first trimester with the subsequent loss of igm can not be excluded. finally some limitations of the study must be taken into account as no outcome data for newborns, substantial loss to follow-up, and limited testing of igg positive women for reinfections or reactivations. however, for the latter two cases, as there are no official recommendations, the follow-up was performed at the discretion of the general practitioner with compliance of pregnant woman who, above all, must pay for cmv antibody screening. in conclusion, although screening is not recommended by any public health system (including italy's) because of its cost/benefit ratio, it is actually adopted by many general practitioners in our area. such screening provides an opportunity to identify seronegative women who can be counselled about using appropriate hygienic measures to prevent infection, especially in relation to their behavior with children, who are a major source of infection. furthermore, the screening identified primary infections in pregnant women who could be referred to reference centers to check for prenatal infection. amniocentesis, funicolocentesis, ultrasonography, and magnetic resonance imaging can all be used to detect infection and allow the planning of appropriate interventions (e.g., antiviral therapy, termination of pregnancy). although some authors consider that screening is not justified on the grounds of its economic cost, the imperfect nature of congenital infection prognostic criteria, the risk of spontaneous abortions induced by invasive tests such as amniocentesis, and the few data concerning effective treatments during pregnancy, it is unthinkable to deny pregnant women appropriate information concerning the health of their unborn child as this raises a number of ethical and legal questions. the incidence and risk of cmv infection in pregnancy found in our area, therefore, support the use of serological screening, certainly in the first trimester when the risk of infection is higher and, in the case of seronegative women, possibly also one screening in the second trimester and one in the third .

the fetal consequences of cmv infection make it one of the most serious infections contracted during pregnancy, but the scientific community is divided over the proposed implementation of preventive screening for anti-cmv antibodies. the aim of this study was to assess the incidence and risk of infection during pregnancy in 2817 women who underwent anti-cmv igg and igm antibody screening during the period 20052007. the prevalence of anti-cmv igg antibodies was 68.3% (95% ci: 66.670.0); the seroconversion rate in the 892 seronegative women was 0.32%; the results of igg avidity testing revealed an cumulative incidence of 1.4% (95% ci: 0.971.83), density incidence of 0.8% (as cases/pregnant woman-trimester) (95% ci: 0.471.13), and a risk of infection of 0.5% (95% ci: 0.240.76). the screening identified 13 cases of primary infection (84.6% of which occurred in the first trimester of pregnancy). the possibility to identify these cases and consequently to plan appropriate interventions, supports the use of screening during pregnancy, especially in the first trimester when the risk of infection is greater.

PMC2715896

pubmed-189

personalized medicine is defined by the use of genomic signatures of patients to assign effective therapies in order to achieve the best medical outcomes for individual patients, thus improving public health. despite the variety of clinical, morphological, and molecular parameters used to classify human malignancies, patients receiving the same diagnosis can have markedly different clinical courses and treatment responses. since there is no simple way to determine who will have an adverse reaction, the current system of one-size-fits-all- diagnoses is simply not good enough. an increasing number of studies have demonstrated sex differences in drug reactions to the same drug treatment. migeon implied that males and females responded differently to drug treatments and that sex plays a key role in cancer. in addition, females are historically less studied subjects due to the complication of estrous cycle, and therefore such studies would further benefit women's health and promote public health. recent advancements in biotechnology have accelerated the search for molecular biomarkers useful in the diagnosis and treatment of disease. molecular biomarkers of disease risk and status are critical to an accurate treatment by identifying patients most likely to benefit from particular drugs or experience adverse reactions. because medicine is always practiced on individuals rather than populations, the goal is to change the assignment of therapies from a population-based approach to an individualized approach. gene-expression data can be used to identify patients with a good disease prognosis, thereby preventing some patients from unnecessary therapies and toxicity. for example, gene-expression profiling was used to predict clinical outcomes in pediatric patients with acute myeloid leukemia and to find genes whose aberrant expression leads to a poor prognosis. thus, accurate classification of prognosis of patients leads to efficient cancer treatment and prolonged survival of patients. classification algorithms are needed for biomedical decision making in clinical assignment of patients to treatment therapies based on individual risk factors and disease characteristics. since many of those genes are not relevant, feature selection is a commonly addressed problem in classification [3, 4]. the goal of gene selection is to identify a set of genes which plays an important role in the classification. a common approach is to select a fixed number of the highest ranked genes based on t-test-like statistics, some discrimination measures [6, 7], or classification algorithms including support vector machines (svm) [8, 9] and random forest (rf) [10, 11]. development of a biomarker classifier involves two distinct components: (1) a procedure for building a classifier and (2) validation/evaluation procedure for estimating the error rate of biomarker. the most important consideration is the validation/evaluation of a biomarker classifier to assess whether it can accurately and unbiasedly predict new samples based on a set of selected features. two methods are commonly used to develop and assess performance of a classifier: the split-sample procedure and cross-validation procedure. in the split-sample procedure, the sample dataset is randomly split into two subsets: a training set for model building and a test set for performance assessment. that is, the training dataset is used for building the biomarker classifiers and the test set is used for evaluating the classifier. however, samples are often insufficient to split into two sample sets of approximately equal size for model building and model testing, and a cross-validation (cv) procedure is commonly used for performance assessment [12, 13]. a cv can be regarded as a generalization of the split-sample method. it involves repeatedly splitting the data into a training set containing most of the samples and applying the prediction rule to the test set of the remaining samples to estimate the prediction accuracy rate. the prediction accuracy is the average accuracy of the numerous training-test partitions. for model building, given that differences in the biology of lung cancer and other diseases exist between men and women [14, 15], investigations to identify genomic biomarkers for clinical assignment of therapies on an individual patient basis are crucial. in this paper, the ratio of between-group to within-group sums of squares (bw ratio,) gene selection algorithm is used to obtain a feasible set of influential genes via variable importance ranking procedure in the training phases of 20 trials of 10-fold cv within leave-one-out cross-validation (loocv) procedure as illustrated below. the genes with largest bw ratios are ranked high as significant genes. in the development of biomarker classifier, the predictive accuracy of the classifier must be evaluated on a separate set of data. to derive an unbiased accuracy estimate, a nested cross-validation procedure, 20 trials of 10-fold cv within loocv, is used in this paper. in other words, in each loocv, 90% of the wherefore genes are selected only using learning data sets of size (n 1) each, and in the evaluation/validation step a never-touched and left-out single observation in loocv is used to assess the predictive performance of selected genes. in this way, each test case is never used for gene selection. to avoid a bias due to partitions of data, if the performance is assessed using the very same data that are used for developing the classifier, this obviously leads to a biased down estimate of classification error. in other words, if one applies a method to the original data with 20 trials of 10-fold cv only as a way of building the classifier and selects a set of genes and then on that very same data calculates the classification error, it clearly leads to a biased upward estimate of classification accuracy. three publicly available data sets of interest in this paper are pediatric acute myeloid leukemia (aml), b-cell chronic lymphocytic leukemia (b-cll), and primary cutaneous melanoma. the data sets are downloaded from the brb-arraytools data archive for human cancer gene expression located at the website http://linus.nci.nih.gov/~brb/dataarchive_new.html. sex differences in disease rates or in rates of adverse reactions to treatment are common, which we intend to exploit to obtain sex-specific biomarkers from gene-expression data. we hypothesize that genomic biomarkers developed from the sex-specific application of classification algorithms will further improve class prediction accuracy. the summary of our algorithm to find sex-specific predictive/prognostic genomic biomarkers for efficacy or toxicity in individualized treatment of patients for serious diseases is as follows. in each loocv trial, firstly, the data is partitioned into a test data set with one observation and the remaining data as the learning data set. the learning data set is further separated into male and female patients ' learning data sets. thus, this process will be applied n times, where n represents the total number of patients. secondly, within each trial of loocv, twenty trials of 10-fold cv are conducted for each set of male and female patients in the learning data set. at each 10-fold cv step, two sets of top-ranked genes, one for male patients (smi) and one for female patients (sfi), are obtained via the bw ratio to differentiate types of patients such as diseased versus nondiseased. this can be done by applying variable importance ranking approach in order to extract most influential genes and by combining a measure of importance in each gene. a score taking the average of the measure in cross-validation (cv) is prioritized in the list of genes according to variable importance. thirdly, the mutually exclusive sets of male-specific genes and female-specific genes are obtained. fourthly, within each loocv trial, after the sets of potential sex-specific genes are determined in the second and the third steps, they are fitted to a model with diagonal linear discriminant analysis (dlda ;) using each learning data set for male and female patients. finally, the performance is measured with the test data with one observation in each loocv trial. this method is implemented in r. the r code is available upon request. within each trial of loocv, each set of top-ranked genes for male and female patients is obtained in the second and the third steps as follows. first, in order to build genomic biomarkers, 20 trials of 10-fold cv are applied to each learning data set for males and females, where 90% were randomly selected without replacement as a set for each trial of cv. next, for each trial of 10-fold cv, the bw ratio was applied to this 90 percent learning set and the top 25 ranked genes were selected in each process with the target endpoint of a dataset. the bw ratio for a gene j is defined as (1)bwj=iki(yi=k)(xkjxj)2iki(yi=k)(xijxkj)2, where x-j=ixij/n indicates the average value of a gene j across all the training samples, x-kj=i(yi=k)xij/nk indicates the average value of a gene j for a class k, and i indicates an observation. here this criterion has been shown to be reliable for variable selection from high-dimensional data sets [6, 12]. next, to avoid selection bias from a pattern of selection of learning samples, we repeat the entire process 20 times by shuffling samples at every 10-fold cv. in order to obtain the variable importance ranking, 200 sets of top 25 ranked genes were combined so that the maximum possible rank score of a gene would be 200. a set of genes that has been selected at least once (rank score>0) was obtained separately for males and females. these most influential genes used in the classification process are identified in order to extract a feasible set of sex-specific genes. for both male and female learning data sets, the final product of the 20 trials of 10-fold cv described in each loocv is the sets of genes selected for male and female patients in the learning data set smj={g1,, gxmj} and sfj={g1,, gxfj }, j=1, 2,, n, respectively. the sets smj and sfj contain prognostic/predictive genes for male and female patients, respectively. there would be n sets of selected genes. within each trial of loocv, genes that are commonly identified between male-specific and female-specific genes finally, the test sample with one observation is tested using these sex-specific genes in each loocv. at the end of the entire loocv, each selected gene has a combined variable importance score that is less than or equal to n. to verify sex-specific biomarkers, we consider the following four different cases: we classify the outcome of (1) male patients with a set of male-specific genes smj,(2) female patients with a set of male-specific genes smj,(3) male patients with a set of female-specific genes sfj, and (4) female patients with a set of female-specific genes sfj. we anticipate that data with a set of male-specific genes have higher predictable power to predict male patients than the data with female-specific genes. similarly, data with female-specific genes have higher predictable power to predict female patients than the data with male-specific genes. upon completion of loocv, the performance of sex-specific biomarkers is obtained. in order to validly evaluate the performance of a gene set selected by the proposed method, cv utilizes resampling without replacement of the entire data set to repeatedly develop classifiers on a training set and to evaluate these classifiers on a separate test set and then averages the results over the resamples. in this section, we apply the proposed algorithm to the following genomic data sets to find the most meaningful sex-specific predictive/prognostic genomic biomarkers for improving individualized treatment of patients and for evaluating the biomarkers from the proposed algorithm. current chemotherapy enables a high percentage of pediatric patients with aml to enter complete remission (cr), but a large number of them experience relapse (r) with resistant disease. because of the wide heterogeneity of aml, predicting a patient's risk for treatment failure or relapse at the time of diagnosis is critical for the optimal treatment. this gene-expression data set consists of 54 aml pediatric patients (< 15 years old) with an oligonucleotide microarray containing 12,566 probe sets and it is also available at ftp://ftp.ncbi.nih.gov/pub/geo/data/soft/gds/gds1059.soft.gz. patients with cr for more than 3 years are classified as having a good prognosis, while patients experienced relapse within 1 year of the first cr are considered as having a poor prognosis. in this data set, there are 28 patients with cr and 25 patients with r. since a five-month male patient experienced induction failure (no cr achievement) within 3 months of the start of treatment is considered neither cr nor r, we exclude this subject. therefore, there are 32 male patients and 21 female patients in this data set. with the prognostic endpoint (r/cr), the average accuracy of 66% (sd 3.0%) for pediatric patient classification was obtained when no gene selection was introduced. when a set of 200 genes was selected in a learning phase of each cv, the average accuracy of 68.0% (sd 3.0%) was achieved. when a set of 20 genes was selected in a learning phase of each cv, the average accuracy of 71.0% (sd 5.0%) was obtained. since it appeared to be no substantial difference between accuracy and the number of genes selected, a feasible set of 25 genes in the learning phase of each cv was collectively ranked by the bw ratio to find sex-specific biomarkers. at the end of loocv trials, a set of male-specific genes that were selected at least 75% of the time in the entire loocv were 1882_g_at (mecom: mds1 and evi1 complex locus), 37902_at (cryz: crystallin, zeta (quinone reductase)), 38789_at (tkt: transketolase (wernicke-korsakoff syndrome)), 39105_at (vasp: vasodilator-stimulated phosphoprotein), 40844_at (ctr9: ctr9, paf1/rna polymerase ii complex component, homolog (s. cerevisiae)), 36981_at (srp9: signal recognition particle 9 kda), 36338_at (luzp1: leucine zipper protein 1), 31870_at (cd37: cd37 antigen), 1624_at (rap1gds1: rap1, gtp-gdp dissociation stimulator 1), and 39142_at (nudt21: cleavage and polyadenylation specific factor 5, 25 kda). these ten top-ranked male-specific genes were selected as potential male-specific genomic biomarkers to classify male patients into r/cr. among them 38789_at (tkt: transketolase) and 36338_at (est) were also included in the thirty-five genes associated with prognosis of pediatric aml identified by yagi et al.. in order to select a feasible set of sex-specific biomarkers a cut-off criterion of 75 percent is used. since every dataset may have a different sample size, the number of genes selected is given by the percentage, which is a rank score of the selected genes greater than 75% of the sample size in our case. for example, if a sample size is 100, then genes that have rank scores greater than 75 have been selected. similarly, nine top-ranked genes for classifying female patients into r/cr were 40601_at (tm2d1: tm2 domain containing 1), 36330_at (ccbl1: cysteine conjugate beta- lyase; cytoplasmic (glutamine transaminase k, kynurenine aminotransferase)), 40586_at (eef1e1: eukaryotic translation elongation factor 1 epsilon 1), 36648_at (crsp9: cofactor required for sp1 transcriptional activation, subunit 9, 33 kda), 32351_at (gpr20: g protein-coupled receptor 20), 1718_at (arpc2: actin-related protein 2/3 complex, subunit 2, 34 kda), 38622_at (mtg1: mitochondrial gtpase 1 homolog (s. cerevisiae)), 36496_at (impa2: inositol(myo)-1(or 4)-monophosphatase 2), and 38337_at (znf193: zinc finger protein 193). these nine top-ranked genes which were selected at least 75% of the time in the entire loocv were considered as potential female-specific genomic biomarkers to classify female patients into r/cr. data with male-specific genes showed higher prediction accuracy (71.9%) to classify male patients than the accuracy (43.8%) to classify male patients from data with female-specific genes. similarly, data with female-specific genes showed higher prediction accuracy (76.2%) to classify female patients than the accuracy (61.9%) to classify female patients from data with male-specific genes. as shown in table 1, sensitivity and specificity were also higher in using sex-specific genes for each sex. genomic aberrations and mutational status of the immunoglobulin variable heavy chain (vh) gene have been shown to be among the most important predictors for outcome in patients with b-cll. b-cll is the most common leukemia in the western world, and due to its clinical heterogeneity (wide range of life expectancy) and correlations to genomic aberrations, it is important to predict a patient's vh mutation status at the time of diagnosis for optimal treatment. in addition, the study presented by haslinger et al. suggested that the genomic signature for vh mutational status might be sex related. the gene-expression data consists of 100 b-cll patients with an oligonucleotide microarray containing around 12,000 probe sets, and it is available at http://linus.nci.nih.gov/~brb/dataarchive_new.html. patients are classified as either vh-mutated or unmutated (m/nm). there are 62 males (33 m and 29 nm) and 38 females (18 m and 20 nm), with a total of 51 mutated and 49 unmutated patients. in step 1, for each data set with male only and female only patients using the target endpoint (i.e., vh-mutated (m) versus unmutated (nm)), we separately selected and ranked 25 potential prognostic genes for males and for females in every cv trial and separately combined ranks of these genes for males and females during the learning phase of 20 trials of 10-fold cv within each loocv trial. in every loocv trial, we prioritized and combined the final top-ranked 200 genes from the male patients result (sm) and 200 genes from the female patients result (sf) as explained in section 3.1. at the end of the entire loocv trials, a set of potential sex-specific genes are obtained for each sex by prioritizing and combining n sets of top-ranked 200 genes. after deletion of overlapped genes in both males and females, eleven potential male-specific genes were obtained to classify male patients into m/nm. they were 41209_at (lpl: lipoprotein lipase), 41755_at (cobll1: cobl-like 1), 39878_at (pcdh9: protocadherin 9), 38211_at (zbtb20: zinc finger and btb domain containing 20), 39488_at (pcdh9: protocadherin 9), 36886_f_at (kir2dl3: killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3), 32140_at (sorl1: sortilin-related receptor, l(dlr class) a repeats-containing), 33535_at (p2rx1: purinergic receptor p2x, ligand-gated ion channel, 1), 39967_at (ldoc1: leucine zipper, downregulated in cancer 1), 32842_at (bcl7a: b-cell cll/lymphoma 7a), and 36899_at (satb1: special at-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating dna's)). for female patients, only five genes were selected at least 75% of the time in the entire loocv trial as potential female-specific genomic biomarkers to classify female patients into m/nm. they were 33745_at (phkg2: phosphorylase kinase, gamma 2 (testis)), 38152_at (loh11cr2a: loss of heterozygosity, 11, chromosomal region 2, gene a), 34142_at (pde8a: phosphodiesterase 8a), 39593_at (fgl2: fibrinogen-like 2), and 217_at (klk2: kallikrein 2, prostatic). to verify the sex-specific genomic biomarkers, we considered the performance of four different cases in the loocv trials as described in section 2. data with male-specific genomic biomarkers showed higher accuracy (67.7%) to classify male patients into m/nm than the accuracy to classify male patients into m/nm from data with female-specific genomic biomarkers (40.3%). however, female data with female-specific genes showed prediction accuracy similar to random guess close to 50%. therefore, there is insufficient evidence to support that the selected female-specific genes were female-specific genes (see table 2) with 38 female patients in this data set. although cutaneous melanoma represents a small subset, it is the most life-threatening neoplasm of the skin, and its incidence and mortality have been increasing worldwide. the key underlying molecular events have not been clearly elucidated, which may explain why no target has been developed and why almost no clinical benefits from new therapies have been clearly demonstrated in patients with melanoma since the late 1970s. additionally, gene-expression profiling data for human primary cutaneous melanomas are scarce because of the lack of retrospective collections of frozen tumors. this gene-expression data set was collected from 83 patients corresponding to the training data set and 17 patients corresponding to the validation data set. the probes are from tumor tissue and from reference tissue that are differentially labeled by the incorporation of cyanine 3 (cy3) and cyanine 5 (cy5), respectively. set, the endpoint was patient prognosis and survival along with tumor stages, defined as follows. in stage i, cure rates are excellent with surgical removal, since they are the least likely to spread. in stage ii, melanomas can be cured, but the success rate lags behind that of stage i because a small number of cancer cells may have spread to distant sites. in stage iii, since the tumor has started to metastasize (the spreading of a disease from one organ or part to another nonadjacent organ or part), the survival rate for these stages is lower than the earlier ones. stage iv is associated with metastasis beyond the regional lymph nodes to distant sites in the body, such as the lung, liver, or brain, or to distant areas of the skin. based on the tumor size, descriptions, and number of lymph nodes the stages are categorized in two classes. a class of high survival and small tumor size (hs/st) is defined and composed of stages 1 and 2. the second is defined as low survival and non-small tumor size (ls/nst), which is composed of stages 3 and 4. tables 3 and 4 show the distribution of the primary cutaneous melanoma data based on sex, the defined clinical endpoint hs/st and ls/nst for the training data and validation data. among 83 patients in the training dataset, there are 27 males (12 hs/st and 15 ls/nst) and 56 females (30 hs/st and 26 ls/nst). there are 42 cases of hs/st and 41 cases of ls/nst in total. after preprocessing the data the final gene count is 4641 genes. among 17 patients in the validation data set, there are 8 males (1 hs/st and 7 ls/nst) and 9 females (1 hs/st and 8 ls/nst). there are 2 cases of hs/st and 15 cases of ls/nst in total. since the validation set was separately provided, the sex-specific genes were selected via 20 trials of 10-fold cv in the learning set. the following ten male-specific genes were selected at least 75% of the time during 20 trials of 10-fold cv: a_23_p128263 (prb1: proline-rich protein bstni subfamily 1), a_23_p83838 (ca8: carbonic anhydrase viii), a_24_p212990 (mgc70863: similar to rpl23ap7 protein), a_23_p333650 (rad9b: rad9 homolog b (s. cerevisiae)), a_32_p125251 (n/a), a_23_p108835 (ypel5: yippee-like 5 (drosophila)), a_32_p150856 (loc407835: mitogen-activated protein kinase kinase 2 pseudogene), a_23_p11936 (ubxn11: ubx domain protein 11), a_24_p169976 (n/a), and a_32_p3998 (znf600: zinc finger protein 600). for female patients, the following eight female-specific genes were selected from 20 trials of 10-fold cv: a_23_p69497 (clec3b: c-type lectin domain family 3, member b), a_24_p118884 (n/a), a_23_p152420 (kiaa0182), a_24_p265177 (phc3: polyhomeotic-like 3 (drosophila)), a_23_p251421 (cdca7: cell division cycle associated 7), a_23_p211738 (ubp1: upstream binding protein 1 (lbp-1a)), a_23_p47377 (hsd17b12: hydroxysteroid (17-beta) dehydrogenase 12), and a_32_p113646 (cdna flj45341 fis, clone brhip3009672). using a given validation set, the sex-specific genes were verified. as shown in the confusion matrix in table 5, there was no difference in the performance from female data with female genes compared with the performance of female data with male genes. however, there was only one misclassification for male patients with male genes as shown in table 6, while there were four misclassifications for male patients with female genes as shown in table 7. therefore, we conclude that there exists evidence of male-specific genes in a classification of primary cutaneous melanoma. large inter individual differences in benefit from chemotherapy highlight the need to develop predictive genomic biomarkers for selecting the right treatment for the right patient. inappropriate chemotherapy can result in the selection of more resistant and aggressive tumor cells. to date, no reliable genomic biomarkers have been developed to provide the physician with prechemotherapy information to accurately predict the efficacy of a specific therapy. we proposed a procedure to find sex-specific prognostic and predictive genomic biomarkers in order to assign individualized treatments in a personalized paradigm using variable importance ranking via combination of 20 trials of 10-fold cv and loocv. the proposed procedure was applied to data sets obtained from the brb arraytools data human cancer archive. however, the issue arose out of there being not enough samples, and the data was unbalanced (i.e., more males than females or more positives (disease patients) than negatives (nondisease patients)). while patient's sex information was not specified for many of the publicly available data sets adding to that the difficulty of searching for data, we found the following three genomic data sets that had sex information: (1) pediatric patients with aml, (2) b-cell chronic lymphocytic leukemia (b-cll), and (3) primary cutaneous melanoma. in one application, pediatric patients with aml were classified by the algorithms as having either a good or poor prognosis, in terms of the likelihood of induction failure or relapse within one year of the first complete remission, based on gene-expression profiles. if this were brought into clinical application, a patient with a confidently predicted good prognosis might want to elect out of adjuvant chemotherapy and its associated debilitating side effects. with current rule-based decisions, the overall average accuracy of this data set with a variable selection from pooled patients (males and females) was about 71.0%. however, using male-specific genes found by the proposed procedure, the accuracy was improved to about 72% as we found in the model validation studies. similarly, using female-specific genes found by the proposed procedure, the average accuracy was improved to about 76% (see table 1). in the b-cell chronic lymphocytic leukemia (b-cll) dataset we found male-specific prognostic genomic biomarkers associated with b-cell chronic lymphocytic leukemia and its average classification accuracy was improved to about 68%. there was no substantial evidence to find female-specific prognostic genomic biomarkers in this data set. similarly, male-specific predictive genomic biomarkers associated with a classification of primary cutaneous melanoma were found with the classification accuracy of about 88%. the scope of our paper was to find sex-specific genomic biomarkers, if any, imbedded in the data instead of finding genomic biomarkers from the data. if commonly identified genes were kept in the proposed procedure, our procedure was not sex-specific genomic biomarker classifier involving two populations (males and females) any more but rather it became genomic biomarker classifier involving one combined population. in fact, even though commonly identified genes were kept, it did not necessarily improve the classification accuracy. for a counterexample, for the pediatric aml data of yagi et al., the accuracy for female patients with female-specific genes by keeping the commonly identified genes was 62%; however, the accuracy without commonly identified genes was 76%. for the male patients with male-specific genes by keeping the commonly identified genes the accuracy was 59%, but the accuracy without the commonly identified genes was 72%. for the related note, the accuracy of this data can be found anywhere between 59% and 66% with gene preprocessing and between 58% and 71% with gene selection. it is not an easy task to find sex-specific genes, let alone verifying and proving that they are indeed sexspecific. we have presented a procedure for finding sex-specific prognostic and predictive genomic biomarkers in order to assign individualized treatments in a personalized paradigm. the procedure is shown to have good sensitivity and specificity in the sense that the sex-specific genes obtained can improve prediction accuracy in classification of individual patient's prognosis. the proposed procedure to discover predictive and prognostic sex-specific genomic biomarkers for individualized treatment of diseases can play a critical role in developing safer and more effective therapies that replace one-size-fits-all drugs with treatments that focus on specific patient needs.

numerous studies have demonstrated sex differences in drug reactions to the same drug treatment, steering away from the traditional view of one-size-fits-all medicine. a premise of this study is that the sex of a patient influences difference in disease characteristics and risk factors. in this study, we intend to exploit and to obtain better sex-specific biomarkers from gene-expression data. we propose a procedure to isolate a set of important genes as sex-specific genomic biomarkers, which may enable more effective patient treatment. a set of sex-specific genes is obtained by a variable importance ranking using a combination of cross-validation methods. the proposed procedure is applied to three gene-expression datasets.

PMC3834650

pubmed-190

in the last decade, preimplantation genetic diagnosis (pgd) has become an important alternative to prenatal diagnosis for couples at high risk of transmitting inherited disorders to their children. fluorescence in situ hybridization (fish) has been offered for gender selection in x-linked diseases (1, 2), chromosomal translocations (3-5), aneuploidy, and recurrent implantation failure (6, 7). procedures using polymerase chain reaction (pcr) has been applied for single gene defects including x-linked diseases (8-11). ornithine transcarbamylase (otc; ec 2.1.3.3) is placed in the mitochondrial matrix where it contributes to the detoxification of nitrogenous wastes through the urea cycle, and catalyzes the synthesis of citruline from carbamyl phosphate and ornithine. the otc gene is located on the short arm of the x chromosome within band xp21.1 (12). it spans 73 kb, has an open reading frame of 1,062 nucleotides, and contains 10 exons and 9 introns (13, 14). otc deficiency (mim-#311250) is an x-linked and co-dominant metabolic disorder with partial penetrance in females (15). the phenotype of otc deficiency is extremely heterogeneous, ranging from asymptomatic adult hemizygous males to acute neonatal hyperammonemic coma in the first week of affected male babies. approximately 80% of heterozygous females are asymptomatic and remaining 20% show clinical severity similar to males with partial deficiencies (16, 17). there are more than 341 mutations known to cause otc deficiency, all of which are specific for the individual families. mutations have been found in all exons and introns with a relative paucity of mutations in the sequence encoding the leader peptide (exon 1 and a part of exon 2) and in exon 7 (17, 18). to our knowledge, only two cases have been reported where specific pgd for otc deficiency were carried out using multiplex or duplex-nested pcr assay and healthy babies devoid of the otc mutation were born (19, 20). in this study, we describe the successful pregnancy and birth after pgd for otc deficiency with simultaneous analyses of fish and duplex-nested pcr in korea. we have applied a duplex-nested pcr for the amplification of both the causative mutation and the y chromosome specific sry gene, and fish for aneuploidy screening of chromosome x, y and 18. a couple was referred to our center after therapeutic termination of the second pregnancy following prenatal diagnosis for otc deficiency. in the first pregnancy, a male baby was born but died at 10 days after birth due to liver dysfunction accompanying hyperammonemia. molecular genetic analysis of the couple's otc gene was performed by pcr and direct sequencing at seoul asan hospital and revealed a single base substitution (r320x) in the exon 9 of the female partner. in the second pregnancy, the fetus was identified to be an affected boy by pcr and direct sequencing on a chorionic villus sample, and the pregnancy was therapeutically terminated. in order to avoid a pregnancy with an affected baby, the couple was counseled for pgd in cheil general hospital. in order to determine the efficiency of single cell pcr and allele drop-out (ado) rate, primers used for the detection of the causative mutation and y chromosome specific sry gene were tested using single lymphocytes (table 1). ovarian stimulation, in vitro fertilization, and blastomere biopsy were done as previously described (4, 5). after the blastomere biopsy procedure, the embryos were washed several times and transferred to the g2.2 medium (vitrolife sweden ab, kungsbacka, sweden). each blastomere was washed twice through two drops of g2.2 medium and transferred into sterile 0.2 ml pcr tubes containing 5 l of alkaline lysis buffer. the nested-duplex pcr analysis was performed by previously described protocol (6). mutation analysis by restriction fragment length polynorphism (rflp) with bcli restriction enzyme was carried out only for positively amplified pcr products of blastomeres. the fish analysis for chromosome x, y and 18 was done as previously described and the manufacture's protocol (4, 5). the embryos with the normal genotype were selected and transferred on day 4 after fertilization. all 10 exons and exon-intron boundaries of the otc gene were screened by pcr followed by direct dna sequencing analysis. the heterozygous otc gene with r320x nonsense mutation (cgatga) and wild type was detected in the exon 9 of the female partner by rflp (fig. 1) and direct sequencing (data not shown). this r320x nonsense mutation was associated with acute neonatal hyperammonemia in their first pregnancy and reduced enzyme activity by 10-15% (21). the efficiency and accuracy of the duplex-nested pcr analysis were tested on single lymphocytes from the heterozygous female partner and normal male partner. pcr on single lymphocytes resulted in 90.6% (58/64) amplification rate, whereas none of the negative controls showed a positive band. after ovarian hyperstimulation, a total of 18 oocytes were retrieved and 17 oocytes were injected using intracytoplasmic sperm injection in order to prevent dna contamination from inseminated sperm. among a total of 11 embryos, two blastomeres per embryo from 9 embryos were biopsied and simultaneously analyzed by duplex-nested pcr and fish, and one blastomere per embryo from 2 embryos by only duplex-nested pcr. as a result of duplex-nested pcr and rflp analysis with the bcli restriction enzyme, ten showed successful amplification for the exon 9 of the otc gene, and the amplification rate was 90.9%, almost same as that of the single lymphocyte test. there were two unaffected males, five affected males, two unaffected females, and one heterozygous female (fig. 2 and table 2). on the other hand, out of nine blastomeres analyzed by fish, only six blastomeres were identified as chromosomally normal embryos (fig. however, among total four unaffected embryos (embryo 1, 2, 3, and 8) diagnosed by pcr, only two embryos (embryo 3 and 8) were identified as chromosomally normal by fish. the other two embryos (embryo 1 and 2) were shown to have trisomy 18 and monosomy 18, respectively. only one male embryo (embryo 8) was transferred, and another female unaffected embryo (embryo 3) was cryopreserved at blastocyst stage on day 5 after fertilization. this pgd cycle resulted in a singleton pregnancy and the genotype of the fetus was confirmed to be a normal male by amniocentesis at 16 weeks of gestation. the genotype of the baby for the exon 9 of otc gene and level of ammonia were confirmed as normal. most pgd cycles for x-linked disorders such as duchenne muscular dystrophy and fragile x syndrome involved the selection of female embryos which were diagnosed as normal or heterozygous. these gender selections were supported by couples at risk of x-linked recessive conditions. ado for affected allele could lead to yielding an affected heterozygous baby, even if the female embryo was diagnosed as normal by pgd for otc deficiency. gender selection with fish for y chromosome-specific loci is more reliable because amplification failure could occasionally occur in single cell pcr. thus, our protocol with pcr and fish in this study provides higher accuracy for the selection of genetically and chromosomally normal embryos in the pgd for x-linked co-dominant defects. we applied duplex-nested pcr and fish analysis in two blastomeres from each embryo, which were more than 6-cell stage. biopsy of more than a quarter of blastomeres from each embryo could interfere with developmental potential of embryos. thus, single blastomere biopsy was applied to less than 6-cell stage embryos in this study. sequential pcr and fish analysis in one blastomere (cell recycling) was reported and could be used to detect the aneuploidy, but the rate of ado after pcr seems to be higher using this method (22, 23). a duplex-nested pcr analysis was developed for the simultaneous diagnosis of a r320x mutation and a gender selection, and fish analysis was used to detect aneuploidy for chromosome x, y and 18. as a result of duplex nested pcr and fish analysis, concordant results have been obtained from two blastomeres at the sex locus, and the amplification efficiency was 100% (9/9 except two blastomeres, that were not analyzed by fish analysis) for sry. and the amplification rate was 90.9% (10/11) for exon 9 of the otc gene. several strategies have been developed to decrease amplification failure and ado in single cell analysis of pgd. these included the development of sequential first and second polar body analysis (24), improvement of the pcr condition by increasing the denaturation temperature and time (19), using a more powerful lysis method (25-28) and the use of fluorescent pcr for mutations or linked markers and multiplex pcr (29-32). as mentioned above, we have also endeavored to optimize single cell pcr conditions, which included longer initial denaturation time, higher denaturation temperature, and the selection of taq polymerase, the concentration of mgcl2, and lysis methods. the incidence of ado was 5-15% in many pgd laboratories (27, 28). at a preliminary experiment on single lymphocytes in this study, the ado rate for exon 9 of the otc gene was about 13.0% when using duplex-nested pcr. we could not absolutely exclude the possibility of ado in the diagnosis of unaffected female embryo owing to the relatively higher ado. thus, fish was simultaneously applied for the aneuploidy screening and sex selection to prevent the pregnancy of heterozygous female. in this study, we report the successful pgd and delivery of a healthy boy in a couple at risk of transmitting the otc deficiency. this was carried out by the simultaneous analysis of the duplex-nested pcr for a r320x mutation in the otc gene underlying the otc deficiency and y chromosome-specific loci, and fish for aneuploidy screening of chromosome x, y and 18. this strategy could provide higher accuracy for the selection of genetically and chromosomally normal embryos in pgd for single gene defects.

ornithine transcarbamylase (otc) deficiency is an x-linked co-dominant disorder. a couple, with a previous history of a neonatal death and a therapeutical termination due to otc deficiency, was referred to our center for preimplantation genetic diagnosis (pgd). the female partner has a nonsense mutation in the exon 9 of the otc gene (r320x). we carried out nested polymerase chain reaction (pcr) for r320x mutation and fluorescence in situ hybridization (fish) for aneuploidy screening. among a total of 11 embryos, two blastomeres per embryo from 9 embryos were biopsied and analyzed by duplex-nested pcr and fish, and one blastomere per embryo from 2 embryos by only duplex-nested pcr. as a result of pcr and restriction fragment length polymorphism analysis, four embryos were diagnosed as unaffected embryos having the normal otc gene. among these embryos, only one embryo was confirmed as euploidy for chromosome x, y and 18 by fish analysis. a single normal embryo was transferred to the mother, yielding an unaffected pregnancy and birth of a healthy boy. based on our results, pcr for mutation loci and fish for aneuploidy screening with two blastomeres from an embryo could provide higher accuracy for the selection of genetically and chromosomally normal embryos in the pgd for single gene defects.

PMC2693659

pubmed-191

the union rate and hardware-related complications remain a major concern in these patients, especially following multilevel spinal fusion surgeries. developing an adjunct therapy that essentially supplements the mainstay surgical management is of great importance to these patients. multitudinous research to gain insight into use of teriparatide (134 recombinant human parathyroid hormone) for enhancing bone formation in osteoporosis is readily available in the literature. its action as a direct anabolic agent in bone tissue, consistently increases bone mineral density and thus improves skeletal architecture. since its availability in market, indications are unravelling and is being attempted in many conditions including fracture healing, dental stability, hypoparathyroidism, and hypocalcaemia. another evolving field of interest is the role of teriparatide for enhancing bone graft union and osseo-integration of implants. it is said to accelerate bone graft union and reduce the incidence of pedicle screw loosening after lumbar spinal fusion surgeries. we intended to study this effect and analyze if teriparatide can be an effective adjunct therapy to achieve solid posterolateral fusion mass and reduce the incidence of subsequent screw loosening after multilevel instrumented lumbar fusion surgeries in elderly patients. an open-labeled, nonplacebo controlled, retrospective, single center study is formulated by shortlisting 62 elderly patients (male 9; female=53) between the age group of 65 to 78 years (mean age standard deviation [sd]=70.1 3.7), who underwent instrumented lumbar fusion for various degenerative pathologies over a period of time. all of them had received multilevel lumbar fixation (3 levels or 4 vertebral segments) with pedicle screw constructs and postero-lateral intertransverse fusion with a combination of local bone graft and allograft. the prime indication for surgery was chronic unresolving low back pain, with or without neurological symptoms, associated with any one of the following conditions: a)multisegmental spinal instability (spondylolisthesis grade 1),b)multilevel degenerative spondylosis with or without segmental instability, andc)degenerative scoliosis with or without segmental instability. multisegmental spinal instability (spondylolisthesis grade 1), multilevel degenerative spondylosis with or without segmental instability, and degenerative scoliosis with or without segmental instability. we excluded: a)those patients operated with oligo-level spinal fusions (2 levels or 3 vertebral segments).b)those with 1 or more osteoporotic vertebral compression fractures among the fused levels.c)those with previous surgery in the same level.d)those in whom infection or tumor was an indication for surgery.e)those with 1 or more potential data missing. those patients operated with oligo-level spinal fusions (2 levels or 3 vertebral segments). those with 1 or more osteoporotic vertebral compression fractures among the fused levels. those with previous surgery in the same level. those in whom infection or tumor was an indication for surgery. those with 1 or more potential data missing. selection was irrespective of individual bone mineral density (bmd) status, as bmd scoring was not done as a part of routine preoperative evaluation in patients undergoing multilevel spinal fusions. our sample included elderly patients 65 years who are expected to have detoriating osteogenesis potential. associated medical comorbidities included diabetes mellitus (dm) and bronchial asthma (ba) in 25 and 8 patients, respectively. a mixture of fresh frozen allograft and local bone chips were used as graft. local bone consisted of spinous process, lamina, and facets from the decompression site. occasionally, additional interbody cages were used at insufficient discs especially at the caudal end of the construct to increase stability. following surgery, patients were given an option of postoperative teriparatide use and opting to it was solely based on their own decision. in total, 30 patients who accepted for long-term daily use of teriparatide were in the experimental group and remaining 32 patients were in the control group. teriparatide (self-administered; 20 mcg sc injection) was started for those patients in the experimental group from the first postoperative day, once daily using delivery device. the control group received similar standardized and accepted treatment protocols as those in the experimental group except for the use of postoperative teriparatide. all patients were instructed to take calcium and vitamin d supplements every day following surgery. outcome analysis was done using radiological data which included antero-posterior (ap), conventional lateral view, and dynamic stress lateral view radiographs taken at 12 months follow-up (figs. 1 and 2). (c) mri images showing severe degeneration of disc levels and canal stenosis from l1l5. (d) 12 months follow-up ap view x-ray which was considered as solid fusion (lenke type 1). ap=antero-posterior, mri=magnetic resonance imaging. radiological outcome illustration of a random case from the control group. (a) (b) preoperative dynamic stress (extension and flexion) lateral view radiographs showing degeneration from l3s1 segments. (c) mri images showing severe degeneration of disc levels and canal stenosis from l3s1. (d) 12 months follow-up ap view x-ray showing bilateral signs of pseudo-arthrosis interpreted as nonunion (lenke type 4). they divide postero lateral fusion mass into 4 grades based on the appearance in an ap radiograph. grade a represents definitive fusion with bilateral thick bony masses, grade b represents probable fusion with unilateral thick bony mass and thin bony mass on other side, grade c represents no probable fusion with thin bony mass on the one side and pseudo-arthrosis on the other side, grade d represents no fusion with thin bony mass on both the sides showing obvious pseudo-arthrosis or resorption of graft bilaterally. we interpreted grade 1 and grade 2 of lenke's criteria as solid fusion which is explained as unilateral or bilateral bridging bone formation across the transverse process of adjacent vertebra showing continuous trabeculation in an ap radiograph. although most of the patients had long fixations, segmental cobb's angle change involving the upper and lower ends of the construct as seen in dynamic (flexion and extension) stress lateral views will also be considered as nonunion. screw loosening was determined when there was occurrence of radiolucency (halo sign) around the pedicle screws in either ap or lateral view radiographs. change in the screw position noticed in dynamic stress lateral view radiographs will additionally be considered as screw loosening, which may occur at the cephalic and caudal ends of the construct. results were tabulated and statistical analyses were carried out using graph pad prism 5 (graphpad software inc., san diego, ca). analyses were done using unpaired t test for continuous variables and fisher's exact test for categorical variables. probability values of less than 0.05 were considered statistically significant. written informed consent was obtained from all patients including acceptance of daily usage of teriparatide delivery device from those in the experimental group. this study was approved by the institutional review board of chang gung memorial hospital with irb registry no-201600800b0 and was performed in accordance with the ethical standards stated in the most recent version of the 1964 declaration of helsinki. sixty-two elderly patients (age=6578 years; mean=70.11 years; male=9, female=53) are divided into 2 groups based on teriparatide administration following surgery. group 1 or the experimental group (n=30; mean age sd=69.8 3.8 years) was those in whom teriparatide was administered and group 2 (n=32; mean age sd=70.4 3.6 years) was the control group. the presence of concomitant medical comorbidities in group 1 (dm=14; ba=4) and group 2 (dm=11; ba=4) was matched. the demographic variation in characteristics of the groups is statistically insignificant (table 1). surgical parameters of the experimental group (fusion levels=137; pedicle screws=269) and the control group (fusion levels=144; pedicle screws=283) had no statistically significant variance. duration of teriparatide administration averaged 7.4 2.4 months in the experimental group. follow-up data were available for a mean duration of 25.4 months for those in the experimental group and 27 months for those in the control group. even though follow-up was done for a longer duration, analyzing outcome further after 1 year may not be related to teriparatide use. considering the duration of administration of teriparatide, radiological outcome analysis was decided to be done at 1 year follow-up. none of our patients missed the 1st year follow-up and required x-rays were available in our database for all the patients. radiological outcome analysis was done using ap, lateral, and dynamic stress lateral view radiographs taken at 12 months follow-up. two or more observers concurred stating that there was unilateral or bilateral bridging bone formation across the transverse process of adjacent vertebras showing continuous trabeculation confirming solid fusion in 20 patients (66.7%) of the teriparatide group and 16 patients (50%) in the control group. nonunion was noted in 10 patients (33.3%) of teriparatide group and 16 patients (50%) in the control group. the 16.7% advantage procured with teriparatide use was not statistically significant (p=0.20) (table 2). screw loosening was calculated comparing the number of screws showing signs of loosening to total number of screws in each group. the incidence of screw loosening was 13.4% in the teriparatide group and 24.4% in the control group. this difference was statistically significant with p=0.001 (table 2). elderly patients with chronic unresolving symptoms due to degenerative spine disease are prone to have poor surgical outcomes. they also predispose for more hardware-related complications, especially following long spinal fusions. considering the possibility of poor outcomes, treating these conditions can not be ignored but rather a potential solution needs to be developed which effectively supplements the mainstay surgical management. it is said to play a reasonable role in treatment of osteoporosis. apart from being used in osteoporotic individuals, insights into its action on many other conditions are unraveling. animal studies yielded promising results for teriparatide usage to enhance postero-lateral fusion mass in rat models. in human studies relating to teriparatide, most authors studied its effect only in osteoporotic individuals. in our sample, patients were between 65 and 78 years of age and are more susceptible to have poor bmd. patients had comorbidities such as dm and bronchial asthma that have negative influence over bmd. dm is said to reduce bmd at a higher rate in elderly women, even if the baseline bmd was high. along with postero-lateral fusion, additional interbody cages were used especially at very insufficient discs often seen in the caudal end of the construct. this step also allows the graft to access the pluripotent stem cells of the bone marrow. since a large amount of graft is required for long fusions, there usually is a lack of host bone. static and dynamic radiographs are used for radiological assessment of spinal fusion by many authors, but computerized tomography (ct) is considered more accurate. most of the radiographic criteria developed to assess fusion mass consider movement in dynamic radiographs as a main component for assessment. they lack reliability as the absence of motion does not confirm fusion, especially in the case of long instrumented levels. based on ap radiographs, we considered grade a (definitive fusion; bilateral thick bony mass) and grade b (probable fusion; unilateral thick bony mass) described by lenke et al as solid fusion. fusion masses that did not favorably appear to have definitive or probable fusion were considered as nonunion. we also considered change in segmental cobb's angle, visualized in dynamic stress lateral view radiographs as an additional criterion to interpret as nonunion. formation of a radiolucent zone (halo sign) around the pedicle screws seen in conventional ap/lateral view radiographs and change in screw position seen in dynamic stress lateral view radiographs were considered definitive indicators for screw loosening. teriparatide is said to have potential to increase the quality of lumbar spine bone marrow and pedicle cortex and thus reduces the incidence of pedicle screw loosening. it is even believed to increase the insertional torque of pedicle screws when administered from at least 1 month prior to surgery. long-term teriparatide use can be associated with significant improvement in bone microarchitecture and trabeculation. it is also said that; more than 6 months of daily injection facilitates effective bone union following postero-lateral fusion. considering this, we administered teriparatide for a mean duration of 7.4 months and none of the patients had any drug induced complications. most of the similar studies in literature included only short segment postero-lateral fusions. our study is foremost to discuss the effect of teriparatide on multilevel posterolateral fusions in elderly patients. according to our preliminary results, the percentage of patients achieving solid fusion following teriparatide use was found to be more than that of the control group. besides that, use of teriparatide effectively reduced the incidence of subsequent screw loosening which proved to be statistically significant. our study evaluates the radiological outcome following postoperative teriparatide administration in patients undergoing multilevel instrumented lumbar fusion surgery. even though percentage of solid fusion was more among patients who used teriparatide, the difference was not statistically significant. however, teriparatide was more significantly influential in reducing the incidence of subsequent pedicle screw loosening. being a retrospective study, there are few methodological shortcomings that may have influenced our outcome. the lack of preoperative bmd data, variation in surgical indications, and differential treatment durations of teriparatide administration may have biased the sample. use of ct as an evaluation tool to assess bone graft union could have been more empirical. considering the selected sample size, the study may be underpowered to draw potential conclusions.

abstractelderly patients with chronic nonresolving symptoms due to degenerative spine pathologies are prone to have poor surgical outcomes and hardware-related complications, especially following multilevel instrumented lumbar fusion surgeries. with intention of analyzing if teriparatide can be an effective adjunct therapy to surgical management, radiological outcomes are studied. sixty-two elderly patients were divided into 2 similar groups. group 1 (n=30; mean age=69.83 years; fusion levels=137; screws=269) had taken teriparatide (20 mcg sc injection, once daily) for a duration of 7.4 2.4 months following surgery and group 2 (n=32; mean age=70.38 years; fusion levels=144; screws=283) did not take teriparatide. radiological evaluation was done to determine the state of postero lateral fusion mass and to investigate the incidence of pedicle screw loosening at 1-year follow-up. unilateral or bilateral bridging bone formation across the transverse process of adjacent vertebras showing continuous trabeculation suggestive of solid fusion was obtained in 66.7% patients in the teriparatide group and 50% patients in the control group (p=0.20). 13.4% of the total no. of screws showed signs of loosening in the teriparatide group, compared to 24.4% in the control group (p=0.001). percentage of patients achieving solid fusion following teriparatide use was found to be more than that of the control group. this difference may have clinical importance but was not statistically significant. however, teriparatide use was more significantly influential in reducing the incidence of subsequent pedicle screw loosening.

PMC5293457

pubmed-192

according to the world health organization's recent update, diabetes, hypertension, and obesity are one of the top five continuing risk factors for cardiovascular deaths in the world. obesity is increasing substantially and is one of the major contributors of disease prevalence due to its pathophysiological link to other cardiovascular risks such as hypertension and diabetes. it is estimated that, in 2010, 6.4% of adults would have diabetes mellitus affecting 285 million in the world and it will increase to 7.7% by 2030, affecting 439 million adults. of special note is that there will be a 67% increase in the prevalence of diabetes in developing countries from 2010 to 2030. metabolic syndrome (ms) is a constellation of overweight/obesity, hypertension, and disturbances of lipid and carbohydrate metabolism. the definition of ms was debated for a long time to produce a standardized clinical criterion. the world health organisation describes ms as the presence of type 2 diabetes or impaired glucose tolerance with any two of the following characteristics: obesity, high levels of triglycerides, low levels of high-density lipoprotein, and hypertension. the international diabetes federation (idf) takes central obesity as a prerequisite for the diagnosis of ms with the association of any two of the other factors, that is, high blood pressure, abnormal blood glucose, high levels of triglycerides, and low levels of high-density lipoprotein. also, the idf has derived specific reference values for central obesity for different ethnicities. the national cholesterol education programme (ncep) expert panel on detection, evaluation, and treatment of high blood cholesterol in adults (adult treatment panel, or atp, iii), the national heart, lung and blood institute, and the american heart association have released a report on the criteria for diagnosing and managing ms. the panel describes ms as the presence of any three of the following: abdominal obesity, dislipidemia (high levels of triglycerides, low hdl), increased blood pressure, and elevated fasting glucose. for the purpose of this paper, the atp iii and idf's definitions are used and compared. each component of ms is a known risk factor for the development of type 2 diabetes, atherosclerosis, and coronary artery disease (cad). people with ms are 310 times more likely to develop cardiovascular disease commensurate with a high risk of morbidity and mortality [5, 6]. central obesity, one of the components of ms, predicts the occurrence of diabetes and overall cardiovascular risk. the ncep atp iii states that ms is equal to cigarette smoking as a contributing factor for premature cardiovascular disease. the prevalence of metabolic syndrome is increasing all over the world with different regions having individual clusters of epidemic risk factors [6, 8], and in particular there is evidence of a high prevalence of ms and diabetes in south asians. substantial increase in the prevalence of type 2 diabetes in asia in recent years has raised serious concerns about cardiovascular consequences for these populations [5, 10]. however, in developing countries, many of these subclinical conditions are not diagnosed until the onset of complications such as myocardial infarction or stroke. it is essential to initiate early detection of these chronic diseases in underdeveloped countries in asia, such as nepal, so that preventative action can minimize the consequences. this study aims to establish the prevalence of hypertension, diabetes, obesity, and metabolic syndrome in the participants of a major health screening programme in nepal. this study also aims to establish the relationship between the components of ms and lifestyle of the participants. nepal is one of the poorest countries of the world at the 136th position of human development index. the subjects were the participants of the programme for detection and management of chronic kidney disease, hypertension, diabetes and cardiovascular disease, a community-based screening programme in eastern nepal. in this community-based programme a series of community awareness programmes were conducted in a specific locality with the help of local leaders, medical students, and community volunteers. various screening centres such as permanent centers (in health clinics, community centers, etc.) and temporary screening centers (in schools, clubs, houses of worship, and private homes) were used to screen the population. each center used a group of five to seven people as community volunteers and consisted of a local leader (priest, administrator, school teachers, and local political leaders), a laboratory technician, and nurse. medical students (approximately 100 in number) and nursing students (around 25) assisted the community volunteers. prior to screening, the community volunteers went from door to door to record the number of family members residing permanently and to inform the members of the family, about the need of the project. all people of 20 years were invited to come to a predefined place in very close vicinity to their house. pregnant or menstruating women at the time of analysis, people with a fever or acute illness, and those who had recently engaged in heavy exercise were excluded. the research team also collected general information on the participants ' demographic data, diet, smoking, alcohol consumption, and physical activity. the data recorded included family and medical history for kidney disease, high blood pressure, diabetes, cardiovascular disease and any current medication or treatment. blood pressure was measured by the auscultatory method with a random zero mercury sphygmomanometer and standard cuff (12 34 cm). the blood pressure measurement was taken in the seated position, quietly in a chair with feet on the floor and an arm support at the heart level. hypertension was defined according to the guidelines of the seventh report of the joint national committee on prevention, detection, evaluation and treatment of high blood pressure, that is, systolic blood pressure 140 mm hg or diastolic blood pressure 90 mm hg and/or concomitant use of antihypertensive medications. body weight and height were assessed with all subjects standing without shoes and heavy outer garments to the nearest 0.1 kg and 1 cm, respectively. waist circumference was measured over light clothing at a level midway between the lower rib margin and the iliac crest in centimetres rounded up to nearest 0.5 cm. abdominal obesity is defined as an abdominal circumference>102 cm (40 in) in males and>88 cm (35 in) in females for ncep criteria and>90 cm in males and>80 cm in females for idf criteria for south asians. plasma glucose concentration was determined by the glucose oxidase-peroxidase method (vitalab selectra-2, merck, germany). the diagnosis of diabetes was defined by either casual plasma glucose 200 mgdl associated with symptoms of diabetes and on fasting samples plasma glucose 126 mgdl. individuals with self reported, prior physician-diagnosis of diabetes were classified as having previously diagnosed diabetes. serum lipids that include total cholesterol, high-density lipoprotein (hdl), low-density lipoprotein (ldl), and triglycerides (tg) were also measured (vitalab selectra-2, merck, germany). the results from any person having a history of hypertension or found to have hypertension were verified by qualified doctors. the biochemical tests were completed in semiautomatic analysers (microlab 300, vital scientific, the netherelands). epidata refers to a group of applications used in combination for creating documented data structures and analysis of quantitative data. in this study, the idf and ncep atp iii's criteria for metabolic syndrome were used to calculate and compare the frequency of metabolic syndrome. the relationships between the prevalence of cardiovascular risk factors, demographic details, lifestyle, and physiological test results were analysed using the spearman correlation test. further, the differences in the categorical variables were examined using chi-squared test. odds ratios (ors) and their 95% confidence interval were calculated using binary logistic regression (for gender and age) and multinomial logistic regression (for life style factors). in total, 14,425 people, aged 20100 (mean age 41.4 15.1), were included in the study. among them, the percentage of education level is illustrated in accordance to the number of years in education (15 years the participants were divided into four categories according to their work: labourer/farm, office, house, and none/unknown. participants ' physical activities were defined according to the time spent every day on physical activity as>60 min, 3060 min,<30 min/day, and none. abdominal obesity was observed in 11.5% (n=1607/14002) of the participants as per ncep criteria (mean waist circumference: male107.38 6.19 cm, female94.84 5.84 cm) and in 34.7% (n=5006/14418) of the participants as per idf criteria. according to the revised bmi, 10.6% (n=1534/14423) were underweight (bmi<18.5), 28.2% (n=4065/14423) were overweight (bmi=2224.9), and 32.5% (n=4689/14423) were obese (bmi>25). diabetic prevalence was 6.3% (889/14008) of which 4.8% (n=673/14008) were under treatment. a figure of 12.3% (n=1718/14009) had a family history of diabetes. hypertension was observed in 33.9% (n=4894/14422) of the participants (mean systolic 138.72 18.03 mm hg and mean diastolic 93.09 8.45 mm hg). only 12.9% (1812/14009) were previously diagnosed, and 8.5% were receiving treatment for hypertension. a history of coronary artery disease was present in 1.6% (n=218/14007), and 1% (n=142) were under treatment for ischemic heart disease or stroke. table 2 shows the goodness of fit for the prevalence of obesity, hypertension, and diabetes. prevalence of hypertension showed no difference from these data, and obesity showed only a small difference. the percentages of the participants who had abnormal lipid profile that includes total serum cholesterol, serum ldl cholesterol, serum hdl cholesterol, serum triglycerides are listed in table 3. there were 2191 sets of data eligible to meet the criteria for metabolic syndrome. ms was observed in 22.5% (n=494/2191) of the participants according to the idf criteria and 20.7% (454/2191) according to the ncep criteria. the percentages of individual ms risk factors among the total participants and the participants with ms are illustrated in figures 1 and 2. generally, among the total participants and the specific participants with ms, the presence of abnormal lipids was higher than the other factors defining ms. however, the presence of abdominal obesity was higher among ms participants using idf criteria (figure 2). the females had a higher prevalence of ms than males. according to the ncep criteria, the age groups 4160 and 6180 had a higher prevalence of ms than the lower age group. according to idf criteria, the age groups 4160 and 2040 had a higher prevalence of ms. the participants who worked at home had a high incidence of ms according to both the criteria used. the sedentary group had a higher incidence of ms than the participants who were physically active. the univariate correlations between cardiac risk factors are shown in table 5, and the chi-squared independence of them in the metabolic syndrome prevalence is listed in table 6. the prevalence of ms (ncep scores) had a significant positive relationship with education levels and physical activity. there were significant positive correlations between physical activity and the three individual ms components: high glucose (r=0.03, p<.01), high bp (r=0.04, p<.01), and low hdl (r=0.23, p<.01). there was no correlation between physical activity and the other two ms components: high triglyceride (r=0.003, p>.05) and abdominal obesity (r=0.003, p>the ncep scores had a positive correlation between the family history of diabetes (r=0.83, p<.01) and hypertension (r=0.115, p<.01). although a number of these correlations show high levels of significance, the common variance is extremely low, suggesting that the sample size is having a major impact on the significance. as a result of this table 7 lists the chi-squared independence, odds ratios, and confidence intervals in the association between age, gender, and specific lifestyle factors in metabolic syndrome prevalence. gender, age, education level, and physical activity show a positive association with the prevalence of metabolic syndrome. it is important to observe the prevalence of diabetes, hypertension, and obesity individually and also the combination of risk factors as metabolic syndrome to predict the risk of cardiovascular disease. any association between lifestyle factors and these risk factors would provide the opportunity to encourage a change in lifestyle to promote lower levels of subsequent cvd. the large number of poorly educated people and the large number of school dropouts could be linked to the disease prevalence. the prevalence of hypertension and metabolic syndrome in poorly educated people was large when compared with the educated participants. though the results are not generalized, the relationship between education levels and the prevalence of hypertension agrees with earlier studies [19, 20]. these found that education levels significantly influence the knowledge of hypertension and the awareness of cardiovascular risk. this suggests that there is a need to improve the awareness of health and use education to prevent or reduce the risk of ms and cardiovascular risks in these groups. the office workers had a lower prevalence of ms (ncep scores) than the other groups. a considerable number of office workers (64%) undertook regular physical activity of more than 30 min/day. the home workers education levels and physical activities were comparatively lower than the other work groups. these findings clearly show that education and physical activity have an influence on the prevalence of ms. most of the females were home workers (75.5%), and their education was comparatively lower than the males. the amount of physical activity involved in home workers is unknown, but the results suggest it is less than that undertaken by other workers. asian populations continue to modernize, and levels of physical activity are declining as (i) home and work place jobs become more automated and sedentary and (ii) transportation is more readily available. the prevalence of ms among the participants who had no physical activity was surprisingly no different than others. this may be due to a higher than average number of missing values in these data (2191/14425 complete data to meet the criteria for ms) or to other unknown socioeconomic factors. controversially, there was a high prevalence of ms among people who regularly ate fruit and vegetables.. found that a higher intake of macronutrients such as fruits and vegetables is associated with general obesity. however, it is not clear how the vegetables and fruits were eaten, for example, overcooked, processed, and so forth. the exact quantity of the dietary intake was not recorded as it was not the primary area of focus of the study. in these populations, these tend to report a low intake of mono-unsaturated fats (mufas), n-3 polyunsaturated fats (pufa), and transfatty acids (mostly related to widespread use of vanaspati, a hydrogenated oil). the healthy traditional plant-based diets are being replaced by cheaper calorie dense high-fat foods. these changes are resulting in a rapid increase in the prevalence of obesity throughout asia and the subsequent development of ms. ness and powles also found in their review that many studies were reporting the null or negative effects of fruit and vegetable intake on the prevalence of cardiovascular diseases. however, the correlations found in those studies were generally low, as seen in our study. further, they suggest that a food-based analysis would complement the nutrient-based analysis to clarify these issues. in nepal, the regular diet in addition to fruits and vegetables, that is, such as rice, which is high in carbohydrates, and the methods of cooking may be dietary causes of metabolic syndrome. the age groups 4060 had a large prevalence of ms in this study. also, it is important to note that this middle-aged group had a high incidence of overweight or general obesity and abdominal obesity. the other age groups had a lower prevalence of ms than the 4060 years old, yet it was still relatively high. inadequate maternal nutrition in pregnancy, low birth weight, and childhood obesity may be important factors for the development of metabolic syndrome and diabetes. specifically in children and young individuals, a high intake of n-6 pufa is correlated with hyperinsulinaemia. in adults, unger described metabolic syndrome as a failure of the system of intracellular lipid homeostasis which prevents lipotoxicity in organs of overnourished individuals. in this study in addition to low levels of hdl, the hdl particles are small, dense, and dysfunctional in south asians. hypertriglyceridaemia is a direct reflection of an insulin resistance condition, and it is interrelated to the low hdl concentrations in developing endothelial dysfunction. in nepal, a high number of the participants had abdominal obesity and were overweight/obese, according to their bmi. the bmi is a simple useful measure for overall abnormal weight, yet not a standard measure for obesity. bmi can not differentiate between whether the condition was due to unusual muscular development or the accumulation or distribution of fat in the body [26, 27]. despite the low prevalence of general body obesity compared to western countries, metabolic syndrome is growing into a significant public health problem in asia. this may be mainly due to the large number of people with central obesity, a feature which was also observed in this study. the higher prevalence of ms in females is also more likely to be due to a higher incidence of abdominal obesity. abdominal obesity is an important factor because metabolic syndrome and increased abdominal fat are related to a reduction of adiponectin, an adopicyte-derived hormone with antiatherogenic and anti-inflammatory properties. the abdominal adipose tissue results in release of free fatty acids directly in the portal veins and altered lipid levels in the blood. further abdominal adiposity increases insulin secretion, and it would be exaggerated by decreased hepatic clearance leading to hyperinsulinemia. thus abdominal obesity is an important indicator of cardiovascular disease due to its link to dyslipidemia, hyperinsulinemia, hypertension, and impaired fibrinolytic capacity. state that if the ncep's criteria were applied to the asian population, it might underestimate the prevalence of metabolic syndrome and the risk of cardiovascular disease. idf's specific reference values for abdominal obesity make a substantial difference to the prevalence of ms between the two criteria. the idf's cut-off points for south asians ' waist circumference are lower than the ncep's general cut-off points (90 cm versus 102 cm in men and 80 cm versus 88 cm in women). another study on chinese population also found a large increase in the prevalence of metabolic syndrome using idf criteria compared with ncep criteria. however, in our study both definitions demonstrated a higher prevalence of metabolic syndrome (20.722.5%) in nepal when compared with the studies done in other southeast asian countries such as thailand (1218% using ncep definition) and india (18.3% using idf definition). these findings suggest the need for specific attention to control the disease prevalence in nepal. although data were prospectively collected, they may not be generalizable outside of eastern nepal. the results did not show substantiate relationship between smoking histories, diet, family history of cardiovascular, and metabolic syndrome. abdominal obesity, with the revised reference values, is an important risk due to its physiological relationship to the other ms risk factors. the ms prevalence may be due to lack of awareness and unhealthy lifestyles, so health education and more preventive measures should decrease the prevalence of ms and cardiac risks in nepal .

background. this study was carried out to establish the prevalence of cardiovascular risks such as hypertension, obesity, and diabetes in eastern nepal. this study also establishes the prevalence of metabolic syndrome (ms) and its relationships to these cardiovascular risk factors and lifestyle. methods. 14,425 subjects aged 20100 (mean 41.4 15.1) were screened with a physical examination and blood tests. both the international diabetic federation (idf) and national cholesterol education programme's (ncep) definitions for ms were used and compared. results. 34% of the participants had hypertension, and 6.3% were diabetic. 28% were overweight, and 32% were obese. 22.5% of the participants had metabolic syndrome based on idf criteria and 20.7% according to the ncep definition. prevalence was higher in the less educated, people working at home, and females. there was no significant correlation between the participants ' lifestyle factors and the prevalence of ms. conclusion. the high incidence of dyslipidemia and abdominal obesity could be the major contributors to ms in nepal. education also appears to be related to the prevalence of ms. this study confirms the need to initiate appropriate treatment options for a condition which is highly prevalent in eastern nepal.

PMC3095978

pubmed-193

a 33-year-old woman, (gravida 3, para 2), at 34 weeks of gestation, presented with episodes of lightheadedness, and dyspnea. she was asymptomatic until 18 weeks of gestation, when she started having episodes of palpitations associated with presyncope. initially, the episodes were infrequent (less than once per day) but a gradual increase in frequency and severity was noted by the patient. one month prior to presentation, she noted episodes of paroxysmal nocturnal dyspnea, but no dyspnea on exertion, chest pain, diaphoresis, pedal edema, orthopnea, or neurological symptoms. she had no significant past medical history and had not had complications relating to this pregnancy. all prior pregnancies had progressed to full term without similar symptoms or complications, and resulted in spontaneous vaginal deliveries of healthy newborns. physical examination revealed an afebrile patient with a regular pulse of 80 beats per minute, blood pressure 110/70 mmhg, and an oxygen saturation of 100% on room air. the examination was normal except for mild non-pitting edema and fine bibasilar crackles. laboratory investigations revealed normal complete blood count, electrolytes, renal function, cardiac markers and tsh. cardiac monitoring showed multiple episodes of monomorphic, non-sustained ventricular tachycardia (vt) with left bundle branch morphology, consistent with vt originating from the right ventricular outflow tract (fig. urgent two-dimensional echocardiogram showed normal left ventricular size and wall thickness with no segmental wall motion abnormalities and normal systolic and diastolic function with a left ventricular ejection fraction of 57%. a 12-lead electrocardiogram showed sinus rhythm with average rate of 80 beats/min with a normal axis, pr-interval, and qrs duration with no evidence of chamber enlargement or infarction. the clinical working diagnosis was pregnancy-related vt of right ventricular outflow tract origin. a 24 year woman (gravida 4, para 2) presented to her local emergency department at 24 weeks gestation because of shortness of breath, cough, and chest tightness developing over the previous day. she had a history of mild asthma but had not had asthma-related symptoms for several years and had never had an asthma exacerbation requiring inpatient or emergency department care. past medical history and family history there had been no similar symptoms or medical complications in her previous three pregnancies, one of which had ended with spontaneous abortion and the other two with term delivery of healthy children. she smoked one-half to one pack of cigarettes per day but did not drink alcohol or use recreational drugs. physical examination revealed an afebrile patient with a regular pulse of 78 beats per minute, blood pressure 100/60 mmhg, and an oxygen saturation of 96% on room air. on respiratory exam the rest of the examination was normal except for mild non-pitting peripheral edema. laboratory investigations revealed normal complete blood count, electrolytes, renal function, cardiac markers, and tsh. the patient was diagnosed with an asthma exacerbation and treated with nebulized salbutamol 2.5 mg, which relieved her symptoms. shortly thereafter, she developed runs of asymptomatic nonsustained vt with a left bundle branch block pattern (fig. nebulized salbutamol 5 mg was once again administered, whereupon the patient developed sustained runs of vt of similar morphology. intravenous lidocaine and magnesium sulfate were administered, leading to resolution of the ventricular arrhythmia. no further salbutamol was administered, and two further days of electrocardiographic monitoring showed only occasional pvcs. twelve lead electrocardiogram showed sinus tachycardia at 102 beats per minute with occasional premature ventricular beats, normal corrected qt interval and no evidence of ischemia or chamber enlargement. echocardiography showed normal left ventricular size with normal systolic function with an ejection fraction of 57%, and no valvular abnormalities. given the absence of structural heart disease and risk factors for coronary disease or arrhythmia, the clinical diagnosis was catecholamine-sensitive pregnancy-related vt of right ventricular outflow tract origin. ventricular tachycardias (vt) may be seen in pregnancy and can manifest as a new onset arrhythmia or be exacerbated by pregnancy and can cause concern for the well-being of both the mother and the fetus. a study of 11 pregnant women who experienced a new onset of vt during pregnancy showed that onset was distributed equally over the three trimesters and disappeared completely during the postpartum period.1 the characteristics and underlying mechanisms of new-onset vt during pregnancy have not been adequately investigated. although the majority of vts that occur during the pregnancy are benign, in women with structural heart disease, arrhythmias (especially those of ventricular origin) is one of the five independent predictors of having an adverse outcome during pregnancy.2,3 peripartum cardiomyopathy (ppcm) needs to be considered in women presenting with vt in the last month of pregnancy.4,5 the criteria for the diagnosis of ppcm include: development of congestive heart failure secondary to left ventricular systolic dysfunction in the last month of pregnancy or within 5 months after delivery, absence of preexisting cardiac dysfunction, and absence of identifiable cause of heart failure and lv systolic dysfunction demonstrated by classic echocardiographic criteria.6 hence in women presenting with vt in the last month of pregnancy, an urgent echocardiographic study can assist in establishing a diagnosis of ppcm. women with certain types of congenital heart disease (chd) either repaired or not, are particularly vulnerable to vt. for example, patients with previous surgeries for correction of tetralogy of fallot may experience vt arising from the right ventricular outflow tract as a result of right ventricular volume overload due to decades of severe pulmonary regurgitation as a consequence of patch augmentation of the right ventricular outflow tract at the time of original corrective surgery.7 a study of 28 female patients with repaired chd demonstrated women with chd had a significantly higher incidence of tachyarrhythmia during pregnancy and in the postpartum period compared to controls.8 congenital long qt syndrome (lqts) is a hereditary disorder of cardiac ion channels causing abnormal electrical activation of the heart.9 women with congenital lqts may experience life-threatening polymorphic vt; however recent reports indicates that their incidence appears to be significantly increased during the postpartum period.10,11 patients with congenital lqts are particularly vulnerable to adverse arrhythmic effects of electrolyte depletion (further prolongation of qt interval) a possible complication in some pregnant women with hyperemesis. cautious use of mediations that may further prolong the qt interval is necessary in these individuals to avoid precipitation of polymorphic vt. in addition to cardiac diseases, several systemic non-cardiac disorders, including severe electrolyte derangements, thyroid function abnormalities, pulmonary embolism, anemia, and drug overdose may present with ventricular arrhythmias. there are few reports of new onset vt during pregnancy in absence of structural heart disease.12,13 increased sympathetic activity, as well as physiological changes associated with normal pregnancy such as increased heart rate, decreased peripheral resistance, increased stroke volume and psychological stresses are thought to be the most common precipitants of vt in pregnant women with a structurally normal hearts.14,15 the majority of outflow tract vt in structurally normal hearts originate from the right ventricular outflow tract (rvot) just below the pulmonary valve. this is also the most common focus of initiation of pregnancy-related idiopathic vt and usually does not deteriorate to an unstable rhythm. it will often manifest as ectopic beats, bigeminal rhythms or short runs of non-sustained vt. norepinephrine concentration in the myocardial synaptic cleft has been suggested as a potential mechanism for this arrhythmia.16 only 10% of vt originates from the left ventricular outflow tract (lvot).17 to make a diagnosis, a 12-lead ecg should be recorded ideally during the arrhythmia, although this can be difficult. a typical resting ecg of a pregnant woman may show an increased heart rate with decreased pr, qrs and qt intervals, but there is usually no significant change in the amplitudes of p and t-waves and qrs-complex.15 premature atrial and ventricular beats as well as q wave and inverted t waves in the inferior leads can also be seen during pregnancy.18 on ecg, rvot vt appears as wide qrs complex tachycardia with left bundle brunch block (lbbb) morphology and an inferior axis.17,19 two phenotypic forms of rvot vt can occur, non-sustained monomorphic vt and paroxysmal sustained vt.20 in contrast, lvot vt morphology depends on the site of origin with either lbbb and early precordial transition in leads v12, or rbbb pattern in v1 with broad monophasic r in the precordial leads. in addition, the ecg in patients with vt originating in the lvot will show r: s amplitude ratio of 30% or more or an r: qrs duration ratio of 50% in leads v12.21 a routine 24 to 48 hour-holter monitor is helpful in capturing frequently occurring paroxysmal arrhythmias. to elicit symptoms, an exercise ecg can be reasonably carried out during pregnancy in absence of obstetrical contraindications for exercise. no fetal adverse events are reported for adenosine, except for one case of transient fetal bradycardia.22 the first step in acute management of vt in pregnancy to determine the hemodynamic stability of the pregnant woman. if the woman is unstable or there is evidence of significant fetal compromise which is thought to be related to the vt, dc cardioversion with 50100 j should be given immediately. dc shocks can be repeated at higher levels of energy (100360 j) if indicated. the risk for the fetus is minimal for all stages of pregnancy, because the amount of current reaching the fetus is small.23 in stable vt, an accurate diagnosis of the type of arrhythmia should be made with a twelve-lead ecg prior to any intervention. invasive electrophysiological studies are rarely required during pregnancy, as the arrhythmias can be effectively managed pharmacologically. conservative medical treatment of vt arising during pregnancy is indicated in any patient with sustained vt as long as the patient is hemodynamically stable.14 if possible drug therapy should be avoided during the first trimester and drugs with the longest records of safety should be used as the first-line therapies.24 the literature safety data has examined digoxin, adenosine, flecainide, procainamide, propranolol, propafenone, quinidine, sotalol and verapamil, however; the experience is limited to single or small case series. in stable patients with sustained vt acute therapy can be initiated with either intravenous procainamide, which is safe, well-tolerated and is not associated with teratogenicity. alternatively lidocaine can also be used to treat stable vt.14 idiopathic vt originating from the rvot and with a lbbb morphology responds well to beta-blockers, while idiopathic lvot vt with rbbb morphology generally responds well to verapamil. given the sensitivity of majority of vts in pregnancy to catecholamines, a cardioselective beta-blocker, in particular metoprolol, in the absence of contraindications is considered first line therapy.12 in our cases, further investigations did not reveal a secondary cause of the patients arrhythmias. based on the ecgs (qrs morphology of a left bundle branch block pattern with an inferior axis, and clinical findings) both patients were diagnosed with idiopathic vt originating from the rvot. the lower dose for the second patient was chosen because of suspected asthma exacerbation; however the dose was slowly increased to 50 mg po every 12 hours. both patients tolerated treatment well and had no further documented episodes of vt on long-term cardiac monitoring. patient 1 was scheduled for elective c-section at a high risk obstetric center and was discharged home. on the follow-up patient 2 had a spontaneous vaginal delivery at 36 weeks and continued to be on metoprolol after discharge. pregnant patients may present with ventricular tachycardia during any trimester careful and timely clinical, electrocardiographic, as well as echocardiographic assessment help identify those individuals with structural cardiac abnormalities such as congenital heart disease or peripartum cardiomyopathy, as well as those with long qt syndrome who will need specific management beyond therapy for the arrhythmia. in those stable patients with structurally normal hearts, identification of the location of origin of tachycardia will help in choice of appropriate medical therapy.

ventricular tachycardia although not common, can occasionally complicate pregnancy. its presence may indicate an underlying cardiac structural abnormality, or undiagnosed congenital arrhythmic disease. however, some pregnant patients with ventricular tachycardia have structurally normal hearts. two cases of ventricular tachycardia in pregnant patients with structurally normal hearts are presented and an approach to diagnosis and management of such patients are discussed.

PMC2884340

pubmed-194

common sources include backyard burning, incineration of plastics, and chlorine bleaching of pulp in paper mills. documented health effects include acute and chronic effects, including chloracne, various types of cancers, reproductive diseases, circulatory and respiratory diseases, and diabetes. the traditional approach to environmental remediation includes a host of physical and chemical methods, depending on the characteristics of the polluted site and the extent of contamination present. bioremediation, which is the use of biogenic materials and organisms for environmental cleanup, has also been proposed, including phytoremediation using plants and microbial degradation using primarily bacteria and fungi. bioremediation is an attractive strategy, as it can destroy the pollutant rather than transferring it from one environmental compartment to another. common bioremediation strategies include the addition of nutrients, degradative microorganisms, or both. sphingomonas wittichii rw1 is a microorganism of great interest to the bioremediation community for its ability to biotransform a large number of toxic polychlorinated dioxins and to utilize both nonchlorinated dibenzo-p-dioxin and nonchlorinated dibenzofuran as a growth substrate and sole source of carbon and energy. one of the major challenges in bioaugmentation strategies relying on the addition of nonnative microbes is to ensure their viability and degradative activity toward the target compounds. monitoring bioremediation is critical to ensure the efficacy of the process and the reduction of contaminant mass to acceptable levels. traditionally, the most important characteristics investigated for microorganisms used in bioremediation were their ability to transform the substrate, the rate of substrate removal, and the resulting metabolites [69]. to optimize the bacterial degradation of pollutants, it is important to understand how these organisms function during growth on recalcitrant substrates and which factors influence their degradative abilities. this includes analyzing not only the degradative pathways [1012], but also the peripheral processes and mechanisms that are involved in taxis (i.e., directed motion in a chemical gradient), uptake, and transport during exposures to specific substrates. analysis of dna and rna can shed light on an organism's metabolic potential; however, these measurements poorly correlate to actual protein expression profiles. therefore, global analyses of protein expression profiles may be a more informative tool for understanding the physiological mechanisms of biodegradation. in addition to identifying important degradative enzymes in a variety of important microbes [1517], proteomic studies have opened the door to a better understanding of system-wide changes in response to differing substrates. the imperative to perform proteomic analyses is particularly true for s. wittichii rw1 because the enzymes in the dioxin degradation pathway are encoded on different loci throughout the genome, certain elements in the pathway are located on a plasmid, and there may be alternative pathways at work. the present study builds on previous work and utilized difference gel eletrophoresis (dige) coupled with mass spectrometry (ms) to exploit recently gathered rw1 genome data. when used together, these tools yield information on the response of cells of s. wittichii rw1 to dioxin exposure and the bacterium's degradative activity toward this recalcitrant compound. the aim of this study was to investigate system-wide changes in protein expression during growth on dibenzofuran, a nontoxic surrogate for dibenzo-p-dioxin, as compared to nonselective growth media. acetate was selected as the nonselective alternate substrate, as growth on this compound was observed to influence expression of select proteins, including the dioxin dioxygenase. thus, any changes measured in response to cells grown on dibenzofuran should represent cell-wide effects related specifically to the growth substrate and not to unanticipated extraneous effects. cultures of s. wittichii strain rw1 (100 ml to 1.0 l) were grown to mid log phase at 30c in m9 phosphate-buffered minimal medium (ph 7.05) supplemented with either dibenzofuran crystals or 50 mm acetate as growth substrates. cells were grown overnight on dibenzofuran and acetate as sole carbon sources to an optical density of 0.40.6 absorbance units (560 nm). following biomass processing, protein levels in the samples were on the order of 75200 g/ml. protein concentrations were normalized prior to analysis by concentration and resuspension in dige sample preparation buffer. culture purity was confirmed by the streak plate method using luria bertani medium supplemented with 1.5% agar. harvested biomass was washed, spun again, and the resultant pellet suspended in a small volume of 100 mm ammonium bicarbonate (ph ~7.0). this microbial suspension was then sonicated under cooling with ice, using a microtip sonicator (fisher scientific, pittsburgh, pa, usa) in a sequence of three 10-second bursts delivered in thirty-second intervals. the sonicated cells were then immediately centrifuged at 10,000 xg for 10 minutes at 4c. briefly, 8 parts of 10% tca in acetone (20c) were added per volume of supernatant and, following mixing on a vortex, the resultant dilution was incubated at 20c overnight. following centrifugation (10,000 xg, 10 minutes, 4c), harvested biomass was washed in cold acetone for 10 minutes at 20c. following a subsequent centrifugation, the pellet was resuspended in sample preparation buffer (7 m urea, 2 m thiourea, 2% chaps, 0.2% dtt, 0.02% bromophenol blue) and stored at 20c until analyzed. protein concentrations were measured using the bicinchoninic acid assay (pierce, rockford, il, usa) following dilution to reduce the concentration of interfering agents. twenty-five g of crude cell lysates of rw1 biological replicates grown on dibenzofuran (n=3) and acetate (n=3) were labeled using cy dyes (ge healthcare) as described elsewhere. briefly, samples were adjusted to 1 g/l using sample preparation buffer and the ph checked. subsequently, 0.25 l of 1 pmol/l cy dyes were added to samples for 30 minutes in the dark on ice. to stop the labeling reaction, 0.5 l of 10 mm lysine was added to the samples, which were mixed and incubated on ice for 10 minutes prior to storage at 20c until analysis. unless stated otherwise, all procedures were carried out in the dark or minimal light to protect the integrity of the fluorescent dyes. samples were randomized to reduce the effect of dye bias and in-gel variations. a global pool consisting of fractions of each sample was labeled as outlined above using cy 2 and added to each sample as an internal standard. one cy-3- and one cy-5-labeled sample were added to each gel, as defined by the experimental randomizing procedures. to each sample, an additional 175 g of unlabeled sample were added; the volume was increased to a total of 450 l using sample preparation buffer. the reducing agent dtt (dithiothreitol; 1.3 mg per tube) and ipg (immobilized ph gradient) buffer (0.5%) were added, and the samples incubated and mixed in the dark at room temperature for approximately 1 h. samples were then applied to 24 cm ph 47 ipg strips (ge healthcare) and focused for 60 kvh using the following protocol: 12 h rehydration at 30 v; 1 h step and hold at 500 v; 7 hour gradient to 1,000 v; step and hold at 1,000 v for 1 hour; gradient to 8,000 v for 3 h; step and hold at 8,000 v until 60 kvh. strips were then reduced and equilibrated using 10 mg/ml dtt (15 min) followed by 25 mg/ml iodoacetamide (15 min). the ipg strips were overlaid on 24 26 cm 816% gradient tris-hcl ph 8.8 precast gels (nextgen sciences, ann arbor, approximately 1 ml of agarose was applied to fix the gels and a cy-2-labeled molecular weight marker was applied adjacent to the acidic side of the strip. the gels were then run 1-2 w per gel overnight (~2224 hours) at 20c until the marker dye ran off the gel. gels were then imaged with a typhoon 9400 scanner and processed using decyder v6.5 (ge healthcare) bva batch processor tool. images were uploaded to decyder (version 6.5) and spurious image objects (water spots, streaks, and mismatches) were identified and excluded from further analysis. following allocation of changed proteins, individual spots were manually inspected and excluded from analysis if they fell outside acceptable parameters for peak height, area, and slope. pick lists were generated by selecting proteins whose expression was statistically changed in the two growth conditions (p<0.05) following digital image analysis using decyder, and the corresponding spots were automatically picked using an ettan spot picker (ge healthcare) with ettan spot pick software v.1.1. spots were delivered in 100 mm ammonium bicarbonate to a 96-well plate and digested using established protocols. briefly, gel pieces were sequentially dried using three exchanges of 100% acetonitrile followed by a 10-minute speedvac (savant) drying. gel pieces were rehydrated in 40 l of 10 ng/l trypsin in 100 mm nh4hco3 on ice for 45 minutes. the supernatant was removed and replaced with 100 mm nh4hco3 and digested at 37c overnight. peptides were then extracted using 50% acetonitrile/0.1% tfa (trifluoroacetic acid) for 30 minutes at 37c. the peptides were microextracted using omix c18 tips (varian, palo alto, ca, usa) following the manufacturer's instructions and then deposited on a stainless-steel target plate in a matrix consisting of 10 mg/ml 2,5-dihydroxybenzoic acid. mass spectra were acquired using a voyager de-str matrix-assisted laser desorption/ionization time-of-flight ms (applied biosystems, foster city, ca, usa) in positive reflector mode with delayed extraction using the following parameters: laser energy, 1400 arbitrary units; mass range, 5005,000 da; 120 nsec delay, 100 laser shots per spectrum. external calibration was conducted using a standard peptide mixture (bradykinin, insulin b chain, p14r, and acth), and internal calibration was carried out using trypsin autolysis peaks. data were processed in data explorer v1.1 (applied biosystems, foster city, ca, usa) using noise reduction (2 standard deviations) and peak deisotoping. peak masses were searched using the mascot online search engine (http://www.matrixscience.com/) with the following settings: database, ncbi entire database (5.6 million entries); no missed cleavages; monoisotopic peaks; no fixed modifications; variable modification of methionine oxidation; error tolerance of 150 ppm. database and literature searches were used to further characterize and classify the proteins identified by maldi-tof ms. where ambiguous names were encountered, blastp searches were used to identify homologous proteins from orthologous species. image analysis of 24 cm 2d-dige gels loaded with protein of s. wittichii rw1 cells grown on either dibenzofuran or acetate revealed 937 unique spots. differential in-gel analysis of individual gels determined gel-specific parameters for selection criteria and allowed visual examination of changes between growth on the two substrates (figure 1). of the 937 identified spots, 595 were matched between all the gels used to statistically compare the quantitative abundance of proteins. statistical analysis compared triplicate biological observations for each condition, normalized to the internal pooled standard (figure 2). crude cell lysates from s. wittichii rw1 grown on dibenzofuran showed that, of all proteins observed, 22 proteins were modulated in response to changes in culture conditions. these candidate biomarkers of metabolic activity and phenotype were observed in at least 6 of 9 dige images and were modulated as follows: 16 showed an apparent increase and 6 an apparent decrease (figure 2). these proteins, along with 22 proteins selected due to their high abundance in both growth conditions, were further analyzed and identified using mass spectrometry (figure 3). a mascot search of the entire ncbi database using mass spectral data generated by peptide mass fingerprinting identified 23 of the 44 proteins (52%). all protein identifications corresponded to the genome of s. wittichii strain rw1. among the 16 proteins upregulated during growth on dibenzofuran, 7 were successfully identified (table 1). among the 6 proteins downregulated during growth on dibenzofuran, an additional 13 proteins were identified whose expression level remained unchanged regardless of culture conditions (table 3). of the 7 identified proteins increased during growth on dibenzofuran, 2 were directly related to the dibenzofuran degradation pathway (figure 4); the others were involved in downstream metabolic processes (catechol 1,2-dioxygenase, adenosylhomocysteinase), cell growth (elongation factor ts), and cell protection (cold shock dna-binding domain protein, alkyl hydroperoxide reductase). the three identified proteins whose expression was decreased (fumarylacetoacetate hydrolase, tonb-dependent receptor, and acyl-coa dehydrogenase) are involved in biosynthesis, catabolism, and transport. the unchanged proteins represented basic cell functions, although biosynthesis, catabolism, and transport proteins dominated the identities. the alpha subunit of the dioxin dioxygenase, the first step in the dioxin degradation pathway, was also identified as unchanged. dige and 2d electrophoresis are an accepted strategy for mining microbial proteomes for biomarkers related to a number of processes [2830]. the complete protein content of s. wittichii rw1 consists of approximately 5,000 putative proteins from the bacterial chromosome and two megaplasmids. using simple extraction and purification techniques followed by dige, over 500 protein spots were resolved on a large (24 cm) 2-dimensional gel and matched between the three biological replicates, representing approximately 10% of the entire protein content. of these 500 proteins, 22 were found to be regulated in response to growth condition changes. of the genes they identified as being changed in their experiments, only two overlapped with the proteins identified in our study: swit_3144 (tonb-dependent receptor, downregulated) and swit_3376 (chaperonin groel, upregulated). both of these gene levels responded to short-term perturbation with peg8000 but not sodium chloride in the transcriptomic study and were unchanged in our study. in our study, we also identified a number of proteins that are related to dioxin/dibenzofuran degradation (e.g., dioxin dioxygenase, meta-cleavage product hydrolase, and 2,3-dihydroxybiphenyl 1,2-dioxygenase). other proteins were identified that showed increases in abundance but whose role was not directly related to the dibenzofuran degradation pathway. the increase in the presence of antioxidants such as alkyl hydroperoxide reductase suggests that there is an increasing stress upon the bacterial cell during growth on dibenzofuran, perhaps due to a change in catabolism resulting in an increase in endogenous peroxide generation. increases in a cold-shock dna-binding protein may be further evidence of an increased cellular stress. however, proteins of the cold shock family and related ones are also known to have transport and protein processing roles. among the proteins in the dioxin degradation pathway, the most prominent on the gel was the meta-cleavage product hydrolase. this identification was produced from two adjacent spots, likely representing an artifact due to the protein's extremely high expression or a reflection of the presence of multiple isoforms or a modified enzyme. the one identified in the present study is the product of the swit_3055 locus, a gene also known as dxnb2. the glyoxalase/bleomycin resistance protein/dioxygenase identified in this study is also annotated as a 2,3-dihydroxybiphenyl-1,2-dioxygenase located on the chromosome at the swit_3046 locus. again, there are multiple isoforms of this enzyme found both on the chromosome and the megaplasmids. the kegg dioxin degradation pathway identifies swit_4182 as the dihydroxybiphenyl dioxygenase involved in biphenyl metabolism and swit_4902 as the trihydroxybiphenyl dioxygenase in both dioxin and dibenzofuran metabolism. the increased expression in response to dibenzofuran suggests that the swit_3046 dioxygenase plays a more important role in dibenzofuran degradation in vivo. the high degree of redundancy in the dioxin and dibenzofuran degradation pathways, that is, the presence of multiple ring-hydroxylating alpha and beta subunits, glyoxalase/bleomycin resistance protein/dioxygenases, and meta-cleavage product hydrolases, remains to be explained. one possibility is that the various isoforms have different affinities for chlorinated metabolites that would result from chlorinated dioxins and furans. further experiments are needed to fully distinguish the roles of these enzymes in s. wittichii rw1 degradation pathways. although not directly implicated in dioxin degradation, the fumarylacetoacetate hydrolase is also of interest because the gene encoding this protein (swit_5089) flanks the ferredoxin fdx1 (swit_5088) that has been identified as part of the electron supply chain supporting dioxin dioxygenase activity. of the multiple isoforms of this enzyme, the electron supply chain also contains two isofunctional reductases. neither the ferredoxin itself nor the reductases could be identified. in previous studies, the reductase was present as a much smaller fraction of the soluble cell proteome than either the ferredoxin or the dioxin dioxygenase, so gel-based methods may not be sensitive enough to detect this protein. if transcription of the ferredoxin is linked to the other genes at that locus, as is predicted, the decreased expression in response to dibenzofuran suggests that another ferredoxin is more important in the dioxin degradation pathway in vivo. the detection of the dioxin dioxygenase alpha subunit and related enzymes in both acetate- and dibenzofuran-grown cells is potentially of importance for the field of bioremediation because it suggests an avenue of biostimulation. when utilizing s. wittichii rw1 as a bioremediation agent, it may be possible to induce the expression of the dioxin degradation pathway using acetate. induction of the dioxin degradation pathway has not been observed when s. wittichii rw1 is grown on glucose or rich medium, and growth in a complex environmental medium (landfill leachate) was correlated with a decrease in copy number of the gene encoding the dioxin dioxygenase alpha subunit. previous studies using s. wittichii rw1 to transform chlorinated dioxins in soil or fly ash have observed a progressive decrease in degradative activity or viable cells [38, 39], respectively. the addition of acetate may generate sufficient relevant protein biomass to catalyze the successful degradation of dioxin and dioxin-like compounds in environments bioaugmented with s. wittichii rw1. proteomic technology has emerged in microbiology more rapidly than in other fields for several reasons. the relatively small genomes code for relatively limited proteomes featuring no or very limited posttranslational modifications compared to higher organisms. furthermore, microbes are easily controlled and manipulated in the laboratory, both during growth and gene expression. these factors will continue to drive biomarker discovery in microbial proteomes, including phenotypic biomarkers informing on the degradative activity of biomass produced for bioaugmentation of contaminated environments. furthermore, the field of bioremediation can benefit from methods suitable for monitoring microbial biomarkers in field samples to inform on progress in site bioremediation. this study highlights a number of proteins that were changed in response to dibenzofuran exposure, opens the door to a greater understanding of how s. wittichii rw1 performs and regulates the degradation of dioxins, and suggests ways to enhance the biodegradation of dioxins.

sphingomonas wittichii rw1 is a bacterium of interest due to its ability to degrade polychlorinated dioxins, which represent priority pollutants in the usa and worldwide. although its genome has been fully sequenced, many questions exist regarding changes in protein expression of s. wittichii rw1 in response to dioxin metabolism. we used difference gel electrophoresis (dige) and matrix-assisted laser desorption/ionization mass spectrometry (maldi-ms) to identify proteomic changes induced by growth on dibenzofuran, a surrogate for dioxin, as compared to acetate. approximately 10% of the entire putative proteome of rw1 could be observed. several components of the dioxin and dibenzofuran degradation pathway were shown to be upregulated, thereby highlighting the utility of using proteomic analyses for studying bioremediation agents. this is the first global protein analysis of a microorganism capable of utilizing the carbon backbone of both polychlorinated dioxins and dibenzofurans as the sole source for carbon and energy.

PMC3468919

pubmed-195

a 34year-old male presented for general examination on day 49 of a 50-day self-imposed fast, seeking approval to continue his fasting behavior. during this period, the patient reported only consuming water, tea, coffee (with no milk or sugar), and a daily multivitamin tablet (centrum performance; pfizer). patient history prior to fasting behavior revealed a family history of obesity and the presence of pathologies related to body mass. personal history involved an oscillating mass between 85 and 134 kg over a 10-year period. at the start of fasting, the patient reported body mass as 96.8 kg, and 29.2% body fat, as recorded by a personal bioelectrical impedance device. history following the onset of fasting behavior was unremarkable, but included severe abdominal cramps between days 7 and 21 of fasting, development and frequent occurrence of vasovagal syncope on transition from sitting to standing, and the near-cessation of fecal movement. self-reported physical activity and mobility was reduced, but not prevented; this participant was not bedridden. substantial water and coffee intake was noted (812 cups of coffee daily and 23 bottles of water daily). as expected, body mass loss during fasting was severe and noticeable (fig. resting metabolic rate (30 minutes by indirect calorimetry) was 1626 kcal day. during the 30-minute rest period resting ecg appeared morphologically normal, patient was bradycardic (52 bpm) and notably hypertensive (150/78 mmhg). body composition was measured by whole-body air displacement plethysmography (bod pod) as 19.8% body fat, while height was 180.9 cm and mass was 75.4 kg, with a bmi of 23.5 kg m, all recorded on calibrated laboratory devices. sum of four skinfolds1 was 30.0 mm, approximately half of that of a reference population of similarly aged males (62 25 mm, aged 3039). it was visually noted that subcutaneous fat in the abdominal region was still present, despite severe losses in the peripheral limbs, protruding ribs, and lack of prominent chest and shoulder musculature. 2). during a six-minute walk test, this individual covered 342 m, which was below expected performance for a healthy male adult.2 a mild scoliosis was observed while walking; however, it is unclear if this is related to fasting. venous blood was taken for serum markers of metabolism, liver, and renal function. noteworthy findings include plasma glucose of 3.1 mmol l and alkaline phosphatase of 36 u l. total bilirubin was 19 mol l, direct bilirubin was 7 mol l. uric acid was 620 mol l. urine was straw colored, lacked sediment, and was noticeably sweet in aroma. rapid dipstick analysis (multistix 2161; siemens) was negative for blood glucose, contained trace proteins, and indicated urine ph of below 5. one month following initial presentation, the patient returned for follow-up examination during which body composition, resting metabolic rate, urine, and venous blood were recorded. resumption of feeding initially involved liquids such as vege table soups, with the resumption of solid foods three days following breaking of fast. days 35 involved one solid meal per day, with 23 solid meals during days 57, and the resumption of three solid food meals per day for 7 days following breaking of fast. in the following 23 days, diet was reported to be of caffeine and alcohol free, low carbohydrate (a piece of bread every 13 days), and high servings of fruit and vegetables. self-estimation of diet by volume was 20% animal protein (chicken and fish) and 80% fruit or vegetables; validated, quantifiable measures of intake and caloric content are not available. heart rate remained bradycardic at rest (48 bpm), and blood pressure was notably reduced (132/78). metabolic rate was reduced (1413 kcal day), and body composition was unchanged (75.0 kg; bmi, 23.4 kg m; 16.1% fat mass). blood biochemistry returned to within normal range, with the exception of direct bilirubin (table 1). it is noteworthy, therefore, in this case study that moderate physical function appears maintained at day 49, as assessed by general observation and results of the six-minute walk test. frommel et al.3 suggested that fasting in healthy lean individuals was well tolerated until 18% of body mass was lost; the patient reported here lost 20.7% of body mass without substantial loss of function. one prior report of long-term fasting in obese individuals for 3040 days demonstrated body mass losses between 10.6% and 20.5%, but does not report on function of individuals.4 it seems self-apparent and supported by this limited evidence, such that the starting mass is a key variable in survival of extreme fasting, and not the amount of loss. this patient started fasting while obese and ended his fast when anthropometric variables were within the targeted ranges for the general population. indeed, among the few (nonpublished) examples of complete fasting and mortality,5 patients were frail between 30 and 50 days, and death was noted to occur between days 43 and 70, which this case study has reached without obvious or significant frailty occurring. current world medical association guidelines prioritize autonomy, recommending nonintervention in fasting to the point of harm and/or death, if the patient makes a written informed statement of intent.5 lack of research into this field precludes evidence-based decision-making or advice. in the limited light of this case study and historic data of fasting in obesity,4 it is tempting to suggest that guidelines to physicians for advice to the fasting individual reflect body mass, and specifically mass of adiposity at start of fasting behavior. survival in starvation is ultimately governed by physics, the calories available to maintain metabolic function. availability of adipose tissue for metabolic usage may thus delay the catastrophic degradation of muscular protein, increasing survival time. that said, small animal models reveal organ-specific effects of starvation, with loss of liver and gut size and function noted after only four to six days.6 functional damage to digestive organs can not be ruled out, and indeed, the elevated direct bilirubin is suggestive of reduced liver filtration. of concern, direct bilirubin remained elevated 30 days post breaking of fast. elevated uric acid is likely due to reduced kidney filtration, as has been reported in caloric restriction previously.7 further, hypertension was an unexpected finding. this finding is counter to one of the few published examinations of cardiology in severe starvation, where bradycardia and hypotension (~20 mmhg below fed state) were noted in juvenile pigs following 29 days of complete starvation.8 the porcine heart contains several structural differences relative to the human, most related to bipedal vs. quadrupedal stance.9 as frequent syncope was also noted in that our case study, it is plausible that dysregulated autonomic regulation of blood pressure underlies the observed hypertension. blood pressure was measured in a supine position, increasing venous return in the human relative to standing position. simple frank starling mechanics combined with a failure of autonomic regulation may thus explain elevated blood pressure. thus, it is tempting to suggest that differences observed may be species dependent; however, this is highly speculative on a single case study. further, long-lasting cardiovascular deficits were noted in the above porcine model on refeeding, as well as chronically following experimental conclusion.8 as death resulting from starvation often occurs via cardiovascular complications, this elevated blood pressure during fast is key to note; this should be carefully monitered in fasting individuals. caloric restriction and weight loss in overweight or obese individuals is often associated with subsequent regain of weight.10,11 having access to this case study 30 days following resumption of feeding was of interest due to a chance to examine any occurrence of such a rebound effect. it is of interest to note that this was not seen here; however, future gains in weight can not be ruled out. here, we report the maintenance of physical function of an individual after 49 days of complete fast. this report does not indicate support for such behavioral choices, and the projections of metabolic energy provision by starting adiposity assume no other perturbations to homeostasis, such as impaired immune response, liver and renal function, or cardiovascular events.

a 34-year-old obese male (96.8 kg; bmi, 30.2 kg m1) volitionally undertook a 50-day fast with the stated goal of losing body mass. during this time, only tea, coffee, water, and a daily multivitamin were consumed. severe and linear loss of body mass is recorded during these 50 days (final 75.4 kg; bmi, 23.5 kg m1). a surprising resilience to effects of fasting on activity levels and physical function is noted. plasma samples are suggestive of early impairment of liver function, and perturbations to cardiovascular dynamics are also noted. one month following resumption of feeding behavior, body weight was maintained (75.0 kg; bmi, 23.4 kg m1). evidence-based decision-making with the fasting or hunger striking patient is limited by a lack of evidence. this case report suggests that total body mass, not mass lost, may be a key observation in clinical decision-making during fasting and starvation.

PMC4982520

pubmed-196

titanium dioxide (tio2) is a component of many sunscreens, soaps, shampoos, toothpastes, cosmetics, paper products, plastics, ink, paint, and building materials 1 in both its bulk form and its nanoform. it is also used in human food as a colorant and inactive ingredient, where it can also be present in both forms 1, 2. from 1916 to 2011, an estimated total of 165 050 000 metric tonnes of tio2 pigment were produced worldwide (bulk form and nanoform combined), with a current annual estimated production of more than 6 million tonnes/yr 2. reviews of nanotio2 toxicology are available across various evolutionary groups of species 3, 4, 5, 6, 7, 8, often summarizing half maximal effective concentration (ec50), half maximal inhibitory concentration (ic50), and median lethal concentration (lc50) values. nanotio2 is also photoactive and produces reactive oxygen species (ros) on illumination 9. reactive oxygen species can be detrimental to many organisms, causing oxidative damage, cell injury, and ultimately death 10. recently, it has been argued that photoactivation of nanotio2 under natural levels of sunlight is sufficient to affect the output of lc50 and ec50 values in standard toxicology tests 11, 12. the majority of studies investigating nanotio2 toxicity did not take photoactivation into account and performed tests either in dark conditions or under indoor commercial artificial lighting that did not simulate natural solar irradiation. the aim of present study was to derive a phototoxicity ratio between the results of the nanotio2 experiments conducted in the absence of sunlight and conducted in the presence of solar or simulated solar radiation (ssr). to achieve this aim, we searched the literature for studies that included nanotio2 experiments both with and without irradiance under the same experimental setup and otherwise identical conditions. therefore, the phototoxicity ratio can be used to correct endpoints of the toxicity tests with nanotio2 that were performed in absence of natural sunlight or ssr. such corrections also may be important for regulators and risk assessors when reviewing previously published data. for example, one of the current challenges for conducting risk assessment of nanoparticles such as tio2 is lack of consistent toxicity data because of the varieties of materials and test conditions. regulatory thresholds for nanotio2 do not exist currently; however, regulation of nanoparticles discharge and monitoring in aquatic environment is anticipated in the future. it is expected that regulators will use the phototoxicity ratio when deriving thresholds for nanotio2 because the majority of the published literature reported toxicity endpoints for nanotio2 in the absence of natural sunlight or ssr. of course, the phototoxicity ratio value calculated in present study is not absolutely precise and correct for all environmental conditions and species; it does, however, considerably reduce the possible error of data endpoints obtained in the absence of natural sunlight or ssr. it also mitigates uncertainties in the risk assessment process by taking into account the photoactivation and phototoxicity of nanotio2. a comprehensive literature review was conducted to collect available toxicity endpoints for nanotio2. the literature search (september 2014) was performed within 4 databases web of science, scopus, google scholar, and the university of british columbia library database using the following keywords in various combinations: titanium dioxide, tio2, nanoparticles, phototoxicity, photoactivation, ec50, lc50, ic50, and lowestobservedeffect concentration (loec). abstracts of numerous hits were read, and downloaded papers were checked for useful information. only papers that reported results under the same environmental conditions for 2 different nanotio2 exposure groups (with and without ssr) in the form of ec50, lc50, ic50, loec, or a ratio were selected. thus, all included data were based on dose response curves, ensuring the highest possible quality. the phototoxicity ratio (pr) was calculated in the form of a ratio: pr=tio2 lc50, ec50, ic50, loec without sunlight or ssrtio2 lc50, ec50, ic50, loec with sunlight or ssra phototoxicity ratio greater than 1 means nanotio2 is phototoxic. in a few isolated cases, results were not given in the form of a number; but it was possible to derive a number based on figures provided. because the papers reported only irradiance (power of electromagnetic radiation per unit area) intensity and not actual insolation (total amount of solar radiation or ssr energy received on a given surface area during a given time), insolation value was calculated when possible. insolation was calculated based on the irradiance (w/m), actual duration of irradiance (h), and total duration of the toxicity test. in cases in which irradiance intensity was reported in units other than w/m, the data were converted for consistency. for the studies in which data existed only in the form of full spectrum insolation, it was important to at least approximate the levels of ultraviolet a (uva) and ultraviolet b (uvb) used in the studies. at sea level, uva spectra is accountable for 5.7% of the total sunlight, whereas uvb is accountable for 0.3% of the total sunlight 14. thus, uva and uvb approximations were performed on the studies reporting full spectrum with factors of 0.057 and 0.003 for uva and uvb, respectively. such conversions allowed us to determine whether uva and uvb levels used in the studies were of environmental relevance by comparing the data with published averaged uva and uvb levels over europe. because the focus of the present study is environmental relevance, in all cases, data points were excluded from evaluation if testing conditions did not represent environmentally relevant exposure conditions, such as in vitro toxicity tests with cells. nanotio2 toxicity was reported as greater than the highest exposure concentration with no negative toxic effects. in those cases, greater than value was from the control tio2 group that was not exposed to ssr or sunlight. this might have led to a slight underestimation of the phototoxicity ratio value, which can be seen as a conservative approach. in all cases, the crystal structure of the nanotio2 particles, their primary particle size, and their hydrodynamic diameter were reported, and the data are presented in table 1. therefore, collected data are a mixture of both anatase and rutile crystal forms as well as various particle sizes. ecosystems generally contain a mixture of all sizes and types of crystal structures of anthropogenically introduced nanoparticles with which decision makers have to cope simultaneously; thus, the aim of the phototoxicity ratio is to provide a distinct value within a muddle. the coating of nanotio2 was not taken into account when evaluating phototoxicity of nanotio2, since all of the collected studies have investigated exclusively bare nanotio2. review of nanotitanium dioxide (tio2) phototoxicity to various species anatase (a) or rutile (r). derived data based on the presented data. calculated as 0.45 m distance; 30% shadow angle; and 250 w light source. not in total darkness. ec50=median effective concentration; ic50=median inhibitory concentration; lc50=median lethal concentration; loec=lowestobservedeffect concentration; uva=ultraviolet a; uvb=ultraviolet b; pr=phototoxicity ratio; noec=noobservedeffect concentration; na=data are not available. data were checked for normality with the kolmogorovsmirnov test and were found not to be of normal distribution. spearman rank correlation was performed between the phototoxicity ratio value and time duration of the reported toxicity test, time duration of irradiance, irradiance intensity, insolation, and the organism taxa to determine whether any of these variables drove the output value. in the case of organism taxa, for the purpose of analysis, a code of 5 different digits was assigned to bacteria, algae, invertebrates, fish, and amphibians. kruskalwallis analysis of variance with a post hoc multiple comparison and/or mannwhitney u test were also performed where applicable. validation of phototoxicity ratios in correction of toxicity tests endpoint values was performed on data obtained in absence of sunlight or ssr. phototoxicity data summarized in table 1 (obtained in the presence of sunlight or ssr), served as a control group. results were log 10 transformed and then statistically compared with either log 10 (data), log 10 (data/median phototoxicity ratio), or log 10 (data/75% phototoxicity ratio quartile). these 3 groups of results originated from the same set of analyzed studies but were obtained in the absence of sunlight or ssr. the literature search resulted in 25 usable references, from which 62 pairs of data were generated for calculation of a phototoxicity ratio (table 1). in total, experiments were performed on 20 different species, ranging from bacteria to amphibians. applied total irradiance was between 0.46 w/m and 231 w/m (mean, 35.63 w/m; median, 17 w/m), and effective total insolation was between 0.013 wh/m and 200 wh/m (mean, 17.44 wh/m; median, 2.83 wh/m). the recalculated and approximated insolation mean and median data are, respectively, 5.64 w/m and 1.7 w/m for uva, and 0.243 w/m and 0.015 w/m for uvb. the majority of the studies have used the same nanotio2 products (p25 degussa), resulting in a fairly similar size span of primary particle diameter. phototoxicity ratio minimum and maximum values were 0.84 and 16 778, respectively, and mean and median values were 407.5 and 3.7. the discrepancy between the mean and median was caused primarily by the data associated with the cladocera taxon. when the data were analyzed for susceptibility of bacteria, algae, invertebrates, fish, and amphibians to phototoxicity, the invertebrates were significantly different compared with other groups. nanotio2 was significantly more toxic to invertebrates after exposure to light compared with other groups, resulting in a greater phototoxicity ratio (kruskalwallis followed by post hoc multiple comparison). on the other hand, the spearman rank correlation test was not statistically significant for phylogeny and phototoxicity ratio (decreased or increased phototoxicity of nanotio2 from species on the lower organism stadium, such as bacteria, toward more complex organisms, such as amphibians). also, there was no correlation between phototoxicity ratio and irradiation intensity, duration of irradiation, or received insolation. indeed, when exclusive cladocera data were analyzed against all other taxa (figure 1), the statistical difference was highly significant (mannwhitney u test, p<0.01). because of the clear need for data segregation, separate descriptive statistics were performed for cladocera and noncladocera phototoxicity ratio values (table 2). on average, nanotio2 was 20 times more toxic to noncladocera and 1867 times more toxic to cladocera (median values, 3.3 and 24.7, respectively) after illumination. descriptive statistics of phototoxicity ratio (pr) values significant statistical difference was observed between true phototoxicity data and data obtained in the absence of sunlight or ssr (figure 2). once the data were corrected by dividing data obtained in the absence of sunlight or ssr with a median phototoxicity ratio or a 75% quartile phototoxicity ratio value, there was no longer statistical difference compared with the data obtained in the presence of sunlight or ssr (figure 2). however, we do not claim that values for the median phototoxicity ratio and the 75% phototoxicity ratio quartile are definite, because they will change over time as more data points become available from future studies. comparison of uncorrected data (top), corrected data with median phototoxicity ratio (middle), and corrected data with 75% phototoxicity ratio quartile (bottom) obtained in the absence of sunlight or simulated solar radiation (ssr) with true data obtained in the presence of sunlight or ssr. cladocera and noncladocera data were corrected separately with the group corresponding median or 75% quartile values. the fact that the cladocera taxon was more sensitive to nanotio2 phototoxicity can not be explained by the intensity of irradiation or received insolation during testing, because such correlation was not statistically significant (spearman rank correlation test). in cladocerarelated experiments, the original publications from which data were derived provided no evidence that cladocera were exposed to any specific grade, type, or size of nanotio2 particles to which other taxa were not exposed. ultraviolet sensitivity of the taxon has to be ruled out as well, because appropriate exposure controls to uv were included and no increase in toxicity was detected. although uv is toxic and lethal to cladocera at higher exposure doses, numerous protection mechanisms prevent hazardous occurrences at lower doses 15. both uv and nanotio2 toxicity are based on ros, and oxidative stress was indicated in cladocera exposed to either uv 15, 16 or nanotio2 17. however, this does not necessarily mean that uv and nanotio2 have the same toxicity mechanism. whereas generation of ros and consequently oxidative stress following exposure to uv radiation requires endogenous photosensitizer molecules, generation of ros by nanotio2 under uv radiation is a direct photochemical process, and the substantial ros production can readily damage or kill cells or organisms such as cladocera. why cladocera are more sensitive to irradiated nanotio2 remains unclear, and more targeted research is needed. however, one possible explanation for the high sensitivity of cladocera to nanotio2 phototoxicity is that photoinduced ros on the surface of cladocera carapace may interfere with the respiratory gas exchange. in fact, surface attachment of nanotio2 to cladocera carapace has been observed in previous studies 18, 19, and the inner wall of the carapace is a major site of respiratory gas exchange for cladocera 20. sunlight is composed of visible, uv, and infrared spectra. some of the analyzed studies reported irradiance values exclusively within the uv spectrum, whereas others reported values for the full spectrum. thus, insolation data also were presented based on reported irradiance spectrum. when the data were segregated into what appeared to be insolation values for the full spectrum, the mean insolation was 25.9 wh/m, and the median was 5 wh/m. the studies that supposedly only reported values for the uv spectrum had a mean insolation of 8.72 wh/m, with a median of 2.83 wh/m. for the purpose of comparison, a solar constant (irradiance of the sun when positioned at 1 astronomical unit compared with earth at zenith) measured at the outer surface of earth's atmosphere is approximately 1360 w/m 21. a significant amount of the solar constant is lost by the time sunlight reaches a location on the earth's surface, depending on atmosphere, latitude, and time of day. for example, average insolation of the visible spectrum during a decade of measurements over europe is between 5 wh/m and 302 wh/m in winter and between 285 wh/m and 430 wh/m in summer 22. therefore, both the mean and median (25.9 wh/m and 5 wh/m, respectively) insolation used in the studies reporting only values for full spectrum are much less than the insolation values over europe. the most likely culprits for tio2 phototoxicity are uva and uvb spectrum because those photons would have enough quantum energy (uva, 3.103.94 ev per photon; uvb, 3.944.43 ev per photon) 23 versus energy of visible light photon (1.63.4 ev) to overcome the band gap. when uva and uvb level approximations were performed on the studies reporting full spectrum and combined with studies directly reporting uva and uvb, mean and median values were 5.64 w/m and 1.7 w/m, respectively, for uva and 0.243 w/m and 0.015 w/m, respectively, for uvb. the actual uv spectrum insolation over europe is, on average, 0.7 wh/m to 37.7 wh/m in winter and 34 wh/m to 64.2 wh/m in summer for uva; for uvb, the average is 0.001 wh/m to 1.08 wh/m in winter and 0.77 wh/m to 2.05 wh/m in summer 22. the mean and the median values for uva and uvb used in toxicity studies are well within the range of uva and uvb values over europe 22. therefore, the current experimental setups represent realistic and natural conditions, and the obtained results should not be doubted. thus, levels used in experimental setups are credible for the purpose of risk assessment, since they do not exceed natural conditions. it is important to note, however, that approximation to the uva and uvb values were based on the assumption that all of the irradiation lamps spectra used in the phototoxicity studies fully corresponded to sunlight spectrum. although the technology has advanced significantly over the years, there is no absolute guarantee that all of the studies had the proper irradiation lamps. furthermore, a significant amount of irradiation at sea level altitude is lost because of reflection and adsorption in the water column, according to the beerlambert law iz=i0ekzwhere z is depth, e is natural logorithm, k is attenuation coefficient, and i 0 is the energy of the sunlight at the surface of the water. although attenuation in pure water might not affect energy of uv light, reflectance of the water surface may, thus reducing the actual uv energy to which aquatic organisms are exposed. however, an opposite effect may occur in shallow waters because of strong scattering of light, thus multiplying the uv exposure levels 25. therefore, although uv insolation levels currently used in nanotio2 phototoxicity studies are credible at the water surface level, it is still not clear whether they are credible for risk assessment below the water surface. the fact that different studies used different exposure time and different irradiances only suggest that current scientific community does not really have a standardized toxicity test to check for the phototoxicity effects of nanoparticles. therefore, we strongly recommend that universal agreement on irradiation time and irradiance in a standard nanomaterial phototoxicity test is necessary. a validation test of phototoxicity ratio correction (figure 2) showed that after correction with a median phototoxicity ratio value the corrected data are no longer statistically different from the real data obtained in the presence of sunlight or ssr. data correction for the 75% quartile of the phototoxicity ratio was still not significantly different from the real data (p=0.052) but in general generated much lower endpoints (higher toxicity), as expected. however, the value of 75% quartile application is that, compared with the median phototoxicity ratio, it can more successfully prevent false toxicity underestimation. the use of phototoxicity ratio does not mean that the newly corrected data are the true representation of endpoints from toxicity tests, but rather that they are likely as close as possible. the true correction of data can be achieved only by defining a function through regression analysis. however, because many variables such as particle size, hydrodynamic diameter, crystal structure, illumination time, irradiance, insolation, species, and organic matter content in test media will likely influence the phototoxicity of nanotio2 (even if their effect is not statistically significant, they will contribute certain percentage of variability), generating such a function will be difficult. therefore, the use of a phototoxicity ratio is an oversimplified method that can provide an approximate correction with lots of versatility. one recent study 13 deployed a similar methodology to the present phototoxicity ratio approach to determine which is more toxic in the environment, nanosized or dissolved metals. toxicity ratio was calculated between median lethal dose, lc50, ec50, and ic50 values of dissolved and nanoparticulated metals to provide corrections for threshold values in existing regulatory standards. therefore, the ratio metric approach whether toxicity ratio, phototoxicity ratio, or nanoratio is an inexpensive, straightforward method that mitigates uncertainties for the purpose of risk assessment and management, assuming enough literature is available. in conclusion, the present study found that nanotio2 is phototoxic to aquatic species, because the phototoxicity ratio values were substantially greater than 1 for the majority of analyzed studies. existing literature on the subject is likely credible for the purpose of risk assessment because the insolation levels used in experimental setups did not exceed uv levels under natural conditions at the water surface. a significant difference was observed between the phototoxicity ratios of 2 analyzed groups: aquatic species belonging to order cladocera, and all other aquatic species. the order cladocera is very sensitive and prone to nanotio2 phototoxicity, at least in laboratorybased toxicity tests. a median phototoxicity ratio value and a 75% quartile were chosen as the most practical approach for correcting nanotio2 toxicity endpoints obtained in the absence of sunlight or ssr. using a median phototoxicity ratio value in correction is a more conservative approach, whereas using the 75% quartile lowers the chance of underestimating toxicity and may be favored by risk assessors when analyzing previously published data. the values for the phototoxicity ratio are not definite and may change as more data become available in the future. all of the data used for calculation and statistical analysis are presented in table 1 of the present study, with corresponding references.

abstracttitanium dioxide nanoparticles are photoactive and produce reactive oxygen species under natural sunlight. reactive oxygen species can be detrimental to many organisms, causing oxidative damage, cell injury, and death. most studies investigating tio2 nanoparticle toxicity did not consider photoactivation and performed tests either in dark conditions or under artificial lighting that did not simulate natural irradiation. the present study summarizes the literature and derives a phototoxicity ratio between the results of nanotitanium dioxide (nanotio2) experiments conducted in the absence of sunlight and those conducted under solar or simulated solar radiation (ssr) for aquatic species. therefore, the phototoxicity ratio can be used to correct endpoints of the toxicity tests with nanotio2 that were performed in absence of sunlight. such corrections also may be important for regulators and risk assessors when reviewing previously published data. a significant difference was observed between the phototoxicity ratios of 2 distinct groups: aquatic species belonging to order cladocera, and all other aquatic species. order cladocera appeared very sensitive and prone to nanotio2 phototoxicity. on average nanotio2 was 20 times more toxic to noncladocera and 1867 times more toxic to cladocera (median values 3.3 and 24.7, respectively) after illumination. both median value and 75% quartile of the phototoxicity ratio are chosen as the most practical values for the correction of endpoints of nanotio2 toxicity tests that were performed in dark conditions, or in the absence of sunlight. environ toxicol chem 2015;34:10701077. 2015 the author. published by setac.

PMC5008198

pubmed-197

it was previously suggested that atherothrombotic infarction (ati) and lacunar infarction (li), as two different subtypes of ischemic stroke, might also differ in the set of the relevant risk factors, with ati being more associated to the atherogenic risk factors in contrast to li.. however, decreased insulin sensitivity (is), that is, insulin resistance, was observed both in ati and li, which was frequently accompanied with compensatory hyperinsulinemia in t2d patients as well as in nondiabetics [2, 3]. simultaneously, it has been shown that impaired balance between products of oxidative stress and the level of antioxidant enzyme activities might be the important mechanism underlying the occurrence of ischemic stroke. moreover, it was elucidated that the brain has only moderate content of glutathione-dependent enzymes, for example, glutathione peroxidase (gsh-px), glutathione reductase (gr), and superoxide dismutase (sod), together with the fact that the intact antioxidant defense could provide first line of protection from initiation and exacerbation of ischemic cerebral injury. in addition, changes in enzymatic antioxidative defense mechanisms in patients with stroke are still controversial. previous results implied that the majority of antioxidant enzyme activity was significantly reduced in acute ischemic stroke, possibly as a consequence of increased oxidative stress while the recent finding suggested increased levels of glutathione dependent enzymes as an adaptive mechanisms during acute cerebral ischemia. finally, due to novel facts, oxidative stress can be an important component for astrocytic cell death following metabolic stress. until now, experimental studies provided evidence of an association between ischemic stroke and increased oxidative stress [8, 9], but data in humans are still heterogeneous and limited. therefore, our study was aimed to determine is levels and three different types of antioxidant enzyme activities gsh-px, gr, and sod, in t2d with ati and li. in this study we included a total of 93 patients with t2d, ascribed to the following groups: t2d patients with ati (group a, n=30), and t2d with li (group b, n=30), and t2d without ischemic stroke (group c, n=33). simultaneously, we involved a total of 93 nondiabetics, matched with the t2d patients regarding gender and age, and also comprising the following groups: nondiabetics with ati (group d, n=30), nondiabetics with li (group e, n=30), and nondiabetics without stroke (group f, n=33). t2d was diagnosed in accordance with the criteria of the world health organization. diagnosis of ati and li was done by a neurologist due to clinical features and brain imaging methods such as cranial computerized scan and/or magnetic resonance imaging in two consecutive examinations, during the first 7 days from the appearance of ischemic stroke. the patients with ati or li were included in the study provided that they had not shown signs of cardioembolic cerebral infarction, or coronary heart disease based on a history of myocardial infarction with definite elevation of serum cardiac enzymes or coronary angiography. t2d patients were treated with insulin therapy, and/or ingestion of antioxidant supplements and drugs, which might affect free radical and antioxidant activity potential; likewise patients who had other endocrine disease or autoimmune diseases, renal or hepatic failure, current infections, neoplasms, polycythemia, or rheumatic diseases were also excluded as well as the patients with history of trauma or operation within the last 3 months. no patient had uncontrolled hypertension, severe alcohol consumption, acute infection, or an inflammatory disease during the last 4 weeks. all the patients, with or without ati and li, showed the similar level of their physical activity. in addition, they were required not to smoke at least 12 hr before the tests were performed. the patients were fully informed about the study and gave the inform consent to participate. the study was conducted at the clinic for endocrinology, diabetes and metabolic diseases and at the clinic for neurology, clinical centre of serbia, faculty of medicine, university of belgrade, and was approved by the institutional ethics committee. the interview, physical examination, metabolic test, and evaluation of antioxidant enzyme activities were performed in all the patients included in the study, for each patient within the same day. hypertension was diagnosed according to world health organisation criteria (systolic/diastolic blood pressure 140/90 mm hg) or by the use of antihypertensive agents. the metabolic tests were implemented at least after 6 months from the occurrence of the ischemic stroke. the evaluation of insulin sensitivity was done by frequently sampled intravenous glucose tolerance test (fsigt) with minimal model analysis. briefly, before testing, each patient was required to be at a 12 hr fasting state. during the fsigt, 0.3 g/kg body weight of glucose was injected and the blood samples for plasma glucose (pg) and plasma insulin (pi) determination were taken immediately before and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 20, 23, 24, 25, 27, 30, 40, 50, 60, 70, 80, 90, 100, 120, 160, and 180 minutes after intravenous glucose stimulation. insulin was injected as a continuous infusion 4 mu/kg/min between minutes 20 and 25 in order to avoid the effect of the potentially blunted insulin response. the insulin sensitivity index (si) was calculated from the results of pg and pi levels by computerized minimal model analysis, using the minmod program (kindly provided by dr. determination of the antioxidant enzymes sod, gsh-px, gr was conducted using the commercial assays (produced by randox laboratories ltd., uk), based on spectrophotometer determination methods as described previously. pg was determined by glucose oxidase method using a beckman glucose analyser (beckman instruments, fullerton, ca). pi was tested by radioimmunoassay (inep, zemun, rs, double antibody kits). total cholesterol, hdl cholesterol, and triglyceride concentrations were determined with the chromatography method using commercial kits (produced by boehringer mannheim). the continuous variables within each subtype of ischemic stroke were analyzed with analysis of variance (anova) with a post hoc bonferroni test. all analyses were performed with the spss statistical package (version 16.0 for windows). the clinical characteristics and biochemistry parameters of t2d patients and nondiabetics with ati or li as different subtypes of ischemic stroke are shown in table 1. the age, gender, duration of diabetes, and duration from the onset of ischemic stroke were similar in t2d patients and nondiabetics with different subtypes of ischemic stroke, together with hba1c levels, implying satisfactory metabolic control before metabolic investigation was done. however, ldl-c level was significantly higher in t2d patients with ati compared to the t2d patients with li and t2d patients without stroke and also in nondiabetics with ati compared to nondiabetics with li and healthy controls. there is no difference in prevalence of hypertension in patients with t2d and ati or li and t2d without ischemic stroke, while it was significantly higher in nondiabetics with ati or li than in healthy controls. we found that si levels were significantly lower in t2d patients with ati (group a) and li (group b) compared to t2d patients without ischemic stroke (group c) (1.14 0.58 and 1.00 0.26 versus 3.14 0.62 min/mu/l 10, resp. also, the results showed significantly lower si levels in nondiabetics with ati (group d) and li (group e) compared to healthy controls (group f) (3.38 0.77 and 3.03 0.72 versus 6.03 1.69 min/mu/l 10, resp. simultaneously, pi levels were higher in t2d patients, ati (group a), and li (group b) than in t2d patients without ischemic stroke (group c) (20.94 4.31 and 20.07 0.88 versus 16.06 0.91 mu/l, respectively, p<0.001) and in nondiabetics with ati (group d) or li (group e) in comparison to healthy controls (group f) (15.57 1.86 and 15.59 1.26 versus 7.54 2.03 mu/l, respectively, p<0.001) (figure 2). when we evaluated antioxidant enzyme activities in t2d patients with ati (group a) and li (group b) and without ischemic stroke (group c) and in nondiabetics with ati (group d) and li (group e) and healthy controls (group d), we detected the levels of the gsh-px and gr activity being significantly lower in group a and b versus c and in group d and e versus f (gshpx: a: 21.96 3.56 versus b: 22.51 1.23 versus c: 25.12 1.67 u/ghb, p<0.001; d: 24.75 3.02 versus e: 25.57 1.92 versus f: 28.56 3.91 u/ghb, p<0.001; gr: a: 44.37 3.58 versus b: 43.50 2.39 versus c: 48.58 3.67 u/ghb, p<0.001; d: 24.75 3.02 versus e: 25.57 1.92 versus f: 28.56 3.91 u/ghb, resp., p<0.001) (figure 3), while the sod levels did not differ between the investigated groups (a: 769.57 72.36 versus b: 768.97 34.50 versus c: 789.18 60.28, d: 795.23 48.28 versus e: 797.80 69.21 versus f: 813.88 45.80 mu/mghb, resp. this analysis identified that decreased insulin sensitivity si and the decreases of gr were related to both ati and li in t2d patients. simultaneously, this model identified decreased insulin sensitivity si and the level of gr and gsh-px in nondiabetics with ati, but predominantly decreased insulin sensitivity si in nondiabetics with li (table 2). in this study, we directly measured the is level, together with three different types of antioxidant enzyme activities, gsh-px, sod, and gr, in t2d patients and nondiabetic individuals with two different subtypes of ischemic stroke in type 2 diabetics. our results have shown decreased is level in t2d patients with two different subtypes of ischemic stroke, ati and li, compared to t2d without stroke, while we could not demonstrate the difference between the subtypes, and the same pattern of is changes was found in the nondiabetics. to our knowledge, there are scarce data regarding the changes in is in t2d with ischemic stroke subtypes. previous study also suggested that insulin resistance measured using different methodology, the short insulin tolerance test, is independently associated with markers of atherosclerosis detected on carotid arteries in t2d patients. simultaneously, an association has been documented between insulin resistance and other markers at the large vessels, such as the pulsatility index on cerebral arteries. on the other hand, it has been shown that insulin resistance, evaluated by the homeostasis model assessment (homa) index, was higher in diabetic in contrast to nondiabetic patients with li being a small vessel disease. additionally, it has been suggested that diabetes, hypertension, and metabolic syndrome which share insulin resistance as a common mechanism, contribute to li occurrence [1820]. however, detailed mechanisms of the possible link between the presence of ischemic stroke subtypes and insulin resistance remain to be clarified. in addition, when we measured the level of insulinemia in these patients, the significantly higher level of insulinemia was detected in both groups of t2d patients, with ati and li. the increases in insulin levels might be primarily consequence of the simultaneous presence of insulin resistance in the relevant groups. however, the increases in insulin might contribute to the appearance of the ischemic stroke subtypes. insulin, as a growth factor, might interfere with the beneficial effects of nitric oxide (no) on the vasculature. moreover, insulin infusion during euglycemic insulin clamp was able to suppress endothelium-dependent vasodilation in large arteries, which is reported to be based on increased availability of endothelin-1, leading to downregulation of nad(p)h oxidase and superoxide anion production, and endothelial dysfunction is proposed to play an important role in the pathogenesis of cerebral small vessel disease [23, 24]. also, our results demonstrated lower values of antioxidant enzymes in t2d patients with ati or li than in type 2 diabetics without ischemic stroke. the patients with ati and li did not differ regarding the level of antioxidant enzymes. these findings could be explained by the fact that in diabetes there is already reduced capacity of antioxidant protection, which is further significantly disturbed in the acute phase of ischemic stroke [4, 5]. in our data, in patients with ati and li, we found the decreases in glutathione-dependent enzymes activity in contrast to other types of antioxidant enzyme activity, for example, sod. these results imply a prolonged and severe depression of gluthatione dependent antioxidative defense mechanisms irrespective of stroke subtypes. since it has been documented that free radicals are extremely difficult to measure directly, antioxidant enzymes have been proposed to represent indirect markers of oxidative stress. numerous, but mostly experimental, studies provided evidence of an association between ischemic stroke and decreased antioxidant enzyme activity, although this possible association in humans has been less investigated [9, 25]. moreover, the analyses of treatment with agents in stroke showing an ability to prevent further depression of antioxidant protection and scavenging reactive free radicals were reported to fail to restore gsh-px and gr activities [26, 27]. generally, a recently study that aimed to assess total antioxidant capacity and oxidative stress in diabetic and nondiabetic acute stroke patients with 2 different stroke subtypes, large and small vessel disease strokes, concluded that oxidative stress and counterbalancing antioxidant capacity are more pronounced in diabetic acute stroke patients than in nondiabetics. the study provided different data in comparison to the previous investigations showing decreased gsh-px activity in both diabetic and nondiabetic patients with coronary heart disease when compared to controls [17, 29, 30]. however, the results from our study have shown the diminished activity of both gsh-px and gr in t2d patients with ati and li, which is consistent with previous reports of decreased gsh-px levels patients with stroke [6, 8, 31, 32]. the levels of sod are found to exhibit great variations in the previous study in patients with the stroke [6, 8, 26, 29, 3137]. our results could not detect the differences in the sod levels in different groups of patients, and thus they are in line with data showing no changes in respect to sod level in both diabetics and nondiabetics irrespective of different subtypes of ischemic stroke [33, 34, 37]. the tentative explanation for the inconsistent findings regarding sod might reflect the predominant role of intracellular versus extracellular fraction of sod in free radical scavenging. in our study, the detected antioxidant enzyme activities were not affected by other important factors potentially influencing the enzyme levels, for example, by hyperglycemia, aging, duration of diabetes, and presence of macrovascular complications, due to the fact that in all groups of t2d patients had similar levels of metabolic and satisfactory metabolic control and that patients were matched in respect of age, duration of diabetes, and the prevalence of macrovascular complications. the multiple regression analysis applied to our data has demonstrated that decreased is together with the decreases in gr are related to both ati and li in t2d patients. in nondiabetics, the decreases in si levels and the diminished gr the analysis reveals the potential difference in the mechanisms underlying the onset of the two subtypes of the stroke in t2d patients compared to nondiabetics. the results imply that higher levels of insulin resistance combined with lower levels of gr, detected in t2d patients compared to nondiabetics, were underlying the onset of li together ati in t2d in contrast to the findings in nondiabetics. in this context, our results are consistent with the findings that li represents the most frequent ischemic stroke subtype in t2d. taken together, our data imply that insulin resistance exerts its pathogenic influence on the level of gluthatione dependent antioxidant enzymes, especially in t2d. in conclusion, our results suggest that the presence of different subtypes of ischemic stroke is associated with insulin resistance and diminished antioxidant enzyme activity in both subtypes of ischemic stroke in t2d. the results also imply that atherogenic influence of decreased is in the different subtypes of stroke in t2d might be exerted through a significantly reduced glutathione dependent antioxidant enzyme activity, while the mechanisms relating the effects of insulin resistance and decreased antioxidant enzyme activity remain to be clarified.

we analyzed (a) insulin sensitivity (is) and (b) glutathione peroxidase (gsh-px), glutathione reductase (gr), and superoxide dismutase (sod) antioxidant enzyme activity in type 2 diabetic (t2d) patients with atherothrombotic infarction (ati) (group a), lacunar infarction (li) (b), or without stroke (c) and in nondiabetics with ati (d), li (e), or without stroke (f). ati and li were confirmed by brain imaging is levels were determined by minimal model (si index), and the enzyme activity by spectrophotometry. in t2d patients, si was lower in a and b versus c (1.14 0.58, 1.00 0.26 versus 3.14 0.62 min1/mu/l 104, p<0.001) and in nondiabetics in d and e versus f (3.38 0.77, 3.03 0.72 versus 6.03 1.69 min1/mu/l 104, p<0.001). also, gsh-px and gr activities were lower in a and b versus c (gsh-px: 21.96 3.56, 22.51 1.23 versus 25.12 1.67; gr: 44.37 3.58, 43.50 2.39 versus 48.58 3.67 u/ghb; p<0.001) and in d and e versus f (gsh-px: 24.75 3.02, 25.57 1.92 versus 28.56 3.91; gr: 48.27 6.81, 49.17 6.24 versus 53.67 3.96 u/ghb; p<0.001). decreases in si and gr were significantly related to both ati and li in t2d. our results showed that decreased is and impaired antioxidant enzymes activity influence ischemic stroke subtypes in t2d. the influence of insulin resistance might be exerted on the level of glutathione-dependent antioxidant enzymes.

PMC3697295

pubmed-198

the formation of spores is a survival mechanism of microorganisms when exposed to unfavorable environmental conditions (e.g., heavy metal stress, nutrient limitations) leading to a dormant or resting growth state [1, 2]. a variety of bacteria identified in diverse habitats including soil is able to form endospores. these physiological groups include aerobic heterotrophs (e.g., bacillus, paenibacillus, brevibacillus, geobacillus, thermoactinomyces, and sporolactobacillus), anaerobes (clostridium, anaerobacter, and desulfotomaculum), microaerophiles (sporolactobacillus), halophiles (sporohalobacter), and phototrophs (heliobacterium, heliophilum) [3, 4]. bacterial spores are characterized by a series of unique chemical features which can facilitate their identification in natural environments. besides the high content of minerals (particularly calcium), spores contain high amounts of dipicolinic acid, dpa. dpa is uniquely found in bacterial spores in amounts of up to 25% of the spore dry weight and depends on the bacterial species [6, 7]. in solution, a complex is formed in the presence of terbium which shows a very strong and distinctive fluorescence spectrum. originally, dpa was used to detect very low concentrations of terbium (iii). on this basis, methods for the detection of bacterial endospores have been developed [1013]: by the addition of terbium, the dpa content was determined. however, terbium-dpa fluorescence might be interfered by a series of compounds, especially when dpa has to be determined in complex samples such as sediments or soils. it has been reported that the presence of phosphorus compounds (especially ortho-phosphate) reduced terbium fluorescence by as much as 98%. the addition of aluminium compounds (especially aluminium chloride, alcl3), however, ameliorated the interference caused by the quenching substances. from a series of organic compounds (benzoate, tryptophan, tyrosine, phenylalanine, glucose, malate, riboflavin, nad, and tryptone) only the latter two (especially tryptone) reduced fluorescence significantly. carbohydrates (e.g., starch, dextrine) were reported not to interfere with the terbium fluorescence. inorganic compounds such as calcium carbonate, sodium chloride, potassium chloride, ammonium sulphate, ammonium nitrate, and sodium nitrate did not lead to a reduction of the fluorescence, but only dipotassium phosphate did. the aim of this study was to adopt the fluorescence-based method to determine the spore content in soils sampled from various locations. in particular, we were interested in the differentiation between different types of soil such as grasslands (pasture, meadow), allotment gardens, and forests, as well as fluvial sediments, the relationship of soil parameters (carbon-to-nitrogen ratio) on the occurrence of bacterial spores, and the distribution of spores in relation to sampling depth. different bacillus species (b. megaterium, b. subtilis) were cultivated in liquid medium containing (in g/l): glucose (3.6), ammonium chloride (2.5), magnesium sulfate (0.2), calcium chloride (0.07), iron sulfate (0.01), edta (0.01), potassium dihydrogen phosphate (0.6), dipotassium hydrogen phosphate (0.9), and yeast extract (1.0). erlenmeyer flasks (250 ml) containing 100 ml of growth medium were inoculated and incubated for 10 to 15 days (150 rpm, 30c). to initiate and stimulate sporulation, bacteria were subsequently transferred to a sporulation medium (identical composition, but without glucose and less ammonium chloride [only 1 g/l]). after additional 30 days of incubation until vegetative cells were not present anymore after inspection by microscopy spores were harvested by centrifugation, immediately frozen in liquid nitrogen followed by lyophilization. samples from different locations were collected using a stainless steel soil corer (15 mm in diameter), which was sterilized before each sampling. cores with a maximum length of 25 cm were obtained, cut in sections of 5 cm, transferred to sterile screw cap falcon tubes (20 ml), and stored on dry ice. after return to the laboratory, samples were immediately lyophylized or stored at 80c until further processing. sampling sites were located in the surroundings of zurich (switzerland): grassland soil, meadow (municipalities of mnnedorf; uerikon; stfa; and dbendorf), allotment garden (university of zurich, irchel campus), pasture (university of zurich, irchel campus; municipality of wdenswil), forest soil (municipality of stfa), and aquatic sediments (river glatt in dbendorf). lyophilized aliquots of approximately 1 g were transferred to an eppendorf micro test tube (2 ml) and ground (by adding a 6 mm glass bead) in tissuelyser (retsch, haan, germany) for 5 1 min. elemental composition (carbon, hydrogen, nitrogen) of soil was performed with a chn-932 elemental analyzer (leco corp., st. composition (in% of dry soil) varied between 2.2 and 15.4, 0.2 and 1.4, and 0.2 and 2.0 for total carbon, total hydrogen, and total nitrogen, respectively. phosphate in aqueous soil extracts (250 mg soil in 5 ml sodium acetate buffer; 0.2 m, ph 5) was determined using commercially available kits (lck 348 and 349; hach lange ag, hegnau, switzerland). 10 mg of dry spore powder was resuspended in 10 ml sodium acetate buffer (0.2 m, ph 5). soil samples were thawed and 50 mg were suspended in 0.9 ml sodium acetate buffer and 0.1 ml aluminium chloride (alcl3, 0.5 m). samples were microwaved (berghof microwave digester mws-1, with built-in in situ infrared temperature control) in teflon tfm screw cap digestion vessels. temperature and power were set to 140c and approximately 680 w (80%), respectively. alternatively, dpa was released from spores by autoclaving the samples in screw cap glass test tubes for 15 minutes at 121c. the identical dpa extraction protocol was applied for soil samples. however, microscopy was not possible due to the presence of mineral particles interfering the observation. after cooling for 30 minutes, 100 l of the spore suspensions were mixed with 100 l terbium chloride solution (tbcl3, 30 m) in white 96-well microtiter plates (in 8 replicates). fluorescence was immediately measured using a plate reader (spectramax m2, bucher biotec, basel, switzerland) with the following settings: time-resolved fluorescence (delay 50 s, interval 1200 s) at an excitation wavelength of 272 nm, emission wavelength of 545 nm, and 10 endpoint readings per sample at 30c. the number of spores in the soil samples was determined using standard addition method with spores of b. subtilis. microwave treatment of spore suspensions and soil samples led to a fast release of dpa (figure 1). within two minutes, maximum release was obtained. highest spore numbers up to 4 10 spores per gram dry soil were found in agriculturally used land (meadow, pasture), less in forest soil. the interference of different compounds present in soil (e.g., phosphate) might lead to quenching of the fluorescence signal. this drawback has been overcome by the addition of aluminium chloride as already shown for the determination of bacterial spores in aquatic sediments. concentration of ortho-phosphate in soil extracts (22.5 m) was reduced by the addition of aluminium chloride to concentrations below the detection limit (< 1.2 m). concomitantly, a de-colorization of the extract was observed suggesting the removal of humic acids which have also the potential to form complexes with terbium and quench the fluorescence signal. the method based on terbium fluorescence for the detection of total numbers of bacterial endospores in soils is fast and easy. a transect (approximately 100 m in length) through a grass field with different land use management (unused meadow, allotment garden, and pasture) gave spore numbers in the range of 5 to 9 10 spores per gram of dry soil (figure 3). spore counts were not related to the type of land use: in allotment garden soil, counts were not significantly different from soil samples taken from a pasture (p=0.423; t-test). regarding the different sampling sites, our results show that grassland soils (meadow, allotment garden, and pasture) contains much more bacterial spores than forest soils and fluvial sediments. spore content was related to the carbon-to-nitrogen ratio (figure 4). at c/n ratios>20 only low spore counts (0.5 10 spores per gram of dry soil) were detected as compared to c/n ratios<20. it has been demonstrated in pure cultures of bacillus thuringiensis in a stirred bioreactor that low carbon-to-nitrogen ratios of 4: 1 resulted in high spore counts. in contrast however, spore formation in streptomyces coelicolor was stimulated under nitrogen-limiting conditions. in particular, c/n ratios between 50 and 100 promoted sporulation, whereas c/n rations<40 did not allow spore formation. our results showed that in soils with extremely high c/n ratios, spore content was low. the importance of c/n ratio was stressed by gao and coworkers regarding the sporulation of fungi, although fungal spores do not contain dpa. a carbon-to-nitrogen (c/n) ratio of 20 stimulated spore formation by fungi such as penicillium camembertii. the fungus colletotrichum coccodes produced highest spore counts at a c/n ratio of 5 to 10, whereas at a ratio of 40, spore formation was significantly lower. similarly, in plectosporium tabacinum optimal spore formation was found when c/n rations were between 5 and 10. the distribution of spores in marine sediments (determined as dpa) showed only a low correlation with the content of total organic carbon and varied with the sediment type. highest numbers have been found in organic-rich black sediments, lowest number in sandy sediments. it was hypothesized from anthrax outbreaks, that the high numbers of bacillus spores might be related to soils rich in organic matter that is, to a high c/n ratio. these soil environmental conditions are suggested to support the presence and viability of b. anthracis spores. depth distribution of spores from an area currently used as allotment garden (cultivation of flowers and vegetables) showed highest numbers in a horizon of 5 to 10 cm (figure 5). the two methods evaluated (microwaving, autoclaving) for the mobilization of dpa from bacterial spores gave similar results. however, microwaving was less time-consuming, whereas autoclaving allowed faster throughput of samples. in summary, microwave treatment of soil samples followed by the measurement of fluorescence after addition of terbium proved to be a fast and easy method to assess the content of bacterial spores. our study might provide a basis for the detection of hot spots of endospores in soil.

spore formation is a survival mechanism of microorganisms when facing unfavorable environmental conditions resulting in dormant states. we investigated the occurrence of bacterial endospores in soils from various locations including grasslands (pasture, meadow), allotment gardens, and forests, as well as fluvial sediments. bacterial spores are characterized by their high content of dipicolinic acid (dpa). in the presence of terbium, dpa forms a complex showing a distinctive photoluminescence spectrum. dpa was released from soil by microwaving or autoclaving. the addition of aluminium chloride reduced signal quenching by interfering compounds such as phosphate. the highest spore content (up to 109 spores per gram of dry soil) was found in grassland soils. spore content is related to soil type, to soil depth, and to soil carbon-to-nitrogen ratio. our study might provide a basis for the detection of hot spots of bacterial spores in soil.

PMC3132637

pubmed-199

cannabis is a prominent political, health, and law enforcement issue in north america that is currently receiving a great deal of attention. as we watch the effects of the legalization of cannabis in colorado, washington, alaska, oregon, and the district of columbia, other jurisdictions are debating the future of this illicit drug. how can we prevent commercialization promoting increased rates of use within a legalization model? where does marijuana for medical purposes fit into the picture, if at all? a critical piece of information often missing from these debates or not addressed adequately is the scientific evidence about the effects of cannabis use on a person's overall health. this concern is even more pressing when it comes to the cognitive, physical, and mental health harms to adolescents who use cannabis. it is critical we ask these questions because adolescence is a time of rapid development that helps lay the foundation for success later in life. conversely, it can also set the stage for experiencing challenges in adulthood, as youth are disproportionately more likely than adults to experience greater harms from drug use. their brains are undergoing rapid and extensive development that can be negatively affected by cannabis use. there is certainly cause for concern about the amount and frequency of cannabis use among youth. according to the 2014 monitoring the future (mtf) survey in the us, 35.1% of high school seniors reported pastyear use of cannabis, with 5.8% reporting daily or near daily use. comparable prevalence rates are reported in canada, with 22% of 1519yearolds and 26% of 2024yearolds reporting pastyear use of cannabis in 2013 according to the canadian tobacco, alcohol and drugs survey. moreover, a 2013 unicef report noted that canada's youth are the highest users of cannabis when compared to students in other developed countries. the mtf survey also indicates a growing perception among young people that cannabis is a relatively harmless drug, and there is strong evidence that perception of harm is inversely related to rates of use. knowing that youth are disproportionately heavy users of cannabis, what specific concerns should this raise about short and longterm consequences and how do we incorporate these concerns in the debate? recent evidence shows that early and frequent use of cannabis has been linked with deficits in shortterm cognitive functioning, reduced iq, impaired school performance, and increased risk of leaving school early all of which can have significant consequences on a young person's life trajectory.1 of note, the impact of cannabis use on iq has been the topic of recent debate among experts in the field and further research aimed at understanding this relationship will provide much needed clarity. heavy cannabis use in adolescence is also a risk factor for psychosis, a risk that is heightened if users have a preexisting vulnerability to that condition.1 cannabis use can also lead to dependence, with evidence from longitudinal studies in the us estimating the risk of developing cannabis dependence to be one in six among those users who initiated in adolescence,2 a rate higher than that reported among adults. recent data from the 2012 canadian community health survey reveal that more than one in 20 young canadians aged 1524 met the criteria for cannabis abuse or dependence during the past year. there is also growing evidence from the human literature that early and frequent use of cannabis can alter structural aspects of the developing brain, including those that are responsible for memory, decisionmaking, and executive functioning.1 however, we do not yet know the full extent of the impact of early cannabis use on changes in brain function and behavior of young people, which underscores the need for further investment in research in this area. beyond longerterm consequences, cannabis can also acutely impair cognitive and motor functions like perception, coordination, and balance for hours after use. this impairment presents a safety hazard for drivers getting behind the wheel, as well as for other motorists and pedestrians. in fact, the risk of car crashes doubles for drivers who get behind the wheel after using cannabis and this risk is further elevated if cannabis use is combined with other substances, most notably alcohol. recent data from the national fatality database indicate that cannabis was the most common illicit drug present among fatally injured drivers aged 1524 in canada between 2000 and 2010. the drug abuse warning network, which monitors the health impact of drugs in the us, estimated that in 2011, there were nearly 456,000 drugrelated emergency department visits in which cannabis use was mentioned in the medical record. data from the canadian institute for health information reveal that from 2006 to 2011, youth aged 1524 spent the largest number of days in a hospital for a primary diagnosis of mental and behavioral disorders due to the use of cannabinoids. furthermore, the number of days spent in a hospital increased by almost 40% during the same time period.3 these findings are particularly troubling because recent research from canada has revealed that young people are confused about cannabis and do not have the knowledge they need about the risks associated with this drug to make more informed decisions.4 some have expressed questionable beliefs about the effects of cannabis, indicating that it helps to improve their focus at school and can prevent or even cure cancer. youth also expressed mixed beliefs as to whether cannabis improves or impairs driving performance, and felt that cannabis and driving was not as dangerous as drunk driving. youth talked about how cannabis is natural and so they did not really think of it as a drug. the findings from this reviewed research highlight the complexity of the issues surrounding youth consumption of cannabis. youth are confused with the mixed messages they are receiving from discussions ranging from legalization to the use of cannabis for medical purposes, which points to the need for a coordinated, comprehensive, factual, and consistent approach to increasing awareness of this drug and its impact. as primary care is an important intervention point for youth experiencing harms related to cannabis, there is an urgent need to develop practical, evidenceinformed tools to assist healthcare providers in the early identification of cannabis use and cannabis dependence, as well as tools to deliver interventions to treat potential problems. examples of such tools may include screening instruments to screen for cannabis use that warrants clinical intervention, as well as brief intervention strategies aimed at addressing the problematic substance use revealed during the screening process. there is also an urgent need for further research aimed at improving the understanding of differences between the short and longterm effects of cannabis use, particularly on the developing adolescent brain. such research should include mechanistic studies regarding alteration of cellular structure and function related to cannabis to determine the impact on adolescent brain development. of particular concern are the impacts of the dramatic increase in concentrations of tetrahydrocannabinol (thc), the main psychoactive ingredient of the cannabis plant, over the past 25 years. the average potency of federally seized cannabis in the us has steadily increased from 3.5% in 1985 to 13.2% in 2012.5 in light of such an increase in potency, some historical findings about the health and developmental effects of cannabis use might not be relevant when trying to predict effects on contemporary users. more research is also needed to shed light on the influence of cannabis policy on public health, public safety, and other outcomes. the current understanding of the impact of cannabis policy on market forces, such as healthcare costs, lost productivity costs, and tax revenues, for example, is very limited, as is overall understanding of how perception, use, and outcomes interrelate around this drug. in an effort to help clear the smoke, the canadian centre on substance abuse is currently undertaking a comprehensive review and synthesis of the literature on the effects of cannabis use during adolescence that will highlight key areas for action in policy, practice, and research. this muchneeded work will provide clarity to misperceptions about cannabis, and make sense of some conflicting evidence about the effects of cannabis use and the impact of early or regular use during a time when the brain is still developing. by integrating neuroscience with the behavioral and social context of cannabis use by youth, this report will provide a muchneeded resource for those working with youth and those involved in making decisions about policies, programs, or practices related to cannabis. aj porathwaller has provided expert testimony at the standing committee on health's (hesa) recent report on marijuana's health risks and harms, october 2014.

cannabis is the most commonly used illicit substance among youth. recent policy developments and ongoing debate related to this drug underscore the urgent need to clear the smoke and better understand what the scientific evidence says about the health and behavioral effects of cannabis use, particularly on youth whose brains are undergoing rapid and extensive development.

PMC5034357

pubmed-200

hypertension (htn) is the most common comorbidity in the world with significant public health implications [1, 2]. the overall u.s. prevalence of hypertension among adults ages 18 years in 20052008 was 30.9% and was highest among persons ages 65 years (69.7%) and non-hispanic blacks (44%). the american heart association estimates that the incurred costs of hypertension are more than $93.5 billion per year, and that cardiovascular disease and stroke for which htn is the predominant risk factor, account for 17% of the total annual health expenditures in the united states. hypertension and its sequelae, heart failure (hf), are a progressive disease. evidence shows that less than half of patients with heart failure survive five years (after diagnosis), and less than a quarter of them live ten years after their initial diagnosis. framingham heart study showed that hypertensive patients were more likely to develop heart failure (142 cases of hf detected during the first 16 years of followup) than those who were normotensive. the lifetime risk for development of hf among people with blood pressure (bp)>160/90 mm hg is double that of those with bp<140/90 mm hg. heart failure in comparison to the most prevalent gender malignancies (bowel cancer in men and breast cancer in women), was associated with worse long-term survival. over a million hospitalizations, contributing to more than 250,000 deaths, and escalating billions of dollars in health care expenditure is the norm. the disastrous duo, htn and hf, should be recognized, and a tailored focus on management in special populations, high-risk ethnic minority groups especially blacks who are disproportionately burdened should be developed. among racial groups, african-american adults have the highest rates (44%) of hypertension in the world and are more resistant to treatment. in particular, black women have the highest prevalence and the lowest blood pressure control. the relative incidence of hf is 50% higher in african americans, 3% of whom have hf, compared with 2% of the general population [13, 14]. the disease occurs at an earlier age, and usually at a more advanced stage along with increased hospitalization and mortality. other causes of hf include coronary artery disease, valvular heart disease, diabetes, left ventricular hypertrophy and cardiomyopathies. overt clinical hf resulting from diastolic left ventricular dysfunction may be clinically indistinguishable from that resulting from systolic dysfunction. hf with preserved left ventricular function is observed in 30% to 50% of adult cases of hf. coronary artery disease and myocardial infarction is a principal cause of systolic left ventricular dysfunction followed by hypertension. a variety of neurohormonal systems, especially the renin-angiotensin aldosterone and sympathetic nervous systems are activated in response to the left ventricular dysfunction and such activation leads to abnormal ventricular remodeling. the inexorable progression to more severe stages of left ventricular dysfunction can be significantly reduced by effective therapy with neurohormonal blockade including angiotensin converting enzyme inhibitors (aceis), beta blockers (bbs), and aldosterone antagonists. current understanding of the pathophysiology of hf has revolved around neurohormonal activation [19, 20]. this endothelial dysfunction may result from insufficient nitric oxide (no) secondary to either reduced endothelial production of no or to increase no inactivation [17, 19, 21]. in hf, a pronounced increase in angiotensin ii, with modestly reduced no is seen among whites. however, african americans with hf may exhibit greater no reduction; conversely, angiotensin ii might be less elevated among whites. important studies are investigating gene variation among the races that may influence the risk of developing hypertension and its complications, such as single nucleotide polymorphisms in the genes encoding for 1-adrenergic receptors and a2c-adrenergic receptors. african americans who are homozygous for polymorphisms in both the 1-adrenergic and a2c-adrenergic receptor genes are at a 10-fold greater risk for heart failure, which is overexpressed in african-americans. groups with overexpression of transforming growth factor -1 (tgf-1), a cytokine involved in cardiac fibrosis and remodeling, vascular and renal disease, production of the vasoconstrictor, endothelin-1, and stimulation of renin release, have a worse prognosis. other genetic polymorphisms in african americans that may influence heart failure risk include elevated production of endothelial nitric oxide synthase, aldosterone synthase, and the g protein 825-t allele. there are two major approaches to classifying the patient's hf stage or clinical severity. the most common is the new york heart association (nyha) classification, mainly based on functional capacity and subjective level of symptoms severity. this scheme is fluid and its class fluctuates in the same patient depending on their subjective assessment and clinical status. the other approach, adopted by the american college of cardiology/american heart association (acc/aha) guidelines, emphasizes disease progression. classified as stages a, b, c, and d, each of these stages has definable characteristics and recommended interventions. to emphasize the progressive nature of hf and the need to prevent its development or progression to end-stage disease (stage d) [18, 23], current hf guidelines define patients in stage a as those at increased risk for hf without evidence of structural heart disease or symptoms of hf. stage a represents a critically important group because many of the risk factors including hypertension can be effectively controlled and by doing so may prevent development of cardiovascular diseases including hf. patients are in stage b when they present with evidence of structural heart disease but without current or prior symptoms of hf. stage c is recognized by the presence of structural heart disease and current or prior symptoms of hf. stage d patients are those who have refractory heart failure requiring frequent hospitalization and specialized interventions. several studies have shown the efficacy of treatment of hypertension in preventing hf [2427]. treatment of hypertension reduces the incidence of hf by about 50%. in recent years, significant advances have been made in increasing awareness, treatment, and control of blood pressure. several large, randomized clinical trials have shown that specific classes of medication have mortality benefit in patients with heart failure [2834]. in the most recent guidelines for the diagnosis and management of hf in adults, the american college of cardiology foundation (accf)/american heart association (aha) recognized the need for specific recommendations for special population. lifestyle modifications have been shown to reduce blood pressure, increase drug efficacy, and decrease cardiovascular risk. long-term primary prevention of hypertension includes weight reduction in overweight/obese individuals. weight loss intervention was associated with a 21% reduction in the incidence of hypertension over a 36-month period. dietary practices, reducing intake of dietary sodium to<1.5 g nacl [3, 36], low potassium, magnesium, and saturated fat intake, increased calcium intake, decreased consumption of alcohol, have demonstrated greater bp reduction in blacks. these practices are most successful when reinforced with comprehensive education and counseling [39, 40]. exercise training, regular aerobic physical activity for at least 30 minutes per day most days, has been shown to reduce recurrent cardiac events in patients with lv dysfunction from ischemic heart disease and is recommended under close medical supervision. culturally cognizant and sensitive modalities should be implemented to help guide improved compliance of therapeutic lifestyle changes (tlc) in special populations [43, 44]. despite lifestyle modifications, most patients with hypertension need pharmacologic therapy for better bp control. in the united states, pharmacological treatment of hypertension before development of structural heart disease or symptoms of hf is mainly based on studies looking at prevention of end-organ damage. specific classes of medication are recommended for patients in stages b-d that have shown benefit in reducing mortality and number of hospitalizations. the reader should refer to the major guidelines for full treatment recommendations of hf in the general population [18, 23, 46].. however, ethnic minorities who are at greater risk for developing hf remain underrepresented in most clinical trials. according to a recent paper by mitchell et al. treatment of hf in african americans a call to action, most of the available evidence is based on limited representation of african americans in these trials or posthoc analysis of limited evidence. these papers once again summarize the available evidence in hf management in african americans and call for more therapeutic trial focused in these high-risk population. the african american heart failure trial (a-heft) was the first heart failure large trial to focus specifically on the african-american population and evidence represented approximately 50% of all african americans ever studied in heart failure trials. this is randomized placebo-controlled double blind study of fixed dose isosorbide dinitrate/hydralazine (isbd/hyd) (figure 2). in an effort to summarize efficacy of available treatments, psaty et al the database included 192,478 patients from 42 trials randomized to 7 treatment strategies including placebo. low-dose diuretics proved the most effective first-line treatment for preventing cardiovascular disease and mortality including hf. the allhat trial showed that diuretics are as effective as calcium channel blockers or acei in preventing cardiovascular disease outcomes including hf. the allhat study also has suggested that thiazide-diuretic therapy is useful in preventing disease progression. although, allhat trials and other trials showed diuretics is the first-line of antihypertensive therapy and is still the most commonly prescribed antihypertensive medications, this is challenged by recent studies as published in february jacc and presented in the european society of htn meetings. however, the diuretics used in the allhat trials was chlorthalidone a long acting thiazide (shown to effectively lower bp and improve survival), not really the same as hydrochlorothiazide (hctz) which is the most commonly prescribed antihypertensive thiazide at a dose of 12.525 mg. (st luke roosevelt hospital, new york, ny), published the analysis of 18 trials on hctz where the antihypertensive effect of hctz at the dose that is most often used12.5 to 25 mg a day is consistently inferior to that of most other antihypertensive drug. the other limitation of diuretics as first line therapy in african americans is not only not adequate but also, has multiple side effects like dm, electrolyte abnormalities and urecemia, to mention a few. however, there is still a role of diuretics in combination with neurohormonal (renin angiotensin aldosterone axis) blockade and when there is compelling indication. according to the recent consensus statement of the international society on hypertension in blacks (ishb), chlorthalidone furthermore, the ishb consensus statement reinforces, patient above goal bp (sbp/dbp15/10) with (goal bp<130/80) end organ damage (hf, lvh, kidney disease) or without end organ damage (goal bp<135/85) should be on at least on combination pharmacotherapy. use of beta blockers (bb) as treatment for hypertension has come under scrutiny. conducted a meta-analysis of 13 trials, which included 105,951 patients showing that atenolol did not improve outcomes in terms of stroke and cardiovascular events. in stage b chf (nyha class i), defined by the presence of reduced left ventricular ejection fraction (lvef)<40 percent in otherwise asymptomatic individuals, aceis and bbs are recommended. iii) manifest left ventricular dysfunction and overt symptoms; in these individuals, aceis and bbs are also indicated. bbs are also recommended in hf because of clinical studies demonstrating decreased morbidity and mortality, and improvement in hf symptoms. aldosterone antagonists may provide additional benefit in patients with severe left ventricular dysfunction, usually late stage c (nyha class iii low-dose spironolactone (12.525 mg daily), when added to standard therapy, decreased mortality by 34 percent. in the eplerenone postacute myocardial infarction heart failure efficacy and survival study (ephesus), eplerenone reduced mortality by 15% in patients following a recent mi with lvef<40%, 90% of whom had hf symptoms. patients were excluded who had a serum creatinine of<2.5 mg/dl and hyperkalemia. the v-heft i and ii are a large-scale trial that compared different vasodilators with placebo and among themselves. v-heft i showed, the mortality rate was significantly lower for the total cohort (african americans and whites) in isdn/hyd arm compared to patients treated with prazosin or placebo added to digitalis and diuretics (figure 1). in v-heft ii, though isbd/hyd was statistically inferior to enalapril in effect on mortality, patients taking isbd/hyd experienced similar mortality rate in patients taking isbd/hyd in v-heft-ii as those in v-heft-i taking isbd/hyd. posthoc analysis of v-heft i showed isbd/hyd significantly reduced mortality in african american patients but not in white patients. the reanalysis of v-heft ii, demonstrated the annual mortality rate african american (12.9) patients receiving isbd/hyd was 12.9% compared with 12.8% for african americans receiving enalapril. due to difference in outcomes in african americans in v-heft, the african american heart failure trial (a-heft) definitive study was designed. the a-heft was terminated earlier than anticipated completion date due to a significant (43%) reduction in mortality in patients receiving combination (isdn/hyd) compared to the placebo arm. adding the combination of a fixed-dose of isdn/hyd (20 mg/37.5 mg) to a standard medical regimen for hf, including acei and bbs, is recommended in order to improve outcomes for patients self-described as african americans, with nyha functional class iii or iv chf. furthermore, genomic evidence from the grahf (genetic risk assessment of heart failure in african americans) arm of the african american heart failure trial (a-heft) showed that blacks with the more common tt phenotype (61%) of the aldosterone synthase gene (cyp11b2) showed greater responsiveness to the combination of isosorbide dinitrate and hydralazine. the vast majority of blacks will have no identified cause for their htn. past studies elucidating the pathophysiological mechanisms have shown conflicting information and further investigations exploring the complex relationships and interactions are warranted. there are, however, several secondary forms of htn in blacks that are prominent and preventable. we will focus on the most common, preventable and treatable secondary form of hypertension, obstructive sleep apnea (osa). the prevalence of osa in hypertensive populations is estimated to range between (3040%) and in heart failure at 53%; apnea-hypopnea index (ahi) 10/h). it is an independent risk factor for htn, nondipping of blood pressure and increased bp variability and follows a dose-dependent relationship. a prospective study showed that the odds of developing hypertension over 48 years was 2.89 times more likely for participants who had ahi 15/h compared to ahi 0, independent of known confounders. cross-sectional data has shown 2.38-times increased likelihood of having heart failure in association with osa, independent of confounders (n=6424) [67, 68]. osa has been shown to act through various mechanisms, independent of blood pressure, in promoting left-ventricular (lv) hypertrophy, diastolic, and systolic dysfunction, and overt heart failure. these mechanisms include the hemodynamic consequences of repetitive increases in left-ventricular transmutable wall pressure and over time impaired vigil heart rate modulation leading to lv hypertrophy and ventricular remodeling. additionally, osa patients without overt heart failure have more impaired diastolic relaxation than those without osa. emerging evidence illustrates patients with osa have more active atherosclerotic disease with a greater degree of vessel involvement and more vulnerable plaques than do patients without the disease, resulting in greater cardiovascular burden. the definite treatment for osa, long-term adherence to continuous positive airway pressure (cpap) therapy, has shown to suppress sympathetic activity, lower blood pressure, reduce right ventricular volume, and improve systolic function in patients with hf. systematic reviews, meta-analyses, and randomized controlled trials have shown statistically significant net reduction in blood pressure with cpap, especially in patients with increased ahi events [7883]. a recent 3-year study (n=340) by durn-cantolla et al. reported that participants assigned to cpap therapy for 3 months had mean 24-hour ambulatory blood pressure decreased by 2.1 mmhg (0.4 to 3.7) mmhg (p=.01) for systolic and 1.3 (0.2 to 2.3) mm hg (p=.02) for diastolic blood pressures. similar evidence from randomized trials showed up to 9% increase in lvef and increased quality of life (qol) and functional capacity among patients treated with 13 months of cpap therapy. furthermore, among patients with no overt failure, cpap therapy has been shown to reverse impaired diastolic relaxation. there is a need for further randomized clinical trials with cpap therapy among high-risk ethnic minorities especially blacks to assess whether treatment of osa has similar long-term effects and to evaluate the effect on htn and hf morbidity and mortality. taking into consideration, lifestyle and pharmaceutical interventions, our changing health care community needs to emphasize the essential nature of the patient-provider relationship and establish trust and collaboration. in the past, this has been accomplished through physician, patients, family member, and other caretaker awareness, increased education of both provider and patients, and establishment of community outreach programs. these measures have contributed to an increase in compliance and a reduction in the risk of hospitalizations [23, 87]. we recommend an additional emphasis on the implementation of specialty care in patients with heart failure in collaboration with the primary care provider. the dramatic improvement in the management of hf and hypertension over the last 50 years has allowed us to start to target specific populations and provide more evidence-based treatment that will lead to an improvement in mortality. there are disparities in the prevalence, treatment, and control of hypertension and the incidence and morbidity and mortality of heart failure between blacks, a diverse and heterogeneous population, and whites. the management team needs to take into consideration new evidence and develop tailored strategies for effective treatment, especially for hypertension, one of the main causes of hf and many other cardiovascular complications in african africans .

hypertension (htn) is the most common co-morbidity in the world, and its sequelae, heart failure (hf) is one of most common causes of mortality and morbidity in the world. current understanding of pathophysiology and management of htn in hf is mainly based on studies, which have mainly included whites. among racial groups, african-american adults have the highest rates (44%) of hypertension in the world and are more resistant to treatment. there is an emerging consensus on the significance of racial disparities in the pathophysiology and treatment options of hypertension and heart failure. however, african americans had been underrepresented in all the trials until the initiation of the a-heft trial. since the recognition of obstructive sleep apnea (osa) as an important medical condition, large clinical trials have shown benefits of osa treatment among patients with htn and hf. this paper focuses on the pathophysiology, causes of secondary hypertension, and treatment of hypertension among african-american patients with heart failure. there is increasing need for randomized clinical trials testing innovative treatment options for african-american patients.

PMC3124316