Datasets:

giuliadc

/

pubmed-filtered

like 0

pubmed-1101

gene duplication is one of the most prominent mechanisms by which organisms acquire new functions. spectacular examples of such gains of function resulting from gene duplications are the evolution of trichromatic vision in primates, the evolution of human beta-globin genes that are involved in the oxygen transport at different developmental stages as well as the expansion of the family of immunoglobulins and other immunity-related genes that shaped the vertebrate immune system [4, 5]. because of the central role of gene duplication in evolution, there has been a profound interest for a better understanding of how these new functions evolve at the molecular level, for determining at what rate gene duplication occurs [79] and for testing whether the retention of paralogous genes necessarily requires the evolution of new functions [6, 10, 11]. one of the most important challenges has been to determine mechanistically how specific mutations translate into new functions, as establishing sequence-function relationships remains a difficult task. after a gene duplication event, the two sister paralogs are identical copies of their ancestor and encode two identical functions, thus relaxing the selective constraints on each paralog. under most evolutionary models, both paralogs have to diverge to be retained on evolutionary time scales, otherwise one paralog would be lost and the system would return to its ancestral state (nonfunctionalization). the first one is the acquisition of new functions by one or both of the two paralogs, a mechanism called neofunctionalization [1, 8, 10]. the second mechanism, called subfunctionalization, implies the complementary partitioning of the ancestral function between the two paralogs by losses of functions [8, 10, 13]. these two mechanisms are not mutually exclusive because the ancestral function can be partitioned by subfunctionalization and then one or both paralogs may acquire new functions by neofunctionalization, a mechanism called neosubfunctionalization. an increase in the dosage of a gene product by the addition of a second identical copy of the ancestral gene can also contribute to the retention of paralogous pairs, without the need for the gain or loss of functions [15, 16]. divergence between paralogs does not necessarily imply a divergence in a specific function but can also involve a change in the regulation of that function. for instance, the regulatory control of a protein function can be modified at the transcriptional or at the posttranslational level. divergence in expression pattern of duplicated transcript is well documented [1, 10, 17, 18].. showed that a large fraction of ancient duplicated gene pairs in yeast shows divergent gene expression patterns. a more recent study showed that nearly half of the genes that duplicated after a whole genome duplication event (wgd) in a forest tree species have diverged in expression by a random degeneration process. however, little is known about the divergence of regulation by posttranslational modifications (ptms), which take place after transcription and translation and directly affect protein activities. ptms are covalent modifications of one or more amino acids that affect the activity of a protein, its localization in the cell, its turnover rate, and its interactions with other molecules. although only 20 amino acids are encoded by the genetic code, more than 200 amino acid variants or their derivatives are found in proteins after ptms. phosphorylation, the addition of a phosphate moiety from an atp donor to a serine (ser), threonine (thr), or tyrosine (tyr) residue by a protein kinase, is by far the best-known ptm, as it is the most common and is involved in the regulation of key biological processes of fundamental and medical interest, such as signal transduction and cell-cycle regulation. of particular interest for this study is the addition of a phosphate group that brings two new negative charges that allow the formation of a salt bridge or that contribute to the local charge of the protein. given that a phosphate group is a relatively large molecule, phosphorylation can also have sterical effects. such properties can notably induce conformational changes of the protein, modify its catalytic activity, or block the access to its catalytic site, which result in the activation or inhibition of the activity of the target protein by direct or allosteric effects. several of the effects of protein phosphorylation can be mimicked by the negatively charged amino acids aspartic acid (asp) and glutamic acid (glu). indeed, the biochemical properties of these amino acids are close to those of phosphorylated ser or thr residues. in particular conditions, asp and glu are constitutive functional equivalents of phosphosites in a phosphorylated state. this functional resemblance has been exploited by biochemists by replacing ser and thr residues by asp and glu in proteins of interest in order to mimic their phosphorylated status. a striking example comes from the evolution of the activation induced cytidine deaminase (aid) across vertebrates, an enzyme involved in the generation of antibody diversity. the interaction of this enzyme with the replication protein a (rpa) promotes aid access to transcribed double-stranded dna during immunoglobulin class switch recombination. this interaction requires a negative charge on aid, which is provided by an asp in bony fish. in these organisms, the enzyme is constitutively capable of interacting with rpa. in amphibians and mammals, the function of the asp residue is carried out by a phosphorylatable ser (pser), which allows the regulation of the protein interaction by protein kinases in a condition-specific fashion. globally, it was shown that pser tends to evolve from or to phosphomimetic amino acids (asp and glu) when gained and lost, respectively, throughout the evolution of eukaryotes [27, 28]. protein phosphoregulation has been suggested to play a role in the evolutionary fate of paralogous proteins. most studies done so far focused on the paralogous genes of the budding yeast saccharomyces cerevisiae because its phosphoproteome has been intensely studied [2931]. using the yeast paralogs that derive from the wgd event, amoutzias et al. showed that the number of phosphosites on a phosphoprotein is an important determinant for the retention of its duplicated descendants. in a following study, freschi et al. studied the gains and losses of phosphosites in paralogous phosphoproteins and found that the great majority of them are present in one paralog and not in the other. this divergence was shown to be principally driven by losses rather than gains of phosphosites on one paralog. finally, kaganovich and snyder found that phosphosites tend to diverge more asymmetrically than nonphosphorylated amino acids, playing thus an important role in paralogous genes divergence and retention. these observations raise the question of where do phosphosites come from and where do they go after a gene duplication. according to the observations on phosphomimetic amino acids described above, gains and losses of phosphosites could represent two distinct types of divergence. on the one hand, the gain or the loss of phosphosites from or to a nonphosphomimetic residue would represent a divergence in the function of the protein. on the other hand, a gain or a loss could occur from or to phosphomimetic residues, leading to a modification of the control of the charged residue by the cell rather than a modification of function per se. here we test whether this second scenario could have contributed to the divergence of paralogous proteins using the yeast phosphoproteome as a model. all analyses were performed using the dataset we compiled in a previous study, and that is available at http://www.bio.ulaval.ca/landrylab/download/ (dataset 1). this dataset contains 20,342 phosphosites on 2688 proteins from eight large-scale studies [2931, 3539]. it also provides the alignments of all s. cerevisiae wgd paralogous genes with their ancestral sequence and with the orthologs of lachancea kluyveri and zygosaccharomyces rouxii. the alignments were performed using muscle while the ancestral sequence was inferred using the codeml method implemented in paml. we chose to analyze only two species that diverged before the wgd event for the following reasons. the majority of phosphorylation sites are located in disordered regions, and these regions are fast evolving. alignment of sequences from distantly related species leads to spurious alignments or to alignments that may contain several indels. indels decrease the number of phosphorylation sites available for the analysis, as ancestral sequences can not be computed at these positions., we performed the analyses including an additional species that diverged prior to the whole-genome duplication, and we found that this did not significantly affect our results. finally, this dataset also provides information about the localization of each residue in ordered or disordered regions of the protein, according to predictions made with disopred. we applied different approaches to study gains and losses coming from or going to negatively charged amino acids. in the first approach, we used the ancestral sequence as a reference to assess the presence of a gain or a loss at a specific position. for the gains, we compared the proportion of phosphomimetic amino acids in the ancestral sequence (asp or glu) going to pser or pthr to the proportion of phosphomimetic amino acids going to cser and cthr. for the losses, we compared the proportion of phosphorylated residues (pser and pthr) coming to asp or glu to the proportion of nonphosphorylated residues (cser and cthr) coming to asp or glu, respectively. we required the ancestral sequence to have a phosphorylatable residue and one of the two paralogs to be phosphorylated at the homologous position. comparisons of proportions were performed using fisher's exact tests as implemented in r. in our second approach this time we used the sequences of l. kluyveri and z. rouxii as reference. in the case of a gain of phosphosites, we required the presence of the same negatively charged residue (asp or glu) in the reference species as well as in one of the two paralogs and a phosphorylatable residue (ser or thr) in the other paralog. in the case of losses of phosphosites, we required the presence of the same phosphorylatable residue (ser or thr) in the reference species as well as in one of the two paralogs and a negatively charged residue (asp or glu) in the other paralog. all proportions were calculated by dividing the number of sites coming from or going to an asp or a glu by the number of sites that come from or go to any of the 17 nonphosphorylatable amino acids following the same criteria (figure 1). the phosphoproteome of s. cerevisiae is the best described among eukaryotes and has been mapped by mass spectrometry, leading to the identification of high-confidence phosphosites [2931]. we assembled a data set that consists of 2,726 phosphosites (ser, 82%; thr, 16%; tyr, 2%) that belong to one or the other member of the 352 pairs of yeast wgd paralogs for which at least one of the two proteins is a phosphoprotein. we inferred the ancestral sequence for each pair of paralogs using alignments with orthologous sequences from l. kluyveri and z. rouxii, two species that diverged from s. cerevisiae before the wgd event. for each pair, we aligned all five sequences, we mapped the phosphosites on the sequences of the paralogs and analysed phosphosites that diverged, that is, cases where a phosphorylatable residue was present in only one paralog. under a scenario where gains of phosphosites would result from selection for transitions from phosphomimetic amino acids to phosphorylated residues, we would expect phosphorylated ser or thr (pser and pthr, resp.) to evolve more often from asp or glu than nonphosphorylated ones (cser and cthr, resp.). similarly, under a scenario where losses of phosphosites would result from transitions from phosphorylated residues to phosphomimetic amino acids, we would expect pser and pthr to evolve more often to asp and glu than equivalent cser and cthr. in the first case, we compared the proportion of pser and pthr that were gained from asp and glu with that of cser and cthr, that is, all serines and threonines from the same set of proteins that were gained from asp and glu but that are not known to be phosphorylated. in the second case, we compared the ratio of sites that were lost and replaced by phosphomimetic residues in only one paralog with the ratios derived from cser and cthr. we performed the analysis using paralogous ancestral sequences inferred with a likelihood method and also using a parsimonious approach, whereby the ancestral state of phosphosites was inferred based on the conservation of the site in one of the two paralogs and its two orthologs (figure 1(a)). global results are presented in figure 2, and detailed analyses are presented in figure 3. a gobal analysis of pser, pthr, asp, and glu shows that phosphosites tend to be lost to asp and glu more frequently than cser and cthr, and this holds true for both likelihood (16.6% versus 12.1%, resp., however, although there is a tendency towards the gains of phosphosites from asp and glu, the observed differences are not significant (figure 2). when studied separately, phosphosites in ordered and disordered regions show the same global tendency to go toward phosphomimetic amino acids (likelihood: 17.5% versus 10.0% in ordered regions, p=0.058; 16.5% versus 13.7% in disordered regions, p=0.086, parsimony: 20.0% versus 8.1% in ordered regions, p=0.076; 16.7% versus 11.7% in disordered regions, p=0.110). further, we found that phosphosites are not preferentially gained from phosphomimetic amino acids in disordered regions, while there is a nonsignificant tendency for this type of transition in ordered regions (likelihood: 16.0% versus 15.7% in disordered regions, p=0.943; 18.8% versus 13.7% in ordered regions, p=0.294, parsimony: 14.1% versus 14.2% in disordered regions, p=1.000; 11.8% versus 10.2% in ordered regions, p=0.691). this suggests that the effect might be more important in ordered regions of proteins, as would be expected if these residues were playing structural roles. because the distinction between order and disorder reduces the number sites in each category and does not provide opposite results, we considered both regions simultaneously in the following analyses. we also examined which class of substitution could be contributing to this overall result (figure 3). we first found that pser and pthr that were gained after gene duplication follow trends that are in the expected direction although some of the comparisons are not statistically significant and other results are in the opposite direction (figure 3). however, this detailed analysis showed that pser is significantly more likely to evolve to glu than cser (11.6% versus 5.3%, p=0.008) while pthr evolves significantly more frequently to asp than cthr (9.8% versus 4.3% resp. evolutionary events such as gains and losses of phosphosites can lead to changes in protein regulation, thus rewiring the protein regulatory network of the cell. in the literature, there is evidence for gains of new phosphosites coming from negatively charged residues among orthologs [26, 27] as well as cases of losses of phosphosites to these amino acids. the biochemical properties of glu and asp mimic the ones of pser and pthr with the exception that their charge is not regulatable. these observations led us to hypothesize that coding sequence divergence of paralogous genes by neo- and subfunctionalization does not strictly involve the apparition or the partitioning of protein function. divergence in the regulatory control is well known at the transcriptional level [19, 46] but has not been specifically addressed at the posttranslational level. we tested this hypothesis on the complete set of wgd phosphoproteins of the budding yeast s. cerevisiae. using two different methods to infer the ancestral state of phosphorylated and nonphosphorylated ser and thr, we found that pser and pthr globally have a tendency to evolve from negatively charged amino acids in paralogous phosphoproteins compared to their nonphosphorylated counterparts. the tendencies observed are in agreement with our hypothesis and with the observations made by pearlman et al. across eukaryotes. however, the observed differences are not significant, which could be explained by a few nonexclusive scenarios. first, we are looking at a narrow evolutionary window (100 my), which contrasts with the analysis conducted by pearlman et al., who used aligned sequences from organisms spanning the entire tree of life. further, the mechanism proposed may apply primarily to few sites and in ordered regions of proteins. only few phosphosites in these regions could be analysed here since the majority of them are found in disordered regions, which reduces the statistical power of our analysis. because these nonfunctional sites are not under selective pressure, they may contribute to decrease the signal coming from functional sites. nevertheless, from our results, we can not rule out the possibility that gains of phosphosites are not more likely to derive from phosphomimetic residues after gene duplications. a larger sample size, the study of a time window of a different length and a better knowledge of the functional importance of phosphosites may be needed to provide a final answer. following the same approach, we examined whether phosphorylated residues, when lost, are more likely to be replaced by asp and glu than when nonphosphorylated equivalent residues are lost. we found that this is the case globally and also when considering individual cases for both pser and pthr; pser are more likely to be replaced by glu residues while pthr by asp residues. these results are in agreement with those from kurmangaliyev et al. who also showed that pser are more likely to evolve to phosphomimetic amino acids than cser in the divergence of orthologs between species. our results show that the evolutionary trajectories of pser and pthr provide a mechanism for paralogous protein divergence. our analyses support the hypothesis that divergence between paralogs can be generated by a loss of the posttranslational regulatory control on a function rather than by the complete loss of the function itself. indeed, the substitution of a phosphosite for an asp or a glu residue may block one paralog into a single constitutive functional state whereas the other one remains regulatable by protein kinases and phosphatases. the genetic code is organized in such a way that transitions between phosphorylatable and phosphomimetic amino acids involve a transition state with an amino acid that is not negatively charged, except for transitions between two asp and two ser codons that involve a tyr residue (figure 4). however, tyr is only rarely phosphorylated in yeast, and tyr residues are not phosphorylated by the serine/threonine kinases, which suggests that this path would not be favoured.. a non negatively charged intermediate could lead to a complete loss of the function that was performed by the negative charge and could thus be deleterious (figure 5(a)). here we propose that the relaxed constraints that follow a gene duplication event could provide the mean to reach this intermediate state and to go beyond (figure 5(b)). after gene duplication, when one of the duplicated copies is lost, the system is assumed to go back to its ancestral state, a process called nonfunctionalization. however, following our model, the duplicated copy could serve as a backup for a transition period, which would allow the other copy to reach a state that would have been unreachable otherwise [4850]. after the loss of the backup copy, the system would remain different from its ancestral state since the phosphorylation profile and thus the phosphoregulation of this protein has changed. the term nonfunctionalization may thus not be suitable for such cases. in the case of a wgd event, where the vast majority of the duplicated genes are eventually lost and are thought to return back to their ancestral state, these 2-step transitions could potentially lead to a great burst in the evolution of phosphoregulation. further studies at different time points following gene duplication would be needed to determine how important this mechanism could be for the evolution of phosphorylation networks.

gene duplication followed by divergence is an important mechanism that leads to molecular innovation. divergence of paralogous genes can be achieved at functional and regulatory levels. whereas regulatory divergence at the transcriptional level is well documented, little is known about divergence of posttranslational modifications (ptms). protein phosphorylation, one of the most important ptms, has recently been shown to be an important determinant of the retention of paralogous genes. here we test whether gains and losses of phosphorylated amino acids after gene duplication may specifically modify the regulation of these duplicated proteins. we show that when phosphosites are lost in one paralog, transitions from phosphorylated serines and threonines are significantly biased toward negatively charged amino acids, which can mimic their phosphorylated status in a constitutive manner. our analyses support the hypothesis that divergence between paralogs can be generated by a loss of the posttranslational regulatory control on a function rather than by the complete loss of the function itself. surprisingly, these favoured transitions can not be reached by single mutational steps, which suggests that the function of a phosphosite needs to be completely abolished before it is restored through substitution by these phosphomimetic residues. we conclude by discussing how gene duplication could facilitate the transitions between phosphorylated and phosphomimetic amino acids.

PMC3388353

pubmed-1102

histone acetylation and deacetylation by histone acetyl transferases and histone deacetylases is involved in the epigenetic regulation in human cells [1, 2]. recently, this post-translational modification has become a popular molecular target for cancer therapy. hdac inhibitors (hdacis) have demonstrated significant antitumor activity by hyperacetylation of nucleosomal histones resulting in reexpression of repressed genes that produce growth arrest, terminal differentiation, and/or apoptosis in carcinoma cells. valproic acid (vpa), an hdaci and an antiepileptic agent, causes marked decrease in proliferation of prostate cancer (pca) cells in vitro and significant reduction in tumor volume in vivo [4, 5]. multiple pathways including cell cycle arrest, apoptosis, angiogenesis, and senescence contribute to the antitumor effects of vpa. neuroendocrine (ne) cells are the third and minor epithelial cell type in prostate, in addition to the more abundant luminal secretory cells and basal cells. ne cells have dual properties of neurons and endocrine cells and are believed to be involved in the regulation, secretion and differentiation of other prostatic cells. small cell pca and prostatic carcinoid are relatively rare and are considered pure ne tumors with a poor prognosis. neuroendocrine differentiation thus has been suggested as a poor prognostic sign by some authors, but the exact role of ne differentiation of the prostate remains unclear, and its prognostic importance in prostate cancer still remains controversial [7, 9]. the characteristics of ne differentiation in pca are very much similar to those seen in patients who develop this histologic phenotype in non-small-cell lung cancer. ne cells in prostate express ne markers such as chromogranin a (cga), synaptophysin, b-tubulin, neural cell adhesion molecule (ncam or cd56), neuron specific enolase (nse), and so forth. ne cells can be generally identified by electron microscopy or immunohistochemical (ihc) staining with antibodies for ne markers. recently, some studies have documented increased neuroendocrine markers after in vitro treatment of prostate cancer cell lines with hdacis [9, 12] indicating neuroendocrine transdifferentiation. in contrast, studies done in neuroendocrine tumors such as carcinoid, pheochromocytoma, and small cell lung cancers have shown vpa and other hdacis to exert antitumor effects [1315]. vpa has been shown to promote apoptosis, reduce ne phenotype and expression of ne markers, and is suggested as a promising therapy for these tumors [16, 17]. thus the role of hdaci's in neuroendocrine differentiation still remains unclear and has thus warranted further investigation. the goal of this study is to carefully determine whether vpa induces ne differentiation in the pca cell lines, in vivo and in vitro, by studying a variety of markers associated with ne differentiation in numerous pca cell and tumor models. markers including cga, synaptophysin, and ncam were quantified by ihc in a tissue microarray (tma) format from several vpa-treated human pca cells grown in vitro and in vivo as tumor xenografts in nude mice. human prostate cancer cell lines lncap, pc-3, and du145 were obtained from american type culture collection (manassas, va), and c4-2 line was a gift from dr. all the cells were grown in rpmi 1640 with l-glutamine (cellgro, herndon, va) supplemented with 10% heat-inactivated fetal bovine serum (fbs; life technologies, inc., carlsbad, ca), 5 g/ml ciprofloxacin hydrochloride (u.s. biological, swampscott, ma), and 50 g/ml gentamicin (quality biological, inc., gaithersburg, md). cells were allowed to grow until 80% to 90% confluent and harvested with 0.05% trypsin/0.53 mmol/l edta (cellgro, herndon, va) before each subsequent passage. cells were resuspended in 1x phosphate-buffered saline (ph 7.4; biosource, rockville, md), mixed 1x with matrigel (bd biosciences, palo alto, california), and injected (1 10 per injection) subcutaneously into the lateral flanks of male athymic nu/nu mice. vpa (1 mol/l; vpa sodium salt; sigma, st. louis, mo) stock was made in pbs and filters sterilized through a 0.22 m filter. for in vitro experiments cell lines were treated with 0, 0.6, and 1.2 mm vpa for 14 days. medium was replaced every 48 hours with fresh medium containing vpa. for in vivo experiments, animals received 0.4% w/v vpa in drinking water. this has been shown to produce blood levels in mouse comparable to fda approved levels in humans. animals in treatment arm were treated for 35 days before excision of tumors. in in vivo experiments, chronic treatment implies to long-term treatment with regards to life span. we considered 35 days of treatment in nude mice (with life span of 1 year approx. in our experience) as long-term treatment. cells treated with different doses of vpa were harvested by trypsinization and resuspended with 5 volumes of cold lysis buffer (ripa buffer, cat #r0278, sigma, st. louis, mo) and supplemented with protease inhibitor cocktail (roche, indianapolis, in, usa). equal amounts of proteins were separated by sds-page and the resolved proteins transferred to nitrocellulose membrane. the membrane was blocked for an hour in blocking buffer [100 mm tris-hcl (ph 7.5), 150 mm nacl, 0.1% tween 20] with 5% nonfat dry milk and then incubated with rabbit antiacetylated histone h3 (upstate, charlottesville, va) overnight followed by antirabbit igg peroxidase conjugate (sigma, st. immunoreactive bands were detected using the enhanced chemiluminescence plus western blotting detection system (amersham biosciences, piscataway, nj) according to the manufacturer's instructions. anti-cip1/waf1/p21 mouse monoclonal igg (upstate, charlottesville, va), cga (lk2h10) mouse monoclonal antibody (santa cruz biotechnology, inc., santa cruz, ca), and antimouse igg peroxidase (sigma, st. louis, mo) were used to normalize protein loading. for in vitro models, cells were harvested and washed in pbs. resulting cell pellets were incubated for 1-2 hr in bouin's fixative (75% saturated picric acid, 20% formalin (40%), 5% acetic acid, rinsed with 70% ethanol, and dehydrated according to standard procedures with ethanol and xylene. cells were embedded in paraffin following 90 min of incubation in liquid paraffin at 60c. for in vivo models, tumors were excised and portioned on day 35. portions were either immediately frozen in liquid nitrogen and stored at 80c or fixed in buffered formalin and subsequently embedded in paraffin. a tissue microarray (tma) of the paraffin embedded materials was generated as described previously. each array block also contained control normal human prostate tissues and animal xenograft tissues such as bladder, kidney, lung and spleen. immunohistochemical stains for chromogranin a (clone lk2h10, ventana, tucson, az), synaptophysin (polyclonal, cell marque, rocklin, ca), and ncam/cd56 (123c3.d5, cell marque, rocklin, ca) were performed separately on sections cut from the tma. stained tma slides were scanned (at 20x magnification setting) using the aperio imaging system and the images were uploaded and viewed using tmaj [20, 21]. each array spot was then formed into a composite image for viewing and scoring on a personal computer monitor. the specimens showed a varying degree of staining intensity and percentage of cells staining. therefore strong intensity staining was scored as 3, moderate as 2, weak as 1, and negative as 0. for each intensity score, the percentage of cells with that score was estimated visually. a combined weighted score consisting of the sum of the percentage of cells staining at each intensity level was calculated for each sample, for example, a case with 50% strong staining, 20% moderate staining, and 10% weak staining would receive a score as follows: (50 3+20 2+10 1)=200. one way anova with post-hoc testing was done to evalauate differences in mean staining score between different groups. the most reliable method to assess ne differentiation in pca is the detection of cga in tumor cells. the ihc staining of sections constructed of cell lines treated for 14 days with vpa was not able to detect any expression of cga (figure 1(a)). in order to verify the absence of cga by the ihc in all the cell lines tested, we performed western blot analysis (figure 1(b)). results revealed cga expression in these cell lines; however, cga protein levels were reduced in a dose-dependent manner after vpa treatment. chronic in vitro treatment of c4-2 cells with vpa resulted in increased synaptophysin expression (mean weighted score 65(4) at 1.2 mm versus 34(4) at 0.6 mm (p =.002) and 18(4) at 0 mm (p<.001)). significantly increased expression was also found in pc-3 cells treated at 1.2 mm (mean weighted score 68(2) versus 10(2) in other two groups, p<.001). however, synaptophysin expression was not altered in lncap and du145 cell lines following vpa treatment (figure 2). chronic in vitro treatment of vpa increased the expression of ncam in lncap (weighted score 8(3) at 0 mm versus 40(3) at 0.6 mm, (p<.001); 40(3) at 0.6 mm versus 65(4) at 1.2 mm, (p =.002). in pc-3 cells, no expression of ncam was seen at 0 and 0.6 mm vpa, but slight expression was seen at 1.2 mm (mean weighted score 20(5)). none or very little ncam staining was seen in c4-2 and du145 at either dose (figure 3). we have shown previously that administration of 0.4% vpa in mouse drinking water can achieve plasma vpa levels similar to the levels obtained in human patients. vpa treatment at these levels was shown to induce acetyl h3k9, p21, and reduce tumor volume, thus confirming the pharmacologic activity of vpa. animals were sacrificed, and tumors were harvested on day 35. to investigate the effects of vpa on ne markers of pca tumors in vivo, we evaluated expression of ne markers by ihc on the excised tumors. ihc did not reveal any cga staining in either treatment or control arms in all cell lines (figure 4(a)). tmas from c4-2 tumors revealed decreased expression of both synaptophysin (mean weighted score 47(10) versus 15(5), p <.001) and ncam (44(9) versus 5(6), p =.002) in treatment arms (figure 4(b)). none of the other arms revealed any significant staining (weighted scores less than 30) for ncam or synaptophysin (figures 4(b) and 4(c)). thus vpa does not induce any ne markers in the physiologically relevant in vivo setting. ne cells are considered to be derived from local stem cells and are an example of normal, terminally-differentiated cells without proliferative activity. ne cells in tumor lesions are phenotypically similar to ne cells in normal prostate epithelium in terms of expression of neuropeptides and biogenic amines. furthermore, dual epithelial characteristics such as prostatic acid phosphatase and/or psa production and ne marker expression, such as cga, are frequently coexpressed in the malignant phenotype of ne cells. studies evaluating the role of focal ne differentiation in pca prognosis have reported varied results: some reports indicate a negative correlation with prognosis while some show little or no relationship to prognosis [10, 2328]. histone deacetylase inhibitors are a promising new class of cancer therapy which have antiproliferative and prodifferentiation properties. for prostate cancer thus vpa, which is capable of inhibiting hdacs classes i and iia, may be a good option for pca therapy. in preclinical models, vpa treatment leads to proliferation arrest and differentiation and apoptosis of cancer cells of various tissue origin, while nominal effects were reported in normal cells [2, 4, 5]. reported vpa to cause an increase in the secretion of nse in lncap cells (in vitro) which may indicate an ne differentiation. in order to better understand the role of vpa in possibly stimulating ne differentiation in pca cell models, we selected the clinically recommended panel of antibodies for the ihc investigation of ne cells in multiple pca cell lines and xenograft tumors. chromogranin a or parathyroid secretory protein 1 is a member of the chromogranin-secretogranin family and forms the major constituent in neurosecretory peptide containing dense core granules in ne cells. cga is highly expressed by cells of neuroendocrine origin, both normal and tumoral, functional and nonfunctional. while neuron specific enolase (nse) has also been used as an ne marker, it is known to be expressed in a variety of non-ne cells and tumors, which has led researchers to question its specificity [30, 31]. serum cga levels, on the other hand, have been reported to be better predictors of neuroendcocrine differentiation than nse [32, 33]. thus, cga now is widely regarded as an excellent and more specific marker of ne differentiation. in our study, cga expression was not detected by ihc in either control or treated groups in human prostate cell lines of lncap, c4-2, pc-3, and du145 in vitro or in vivo. western blotting, being more sensitive, revealed low cga expression in these cell lines; which reduced further with vpa treatment in a dose-dependent manner. histone acetylation and p21 induction (data not shown) confirmed that active vpa doses were achieved as we have previously demonstrated [5, 34]. our results are further corroborated by similar reduction in ne markers and ne morphology in ne tumors after treatment with hdacis [13, 14, 16]. have previously demonstrated cga to be an important neuropeptide promoting the growth of prostate cancer cells and its suppression leading to programmed cell death in multiple prostate cell lines. gong et al. later found antiapoptotic effects of cga to be dependent on a protein kinase b/akt (an antiapoptotic protein or prosurvival factor) mediated pathway. also hdacis have been known to downregulate akt phosphorylation in prostate cancer cells taken together, it suggests a link between hdaci's-mediated apoptosis and cga inhibition. further studies will be required to determine the contribution of cga and akt to the vpa therapeutic effect. synaptophysin and ncam are other specific and fairly sensitive markers for ne differentiation [38, 39]. in in vitro experiments, these markers showed varying trends (increased synaptophysin staining in c4-2 and pc-3 cells but unaltered in lncap and du145; increased ncam in lncap and pc-3 cells but unaltered in c4-2 and du145), and no consistent pattern was seen. in in vivo experiments, the staining did not reveal any significant expression of these markers in any of the xenografts except in c4-2 tumors where it revealed a downward trend on treatment. the findings in our study do not support any neuroendocrine differentiating role of vpa. on the contrary, cga, a very specific marker, synaptophysin and ncam showed some inconsistent induction following vpa treatment in some cell lines but, in vivo, vpa treatment did not induce any significant expression of any ne markers. 0.4% vpa in mouse drinking water can achieve plasma vpa levels similar to the therapeutic levels obtained in human patients. tmas from xenografts of different cell lines either did not stain for ne markers or had very little staining without any induction on vpa treatment. thus, our data clearly demonstrates that vpa does not induce ne differentiation of pca cells in the physiologically relevant in vivo setting .

valproic acid (vpa) is a histone deacetylase inhibitor that holds promise for cancer therapy. here, we investigate whether vpa treatment induces neuroendocrine differentiation of prostate cancer (pca). a tissue microarray of vpa-treated and untreated tumor xenografts and cell lines of human pca (lncap, c4-2, du145, and pc-3) were generated and were analyzed by immunohistochemical analysis (ihc) for ne markers chromogranin a (cga), synaptophysin, and ncam (neural cell adhesion molecule). western blot analysis for cga was performed to confirm the results of the tma. ihc analysis did not reveal any induction of cga, synaptophysin, or ncam in any xenograft after vpa treatment in vivo. in vitro, vpa treatment induced little synaptophysin expression in c4-2 and pc-3 cells and ncam expression in lncap and pc-3 cells. in the case of cga, vpa treatment decreased its expression in vitro in a dose-dependent manner, as determined by western blot analysis. thus our data demonstrates that vpa does not induce ne differentiation of pca cells in the physiologically relevant in vivo setting.

PMC2963803

pubmed-1103

secundum type atrial septal defect (asd) is one of the most common congenital heart defects that occur in adults.1) in the past, asd was closed surgically. percutaneous device closure of asd has been developed as an alternative treatment to surgery.2) the first percutaneous device closure of asd was performed in 1974.3) percutaneous device closure has several advantages over surgery, including less surgical morbidity, avoidance of a scar and reduced hospitalization duration.4) however, this method of closure is associated with rare early and late complications. we report a rare complication of silent and late device embolization of the asd occluder device into the right pulmonary artery, three months after implantation. a 16 year-old patient presented with dyspnea. clinical examination revealed normal vital parameters with a fixed split second heart sound and a 2/6 systolic ejection murmur heard best at the left upper sternal border. the patient was initially evaluated by transthoracic echocardiography (tte) and had a typical ostium secundum type asd. transesophageal echocardiography (tee) confirmed the presence of a moderately large sized secundum asd that measured 20 mm. the aortic rim was almost absent (2-3 mm) with other surrounding rims>7 mm (not thin). the length of the interatrial septum was 45 mm in the longitudinal plane and 48 mm in the shortaxis view. the 30 mm sizing balloon was positioned across the defect and measured by both quantitative angiography and tee at 21 mm. a 24-mm asd septal occluder device (occlutech figulla asd occluder n, international occlutech ab, helsingborg, sweden) was deployed with fluoroscopic and transesophageal echocardiographic guidance. before releasing the device, fluoroscopy and the " minnesota tug technique " cessation of flow across the interatrial septum was confirmed on tee prior to final deployment of device. tte was performed 24 hours, seven days and one month after the implantation and confirmed adequate device position with no significant residual shunting. at the third month physical examination, a fixed split second heart sound and a systolic ejection murmur chest roentgenogram showed the asd closure device in the area of the right pulmonary artery (fig. echocardiography showed device migration into the right pulmonary artery without any significant obstruction to forward flow into the right pulmonary artery (fig. when the patient was interviewed again, he had complained of mild chest discomfort for a short duration during lifting of a heavy object fifteen days prior to being seen. right ventriculography and fluoroscopy also showed embolization of the device into the right pulmonary artery (fig. 3). percutaneous removal of the device was not considered because of the position of the device in the right pulmonary artery. the patient was referred for surgical retrieval of the device and closure of the defect, and underwent median sternotomy under general anesthesia, while cardiopulmonary bypass was performed by aorta-bicaval cannulation. asd closure device was removed out of the right pulmonary artery through arteriotomy performed on the main pulmonary artery, and secundum type asd primary closure operation was performed through the right atriotomy. following surgical retrieval, the device was macroscopically intact (fig. there were no problems in the postoperative follow-ups; additionally there was no leakage from atrial septum in the follow-up echocardiography. surgical closure of an asd is the gold standard treatment regardless of the size and number of defects present in any clinical case.2)5) percutaneous transcatheter closure of asd is an established alternative treatment to surgical closure as it has lesser morbidity, shorter hospital stay, lack of a scar, and comparable rates of complications.4-6) however, percutaneous device closure is associated with rare early and late complications such as migration or embolization of the device, pericardial effusion, arrhythmias, thrombus formation on the device, and mitral regurgitation and vascular injury.4)7)8) the most frequent complication of percutaneous transcatheter closure of asd is device embolization with incidence ranging from 4% to 21%.9) embolization usually occurs within 24 hours and after that, it is rarely seen. factors relating to device embolization are associated with the type of device used, larger size of defect, thin rim of atrial tissue, mobility of device postimplantation, use of undersized device and deficiency or absence of aortic rim.2)4)7)8) the aortic rim is very important and a margin<5 mm may predispose to both early and late device embolization.2) our patient had a moderately large secundum asd and very small aortic rim (2-3 mm), the combination of which may have resulted in embolization of the device at a late period. another potential cause of late device embolism is acute change in intracardiac pressure due to physical strain. a sudden increase in afterload to the left heart in conjunction with diminished right heart filling (valsalva) may have favored the migration of the device to the right and subsequently to the pulmonary artery.10) ten weeks after the procedure, when the patient was lifting a heavy object, he had complained of mild chest discomfort for a short duration of time. the history of our patient suggests that an acute change in intracardiac pressure due to physical strain may have dislodged the device. therefore, we believed that both physical strain and small aortic rim were possible causes for device embolism in our patent. we routinely advise to avoid heavy lifting for 3 months in all asd patients who are treated with percutaneous device closure. stricter and longer duration of avoidance of heavy lifting should have been recommended for patients with increased risk of device embolism, as in our case. mashman et al.10) also recommended 6 months of avoidance from strenuous exercise for decreasing embolic risk. devices usually embolize in the main pulmonary artery.7) if the device embolizes to the pulmonary circulation and impedes pulmonary flow, it may lead to both acute volume and pressure overload of the right ventricular. according to the degree of pulmonary flow impairment, constitutional symptoms usually developed.2) in our patient, it was embolized to the right pulmonary artery. it is fortunate that the device position in the right pulmonary artery was in the longitudinal axis in our patient. because the pulmonary flow was not influenced by the embolized device, our patient was asymptomatic. if the device is embolized, percutaneous or surgical removal of the device is indicated.7) in our case, percutaneous treatment was not considered because of the orientation of the device in the right pulmonary artery, which precluded snaring the device and the chronicity of the implantation. device embolism, which is the most frequent complication of percutaneous transcatheter closure of asd, may also occur during late periods of post-implantation. in addition, longer duration of avoidance from physical straining must be recommended for patients who have high risk of device embolization.

percutaneous device closure of atrial septal defect (asd) is an alternative treatment to surgery. the main advantages of the percutaneous approach include avoidance of surgery, short procedure time and hospital length, in addition to comparable rates of complications. however, percutaneous device closure is associated with infrequent early and late complications including device embolization, air embolism, cardiac tamponade and thrombotic complications. we report a rare complication of silent and late device embolization of the asd occluder device into the right pulmonary artery, three months after implantation.

PMC3518714

pubmed-1104

small cell carcinoma of the bladder is a very rare and aggressive histological subtype, and accounts for less than 1% of all bladder tumors.its management is challenging because it presents in the same way of other more frequent histological types, but with a high metastatic power. the diagnosis demands that the pathologist be suspicious and accurate in the analysis of the fragments of a transurethral bladder resection (tur). multimodal treatment, including radical cystectomy, chemotherapy and radiation therapy should be initiated as soon as possible for a chance of cure and to improve survival. this kind of carcinoma presents metastasis and has a poor prognosis. in the present article we report a case of a male patient with small cell carcinoma of the bladder and the development of the condition, and we aim to show the most current management of this tumor, which has no consensus for treatment in the international literature for being extremely rare. patient jhc, male, 61 years old, came to the medical service with a complaint of hematuria and hypogastric pain for one year. the urinary tract ultrasound revealed an intravesical tumor, and he was submitted to bladder tur, with a conclusive report for small cell carcinoma of the bladder. faced with the diagnosis, the attending team chose to perform chemotherapy (received four sessions of cisplatin, gemcitabine and paclitaxel) (figure 1). figure 1field with the presence of multiple mitoses, salt-and-pepper nuclei when referred to our service, he was submitted to thorax and abdomen computerized tomography (ct) that showed a 6.2x6.0x5.5 cm neoplasm on the left anterolateral wall of the bladder, suggesting invasion of the prostatic urethra. the patent was then submitted to radical cystectomy, with a bricker ileal derivation procedure, performed uneventfully, lasting 5 hours, with no need for blood transfusion. it is important to underscore that the time between the last chemotherapy and surgery was 2 months. the pathology report of the surgical specimen proved small cell carcinoma of the bladder with extravesical extension, perineural and vascular infiltration, and one lymph node affected (left obturator) out of 16 dissected. the patient had pneumonia, was on antibiotics and was discharged 29 days after surgery. he was referred to oncology to discuss adjuvant therapy which was not initiated, because the patient died 4 months after surgery due to pulmonary thromboembolism (figure 2). the first report of small cell carcinoma of the bladder was made in 1981 by cramer et al. since then, approximately 600 cases were registered in the international literature. it is characterized by its high aggressiveness and poor prognosis, and by the development of metastic disease in about 67% of patients. the small cell carcinoma of the bladder usually affects individuals of the same age, sex and presents the same symptoms and morphology of urothelial carcinoma. that is why it is a diagnostic challenge, depending only on the skills of the pathologist to differentiate it from urothelial carcinoma, which beside the factors already mentioned, has the same radiological aspect of small cell carcinoma of the bladder. thus, recommendations are based on retrospective studies, reports of individual cases, and protocols for small cell lung carcinoma. frequently, it presents with mixed histology.molecular studies show a common origin for small cell carcinoma of the bladder and urothelial carcinoma, when coexisting. however, management should be different, since it frequently presents metastases and has a poor prognosis. the pathological diagnosis of this kind of tumor is challenging and requires that the pathologist use immunohistochemical techniques for histological confirmation. as they are histologically identical, the world health organization standardization for small cell lung carcinoma is used. it comprises the following criteria for diagnosis of small cell carcinoma of the bladder: presence of group of small cells with scarce cytoplasm, few organelles, salt and pepper chromatin and high rate of mitoses (> 10 mitoses/10 high power fields). on immunohistochemistry, these tumors express quite an amount of neurospecific enolase, chromogranin, synaptophysin and n-cam (cd-56). the presence of one or more markers allows to establish the diagnosis of neuroendocrine tumor. pathological staging is based on the consensus for urothelial carcinoma of the bladder (figure 3). figure 3marker cd-56 that characterizes neuroendocrine tumors isolated therapies whether tur, partial cystectomy or radiation therapy radical cystectomy is considered the best method to eliminate small cell carcinoma of the bladder completely, but it alone is believed to only change survival in stage i and ii tumors. reviewed 64 cases and concluded that in patients submitted to radical surgery compared to those treated with combined treatment (whether only chemotherapy or radiation therapy or both as adjuvant), there was no increase in survival. in contrast, chemotherapy adjuvant to radical cystectomy resulted in a favorable prognosis in other studies, including meta-analyses. another alternative is neoadjuvant chemotherapy, recommended by the md anderson cancer center, which reported a 5-year disease free survival in 36% of the group submitted to radical cystectomy alone and of 78% in the group submitted to chemotherapy neoadjuvant to surgery. on the other hand, a canadian group reported ten patients with pt3-t4, n0 lesions with chemotherapy, attaining complete remission in nine of them. the 2-year survival rate for this group was 70% and, 44% in 5 years. another similar series reported four patients treated with chemotherapy followed by radiation therapy who survived 27 to 60 months. the advantage of this treatment is sparing the organ. therefore, it is a less invasive treatment when compared to radical surgery, which is related to important rates of morbidity and mortality. patients with metastatic disease should receive systematic chemotherapy, and the most common treatment regimens are platinum-based (cisplatin and etoposide, carboplatin, etoposide and cyclophosphamide) (figure 2). given the extremely aggressive and rare disease, little is known about pathogenesis and molecular biology. data on the ideal approach for this kind of tumor are scarce, showing the importance of reporting such cases and, in this way, defining the best diagnostic and treatment methods. o carcinoma de clulas pequenas da bexiga um subtipo histolgico muito raro e agressivo, correspondendo a menos de 1% de todos os tumores de bexiga.sua abordagem torna-se desafiadora, pois se apresenta da mesma forma que outros tipos histolgicos mais frequentes, porm com alto poder metasttico. o diagnstico exige suspeio e preciso do patologista na anlise dos fragmentos de resseco transuretral (rtu) de bexiga. o rpido tratamento multimodal, incluindo cistectomia radical, quimioterapia e radioterapia, deve ser institudo o mais precocemente possvel, para haver chance de cura e melhora da sobrevida.esse tipo de carcinoma apresenta metstase e tem prognstico ruim. neste artigo, relatamos o caso de um paciente do sexo masculino com carcinoma de clulas pequenas de bexiga e sua evoluo, assim como buscamos trazer o que h de mais atual no manejo desse tumor que, por sua extrema raridade, no apresenta consenso para o tratamento na literatura mundial. paciente jhc, masculino, 61 anos de idade, procurou servio mdico com queixa de hematria e dor hipogstrica h um ano. evidenciada tumorao intravesical em ultrassonografia do aparelho urinrio, foi submetido a rtu de bexiga, cujo laudo foi conclusivo para carcinoma de clulas pequenas de bexiga. frente a esse diagnstico, a equipe que o acompanhava optou por realizar quimioterapia (recebeu quatro sesses de cisplatina, gencitabina e paclitaxel) (figura 1). figura 1presena de mltiplas mitoses no campo, ncleos em sal e pimenta ao ser encaminhado ao nosso servio, foi submetido tomografia (tc) de trax e abdome, a qual mostrou neoplasia de 6,2x6,0x5,5 cm em parede anterolateral esquerda da bexiga, com sugestiva invaso de uretra prosttica. foi, ento, submetido cistectomia radical, com derivao ileal bricker, procedimento realizado sem intercorrncias, com durao total de 5 horas, sem necessidade de transfuso sangunea. importante ressaltar que o tempo da ltima quimioterapia para a cirurgia foi de 2 meses. o laudo anatomopatolgico da pea cirrgica comprovou carcinoma de clulas pequenas de bexiga com extenso extravesical, infiltrao perineural e vascular presentes, comprometimento de um linfonodo (obturatrio esquerdo) em 16 dissecados. no ps-operatrio apresentou pneumonia, sendo submetido a antibioticoterapia e recebendo alta hospitalar 29 dias aps a cirurgia. foi encaminhado oncologia para discusso de tratamento adjuvante, que no foi iniciado, pois o paciente faleceu 4 meses aps a cirurgia devido a tromboembolismo pulmonar (figura 2). o primeiro relato de carcinoma de clulas pequenas de bexiga foi feito em 1981 por cramer et al. desde ento, foram registrados aproximadamente 600 casos na literatura mundial. caracterizado por sua alta agressividade e mau prognstico, bem como pelo desenvolvimento de doena metasttica em cerca de 67% dos pacientes. o carcinoma de clulas pequenas da bexiga urinria costuma atingir pessoas da mesma idade, sexo e apresentar os mesmos sintomas e morfologia do carcinoma urotelial. por isso, um desafio diagnstico, dependendo apenas da habilidade do patologista em diferenci-lo de carcinoma urotelial, que, alm dos fatores j citados, apresenta o mesmo aspecto radiolgico do carcinoma de clulas pequenas de bexiga. assim, recomendaes so baseadas em estudos retrospectivos, relatos de caso individuais e protocolos para carcinoma de clulas pequenas de pulmo. frequentemente, apresenta-se com histologia mista.estudos moleculares mostram origem comum entre o carcinoma de clulas pequenas de bexiga e o carcinoma urotelial, quando coexistentes. no entanto, seu manejo deve ser diferente, pois, frequentemente, apresenta metstases e tem prognstico ruim. o diagnstico anatomopatolgico desse tipo de tumor desafiador e exige do patologista o uso de tcnicas de imuno-histoqumica para a confirmao histolgica. como so histologicamente idnticos, no diagnstico de carcinoma de clulas pequenas de bexiga utilizada a padronizao da organizao mundial da sade para carcinoma de clulas pequenas de pulmo, composta dos seguintes critrios: presena de grupos de clulas pequenas com citoplasma escasso, poucas organelas, cromatina em sal e pimenta, e alta taxa de mitoses (> 10 mitoses/10 campos de alto poder). na imuno-histoqumica, esses tumores expressam muita enolase neuroespecfica, cromogranina, sinaptofisina e n-cam (cd-56). o estadiamento patolgico feito com base no consenso para carcinoma urotelial de bexiga (figura 3). figura 3marcador cd-56, que caracteriza tumores neuroendcrinos terapias isoladas seja a rtu, a cistectomia parcial ou a radioterapia apresentam benefcio apenas em casos especiais de doena em estgio inicial. cistectomia radical considerada o melhor mtodo para remover o carcinoma de clulas pequenas de bexiga completamente, mas acredita-se que ela sozinha s altera a sobrevida em tumores de estgios i e ii.cheng et al. revisaram 64 casos e concluram que, em pacientes submetidos cirurgia radical comparados queles tratados com terapia combinada (seja apenas quimioterapia e radioterapia ou ambas em adjuvncia), no houve aumento da sobrevida.em contrapartida, quimioterapia adjuvante cistectomia radical resultou em prognstico favorvel em outros estudos, incluindo meta-anlises. outra alternativa a quimioterapia neoadjuvante, recomendada pelomdanderson cancer center, o qual relatou sobrevida de 5 anos sem doena em 36% do grupo submetido cistectomia radical isoladamente e de 78% no grupo submetido quimioterapia neoadjuvante cirurgia.de maneira semelhante, a radioterapia neoadjuvante tambm mostrou-se eficiente. por outro lado, um grupo canadense tratou dez pacientes com leses pt3-t4, n0 com quimioradioterapia, obtendo remisso completa em nove deles. a taxa de sobrevida desse grupo no perodo de 2 anos foi de 70% e, em 5 anos, de 44%.outra srie na mesma linha relatou quatro pacientes tratados com quimioterapia seguida de radioterapia que sobreviveram de 27 a 60 meses. a vantagem desse tratamento a preservao do rgo. portanto, trata-se de terapia menos invasiva quando comparada cirurgia radical, a qual est relacionada a importantes taxas de morbidade e mortalidade. pacientes com doena metasttica devem receber quimioterapia sistemtica, sendo os esquemas teraputicos mais comuns os baseados em platina (cisplatina e etoposida, carboplatina, etoposida e ciclofosfamida) (figura 2). por se tratar de doena extremamente agressiva e rara, pouco se conhece da patognese e da biologia molecular. h escassez de dados para abordagem ideal desse tipo de tumor, mostrando a importncia de relatar tais casos e, desta forma, definir melhor os mtodos de diagnstico e tratamento.

small cell carcinoma of the urinary bladder is an extremely aggressive and rare tumor. even though small cell carcinoma most commonly arises from the lungs there are several reports of small cell carcinoma in extrapulmonary sites. due to its low frequency there is no well-established management for this disease. we report the case of a 61 year-old man with small cell carcinoma of the bladder who underwent radical cystectomy following neoadjuvant chemotherapy. we also reviewed the literature for the optimal treatment strategy.

PMC4946818

pubmed-1105

ten isoforms of voltage-gated na channels have been identified that vary in tissue distribution, structure, biophysical properties, and sensitivity to neurotoxins (table 1; chahine et al., 2005). in standardized nomenclature, the nine confirmed members with>50% common amino acid identity in the transmembrane and extracellular loop regions have been designated as nav1.1 through nav1.9. the prefix nav indicates the chemical symbol of the principal permeating ion (na) with the principal physiological regulator (voltage; catterall et al., 2003). the tenth isoform has not yet been fully identified because it has not been functionally expressed. however, this isoform plays an important role in the detection of body fluid na levels and the regulation of salt intake (watanabe et al., at least eight of the mammalian subunits are expressed in the nervous system: nav1.1, nav1.2, nav1.3, and nav1.6 are widely expressed in the central nervous system (cns) while nav1.7, nav1.8, and nav1.9 are preferentially expressed in the peripheral nervous system (pns; black et al., 1996). gene location and distribution of na channels subunits in subpopulations of drg sensory neurons.*small- (< 25 m) and large-diameter (> 30 m) drg neurons. primary sensory neurons in the dorsal root ganglia (drg) give rise to afferent nerve fibers that convey information about thermal, mechanical, and chemical stimulations from peripheral tissues to the cns. these neurons express a unique combination of tetrodotoxin-sensitive (ttx-s) and tetrodotoxin-resistant (ttx-r) na currents that produce the rapid rising phase of action potentials. much of what is currently known about the na channels expressed in sensory neurons is derived from electrophysiological studies of cultured drg neurons (cummins et al. small-diameter drg neurons (< 25 m) are the cell bodies of unmyelinated c-fiber nociceptors that preferentially express ttx-r na currents. this contrasts with the myelinated large-diameter (> 30 m) neurons typically associated with low-threshold a-fibers that predominately express ttx-s na currents. primary sensory neurons express a variety of na channel isoforms that display properties similar to the endogenous ttx-s (nav1.1, nav1.2, nav1.6, nav1.7) and ttx-r (nav1.8, nav1.9) na currents observed in these neurons (black et al., 1996; dib-hajj et al., 1998; amaya et al., 2000; ho and oleary, 2011). in vivo, most na channel subunits are associated with one or more auxiliary subunits (isom, 2002). four distinct isoforms (1, 4) and two splice variants (1a, 1b) have been identified (table 2). they share a common structure (chahine et al., 2005) consisting of a single membrane spanning domain, a small intracellular c-terminal domain, and a large extracellular n-terminal domain incorporating an immunoglobulin-like fold similar to that of cell adhesion molecules (figure 1; isom, 2001; yu et al., 2003) they share an identical n-terminal domain but have a novel c-terminal domain resulting from intron retention (kazen-gillespie et al., 2000; na channel subunits can be broadly classified based on sequence homology and molecular interactions with subunits. the 1, 1a b, and 3 subunits have similar amino acid sequences and form non-covalent interactions with subunits (isom et al., 1992; this contrasts with the 2 and 4 subunits, which are best characterized as closely related (sharing 35% amino acid sequence), and which are covalently linked to subunits via a disulfide bridge (yu et al., 2003). in vivo na channel subunits are believed to form heteromultimeric complexes consisting of one non-covalently associated (1, 3) and one covalently (2, 4) linked subunit (catterall et al. depending on the composition of the subunit, these interactions have been shown to modulate the gating kinetics, voltage-dependence, and cell surface expression of the associated subunits (catterall, 2000). subunits also function as adhesion molecules that interact with cytoskeleton proteins, the extracellular matrix, and other molecules that regulate cell migration and aggregation (yu and catterall, 2003; brackenbury et al., 2008). schematic representation of a typical subunit, consisting of an nh2-terminal (n) containing an ig loop and the 1a splice site, a cooh-terminal (c) and a transmembrane-spanning segment. voltage-gated na channels are important determinants of sensory neuron excitability, and changes in the expression and gating properties of these channels have been implicated in the development of neuropathic pain (cummins et al., 2007; immunohistochemistry and in situ hybridization studies have shown that all four isoforms of subunits and both slice variants are present in drgs (kazen-gillespie et al., 2000 ;, 2001; qin et al., 2003). given the close physical and functional interactions between and subunits, it is not surprising that these auxiliary subunits are also important contributors to pain sensation (isom, 2001). however, the precise role of these subunits in nociception and neuropathic pain has not been fully elucidated. it has been convincingly demonstrated that the 1 subunit regulates the expression and gating properties of na channels and thereby modulates the electrical excitability of both nerves and muscles (chahine et al., 2008). immunohistochemistry and transcript analyses have shown that the 1 subunit is differentially expressed in subpopulations of primary sensory neurons (oh et al., 1995; black et al., 1996; takahashi et al., 2003; zhao et al., 2011) 1 is abundantly expressed in intermediate- and large-diameter (> 30 m) drg neurons but is present at comparatively low levels in small-diameter (< 25 m) neurons. the preferential expression of 1 subunits in medium and large neurons suggests that these subunits may contribute significantly to the excitability of low-threshold a-fibers but play a reduced role in small-diameter nociceptors. this is consistent with rodent models of nerve injury where 1 expression is not significantly altered, suggesting that these subunits do not contribute significantly to the development of neuropathic pain (shah et al. the co-expression of 1 subunits with sensory neuron nav1.7 and nav1.8 na channels in xenopus oocytes accelerates current kinetics and produces a hyperpolarizing shift in steady-state inactivation (vijayaragavan et al., 2001). in addition, 1 selectively increases nav1.8 current density but has no effect on nav1.7 expression. these findings indicate that 1 subunits regulate both the gating and cell surface expression of sensory neuron na channels in an isoform-specific manner. more recent work using mammalian cell lines revealed a twofold increase in nav1.81 peak current density and hyperpolarizing shifts in both activation and inactivation (zhao et al., 2011). studies on subunit chimeras showed that the intracellular c-terminus, but not the membrane spanning or extracellular domains of 1, was critical for retaining the functional regulation of nav1.8 gating (zhao et al., 2011). the role of 1 subunits in sensory neuron excitability has been addressed using scn1b null mice (lopez-santiago et al., 2007). the 1 knockouts exhibit numerous neuronal deficits, including symptoms of epilepsy and ataxia consistent with a broad distribution of this subunit in the cns (chen et al. the 1 knockout produces a slight reduction in persistent na current associated with small changes in the amplitudes and gating properties of the predominant ttx-s and ttx-r na currents (lopez-santiago et al., 2011). overall, the subtle 1 regulation of drg na channels coupled with the low level expression in small-diameter neurons and the absence of change in models of nerve injury are inconsistent with the idea that 1 subunits contribute significantly to the development of neuropathic pain. there are two splice variants of the 1 subunit, the 1a subunit in the rat and 1b subunit in humans (kazen-gillespie et al., 2000; these variants have n-terminal domains that are identical to that of the 1 subunit, but have novel c-terminals resulting from intron retention. the retained 1b intron codes for a novel membrane spanning and intracellular domain that shares little sequence homology with 1 (17%) or 1a (33%). when co-expressed in oocytes, the 1b subunit increases peak nav1.2 currents twofold but does not alter the current kinetics or gating properties of the channels (qin et al. the 1a subunit is highly expressed during embryonic development but decreases after birth (kazen-gillespie et al., 2000). western blotting analyses have revealed that 1a is expressed in the heart, brain, spinal cord, and drgs. when co-expressed in chinese hamster ovary (cho) cells, the 1b subunit produces a 2.5-fold increase in nav1.2 current density and a slight depolarizing shift in activation (<3 mv), but no change in steady-state inactivation or current kinetics. 1a appears to preferentially increase the cell surface expression of nav1.2 channels, a feature it shares with the parent 1 subunit. these findings suggest that 1b regulation may involve the homologous n-terminal domain that is common to the 1 and 1a variants. the 2 subunit is widely expressed in drg neurons of all sizes (coward et al., 2001; takahashi et al., 2003) and throughout the cns, including the spinal cord, cerebral cortex, and cerebellum (gastaldi et al., 1998). nav1.2 channels expressed in xenopus oocytes result in currents that display abnormally slow activation and inactivation kinetics (auld et al., 1988; krafte et al., co-expressing the 2 subunit induces more rapid activation and inactivation, which is consistent with a shift of nav1.2 channels from a slow to a fast mode of gating (isom et al., 1995). the slow gating observed in oocytes contrasts sharply with the properties of nav1.2 channels expressed in cho (west et al., 1992) and tsa201(oleary, 1998; qu et al., 2001) cell lines, where rapid kinetics similar to those of native tissues are typically observed. in addition to changes in current kinetics, co-expressing the 2 subunit in oocytes results in a hyperpolarizing shift in nav1.2 inactivation (2 mv) and a twofold increase in peak current (isom et al.,, this contrasts with results from tsa201 cells, where the 2 subunit produces small depolarizing shifts (34 mv) in nav1.2 activation and inactivation but no changes in current kinetics or recovery from inactivation (qu et al., 2001). this suggests that 2 regulation of nav1.2 depends on the host cells used for expression, which may be related to differences in cellular genetic background, post-translational protein modification, or regulation by endogenous signal transduction pathways (west et al., 1992; qu et al., 2001 recent work has focused on 2 subunit regulation of na channel isoforms that are preferentially expressed in sensory neurons. the co-expression of nav1.8 and 2 subunits in xenopus oocytes results in a relatively modest depolarizing shift in inactivation (4 mv) but no change in activation, current kinetics, or peak na current (vijayaragavan et al., 2004). subsequent studies of nav1.82, nav1.62, and nav1.32 channels expressed in mammalian cells largely confirmed these findings, demonstrating little or no effect of 2 on voltage-dependence, kinetics, or current density (cummins et al., 2001; zhao et al., 2011). similar results have been observed in preliminary studies of heterologously expressed nav1.72 channels (ho et al., 2011). overall, the 2 subunit appears to weakly regulate many of the voltage-gated na channels expressed in sensory neurons. this contrasts with studies of null mice, where the knockout of the 2 subunit is associated with reductions in ttx-s na current amplitude, mrna, and protein (lopez-santiago et al., 2006). this suggests that 2 expression in drg neurons increases ttx-s na current amplitude and accelerates current kinetics, effects that are not widely observed in co-expression studies. the underlying cause of this discrepancy is not known. one possibility is that 2 subunits in native drg neurons interact with endogenous proteins or are the target of signal transduction processes that are not reconstituted in heterologous expression systems. this possibility has gained credence from studies showing that the expression of nav1.3 in drg cells results in a depolarizing shift in activation and faster recovery from inactivation compared to nav1.3 channels expressed in hek293 cells (cummins et al., 2001). interactions with endogenous subunits or other cell-specific proteins could account for the observed differences in gating properties. alternatively, the apparent differences in na channel function observed in knockout and heterologous expression studies may stem from the compensatory upregulation of related subunits and na channel isoforms in null mice (chen et al. additional studies of the changes in and subunit expression that occur in 2 null mice, or the development of conditional 2 knockouts that reduce the opportunity for subunit compensation, may shed light on the apparent discrepancy between the in vivo and in vitro effects of 2 subunit regulation. several studies have examined the contribution of 2 subunits to the development of pain behaviors in rodent models of nerve injury. a study investigating subunit expression using rt-pcr and in situ hybridization found that 2 mrna levels in drg neurons are not significantly altered following peripheral nerve injury (takahashi et al., 2003). however, subsequent studies of 2 protein expression using immunohistochemistry and western blotting revealed that the 2 protein is upregulated following nerve injuries (pertin et al., 2005). 2 upregulation has been observed in both injured and uninjured sensory neurons, suggesting that the 2 subunit contributes to the excitability of both these populations. this possibility is supported by studies showing that the 2 knockout decreases the expression of ttx-s na channels in drg neurons (lopez-santiago et al., 2006). importantly, the mechanical allodynia associated with peripheral nerve injury is attenuated in 2 null mice, which is consistent with a role for this subunit in the development of neuropathic pain (pertin et al., 2005). in situ hybridization has shown that 3 subunit mrna is highly expressed in small- (< 25 m) and medium-diameter (2545 m) drg neurons and to a lesser extent in large-diameter (> 45 m) neurons (shah et al., 2000, 2001). the cellular distribution of 3 expression extensively overlaps that of ttx-r nav1.8 and nav1.9 channels, which are primarily expressed in nociceptors (akopian et al., 1996; sangameswaran et al., 1996 fiber nociceptors following chronic constriction (shah et al., 2000), spared nerve ligation, and sciatic nerve transection (takahashi et al., 2003), and in medium-diameter a fibers in the streptozocin rodent model of diabetes (shah et al., 2001). the upregulation of 3 observed in animal models of nerve injury is consistent with the increase in 3 protein in human drg neurons following avulsion injuries (casula et al., 2004). the preferential expression of 3 subunits in small drg neurons and their upregulation in models of nerve injury support the idea that 3 is an important contributor to both acute and chronic pain. 3 subunits also appear to play a major role in the development of neuropathic pain. chronic constriction injury and sciatic nerve axotomy have been shown to induce an increase in ttx-s na currents (cummins and waxman, 1997) that has been linked to the enhanced expression of nav1.3 channels in small- and medium-sized drg neurons (waxman et al., 1994; dib-hajj et al. the injury-induced increase in nav1.3 expression is paralleled by a similar increase in 3 mrna and protein levels (shah et al. heterologous expression studies have shown that co-expressing the 3 subunit produces depolarizing shifts in nav1.3 activation and inactivation, faster recovery from inactivation, and slower current kinetics (cummins et al., one possibility is that the upregulation of nav1.3 channels and 3 subunits may be an attempt by the neurons to compensate for the injury-induced decrease in the expression of nav1.8 and nav1.9 channels (dib-hajj et al., 1996, 1999; sleeper et al., 2000). replacing the slowly gating ttx-r nav1.8 current with the more rapid ttx-s current of nav1.33 channels is predicted to reduce the action potential threshold and promote high-frequency firing, thereby contributing to the hyperexcitability of injured drg neurons (cummins et al., 2001). however, immunohistochemical analysis suggests that nav1.3 channels are preferentially upregulated in medium to large size drg neurons after nerve injury (kim et al., 2001; fukuoka et al., 2008) and therefore may not extensively overlap with nav1.8 channels primarily expressed in small-diameter nociceptors. early studies of nav1.8 channels expressed in xenopus oocytes found that co-expressing 3 increases na current density and produces a hyperpolarizing shift in activation (shah et al., 2000). this contrasts with later studies showing that co-expressing 3 in oocytes produces a depolarizing shift in nav1.8 inactivation but no change in current density (vijayaragavan et al., 2004). studies on nav1.8 expressed in mammalian cells revealed that 3 causes a 31% decrease in peak current density but no change in activation or steady-state inactivation (zhao et al., 2011). collectively, these findings suggest that co-expressing the 3 subunit either has no effect or reduces nav1.8 current density, without altering voltage-dependence or gating kinetics. similar findings have been reported for the 3 regulation of nav1.6, a rapidly gating ttx-s na channel that is preferentially expressed at the nodes of ranvier of peripheral nerve fibers (krzemien et al., 2000; tzoumaka et al., 2000; ulzheimer et al., 2004) and in large-diameter sensory neurons (black et al., 1996; fukuoka et al. heterologous expression studies have indicated that co-expression with the 3 subunit does not alter the peak current density, current kinetics, or voltage-dependence of nav1.6 channels (zhao et al., the mature 4 subunit protein has a large extracellular ig-like fold, a single membrane spanning segment, and a short cytoplasmic c-terminal domain that is structurally similar to those of the 13 subunits. 4 shares high amino acid identity (35%) with 2 and includes an extracellular unpaired cysteine that enables 4 to covalently associate with na channel subunits via disulfide bonds (yu et al., 2003). the 4 subunit is highly expressed in drgs and at lower levels in the brain and spinal cord. at the cellular level, 4 is abundantly expressed in large-diameter sensory neurons and at lower levels in intermediate and small neurons (yu et al., 2003). the co-expression of 4 with the nav1.2 channel in tsa201 cells produces a hyperpolarizing shift in activation (7 mv) but no change in steady-state inactivation (yu et al., 2003). the effects of 4 on the gating properties of the ttx-s nav1.6 and ttx-r nav1.8 channels have also been studied (chen et al., 2008; zhao et al., 2011). co-expressing 4 produces pronounced hyperpolarizing shifts in activation (17 mv) and steady-state inactivation (9 mv) of nav1.8, and a smaller hyperpolarizing shift (8 mv) in nav1.6 activation (zhao et al., 2011). 4 subunits produce similar negative shifts in the activation of the neuronal nav1.1 and skeletal muscle nav1.4 channels (yu et al., 2003; aman et al., the consistent hyperpolarizing shift in activation produced by the 4 subunit suggests that this subunit may modulate neuronal excitability by causing na channels to activate at more hyperpolarized voltages. resurgent currents were initially described in purkinje neurons where they were found to promote the discharge of multiple action potentials in response to brief depolarizations (raman and bean, 1997, 1999). subsequent work found that the open-channel block at depolarized voltages coupled with rapid unblocking and slow na channel deactivation at voltages near threshold produce an inward na current (resurgent current) that transiently depolarizes the neurons (grieco et al., 2005). these resurgent currents increase excitability and are believed to underlie the high-frequency firing of purkinje neurons (raman and bean, 2001). the cytoplasmic c-terminus of the 4 subunit has emerged as a likely candidate for the endogenous blocking particle responsible for resurgent currents (grieco et al., 2005; bant and raman, 2010). this possibility is supported by studies showing that sirna targeting scn4b abolishes resurgent currents in cultured cerebellar granule cells and that the exogenous application of synthetic 4 c-terminal peptide (4154-167) blocks na currents and induces resurgent currents in inactivation-impaired purkinje neurons. resurgent currents are substantially reduced in purkinje neurons isolated from nav1.6 null mice, indicating that these channels play an important role in the production of resurgent currents (raman et al., 1997). however, persistent resurgent currents have been reported in the subthalamic nucleus and purkinje neurons isolated from nav1.6 null mice, suggesting that other na channel isoforms may also produce these currents (do and bean, 2004; grieco and raman, 2004). the role of subunits in the generation of resurgent currents has been further investigated in vitro. co-expressing the 4 subunit does not induce resurgent currents in heterologously expressed nav1.1 (aman et al., 2009), nav1.6 (zhao et al., 2011), or nav1.8 (zhao et al., 2011) channels, indicating that the association with the intact 4 subunit alone is insufficient to produce resurgent current. additional proteins or post-translational modifications appear to be required to recapitulate the resurgent currents observed in native neurons (grieco et al., 2002). these endogenous proteins and regulatory pathways may be highly specific to particular cell types and may thus be absent in the mammalian cells lines that are widely used for heterologous expression and cellular electrophysiology studies (theile and cummins, 2011). alternatively, 4-mediated resurgent currents may involve cell-specific enzymatic cleavage by proteases such as -site amyloid precursor protein cleaving enzyme 1 (bace1) or other proteases that are required to produce the functionally active blocking peptide (huth et al., 2011). resurgent currents are observed in 40% of large-diameter (3550 m) drg neurons and are substantially reduced in neurons from nav1.6 null mice (cummins et al., 2005)., 1996; fukuoka et al., 2008; ho and oleary, 2011) and 4 subunits (yu et al., 2003), further supporting the idea that nav1.64 channels may play a role in these currents. this contrasts with small-diameter drg neurons that do not routinely produce resurgent currents (cummins et al., 2005) and that express low levels of nav1.6 (black et al., 1996; fukuoka et al., 2008; ho and oleary, 2011) and 4 subunits (zhao et al., 2011). resurgent currents have recently been implicated in the neuronal hyperexcitability and pain associated with paroxysmal extreme pain disorder (pepd; jarecki et al., 2010; theile and cummins, 2011). iv linker of the nav1.7 channel reduces the rate of inactivation, increases the persistent na current, and induces a depolarizing shift in steady-state inactivation (fertleman et al., 2006 ;. these changes are consistent with impaired fast inactivation, which increases the probability of open-channel block, a suspected contributor to the generation of resurgent currents (grieco and raman, 2004). when heterologously expressed in cultured drg neurons, the nav1.7i1467 t mutant channel increases both the percentage of neurons displaying resurgent currents and the peak current amplitude (theile et al., 2011). computer simulations further support the idea that pepd mutations that alter nav1.7 inactivation induce resurgent currents in drg neurons that contribute to aberrant action potential firing and increased cellular excitability. the evidence supporting a role for resurgent currents in the development of neuropathic pain is compelling and warrants further investigation. all four isoforms (14) and both splice variants (1a, 1b) of subunits are broadly expressed in the pns. these subunits interact with many of the na channel isoforms in sensory neurons and alter the expression, voltage-dependence, and gating properties of these channels. subunits are differentially expressed in large-diameter mechanoreceptors (1, 4) and small-diameter nociceptors (3). this pattern of subunit expression suggests that these auxiliary subunits may differentially regulate voltage-gated na currents and the excitability of these neuronal populations. injury-induced changes in subunit expression and the altered functional regulation of the na channels expressed in sensory neurons contribute to the hyperexcitability and ectopic firing of sensory neurons. current evidence suggests that subunits are important contributors to sensory physiology, nociception, and neuropathic pain. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

voltage-gated sodium na+ channels are membrane-bound proteins incorporating aqueous conduction pores that are highly selective for sodium na+ ions. the opening of these channels results in the rapid influx of na+ ions that depolarize the cell and drive the rapid upstroke of nerve and muscle action potentials. while the concept of a na+-selective ion channel had been formulated in the 1940s, it was not until the 1980s that the biochemical properties of the 260-kda and 36-kda auxiliary subunits (1, 2) were first described. subsequent cloning and heterologous expression studies revealed that the subunit forms the core of the channel and is responsible for both voltage-dependent gating and ionic selectivity. to date, 10 isoforms of the na+ channel subunit have been identified that vary in their primary structures, tissue distribution, biophysical properties, and sensitivity to neurotoxins. four subunits (14) and two splice variants (1a, 1b) have been identified that modulate the subcellular distribution, cell surface expression, and functional properties of the subunits. the purpose of this review is to provide a broad overview of subunit expression and function in peripheral sensory neurons and examine their contributions to neuropathic pain.

PMC3221288

pubmed-1106

the foot is the point of direct contact between the body and the surface below. therefore, muscle force generated from the toes and ankles may play an important role in maintaining stability. a limited number of studies have reported the association between toe grasping strength and postural control. for example, two studies investigated the age-related change in toe grasping strength in males and females and found that toe grasping strength is related to age and declines faster than handgrip strength with increasing age1, 2. in addition, handa and colleagues1 reported significant correlations between toe grasping strength and static balance with eyes open (r=0.443, p <0.01) as well as tolerance to falling forward (r=0.620, p<0.01). interestingly, postural sway behavior while standing improved following 8 weeks of toe grasp training (consisting of gathering a towel attached to a weight and passing small bags from one place to another) in older adults although the authors did not measure toe grasping strength3. perrin and colleagues4 reported that daily physical activity in older adults, even if never practiced earlier in their life, had a positive effect on balance control. gauchard and colleagues5 investigated the influence of two types of physical exercise (yoga and soft gymnastics vs. jogging, swimming, and cycling) on postural sway balance in older females and found that yoga and soft gymnastics appeared to have the best impact on postural control in simple postural tasks. one difference between these two types of physical exercise is how the foot contacts the ground surface during the exercise. foot muscles involved in toe grasping may be activated during relatively slow movements of physical activities such as yoga and soft gymnastics. thus, toe grasping strength may be associated with the duration and intensity of daily physical activity. the purpose of the present study was to test the hypothesis that daily physical activity probably contributes to toe grasping strength in middle-aged and older adults. fifty-seven japanese women between the ages of 52 and 78 years (mean age, 66.3 6.8 years) were recruited through printed advertisement and by word of mouth from the surrounding area of the university campus in chiba. in this study, female volunteers were chosen because a higher incidence of falls has been reported in japanese females than in japanese males7. all subjects were free of overt chronic disease (e.g., diabetes, angina, myocardial infarction, arthritic and neuromuscular disorders, cancer, stroke) as assessed by self-report following a general health examination. the main types of sports activities were walking (17 females) and yoga/tai chi (6 females). the study was conducted according to the declaration of helsinki and was approved by the ethics committee for human experiments of toyo gakuen university (2012-001). written informed consent was obtained from all subjects. subcutaneous fat thickness (ft) was measured using b-mode ultrasound (aloka ssd-2000, tokyo, japan) at 9 sites, as described previously8. the measurements were taken while the subjects stood quietly with their knees extended and relaxed. a 5-mhz scanning head was placed on the measurement site without depressing the dermal surface. body density was estimated from ft using an ultrasound-derived prediction equation8. percent body fat (% fat) was calculated from body density using brozek s equation9. fat-free mass (ffm) was estimated as total body mass minus fat mass. body mass and standing height were measured to the nearest 0.1 kg and 0.1 cm, respectively, using a height scale and an electronic weight scale. body mass index (bmi) was defined as body mass (kg)/height (m). 3361, takei, tokyo, japan), as described previously2. while barefoot, subjects were instructed to maintain a one-legged upright standing position on the dynamometer, put both hands on the wall in front of them, and hold the dynamometer grasping bar with their toes. the distance between the bar and the heel was adjusted to the foot size of each subject such that the distal phalanges of the great toe and fifth toe and the middle phalanges of the second to fifth toes could be placed on the toe grasping bar. subjects were allowed to perform one test trial, followed by 3 maximum trials, and the best values for right and left feet were averaged and used for data analysis. maximal toe grasping strength divided by body weight was calculated for evaluating relative toe grasping strength. test-retest reliability of toe grasping strength has been reported in a previous study10. maximum voluntary isometric strength of the knee extensors was determined using a biodex system 3 dynamometer (shirley, new york, usa). subjects were carefully familiarized with the testing procedures of voluntary force production approximately one week before testing. each subject was seated on a chair with the hip joint angle positioned at 85. the center of rotation of the knee joint of the right leg was visually aligned with the axis of the lever arm of the dynamometer, and the ankle of the right leg was firmly attached to the lever arm of the dynamometer with a strap. after a warm-up consisting of submaximal contractions, the subject was instructed to perform maximal isometric (mvc) knee extension at a knee joint angle of 80. a knee joint angle of 0 corresponded to full extension of the knee. if mvc strength for the first two trials varied by>5%, an additional mvc was performed. knee extension mvc divided by body weight was calculated for evaluating relative knee extension strength. during orientation, participants were shown how to attach the accelerometer (lifecorder ex, suzuken, nagoya, japan) on an elastic belt over their left or right hip and were instructed to record their daily physical activity for 30 days, beginning on the following day. if participants did not use the accelerometer for a couple of days during the testing period, they were requested to record their activity for additional days. to achieve>90% reliability for estimating the yearly physical activity in older adults,>30 consecutive observation days are required11. after the measurements were taken, the recorded activity level data were downloaded to a personal computer. the data were classified into different intensities using 10 activity levels, ranging from 0 to 9, based on the accelerometer signal. level 0 (corresponding to<0.06 g) denotes immobility, and levels 1 to 9 (corresponding to 0.06 g) denote subtle to vigorous movements. in this study, exercise intensity was categorized into one of 3 activity levels on the basis of the accelerometer signal: light physical activity (levels 13,<3 metabolic equivalents [met]), moderate physical activity (levels 46, 36 met), and vigorous physical activity (levels 79,>6 met) according to a previous study12. in addition, the total duration of each level of exercise intensity was calculated. participants were separated into two groups on the basis of daily step counts measured by an accelerometer: low (n=28,<8,000 steps per day) and high (n=29, 8,000 steps per day). before comparisons were made, dependent variables were tested for normality of distribution by the shapiro-wilk test. the difference between low and high groups was tested for significance by using unpaired student s t-tests, and if any variables were not normally distributed, the mann-whitney u test was used. pearson product correlations were performed to determine the relationships between accelerometer-determined physical activity level and relative maximum strength (divided by body weight) of toe grasping and knee extension. if any variables were not normally distributed, then spearman s rho correlation was used. because age was different between the two groups, partial correlations of relative strength with physical activity levels adjusted for age although the high group was approximately 5 years younger than the low group (p<0.01), bmi and body composition (% fat and ffm) were similar between the two groups. absolute and relative toe grasping maximal strength were greater (p<0.001) in the high group than in the low group. however, both absolute and relative knee extension strength were similar between the two groups. all 3 intensities (light, moderate, and vigorous) of physical activity were higher in the high group compared with the low group (table 1table 1.body composition, physical activity, and muscle strength in middle-aged and older womendaily step counts (steps/day)overalllow (< 8,000)high (8,000)n282957age, yrs69 (7)64 (6)66.3 (6.8)height, m1.53 (0.05)1.53 (0.06)1.53 (0.05)body weight, kg52.9 (6.1)51.7 (4.5)52.3 (5.4)body mass index, kg/m22.7 (2.9)22.1 (2.0)22.4 (2.5)body fat,% 27.3 (5.1)26.9 (5.2) 27.1 (5.1)fat-free mass, kg38.3 (3.1)38.2 (3.2)38.2 (3.2)muscle strengthfoot grasping, kg11.9 (3.1)14.9 (3.3)13.4 (3.5)knee extension, nm104 (28)106 (22)105 (25)relative muscle strengthfoot grasping/wt, kg/kg0.23 (0.06)0.29 (0.07)0.26 (0.07)knee extension/wt, nm/kg1.96 (0.48)2.07 (0.45)2.01 (0.46)physical activity, min/daylow48.3 (14.6)71.4 (19.1)60.1 (20.5)moderate10.6 (7.7)33.3 (13.7)22.2 (15.9)vigorous0.6 (0.9)2.4 (1.7)1.54 (1.65)low+moderate59.0 (17.2)104.7 (18.3)82.2 (29.1)moderate+vigorous11.2 (8.1)35.8 (14.6)23.7 (17.1)step counts, steps/day5,456 (1,588)10,406 (1,898)7,974 (3,041)significant difference from low group p<0.01, p<0.001. wt: body weight a negative correlation was observed between age and relative toe grasping strength (r= 0.480, p<0.001) and between age and relative knee extension strength (r=0.307, p <0.05). relative toe grasping strength correlated positively with light (r=0.320, p <0.05), moderate (r=0.345, p<0.01), and vigorous (r=0.296, p<0.05) physical activity. relative knee extension strength correlated positively with moderate (r= 0.298, p<0.05), and vigorous (r=0.358, p<0.01) physical activity, but not with light (r=0.203, p=0.131) physical activity. similarly, both toe grasping and knee extension strength correlated with light plus moderate physical activity as well as moderate plus vigorous physical activity (table 2table 2.pearsons and partial (adjusted for age) correlation coefficients between muscle strength and physical activity in middle-aged and older womenpearson s correlationpartial correlationgraspingknee exgraspingknee ex light+moderate0.4150.306*0.290*0.217 moderate+vigorous0.350 0.312*0.228 0.233 step counts0.4120.330*0.283*0.242*p<0.05, p<0.01. grasping, foot grasping strength/body weight; knee ex, knee extension strength/body weight). average step count also correlated with both toe grasping and knee extension strength (table 2). after adjusting for age, only the duration of light plus moderate physical activity and average step count correlated to toe grasping strength (table 2).*p<0.05, p<0.01. grasping, foot grasping strength/body weight; knee ex, knee extension strength/body weight in the present study, we tested our hypothesis that daily physical activity may contribute to toe grasping strength in middle-aged and older females. the primary findings of this study were that: 1) the high group (8,000 steps/day) had significantly greater toe grasping strength, but not knee extension strength, when compared with the low group (< 8,000 steps/day) strength, 2) toe grasping strength was significantly associated with daily step count, and 3) toe grasping strength significantly correlated with light plus moderate intensity physical activity, but not moderate plus vigorous intensity physical activity. it has previously been reported that accelerometer (or pedometer)-determined physical activity levels dramatically decrease later in life13,14,15. in japanese, for example, average yearly step counts were approximately 7,000 steps/day for ages 6574 and 5,000 steps/day for ages 758413. kitagawa et al.16 reported a mean value of 8,401 (sd 3404) steps/day in older japanese females aged 6187 years (mean age 71 6 years). similarly, yoshioka et al.17 reported an average number of 7,922 steps/day in middle-aged and older adults (females and males) aged 5069. physical activity levels of our subjects were similar to the previous studies with an average value of approximately 8,000 steps/day (mean and sd, 7,974 3,041) in middle-aged and older females (mean age 66 7 years). it is generally believed that participation in regular physical activities may be associated with greater maintenance of muscular strength. in the present study, active females (8,000 steps/day) had 26% higher toe grasping strength compared with females who were not as physically active (< 8,000 steps/day), while knee extension strength was similar between the two groups. furthermore, both knee extension and toe grasping strength correlated significantly to average step count, although the correlation coefficient between step count and toe grasping strength was only significant after adjusting for age. al.18 investigated the influence of physical activity on muscular strength of knee extensors, plantar flexors, and handgrip in females aged 20 to 89 years. they found that self-reported physically active females were stronger than physically inactive females when absolute strength of the leg muscles was normalized for body weight; however, knee extension strength at ages 6064, 6569, and 7074 were probably similar between the active and inactive females. leskinen et al.19 reported that active twins had 20% higher knee extension strength than their inactive co-twins, while the active twins had only 4% higher mid-thigh muscle cross-sectional area than that of the inactive twins. our findings in toe grasping strength support the previous studies, whereas the reasons for the difference in knee extension strength between the present and previous studies are not well known. one possible explanation is that most of the previous studies used questionnaires for evaluating the frequency and/or duration of a given type of physical activity during a typical week, and determination of physical activity profile based on questionnaires may or may not be accurate, especially regarding exercise intensity20,21,22. thus, this methodological concern may have affected the results reported by the previous studies. in the present study, toe grasping strength was associated with light plus moderate intensity physical activity. in terms of foot-ground contact time, foot muscles involved in toe grasping may be better activated during light/moderate intensity slow movements than during vigorous intensity fast movements although this may depend on footwear. a previous study examined the effects of low-intensity toe grasp training (which consisted of gathering a towel attached to a weight and passing small bags from one place to another) in older adults and found that postural sway behavior while standing improved following the training3. although that study did not measure the change in toe grasping strength, it is expected that muscular functions involved in toe grasping may be improved by relatively low-intensity exercise training. therefore, results from the present and previous studies together suggest that relatively low-intensity exercise would be suitable for improving toe grasping strength. another previous study investigated the effect of accelerometer-determined daily physical activity on lower body muscular power in adolescents23. the results showed positive correlations between muscular power and vigorous intensity physical activity but not with moderate or light intensity physical activity. in that study, the duration of vigorous intensity physical activity was approximately 14 minutes for female adolescents and 25 minutes for male adolescents. in the present study, the average duration of vigorous intensity physical activity was only 1.5 minutes in middle-aged and older females, and the effect of vigorous intensity exercise on knee extension strength appeared to be limited. therefore, for improving knee extension strength, the advantage of regular physical activity may depend on the intensity and duration of exercise. it is possible that older adults with high levels of physical activity in daily life have better balance control compared with less active individuals. although aoyagi et al.24 reported no significant association between body sway and level of daily physical activity, many intervention studies have revealed a number of factors that contribute to better balance25. in particular, gauchard et al.5 reported more improvement in static postural control with yoga/soft gymnastics (proprioceptive exercise) than with jogging/swimming/cycling (bioenergetic exercise). it has been reported that toe grasping strength is associated with static balance with eyes open as well as with tolerance to falling forward1. our results, along with those of previous studies, suggest that toe grasping strength may be a contributing factor to the connection between the effects of daily physical activity and balance control. several limitations of this study should be mentioned. because patterns of daily physical activity differ between women and men and our subjects were only women although the duration of light/moderate physical activity was associated with toe grasping strength, we did not consider the type of exercise performed during daily physical activity. additional research into these issues is needed. in summary, active middle-aged and older women had higher toe grasping strength compared with females who were relatively physically inactive. significant correlations were observed between toe grasping strength and accelerometer- determined physical activity levels, especially the duration of light plus moderate physical activity. these results suggest that toe grasping strength may be associated with the amount of light daily physical activity.

[ purpose] to test the hypothesis that toe grasping strength is associated with daily physical activity in older adults. [subjects] fifty-seven japanese women, aged 5278 years, volunteered. [methods] toe grasping and knee extension strength were measured. physical activity was also measured, using an accelerometer, and the total duration of each level of exercise intensity (light, moderate, and vigorous) and average step counts were calculated. subjects were separated into two groups on the basis of accelerometer-determined step counts: low (n=28,<8000 steps/day) and high (n=29, 8000 steps/day). [results] body mass index and body composition (% fat and fat-free mass) were similar between the two groups. absolute and relative toe grasping strengths (divided by body weight) were greater in high than in low. however, both absolute and relative knee extension strength were similar between the groups. relative toe grasping and knee extension strength correlated with all 3 intensities of physical activity and average step count. after adjusting for age, the duration of light plus moderate physical activity and average step counts correlated to toe grasping strength but not to knee extension strength. [conclusion] our results suggest that toe grasping strength may be associated with the amount of light intensity daily physical activity.

PMC4500006

pubmed-1107

breast cancer, the most common cancer in women worldwide, accounted for 1.7 million new cases in 2012, comprising a quarter of all new cancer cases. while traditional risk factors for breast cancer include age, family history of cancer, and reproductive and menstrual history, the national cancer institute also recognizes overweight, lack of physical activity, and consumption of alcohol as risk factors. metabolic syndrome (ms) is a cluster of pathophysiological disorders comprising central obesity, insulin resistance, high blood pressure, and dyslipidemia. reaven's definition of ms in 1988 was followed by definitions from the world health organization, national cholesterol education program's adult treatment panel iii (ncep atp iii), american heart association/national heart, lung, and blood institute, and the international diabetes federation. these criteria include the presence of three or more of the following: abdominal obesity (waist circumference 35 inches in women), triglycerides 150 mg/dl, high density lipoprotein cholesterol (hdl-c)<50 mg/dl, blood pressure (bp) 130/85 mmhg, and fasting glucose 110 mg/dl. ms is estimated to be prevalent in at least a quarter of the adults in the americas, in europe, and in india. ms has been identified as a risk factor for several cancers, particularly breast, pancreatic, colorectal, and prostate cancers [1015]. individual components of ms, for example, abdominal obesity, high blood glucose, high bp, high triglycerides, and low hdl, are positively associated with the development of certain cancers, most notably breast cancer [1627]. while studies show a positive association of breast cancer with diabetes [19, 2833] and obesity [16, 34, 35], others show a negative association with obesity in premenopausal women [3638]. mixed results also characterize hypertension [22, 23, 39, 40] and dyslipidemia [22, 41, 42] as risk factors for breast cancer. in addition, although individual components of ms may not be strongly associated with the development of breast cancer, their combination may elevate the risk [13, 14, 4356]. for example, ms may activate different molecular pathways through endocrine, metabolic, and immune cell changes, which in turn influence breast tumorigenesis. such pathways that enhance breast cancer cell proliferation and inhibit apoptosis include (1) increased levels of circulating estrogen, for example, estradiol [52, 54, 57], (2) higher levels of insulin [58, 59], (3) decreased level of circulating adiponectin, (4) increased plasma leptin concentration, and (5) increased production of proinflammatory cytokines, such as interleukin-6 and tumor necrosis factor alpha. previous epidemiologic studies on ms and breast cancer risk show contrary results. for example, only four [13, 14, 43, 51] of eight studies [13, 14, 43, 48, 51, 6264] reported a statistically significant association between ms and risk of breast cancer. this might invite a conclusion that the association between ms and breast cancer risk is unknown. however, such an inference would be based on the vote-counting approach, an approach that ignores the magnitude of the association. a recent systematic review and meta-analysis of ms and postmenopausal breast cancer found that ms was moderately associated with the risk of postmenopausal breast cancer. however, to the best of our knowledge, no meta-analytic research has addressed the conflicting results from individual studies of ms and breast cancer risk in all adult women. therefore, the purpose of this study was to use the aggregate data meta-analytic approach to examine the association between ms and breast cancer risk in women. the a priori inclusion criteria for this study were as follows: (1) observational studies using cohort (both prospective and retrospective), case-control, or nested case-control study designs; (2) studies examining the association between ms (presence of a cluster of three or more metabolic abnormalities) and breast cancer incidence, as defined by the authors; (3) studies with adult females 18 years of age as participants; (4) english-language studies published as journal articles, doctoral dissertations, or masters ' theses; (5) published and indexed studies up to june 30, 2012; and (6) studies reporting sufficient data (e.g., rate ratios, risk ratios, odds ratios, standardized incidence ratios, hazard ratios, or frequencies) for calculating a common effect size. neither lobular carcinoma in situ nor ductal carcinoma in situ breast cancer cases were excluded from the study. studies not meeting all inclusion criteria were excluded from this review. excluded studies were those that (1) were not published as full reports, such as conference abstracts and letters to the editors; (2) only examined individual components of ms; (3) measured the ms variables at time of cancer diagnosis; (4) used cancer mortality, rather than incidence, as the outcome; and (5) were published in a language other than english. a comprehensive and systematic search was conducted using four electronic databases: pubmed, cumulative index to nursing and allied health literature (cinahl), web of science, and proquest (from their commencement to june 30, 2012). since the term ms dates back to the late 1950s, with variations in use as early as the 1920s, the start dates of each of the databases were used as the commencement date for study search: web of science (1900), cinahl (1952), pubmed (1966), and proquest (1861). major keywords used in the search for potentially eligible studies included metabolic syndrome (insulin resistance syndrome, syndrome x) and breast cancer (neoplasm and breast). using the most recent publication, trials published as duplicate reports (parallel publications) an initial cut-off point for the inclusion of studies was not used given the difficulty in establishing such a point, as well as our concern about the potential loss of studies that met our eligibility criteria. at the first screening, one author (rb) screened all abstracts and selected articles for full-text examination. at the second level of the study selection process, two of the authors (rb and th) examined the full-text articles and then selected the included studies following mutual discussion and consensus. two of the authors (rb and th) reviewed every study selected and independently extracted data from studies onto electronic coding forms. attempts were made to contact authors of three of the original studies for missing information [13, 62, 64], but only one provided the requested information. after initial coding, the two coders (rb and th) reviewed each item for agreement. using cohen's kappa (k) statistic, the overall interrater agreement rate prior to correcting discrepant items was 0.96 for all included studies. risk of bias was assessed using a modified version of strengthening the reporting of observational studies in epidemiology (strobe) checklist. the items assessed included (1) study design, (2) adjustments for confounders, (3) selection of participants and their eligibility criteria, (4) measurement of predictor variables, (5) breast cancer diagnosis, (6) study size, (7) handling of missing data, and (8) reasons for nonparticipation of individuals at each stage of the study. a description of the criteria for risk of bias assessment is shown in table 1. two of the authors (rb and th) conducted all assessments, independently of each other. risk estimates were used to examine the association between ms and risk of breast cancer. these were derived from reported relative risks, odds ratios, hazard ratios, incident rate ratios, or standardized incidence ratios, together with corresponding 95% confidence intervals (cis), from the original studies. where necessary and possible adjusted risk estimates were pooled for analysis from multivariable models in the original studies. however, for two case-control studies that were included [14, 51], adjusted odds ratios were used because of the lack of the requisite data to convert odds ratios to rrs. all rr results were pooled using a random-effects model, an approach that incorporates between-study heterogeneity into the model. a z-score two-tailed alpha value 0.05 was considered to be statistically significant. in addition, 95% cis were calculated for each result from each study as well as for pooled estimates. an alpha level 0.10 for the q statistic was considered to be evidence of statistically significant heterogeneity. while somewhat arbitrary, i values of 25%, 50%, and 75% were considered to represent low, moderate, and high amounts of heterogeneity. publication bias was assessed using the trim and fill approach of duval and tweedie. in addition, rosenthal's fail-safe n test was used to compute the number of missing null studies that would be needed to nullify the overall pooled rr as being statistically significant. influence analysis was conducted with each study result deleted from the model once, in order to examine the effects of each on the overall pooled results. cumulative meta-analysis, ranked by year, was also conducted in order to examine the accumulation of results over time. a separate pooled analysis, limited to postmenopausal women, was conducted because studies show that ms in postmenopausal women increases the risk of breast cancer [13, 14, 43, 48, 51, 62]. in addition, pooled analyses were conducted with the following caveats post hoc: (1) deletion of results from two case-control studies because odds ratios were used instead of rr [14, 51], (2) deletion of results from studies that were not prospective cohort designs [13, 14, 51], and (3) limiting the results to studies that controlled for four or more of the important confounders (as listed in table 1) [14, 43, 48, 51]. given the potential for diabetes and diabetes medications to affect breast cancer risk, post hoc data analysis was also conducted with studies that included participants with diabetes and/or taking medications for diabetes, deleted from the model [14, 43, 64]. figure 1 presents a flow diagram of the selection of studies for the meta-analysis. of the 291 studies screened, 47 (16.2%) were selected for full-text review: 25 from pubmed [14, 4355, 64, 7483], 17 from the web of science [13, 39, 63, 8497], one from cinahl, and four from proquest [62, 99101]. eight (17.0%) of the 47 studies that underwent a full-text review met the eligibility criteria [13, 14, 43, 48, 51, 6264]. one article presented results for two independent cohorts; thus each cohort was treated independently. the study designs included four prospective cohorts [48, 6264], one retrospective cohort, one prospective nested case-control study, and two case-control studies [14, 51]. the baseline year for cohort inception ranged from 1983 to 2004, with average follow-up ranging between 2.7 and 13.5 years. six studies conducted analyses on postmenopausal women [13, 14, 43, 48, 51, 62]. the results of each cohort or case-control study were initially reported as a hazard ratio [13, 48, 63], incidence rate ratio [43, 62], standardized incidence ratio, or odds ratio [14, 51]. methods for exposure assessment, cancer identification, and control of confounders varied across the eight included studies (table 3). seven studies identified the outcome (breast cancer) through histological reports or medical reports or from a cancer registry [13, 14, 43, 48, 51, 62, 64], while one used self-report. only three studies examined invasive breast cancer cases [43, 48, 64]. one study also reported on the in situ breast cancer cases but there were only seven such cases in that study. another study analyzed all breast cancer cases (in situ and invasive) as well as invasive cancers separately, and results remained unchanged. all of the studies were considered to be at low risk for selection of participants and meeting eligibility criteria in addition to providing adequately powered sample sizes. out of eight studies, a majority were also considered low risk with respect to study design (six studies) and measurement of the outcome variable (seven studies). in terms of handling potential confounders, half the studies were low risk, three were high risk, and one was unclear risk. missing confounding variables included education, smoking status, alcohol use, family history of cancer, contraceptive use, or hormonal history. similarly, half the studies had objective measurements of predictor variables, while the remainder relied on self-report, and were consequently considered high risk. four studies deleted the participants with missing variables in their analyses (high risk), while two did not report how they handled missing data. lastly, six studies were considered high risk because they did not report the reasons for nonparticipation of subjects at each stage of follow-up. overall, a statistically significant increase of 47% in the risk for incident breast cancer was observed for adult females with ms (rr: 1.47, 95% ci, 1.151.87; z=3.13; p<0.002; q=26.28, p<0.001; i=69.55%) (figure 2). with the exception of one study, all other studies had rr in the direction of increased risk [13, 14, 43, 48, 51, 62, 64]. funnel plot results for potential publication bias are shown in figure 3. using the trim and fill approach that resulted in two imputations, the risk decreased by 16% but remained significant (rr: 1.31, 95% ci, 1.011.70). null studies would be needed to nullify the statistically significant association between ms and breast cancer risk in adult females. no statistically significant outliers were identified (p=0.060.82). with each study deleted from the model once, results remained positive and statistically significant (figure 4). the pooled rr fell within a range of 20% (rr=1.361.56) and none of the cis for the point estimates was less than 1.0. cumulative meta-analysis, ranked by year, revealed that results have been statistically significant since 2011 (figure 5). deleting the two case-control studies from the model, the rr for incident breast cancer for women with ms decreased by 18% but was still statistically significant with moderate heterogeneity (rr: 1.29, 95% ci, 1.0031.67; z=1.98; p=0.05; q=14.13, p=0.01; i=64.61%). when limited to studies with only prospective designs, the rr decreased by 30% but remained statistically significant with very low heterogeneity (rr: 1.17, 95% ci, 1.011.36; z=2.04; p=0.04; q=4.30, p=0.37; i=7.04%). when limited to postmenopausal women, breast cancer risk increased by 34% and was still statistically significant with high heterogeneity (rr: 1.81, 95% ci, 1.282.56; z=3.37; p=0.001; q=23.36, p=0.001; i=74.32%). when limiting the results to studies that controlled for four or more of the important confounders (as listed in table 1) [14, 43, 48, 51], breast cancer risk increased by 17% and was statistically significant with moderate heterogeneity (rr: 1.64, 95% ci, 1.232.20; z=3.34; p=0.001; q=8.55, p=0.07; i=53.21%). lastly, when data were analyzed after deleting from the model those studies that had participants with diabetes or taking medications for diabetes [14, 43, 64], the rr was slightly larger than the overall finding but the 95% ci included 1.0 (rr: 1.48, 95% ci, 0.922.4; z=1.61; p=0.11; q=17.4, p=0.02; i=76.96%). the purpose of this aggregate data meta-analysis was to examine the association between ms and the risk for breast cancer in adult females. overall, the results suggest that there was a modest positive association between ms and risk of breast cancer. this finding is strengthened by the robustness of results from other analyses. these include (1) examination for publication bias, (2) influence analysis with each study being deleted from the model once, (3) deletion of the two case-control studies with odds ratios from the overall model, (4) limiting the analysis to prospective designs, (5) including only postmenopausal women in the analysis, and (6) limiting the results to studies that controlled for four or more of the important confounders. in addition, the results from cumulative meta-analysis, ranked by year, indicate an increasingly statistically significant association since 2011. in contrast, despite a slightly increased mean rr, overlapping cis were observed when studies that included participants with diabetes or taking medications for diabetes were deleted from the model [14, 43, 64]. however, whether this reduced precision is the result of these specific characteristics or some other factors, for example, loss of power with a reduced number of studies, is not known. assessment for risk of bias indicated that a majority of studies were at low risk regarding study design, cancer assessment, and sample size. however, a majority were at high risk or unclear risk in terms of handling of missing data and nonparticipation of subjects at each stage of follow-up. it is suggested that future studies provide complete information on the handling of missing data and on the nonparticipation of subjects at each stage of follow-up. when limited to postmenopausal women, a stronger association between ms and breast cancer was observed. this association was stronger in case-control and retrospective cohort study designs compared to prospective cohort study designs. these findings concur with those from a recent meta-analysis on ms and breast cancer risk in postmenopausal women. several studies have shown that ms in this group increases the risk of breast cancer [43, 46, 102], suggesting that the etiology of breast cancer may differ among pre- and postmenopausal women. first, obese postmenopausal women produce higher levels of estrogens, which in turn increase the biologically available fraction of circulating estradiol by reducing plasma concentration of sex hormone binding globulin (shbg). low plasma shbg levels are associated with insulin resistance [104, 105] and other components of ms [106, 107]. second, adipose tissue produces two adipokines (cytokine-like factors), leptin and adiponectin, that affect breast cancer biology. higher plasma leptin levels are associated with obesity [54, 57, 109], insulin resistance [110, 111], and ms [112, 113]. leptin stimulates human breast cancer cell lines, whereas adiponectin acts protectively, inhibiting the growth of these cell lines [57, 108, 114]. third, insulin has been shown to have a mitogenic effect upon breast cancer cells in vitro through several mechanisms. moreover, low serum hdl-c concentrations indicate higher circulating bioactive estrogen levels, which in turn may stimulate target breast tissue. the increasing prevalence of ms and its association with breast cancer, among other comorbidities, point toward the critical need to develop public health strategies to manage ms. given the increasingly large global burden of metabolic risk factors, risk assessment tools can be developed which incorporate ms as a risk factor for breast cancer. healthcare providers will then be better equipped to identify high-risk women for primary and secondary prevention. this study has several strengths. first, to the best of our knowledge, this is the first systematic review and meta-analysis examining the association between ms and risk of breast cancer in all adult women. the overlapping meta-analysis on metabolic syndrome and breast cancer was confined to postmenopausal women only. second, a number of other analyses were performed which strengthened the robustness of findings. third, the results of this study provide direction for future research on this topic. these include (1) the different methods used to assess exposure, identify cancer, control for confounders, and define ms, (2) limiting studies to those published in english, which may have inflated the results, (3) the relatively small number of studies that met the inclusion criteria, (4) the inability of some studies to provide raw data for calculating the rr, (5) the different study designs employed, and (6) the varied populations studied, including those with diabetes and/or taking medications for diabetes. most notably and with respect to controlling for adiposity, a potential confounder, two of the included studies controlled for bmi [48, 62] but no information was available from the other studies with respect to controlling for bmi or any other obesity-related measures, including such measures of central obesity as waist circumference and waist-to-hip ratio [13, 14, 43, 51, 63, 64]. given the potential association between breast cancer and adiposity, it may be prudent for future studies to control for this potential confounder. to this point, kabat et al. suggested that some, but not all, studies have reported an association between increased central adiposity and an increased risk for postmenopausal breast cancer. the inclusion of such information in future studies may be important, given the potential differences in risk according to exposure and disease subtype. in order to inform and undergird a biological rationale for the observed positive association between ms and breast cancer risk in adult females, future research should comprise analyses based on a standard definition of ms and employ objective and standard biomarkers for assessing each ms component.. it would be helpful if future studies examined the relationship between ms and breast cancer risk separately in perimenopausal and premenopausal women since breast cancer in women may be estrogen-independent. along those lines, not all studies adjusted for hormone replacement therapy, a potential confounder. furthermore, they need to examine in situ and invasive cancers separately in relation to metabolic syndrome. finally, a focus on obese women with respect to ms and breast cancer seems appropriate. in conclusion, the overall results of this meta-analysis suggest that there is a modest positive association between ms and risk of breast cancer in adult females.

background. although individual metabolic risk factors are reported to be associated with breast cancer risk, controversy surrounds risk of breast cancer from metabolic syndrome (ms). we report the first systematic review and meta-analysis of the association between ms and breast cancer risk in all adult females. methods. studies were retrieved by searching four electronic reference databases [pubmed, cumulative index to nursing and allied health literature (cinahl), web of science, and proquest through june 30, 2012] and cross-referencing retrieved articles. eligible for inclusion were longitudinal studies reporting associations between ms and breast cancer risk among females aged 18 years and older. relative risks and 95% confidence intervals were calculated for each study and pooled using random-effects models. publication bias was assessed quantitatively (trim and fill) and qualitatively (funnel plots). heterogeneity was examined using q and i2 statistics. results. representing nine independent cohorts and 97,277 adult females, eight studies met the inclusion criteria. a modest, positive association was observed between ms and breast cancer risk (rr: 1.47, 95% ci, 1.151.87; z=3.13; p=0.002; q=26.28, p=0.001; i2=69.55%). no publication bias was observed. conclusions. ms is associated with increased breast cancer risk in adult women.

PMC4295135

pubmed-1108

in india, transmission of blood-borne viruses in unsafe health care is endemic.(1) poor sharps waste management and misconceptions about injection safety both contribute to injection equipment reuse in india. recent outbreak investigations suggest that many injection providers believe it is safe to reuse a syringe after changing the needle, that it is safe to reuse injection equipment to access an iv line, or that it is safe to reuse injection equipment on the same patient when reconstituting from a multidose vial, without sterilization.(2) these misconceptions are still reported in high-income developed countries and are thought to be prevalent in the developing world.(3) even more troubling, recycling of sharps waste for repackaging and resale is practiced on a large scale in india, uncovered recently in the investigation of a deadly hepatitis b outbreak.(4) the goal of this review is to evaluate the incremental cost-benefit of using the auto-disable syringe for all medical injections in india, in terms of prevented disability and mortality from hepatitis b, hepatitis c, and hiv infections. india's ministry of health issued an advisory to 24 governors and state health ministers to introduce auto-disable syringes for all medical injections in 2008 to prevent injection equipment reuse in health care settings. most states have not implemented this policy for curative injections, although auto-disable syringes are now used nationwide for immunization injections. most injections in india are not immunization injections, as injectable drugs are widely preferred over oral formulations.(5) the benefit of using only auto-disable syringes in a country with a low prevalence of blood-borne viruses has not been previously assessed. the total number of human immunodeficiency virus (hiv), hepatitis b virus (hbv) and hepatitis c virus (hcv) infections that would result from unsafe medical injections in india in 2010, barring the introduction of auto-disable syringes for all medical injections, is estimated following the mass action model used to develop the world health organization global burden of disease estimates.(6) the incidence of each blood-borne virus iv is a product of the size of the susceptible population ps, the probability of transmission in an unsafe medical injection for each virus ptv, and the number of contaminated medical injections performed nc, as given in equation (1). based on a systematic review of studies of needlestick accidents in health workers, the who estimates that the probability of hiv transmission in an unsafe medical injection is 1.2%, the probability of hbv transmission is 6% for hbeag-negative source patients and 30% for hbeag-positive patients, and the probability of hcv transmission is 1.8%.(6) i=psv ptv nc (1) the number of contaminated injections nc is calculated from the unsafe reuse rate pr, the prevalence of each virus in the general population pv (or the adjusted probability that used injection equipment will be contaminated with the virus), and the number of injections per person-year n, as given in equation (2). nc=pr pv n (2) because india's hiv epidemic is concentrated, the model for hiv is adjusted for associations between unsafe injection frequency and hiv prevalence across geographic and demographic segments of the population. the 2004 inclen injection safety report evaluated unsafe injection frequency in states and territories with varying hiv prevalence, and the national aids control organization of india reports hiv prevalence by state and territory.(78) the 20052006 demographic and health survey for india is used to relate unsterile injection frequency to hiv prevalence across age groups, gender and marital status, ethnic and religious groups, rural or urban residence, wealth and education level. risk factor analyses investigating an association between injections and hepatitis b, hepatitis c and incident hiv infections in india were identified in a systematic search using pub med. the population attributable fractions from these risk factor analyses are used to validate the model. the incremental cost per disability adjusted life year (daly) from each prevented hepatitis b, hepatitis c and hiv infection is calculated in a cost benefit assessment of the use of the auto-disable syringe, priced at $0.0425 in india. in a nationwide survey in 2004, the estimated injection frequency varied by recall interval from 2.9 to 5.8 injections per person-year, of which 32% had the potential to transmit blood-borne viruses.(7) the demographic and health survey for india indicates that 0.71% of unsafe injections given to adults were potentially contaminated with blood from an hiv-positive patient, before adjusting for associations between unsafe injection frequency and hiv prevalence. hiv prevalence in children under age 15 (29% of the population) is only 0.00028%.(9) in ecological regression, rural unsterile injection frequency is associated with hiv prevalence (p=0.036, r=0.30, =1.4). the selected demographic predictors of hiv prevalence are also associated with unsafe injection frequency in adults (p=0.010, r=0.23, =0.32). equation (3) reports the adjustments for the probability of an unsafe injection given to a susceptible patient being contaminated with hiv, where 1 is the adjustment factor for geographic region, 2 is the adjustment factor for demographic group, pa is the probability the injection is being given in an adult patient care setting and pc is the probability that the injection is being given to a child. the estimated probability that an unsafe injection given to an hiv-negative patient will be contaminated with blood from an hiv-positive patient is 0.85%. pv=0.71 (1+2) pa+0.00028 (1+2) pc (3) three studies of sexually transmitted disease (std) patients in india investigated an association between medical injections and incident hiv infections, with a median population attributable fraction of 12%. the modeled annual incidence of hiv from unsafe medical injections is 1021 cases per 100,000. in south india, the adult incidence of hiv was 50 cases per 100,000 in 2008.(10) thus, this mass action model attributes 2042% of hiv transmission in india to unsafe medical injections, a far larger fraction than that supported by risk factor analyses in patients with competing risks. hiv incidence in these std clinic attendees was far higher (5.18.2 per 100 person-years at risk) than the population average, suggesting that competing risks were greater in study participants than in the general population. the median population attributable fraction for chronic hepatitis b across five risk factor analyses to look at injection risks is 46%. this discrepancy suggests that either the modeled transmission efficiency of hepatitis b infections is a conservative estimate or the populations in which injections have been investigated as a risk factor for hepatitis b infection are at increased risk for unsafe injections. population attributable fraction of hepatitis infections linked to injections in india the median fraction of hepatitis c infections attributed to injections across five risk factor analyses, also shown in table 1, is 38%. the average annual incidence suggested by the age distribution of hepatitis c infection in india is 0.1%.(11) for hepatitis c, the modeled incidence is 0.030.05%, or 3050% of prevalent infections. following the age-adjusted global burden of disease model for south asia, these estimates predict that 352,000646,000 dalys from hepatitis b infection, 48,70081,200 dalys from hepatitis c infection and 2,605,0005,210,000 dalys from hiv infection would result which can be prevented by the use of the auto-disable syringe in 2010. estimating hiv, hbv and hcv incidence from the median population attributable fractions in epidemiological investigations instead, the incremental cost may be higher or lower at $3979 per daly. unsafe medical injections carry a risk of blood-borne virus transmission (hiv, hbv, hcv) when the injection equipment is reused without sterilization.(22) this has been shown in case control studies indicating an association between blood-borne virus infection and receipt of medical injections,(2325) with many of these studies demonstrating a dose response relationship(2628) corroborating evidence is available from blood-borne virus epidemics in populations of injection drug users(2931) and from the outcomes of accidental needlesticks in health workers.(3234) phylogenetic analysis of outbreak strains of nosocomial hiv, hbv and hcv have further confirmed the biological plausibility of unsafe medical injections as a vehicle for transmission.(3537) continuing unsafe injection practices in india have been well documented and remain a serious threat to public health.(53839) the present model of blood-borne virus transmission in india through medical injection equipment reuse has several important limitations. risk factor analyses investigating medical injection risks in india have not controlled for the full range of confounding variables thought to influence the association between medical injections and hiv, also likely to influence the association with hbv. model-based cost-benefit assessments of the introduction of auto-disable syringes for all medical injections are as uncertain as the model parameters, and the modeled patient mixing patterns only indirectly capture differences in patient populations at facilities with high and low levels of injection equipment reuse. taken together, however, model-based and empirical evidence of iatrogenic hiv, hbv and hcv transmission in india supports the introduction of auto-disable syringes as a cost-effective intervention. the estimated cost per daly averted is a fraction of average earned annual income in india by either estimation method, indicating that the introduction of auto-disable syringes for all medical injections is a cost-effective national policy for a low-income country with low prevalence of blood-borne viruses. this is an improvement from the incremental cost per daly averted estimated for south asia in 2003.(40) this review indicates that unsafe injections are associated with hiv at the individual level and at the population level in india. unsterile injections may serve as a bridge for hiv transmission between high-risk groups and the general population, as has been documented on a tragic scale in the town of jalal pur in pakistan.(41) among patients at std clinics, cyclic hiv transmission dynamics are possible, and high rates of hepatitis c infection in female sex workers are suggestive of a role for blood exposures in concentrated hiv epidemics.(42) nevertheless, given the mismatch between modeled and epidemiological estimates of hiv transmission from unsafe medical injections, the true extent of iatrogenic hiv transmission remains unclear. the most uncertain parameter in the model of blood-borne virus transmission is the transmission efficiency of each virus in a medical injection. the probability of hiv, hbv or hcv transmission in a contaminated medical injection may be similar to the risk from a needlestick accident. however, descriptive studies of needlestick accidents are few and the ranges of transmission efficiency estimates across these studies are wide. recently, it has been argued that rinsing injection equipment eliminates the blood-borne virus transmission risk.(43) however, a comparison of the inoculum volume in a needlestick injury (in which the needle is inserted but the plunger of the syringe is not depressed) and in an injection shows that after adjustment for both rinsing the syringe and injecting the remaining contents of the syringe, the transmission efficiency in an unsafe injection is probably of the same order of magnitude as the transmission efficiency in a needlestick accident.(44) some other model parameter estimates are less uncertain. the 95% confidence intervals around the injection frequency estimates on 2 weeks and 3 months recall intervals were 5.36.3 injections and 2.83.2 injections per person per year.(7) the 95% confidence interval around the proportion of medical injections with the potential to transmit blood-borne viruses was 2934%.(7) on the other hand, the adjustment for patient mixing patterns accounting for the association between hiv prevalence and exposure to unsafe medical injections was not empiric in the sense that demographic groups do not necessarily mix assortatively in clinical settings. moreover, the adjustments did not account for the population distribution of the demographic characteristics that predict unsafe injection frequency and hiv prevalence. the average registered medical practitioner reuses disposable syringes three times without sterilization, but this model assumes that blood-borne viruses are only transmitted from the first patient to the second.(1) multidose vial contamination when an injection needle is used to reconstitute medication is also prevented by the introduction of auto-disable syringes, but this has not been modeled. in these respects, the model does not account for deaths from septicemia, a common complication of unsterile injecting among injection drug users that results from bacterial contamination.(45) septicemia can result from injection equipment reuse irrespective of whether injection equipment has been used on a patient previously infected. in hospitalized patients with a bacterial culture positive intravenous catheter, 61% had a concomitant bacterial infection.(46) injection equipment prepared for reuse by boiling is frequently culture positive (e.g., 33% contamination rate in one assay in tanzania), and by implication injection equipment reused without sterilization is likely to be infectious.(47) in countries with a low prevalence of blood-borne viruses, the primary benefit of preventing injection equipment reuse may be the prevention of potentially serious bacterial infections. today, auto-disable syringes are required for all medical injections in india, burkina faso, the democratic republic of congo, nigeria, tanzania, and uganda, and the importation of syringes that are not auto-disable syringes is restricted in burkina faso and tanzania. these national injection safety policies address a patient safety crisis recognized even in high-income developed countries the widespread practice of injection equipment reuse without sterilization.(4849) the who recommends the use of auto-disable syringes for all immunization injections, and united nations children's fund (unicef) recommends that auto-disable syringes also be used for reconstitution. more extensive use of auto-disable syringes may be needed in countries with generalized hiv epidemics to prevent these nosocomial infections. in india, implementation of this policy still faces serious obstacles, as state ministries of health have not embraced the national government's advisory and the new minister of health has not pressed the issue. in kerala, karnataka and madhya pradesh, the policy has been opposed, although 2547% of injections in government health facilities in these states carry a risk of blood-borne virus transmission from patient to patient. only eight states and the central government owned hospitals have partially introduced auto-disable syringes for curative injections. hiv surveillance in india does not investigate iatrogenic risks, and awareness of medical injections as an important secondary hiv transmission route is not widespread.(50) as other developing countries move toward a zero-tolerance policy for iatrogenic hiv transmission, medical injection equipment reuse continues to contribute to widespread undetected blood-borne virus transmission in india. implementation of the national advisory to use auto-disable syringes for all medical injections could radically improve patient safety and reduce the burden of disease from chronic and stigmatizing infections in the most vulnerable segments of society.

background: unsafe medical injections are a prevalent risk factor for viral hepatitis and hiv in india. objectives:this review undertakes a cost benefit assessment of the auto-disable syringe, now being introduced to prevent the spread of hepatitis b virus, hepatitis c virus, and human immunodeficiency virus (hiv). materials and methods: the world health organization methods for modeling the global burden of disease from unsafe medical injections are reproduced, correcting for the concentrated structure of the hiv epidemic in india. a systematic review of risk factor analyses in india that investigate injection risks is used in the uncertainty analysis. results:the median population attributable fraction for hepatitis b carriage associated with recent injections is 46%, the median fraction of hepatitis c infections attributed to unsafe medical injections is 38%, and the median fraction of incident hiv infections attributed to medical injections is 12% in india. the modeled incidence of blood-borne viruses suggests that introducing the auto-disable syringe will impose an incremental cost of $4648 per disability adjusted life year (daly) averted. the epidemiological evidence suggests that the incremental cost of introducing the auto-disable syringe for all medical injections is between $39 and $79 per daly averted. conclusions:the auto-disable syringe is a cost-effective alternative to the reuse of syringes in a country with low prevalence of blood-borne viruses.

PMC3361807

pubmed-1109

nearly 233,000 new cases were estimated to be diagnosed in 2014 in the united states, representing 14% of all new cancer cases. although metastatic bc (mbc) is diagnosed in only 5% of cases, nearly 30% of bc patients with earlier stage tumors eventually develop metastases. this advanced disease is associated with worse prognosis than early stage bc, with 5-year survival rates around 25%. most bc samples overexpress hormone receptors (hr), including estrogen receptor (er) and/or progesterone receptor (pr) [4, 5], whereas human epidermal growth factor receptor 2 (her2) overexpression only occurs in 2030% of cases; thus, the most common bc subtype is hr+/her2. postmenopausal women, in particular, are more likely to have hr+/her2 tumors, as hr overexpression increases with age. the national comprehensive cancer network (nccn) treatment guidelines for hr+/her2 mbc recommend the use of endocrine therapy, particularly a nonsteroidal aromatase inhibitor (ai), as first-line treatment in postmenopausal women. since most patients eventually develop resistance to these therapies, the nccn guidelines recommend another endocrine agent when the first therapy fails. after the failure of three sequential endocrine therapies, if symptomatic visceral disease is present or if the cancer is rapidly progressing or immediately life-threatening chemotherapy is recommended, either as monotherapy with an anthracycline, taxane, antimetabolite, or other microtubule inhibitors or as combination treatment. however, observed real-world treatment patterns are not consistent with nccn guidelines, showing that many hr+/her2 mbc patients only receive one line of endocrine therapy before switching to chemotherapy for second-line treatment [9, 10]. chemotherapy is often accompanied by serious treatment side effects (grade 3/4), some of which have severe impact on the patients ' health-related quality-of-life (qol) [11, 12]. therefore, there is an unmet need for efficacious but more tolerable alternatives for the treatment of hr+/her2 mbc. a novel targeted agent, everolimus, was approved in july 2012 to be used in combination with endocrine therapy exemestane for the treatment of mbc in patients who failed nonsteroidal ai. the efficacy of everolimus/exemestane combinational therapy was demonstrated in the phase iii, double-blind, randomized, bolero-2 trial with significantly improved progression-free survival (pfs) compared to exemestane monotherapy [1315]. the efficacy of other everolimus-based therapies, such as combinational therapy of everolimus and tamoxifen, has also been examined in other clinical studies. currently, there is limited evidence regarding the comparative effectiveness of everolimus-based therapy and chemotherapy, two common treatment options for hr+/her2 mbc after initial failure of nonsteroidal ai. several recent studies presented in oncology conferences have indicated that everolimus/exemestane combinational therapy was associated with significantly longer survival compared to chemotherapies [17, 18], but these studies were based on small samples of patients or physician surveys. a network meta-analysis of previous mbc trials also found that everolimus/exemestane combinational therapy was associated with comparable or better pfs compared to some commonly-used chemotherapy; however, findings in clinical trial settings may not represent the real-world comparative effectiveness. in addition, this analysis also had inherent limitations due to indirect comparisons of treatments from different studies with heterogeneous designs and patient populations. the present study aims to address this knowledge gap and to compare the real-world effectiveness of everolimus-based therapy versus chemotherapy in treating hr+/her2 mbc patients in community-based oncology practices in the us. the everolimus-based therapy group includes everolimus monotherapy and combination therapy of everolimus and either endocrine therapy or chemotherapy; the chemotherapy group includes chemotherapy monotherapy, combinational therapy of chemotherapy agents, and combinational therapy of chemotherapy and endocrine therapy (excluding combination of chemotherapy and everolimus). the clinical outcomes of interest include time on treatment (tot), overall survival (os), and pfs. community-based oncologists/hematologists who treated postmenopausal women with hr+/her2 stage iv mbc were invited from a nationwide online panel of over 9,500 oncologists/hematologists to participate in the chart review study. physicians were eligible for participation if they had treated one or more postmenopausal hr+/her2 mbc patients who met all the patient selection criteria described below. each physician was asked to provide data for up to 10 patients, selected at random from their list of eligible patients. stratified sampling was used to ensure sufficient sample size in each treatment group (everolimus-based therapy or chemotherapy) and by line of therapy (first line, second line, third line, and above). a standardized electronic case report form (ecrf) the ecrf was extensively tested for logic and consistency and was pilot tested by three community based oncologists for clarity and understandability. the identity of physicians was blind to the authors and study sponsor, and vice versa. patient medical records were selected for abstraction if the patient was a postmenopausal woman who had bc recurrence or progression on or after a nonsteroidal ai in an adjuvant or metastatic setting and subsequently initiated an everolimus-based therapy or chemotherapy in any line of treatment for mbc between 07/01/2012 and 04/15/2013 (the first treatment initiated during this time period that met the aforementioned criteria was defined as the index therapy). patients who received everolimus-based therapies before their index treatment were excluded from the current analysis for both treatment groups. furthermore, physicians were required to have access to their patients ' mbc-related medical records from the first mbc diagnosis to the last follow-up (or death), while patients were required to not be enrolled in any clinical trials and to not have a history of primary malignancy of other nonbreast cancers (with the exception of nonmelanoma skin cancer and carcinoma in situ of the uterine cervix) within 3 years prior to the first mbc diagnosis date. tot was defined as the time from initiation of index therapy to either death or discontinuation of index therapy, whichever occurred first. patients without recorded death or discontinuation of the index therapy were censored at the last follow-up date. os was defined as the time from initiation of the index therapy to death from any cause. pfs was defined as time from initiation of index therapy to disease progression or death, whichever occurred first. progression was determined by the participating physicians with radiographic evidence or tests, physical exams, or assessment of symptoms or through the use of other methods. patients ' baseline characteristics at either the first mbc diagnosis or the initiation of index therapy were summarized. they included age, race, insurance type, disease status (de novo, recurrent with adjuvant endocrine therapy, recurrent without adjuvant endocrine therapy), adjusted charlson comorbidity index (cci) (excluding a score of 6 for metastatic cancer), eastern cooperative oncology group (ecog) performance status, number and sites of metastases, physician-classified tumor volume, prior chemotherapy in the mbc setting, and time from initiation of last adjuvant endocrine therapy to the first mbc diagnosis. patient baseline characteristics were compared between the everolimus-based therapy and chemotherapy groups using wilcoxon rank-sum tests for continuous variables and chi-square tests for categorical variables. patients treated with everolimus-based therapy and chemotherapy were compared for all study outcomes (tot, os, and pfs) using kaplan-meier (k-m) analyses and cox proportional hazards models. unadjusted comparisons between everolimus-based therapy and chemotherapy included (1) k-m curves generated for each study outcome and log-rank tests; (2) median estimates obtained for patients who were not censored for tot and pfs (e.g., for tot, medians were assessed among those patients who had completed their index treatment); (3) cox models used to compare each outcome using two approaches, one included treatment group assuming homogeneous comparative effectiveness across lines of therapy, and the other one included an interaction term between line of therapy and treatment group allowing heterogeneous comparative effectiveness across lines of therapy. adjusted comparisons between everolimus-based therapy and chemotherapy were conducted using multivariate cox models, controlling for patient baseline characteristics including age, race, insurance type, index therapy line, disease status, adjusted cci, sites of metastases, ecog performance status, prior chemotherapy in the mbc setting, and time from initiation of last adjuvant endocrine therapy to first mbc diagnosis. similar to the unadjusted cox regression analyses, one set of models adjusted for treatment group and the other adjusted for an interaction term between the line of therapy and treatment group. a total of 234 patients were included for the everolimus-based therapy group and 137 for the chemotherapy group. both groups had similar comorbidity burden, insurance coverage, ecog performance status, prior chemotherapy in the mbc setting, and time from initiation of last adjuvant endocrine therapy to first mbc diagnosis. patients treated with everolimus-based therapy were older (64 years versus 62 years, p=0.050) and more likely to be caucasian than patients treated with chemotherapy (64.1% versus 50.4%, p=0.009). compared to the chemotherapy group, everolimus-based therapy group had a lower proportion of liver, lung, and visceral metastases, a smaller number of metastatic sites, and a lower proportion of high-/medium-volume tumors (all p<0.05). overall, patients treated with everolimus-based therapy appeared to have less aggressive mbc than those treated with chemotherapy. everolimus-based therapy was associated with significantly longer tot than chemotherapy (log-rank test p<0.001; unadjusted hazard ratio (hr)=0.36, 95% confidence interval (ci): 0.270.47, p<0.001; table 2). median tot among patients who completed their index treatment was 8.6 months for everolimus-based therapy patients and 6.1 months for chemotherapy patients. multivariate-adjusted cox regression results showed that tot was significantly longer for everolimus-based therapy patients compared to chemotherapy patients (adjusted hr=0.34, 95% ci: 0.250.45, p<0.001; table 2). when further adjusted by the interaction between line of therapy and treatment group, tot was longer in patients who received everolimus-based therapy in all lines of therapy than patients who received chemotherapy in the same lines (adjusted first-line hr=0.30, 95% ci: 0.200.46, p<0.001; adjusted second-line hr=0.30, 95% ci: 0.170.52, p<0.001; adjusted third-line and above hr=0.45, 95% ci: 0.260.78, p=0.004; table 3). everolimus-based therapy was associated with significantly longer os than chemotherapy (log-rank test p=0.002; unadjusted hr=0.49, 95% ci: 0.300.78, p=0.003; table 2). multivariate-adjusted cox model results showed that os was significantly longer for everolimus-based therapy patients compared to chemotherapy patients (adjusted hr=0.37, 95% ci: 0.220.63, p<0.001; table 2). when further adjusted by the interaction between line of therapy and treatment group, os was significantly longer in patients who received everolimus-based therapy in first-line or third-line and above than patients who received chemotherapy in the same lines (adjusted first-line hr=0.35, 95% ci: 0.160.79, p=0.011; adjusted third-line and above hr=0.29, 95% ci: 0.120.75, p=0.010; table 3). everolimus-based therapy was associated with numerically longer pfs than chemotherapy, although the difference was only marginally significant (log-rank test p=0.057; unadjusted hr=0.74, 95% ci: 0.551.01, p=0.058; table 2). median pfs among patients who completed their index treatment was 8.5 months for everolimus-based therapy patients and 7.1 months for chemotherapy patients. multivariate-adjusted cox regression results showed that pfs was significantly longer for everolimus-based therapy patients compared to chemotherapy patients (adjusted hr=0.70, 95% ci: 0.500.97, p=0.033; table 2). when further adjusted by the interaction between line of therapy and treatment group, pfs was longer in patients who received everolimus-based therapy in third-line and above than patients who received chemotherapy in third-line and above, although the difference was marginally significant (adjusted hr=0.56, 95% ci: 0.301.02, p=0.059; table 3). for the treatment of hr+/her2 mbc, the nccn guidelines recommend three consecutive lines of endocrine therapy (including everolimus/exemestane combinational therapy for patients who meet the eligibility criteria for the bolero-2 trial) before chemotherapy. however, real-world studies report that many patients start chemotherapy earlier [9, 10], possibly due to concerns about endocrine resistance or visceral symptoms. as newer targeted therapies become available for hr+/her2 mbc, evidence of the comparative effectiveness of these treatments versus chemotherapy is important for the decision-making process of physicians and payers. the current retrospective chart review showed that in hr+/her2 postmenopausal women with mbc, patients receiving everolimus-based therapy tended to have less aggressive mbc, in particular visceral metastases, than patients receiving chemotherapy. everolimus-based therapy was associated with significantly longer os, pfs, and tot than chemotherapy after adjusting for the observed baseline characteristics; and the findings were largely consistent across lines of therapy. the present comparative effectiveness findings are consistent with recent studies showing that hr+/her2 mbc patients treated with everolimus-based therapy tended to have better os [17, 18] and pfs than those treated with chemotherapy. for example, using a small sample of hr+/her2 mbc patients, pouget et al. showed that everolimus plus endocrine therapy resulted in significantly longer os than chemotherapy for patients pretreated with two or fewer lines of therapies for mbc [17, 18]. (2013) conducted a network meta-analysis of available mbc clinical trials and concluded that despite differences in patient characteristics across studies, everolimus/exemestane combinational therapy was associated with the longer mean pfs until 20 months compared to commonly-used chemotherapies such as capecitabine, doxorubicin, paclitaxel, and vinorelbine. future head-to-head clinical trial evidence will help further assess the comparative efficacy of everolimus-based therapy compared to chemotherapy. a phase ii bolero-6 trial is actively recruiting patients and aims to compare the efficacy of chemotherapy (capecitabine monotherapy) with everolimus-based therapy in er+ mbc patients after recurrence or progression on prior nonsteroidal ai. primary findings of the study are expected in early 2016. while chemotherapy is recommended for more aggressive cancers, for the majority of hr+/her2 mbc patients who present a more manageable course of disease endocrine therapy presents a more favorable risk-benefit profile, particularly due to the treatment's similar efficacy but milder toxicity relative to chemotherapy. the current nccn guidelines recognize this and support subsequent treatment to prolong the benefits of endocrine therapies for as long as possible before initiating chemotherapy. together with recent studies [17, 18], the current findings suggest that everolimus-based therapy may be a more effective alternative to chemotherapy after initial failure of nonsteroidal ais. furthermore, previous studies have shown that while everolimus may result in some moderate toxicity [23, 24], the adverse events are generally manageable and the patient's health-related qol is similar to that of patients on endocrine therapy. this may make everolimus more preferable over chemotherapy, which is often accompanied by severe tolerability issues that result in worse health-related qol while on treatment [11, 12, 22]. the observed shorter tot among patients treated with chemotherapy may be due to oncologists ' preference of only prescribing a limited cycle of chemotherapy in order to avoid cumulative toxicity. future studies can compare real-world safety outcomes between the two treatments to better inform treatment decisions. first, inherent to observation studies, the findings may be subject to bias if important confounding factors are not identified and adjusted for in the study's analyses [27, 28]. in the current multivariable analyses, we adjusted for patient characteristics commonly recorded in medical charts and known to be prognostic for outcomes in mbc. these included characteristics such as age, race, insurance type, index therapy line, disease status, cci, sites of metastatic disease, ecog, prior chemotherapy in the mbc setting, and time from initiation of the last adjuvant endocrine therapy to the first stage iv mbc diagnosis. however, if patients treated with everolimus-based therapy are healthier based on unobserved measures of disease severity or have better coping skills, the results are likely to be biased in favor of everolimus. second, the frequency of patient follow-up could be different between the two treatment groups. the group with more frequent visits to oncologists was more likely to be identified to have an event (such as discontinuation and progression). these limitations can only be addressed with a well-conducted randomized-controlled trial. nonetheless, observational studies constitute a valuable and rich source of data, as they allow researchers to examine treatment effectiveness across patient groups in a large sample set and are directly reflective of (and applicable to) real-world clinical practice. in this retrospective review of hr+/her2 mbc patients from community-based oncology practices in the us, patients treated with everolimus-based therapy tended to have less aggressive mbc than patients treated with chemotherapy. after controlling for the observed baseline characteristics, everolimus-based therapy was associated with significantly longer os, pfs, and tot than chemotherapy. as this is an observational study, unobserved patient characteristics may affect study findings.

objective. to compare the real-world effectiveness of everolimus-based therapy and chemotherapy in postmenopausal women with hormone-receptor-positive/human-epidermal-growth-factor-receptor-2-negative (hr+/her2) metastatic breast cancer (mbc). methods. this retrospective chart review examined a nationwide sample of postmenopausal hr+/her2 mbc women in community-based oncology practices. patients received everolimus-based therapy or chemotherapy for mbc between 07/01/2012 and 04/15/2013, after failure of a non-steroidal aromatase inhibitor. overall survival (os), progression-free survival (pfs), and time on treatment (tot) were compared using kaplan-meier analysis and cox proportional hazards models adjusting for line of therapy and baseline characteristics. results. 234 and 137 patients received everolimus-based therapy and chemotherapy. patients treated with everolimus-based therapy tended to have less aggressive mbc than patients treated with chemotherapy. multivariate-adjusted cox models showed that everolimus-based therapy was associated with significantly longer os [hazard ratio (hr)=0.37, 95% confidence interval (ci): 0.220.63], pfs (hr=0.70, 95% ci=0.500.97), and tot (hr=0.34, 95% ci: 0.250.45) than chemotherapy. adjusted comparative effectiveness results were generally consistent across lines of therapy. conclusion. in this retrospective chart review of postmenopausal hr+/her2 mbc patients, treatment with everolimus-based therapy was associated with longer os, pfs, and tot than chemotherapy.

PMC4452841

pubmed-1110

the management of parkinson's disease (pd) is often enhanced by complementary rehabilitation strategies, such as exercise. for example, studies of resistance [13] and endurance [47] exercise training have improved balance, gait, postural stability, and physical function and reduced falling in people with pd. tai chi, a traditional chinese martial art that involves meditation and slow, graceful movements, is often recommended to reduce stress, improve mood, flexibility, physical function, and balance [810]. studies of tai chi in people with chronic disease including parkinson's disease and old people have supported the potential for benefit, with gains in the quality of life, postural stability, gait, physical function, immune function, cardiometabolic disease risk factors, and other health-related parameters [4, 1119]. however, research on the effectiveness of tai chi is contradictory due to inconsistencies in the implementation of the tai chi movements, limited samples, and the lack of randomized control trials. the purpose of this study is to investigate the effects of a randomized control trial of therapeutic tai chi training on improving the motor function and physical function of parkinson's disease patients. all participants gave informed consent in accordance with the procedures of the parkinson's disease center and the sports medicine center of the asan medical center. the participants of this study were 24 clinically stable patients with diagnosed idiopathic parkinson's disease recruited from the parkinson's disease center in asan medical center in seoul, republic korea. eligible participants met the following inclusion criteria: (1) hoehn-yahr stage 1 or 2 and (2) stable drug regimen. volunteers were excluded from the study if they had (1) severe cognitive impairment, (2) concomitant severe neurologic, cardiopulmonary, or orthopedic disorders, (3) specific contraindications to exercise, or (4) they had recently participated in any physiotherapy or rehabilitation program. the volunteers were screened for inclusion and exclusion criteria based upon the medical history and physical examination. participants were randomized to either a twelve-week intervention of therapeutic tai chi (ttc) or a non-exercise control group (see figure 1). the ttc group visited the clinic 2 times a week and performed home-based activity 1 time per week for 12 weeks. each ttc session started with a 10-minute stretching exercise warm-up, followed by 30 minutes of tai chi exercises, and ending with 10 minutes of meditation and 10 minutes of stretching exercise cool-down. the exercise was performed within the intensity ranges of 11 to 15 (light to somewhat hard) on the borg ratings of perceived exertion (rpe) scale. study outcome measures were obtained at baseline (prerandomization; one week prior to the start of the program) and within one week following the end of the 12-week intervention. the outcome measures included several test of physical function (lateral stance, agility, tandem gait, timed up and go, and six-minute walk) and the unified parkinson's disease rating scale (updrs) sections 13. all the tests were performed in the same order, at the same time of day, and when the participant felt best. the participant stands with hands on hips with eyes closed; when ready, the participant stands on the foot of choice for as long as possible, with the knee of the other leg flexed to 90 degrees. when a light comes on, they jump up as fast as possible in response to a single light stimulus. the tandem gait test was used to assess balance, appendicular coordination, and gait, which involves multiple sensory and motor systems. the participant walks in a straight line while touching the heel of one foot to the toe of the other with each step. for the timed up and go test, the participant was seated in an arm chair (45 cm high) with their back against the chair. on a signal, they stand up, walk 3 meters as quickly and safely as possible, turn around, walk back to the chair, and sit down with their back against the chair. the six-minute walk test was applied as a test of cardiorespiratory endurance for daily physical activities. this test measures the distance that can be walked at a self-paced velocity on a flat hard surface over a period of six minutes. an analysis of variance (anova) for repeated measures with one between factor (treatment group; ttc versus control) and one within factor (time; pre- and postintervention) was used to evaluate the effects of the intervention. a total of 11 participants were randomized to the ttc and 11 participants to the control condition. two subjects in the control group did not complete the study for personal reasons unrelated to the study. as shown in table 3, significant changes were observed in the mentation, behavior, and mood subscale and the motor subscale of the updrs, with no significant main effects on the activities of daily living scale (adl), balance, or reaction time. however, there were significant interactions between time and intervention group on the updrs activities of daily living subscale (figure 2). however, as shown in figures 3 and 4, there were significant (p<0.05) interaction effects for balance (one-leg standing test) and reaction time (light stimulus). in this study, we investigated the motor and nonmotor effects of therapeutic tai chi exercise training on participants with pd. the findings of our study showed modest effectiveness of tai chi training on people with parkinson's disease, with significant interaction effects for balance, reaction time, and adls. these findings support that tai chi is effective in improving some aspects of motor function, most notably reaction time and balance. in addition, pd participants reported an improvement in their ability to engage in their activities of daily living. exercise therapy has a major role in the rehabilitation of the patients with parkinson's disease [26, 27]. regular physical activity may increase the functional ability and enhance the capacity for independent living by decreasing the need for assistance with the activities of daily life. in addition, exercise may achieve the goal of neuroprotection, slow disease progression, and postpone disabilities [28, 29]. several cohort studies have described the functional achievements of moderately affected parkinson's disease participants who have undergone intensive standardized exercise training [3033]. however, burini et al. reported in a study with a crossover design that a 7-week tai-chi and aerobic exercise training did not affect the severity of neurological signs and symptoms as assessed by the updrs or have any significant impact of training on the attendant disability.. showed that physical therapy is mainly focused on mobility rather than various neurologic symptoms such as rigidity and tremor. reported that some aspects of the mobility and balance functions were positively affected by tai chi exercise. however, assessing the mobility and balance function by only one item, such as the walking function, is not very representative of the spectrum of the motor signs and symptoms. furthermore, there is little attention toward non-motor symptoms such as fatigue mood and health quality of life, all of which may be altered by exercise [27, 3740]. in a recently published clinical trial, li et al. found beneficial effects of tai chi exercise on balance, physical function, and falls, suggesting that tai chi is an appropriate physical activity for patients with parkinson's disease and it might be useful as a therapeutic exercise. the ability to balance is related to the control of the center of gravity within the base of support. koller and huber found that the balance impairment in older adults with a longer duration of pd does not usually respond to levodopa; 38% of the persons with pd experience fall, 13% fall more than once per week, and some studies have reported that pd patients fall repeatedly throughout the day. persons with pd are 5 times more likely to suffer falls-related injuries such as hip fractures than healthy older adults. reaction time for agility was measured in the present study and improved with ttc training. ttc training has benefits for postural stability in elderly people, including patients with pd, likely by acting on a number of sensorimotor systems that contribute to postural control [12, 43, 44]. this improvement combined with the observed improved agility performance confirms the separate observations of previous studies showing that ttc training results in better balance capacity, proprioception function, and muscle strength [11, 4547]. while our study and other studies have shown enhanced balance and agility resulting from tai chi, further work is needed to confirm that these improvements in fall risk factors actually result in fewer falls, as there are somewhat contradictory findings in the literature [19, 45, 48]. physical function refers to the assessment of the capability to complete a specific task rather than assessing the physiologic-derived attributes, and it is believed to reflect the ability to carry out activities of daily living. in the present study, we assessed the physical function with the timed up and go, tandem gait, and six-minute walk tests. the timed up and go test showed no significant change after training, which is in contrast to the findings of li et al.. these differences may be due to differences in the programs of tai chi, the wider range of disease severity in the study by li et al., or the smaller numbers of participants in our study. the timed up and go test largely depends on the muscular power and strength of the quadriceps and the hip extensor muscles to arise from a chair [49, 50]. it may be that our version of tai chi does not substantially improve lower extremity power. the results of the tandem gait test and the six-minute walk test were also not changed after 12 weeks of ttc training. poor performance on the tandem gait and six-minute walk could result from several potential factors, including poor cardiorespiratory fitness and gait or balance abnormalities [23, 51]. many of the pd participants likely had poor cardiorespiratory fitness and inadequate levels of physical activity, as shown by garber and friedman. consistent with this finding, all of the participants in this study had below normal results on the six-minute walk test, suggesting that poor cardiorespiratory fitness, gait, and/or balance may have been an important determinant of performance. other studies of tai chi have not shown an improvement in cardiorespiratory fitness, and our results are consistent with these previous findings. this study investigated motor function and the severity of motor and non-motor symptoms and signs. these motor and nonmotor symptoms and signs were not improved after treatment, although self-reported engagement in activities of daily living was enhanced by tai chi exercise. ttc training involves splitting up complex movements into simple motor tasks and incorporating simultaneous movements, which is also beneficial for parkinson disease patients. thus, this study lends additional evidence for tai chi as a complementary treatment for people with parkinson's disease one that will allow them to engage more fully in their activities of daily living. further studies are needed that will consider the effects of various components of a tai chi program and also to help to identify the intensity, duration, and frequency of tai chi exercise to attain optimal benefits. further, the influence of various medication and dietary factors may moderate the effects of exercise, and this has also not been studied.

objective. the purpose of the study was to investigate the effects of a 12-week program of therapeutic tai chi on the motor function and physical function of idiopathic parkinson's disease patients (pds). methods. the participants were 22 clinically stable pds in hoehn-yahr stages 1-2 randomly assigned to a therapeutic tai chi group (ttc, n=11) or a control group (con, n=9). two subjects in control group did not complete the study for personal reasons. ttc was performed three days a week (60 min/session). motor symptoms by the updrs were assessed, and tests of physical function were administered before and after the 12-week trial. results. the ttc group, as compared to the con group, showed changes in the mentation, behavior, mood, and motor scales of the updrs (p<0.05, p<0.01, resp.), with no significant main effects on the activities of daily living scale (adl). however, there was a significant interaction between the time and intervention group on adl (p<0.05). there were no significant main effects for any of the physical function variables. there were significant interaction effects in balance and agility (p<0.05, resp.). conclusions. this study showed that ttc training had modest positive effects on the functional status of parkinson's disease patients.

PMC3833322

pubmed-1111

mammalian memory is organized into dissociable neural systems that differ in terms of the type(s) of memory they mediate (white and mcdonald, 2002, squire, 2004, white et al., 2013). extensive evidence indicates that among these memory systems is a stimulus-response/habit system principally dependent on the integrity of the dorsolateral striatum (dls) (packard et al., 1989, packard and mcgaugh, 1996, packard and knowlton, 2002, yin et al., 2004, dls-dependent memory processes have been implicated in a variety of learning and memory tasks including response learning in the plus-maze, whereby animals acquire an egocentric turning response at the maze choice-point to receive reinforcement (packard and mcgaugh, 1996, chang and gold, 2004, yin and knowlton, 2004). memory in dls-dependent maze tasks may be considered an exemplar of habit memory, given that the learned behavior in these tasks remains insensitive to reward devaluation (sage and knowlton, 2000, lin and liao, 2003, de leonibus et al. stress influences a wide variety of learning and memory processes, and whether stress enhances or impairs memory partly depends on the type of memory being investigated (kim and diamond, 2002, mcgaugh, 2004, sandi and pinelo-nava, 2007, packard, 2009, roozendaal et al., 2009, sandi, 2013, arnsten, 2015). converging evidence indicates that dls-dependent habit memory in the plus-maze may be facilitated by the induction of emotional arousal through the exposure of animals to aversive unconditioned stimuli (packard, 2009, packard and goodman, 2012, packard and goodman, 2013, sandi, 2013, schwabe, 2013). for example, dls-dependent habit memory may be facilitated following chronic restraint stress, tail shock, exposure to predator odor, or administration of anxiogenic drugs (kim et al., 2001, packard and wingard, 2004, wingard and packard, 2008, elliott and packard, 2008, schwabe et al., 2012, leong and packard, 2014, taylor et al., 2014, furthermore, some evidence suggests that, as observed with unconditioned emotional stimuli, exposure to emotionally arousing conditioned stimuli also modulates memory (holahan and white, 2002, holahan and white, 2004, hawley et al., 2013, in particular, recent work from our laboratory revealed that exposing rats to shock-associated stimuli (i.e., a tone and context previously paired with footshock hereafter termed cs exposure) enhanced dls-dependent habit memory and biased animals toward the use of a response learning strategy in the plus-maze (leong et al. noradrenergic activity, particularly within the basolateral complex of the amygdala (bla), plays a critical role in regulating emotional arousal and the emotional modulation of memory (mcgaugh, 2004, roozendaal et al., additionally, the bla is required for the acquisition and expression of pavlovian fear conditioning (campeau and davis, 1995, maren et al., 1996, ledoux, 2000, ledoux, 2003, maren, 2001a, maren, 2001b). studies have found that noradrenaline administered directly into the bla modulates memory consolidation, whereas administration of a -adrenoceptor antagonist blocks the emotional modulation of memory (liang et al., 1990, hatfield and mcgaugh, 1999). in addition, the memory modulatory effects of systemically administered adrenaline are also blocked after intra-bla administration of the -adrenoceptor antagonist, propranolol, across a range of learning and memory tasks (liang et al., 1986; for review, see roozendaal et al., 2009). evidence from our laboratory indicates that similar neural mechanisms underlie the emotional enhancement of dls-dependent habit memory in the plus-maze. for example, administration of anxiogenic drugs directly into the bla is sufficient to enhance dls-dependent habit memory and the enhancement of habit memory produced by exposure to predator odor or systemic administration of anxiogenic drugs is blocked by neural inactivation of the bla (elliott and packard, 2008, wingard and packard, 2008, packard and gabriele, 2009, leong and packard, 2014). in view of this evidence, we hypothesized that the enhancement of dls-dependent habit memory consolidation after exposure to an aversive cs (leong et al., 2015) may also be dependent on noradrenergic activity, particularly within the bla. in order to test this hypothesis, rats were first subjected to a standard fear conditioning paradigm (i.e., repeated tone-shock pairings). rats were then trained in a response learning task in the water plus-maze that requires the use of dls-dependent habit memory. following training sessions, rats were given systemic (experiment 1) or intra-bla (experiment 2) administration of propranolol immediately before cs exposure. subjects were experimentally nave adult male long evans (blue spruce) rats, obtained from harlan laboratories (indianapolis, in), and weighing 275375 g at the time of training. subjects were individually housed in clear plastic cages with sawdust bedding in a climate-controlled vivarium. experimenters handled rats for 1 min per day for five days prior to the start of behavioral training or surgeries. for experiment 1, rats experienced a 12:12 light dark cycle (lights on at 7:00 a.m. and off at 7:00 p.m.). the institutional animal care and use committee at texas a&m university approved all experimental procedures. for experiment 1 and 2 the chambers (30 cm 24 cm 21 cm) are comprised of aluminum (side walls) and plexiglas (real wall, front door, and ceiling). the floor of each chamber consisted of 19 stainless steel rods (4 mm in diameter) spaced center to center at 1.5 cm apart. footshock (2 s, 1 ma; unconditioned stimulus, us) was delivered via a shock source and solid-state grid scrambler (med associates). a speaker attached to each individual chamber provided the auditory conditioned stimulus (2 khz, 20 s, 80 db). cameras mounted above the plexiglas ceiling of the chambers remotely recorded each animal's behavior. for the conditioning context, a small volume of 1.5% acetic acid odor was poured into the metal pan beneath the grid floor, the testing room lights remained on, and the cabinet doors were left open. the same contextual cues were used for both conditioning and cs exposure sessions. a load-cell platform beneath each chamber recorded chamber displacement (10 v to +10 v) as a result of each animal's movement. load-cell activity values were acquired and digitized at 5 hz with threshold activity software (med associates). activity values were transformed offline into absolute values ranging from 0 to 100 (with lower values indicating less displacement of the chamber); rats were scored as freezing if absolute values were 10 for 1 s or more. freezing was analyzed as a percentage of total time across each trial as described below. the water maze consisted of a clear plexiglas plus-maze (43 cm in height; each arm is 27 cm wide and 60 cm in length) that was inserted in a black circular tub (180 cm in diameter; 45 cm in height ;, 2012, goodman and packard, 2014, leong and packard, 2014, leong et al., 2015). for experiment 1 and 2, the maze was filled with water to a level of 21 cm; water temperature was 25 c (i.e., room temperature). a submerged clear plastic platform (15 cm 14 cm 20 cm) served as the hidden escape platform; the platform was about 1 cm below the water level throughout maze training. a movable piece of plexiglas (43 cm in height; 27 cm wide) blocked entry into the arm opposite to the start arm for each trial, creating a t-maze as necessary for the response learning task described below. prior to behavioral training in experiment 2, rats were anesthetized with isoflurane and treated with atropine nitrate (0.4 mg/kg, i.p.). each rat was secured in a stereotaxic frame (david kopf instruments) and a small incision was made in the tissue above the skull; bregma and lambda of the skull were leveled on an even plane. small holes were drilled in the skull and guide cannulae (10 mm, 26 gauge; small parts) were lowered to the following coordinates: 2.2 posterior to bregma; 5.0 medial/lateral to the midline; 6.0 ventral to dura (targeting the bla). dental cement was used to anchor the guide cannulae to the screws in the skull. stainless steel dummy cannulae (11 mm, 30 gauge) were inserted into the guide cannulae (extending 1 mm beyond the end of the guide cannulae into the bla). rats were allowed 7 days of recovery from surgery before the start of behavioral training. freezing behavior served as the index of fear for conditioning and during exposure to the conditioned fear stimuli. on the first day of behavioral training, rats (in squads of eight; counterbalanced by group assignments) were transported in black plastic containers from their homecages in the vivarium to the fear conditioning chambers in the laboratory. 3 min after being placed in the conditioning chambers, rats received three tone (2 khz, 20 s, 80 db)-footshock (2 s, 1 ma) pairings; the tone and shock co-terminated. tone-footshock pairings were separated by 1-min interstimulus intervals; rats remained in the conditioning chambers for 1 min after the final tone-footshock pairing. rats were immediately returned to the vivarium after conditioning. for experiment 1 and 2, training procedures for the response learning task were identical to the procedures employed in our previous studies (leong et al., 2012, goodman and packard, 2014, leong et al., 2015, wingard et al., twenty-four hrs after fear conditioning, rats were individually transported from the vivarium to the room containing the water plus-maze. rats were trained in the water maze across five consecutive days with six trials per day. for each trial, the subject was removed from the white transport container and gently placed into the water maze (facing the maze wall) in either the north (n) or south (s) arm; rats were allotted 1 min to swim to a hidden platform at the end of another arm (east or west). the arm opposite to the start arm would be blocked with the removable plastic wall. the location of the hidden platform was consistently in the arm in which a right body turn at the maze's choice point (i.e., at the middle of the maze) would lead to finding the platform. for instance, if a rat started in the north arm, the hidden escape platform would be in the west arm; if the rat started in the south arm, the hidden platform would be in the east arm. on the first, third, and fifth day of training (odd days), the sequence of the start arm was nssnns. if the rat did not locate the escape platform within 1 min, the experimenter would manually guide the rat to the escape platform. once the rat climbed onto the platform, the rat would remain on the escape platform for 10 s before being returned to the white plastic container for a 30 s intertrial interval. if the subject made a full-body entry into the arm containing the hidden platform, then this response was scored as correct. if the rat made a full-body entry into the adjacent arm that did not contain the hidden platform, then this response was scored as incorrect. if the rat exited the start arm and made a full-body entry back into the start arm, then this was also scored as incorrect. performance in the maze was analyzed as a percentage of correct responses for each day as described below. an overview of the designs for each experiment is depicted in fig. 1. for experiment 1 (prior to behavioral training), rats were randomly assigned to drug (propranolol [prop] or vehicle [veh ]) and exposure (fear or neutral) conditions, yielding the following groups: prop-fear (n=8), prop-neutral (n=8), veh-fear (n=8), veh-neutral (n=8). for experiment 1, prop and veh rats received systemic (i.p.) administration of propranolol (3.0 mg/kg) or vehicle (respectively) immediately following maze training on the first three days. this dose of propranolol was selected based on previous evidence that this dose blocks the memory modulatory properties of glucocorticoid administration (roozendaal et al., 2006b). propranolol (sigma aldrich) was dissolved in saline and prepared fresh for each day's use. systemic injection of propranolol was administered at a volume of 1 ml/kg. immediately following propranolol or vehicle administration (on the first three days of training in the maze), rats were exposed to either the cs in the original conditioning chambers (fear rats) or to a clean blue plastic container enclosed in a separate room (neutral rats) for an equal duration. fear rats received three non-reinforced conditioned tone presentations in the conditioning chambers (separated by 1 min interstimulus intervals in the chamber, with 3 min of baseline and 1 min following the final tone-alone presentation). fear rats were transported to and from the fear conditioned chambers in the same black transport boxes used during conditioning. neutral rats were transported in the white plastic containers used throughout their training in the maze. in experiment 2, rats were randomly assigned to drug (prop or veh) and exposure (fear or neutral) conditions, yielding the following groups: prop-fear (n=6), prop-neutral (n=9), veh-fear (n=9), veh-neutral (n=7). all apparatuses and procedures were identical to those in experiment 1, except that drugs were administered directly into the bla. for each infusion, propranolol (sigma aldrich) was dissolved in distilled water to a concentration of 1.0 g/l. gas-tight syringes (hamilton co.) were secured to an automated syringe pump (kd scientific). polyethylene tubing (pe-20; braintree scientific) was inserted over the gas-tight syringes. internal injection needles (11 mm, 33 gauge; small parts) were fitted to the opposite end of the tubing. the stainless steel dummy cannulae were removed from within the guide cannulae and the injectors were inserted into the guides. prop rats received bilateral infusions of propranolol at a rate of 0.5 l/min for 1 min, yielding a dose of 0.5 g of propranolol per hemisphere (veh rats received an equal volume of saline at an equal rate of infusion). this dose of propranolol was selected based on previous evidence that intra-bla infusions at this dose block the memory modulatory properties of glucocorticoid administration (roozendaal et al., 2006b). injectors remained in the guide cannulae for 1 min after infusion before being removed; clean dummy cannulae were inserted into the guides after these procedures. rats from experiment 2 were overdosed on pentobarbital (0.5 ml, i.p.) and intracardially perfused with physiological saline and 10% formalin. brains were extracted and stored in 10% formalin for twenty-four hrs then switched to a sucrose-formalin solution until sectioning. only rats with injector tips localized within the bla (bilaterally) were included in the final analyses. twenty-four hrs prior to training in the response learning task, rats reliably conditioned to the auditory tone (fig. 2a). repeated measures anova revealed a main effect of trial [f(1,28)=161.998; p<0.0001] such that rats significantly increased in freezing from baseline to the final tone at conditioning. as expected, rats did not differ based on drug or exposure assignments across conditioning trials [fs<2]. after maze training, cs exposure in the conditioning context reliably induced freezing behavior in fear rats (fig.. collapsed across the three days of cs exposure, a main effect of trial revealed that rats significantly increased in mean freezing following the onset of the cs [f(1,14)=30.194; p<0.0001], indicating robust cs-evoked fear. peripheral administration of propranolol did not significantly alter freezing, as rats exposed to fear conditioned stimuli did not significantly differ across drug assignments during the retrieval phase [fs<1]. 2b. as illustrated, systemic propranolol administration prevented the memory enhancement produced by post-training exposure to the fear cs. this was confirmed in the anova by a significant drug exposure interaction for responding in the maze across days 25 of training [f(1,28)=6.599; p<0.05]. post hoc analyses revealed that veh-fear rats exhibited significantly more correct responses (%) across days 25 as compared to prop-fear [p<0.01] or veh-neutral [p<0.05] rats, whereas prop-fear, prop-neutral, and veh-neutral rats did not significantly differ from one another across training. a main effect of day indicated that performance in the maze improved for all groups across days 25 [f(3,84)=13.733; p<0.0001]. factorial anova of group performance on day 1 revealed no significant group differences [fs<2]. a trending but nonsignificant main effect of propranolol was detected across days 25 [f<3]. no other significant comparisons were detected [fs<1]. in sum, the data from experiment 1 reveal that post-training peripheral antagonism of -adrenoreceptors is sufficient to blunt the enhancement of habit memory as a result of exposure to fear css. a main effect of trial indicated that rats significantly increased in freezing from baseline to the final tone at conditioning [f(1,27)=48.746; p<0.0001]. groups did not significantly differ from baseline to the final conditioning trial [fs<2]. during post-maze fear exposure, the cs reliably induced freezing (fig.. collapsed across the three days of cs exposure, a main effect of trial revealed that rats significantly increased in mean freezing following the onset of the cs [f(1,13)=13.930; p<0.005]. prop-fear and veh-fear rats did not significantly differ in their levels of freezing across the three days of fear cs exposure [fs<2] (similar to experiment 1). in contrast to experiment 1, anova of maze performance on the first day of maze training revealed a significant drug exposure interaction [f(1,27)=5.395; p<0.05], indicating that the groups differed in baseline memory performance. this was unexpected, because all groups were treated equally before and during day 1 maze training. drug administration and fear cs exposure did not occur until immediately after maze training on day 1. nevertheless, post hoc analyses revealed that veh-fear rats exhibited significantly fewer correct responses on the first day of maze training as compared to prop-fear rats [p<0.05]. on days 25, a main effect of day was observed [f(3,81)=10.247; p<0.0001], but no other significant main effects or interactions were detected for% correct responses [fs<1.5]. given that, in contrast to experiment 1, groups in experiment 2 displayed differences in day 1 baseline memory performance and that significant differences on the first day of training may influence differences in future performance, we normalized the responding of each rat in the maze to each rat's relative performance for the first day. specifically, the percentages of correct responses of each rat for each day (25) were divided by the rat's percentage correct on day 1 (i.e., a value of 1 indicates an equal amount of correct responses as compared to day 1, a value of 2 indicates twice as many correct responses as compared to day 1, and so on). as such, we analyzed the relative rate of increase in habit memory expression in the maze as compared to the first day of training (i.e., before drugs were administered). anova of percentage correct responses across training days 25 revealed a significant drug exposure interaction [f(1,27)=5.413; p<0.05]. additionally, a significant day drug exposure interaction was revealed [f(1,27)=2.855; p<0.05]. a main effect of prop was trending, but not significant [f<2.5]. post hoc tests revealed that veh-fear rats increased their performance in the maze at a faster rate as compared to prop-fear [p<0.05] and veh-neutral [p<0.05] rats. conversely, prop-fear, prop-neutral, and veh-neutral rats did not significantly differ across days 25 of maze training. a main effect of day was observed [f(3,81)=9.642; p<0.0001], indicating that rats in general significantly increased in their performance in the maze across days. no other main effects or interactions were detected [fs<1]. in sum, intra-bla infusions of propranolol prevented the relative increase in performance in the response learning water plus-maze task after exposure of rats to conditioned fear cues. the present findings indicate that the enhancement of dls-dependent habit memory produced by exposure of rats to fear css is blocked by systemic (experiment 1) or intra-bla (experiment 2) antagonism of -adrenoreceptors. the finding that post-training exposure to fear css, relative to exposure to neutral stimuli, enhanced habit memory is consistent with previous research from our laboratory (leong et al., 2015). given previous evidence indicating that delayed post-training cs exposure does not influence habit memory in the plus-maze (leong et al., 2015), we assume that cs exposure influences maze performance by augmenting the initial consolidation phase of habit memory. in addition, previous evidence indicates that animals not given fear conditioning or animals given fear conditioning but no post-training cs exposure do not display enhanced habit memory in the plus-maze (leong et al., 2015). this suggests that the enhancement of habit memory in the present study is specifically attributed to cs exposure (as opposed to the fear conditioning that transpired twenty-four hrs prior to maze training). also, given the present finding that cs exposure was associated with conditioned freezing, it is plausible that post-training cs exposure enhanced habit memory by eliciting emotional arousal (i.e., fear). attributing the present habit memory enhancement to emotional arousal concords with extensive previous evidence indicating that high emotional arousal produced by unconditioned stimuli enhances dls-dependent memory processes (packard, 2009, packard and goodman, 2012, schwabe, 2013). for example, systemic infusion of anxiogenic drugs such as -2-adrenoreceptor antagonists yohimbine or rs 79948-197 similarly enhances dls-dependent habit memory in the water plus-maze task (wingard and packard, 2008, packard and gabriele, 2009, leong et al., 2012) and leads to the preferential use of dls-dependent learning in tasks that can be solved adequately using alternative strategies (packard and wingard, 2004, elliott and packard, 2008). enhancements of dls-dependent habit memory are also observed after exposure to behavioral or ecologically valid stressors, such as chronic restraint, tail shock, or predator odor (kim et al., 2001, notably, the stress/anxiety-induced enhancement of habit memory originally demonstrated in rodents (packard and wingard, 2004) has also been demonstrated in humans following administration of anxiogenic drugs (e.g., hydrocortisone) or exposure to psychological stressors (schwabe et al., 2010b, schwabe et al., 2013, schwabe and wolf, 2009, schwabe and wolf, 2010, guenzel et al., 2014). the influence of emotional arousal on memory systems may involve the release of stress hormones and subsequent activation of glucocorticoid, mineralocorticoid, and adrenergic receptors in the brain (mcgaugh, 2004). consistent with this suggestion, drug treatments increasing the activation of these receptors mimic the mnemonic effects of emotional arousal, whereas decreasing activation of these receptors through the use of selective antagonists prevents the effects of emotional arousal on memory (mcgaugh, 2004, roozendaal and mcgaugh, 2011). for example, administration of the -adrenoreceptor antagonist propranolol blocks the emotional enhancement of dls-dependent habit memory in humans (schwabe et al., 2011b), and a similar blockade may be observed following administration of mineralocorticoid receptor antagonists in mice and humans (schwabe et al., 2010a, schwabe et al., 2013) in addition, propranolol administration blocked the fear cs-enhancement of habit memory in the present study, consistent with the hypothesis that noradrenergic activity also underlies the mnemonic benefit of exposure to aversive css. a modulatory role of the bla has also been implicated in the emotional enhancement of dls-dependent habit memory (packard, 2009, packard and goodman, 2012). direct administration of anxiogenic drugs into the bla mimics the enhancement of habit memory produced by systemic administration of these drugs (elliott and packard, 2008, wingard and packard, 2008). in addition, the enhancement of habit memory after systemic administration of anxiogenic drugs or exposure to predator odor is blocked by reversible inactivation of the bla (packard and gabriele, 2009, leong and packard, 2014). the present finding that administration of the -adrenoreceptor antagonist propranolol directly into the bla blocks the fear-enhancement of habit memory suggests that the mnemonic effects of conditioned emotional stimuli might similarly depend on both the noradrenergic system and a modulatory role of the bla. interestingly, this present finding suggests for the first time that noradrenergic activity specifically within the bla is required for emotional arousal to influence dls-dependent memory. moreover, prior evidence indicates that increasing noradrenergic activity in the bla is sufficient to enhance memory in a task identical to the one employed in the present study (wingard and packard, 2008), and the present results suggests that this effect is likely mediated through -adrenergic receptors. prior research indicates that exposure to fear css increases norepinephrine release in the amygdala (tanaka et al., 2000, zhou et al., 2015) and this increase in amygdala norepinephrine release may be responsible for the enhancement of habit memory observed in the present study. future studies are necessary to examine whether increasing bla noradrenergic activity augments the enhancement of habit memory by fear css and whether bla norepinephrine levels correlates with these memory enhancements. although we only analyzed data for rats having injectors within the bla, it is possible that drug had spread to other regions of the amygdala (e.g., the central nucleus [cea]). while previous evidence suggests that the bla, not cea, mediates the memory modulating capacity of the amygdala (see roozendaal and mcgaugh, 1996, quirarte et al., 1997, roozendaal and mcgaugh, 1997, akirav and richter-levin, 2002), it is possible that the enhancement of habit memory in the present study may have been partially influenced by blockade of -adrenoreceptors in the cea. the cea may influence habit memory through an indirect cea-dorsal striatum pathway (ferreira et al., 2008, lingawi and balleine, 2012). whether the role of the cea in habit memory depends on -adrenoreceptor activity has yet to be examined. an additional consideration regarding the fear cs enhancement of habit memory is how the physiological processes during emotional arousal (e.g., stress hormone activity and bla function) lead to the enhancement of dls-dependent memory processes., previous evidence indicates that systemic or direct administration of corticosterone into the dorsal striatum enhances memory consolidation in both the cued water maze and inhibitory avoidance task (medina et al. thus, fear cs exposure may be associated with the release of stress hormones such as corticosterone that directly increase activity of the dls and consequently enhance habit memory consolidation in the plus-maze. aside from this direct mechanism of enhancement, it is also reasonable to hypothesize that fear cs exposure may have enhanced habit memory indirectly through modulation of other brain regions. extensive evidence indicates that in some learning situations, dls-dependent memory processes may be facilitated by lesion or inactivation of the hippocampal formation (packard et al., 1989, mcdonald and white, 1993, schroeder et al., 2002; for review, see poldrack and packard, 2003). given that stress/anxiety is frequently associated with impaired hippocampus-dependent memory function (diamond et al., 1996, de quervain et al., 1998, conrad et al., 2004, sandi et al., 2005, park et al., 2008, wingard and packard, 2008; for review, see sandi and pinelo-nava, 2007), cs exposure may have similarly impaired hippocampal function in the present study, thus indirectly enhancing dls-dependent habit memory. consistent with this suggestion, previous evidence from our laboratory indicates that anxiogenic drug doses that impair hippocampus-dependent place learning also enhance dls-dependent response learning, and that these enhancing and impairing effects of anxiogenic drug administration critically depend on bla function (wingard and packard, 2008, packard and gabriele, 2009). taking this indirect hypothesis a step further, it is tempting to speculate that propranolol administration in the present study might have blocked the cs enhancement of habit memory indirectly by preventing an impairment of hippocampal function. this hypothesis is consistent with some evidence indicating that propranolol might rescue the impairment of hippocampus-dependent memory produced by glucocorticoid administration (roozendaal et al., 2004, in addition to memory impairments, previous evidence indicates that memory enhancements following corticosterone administration are also blocked by concurrent infusions of propranolol (quirarte et al. notably, we have recently demonstrated that the corticosterone-induced enhancement of dls-dependent habit memory may also be blocked by concurrent propranolol administration (goodman et al. thus, consistent with the view that glucocorticoid and noradrenergic mechanisms might interact to produce the emotional enhancement of habit memory, cs exposure in the present study would be expected to increase the release of glucocorticoids (goldstein et al., 1996, cordero et al., 1998, hagewoud et al., 2011), whereas administration of propranolol might prevent glucocorticoids from enhancing habit memory (goodman et al., another possible mechanism underlying the current results is that propranolol administration may have reduced fear expression (rodriguez-romaguera et al., 2009, fitzgerald et al., 2014, fitzgerald et al., 2015, giustino et al., 2016 however, in the current study, cs-evoked levels of freezing across retrieval were not significantly different between propranolol- and vehicle-treated animals in either experiment. similarly, cain and colleagues (2004) reported no significant differences between mice treated (i.p.) with propranolol or vehicle in the early phases of massed auditory cs extinction or across a 60-min extinction session in a conditioned context (also, see fitzgerald et al., 2015, zhou et al., however, it is possible that floor effects might have competed with propranolol's effects on freezing in the current study. a higher dose of propranolol may also be required to significantly impact fear expression during post-maze cs exposure. regardless, cs-evoked fear in the current study was sufficient to modulate performance in the maze for vehicle-treated animals. finally, numerous investigators have suggested that enhancement of the dorsal striatum-dependent memory system might in part underlie the development of some neuropsychiatric disorders, in particular disorders with prominent habit-like behavioral features (white, 1996, everitt and robbins, 2005, schwabe et al., 2011a, berner and marsh, 2014, gillan and robbins, 2014, goodman et al., 2014, for instance, post-traumatic stress disorder (ptsd) is partly characterized by intractable avoidance behaviors that occur in response to trauma-related cues, and some investigators suggest that such avoidance symptoms may be a manifestation of enhanced dls-dependent habit memory following very high levels of emotional arousal (i.e., trauma; packard, 2009, schwabe et al. the fear cs enhancement of habit memory observed in the present study may be considered a putative animal model of this proposed mechanism, whereby the conditioned emotional stimuli represent the trauma-related cues that enhance dorsal striatum-dependent memory processes and lead to the development or expression of behavioral avoidance symptoms in ptsd. clinical evidence indicates that -adrenoreceptor antagonists such as propranolol, when administered shortly after trauma or after ptsd has already developed, may be useful in treating some ptsd symptoms (famularo et al. 2016). considering that propranolol blocked the fear cs enhancement of habit memory, propranolol administered in the acute aftermath of trauma

emotional arousal can have a profound impact on various learning and memory processes. for example, unconditioned emotional stimuli (e.g., predator odor or anxiogenic drugs) enhance dorsolateral striatum (dls)-dependent habit memory. these effects critically depend on a modulatory role of the basolateral complex of the amygdala (bla). recent work indicates that, like unconditioned emotional stimuli, exposure to an aversive conditioned stimulus (cs) (i.e., a tone previously paired with shock) can also enhance consolidation of dls-dependent habit memory. the present experiments examined whether noradrenergic activity, particularly within the bla, is required for a fear cs to enhance habit memory consolidation. first, rats underwent a fear conditioning procedure in which a tone cs was paired with an aversive unconditioned stimulus. over the course of the next five days, rats received training in a dls-dependent water plus-maze task, in which rats were reinforced to make a consistent body-turn response to reach a hidden escape platform. immediately after training on days 13, rats received post-training systemic (experiment 1) or intra-bla (experiment 2) administration of the -adrenoreceptor antagonist, propranolol. immediately after drug administration, half of the rats were re-exposed to the tone cs in the conditioning context (without shock). post-training cs exposure enhanced consolidation of habit memory in vehicle-treated rats, and this effect was blocked by peripheral (experiment 1) or intra-bla (experiment 2) propranolol administration. the present findings reveal that noradrenergic activity within the bla is critical for the enhancement of dls-dependent habit memory as a result of exposure to conditioned emotional stimuli.

PMC5146203

pubmed-1112

diabetic retinopathy (dr) is a common complication of diabetes mellitus (dm) and is a leading cause of blindness worldwide. diabetic macular ischemia (dmi) is an important category of diabetic retinopathy (dr) [2, 3]. during the imaging study of the normal macula, an important hallmark is the capillary-free region called foveal avascular zone (faz). it is recognized that the faz can enlarge and can become irregular in dr and seems to get larger as the stage of retinopathy advances [2, 3]. dmi is characterized by the occlusion and loss of the macular capillary network or capillary dropout [4, 5]. this condition results in upregulation of growth factors, which contributes to the development of diabetic macular edema (dme), the most frequent sight-threatening disorder in individuals with dr. dmi is an irreversible category of diabetic maculopathy, and its presence limits the potential benefits of treatments for dr [3, 5, 6]. the early treatment of diabetic retinopathy study (etdrs) established dmi standards that were determined using fluorescein angiography (fa). according to the etdrs report 11, clinically, there is a correlation between dmi and poor prognosis that varies according to the severity of the macular ischemia. the anatomy of the retina appears to be altered in dmi, with thinning of retinal nerve fibre layer (rnfl) and outer retina and thickening of outer choroid. in retinal microcirculation, blood supply is divided mainly into superficial capillary plexus (scp) and deep capillary plexus (dcp). choroidal circulation appears to be the most important blood supply to the central macula, including photoreceptor inner segment (is) band, which is most likely the most important consumer of oxygen. it is likely that the dcp is responsible for up to 15% of the blood supply to the photoreceptors, especially during dark adaptation [8, 10, 11]. fa has been the gold standard imaging modality since it was introduced in 1961 [7, 12, 13] however, it requires venipuncture, and reports of anaphylaxis and death related to contrast injections, despite being rare, have been documented. in addition, the technique is costly and time-consuming, requiring up to 10 minutes for framing acquisition [4, 8, 10, 11]. spectral domain (sd) oct has emerged as a potential alternative for detecting macular nonperfusion in diabetic patients, but results are contradictory [1, 2, 13]. macular ischemia may disrupt the normal flow of nutrients to the outer retina, but photoreceptor status on sd-oct remains controversial. in diabetic patients, the disruption of photoreceptors in sd-oct can indicate a manifestation of underlying dcp nonperfusion in patients with a relatively healthy macula [1416]. oct angiography (octa) has been used for 3d mapping at microcirculation level [9, 1316]. it allows detection of retinal and choroidal structures via motion contrast imaging and high speed scanning, which detect blood flow by analysing signal decorrelations between scans [7, 11, 14, 15]. both inner and outer retinal capillary plexuses are imaged in contradistinction in conventional angiography, which does not effectively image the outer plexus. this study aimed to compare the use of fluorescein angiography and octa in the diagnosis and quantification of dmi when applying a split-spectrum amplitude-decorrelation angiography algorithm (ssada) to improve the detection of flow signals in angiography with the purpose of offering a suitable sparing contrast alternative using 3 mm 3 mm octa for clinical investigations of diabetic patients [8, 1520]. this was a retrospective cross-sectional comparative study analysis conducted at federal university of goias and approved by ethics committee of the same institution. signed informed consent was obtained from each subject prior to enrolment. imaging data were collected from patients who underwent fa and octa on the same day in a tertiary referral retina center in the period between january 1, 2015, and july 30, 2015. exclusion criteria included significant cataract (without surgical indications at the time of examination), previous retinal arterial or venous occlusion, inherited macular dystrophy, posterior segment inflammation, and macular degeneration or scarring of any cause. subjects that presented motion artifacts during octa or poor signal strength were also not included in this study. all subjects underwent a comprehensive ophthalmologic examination, including best-corrected visual acuity (bcva) on etdrs charts,+78 d noncontact lens slit-lamp fundoscopy, color fundus photography, and fa and oct angiography, on a single day. color fundus photographs were obtained and fa was performed using a digital retinal camera (topcon trc 50dx; topcon, paramus, nj). the central macular nonperfusion area, faz boundaries, and the maximum height and area were manually delineated. the faz area was measured using a single fa photograph, such as the octa angiogram of the scp and then divided into (superior to 0.32 mm) and small (inferior to 0.32 mm) groups. group comprised both moderate and severe etdrs established grading groups [3, 19, 20]. the quantification of macular nonperfusion in both fa and oct angiography captured images was completed using imagej software (imagej, national institutes of health, bethesda, md). octa instrument used was the rtvue xr avanti with angiovue software for octa (optovue, inc., fremont, ca), and imaging data were obtained using the split-spectrum amplitude-decorrelation angiography (ssada) software. the algorithm was employed to improve the signal-to-noise ratio [8, 1521]. this instrument operates at ~840 nm wavelength, 70,000 a-scans per second, and a bandwidth of 50 nm. the tissue resolution is 5 m axially and there is a 15 m beam width. each b-scan consisted of 304 a-scans for a total of 2 304 304 a-scans per acquisition, with a total acquisition time of approximately 3 seconds. the scanning area was captured in 3 mm 3 mm sections, and the acquired oct volumes were centered on the fovea [811]. a 3 mm 3 mm octa image was used primarily because this size is the one that provides images with higher resolution in the used octa device [10, 11]. the ssada algorithm was used to generate a volumetric rendering of blood flow from the internal limiting membrane (ilm) to the choroid, and it allowed the direct visualization of normal and abnormal blood circulation [1821]. for the octa angiograms, it was used the automatic segmentation of the retinal layers at the level of the scp generated by the angiovue software in an orthogonal view. in order to correct for automated segmentation error and projection artifacts, the segmentation slab was manually adjusted, using corresponding structural oct b-scans as a guide for the placement of 2 segmentation lines: the inner located at 3 m beneath the internal limiting membrane and the outer boundary at 15 m beneath the inner plexiform layer. this semiautomatic method permitted the readers to select images that pictured the largest extent of scp for subsequent quantitative analysis. the dcp image was segmented with an inner boundary 15 m beneath the inner plexiform layer and an outer boundary at 70 m beneath the inner plexiform layer. this section captured both layers of the outer capillary plexus, which sandwiched the inner nuclear layer. all statistical analyses were performed using statistical package for social science 22.0 (ibm spss; ibm, armonk, ny). fa and octa images were independently reviewed by two independent masked readers retina specialists (jg and di) who reached an agreement regarding the area (mm) of macular nonperfusion that was obtained using both methods according to etdrs report 11. intraclass correlation coefficient (icc) was used to estimate the agreement between individual measurements from both readers. since the icc was consistently>0.9 between the 2 readers, nonparametric wilcoxon signed-rank test was used to compare area measurements performed by 1 reader on fa and octa 3 mm 3 mm scans. thirty-four eyes from 34 patients, including 20 (58.82%) females and 14 (41.18%) males, were enrolled and separated according macular status (table 1). twenty-four eyes from 24 patients were placed in the group of patients with dmi, including 15 (62.5%) females and 9 (37.5%) males. the mean (sd) age of the dmi population was 61.20 6.95 years. the group without dmi comprised 10 patients, including 5 (50%) females and 5 (50%) males. four eyes from 2 patients were excluded from the study due to a high quantity of motion artifacts. patients with dmi presented a mean fa of 0.68 0.53 mm (95% ic, 0.460.90; p<0.05). octa angiogram analysis demonstrated a mean of 0.58 0.35 mm (95% ic, 0.430.73; p<0.05). the wilcoxon signed-rank test did not identify a significant difference between fa and octa in patients diagnosed with dmi (p=0.1374). patients without dmi presented a mean fa of 0.19 0.67 mm (95% ic, 0.140.24; p<0.05). octa angiogram analysis demonstrated a mean of 0.20 0.79 mm (95% ic, 0.150.26; p<0.05). the wilcoxon signed-rank test did not identify a significant difference between fa and octa in patients without dmi (p=0.9594) (figure 1). the iccs for faz area measurements between 2 observers with respect to fa and octa were 0.96 (ic: 0.360.71) and 0.92 (ic: 0.350.79), respectively, demonstrating the reproducibility and consistency of the methodology. this result highlights the notion that the faz is most often clearly demarcated by a distinct foveal vascular ring and that its abnormalities, in addition to its capillary dropout, can be lucidly obtained from octa images. etdrs research group connected the severity of macular nonperfusion to the potential for progression in dr. in fact, in dr, the advanced deterioration of macular perfusion is the basis for macular ischemia, and developing a method to perceive perfusion maps may allow correlations between central ischemia and the different stages of dr. however, it is an invasive method requiring venipuncture and contrast infusion; it is a time-consuming test and provides only 2-dimensional images. therefore, reports of anaphylaxis and death related to contrast injections have been documented, despite being rare. octa is a noninvasive method, obtains highly detailed 3-dimensional images without requiring injection of a contrast dye, and allows faster acquisition of images (figure 2) [9, 10, 1214]. octa performed using a split-spectrum amplitude-decorrelation angiography (ssada) algorithm has already been shown to be useful for imaging microvascular changes in dr [811, 14, 20]. cole et al. also observed macular nonperfusion in a diabetic patient in a 3 mm 3 mm octa that was centered on the fovea by applying a similar technology. the 3 mm 3 mm octa central sections obtained using sd-oct allowed us to obtain a higher resolution over a small area (figure 3). this area was sufficient for detecting central dmi, but it was not large enough to identify peripheral retinal nonperfusion. high-resolution oct imaging allows measuring thickness of segmented retinal layers in angiographically apparent ischemic dr. future octa devices improvements may provide clinicians the ability to obtain wider field images with better resolution. in the present study, statistical analysis also did not indicate significant difference between area measurements obtained with fa and octa in patients diagnosed with dmi. the same has occurred among patient without dmi regarding the measurement of normal faz area. the icc for the zaf area between the 2 observers on fa and octa demonstrated the reproducibility and consistency of used methodology. these results highlight the notion that faz is most frequently demarcated by a distinct foveal vascular ring and its abnormalities, in addition to its capillary dropout, can be lucidly obtained from octa imaging device. first, all of the results were obtained during a single appointment, and there was no follow-up. the present study demonstrates that fluorescein angiography and octa provide similar results when used to diagnose macular ischemia in diabetic patients. with further improvements in summary, octa may provide images with higher details regarding macular status, becoming a novel imaging technique for the diagnosis of dmi, and may become an alternative to fa for this purpose. the results also offer improved quantification of faz area in diabetic patients without dmi when compared to diabetic subjects with established macular ischemia.

purpose. to compare fluorescein angiography (fa) and optical coherence tomography angiography (octa) images of foveal avascular zone (faz) in patients with diabetic retinopathy (dr) with and without diabetic macular ischemia (dmi). methods. the wilcoxon signed-rank test was used to compare area measurements and p values of<0.05 were considered statistically significant. fa and octa images were independently graded by 2 observers that reached agreement regarding quantitative dmi according established protocols. the ischemic area was divided into large macular ischemia (superior to 0.32 mm2) and small (inferior to 0.32 mm2) groups. quantitative analyses of the faz were performed using custom software. results. thirty-four eyes from 34 diabetic patients were enrolled. subjects with dmi presented a mean area on fa and octa of 0.68 0.53 mm2 and 0.58 0.35 mm2, respectively (p=0.1374). patients without dmi presented a mean area on fa and octa of 0.19 0.67 mm2 and 0.20 0.79 mm2, respectively (p=0.9594). the icc for the faz measurements between the 2 observers on fa and octa was 0.96 and 0.92, respectively. conclusion. octa represents a novel technique for the diagnosis of dmi and it may become an alternative to fa for this purpose.

PMC5116522

pubmed-1113

geriatric population is on rise globally because of increasing life span. as per the us census, people above 60 years constituted 6.4% of the total population in 1900, which increased to 18.4% in 2010 and predicted to go up to 25.5% by 2050.1 spinal problems and spine surgeries in geriatric population are also showing a similar trend. lumbar fusion surgeries in people aged 60 years and above have increased by 230% in a decade from 1991 to 2001.2 desire to lead a more active life in advanced age, improved diagnostic techniques, and better operative results are some of the reasons for increasing spine surgeries in the elderly. in general, spine surgery in the elderly in the presence of comorbidities is feared among both patients and surgeon, as it is presumed to have higher perioperative complications and increased cost. many articles can be found in literature supporting this.345 a study by daubs et al. involving adult spinal deformity in people over 60 years of age has reported that age and complication rates do not affect the surgical outcome.6 similar studies have reported 91%96% good to excellent results following surgical treatment of lumbar canal stenosis (lcs) by decompression and decompression with fusion on people aged above 6570 years.789 this indicates that in the absence of complications, spinal decompression and fusion surgeries would result in a satisfied patient even in the elderly with comorbidities. therefore, measures to reduced complications in such patients should be looked at rather than denying surgical management in symptomatic patients due to their old age or comorbidities. this study evaluates the perioperative complications and the contributing factors in patients over 60 years of age undergoing lumbar fusion surgeries. patients aged 60 years and above with one or more comorbidities undergoing lumbar decompression and instrumented fusion at our institute between january 2012 and december 2013 (2-year period) were included in the study. in all these patients, perioperative complications (intraoperative and complications occurring within 3 weeks postoperative period) and their incidence were recorded. the technique was a standard open technique of pedicle screw instrumentation and fusion, either interbody by transforaminal approach or posterolateral using morcellized bone from the posterior elements or rarely with iliac crest. age, number of levels instrumented and fused, operative time, blood loss, comorbidities, and the duration of stay were correlated with the incidence of perioperative complications using spss software (ibm, spss statistics v 23.0, new york, united states). factors contributing to perioperative complications were noted and measures to reduce them were suggested by these results and compared with the available literature in discussion. analysis of our medical records revealed a total of 52 patients operated by lumbar fusions in the 2-year study period, who were aged 60 years and above and had one or more comorbidities. most common indication for surgery was spondylolisthesis in 17 (32.7%) followed by lcs in 15 (28.8%) patients. hypertension (htn) was the most common comorbidity found in 39 patients (75%), followed by diabetes mellitus (type 2) in thirty patients (56.4%). twenty patients had single comorbidity while 18 patients had two comorbidities and 13 patients were found to have three comorbidities [table 1]. preoperative mri t2w, midsagittal (a) and axial (b) images showing multilevel listhesis and canal stenosis. postoperative x-ray lumbosacral spine anteroposterior (c) and lateral (d) views showing implant (pedicle screws) in situ following instrumented fusion diagnosis and comorbidites of patients forty six patients were operated under general anesthesia (ga) while the remaining six patients were operated in regional or spinal anesthesia. 3.8 levels were the average levels instrumented per patient while one patient underwent 9 levels instrumentation. interbody fusions were performed at single level in 24, 2 levels in 22, and 3 levels in 6 patients. average operative time and blood loss were 150 min (range 60270 min) and 369 ml (range 901050 ml), respectively. both operative time and blood loss the levels of instrumentation and fusions were decided on segmental instability observed on dynamic radiographs. the interbody fusions were based on degree of segmental stenosis, disc degeneration, and instability. clinical details of patients operative time and blood loss with respect to the number of interbody fusion levels a total of 11 complications were noted, 3 systemic and 8 local. among the systemic complications, 2 were hypostatic pneumonia with secondary infection and one was a psychiatric illness called ganser's syndrome. all the three patients required transfer to icu and one patient with pneumonia expired due to septicemia and shock. the average total duration of stay in the hospital was 6.2 days (range 4-14 days). on comparing the complication rates with other variables, we found that the patients with complications had higher blood loss, operative time, number of instrumented levels, and number of interbody fusion levels [tables 4 and 5]. similarly, the duration of stay was longer in these patients. on analyzing these results statistically by anova, the association of blood loss with complications was found to be statistically significant with p=0.002. the duration of stay, operative time, and number of interbody fusion levels were close to significance with p=0.63, 0.58, and 0.61, respectively, while number instrumented levels and the number of associated comorbidities showed no significance [tables 4 and 5]. the complications and their incidence comparisons of different variables in patients with and without complications on analyzing the correlations between different variables, we found that there was a strong positive correlation of blood loss with operative time, number of instrumented levels, and number of interbody fusions which was statistically significant. similarly, operative time showed a strong positive correlation with number of interbody fusions and a significant but a weaker positive correlation with number of instrumented levels [table 6]. the perioperative complication rates in the present study occurred in 11 of 52 patients with an incidence of 21%. increased blood loss strongly correlated with the incidence of complications. age, operative time, number of levels of fusion, and the duration of stay were also more in patients with complications and were close to statistical significance while number of instrumented levels and number of associated comorbidities were unrelated to the complication rates. perioperative complication rates in instrumented lumbar fusions in patients above 60 years of age described in literature range from 29% to 62% [table 7]. reported increased complications in patients with advanced age and surgeries with increased blood loss and number of levels of fusions.1112 carreon et al.11 found increased complication rates with increased operative time while cho et al.12 found no such association. guigui et al.10 found comorbidities to influence the complication rates and a similar study by acosta et al.4 found ten times higher complication rates in patients with htn while others found no association between comorbidities and the perioperative complications.612 the incidence of complications and factors affecting it described in the literature considering the group of population included, the complication rate in our series was within the acceptable limits compared to literature [table 7].4611121314 our patients were 60 years and above with the average age of 69 years, all of them had one or more comorbidities, and the average number of levels fused was 3.8, making this group more vulnerable for complications. despite this, the complications in our series were about 21% with most of them being minor reversible complications such as dural tear, transient root deficits, and postoperative persistent radicular pain. similarly, the operative time and blood loss, in our series, was lesser compared to that described in literature for multilevel fusions [table 7].4611121314 the blood loss in literature ranged from 206 ml in single level to 2056 ml in 9-level fusions and the operative time ranged from 145 min in single level to 415 min in 10.5-level fusions [table 7].4611121314 in comparison in our series with an average of 3.8 levels of fusion, the average operative time and blood loss were 150 min (range 60270 min) and 367.45 ml (range 901050 ml), respectively. this could possibly explain the lesser complication rates in our study as the complications were strongly related to the operative time and blood loss. on reviewing literature and analyzing our surgical technique, we found several strategies that helped in reducing the blood loss and operative time, and hence the complications. injection tranexamic acid 1 g intravenous was given routinely preoperatively, immediately before skin incision in all cases. literature describes that a single dose of tranexamic acid 15 mg/kg can effectively reduce blood loss without increasing the risk of deep vein thrombosis.15 the other technique employed in our surgeries was simultaneous exposure and instrumentation on either side by two trained spine surgeons [figure 2]. this reduced the surgery time and also the blood loss as compared to a single surgeon exposing and instrumenting one side after the other. we employed a laminectomy technique described by okuda et al.16 in which lamina was removed as a single fragment using osteotome and making cuts at pars on either side. this further reduced the operative time as compared to the classical technique of removing the lamina piecemeal by rongeurs. (a and b) intraoperative images showing the technique of bilateral exposure and bilateral instrumentation operative time and blood loss were strongly related to the number of levels of vertebra instrumented and fused. even though operative time and blood loss could be reduced by reducing the number of instrumented and fused levels, not instrumenting or fusing the levels when indicated would compromise the principles of surgery and therefore affect the clinical outcome. hence, the number of vertebrae fused or instrumented should be restricted to the minimum indicated levels, without compromising on indications. we also found that the blood loss increased steeply with number of interbody fusion levels. the average blood loss in single level interbody fusion was 307 ml which increased to 362 ml in 2 levels and almost doubled in 3-level interbody fusions [table 3]. the reason for this exponential increase being continued bleeding from the bed of prepared interbody levels while performing the next level. performing interbody fusions at selected levels such as the most stenotic or unstable levels or at the bottom of the construct and posterolateral fusions at other levels also could reduce the blood loss and hence the complications [figures 3 and 4]. bar diagram showing the relation between the intraoperative blood loss and number of interbody fusion levels postoperative x-rays anteroposterior and lateral views of lumbosacral spine showing interbody fusions at l2l3, l4l5, l5s1 with posterolateral fusion at l3l4 images apart from reduction in operative time and blood loss, a thorough preoperative workup with concerned specialist consultations such as pulmonologist, cardiologist, and optimization of the medical conditions helped in reducing the anesthetic risks during surgery. six of our patients in the series underwent surgery under spinal or combined spinal epidural anesthesia, due to poor pulmonary or cardiac status. studies have shown regional anesthesia (ra) in spine surgery to have many advantages over ga in high-risk patients, like lesser anesthetic intraoperative complications, lesser postoperative htn, respiratory and cardiovascular complications, lesser postoperative vomiting, longer postoperative analgesia, and shorter hospital stay.1718 as surgeons we found spinal anesthesia to be satisfactory with reduced blood loss due to stable blood pressure one of these patients underwent surgery in sitting position which has shown in literature to be more convenient for the patient under ra, with the blood draining by gravity, resulting in clearer operative field and also reduce anesthesia complications by creating a hemodynamic status similar to that in othostasis.19 early mobilization postoperatively with optimal control of medical comorbidities also helped in reducing the early postoperative complications. lumbar fusion surgeries in the elderly with comorbidities have higher complications rates. increased intraoperative blood loss significantly correlated with the complication rates. spinal decompression and fusion surgery when indicated should not be denied merely considering the age and comorbidities of the patients, fearing complications. causes and measures to reduce complications should be considered as the outcome of surgeries in these patients in the absence of complications is good. the authors propose some of the measures to reduce the operative time, blood loss, and hence the complication rates in these patients. mahesh-research grant by ulrich india and consultancy from medtronic india ltd.upendra-research grant from medtronic india. mahesh-research grant by ulrich india and consultancy from medtronic india ltd.upendra-research grant from medtronic india.

background: spine surgery in elderly with comorbidities is reported to have higher complication rates and increased cost. however, the surgical outcome is good irrespective of the complications. hence, it is essential to identify the factors affecting the complication rates in such patients and the measures to reduce them. this retrospective observational study determines the perioperative complications, their incidence and the measures to reduce complications in the elderly with comorbidities, operated by instrumented multilevel lumbar fusion. materials and methods: patients aged 60 years and above with one or more comorbidities operated by multilevel instrumented lumbar fusion in our center between january 2012 and december 2013 were included in the study. perioperative complications and their incidence were calculated. age, number of levels fused, operative time, blood loss, and complication rates were correlated with the duration of stay and the incidence of perioperative complications using spss software. measures to reduce complications are determined by these results and by review of literature. results:fifty two patients were included in the study (28 females and 24 males) with an average age of 69 years (range 60-84 years). hypertension was the most common comorbidity followed by diabetes. spondylolisthesis was the most common indication. eleven complications were noted with an incidence of 21%. three were systemic complications which required transfer to intensive care unit. local complications were incidental durotomy (three), transient root deficits (two), wound infections (one), and persistent radicular pain (two). operative time and blood loss were significantly higher in patients with complications. conclusion:complication rates strongly correlate with the blood loss and operative time. reducing the operative time and blood loss by intraoperative tranexamic acid, laminectomy using osteotome, simultaneous bilateral exposure and instrumentation and reducing the number of interbody fusions can help in reducing the complications.

PMC5361463

pubmed-1114

while the term textiloma is used to describe a mass lesion consisting of surgical sponge, the term gossybipoma is reserved for both the mass of sponge and the foreign body reaction around it. these pathologies can mimic other common spinal mass lesions such as hematoma, abscess, soft tissue tumor, etc. their presentation is well known but varies with each case due to different kinds of reactions of body. in literature, 46 cases of gossybipoma involving the spine have been reported;[13419] however, it is thought to be more than this number because of medico-legal issues. in this report, we present a case of paravertebral gossybipoma, with a short review of the clinical presentation, radiologic findings and differential diagnosis of these lesions. a 40-year-old woman presented with a history of spinal operation for l4l5 lumbar disk herniation before 8 months and got admitted with non-purulent serous leakage from a small (5 mm) detachment in the surgical wound. the wound was minimal erythematous at the detachment site, but there was no tenderness, swelling or fluctuation. there was no fever, and routine laboratory tests including complete blood count, erythrocyte sedimentation rate, c-reactive protein and blood biochemistry were all normal. microbiologic investigations of the serous leakage revealed no pathogens. while waiting for the microbiological results, treatment with first-generation cephalosporin was started and continued for 4 days, and the serous leakage stopped immediately with secondary healing of the wound in a 1-week period. however, the patient's same complaints recurred, and thus she got admitted again to our clinic. a computed tomography (ct) of the lumbar vertebrae revealed a hyperdense mass lesion located in the left side of the previous operation site. magnetic resonance imaging (mri) showed a mass lesion in the left paravertebral area, which was hypointense on t1- and t2-weighted images, with peripheral hyperintense ring in t2-weighted images. mri post-contrast images showed ring enhancement of the lesion [figure 1]. lumbar imaging of our case revealed a paravertebral mass lesion located in the left side of the previous operation site (arrows). (a) axial ct scan, (b) axial post-contrast enhanced mri, (c) sagittal t2-weighted mri the patient was operated by lumbar midline reincision, and the exploration of the left paravertebral area revealed a retained sponge. the sponge was found adherent to the surrounding soft tissue by the new formed fibrotic tissue, which required individual dissection of these fibrotic attachments. histopathologic examination revealed mononuclear cell infiltration and fibrosis formation around the retained sponge [figure 2]. the patient's complaints showed improvement with no neurologic deficits, and the patient was discharged on postoperative day 3 without complications. a photomicrograph shows the mononuclear cell infi ltration and fi brosis formation around the retained sponge (h and e, 200) many different kinds of hemostatic agents absorbable and non-absorbable are used to control intraoperative bleeding in neurosurgical operations. non-absorbable materials include various forms of cotton pledgets and synthetic hemostats, which should be removed before surgical closure. retained surgical sponges can be found following abdominal, gynecologic, urologic, thoracic, orthopedic or neurosurgical procedures. they are encountered in abdominal and thoracic cavities more commonly but they are also reported after extremity and spinal surgeries. a retained surgical sponge is thought to be a common entity; however, due to the medico-legal issues, only a few cases in the literature have been reported. while the term textiloma is used to describe a mass lesion consisting of surgical sponge, the term gossybipoma is reserved for both the mass of sponge and the foreign body reaction around it. in the literature, there are 46 reported cases of gossybipoma after spinal surgery since 1965.[13419] in these reports, patients had presented mostly with complaints of back pain, common motor weakness and/or sensory deficits in neurologic examination, with no infectious findings, at which the placement of surgical sponge occurred at least a couple years ago before the admission.[151719] on the other hand, some cases admitted with fluid leakage after only a short time of the first operation. in our case, the patient presented with sterile serous leakage from the operation wound, 8 months after the previous operation. after surgery, the body gives two types of foreign body reactions against retained sponges: (1) the exudative type tissue reaction, which leads to acute abscess formation, with a tendency to form fistulas through the skin and (2) aseptic fibrous tissue reaction, which involves slow adhesion formation, such as encapsulation and granuloma formation. while the time interval to clinical presentation is short with the exudative type tissue reaction, it ranges to even decades after surgery with aseptic fibrous tissue reaction. surgical sponges with radiopaque markers are used now in most of the medical centers. due to this imaging characteristic of the gossybipomas, plain radiographs and/or had reported 13 patients with gossybipomas in thorax and abdomen, and remarked that the radiopaque marker inside the gossybipoma was seen in only nine patients (69.2%) and even then did not always lead to diagnosis. in our case, the gossybipoma was revealed in ct scans as a hyperdense mass lesion, although it was not diagnostic for this lesion. because the differential diagnosis of paraspinal lesions in patients with history of spinal operations include hematomas, abscess or residual/recurrent tumors, mri with intravenous contrast enhancement is known to be the best radiologic investigation modality in these situations [table 1]. kim et al. stated that mri usually shows a well-defined mass with a fibrous capsule that exhibits low signal intensity on t1-weighted images compared with the signal intensity of the paravertebral back muscles, high signal intensity in the center with hypointense rim on t2-weighted images, and strong peripheral enhancement in post-contrast images. on the other hand, mri of our case demonstrated a mass lesion, which was hypointense on both t1- and t2-weighted images, with peripheral hyperintense ring in t2-weighted images and peripheral enhancement in post-contrast images. accordingly, we believe that despite the importance of the mri in the diagnosis of gossybipoma lesions, the definitive diagnosis must be mainly aided by the high suspicion profile of the physician and the intraoperative findings. in patients with the history of spinal operation, gossybipomas should always have a place in the differential diagnosis of newly found lesions, as it is believed that they are much more common than they are reported. however, no pathognomic radiologic characteristics are defined for these lesions. for this reason, the definitive diagnosis must be mainly aided by the high suspicion profile of the physician and the intraoperative findings. thus, it must be remembered that careful inspection of the surgical field before closure is still an important basic rule in surgery.

spinal or paraspinal retained surgical sponges (gossybipoma or textiloma) are rare incidents and mostly asymptomatic in chronic cases, but can be confused with other masses such as a hematoma, an abscess or a tumor. in chronic cases, the presentation can be as late as decades after the initial surgery; however, some gossybipomas cause infection or abscess formation in the early stages. the authors report a 40-year-old woman with a history of operation for lumbar disk herniation before 8 months, and got admitted with a complaint of serous fluid leakage from the operation wound. in this report, the authors discuss the clinical presentation, the radiologic findings and the differential diagnosis of gossybipoma.

PMC3139335

pubmed-1115

multiple sclerosis (ms, omim 126200) is the most common cause of nontraumatic chronic neurological disability of the central nervous system (cns), characterized by demyelination, axonal degeneration, and inflammation (1-5). the disease onset usually occurs in young adults and it is more common in females, with prevalence rates varying across ethnic groups and depending on geographic latitude (6-8). most ms patients (85%) present a relapsing-remitting ms (rrms) clinical course at the onset, while the remaining groups of patients present primary-progressive ms (9). epidemiological analysis shows that ms results from unknown environmental factors, acting on genetically susceptible individuals (10). susceptibility to ms is held to have a strong genetic component in a large degree, as shown by the increased risk of the disease seen among relatives of affected individuals (11). genetic contributions are clearly included at least in 20% of affected individuals, indicating the family background of the disease. concurrence rates comprise 26% monozygotic twins compared to 3% in dizygotic twins (12). although the etiology of ms is unknown, epidemiological data recommend that predisposition to the disease is approximately genetically found out and linked to a number of genetic loci. an association with human leukocyte antigen (hla) class ii is well recorded (13). tumor necrosis factor (tnf-) gene is located between the hla-b (class i) locus and the class region in tandem in the major histocompatibility complex (mhc) region. the location of the tnf locus within the mhc region has generated notion about the emphasis of tnf in the etiology of mhc-associated diseases, especially those with an inflammatory or autoimmune history. ms is not figured as a hereditary disease; although, a lot of genetic variations have been exhibited to increase the risk of developing the disease (8, 13). the role of tnf- in a demyelinating disease such as experimental allergic encephalomyelitis (eae) is well understood and increasing evidence exists to recommend a role for tnf in the pathogenesis of ms (13). considering the significant differences between the tnf- microsatellite polymorphism gene in patients with ms and healthy controls in europeans, we studied the role of tnf- genotype in ms by determining the correlation between the tnf- microsatellite located in the hla region and ms in patients of two southern provinces of iran (hormozgan and fars). from february to november 2012, all individuals involved in this comparative case-control study gave written informed consents for the genetic analysis according to the iran medical committee. the 81 unrelated patients with ms (26 males and 55 females) considered in this study lived in these two southern areas of iran (hormozgan and fars provinces) and had iranian origins dating back at least three generations from both maternal and parental sides. they were classified according to the poser criteria (14) and diagnosed with either clinically definite (90%), laboratory supported definite (7%) or clinically probable (3%) ms. all the controls were free from acute or chronic internal and neurological diseases, determined by physical examinations. hla typing had been previously performed for hla class ii alleles: increase of drb1*15 allele (p<0.005) in the patients was the most important point. genomic dna was extracted from peripheral blood using dna extraction kit (dnptm, cinnagen co., iran) according to the manufactures protocol and stored at -20c until used. using spectrophotometry, the dna quantity was evaluated in each sample. the microsatellite marker used in this study contained ac/gt repeats and had 13 alleles. the amplification was carried out in a pcr reaction using 5'-gcctctagatttcatccagccaca-3 ' and 5'-cctctctcccctgcaacacaca-3 ' primers. of the genomic dna, a 100 ng sample was amplified in a total volume of 10 l containing 10 mm tris-hcl, 50 mm kcl, 1.5 mm mgcl2, 250 m of each dntp, 1 m of each primer and 0.5 u of taq dna polymerase (fermentas, germany). the following thermal-cycling conditions were used: initial denaturation at 94c for two minutes, 30 cycles of 94c for 45 seconds, 65c for 30 seconds and 72c for 45 seconds, and final extension at 72c for 10 minutes. the amplified products were loaded into a 9% polyacrylamide gel with a standard x174/hinf1 marker (15). chicago, il, usa) in which all the averages were reported as mean sd and frequencies as percentage. allele, genotype and haplotype the frequencies were analyzed using gene pop program (http://genepop.curtin.edu.au) and the comparison of intergroup differences were conducted by the chi-square and t tests. test of hardy-weinberg (hw) equilibrium was carried out for tnf- microsatellite gene in the case and control populations to check any significant deviation. our study was performed in a case-control design consisting of 163 people (81 patients with ms and 82 hcs). basic demographic details of the patients were unremarkable with mean age [mean sd] of 31.20 9.11 years, mean expanded disability statue score (edss) of 4, mean disease duration of 8.55 years, mean age at diagnosis of 27.49 9.07 years, and female: male ratio of 2.12. in total, 83.95% of the patients had rrms, 11.11% had secondary progressive disease (spms), and 4.94% had primary progressive multiple sclerosis (ppms) at the time of assessment. a total of 82 unrelated healthy controls (27 males and 55 females; mean age 34 4.7 years) with almost the same ages, sexes and geographical origins as cases were selected for this study. most of the case group had a family history of ms (89.9%, p<0.005). all the 13 alleles were identified for tnf- microsatellite and genotypic distribution of tnf- microsatellite differed significantly between the two population (p<10-4) (table 2). tnf-a*11 and tnf-*10 alleles increased significantly in patients with ms (0.25, p<0.005 and 0.19, p<0.005, compare to 0.06 and 0.08, p<0.005, respectively). in contrast, tnf-*1 and tnf-*2 allele frequencies decreased in patients (0.01 and 0.02 respectively, p<0.005), compared to hcs (0.15 and 0.21, p<0.005). the heterozygosity for the tnf- microsatellite gene was particularly high in this study (0.8); the tnf- genotypes in studied population were in hardy-weinberg equilibrium (p=0.002 for cases and p=0.05 for controls). linkage analysis is a main method for recognition of genetic factors which can cause diseases. however, this procedure is not enough for finding the etiology of complex diseases such as ms. to date, crohn's disease is the only one that can be diagnosed successfully using linkage analysis (16). we screened tnf- microsatellite polymorphism in patients with ms to find their association in an iranian population. to our knowledge, this is the first study on tnf- microsatellite performed in a tropical area of iran, showing association with pathogenesis of ms. the position of tnf- gene within the hla region has led to paying more attention to the role of tnf- alleles in etiology of ms (15). the tnf- gene is located tandemly and maps within the mhc region centromeric to hla-b and telomeric to the class region on chromosome 6p2l.3. its chromosomal region and the immunomodulatory influence of this gene have caused much more speculation about the role of the tnf locus in mhc-linked diseases (17). it has been repeatedly suggested that genetic predisposition to ms might be influenced by tnf gene polymorphism (3, 18). the investigation of polymorphic markers (including microsatellites) within the tnf locus has resulted in a lot of studies which have shown the relationship between tnf haplotypes and pathogenesis of the disease (17). to find the association of tnf- polymorphism and ms, goertsches et al. performed a research on 200 patients with ms (67 males and 133 females) and 200 hcs in a spanish caucasian population. all the patients had clinically definite ms according to poser and mcdonald criteria (14, 19, 20). performing pcr according to the genetic analysis of ms in europeans (games) consortium (http://www-gene.cimr.cam.ac.uk/msgenetics/games), tnf- polymorphism showed a significant correlation, which confirmed the association of this microsatellite marker and the etiology of this disease (20). as a part of the games collaborative project, godde et al. screened microsatellite markers in 198 germans with ms and 198 hcs to identify any susceptible region to ms. performing pcr and statically analysis, tnf- marker residing in the hla region on chromosome 6p21 showed the most significant relationship (12). comparing gene frequencies of tnf- alleles in a french population of 74 patients with ms and 75 hcs, lucotte et al. showed a strongly significant positive association between tnf-*11 allele and ms (15). our results were consistence with those of a study on europeans patients with ms in the huge games project using 6000 microsatellite markers. the games collaborative screened 19 case-control cohorts and 10 trio family-based cohorts (8, 21), as described in the original publications: australia (22), belgium (23), finland (24), france (25), germany 1 (6), germany 2 (26), hungary (27), iceland (28), ireland (29), italy (30), poland (31), portugal 1 (32), portugal 2 (33), sardinia (34), scandinavia (35), spain (20), turkey (36), and uk (37). it was found that some special alleles of these markers were noticed significantly more usual in ms groups, as compared with the hc groups. in the games project altogether involving 13896 individuals, meta-analysis determined by the fisher's method for the six markers was validated. three non-mhc markers and three mhc markers (including tnf- marker) were identified to be potentially associated with ms (10). our findings also demonstrated that the tnf-*11 allele was more frequent in rrms, ppms and spms groups than the hcs, suggesting a possible genetic predisposition to ms in iranians patients with ms. a large number of microsatellites from the human mhc region presented the polymorphism information content (pic) of around 0.75. for the tnf- microsatellite locus, pic values around 0.85 have been observed (38). in the iranian population (current study), the findings indicated the association between tnf- microsatellite polymorphism in the hla region and the risk of developing ms in the native iranian population. our findings also confirmed the relationship between tnf- microsatellite and predisposition to ms, as reported previously by the games project. however, achieving the exact results need similar studies in other parts of iran as well as in other parts of asia.

background: multiple sclerosis (ms) is an immune-mediated disease of polygenic etiology. tumor necrosis factor- (tnf-) microsatellite as a proinflammatory cytokine is believed to play an important role in the etiology of this disease. objectives:the aim of this study was to investigate the association of tnf- microsatellite sequence variation in patients with ms and its risk factor in the southern iranian population. patients and methods: this polymorphism was investigated in an iranian population of 163 native southern people [81 patients with ms according to the poser criteria and 82 healthy controls (hc) with the same age, sex, social, ethnical and geographical features (hormozgan and fars provinces)]. all the controls were nonimmunological, neurological patients. all the cases and controls were chosen randomly and genotyped for polymorphism of tnf- microsatellite. results:the frequencies of tnf-*11 (0.25, p<0.005) and tnf-*10 (p<0.005) alleles increased in patients with ms compared with controls, showing a significant difference among the studied population. conclusions:the current study adds evidence to the association of tnf- gene polymorphism and ms in this southern south iranian population which is consistent with the genetic analysis of ms in europeans (games) project reports and these two alleles reported in this study may be one of the genetic risk factor for ms. furthermore, this data can be used to build the iranian gene bank for future studies.

PMC4341370

pubmed-1116

renal cell carcinoma (rcc) is defined by the national cancer institute (nci), as the most common type of kidney cancer, which develops in the lining of the renal tubules of the kidney. the highest incidence of rcc between 1998 and 2006 was observed in north america and the czech republic. cytokine therapy is beneficial only to a small number of patients (without multiple unfavorable prognostic factors) and is associated with the occurrence of severe adverse effects. even though substantial progress in general cancer diagnosis techniques has been achieved, as much as around 2030% of patients are diagnosed with metastatic rcc (mrcc). what is more, 20% of patients will relapse after nephrectomy and will develop mrcc in the first 12 months after surgery. molecular therapies such as targeting the mammalian target of rapamycin (mtor) and vascular endothelial growth factor (vegf) are the main achievements in modern rcc treatment. subtypes of rcc are as follows: clear cell, 83%.papillary (chromophil), 11%.chromophobe, about 4%.collecting duct carcinoma, about 1%. rcc is one of the most vascularized solid cancers and angiogenesis plays a pivotal role in growth of renal tumors (especially ccrcc), because of upregulation of proangiogenic vegf and platelet-derived growth factor (pdgf). the upregulation is caused by mutation in the von hippel-lindau (vhl) gene, which induces overexpression of hypoxia-inducible factor (hif) [3, 5, 6]. the main function of tyrosine kinase is to transfer a phosphate group from atp to a protein in a cell. tyrosine kinases function plays a pivotal role in many signal transduction cascades in which extracellular signals are transmitted through the cell membrane to the cytoplasm or nucleus, where gene expression is modulated. tyrosine kinase receptors (tkrs) are cell surface receptors for many polypeptide growth factors, hormones, and cytokines. tkrs are the key regulators of normal cellular processes and have a critical role in the development and progression of many types of cancer. vegf and pdgf receptors play crucial roles in angiogenesis, mainly via induction of cell survival, invasion, and proliferation, as well as exhibition of tyrosine kinase activity. to block the physiological function of some of the tkr class receptors, tyrosine kinase inhibitors (tkis) currently the food and drug administration (fda) approved the following tkis: sunitinib, sorafenib, axitinib, and pazopanib [5, 9] for use in therapy. bevacizumab, which is an anti-vegf monoclonal antibody, is commonly used, with clinical benefit. sunitinib (sigma-aldrich) is a tyrosine kinase receptor inhibitor, which targets vegf-r1, vegf-r2, vegf-r3, pdgf-r, pdgf-r, kit, flt3, csf-1r, and ret. although novel treatment such as using sunitinib significantly prolongs time to progression, the overall survival of patients diagnosed with rcc is still not satisfactory, which justifies the search for new methods and therapy targets, for which it is necessary to understand the mechanisms responsible for the development and progression of this cancer. the thyroid hormones (ths), thyroxine (t4) and its active form triiodothyronine (t3), are produced by the thyroid gland. in order for the thyroid gland to produce t3 and t4, the most common form of th in blood is t4 (with the ratio t4/t3=20/1); however, t4 is converted to four times more potent t3 by 5-iodinase within the cell. production of t3 and t4 is regulated via a closed loop feedback high levels of t3 and t4 in blood plasma inhibit the production of thyroid-stimulating hormone in the pituitary gland. despite the fact that t3 and t4 are lipophilic, they are not able to diffuse passively through the phospholipid membrane of the cell. instead, the t3 and t4 hormones are dependent on transmembrane iodothyronine transporters [10, 11]. thyroid hormones are known for their impact on metabolism, development, and normal growth mostly during fetal development. in adults, deregulation of thyroid hormone levels can cause hypo- and hyperthyroidism, which is connected with a vast number of clinical symptoms [1215]. what is more, ths may play an important role in tumor promotion or suppression. ths act mainly by their nuclear receptors, which serve as hormone-modulated transcriptional regulators. thyroid hormone receptors (trs) are encoded by two genes, and, which are located on chromosome 17 and chromosome 3, respectively [18, 19]. the thr gene resides in 3p21-25 chromosomal region, which is known to be a hot spot for mutations in genes involved in rcc pathogenesis. the transcripts of thr and thr are alternatively spliced to produce three major isoforms of the receptor: tr1, tr1, and tr2. due to their ability to recruit coactivators and corepressors, those receptors are bipolar in their transcriptional properties, which means that they can activate or repress target gene expression. the chromatin template is modified by auxiliary proteins, which interact with general transcriptional machinery to produce appropriate transcriptional output [21, 22]. mutations in thr are usually the cause of resistance to thyroid hormone (rth) syndrome. ccrcc is one of the cancers in which aberrances in tr are frequently observed, due to localization of the gene in the hot spot for mutations. in addition to its metabolic role, tr1 has been known for its tumor-suppressive function. disrupted expression and activation of tr1 have been previously described in tumors of the thyroid, lung, breasts, or insulinomas. based on research conducted on the cell lines of breast cancer and hepatocellular carcinoma it was proposed that hypothyroidism accelerates the development of metastases and increases the invasiveness of tumor cells; however, tumor growth is slower. studies on those cell lines in a mouse cancer model also showed that changes in stromal cells of tumor microenvironment generated in response to low thyroid hormone levels significantly alter the development of cancer. activation of the kinase-signaling pathway3-phosphatidyl-inositol (pi3k), serine-threonine protein kinase akt, and protein kinase b is associated with a mutation in the tr and the development of cancer. moreover, the function of tr1 as tumor suppressor indicates that the low expression of the receptor can affect the proliferation of cancer cells. for example, in prostate cancer it was shown that the induction of cells by t3 can increase the proliferation of tumor cells by reducing the b-cell translocation gene 2 (btg2) gene expression which is responsible for the regulation of the g1/s transition in the cell cycle. research on the role of thyroid hormone and its receptor has proven over the years to be extremely complicated. the problem is the fact that the impact of thyroid hormone differs in different types of cancer. tr1 is known for its tumor-suppressive role, so it is understandable that expression of this receptor in cancer cell lines is reduced. reports of the possibility of existence of an alternative thyroid hormone-signaling pathway can be found in literature; shibusawa et al. it is known that thyroid hormones are essential for inner ear development; therefore they checked if the same effect occurs in tr mutant mice. they concluded that although not completely normal, inner ear development could occur in the absence of thyroid hormone receptor; thus it is possible that an alternative and novel thyroid hormone-signaling pathway may exist. moreover, analysis of the kegg database showed that thyroid hormones could influence the cell through mapk and pi3k-akt signaling pathways, bypassing thyroid hormone receptors as it is shown in figure 1. finally, nongenomic (therefore not-thr mediated) actions of thyroid hormones include the regulation of ion channels, mitochondrial gene transcription, and oxidative phosphorylation. t4 through its own mechanism of action can promote angiogenesis and cell proliferation extracellular signal-regulated kinase (erk) 1/2for transduction of the signal initiated by t4. what is more, lin et al. proposed a model of action for t3 and t4 at the receptor domain of v3. in this two-site model, site one (s1) is exclusively reserved for t3 and activates pi3k and src kinase. activation of those kinases leads to the transcription of hif-1. site two (s2) however can be activated by both t3 and t4 and act through erk1/2 activation to cause tumor cell proliferation. since signaling pathway activated by t4 via v3 can lead to gene expression, thus, both nongenomic effects of t3 and t4 as well as genomic effects of t3 may overlap in the nucleus. what is more, tetrac which is a deaminated t4 analog has been shown to block hormone binding at s1 and s2 of integrin v3. tetrac blocks nongenomic action of t3 at s1 and both t3 and t4 action at s2; therefore tetrac suppresses the proliferative nongenomic activity of thyroid hormone on cancer cells. this data is supported by finding of yalcin et al. who show that tetrac and tetrac nanoparticles reduced tumor volume in human rcc xenografts. the effect of th depends on the cell developmental state (stem/progenitor/differentiated) and type and physiological state (cancerous/healthy). since in this case healthy and cancer cell lines are compared, it is understandable that the effects of t3 hormone are different. effect of t3 on the cell cycle in rcc cell lines has never been described previously. according to the literature, effects of t3 can promote or decrease the proliferation rate in different cell lines [17, 39, 40]. t3 is produced by (extrathyroidal) conversion of t4 by di highly expressed in kidney. the expression of di has also been reported as downregulated in rcc (in comparison to normal kidney). it had been previously shown that the thr gene is frequently mutated in rcc [4244]; however it was only shown for tissue samples but not established cell lines. in first report kamiya et al. found that 40.9% of tested ccrcc samples had at least one tr mutation; however, there is no information about the reference sequence or the percentage of mutations in samples derived from the healthy kidney. nevertheless, mutations were reported to be found in seven of twenty-two investigated cancer samples. finally, if the ccrcc samples were compared with samples from the healthy kidney, there is no information if sequences obtained from control samples were identical to each other. future sequencing research with a broader panel of rcc cell lines and with different primers is needed; however, it is possible that commercially available cell lines are an inadequate model to investigate mutations in rcc. thr mutations were further studied functionally and it was shown that most of these rcc mutants result in expression of a receptor that is impaired in t3-mediated transcriptional activity. moreover, receptors that are not fully functional are dominant-negative inhibitors of wild type thr1 expressed from second allele. mutations in the t3-binding domains of the receptor s380f, e299k, h412r, y321h, and l456s reduce t3 binding activity at different rate between 35 and 60%. in specific cases including q252r w219l, f451s, f451i, f417l, and mutations in dna binding domain like k155e may result in the 100% loss of dna binding activity of thyroid hormone receptor. in selected mutants loss of transcriptional activity results from lower avidity and defective t3 binding. in other cases, transcriptional inefficiency reported for thr1 mutants results from altered corepressors binding and release. these mutants may require significantly higher hormone concentration to release the corepressor and activate transcription. in selected cases increase in corepressor affinity is accompanied with modified corepressor and corepressor splice variants specificity and this may render thr1 mutants toward resistance repression inhibition. finally, thr1 mutants were shown to harbor greatly expanded target gene specificity that is not homologous with that of the wild type thr1. interestingly upregulation of the von hippel-lindau (vhl) tumor suppressor was found in rc15-tr1 mutant cells. in functional study t3 had no direct effect on transcription of hif-1, but activation of thr1/rxr- (retinoid x receptor alpha) heterodimer by t3 stimulated expression of hlf (hepatic leukemia factor), which finally promoted hif-1 expression. disrupted tr1 activity may be the result of reduced tr1 expression, loss of heterozygosity at the thrb locus, decreased intracellular concentrations of t3, mutation in dna at the thrb locus, altered interaction with coregulators, aberrant splicing and sequence of tr1 utrs, or increased expression of mirnas that interact with the thr1 3 utr. in first reports thr1 at the transcriptome level (mrna) was reported as overexpressed in 30% and downregulated in 70% of tumor samples. in the same set of tissues, at the proteome level, expression of thr1 was decreased 1.7 times in tumors tissues when compared to healthy kidney from the same patients. in this report it was revealed that decreased thr1 protein level was found in 87% (20/23) cancer samples when compared with normal adjacent tissue from the same kidney. another dissonance between the relative amount of thr mrna and protein in the cancer cell line when compared to healthy (control) cells was observed by master et al.. expression of thr was correlated with thr in cancer ccrcc tissues, but not in normal kidney samples. in more recent study tr1 mrna and protein levels were reduced by 70% and 91%. this 70% reduction was reported on thr mrna coding sequence, but reduced expression of 5utr variants a and f has been reported in 75% and 62% tumors, respectively. in rcc cell culture model it was shown that weakly folded variant a (ay286465.1) of 5utr promotes the highest level of thr expression, while strongly folded variants f (ay286470.1) and f1 (gq456950) result in low transcription and translation rates and low thr expression and in rcc the delicate balance between a and f/f1 variants is disturbed. reported discordance in tr1 mrna level and protein along with mutations in thr 5utrs deregulating mrna stability and transcription rate suggests that thr expression is regulated mostly by posttranscriptional events along with epigenetic modifications and specific transcription initiation control [31, 45, 49]. tyrosine kinase inhibitor rcc therapy is associated with development of hypothyroidism in up to 25% of patients as per registered trials (average value for subclinical and clinical hyperthyroidism) [5052] and up to 100% in selected it is important to notice that subnormal levels of serum tsh do not always reflect the presence of subclinical hyperthyroidism and in the major part of available literature the definition of hypothyroidism is unclear. among patients treated with sorafenib, sunitinib, pazopanib, and axitinib, those treated with axitinib develop thyroid dysfunction faster and more pronounced compared to the others. the mechanism through which this tyrosine kinase inhibitor (tki) causes changes in function of the thyroid is not yet fully understood; however, emerging evidence suggests that sunitinib induces hypothyroidism by altering t4/t3 metabolism and thyroid capillary regression. sunitinib was found to have antithyroperoxidase activity with potency equivalent to 25% of propylthiouracil (6-propyl-2-sulfanylpyrimidin-4-one). it was found that on sunitinib treatment oxidation of iodide ions to iodine atoms required for the synthesis of t4 is reduced. in cell culture model, sunitinib was shown to induce thyroid cells proliferation inhibition (ic50, 14.6 m) and dose-related increase of (125) i-iodide uptake. computed tomography volumetry of thyroid gland on sunitinib treatment revealed that more than 50% reduction in volume may develop in half of the patients. histological study revealed that thyroid atrophy of thyroid follicles with degeneration of follicular epithelial cells is found on autopsy of patients treated with sunitinib for rcc. surprisingly no decease in vascular volume in the thyroid gland was found in these patients. in clinical research it was also shown that iodine uptake is impaired in rcc patients treated with sunitinib and the lowest uptake is reported at the end of on-drug period of sunitinib treatment (end of 4th week of treatment). most recently it was investigated if autoimmunity is coresponsible for thyroid dysfunction in rcc patients treated with sunitinib. it was found that up to 25% of patients develop anti-thyroid peroxidase (tpoab) autoantibodies within 1218 month of therapy with sunitinib. moreover it was found that progression-free survival (pfs) is significantly longer in patients developing these tpoab in comparison to those who do not develop autoimmune response (10.8 months versus 5.8 months). there are also a few other possible explanations: tki-induced inhibition of vegf receptor tyrosine kinases on thyroid cells that result in capillary regression [59, 60], inhibition of iodine uptake, and inhibition of the protein product of the ret protooncogene. moreover, hypothyroidism induced by tkis such as sunitinib may not be an unwanted toxicity because t3 promotes proliferation of cancer stem cells and metastatic and primary cell lines.. showed that patients who developed subclinical hypothyroidism during treatment with sunitinib had a significantly greater probability of responding to treatment. although correlations between hypothyroidism and treatment outcome have been noticed and many researchers confirmed an association between progression-free survival (pfs) and hypothyroidism, the rate of objective remission (orr) (hypothyroid patients versus euthyroid patients: 46.7 versus 13.7%, resp.; p =0.001), and the median overall survival (hypothyroid patients versus euthyroid patients: 39 versus 20 months, resp.; p =0.019), some researchers argue that there is no certainty that hypothyroidism can be considered as an independent prognostic marker, because it is still unclear if the induction of hypothyroidism is the mode of sunitinib action or this phenomenon is dependent on pharmacokinetics, height, and weight of the patient or affinity to tyrosine kinase receptor. it was suggested that although pfs is longer in these patients, there might be no difference in overall survival of hypothyroid patients. finally, in their study schmidinger et al. reported that there is a statistically significant correlation between hypothyroidism during the treatment of kidney cancer using tyrosine kinase inhibitors and the percentage remission (patients with hypothyroidism versus euthyroid patients: 28.3% versus 3.3%, resp.; p<0.001) and the mean survival time (above and below 13.9 months, resp.; p=0.016). in another study hypothyroidism was associated with a longer pfs in patients treated with sunitinib or sorafenib (16.0 months versus 6.0 months) and replacement with l-thyroxine did not show influence on pfs. recent meta-analysis that covered 250 patients has shown that there is no significant statistical difference in pfs between patients with hypothyroidism on sunitinib and patients without acquired hypothyroidism (hr=0.82 and p=0.22). similar result was calculated for os (hr=0.52 and p=0.01). this leads the authors to the conclusion that development of hypothyroidism during tyrosine kinase inhibitor therapy may not be an independent predictive factor in patients with metastatic renal cell cancer. it is known for a long time that t3 has high impact on cancer development and maintenance; however, there is no fundamental and comprehensive analysis of the role of thyroid hormone in different populations of cancer. of course, many research groups study t3 influence on cancer; however those findings are not structured and can not be compared to each other, because thyroid hormone can act differently in different types of cancer. many research groups provided very important data about t3 and cancer; for example, it has been shown by poplawski and nauman that t3 promotes cell proliferation in rcc in vitro but does not have the same effect on a cell line derived from healthy kidney. what is more, puzianowska-kuznicka et al. and master et al. observed that cells derived from rcc have disrupted tr expression on both the mrna and protein level; therefore disrupted posttranscriptional regulation has been proven for rcc. research by kamiya et al. showed numerous mutations in the thr transcript in the samples derived from rcc patients. however, it is important to mention that studies cited in this paper used supraphysiologic concentrations of t3 in in vitro experiments. concentration of t3 in human sera was described in numerus studies by many groups as 3.07 nm, 1.92 nm, 1.69 nm, and 5.07 nm. what is more, based on these and many other publications it is possible to design and perform functional analysis of the tr1 in different populations of cancer, representing primary tumor, metastatic tumor, and cancer stem cell populations of rcc. it is extremely important to understand the mechanisms responsible for the disrupted influence of t3 hormone on cells of renal cell carcinoma because of its role as a cancer regulator and its link to therapy with sunitinib and other multitargeted receptor tyrosine kinase inhibitors.

it is known that thyroid hormone is an important regulator of cancer development and metastasis. what is more, changes across the genome, as well as alternative splicing, may affect the activity of the thyroid hormone receptors. mechanism of action of the thyroid hormone is different in every cancer; therefore in this review thyroid hormone and its receptor are presented as a regulator of renal cell carcinoma.

PMC4808550

pubmed-1117

twin studies have proved that neurodevelopmental disorders, such as attention deficit hyperactivity disorder (adhd), autism spectrum disorders (asd), as well as psychiatric conditions like schizophrenia (scz) and bipolar disorder (bd) have an important genetic background. nevertheless, until very recently, causal genes have only been found in the context of intellectual disability (i d). classical genetic studies have failed to identify genes with high penetrance in pndd, thus indicating that the genetic background of these disorders is highly heterogeneous. recent developments in dna analysis and sequencing, such as next-generation sequencing, snp arrays, exome sequencing or analysis of copy number variations (cnvs), allow to study the whole genome of large cohorts of affected individuals, enabling the analysis of cns disorders with highly heterogeneous genetic etiology. several of these studies have focused on pndds, uncovering new genes with potential roles in these disorders. interestingly, many of the genes identified are involved in synaptic physiology, pointing towards synaptic dysfunction as an important contributing factor in many of these disorders. although numerous psychiatric conditions have traditionally been ascribed to unbalances in monoaminergic systems, it is also accepted that alterations in the glutamatergic system are involved in these disorders. in particular, an important group of genes expressed at the synapse identified in the context of pndds code for glutamate receptor subunits. glurs comprise three families of ionotropic receptors: ampa (-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid), nmda (n-methyl-d-aspartate) and kainate; as well as three groups of metabotropic receptors (mglurs i-iii). ionotropic receptors are found as tetramers of various subunits: 4 gria genes code for ampa subunits, 7 grin genes code for nmda subunits and 5 grik genes code for kainate subunits. finally, metabotropic receptors, which are g-protein coupled receptors, are coded by 8 grm genes. functionally, ionotropic glurs are specialized on different aspects of synaptic transmission. while nmda receptors act as coincident detectors of postsynaptic membrane depolarization and glutamate release, ampa receptors mediate fast transmission in excitatory synapses. we discuss recently identified mutations in glur subunits in the context of pndds, including large genomic rearrangements directly affecting these genes or point mutations predicted to be deleterious. linkage and association studies of natural variation, such as snps or microsatellites, have not been included in this work as these have a less direct implication in disease. of all four genes coding for ampa receptor subunits, only mutations in gria2 and gria3 have been related with pndds (table 1). alterations in these two genes have been associated with some cases of asd, but have mainly been found concomitant with i d. although chromosomal deletions encompassing gria2 had been described for individuals with mental and developmental retardation (see ref. 12 for review), only recent studies have identified specific mutations in gria2 in the context of i d, suggesting that gria2 haploinsufficiency might cause i d. gria3 was first identified as a candidate gene for x-linked i d in 1999, in a female with a balanced translocation directly involving this gene. since then, several other gria3 mutations have been associated with i d, including complete or partial duplications, mutations on its 5utr and a whole gene deletion. interestingly, both duplications and deletions of gria3, translate into a diminished or absent synthesis of glua3 protein. partial duplications would cause either reduced gria3 transcripts or aberrant protein levels ultimately contributing to i d. missense gria3 variants have also been found linked to i d and, with the exception of the g833r mutation (see table 1) these individuals express gria3 at normal levels. nevertheless, when functionally tested glua3 variants displayed altered channel function either in homomeric combination or in heteromers with normal glua2. glua3 is normally present at synapses together with glua2 contributing to the normal cycling of ampa receptors. from the studied individuals with i d, it can be inferred that the lack of glua3 is not crucial for neuronal viability. in fact, synaptic targeting and function of these receptors are not significantly altered in glua3 ko mice. remarkably, long-term potentiation (ltp), widely thought to be the cellular basis of learning processes, is abnormal in these animals. nevertheless, in humans, the lack of glua3 could impair normal neuronal wiring or stabilization of activated synapses during development. ampa receptor auxiliary subunits, tarps and cnihs, control receptor function by modulating channel trafficking and kinetics. it is interesting to note that a mutation affecting cacng2 (tarp -2) has been described in an individual with moderate i d. this mutation caused a decreased association with ampa subunits, altering the receptor trafficking and reducing mepscs in hippocampal neurons. finally, cnih2 deletion has also been found in a boy with mild i d. thus, it is noteworthy that malfunctions of ampa receptor auxiliary can also be associated with i d. these receptors are composed of two obligatory subunits (glun1) and two variable ones, which consist of either glun2(a-d) or glun3(a, b). of the variable subunits, glun2b expression starts very early in development and is critical for synaptogenesis and neuronal survival in cortical brain areas, thus making it a candidate factor in neurodevelopmental disorders. indeed, grin2b is the most frequently mutated grin gene (see table) in pndds, being mainly related with i d. specific grin2b gain-of-function mutations have also been associated with asd, supporting the hypothesis of an imbalance between excitatory and inhibitory neurotransmission in asd etiology, as well as in west syndrome with severe developmental delay. grin2a de novo mutations and microdeletions have also been associated to i d, indicating the viability of glun2a haploinsufficiency. likewise, a rare grin2a de novo mutation was recently associated with schizophrenia, although the role of glun subunits with scz is under debate. although less frequently, mutations in grin1 gene, the obligatory nmda receptor subunit, have also been identified. a mutation in grin1 has been found to cause non-syndromic intellectual disability (nsid), an observation functionally validated using cellular models. interestingly, regarding grin2c, grin3a and grin3b, only rare truncating mutations affecting both healthy individuals and asd/sz patients have been reported. in contrast, no truncating mutations were found in grin1, grin2a, grin2b and grin2d genes, suggesting a more critical function of these genes during neurodevelopment and the lethality of the putative loss-of-function. taken together, these recent reports suggest that de novo mutations of nmdar subunits are frequently associated with i d, although some specific mutations are also associated with psychiatric diseases. previous classic genetic association studies suggested linkages to mood disorders for some of the kainate receptor-encoding genes, mainly grik2 and grik3 (see ref. more recently, cnvs in grik2 were found enriched in, but not exclusive of, children with i d, indicating limited pathogenic burden. interestingly, a complex loss-of-function mutation in grik2 was found to co-segregate with nsid. this grik2 mutation involves various deletions and inversions spanning exons 7 to 11, resulting in loss of the first ligand-binding domain, the adjacent transmembrane domain, and the putative pore loop of gluk2. this study strongly indicates that loss of gluk2 protein can cause severe-to-moderate cognitive impairment in humans. a grik4 variant with an insertion-deletion in the 3utr region (which results in increased gluk4 levels) was found to confer protection against bipolar disorder. moreover, this grik4 variant increased hippocampal activation during face processing, suggesting a link between kainate receptor-mediated excitation in the hippocampus and bipolar disorder. so far, the subfamily of kainate glutamate receptors is the one for which less mutations have been identified in the context of pndds. however, collectively taken, these results support the notion that mutations leading to up- or down-regulation of kainate subunits can cause learning disabilities and modulate mood disorders. currently, a limited number of papers report deleterious mutations related to pndds in grms (see table 1). of these, two performed grm1 exon sequencing in scz and bd, another sequences the grm3 gene in a cohort of individuals with bd and one performed a genome-wide copy number variation (cnv) association study on attention deficit hyperactivity disorder (adhd). finally, a mutation in the kozak s sequence of grm3 assocaited with scz has also been reported. i d, intellectual disability; nsid, non-syndromic i d; asd: autism spectrum disorder; bd, bipolar disorder; scz, schizophrenia; adhd, attention deficit hyperactivity disorder;*copy number variation study with average cnv size of 62 kb it is important to highlight that, as it happens with genes giving susceptibility to psychiatric diseases, none of the reported mutations supports for a causal role in disease. in most cases, the small number of mutations identified for grms make it still difficult to conjecture on their relevance to disease. nevertheless, a striking observation can be made: there is no report implicating grm mutations in neurodevelopmental disorders such as i d or asd. despite the extensive literature on the role of these receptors, especially grm1 and grm5, in fragile x-syndrome and asd, deleterious mutations on grms have so far been found only in the context of psychiatric disorders, such as scz, bp or adhd. recently developed dna analysis tools are allowing for the rapid uncovering of glurs mutations in the context of pndds. this can be seen by the exponential increase in the number of papers reporting glur mutations in most recent years. based on this, we expect that new glur mutations will be identified in the future, hopefully allowing for a better understanding of glur etiological contribution to pndds. although the number of studies reporting glur mutations in pndd is so far restricted, some initial conclusions can be drawn. these will need to be examined in the light of future studies. in the first place, mutations of subunits of some receptor subtypes are related to certain disease types but not to others. in this regard, mutations in ampa subunits have only been found in the context of i d and asd, both neurodevelopmental disorders. similarly, mutations in genes coding for ampar auxiliary proteins are also related with i d. along these lines, mutations in nmda subunits are mostly linked to i d and asd. in stark contrast, mutations in metabotropic receptors are only related to psychiatric disorders. accordingly, the data available would suggest that mutations in ionotropic glutamate receptors predispose towards neurodevelopmental disorders, while mutations in metabotropic receptors would predispose towards psychiatric disorders. one can also draw a parallel between the extent of mental disability and the contribution to neurotransmission of the affected receptor type. thus, loss-of-function mutations in ampa and nmda subunits are frequently found in patients with i d. this is consistent with their important role in neuronal development, fast transmission, and synaptic plasticity. on the other hand, the abundance of grm mutations in individuals with psychiatric disorders is consistent with the more modulatory role of mglurs. the occurrence of i d in carriers of a mutant gluk2 suggests that tuning of neuronal network activity by kainate receptors can have profound effects on cognitive abilities. while some genes accumulate many potentially deleterious mutations, no mutations have been found in others. amongst ampa subunits, for instance, gria1 and gria4 have not been found mutated in the context of pndd, while twelve different mutations have been described for gria3. remarkably, the spectrum of mutations in nmda subunits concentrates in particular coding regions, namely, the extracellular and pore-forming domains. this observation suggests that impaired ion selectivity and conductance of nmda receptors is closely linked to developmental defects, while the role of its intracellular tail might have a less critical role in disease. there are several potential explanations why some glur genes do not appear mutated in relation to disease; they might play indispensable biological functions, thus leading to lethality even in heterozygosity, or other molecules could compensate for their dysfunction. interestingly, we do not see an increased number of mutations in glur subunits expressed early in development, which a priori, should be more relevant to neurodevelopmental disorders. for instance, a similar number of mutations has been found for grin2b, which starts to be expressed early in development, and for grin2a, that is expressed post-natally. in contrast, no mutations have been described for gria4, also highly expressed during development. nevertheless, this observation should be taken cautiously as mutations in developmental genes could cause lethality and also because gene expression data, mostly obtained from rodent species, might not be completely valid for humans. although the etiopathology of pndds is complex and multigenic, a growing set of genetic and functional evidences indicate the contribution of glutamate receptors in these damaging disorders. the following years will be crucial to understand whether the different receptor subunits are associated with certain pndds or not, as well as their interaction with genetic background and environmental factors.

alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (pndd), but only recent advances in high-throughput dna sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (glur) among afflicted individuals. in this review we discuss recent work describing glur mutations in the context of pndds. although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. in contrast, mutations of metabotropic glurs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. also, the prevalence of mutations among glurs is highly heterogeneous, suggesting a critical role of certain subunits in pndd pathophysiology. the emerging bias between glur subtypes and specific pndds may have clinical implications.

PMC3937208

pubmed-1118

each year there are nearly 795,000 individuals who suffer from a new or recurrent stroke; 10% of these are cases of intracerebral hemorrhage. stroke is the 4th leading cause of mortality according to the latest cdc statistics. among all strokes, the case fatality rate for hemorrhagic strokes (37-38% mortality) is the highest, and most survivors have poor functional outcomes. female gender has been recognized as an important risk factor for stroke, with nhanes reporting that women between 45 and 54 years of age were almost twice as likely to suffer from a stroke than males. a greater decline was also seen in stroke-related deaths among males as compared to females between 1980 and 2005. a recent review concluded that although the incidence of stroke was higher in males, females were more severely ill. internationally, it has been reported that the stroke burden is higher in females, because of a higher prestroke and poststroke disability [58]. this difference in disability after stroke between men and women is seen not only physically but also psychologically. no published literature, however, answers the question of gender differences specifically in acute hemorrhagic stroke. since acute nontraumatic intracerebral hemorrhage (ich) contributes greatly to the poststroke morbidity and mortality burden on the health system, we sought to determine gender differences in an exclusive cohort of first time hemorrhagic stroke patients presenting to our emergency department. this was an institutional review board approved, consecutive cohort study, conducted in the emergency department (ed) of our academic institute with an annual census of 75,000 visits. all adult patients who presented with a diagnosis of spontaneous nontraumatic intracerebral hemorrhage (ich), from january 2006 to december 2008, were eligible for inclusion in the study cohort. all pediatric patients, patients with subdural, extradural, or subarachnoid hemorrhage, and patients with a recurrence of intracerebral hemorrhage were excluded from the final cohort. written consent was obtained for use of medical records from patients at admission to the hospital. the medical records of these patients were reviewed by two independent abstractors for demographics, arrival characteristics, vitals, symptoms, signs, laboratory parameters on presentation, past history of risk factors, treatment, and discharge status. the stroke severity was obtained in the form of nihss scores, calculated on the basis of the examination notes of the neurologist on call [10, 11]. the clinical interpretation program of the ge/marquette mac-8 digital ecg chart determined the intervals on the ecg. the functional outcome at discharge was noted as the modified rankin score (mrs) at discharge. this was stratified into two categories good outcome (mrs<3) and bad outcome (mrs 3). the ct scans of these patients were studied to calculate the volume of hemorrhage using the abc/2 method. the topographic area affected by the hemorrhage and the intraventricular extension of the hemorrhage were also noted. a close network of primary care and a single unified hospital system, in our county, enabled us to collect data on mortality outcomes on all patients in the study. abstractors met periodically to discuss possible ambivalent data and to ensure uniformity in data collection. all associations between nominal variables were analyzed using the pearson chi-square test or fisher's test wherever applicable. multivariate logistic regression was performed to adjust for potential confounding factors to evaluate the association between gender and stroke outcome. survival analysis based on time to death for each of the genders was also performed. of the 261 adult patients with ich who presented to the ed, 13 declined to consent for research; for 3 patients, this was a recurrence of ich, and hence these patients were excluded from the cohort. in the final cohort of 245 patients, there were 125 (51.0%) females (f) and 120 (49.0%) males (m). the median age for the females was 77 years (interquartile range iqr 65 to 83 years), which was significantly higher than the median age for males (median age 69 years, iqr 59 to 80 years; p=0.007). only 12.6% of the patients were<50 years of age (12.5% females, 12.8% males). from the cohort, 57.6% females and 56.7% males were referred to our academic ed, from elsewhere (p=0.883). there was also no difference (p=0.46) in the proportion of females and males who were brought in by ambulances (59.2% f, 51.7% m), helicopters (28.8% f, 32.5% m), or private vehicles (12% f, 15.8% m). on analyzing symptoms on presentation to the ed 37.6% females presented with headache versus 29.2% males, 28.8% females presented with vomiting/nausea versus 12.5% males, 7.2% females presented with syncope versus 5.8% males, and 46.8% females presented with weakness versus 51.3% males. further analysis revealed that females had 2.8 times higher odds of presenting with vomiting/nausea than males (95% ci 1.45 to 5.51; p=0.002). about 58.9% females and 34.4% males presented with left-sided weakness, and 37.5% females and 62.5% males presented with right-sided weakness (p=0.002), implying that there might be a significant difference in the area of affection, which we analyzed on ct scans. we also looked at the glasgow coma scale (gcs) evaluation of patients in our cohort. there was no difference between the proportion of females (26.4%) and males (25%) who arrived comatose (p=0.802). there was also no difference in the stroke severity on arrival as defined by nihss between females (median nihss 7, iqr 2 to 23) and males (median nihss 8, iqr 2 to 19; p=0.76). on assessing the ct scans on arrival of these patients, we found that there was no significant difference between the volumes of hemorrhage between females (median volume 30 cc, iqr 5.2 to 135.7 cc) and males (median volume 22.9 cc, iqr 6.5 to 85.8 cc; p=0.415). there was also no difference (p=0.886) in the prevalence of intraventricular extension of hemorrhage between females (47.6%) and males (46.7%). on analyzing the topographic distribution of the hemorrhage in the brain, we found that 60% of the females had a right-sided hemorrhage as compared to 41% males. males were more likely to have a left-sided hemorrhage (56%) as compared to females (38%). the odds of having a cerebellar hemorrhage were 4.2 times higher in females than males (95% ci 1.63 to 10.75; p=0.002). this association remained significant even after controlling for nausea/vomiting as the latter has been reported to be associated with higher incidence of cerebellar hemorrhage (odds ratio 3.42, 95% ci 1.16 to 10.04, p=0.02). we compared history of ischemic stroke, coronary artery disease, hypertension, diabetes mellitus, dyslipidemia, atrial fibrillation, cancer, coagulation abnormalities, seizures, head trauma, smoking, and cessation of smoking between the genders. females had 0.51 times odds for having coronary artery disease (p=0.024) as compared to males. also, only 30.4% females from the cohort had a past history of smoking as compared to 61.7% males (odds 0.27, 95% ci 0.16 to 0.46; p<0.0001). there was, however, no difference between the proportions of females (25.6%) and males (36.5%) who stopped smoking (p=0.243). associations between past history of other diseases and gender did not reach statistical significance. on analyzing past medication use, there was also no statistically significant difference between the class of antihypertensive medication, anticoagulants, antiplatelets, steroids, and statins (all of which are known to influence ich) used by males and females. there was no difference in the skin temperature (p=0.467), heart rate (p=0.725), and systolic blood pressure (p=0.271) recorded on arrival to the ed between males and females. the women, however, did have a lower diastolic blood pressure on arrival (median 81 mmhg, iqr 71 to 95 mmhg) when compared to the men (median 87 mmhg, iqr 75 to 102 mmhg; p=0.011). on analyzing the ecg intervals (pr, qrs, and qtc), we found a significantly lower qrs interval in females (median 90 ms, iqr 82 to 98 ms) when compared to males (median 94 ms, iqr 88 to 106 ms; p=0.0125). on analyzing hemogram characteristics, we noted that females had lower hemoglobin (median 13.2 mg/dl, iqr 12.3 to 14.1) as compared to males (median 14.1 mg/dl, iqr 12.7 to 15.3 mg/dl; p<0.0001), higher leukocyte counts (median 10.7 10/cc for females versus 9.4 10/cc for males; p=0.039), and higher platelet counts (median 244 10/cc for females versus 223 10/cc; p=0.0031), but all these were within normal limits. there were no differences between the genders with regard to the coagulation parameters inr (p=0.532) and aptt (p=0.096). females also had higher total cholesterol levels (median 199 mg/dl iqr 174 to 211 mg/dl) when compared to males (median 168 mg/dl, iqr 146 to 208 mg/dl; p=0.033). women also had higher measured blood glucose on arrival to ed (median 146 mg/dl iqr 115 to 191 mg/dl) when compared to men (median 129 mg/dl, iqr 106 to 157 mg/dl; p=0.0096). there were also statistically significant differences that were noted between serum sodium (p=0.0386), serum potassium (p=0.0045), and serum creatinine (p<0.0001) levels between females and males, with females having lesser values than males. a total of 12.8% females had a craniotomy/surgery as compared to 10.8% of the male subjects, and nearly 10.4% females had an extraventricular drainage (evd) as compared to 8.3% males. however, there was no difference in proportion of the females undergoing surgery/craniotomy and evd as compared to the males (craniotomy/surgery p=0.62, ivd, p=0.58). there was no difference in the median length of hospital stay between females (median 4 days, iqr 2 to 10 days) and males (median 5 days, iqr 3 to 13 days; p=0.179). females had a worse functional outcome on discharge (median mrs 4, iqr 2 to 6) when compared to males (median mrs 4, iqr 0 to 5; p=0.0062). females had 1.94 times the odds of having a poor outcome as compared to males (95% ci 1.12 to 3.3). there were also more deaths within 7 days in the female subset (n=38, 30.4% patients) as compared to the males (n=23, 19.2% patients). the odds of dying within 7 days were 1.84 times higher in females than in males (95% ci 1.02 to 3.33; p=0.0421). new dnr orders were instituted over a period of 113 days from the date of admission. overall, 62 (49.6%) females had dnr orders versus 36 (30%) of males. despite having no differences between the stroke severity, volume of hemorrhage, and past history of diseases, females were also more likely to have dnr (do not resuscitate) orders instituted after admission to the hospital with ich (odds ratio 2.33, 95% ci 1.37 to 2.97; p=0.0016)., we first made a subcohort of all patients who had dnr orders instituted within 24 hours (n=44). in this subcohort, we excluded any patients who received any operative or interventional procedures after arrival to the ed (n=2), because it was assumed that these patients were only made dnr after significant interventional albeit futile, efforts. the final subcohort (n=42; females 28, males 14) was then omitted from our initial cohort of 245 patients. this final subset of nonearly dnr patients (n=203) consisted of 97 females (47.8%) and 106 males (52.2%). on analysis of association of gender with early mortality, we still found that females were 2.6 times (or) more likely to die within 7 days of presentation with ich than males (95% ci 1.3 to 5.4; p=0.006). it is a known fact that increasing age, stroke severity, cerebellar hemorrhage, and intraventricular extension of hemorrhage are associated with poor outcome and death after ich. we ran a logistic fit incorporating all these variables in a multivariate analysis and found that female gender remained an independent predictor of poor outcome at discharge (adjusted or=2.30, 95% ci 1.04 to 5.25; p=0.0398) and death within 7 days of ich (adjusted or 3.03, 95% 1.24 to 7.79; p=0.0144). the adjusted or for mrs for males was 0.44 (95% ci 0.19 to 0.96) and for death within 7 days was 0.33 (95% ci 0.13 to 0.81). we also ran a survival analysis based on time to death for each of the genders. the curves were near similar and the statistical analysis of difference did not reach significance on the wilcoxon test (p=0.4403). a closer look at the curves did show a clear separation between the mortality trends among females and males between 10 and 150 days after ich (figure 1). in this research, we have reported important differences between males and females who presented with first time intracerebral hemorrhage (ich). our demographic finding of women being older than men at the time of ich concurs with the findings of roquer et al. who reported that women were on an average 6 years older than men at the time of stroke. although there were no differences between the modes of arrival of patients for both genders, or their state of consciousness and orientation (measured by gcs), we did find that women were more likely to have nausea/vomiting as a symptom on presentation. investigators have previously reported some differences in the presentation symptoms between males and females with stroke, with regard to ability to walk, aphasia, visual field disturbances, dysphagia, and coma. the most important difference that we noted however, was that women were more likely to be affected in the right hemisphere, causing left-sided weakness. we also noted that though the volume of hemorrhage was similar in both genders, females had nearly 4 times the odds to have a cerebellarhemorrhage when compared to males. this actually steps away from previous reports on ischemic stroke, which state that infra-tentorial strokes are less prevalent in females [7, 14]. previous experience with subarachnoid hemorrhage (sah) patients has revealed that females with sah may be more prone to hypokalemia and qt prolongation. females also had lower hemoglobin, higher leukocyte, and platelet counts as compared to males, but again these were all within normal limits. women did have higher glucose levels on arrival to the emergency department, although there was no difference in the prevalence of diabetes mellitus between males and females. it has been reported in the past that hyperglycemia on presentation can lead to worse early outcome in patients with spontaneous ich. we concentrated on studying the early mortality outcomes for our cohort, as we wanted to negate influences of complications that arise due to the morbidity and disability after stroke. we found that, despite having similar premorbid status, similar prior medication use, similar hemorrhage volumes and frequency of intraventricular extension, women still experienced higher 7-day mortality post ich. the higher odds of cerebellar ich and hyperglycemia at presentation, could be contributory factors to this phenomenon. it is known that hyperglycemia early on in the course of spontaneous ich does influence the early outcome in these patients. the long-term mortality experience for males and females was, however, similar, as we saw on the survival curves. at discharge from the hospital, females were almost twice as likely as males to have bad functional outcome. this association held true even after adjusting for predictors of worse outcome in a multivariate model. higher inflammatory response in hemorrhagic stroke has been associated with poor outcomes [17, 18]; studies have reported that females tend to have more robust inflammatory response in some diseases. this could have led to poor outcome in females, although we were not able to capture data regarding inflammatory measures such as midline shift, perihematomal edema, or herniation. for example, it has been reported that progesterone and estrogen may be important neuroprotective agents in ischemic stroke [2023]. research has suggested that estrogens may serve this purpose by a way of stimulating growth factor supply, attenuating inflammatory processes, free radical scavenging, stimulation of intrinsic antiapoptotic pathways, and other interactions with intrinsic cell-cell pathways [2426]. some researchers have also suggested the mitochondria as a possible site of estrogen-mediated, neuronal survival. other studies have reported that women experience worse functional outcome and early mortality after ischemic stroke [8, 28]. still others, however have credited the female gender for conferring a survival advantage after ischemic stroke, consistent with the notion that female sex hormones are candidates for neuroprotective therapy. some researchers have reported that gender differences in outcome are not seen in hemorrhagic stroke. our study reports the first comprehensive gender differences in a cohort of exclusively first time hemorrhagic stroke patients. the significant differences outcomes and early mortality, with female sex driving bad outcome, may indicate that unlike in ischemic stroke, female sex hormones might not present a survival advantage in ich. this may be due to intrinsic differences in the neuronal damage mechanisms in ich and ischemic strokes, which need to be studied extensively in the near future. we noted that female patients in our cohort were more likely to have dnr orders instituted after admission for ich, despite the similarities to males on premorbid conditions, stroke severity and hemorrhage volumes. the variation in the use of dnr orders has been studied extensively including differences by gender, race, insurance status, patient preference, hospital, and specialty [31, 32]. it might be suggested that dnr orders could have influenced the outcomes and could have been an important confounder in our study. by doing the subset analysis, wherein we excluded patients who had early dnr orders, a surrogate for no interventions, we believe that we tried to get an understanding of this influence. if anything, the female gender became more strongly associated with early mortality in this subcohort of nonearly dnr patients (odds ratio increased from 1.84 to 2.33). for convenience, we looked at functional outcome at the hospital discharge, rather than at a fixed time the point from point of onset of ich itself. this could have influenced our assessment of mrs, though we did not notice any statistically significant difference in hospital length of stay between the two genders. in addition to this, we did not report long-term outcome for our patients. although prospective large-scale stroke trials typically assess outcome at 36 months, due to the unavailability of data and the retrospective nature of our study, we were unable to do so. we also could not assess the effects of hematoma expansion in our cohort, as the initial ct scan was done at different time points from onset of ich, and results of repeated ct scan were not looked at. it is known that hematoma expansion can continue for up to 48 hours after stroke; hence, we may have overestimated or underestimated the volume of hemorrhage in our patients. referral of a large subset of patients from other hospitals and initial treatment given at other sites could have influenced our assessment of initial gcs. since only 12.5% of our female subset was below the age of 50 years (the median age for menopause), we might not be seeing the protective effects of estrogen on our cohort, which may truly hold true. we also did not look at specific causes of mortality in our cohort of patients. but since we are reporting early mortality after ich, we have fair reason to believe that death within 7 days was primarily related to the ich itself. we have described important gender differences in patients with first episode of ich. we have concluded that unlike in ischemic stroke females are more likely to experience cerebellar hemorrhagic strokes, than males. also, we have reported a greater inclination for females to experience a right hemispheric ich than males, which could influence functional recovery and mortality outcomes. we found that females have nearly twice the odds to die within 7 days after an ich as compared to males. female gender is an independent predictor of early mortality and bad functional outcome at hospital discharge, after adjusting for age, stroke severity, volume of hemorrhage, and intraventricular extension of hemorrhage, all of which are known to predict worse outcome.

objective. to study whether gender influences outcome after intracerebral hemorrhage (ich). methods. cohort study of 245 consecutive adults presenting to the emergency department with spontaneous ich from january 2006 to december 2008. patients with subarachnoid hemorrhage, extradural hemorrhage, and recurrence of hemorrhage were excluded. results. there were no differences noted between genders in stroke severity (nihss) at presentation, ich volume, or intraventricular extension (i ve) of hemorrhage. despite this, females had 1.94 times higher odds of having a bad outcome (modified rankin score (mrs) 3) as compared to males (95% ci 1.12 to 3.3) and 1.84 times higher odds of early mortality (95% ci 1.023.33). analyzing known variables influencing mortality in ich, the authors found that females did have higher serum glucose levels on arrival (p=0.0096) and 4.2 times higher odds for a cerebellar involvement than males (95% ci 1.6310.75). after adjusting for age, nihss, glucose levels, hemorrhage volume, and i ve, female gender remained an independent predictor of early mortality (p=0.0127). conclusions. female gender may be an independent predictor of early mortality in ich patients, even after adjustment for stroke severity, hemorrhage volume, i ve, serum glucose levels, and age.

PMC3777128

pubmed-1119

pneumonia causes almost 1 in 5 under-five deaths worldwide and is responsible for more than 2 million deaths of children each year. nigeria, with a predicated incidence of 6.1 million pneumonia cases and 0.38 episodes of pneumonia per child-year in 2008, ranks 5th among the 15 countries with highest pneumonia burden in the world. it is a leading cause of childhood morbidity and mortality in developing countries including nigeria. in 2010, pneumonia accounted for 868,000 deaths in under-5 children, which was 14% of all causes of deaths in children. however when detected early, pneumonia can be treated with easily available medication at a low cost. unfortunately, only one in five caregivers in developing countries can recognize the danger signs of pneumonia like rapid breathing and chest indrawing, and only half of children under 5 with pneumonia are taken to an appropriate healthcare provider. in a population based survey carried out in six countries in sub-saharan africa, only about 18% and 30% of children with suspected pneumonia in nigeria and ethiopia, respectively, were taken to hospital for healthcare. in a systematic review of ninety-one studies that reported recognition and/or care seeking for diarrhoea, pneumonia, and malaria in low and middle income countries (lmics), it was shown that the median sensitivity of recognition of pneumonia among caregivers was low (45.8%) and care seeking from community health worker for pneumonia was 4.2%. the world health organization (who) and unicef have recommended strengthening family's capacity to recognize danger signs and prompt care seeking as one of the interventions for controlling pneumonia in children under five. this study seeks to determine the maternal perception and care seeking behaviour concerning danger signs of childhood pneumonia. it is hoped that the findings of this study will help reduce mortality from pneumonia in children and will contribute to achieving the sustainable development goal on child mortality. this study was conducted in enugu state, the host town of enugu state university of science and technology. it is located in south east nigeria on latitude 6 27n and longitude 7 30e. enugu state is made up of 17 local government areas with its capital carved from enugu north, enugu south, and enugu east lgas. the majority of the inhabitants are of igbo ethnicity, and christianity is the dominant religion. the minimum monthly income is similar to the national average of 18,000 (90 us dollars; national minimum wage act 2011). literacy rate is 66%, which is higher than the national literacy rate of 45%, and there are 955 males per 1,000 females. the study was conducted over a 10-month period in 4 of the 17 local government areas (lgas) of enugu state. the lgas were divided into rural and semiurban categories based on level of development and population in the lgas. simple random sampling using balloting method was used to select 2 lgas from each category. in the second stage, one community was selected from each lga using simple random sampling (i.e., one community from each of the two rural and two semiurban lgas). in each of the communities visited, through adequate mobilization using the community leaders, women who were caring and/or had cared for a child in the past 2 years and consented to participate were consecutively enrolled. three hundred and nineteen (319) caregivers who met the inclusion criteria and gave consent to participate were interviewed in the rural communities while one hundred and forty-seven (147) were interviewed in the semiurban communities. the following sociodemographic variables of respondents were assessed: (i) age grouped into 2030, 3140, and>40 years, (ii) highest educational attainment grouped into tertiary, secondary, primary, and no education, (iii) number of living children grouped into none, 14, and>4 children, and (iv) socioeconomic class: defined as the wealth index of the household derived using maternal and paternal highest educational attainment and occupation based on oyedeji classification. pneumonia is inflammation of one or both lungs caused by variety of organisms and chemical substances characterized by cough, shortness of breath, fever and difficult breathing, cyanosis, and death in severe cases. oyi in the local igbo language and this name was used for respondents that do not understand english. the world health organization (who) recognizes four features as danger signs in pneumonia. they include stridor, fast breathing, chest wall indrawing, and difficulty in breathing (labored breathing). knowledge of danger signs of pneumonia was assessed using open ended questions based on who definition. based on their responses, the respondents were grouped into no knowledge of danger signs and knowledge of at least one danger sign. also knowledge and uptake of vaccine against pneumonia the respondents were grouped into yes for those who were aware of the danger signs and had vaccinated their children and no for those who had not heard about pneumonia and had not vaccinated their children. health seeking behavior of respondents was assessed to determine where care was sought for a child with suspected pneumonia and the treatment given. quality control check to detect errors in questionnaire administration and data recording was done by researchers on daily basis after enrollment. where there are errors detected, the interviewers were asked to clarify them accordingly with the interviewed mother or caregiver. data cleaning to remove grossly incomplete and/or inconsistent data was also done by researcher assistants and the study researchers. results were presented as percentages and 95% confidence intervals where appropriate. statistical significance was set at p value<0.05. informed consent (written) was obtained from every mother in her own right and on behalf of her child before recruitment. most of the respondents 166 (37.4%) were 40 years and above while those in the 2030 and 3140 years of age bracket were 158 (35.6%) and 120 (27.0%), respectively. approximately half of the respondents 278 (49.7%) had primary school or no formal education and 280 (60.1%) in the lower socioeconomic class. respondents in the middle and upper socioeconomic class made up 103 (22.1%) and 83 (17.8%) of respondents. almost two-fifth, 166 (39.0%) of the respondents, have more than 4 children and 246 (57.7%) with 14 children. fourteen (3.3%) of the respondents had no children at all but had cared for one or more children in the past. in all, 211 children 5 years or younger of respondents with a mean age of 13.7 months were involved in the study (table 1). about 95% of the respondents (440/464) had heard of pneumonia and the remaining 24 (5.2%) never heard about it. when asked about the cause, majority of the respondents 394 (88.7%) believe pneumonia is caused by exposure to cold environment and/or ingestion of cold fluid or food while 32 (6.9%) have no idea what the cause of pneumonia is. the correlation (r) between awareness of pneumonia and knowledge of its cause is 0.374 (p=0.001). for respondents who proffered an answer whether correct or incorrect, source of information was via electronic media (i.e., radio and/or television) in 123 (26.5%), through the internet in 6 (1.3%), and during medical counseling in 226 (48.7%) respondents. other sources of information include print media in 13 (2.8%), social interactions in 73 (15.7%), schools in 37 (8.0%), churches in 8 (1.7%), and others in 18 (3.9%) respondents. almost all 426 (97.7%) of the 440 respondents who have heard of pneumonia acknowledged that it is a potentially dangerous illness that could lead to serious complications. inquiry into preventive measures against pneumonia showed that the vast majority believe that adequate clothing 127 (49.6%) and avoiding cold food and environment 38 (14.8%) were the best strategy to prevent pneumonia. other preventive measures listed by respondents include cleanliness 24 (9.4%), feeding well 14 (5.5%), drugs 11 (4.3%), vaccination 27 (10.5%), prayer 2 (0.8%), educating caregivers 3 (1.2%), and avoiding crowded areas 3 (1.2%). knowledge of vaccine against pneumonia was alleged by 218 (46.8%) of respondents out of which 185 (39.7%) claimed they took the pneumococcal vaccine for their index child. some of the reasons for nonvaccination for the 281 (60.3%) respondents who did not vaccinate their child included lack of knowledge of the availability of pneumococcal vaccine (209/281; 74.3%), nonavailability of the vaccine in health facilities around respondents residence (42/281; 15.0%), religious concerns (8/281; 2.9%), cost of vaccination (12/281; 4.3%), universal concern about ineffectiveness of vaccination (6/281; 2.1%), and side effects (4/281; 1.4%). further analysis showed that only maternal education (p=0.00) and place of residence (p=0.02) were significantly associated with correct knowledge of pneumonia aetiology, knowledge of dangers signs of pneumonia (p=0.00), and uptake of vaccination (p=0.01) against pneumonia (table 2). respondents were asked to list all features that in their opinion signify danger when a child is suspected of having pneumonia. fever 226 (20.6%), fast breathing 181 (16.5%), continuous cough 180 (16.4%), chest pain 67 (6.1%), and difficulty in breathing 66 (6.0%) were the most listed features. also listed were cold body (i.e., hypothermia) 63 (5.7%), catarrh/running nose 43 (3.9%), weakness 41 (3.7%), chest wall indrawing 37 (3.4%), convulsion 33 (3.0%), and others 161 (14.7%). the others included but not limited to poor suck 33, excessive cry 28, abdominal distension 27, restlessness 18, stridor, that is, noisy breathing 15, unconsciousness 11, vomiting 10, watery stooling 9, dullness of face and body 6, and pale skin 5 (table 3). information source on perceived danger signs of respondents followed almost a similar pattern as causes of pneumonia described above except that previous experience of danger signs accounted for close to half, 224 (48.1%) of information source here. others include electronic media in 99 (21.2%), internet in 11 (2.4%), social interaction in 10 (2.1%), medical counseling in 86 (18.5%), and others in 35 (7.2%) respondents. two hundred and thirty-two (56.3%) of respondents have experienced their perceived danger sign of pneumonia in one or more of their children. fever 123 (24.5%), continuous cough 98 (19.5%), fast breathing 75 (14.9%), cold 34 (6.8%), convulsion 22 (4.4%), and difficulty breathing 17 (3.4%) top the list of the most experienced pneumonia danger signs among children of respondents (table 3). the who/unicef recognised danger signs most commonly known by respondents were fast breathing (60.5%) and difficulty in breathing (22.1%) while chest indrawing (12.4%) and stridor, that is, noisy breathing (5.0%), were less known to respondents (table 3). knowledge of at least one who/unicef recognised danger sign was seen in 304 (65.2%) of respondents while knowledge of 2, 3, and 4 recognised danger signs was seen in 219 (47.0%), 37 (7.9%), and 22 (4.7%) of respondents, respectively. one hundred and sixty-two (34.8%) had knowledge of none of the who/unicef danger signs. just like cause and vaccine knowledge, maternal level of educational attainment (p=0.04), and place of residence (p=0.00) were significantly associated with knowledge of the who/unicef recognised pneumonia danger signs in children among respondents (table 2). sixty-four percent of the 253 that responded to the question presented to the hospital, 78 (30.8%) either bought drugs over the counter or visited the patent medicine dealer for treatment, 10 (4.0%) consulted the traditionalist, and 3 (1.2%) took the child to the church for prayers and spiritual healing. first-line treatment option in all respondents ranged from antibiotics 52 (20.2%), cough syrups 119 (46.3%), vitamin c 7 (0.03%), drug combinations 46 (17.9%) [i.e., antibiotics+cough syrup, antibiotics+cough syrup+vitamin c, etc.], herbal concoction 9 (0.04%), and hospital admission 24 (9.4%). majority of the children 202 (81.1%) recovered fully, 38 (15.3%) did not survive the experience, and 9 (3.6%) recovered but with complications. caregivers with tertiary education (70.0%) used hospitals more compared to those with secondary (60%), primary (68%), and no education (60%) (p=0.001). conversely, caregivers with no formal education (14.0%) and those with primary education (2.0%) used traditional and/or spiritual treatment more compared to those with tertiary (0.0%) and secondary school education (0.0%) (p=0.001). finally, caregivers resident in rural area compared to those resident in semiurban areas sought care in a healthcare facility more (65.0% versus 59.0%), self-medicated less (28.0% versus 41.0%), and consulted traditionalist and/or spiritualist more (7.0% versus 0.0%) (p=0.04) (table 2). this study investigated the knowledge of caregivers and caregivers in enugu about the aetiology and danger signs of pneumonia. it also sought to determine factors that influenced the knowledge and health seeking behaviour of caregivers for their under-5 children with probable pneumonia. the study showed high awareness (95%) and knowledge of potential fatality of pneumonia disease (97.7%) among respondents but poor knowledge of the aetiology (4.1%) and danger signs of probable pneumonia. a similar study in thailand also showed inadequate knowledge of danger signs (7%) and causes (21%) of pneumonia among respondents. the relatively poorer knowledge of causes of pneumonia in this study may be related to the higher number of caregivers without any formal education (29.2%) compared to 4.3% among respondents in the thailand study. it was noted in that study that none of the caregivers surveyed was able to mention the four standard danger signs of childhood pneumonia and only 9.4% of the respondents knew that lower chest wall indrawing was a danger sign in childhood pneumonia. it was also shown in this study that older caregivers, caregivers with higher educational attainment, and those that are resident in semiurban areas had better knowledge of the cause and danger signs of pneumonia. this is hardly surprising as caregivers with these sociodemographic variables are more likely to have more experiences of childhood illnesses and/or are better informed about pneumonia. it showed that caregivers with lower than tertiary education were more likely to have less knowledge on aspects of pneumonia disease. the lagos study in addition showed that caregivers whose information source about pneumonia was from health personnel were more likely to have correct information on the cause of pneumonia compared to those from other sources. this fact was supported by this present study which revealed that respondents who obtained their information from medical personnel were more likely to have correct knowledge of aetiology and prevention of pneumonia compared to respondents that got their information from other sources. inquiries into the preventive strategies showed that majority of the respondents believed that adequate clothing and avoidance of cold food, drink, or environment prevents pneumonia disease in a child. this belief which is a common misconception among many lay people in nigeria was also corroborated by the study in lagos which found that 75.6% of mothers surveyed believed that cold was the main cause of pneumonia. furthermore, almost half of respondents in the present survey had knowledge of pneumonia vaccine with only 39.9% of these respondents having vaccinated their child against pneumonia. similarly, only about a tenth of caregivers in our survey listed vaccination as a preventive strategy for pneumonia. this low uptake rate is expected as pneumococcal vaccines, which are relatively new additions to the national immunization schedules, are not widely available in public health facilities. furthermore, even when available, they are not free like other routine vaccines in nigeria. higher maternal educational attainment and residence in semiurban areas were significantly associated with knowledge about pneumococcal vaccine and uptake rate among children of surveyed caregivers. a study conducted in the africa center demographic site in south africa showed that caregivers with secondary and tertiary education were 1.10 and 1.09 times, respectively, more likely to uptake pneumococcal conjugate vaccine (pcv) for their children compared to caregivers with no education. it further showed that those caregivers resident in rural and periurban areas were 0.90 and 0.96 times less likely to uptake pneumococcal vaccine for their child. though majority of the respondents in our study took their children to hospital on suspicion of pneumonia, nearly 40% either self-medicated and/or consulted traditionalist or spiritualist as the first line of action. the finding that caregivers with lower education were more likely to engage in this behaviour is easily rationalized. because these caregivers are more likely to be less informed and easily persuaded, they will more likely be influenced by advice from friends and relatives to seek nonmedical solutions for their child's illness (especially in the face of poverty). it was further noted that caregivers in rural area were more likely to visit hospital, less likely to self-medicate, and also more likely to visit traditionalist and/or spiritualist compared to caregivers in urban areas. it could be further rationalized that because of the easy accessibility of various category of drug stores and ease of getting drugs over the counter in urban areas caregivers tended to patronize these drug dealers and self-medicate their children during illnesses. similarly, because of the traditional belief which is inherent in rural communities and poorer accessibility to healthcare facilities, it is not surprising that caregivers in rural areas may more likely seek traditional and/or spiritualist help for their child's illness. contrary to this finding, a community based comparative study in dera district of oromia regional state, ethiopia, showed that more caregivers in urban area (75.0%) sought healthcare for acute respiratory tract infection in their children from healthcare institution compared to those in rural areas (34.4%). although no explanation was proffered by the authors for this finding, one could speculate that the higher number of caregivers with formal education in the urban category (28.7%) compared to caregivers in the rural category (3.6%) may have contributed to the higher healthcare seeking behaviour among caregivers in the urban compared to those in the rural setting unlike our study where there is no significant difference in educational attainment between caregivers ' resident in urban and rural area. finally, we observed in our study that fast breathing and difficulty in breathing (labored breathing) were the most known and experienced who recognized danger signs among respondents. this may be related to the ease of noticing these symptoms in children compared to chest wall indrawing and stridor. the proportion of caregivers who had knowledge of these signs was more than what was observed in a similar study in uganda. on the other hand, fever, fast breathing, and cough were the most perceived and experienced danger sign among respondents in this study. khas district of pakistan similarly noted that fever and cough (65.2%), followed by fast breathing and chest wall indrawing (59.4%), were the most perceived symptoms of pneumonia by mothers in the district. as noted earlier, this may be related to the ease of picking up these symptoms in children. selection bias would have resulted due to the point enrollment because prospective study participants were required to gather at a preagreed location for consenting and enrollment. household sampling and enrollment which could have significantly reduced selection bias could not be done during selection of respondents in the community due to unorganized household locations and difficult terrains in some communities. also, recall bias could have led to errors in data measurement, classification, and analysis since some caregivers were interviewed on events that took place in the past. this study demonstrated poor knowledge of the aetiology, danger signs, and prevention of childhood pneumonia amongst caregivers. health education targeted at caregivers will enhance dissemination of information to fill this knowledge deficit and hopefully reduce morbidity and mortality from childhood pneumonia. therefore the authors intend to embark on workshops to sensitize medical personnel on the need to educate the caregivers on the danger signs and prevention of childhood pneumonia.

background. efforts to reduce child mortality especially in africa must as a necessity aim to decrease mortality due to pneumonia. to achieve this, preventive strategies such as expanding vaccination coverage are key. however once a child develops pneumonia prompt treatment which is essential to survival is dependent on mothers and caregiver recognition of the symptoms and danger signs of pneumonia. methods. this community based cross-sectional study enrolled four hundred and sixty-six caregivers in enugu state. it aimed to determine knowledge of caregivers about danger signs of pneumonia and the sociodemographic factors that influence knowledge and care seeking behaviour of caregivers. results. there is poor knowledge of the aetiology and danger signs of pneumonia among caregivers. higher maternal educational attainment and residence in semiurban area were significantly associated with knowledge of aetiology, danger signs, and vaccination of their children against pneumonia. fast breathing and difficulty in breathing were the commonest known and experienced who recognized danger signs while fever was the commonest perceived danger sign among caregivers. conclusion. knowledge of danger signs and health seeking behaviour among caregivers is inadequate. there is need for intensified public and hospital based interventions targeted at mothers to improve their knowledge about pneumonia.

PMC4632178

pubmed-1120

osteosarcoma (os) develops most frequently in the extremities, and it is the most common histologic form of the primary bone cancers.1 2 head and neck oss are rare, comprising only 6 to 10% of all oss.3 4 they typically present in the third or fourth decade of life and comprise only 1% of all pediatric head and neck malignancies. the most common craniofacial sites affected by oss are the mandible and maxilla, followed by the calvaria and then the skull base.4 5 6 on cytology, os can be divided into several pathologic types, including the pleomorphic, epithelioid, chondroblastic, small cell, mixed, and osteoclast-like giant cell types.6 in head and neck oss, the chondroblastic type occurs most frequently.7 skull base oss can be challenging to resect and an aggressive surgical approach can result in poor cosmetic outcome.8 imaging plays a crucial role in the diagnosis of each subtype of os and ultimately in patients ' survival because the diagnosis is based on a combination of histopathologic and imaging features. the therapeutic options and prognoses for different types of os differ from each other, so correct diagnosis is essential.9 10 magnetic resonance imaging (mri) or computed tomographic (ct) scan should be used to assess the extent of the primary tumor.11 in this case report, we describe a pediatric patient of occipital os of the chondroblastic type. the chondroblastic type of os has an exceedingly poor outcome.12 however, the detailed imaging description of such cases have not been reported in the previous literatures. we present the ct, mri, and enhanced mri features of this case, followed by a brief review of the related cases reported in the previous literatures a 9-year-old boy was admitted to our hospital with a major complaint of a growing mass on his head. physical examination found a firm and tough mass on the right occipital that showed no tenderness upon palpation. ct scan showed the right occipital bone to be irregularly thickened with fluffy and cloudy calcification, with a mass deriving from the internal occipital protuberance extending toward the basilar part of the occipital bone, invading the neighboring jugular foramen, the sublingual neural tube, and the mamillary process. on mri, the lesion was 4.5- 5.5- 6.5-cm in size with calcifications areas of hypointensity in t1- and heterogeneous in t2-weighted series. contrast mri showed peripheral and septal enhancement in the interior side of the tumor (fig. significant mass effect was present, distorting the cerebellar hemisphere, pons, and the forth ventricle, which led to hydrocephalus, and the oppression of the sigmoid sinus and the transverse sinus. 2), corresponding to the features of chondroblastic os, and occipital bone chondroblastic os was the final definitive diagnosis. (b) t1-weighted image shows a 4- 8- 10-cm mass lesion, isointense to the skull. (c, d) the mass is hypointense in most areas in the t2-weighted series, with focal high signals in the t2-weighted series and reduced signal in flair series.(e) in gd-enhanced mri, most areas show no enhancement or heterogeneous enhancement, with peripheral and atypical septal enhancement on the coronal plane (white arrows). (f) no hyperintensity was observed in both intra- and peritumoral areas in the dwi series. histopathologic examination (hematoxylin and eosin, 200) shows lace-like osteoid material abutting the neoplastic cells. they typically present in the third or fourth decade of life, account for fewer than 5% of oss in children, and comprise only 1% of all pediatric head and neck malignancies. the most common craniofacial sites are the mandible and maxilla, followed by the calvaria and then the skull base.13 14 15 our case in the right occipital bone of skull base is a very rare location. a search of the english language literature revealed 22 cranial oss previously reported in children (table 1): 12 calvarial tumors and 10 tumors of the skull base. the mean age of the pediatric patients with cranial os was 12.2 years old in this table. can be divided into pleomorphic, epithelioid, chondroblastic, small cell, mixed, and osteoclast-like giant cell types.6 our case is a chondroblastic subtype, which occurs most frequently in head and neck oss. abbreviations: gtr, gross total resection; nr, not reported; rt, radiation therapy; str, subtotal resection. the etiology of os is unknown, but the major risk factors for development of os in craniofacial bones may be similar to those of the long skeletal bones, consisting of exposure to radiation, retinoblastoma, li-fraumeni syndrome, and paget's disease. other bone abnormalities, such as fibrous dysplasia, multiple osteochondromatosis, chronic osteomyelitis, myositis ossificans, and trauma, have also been proposed as risk factors.7 15 16 the presenting symptoms varied with the location of the tumors. the maxillary or cranial lesions usually produced no pain, which was in accordance with our case; however, mandibular tumors frequently presented with focal painful swelling.17 18 other common presenting symptoms include headache, cranial nerve palsies, exophthalmos, and visual impairment due to different location of the tumor.5 13 ct best demonstrates tumor mineralization, especially when minimal, and it is usually able to demonstrate tumor extension into the soft tissues. hemorrhage, necrosis, and unmineralized, chondroblastic, or fibroblastic components of the tumor will appear as areas of low attenuation on ct if present. unlike any other conventional oss, we see fluffy calcification in our case, and we believe it is a characteristic of os. the osteoblastic subtype is most common with nearly 90% containing variable amounts of cloudlike opacities.19 bose20 reported an osteoblastic os that appears as a large soft tissue density mass with a few bony densities. compared with our case, the soft tissue mass is prominent and the calcification is less and diffuse. mri is the preferred modality for locally staging os, and it should be performed before percutaneous biopsy because it can help identify areas of viable tumor and mineralized matrix. in our case of gadolinium (gd)enhanced mri, we found no enhancement or heterogeneous enhancement in most areas of the tumor, with septonodular and rim enhancement, which is in in accordance with the current literature. areas that demonstrate either a heterogeneous enhancement pattern or lack enhancement are the preferred sites for biopsy because they are more likely to contain both chondroid and osteoid elements that are necessary for the correct diagnosis.21 22 chondrosarcomas shows similar image characteristic, but they occur in an older age with a mean age of 57 years old. chondroblastic oss also have significantly higher minimum and maximum apparent diffusion coefficient (adc) values compared with other conventional os subtypes, but they have a lower minimum adc and similar maximum adc value compared with chondrosarcoma.23 skull base oss can be challenging to resect, and an aggressive surgical approach can result in poor cosmetic outcome. thus, skull base tumors have a poorer prognosis than mandibular or maxillary tumors.3 complete surgical excision is the mainstay of treatment of the primary tumor. local recurrence is the main reason of treatment failure and mortality in head and neck oss. positive margins and a high tumor grade correlate with a statistically significant decrease in survival.11 in our case, the tumor could not be completely removed because it invades significant neighboring bone structures, including the jugular foreman and the sublingual neural tube. the patient died after 6 months as a result of local recurrence. in summary, chondroblastic os has been shown to be associated with a poor preoperative chemotherapy response and has a worse prognosis than other variants.24 however, this subtype has some particular image characteristic, which helps surgeons identify before surgery and set early therapeutic regimens.

primary osteosarcomas of the skull and skull base are rare and comprise<2% of all skull tumors. in head and neck osteosarcomas, the chondroblastic subtype occurs most frequently, which has an exceedingly poor outcome, but its image characteristic remains unknown. herein, we report a case in the right occipital bone of the skull base and the unique characteristics of image. pathologic examination of the surgical specimens led to the diagnosis of chondroblastic osteosarcomas. we believe those image characteristics can improve the understanding of skull chondroblastic osteosarcoma and the preoperative diagnosis.

PMC5391261

pubmed-1121

. some of these valves can be reconstructed; however this is not always feasible due to tissue degeneration and therefore replacement is needed. several suitable prostheses are available to replace the aortic valve, with specific advantages and disadvantages. biological heart valves, of either allogenic or xenogenic origin, show excellent hemodynamic behavior and low risk of thromboembolic complications, but their use is limited due to tissue deterioration. mechanical heart valves have extended durability, but permanent anticoagulation is mandatory. therefore a new generation heart valve is needed to overcome these limitations, showing the advantages of a healthy viable tissue valve with remodelling, regeneration and growth potential. a concept to create a patient specific viable aortic heart valve can be performed with tissue engineering (te) techniques, in which three essential components are included. first of all a sufficient extracellular matrix, the so-called scaffold, is needed to utilize a three-dimensional structure. these scaffolds are generally made out of polymers or decellularized allo- or xenogenic materials. a sufficient scaffold should fulfil mechanical and biological integrity, provide dynamic and biochemical signals, showing cell attachment and migration, secure diffusion of vital cell nutrients and expressed factors and allow dynamic changes of the scaffold s architecture. the generally used synthetic scaffolds are simple tubes created by polyglycolic acid (pga) or pga in combination with poly-4-hydroxybutyrate (p4hb). the recently developed scaffolds were created from p4hb, including sinuses to support the leaflet closure. nevertheless none of these te aortic heart valves have yet been clinically implanted and evaluated. the important difference between aortic valves and pulmonary valves is the discrepancy between the thickness of the aortic wall and the pulmonary valve in relation with the leaflet of the valves. complete decellularization of the aortic wall is therefore more demanding since the leaflets will be more easily decellularized but should not show structural deterioration and need to withstand the systemic blood pressure. additionally, validated sterilization should be performed on the decellularized scaffolds. in the past allograft irradiation unfortunately, cohen et al. showed that irradiation completely destroyed the extracellular matrix, with a minimal valve survival and early deterioration of these treated allografts. this study compared the implantation of irradiated allografts (n=41) versus -propiolactone (n=39) treated allografts. at a 15 year follow-up 84% of the irradiated and -propiolactone irradiated heart valves needed to be replaced and therefore only 22% and 12.5% respectively remained implanted. in these patients the dosage of irradiation was 22.5 kgy; however the generally excepted dose to irradiate to sterilize tissue is 25 kgy.. showed in a study the changes of decellularized tissue matrices by low dosage of irradiation: increase of tensile strength and a decrease of elasticity. the reason for this is the cross-linking of 1 and 2 subunits of the collagen.. studied the dosage influence of irradiation on tissue, with significant stiffness increase at 1 gy. leaflet deterioration showed a statistically significant increase in calcium content after 2 weeks of implantation in the subcutaneous rat model, showing 100 gy irradiation compared with 10 gy irradiation, respectively 65157 g/mg vs. 11854 g/mg; p=0.005. additionally the optical density values of igg antibodies were also in linear relation with the radiation dose. important to notice in this study are the 100 times lower doses compared with doses used to sterilize tissue. when an appropriate scaffold is available, valvular cells are needed to allow the heart valve to remodel, regenerate and eventually grow. compared in vitro seeded and non-seeded heart valves in the sheep model. in this study no evidence was shown to seed te heart valves in the laboratory; however, if decellularized scaffolds were seeded preoperatively the repopulation of the tissue was accelerated. in some studies only vascular endothelial cell were used for seeding; in other studies also interstitial valvular cells were used. endothelial cells are demanding to multiply in vitro and therefore alternative cell sources are being investigated, such as bone marrow derived cells or umbilical cord cells, to improve the growth rate without compromising cell function. studies are still going on to identify the optimal cell source if in vitro cell seeding is needed, mostly in synthetic scaffolds. meanwhile there are some experimental studies performed on te heart valves implanted in the aortic position. since this is a demanding surgical procedure, with a high mortality rate, there were several implantation techniques performed.. started implanting decellularized equine pericardium into the descending aorta to investigate the stability of this material under systemic circulation conditions. there was no operative mortality and the authors could prove that there was not only no tissue deterioration but also complete ingrowth of interstitial cells and an overgrowth of endothelial cells. these initial studies were performed to develop a te heart based on decellularized pericardium. implanted decellularized ovine aortic heart valves in a juvenile sheep model as a root replacement with a maximum follow-up of 9 months. significant differences between the two groups were seen, since control valves showed massive degeneration and thrombotic formation as early as 3 months after implantation, compared with the decellularized with only minimal calcification at the anastomosis side and micro-thrombotic formation in only one leaflet surface. functional analyses showed significant differences in aortic valve regurgitation between the decellularized and control group (0.50.5 versus 2.50.0 respectively; p=0.002). implanted decellularized porcine heart valves in the aortic position, using a subcoronary technique. at explantation, gross examination showed smooth and pliable leaflets with complete recellularization as early as 4 months after implantation. during this study was also able to show that decellularized valve leaflets are able to withstand the systemic circulation. as a control valve a commercially available gluteraldehyde treated carpentier-edwards (edwards lifesciences, irvine, ca) valve was used and compared after 6 months of implantation. the porcine model was used since the anticoagulation system is more similar to the human compared with the juvenile sheep model. the reason for using a stented heart valve is that today 90% of all bioprosthetic valves implanted are stented and in adult patients no growth potential is needed. the study showed no stenosis and no calcification or regurgitation in the decellularized stented aortic heart valves; however the carpentier-edwards was completely destroyed at 6 months of implantation. this study confirmed superiority of the decellularized stented aortic heart valve compared with the commercially available carpentier-edwards valve. emmert et al. demonstrated, in an initial report, a transapical approach of implanting a te heart valve transcatheter in the descending aortic position. in the next years meanwhile a limited number of experiences have been published of clinically implanted te aortic valves. these results show not only the resistance of the systemic pressure but additionally regeneration and remodelling potential of these valves. no reoperations due to valve dysfunction were needed at a mean follow-up of 30.35.2 months. echocardiographic examination showed a mean gradient of 8.86.3 mmhg and maximum aortic valve regurgitation was trivial in all patients. furthermore panel reactive antibody testing was negative in 19 out of 20 at 1 year follow-up. this group reports no valve related reoperation up to 53 months of follow-up; however, one patient was reoperated on due to severe mitral valve regurgitation. at this time histological examination showed a well preserved extracellular matrix at 18 months of follow-up but also some degree of intimal hyperplasia was seen. hemodynamic evaluation showed no or trivial regurgitation in all except one patient who showed mild to moderate regurgitation. the mean pressure gradient at discharge (n=34) was 5 mmhg, (range 1-17 mmhg) and at the latest follow-up (n=31) 2 mmhg (range 1-11 mmhg). experimental data support the feasibility to implant a te heart valve, based on a decellularized scaffold, into the systemic circulation.

several prostheses are available to replace degenerative diseased aortic valves with unique advantages and disadvantages. bioprotheses show excellent hemodynamic behavior and low risk of thromboembolic complications, but are limited by tissue deterioration. mechanical heart valves have extended durability, but permanent anticoagulation is mandatory. tissue engineering created a new generation heart valve, which overcome limitations of biological and mechanical heart valves due to remodelling, regeneration and growth potential. several publications are available in using tissue engineered heart valves in right ventricular outflow tract reconstruction. limited experiences are available on these heart valves implanted into the systemic circulation. this overview shows the current state on the development of tissue engineered aortic heart valves.

PMC3484929

pubmed-1122

y-tzp (yttria stabilized tetragonal zirconia polycrystals) are commonly used core materials that are manufactured from fine zirconia (zro2) particles and 1.75-3.5 mol.% yttrium oxide (y2o3).1,2,3 y2o3 is commonly used for stabilizing zirconia-based ceramics at room temperature.3,4 however, cerium oxide can also be used to stabilize the tetragonal phase of zirconia.3,5 adding cerium oxide to the zirconia stabilizes its tetragonal phase under chemical and thermal conditions.6 because of the low strength of ce-tzp (ceria stabilized tetragonal zirconia polycrystals), a combination of alumina-zirconia is decided to improve the strength of the material.6,7 recently, a new type of zirconia ceramic, which is called ceria-stabilized tetragonal zirconia/alumina (ce-tzp/al2o3) nanocomposite, has been developed.7,8,9 ce-tzp/al2o3 nanocomposite has an interpenetrated nanostructure and consists of 10 mol% ce-tzp and 30 vol.% al2o3.7,10,11 the homogeneously dispersed al2o3 phase increases the hardness, elasticity modulus, and hydrothermal stability.12,13 evaluating the characteristics under thermocycling and mechanical loading is crucial for the success of zirconia-based restorations because they are exposed to both thermal and mechanical fatigue in the oral environment.14 thermal and mechanical stresses may affect the materials ' strength and clinical performance. on the other hand, phase transformations may be triggered by mechanical2 and thermal fatigue;15 and fatigue causes progression of subcritical cracks.2,16 the effect of different aging procedures on ce-tzp/al2o3 has been studied in several investigations.11,15,17,18,19,20 after storing in water and artificial saliva,15 physiological saline solution,11,19 acetic acid11,19 and autoclave,11,15,17,19 ce-tzp/al2o3 showed satisfactory phase and mechanical durability versus to aging.11,19 these experimental conditions do not fully reflect the oral environment. restorative materials are exposed to saliva, acidification, thermal and mechanical cyclic stresses in the oral cavity. the reported comfortable temperature ranges between 15 and 55.21 fontijn-tekamp et al.22 reported that physiological forces range from 60 to 75 n in the anterior dentition and from 110 to 125 n in the posterior dentition. however, maximum forces ranged from 140 to 170 n, and 250 to 400 n in anterior and posterior regions, recpectively.22 investigating the mechanical properties of the newly developed materials under simulated oral cavity conditions and comparing the results with commonly used core materials are needed for defining their clinical acceptance. the purpose of this study was to evaluate the effect of thermocycling and mechanical loading on the biaxial flexural strength and the phase transformation of ce-tzp/al2o3 and compare the results with two y-tzp core materials. three groups were designed to investigate the effect of thermocycling and mechanical loading on zirconia-based core materials. two yttria-stabilized zirconias; cercon base (cercon, degudent, hanau, germany) and lava plus (lava, 3 m espe, seefeld, germany) and one ceria-stabilized zirconia; nanozr (panasonic electric works, osaka, japan) were used in this study (table 1). the dimensions were selected according to iso 687223 and were verified using an electronic digital micrometer (powertechtools, zhejiang, china). three experimental groups (n=10) were created from each kind of material. control specimens were in group 1 and were abbreviated as cc for cercon base, lc for lava plus, and nc for nanozr. thermocycled specimens were in group 2 and were abbreviated as ct, lt, and nt, for cercon base, lava plus, and nanozr, respectively. thermocycling was subjected in distilled water at 5 and 55 for 10000 cycles in a thermocycling machine (nve, ankara, turkey). during a cycle, specimens were stored for 30 seconds in each bath.14,15,21 the mechanical loading group was group 3. for mechanical loading, the specimens were positioned on the supporting balls which were described in iso 6872.23 specimens in group 3 were abbreviated as cm, lm, and nm for cercon base, lava plus, and nanozr, respectively. the mechanical loading was subjected with 200 n loads and a frequency of 2 hz for 100000 times with a mechanical cycler (instron 8801, instron, canton, ma) at the room conditions (22 1, and 60 5% relative humidity).2 the test was carried out after thermocycling and mechanical loading with a tension-compression test machine (middle east technical university, department of metallurgy, ankara, turkey). the specimens were tested with a technique of piston on three balls, which was identified in the standard of iso 6872.23 three hardened steel balls (turkish aerospace industries inc., ankara, turkey), 3.2 mm in diameter, were placed at an angle of 120 degrees relative to each other to support the specimens. each specimen was located on these supports of the testing machine and the centers of the specimens were loaded (fig. the load was applied with a flat punch (1.4 mm in diameter) until a fracture occurred. the biaxial flexural strengths of the specimens were calculated with the following formula:23 s=-0.2387 p (x-y)/d, where s is the flexural strength at fracture (mpa); p is the total load causing fracture (n), x=(1+)ln(r2/r3)+[(1 -)/2](r2/r3), y=(1+)[1+ln(r1/r3)]+(1-)(r1/r3), and is poisson's ratio (if the value for the ceramic being studied is not known, poisson's ratio of 0.25 is used); r1 is the radius of the support circle, r2 is the radius of the loaded area (mm), r3 is the radius of the specimen (mm), and d is the specimen thickness at the origin of fracture (mm). for this study, =0.25, r1=5 mm, r2=0.7 mm, and r3=7.5 mm were used. the weibull modulus, characteristic strength, 10%, 5% and 1% probabilities of failure were calculated using the biaxial flexural strength data. phase transformation was determined by xrd patterns of the control, thermocycling and mechanical loading specimens before the biaxial flexural strength test. the xrd patterns were recorded with an x-ray diffractometer (d/max 2200pc, rigaku-geirflex x-ray difraktometer, tokyo, japan) by using cu-k -radiation. specimens were scanned at 40 kv, 40 ma, 0.018/step interval from 20-40, and 2 degrees. the relative amount of the monoclinic phase (xm) was calculated with the following formula described by garvie and nicholoson24 for detecting the phase composition of zirconia: xm=(im1+im2)/(im1+im2+it), where i is the intensity detected by the detector, t is the tetragonal peak, and m1 and m2 are the two major monoclinic peaks. the monoclinic phase content was determined by calculating the areas under the t, m1, and m2 peaks with matlab (matlab 2010 a, mattworks, natick, ma, usa). control, thermocycled, and mechanically loaded specimens were examined by a raman spectrometer (senterra; bruker optics gmbh, ettlingen, germany) before the strength test. the raman laser was focused on center of the specimen (p1), the center of the radius of the specimen (p2), and the edge of the radius of the specimen (p3)(fig. 2) at a wavelength of 520 nm and 20 mw power, 3 cm resolution, and 16 spectral integration times. the raman intensity monoclinic ratio (xm) was calculated with the following formula: xm= i m (180 cm)+i m (190 cm)/i m (180 cm)+i m (190 cm)+it (147 cm) where i corresponds the net peak intensities at the raman shifts. by using the formula of kim et al.,25 the monoclinic fraction (m) was calculated: m=(0.19-0.13/(xm-1.01))-0.56. the flexural strength data were analyzed by using the two-parameter cumulative weibull distribution, which is often used for ceramic materials because of their asymmetrical distribution. the weibull moduli were calculated with the formula:23,26 p()=1-exp [-(/0)], where p is the fracture probability, is the fracture strength, 0 is the characteristic strength at the fracture probability of 63.2%, and m is the weibull modulus. in addition, the 10%, 5%, and 1% probabilities of failure were calculated. the relative amount of monoclinic phase was analyzed by two-factor factorial anova (analysis of variance). significant differences with a significance level of =0.01 (spss 18, spss inc., the results of the monoclinic fraction were analyzed by three-factor anova with repeated measures on each factor. significant differences with a significance level of =0.05 (spss 18, spss inc., the weibull statistical analyses, the characteristic strength, and the 10%, 5%, and 1% probabilities of failure are summarized in table 2. the characteristic strengths of nanozr were significantly higher in all materials (p<.001), and the differences among the groups in nc, nt, and nm groups were not statistically significant (p>.001). the characteristic strength values of lava plus were higher than cercon base and lower than nanozr. the characteristic strength values increased in the lm group, and it showed significant difference when compared with the lc and lt groups (p<.001). however, the values were not statistically different within the cercon base groups (p>.001).the weibull moduli of nanozr were higher when compared with the other materials. the lava plus values were higher than the cercon base values and lower than the nanozr values. the values increased in the lm group in comparison with the lc and lm groups. the monoclinic phase contents of the materials are shown in table 3 and table 4. the xrd patterns of one of the specimens in experimental groups are shown in fig. statistical results of xrd showed that thermocycling and mechanical loading did not affect the monoclinic phase content. the monoclinic phase contents were not statistically different between the control, thermocycled, and mechanically loaded specimens. however the monoclinic phase content of the cercon base, lava plus and nanozr specimens were statistically different (p<.01). 37-1484) were detected in all groups except the control and thermal-aged specimens of lava plus. the highest monoclinic phase content was observed in nanozr and it was significantly different from other materials (p<.01). the raman spectroscopy results showed that material type (c, l, and n), the point raman spectra taken from (p1, p2, and p3), and the thermocycling and mechanical loading methods (c, t, and m) affected the monoclinic phase fraction. when comparing the phase fraction of materials at the same point and the same method, except nm at point p1 and all groups in nanozr at points p2 and p3, the differences were not significant in all materials (p>.05). when comparing the points raman spectra taken from the same material and the same method, except for nc and nt groups at point p2, the nm group at point p3, and lm group at points p1 and p2, the differences were not significant in all materials (p>.05). when comparing the experimental groups at the same point and the same material, the mechanical loading groups showed significant differences in all materials (p<.05). zirconia-based restorations are exposed to temperature changes and cyclic stresses in the oral cavity.14 fatigue of these materials can cause detrimental effects on the mechanical properties of the materials.27 therefore, fatigue tests are essential to define mechanical properties and ensure the clinical success of these materials.27 some studies have stated that fatigue affects the mechanical properties of the zirconia-based core materials.2,11,14 within the limitation of the present study, there were no significant differences in the strength of the core materials after thermocycling and mechanical loading. nanozr had significantly higher characteristic strength values than the two other y-tzp ceramics and there were no significant differences in the characteristic strength of nc, nt, and nm groups. nanozr showed a high weibull modulus (m) and demonstrated a low variability ranging from 20.67 to 21.82. a high weibull modulus defines better clinical reliability of the materials.26,28 the characteristic strength of lm group was significantly higher than that of the lc and lt groups (p<.001). the authors observed a similar increase in the strength of bilayered lava specimens when subjected to 20000 mechanical loadings in a previous study.2 the observed m values for lava plus were 12.36 for the control group and 14.99 for the mechanical loading group. the characteristic strengths of cercon base were not significantly different in all groups (p>.001); the m values of the cercon base were between 5.6 and 7.24. nano-meter-sized ce-tzp/al2o3, which has strong mechanical properties and stability against aging, has been developed by nawa et al.10 and its properties have been demonstrated in some studies.9,11,15 ban et al.11 found that nanostructured ce-tzp/al2o3 had durability against aging and there were no significant phase transformation under different storage conditions. stress-induced phase transformation is an important factor for strengthening tzp.29 in the present study, the biaxial flexural strengths of nanozr groups were not statistically significant from each other and the values in the lm group were significantly higher than in the lt and lc groups (p<.001). borchers et al.14 researched the influence of different environmental and loading conditions on the biaxial strength of two different 3y-tzp. it was concluded that y-tzp ceramics showed phase transformations after different hydrothermal treatments. however, their strengths were not significantly influenced because the transformation depths did not progress enough from the surfaces into the materials.14 cattani-lorente et al.1 demonstrated similar results and stated that the transformation occurred in a 6 m thick subsurface layer. in the present study, the specimens were subjected to 10000 thermocycles or 100000 mechanical cycles. the specimens were not affected negatively by the cycling conditions; this result was consistent with the fact that the transformation was not deep enough to extend into the material under these thermal and mechanical cycles. in the present study, results of both thermocycling and mechanical loading methods did not significantly affect the phase transformation of the materials. ylmaz et al.2 reported that the monoclinic phase content of the lava and cercon specimens significantly increased after 20000 mechanical cycles. the cc and lc groups consisted of tetragonal zirconia but the monoclinic contents of the specimens increased after mechanical loading. in the present study, the difference in the monoclinic phase contents of the materials was not statistically significant after thermocycling and mechanical loading. however, the monoclinic phase content of the lm group was significantly higher than that of the lc and lt groups. the difference in the amount of monoclinic phase between the two y-tzp core ceramics may be a result of the difference in the intrinsic structure or sintering schedule.15 the amount of the monoclinic phase of nanozr ranged from 5.917 0.34% to 5.969 0.39%. a similar monoclinic content, ranging from 4.8 to 5.5%, was reported by ban et al.11 perdigo et al.15 evaluated the effect of hydrothermal fatigue on zro2-based (lava, ips and nanozr) materials. the specimens were stored in water, autoclaved or thermocycled in artificial saliva for 30000 thermal cycles. the observed values in the present study were lower than the values presented by perdigo et al.15 although both studies used the same thermocycling conditions, the difference may originate from the higher number of cycles used in the study of perdigo et al.15 the monoclinic phase contents of the zirconia-based materials can be detected with raman spectroscopy. raman spectroscopy is able to detect very small regions on a specimen surface without preparation30 and can be useful for defining the amount of monoclinic phase.25 sato et al.18 evaluated the mechanical properties of ce-tzp/al2o3 and y-tzp after sandblasting and heat treatment and detected the phase changes with raman spectroscopy. raman analyses showed that the transformation zone depth was approximately less than 10 m and that the biaxial flexural strength increased after sandblasting but decreased after heat treatment.18 in the present study, the transformation zone depths were not detected by raman spectroscopy but the raman spectra were taken from three different points on the surface of the specimens. in the present study, according to xrd results, the monoclinic phase contents of the materials were not affected by the experiments. however, it was detected that the phase fraction of the materials was significantly affected by thermocycling and mechanical loading when the raman spectra were obtained from different points on the surface of the specimens (p<.05). furthermore, it was observed that the results were significantly lower in mechanical loading groups at the same point and the same material (p<.05). during mechanical loading, behrens et al.31 stated that applied loads triggered phase transformation and that compressive stresses were higher in the indentation center. the monoclinic phase fractions were found lower at the center of the indent when compared to edge of the indent.31,32 in the present study, specimens were subjected to 100000 mechanical cycles under 200 n and the lower monoclinic phase fraction may be a result of the concentrated compressive stresses on the specimens during mechanical loading. ce-tzp/al2o3 is a novel material with a high mechanical strength and resistance to fatigue. the results of the study showed that both materials have reliability and can be used clinically. however, further experiments related to the effect of the firing processes, surface treatments on the porcelain connection values of bilayered specimens, and clinical applications are needed to evaluate the long-term behavior of this new material. within the limitations of this study, the x-ray diffraction results showed that thermocycling and mechanical loading did not have a significant effect on the phase transformation of the tested materials. however, raman spectroscopy results showed that monoclinic phase fraction of the mechanically loaded specimens were lower at the point p1 where the load was applied. furthermore, it was concluded that the characteristic strengths of all the tested materials were not affected negatively by thermocycling and mechanical loading and all the tested materials have reliability in clinical use.

purposethe purpose of the present study was to evaluate the effect of thermocycling and mechanical loading on the biaxial flexural strength and the phase transformation of one ce-tzp/al2o3 and two y-tzp core materials. materials and methodsthirty disc-shaped specimens were obtained from each material. the specimens were randomly divided into three groups (control, thermocycled, and mechanically loaded). thermocycling was subjected in distilled water for 10000 cycles. mechanical loading was subjected with 200 n loads at a frequency of 2 hz for 100000 times. the mean biaxial flexural strength and phase transformation of the specimens were tested. the weibull modulus, characteristic strength, 10%, 5% and 1% probabilities of failure were calculated using the biaxial flexural strength data. resultsthe characteristic strengths of ce-tzp/al2o3 specimens were significantly higher in all groups compared with the other tested materials (p<.001). statistical results of x-ray diffraction showed that thermocycling and mechanical loading did not affect the monoclinic phase content of the materials. according to raman spectroscopy results, at the same point and the same material, mechanical loading significantly affected the phase fraction of all materials (p<.05). conclusionit was concluded that thermocycling and mechanical loading did not show negative effect on the mean biaxial strength of the tested materials.

PMC4085247

pubmed-1123

when evaluating patients for clinical trial, intrauterine pregnancy is commonly considered an exclusion criteria, however guidelines do not exist to determine what to do should a pregnancy test result as positive. the patient underwent standard-of-care therapy upfront with progression of disease and was referred to investigational therapeutics for phase i treatment. pelvic ultrasound and -hcg heterophilic antibody testing were negative ruling out intrauterine and ectopic pregnancy or phantom hcg. her elevated -hcg appeared consistent with paraneoplastic syndrome reflected in a decline in -hcg that correlated with a response to treatment. a 34-year-old african american female with metastatic mucinous ovarian carcinoma presented with a pelvic mass discovered during her annual gynecological examination. an ultrasound showed a 7.7 8.7 cm left ovarian mass with complex appearance. laparoscopic left salpingo-oophorectomy showed a moderately differentiated mucinous ovarian carcinoma, stage ic1, due to intraoperative rupture of the ovarian mass. tumor cells were diffusely positive for keratin 7 and very focally positive for keratin 20. the patient was taken for diagnostic laparoscopy with appendectomy, omentectomy, and multiple peritoneal biopsies by a gynecologic oncologist; all of which were negative for malignancy. eight weeks later the patient started adjuvant chemotherapy with one cycle of capecitabine and oxaliplatin (xelox), transitioned to four months of fluorouracil and oxaliplatin (folfox) due to insurance issues. the ct abdomen and pelvis post folfox chemotherapy showed an enhancing 2.6 cm nodule in rectus abdominis muscle. the patient underwent an exploratory laparotomy with excision of a 5 6 cm abdominal mass involving fascia and muscle, consistent with metastatic adenocarcinoma. after recovery, the patient received chemotherapy with carboplatin and paclitaxel for 6 months. the ct abdomen and pelvis performed following 6 months of carboplatin and paclitaxel showed progression of disease with new nodal and perihepatic implants. the patient subsequently consulted with the md anderson cancer center department of investigational cancer therapeutics for phase i clinical trial options. the patient was treated with a phosphatidylinositol-4,5-bisphosphate 3-kinase (pi3k) inhibitor plus a mitogen/extracellular signal-regulated kinase (mek) inhibitor with progression of disease after 5 months. she then started on a second phase i trial with a polymeric micellar nanoparticle of the substance dach-pt (1,2-diaminocyclohexane platinum), an in vivo metabolite of oxaliplatin, with progression following 1 cycle of therapy. the patient was then enrolled in a trial with paclitaxel, bevacizumab and temsirolimus (pat). on the day of clearance to start treatment, she was found to have a positive urine and serum pregnancy test. the left ovary was surgically absent however the right ovary was enlarged with complex cystic mass with solid components measuring 9.5 6.6 cm. the work-up for false positive elevation of -hcg including serial dilutions, incorporation of animal serum and outside institutional validation testing for -hcg heterophile antibody, was negative. therefore, the -hcg elevation was not thought to be related to a phantom hcg. dilation and curettage to rule out trophoblastic disease was planned, but not completed due to discovery of a deep vein thrombosis and initiation of therapeutic anticoagulation. as no intrauterine or extrauterine pregnancy could be identified, after several weeks, the patient returned to clinic and was cleared to start treatment. at that time, her -hcg was 210.3. three weeks post treatment with pat, the -hcg decreased to 27.5 and ct scans showed partial response (fig., the patient was admitted to the intensive care unit for weakness due to guillain barre syndrome. nearly all female patients undergoing enrollment on clinical trial are evaluated for pregnancy as part of standard exclusion criteria. an elevated -hcg in the absence of viable pregnancy can occur for multiple reasons and has a broad differential diagnosis including miscarriage, ectopic pregnancy, pituitary hcg production, trophoblastic disease and phantom hcg. ectopic pregnancy is frequently suspected when -hcg levels plateau or fail to double within 48 h without evidence of intrauterine pregnancy with ultrasound. when intrauterine and extrauterine pregnancy are ruled out, pituitary hcg may be produced in perimenopausal or postmenopausal women. as estrogen and progesterone production decreases, releasing gonadotropin releasing hormone (gnrh) from negative feedback, luteinizing hormone (lh) and follicular stimulating hormone (fsh) rise. the subunit gene of lh is found in a sequence of 7 hcg subunit genes and therefore uncontrolled gnrh stimulation may lead to hcg production by pituitary gonadotrope cells (cole, 2005). using an fsh level of 45.0 miu/ml identified hcg of perimenopausal women, ages 4155 years, with mildly increased serum hcg concentrations (5.014.0 miu/ml), an fsh cutoff of 45.0 miu/ml identified hcg of placental origin with 100% sensitivity and 75% specificity. fsh levels greater than 45 miu/ml were never observed when hcg was of placental origin. when hcg is less than 5.0 miu/ml, fsh testing is not performed as pregnancy is unlikely. when hcg is greater than 14.0 miu/ml, fsh testing is not performed as this is consistent with pregnancy (gronowski et al., 2008). in one study, two weeks of estrogen-progesterone therapy suppressed pituitary hcg and may help confirm diagnosis (cole et al., 2007). gestational trophoblastic disease is a group of conditions that may be classified as either premalignant, in the case of a partial or complete hydatidiform mole, or malignant, including invasive mole, choriocarcinoma, placental-site trophoblastic tumor and epithelioid trophoblastic tumor. although not always the case, -hcg is commonly found to be elevated in these conditions and these diseases are considered high on the differential diagnosis list when found. phantom hcg is a phenomenon first described in 1998 by laurence cole, ph.d., where patients have persistent mild elevations of -hcg, occasionally following miscarriage. the elevated -hcg often falsely interpreted and misleads physicians to evaluate or incorrectly treat patients with cytotoxic agents for trophoblast disease (cole, 1998). heterophilic antibodies against mouse, goat, rabbit, cow, horse, or sheep antigens can interfere with two-site immunoassays by creating complexes between the two anti--hcg antibodies without -hcg being present. this leads to a false-positive result (vladutiu et al., 1982). people can develop heterophilic antibodies by exposure to the serum, tissue, or other antigens of nonhuman species. heterophilic antibodies do not appear to be excreted in the urine and therefore urine assays can be used to identify false-positive serum results. serial dilutions may also be performed to assess for interference. to avoid false positives, the excess of nonspecific antibodies saturates heterophilic antibodies in human serum and usually eliminates their interference with the assay (johnson et al., 2000). additionally, serum samples can be sent to outside laboratories with different assay systems to validate results. in our patient's case, the patient continued to have normal menstrual cycles and was using two forms of contraception with her husband who had history of vasectomy. the work up, including pelvic ultrasound and ct scans, was negative for pregnancy and trophoblastic disease. it was therefore believed that the patient's -hcg production was due to the patient's tumor, consistent with a paraneoplastic syndrome. paraneoplastic syndromes occur in about 8% of cancer patients and frequently develop with advanced disease. they may appear earlier than symptoms of the primary tumor itself, leading to new diagnosis of cancer (pelosof and gerber, 2010). it can also be found in the testis, liver, lung, colon, and stomach in small amounts. malignancies in these organs may lead to an increased serum levels (demirtas et al. a gastric origin is the most frequent, ranging from 11% to 17% of this rare subset (germann et al., 2002). in our case, the patient had a primary ovarian neoplasm with metastases within the abdomen. -hcg levels rose while the patient was on a treatment break, nearly impeding her from further treatment. with re-initiation of therapy, the -hcg declined, corresponding to a partial response per response evaluation criteria in solid tumors (recist) on radiographic imaging. urine hcg remained positive despite decline in serum hcg as the level was still over the detection threshold of 25 interesting enough, other tumor markers (ca 125, ca 15-3, ca 19.9 and cea) all increased. the decreased size of tumor within the pelvis corresponded with decreasing -hcg levels while increased hepatic metastasis corresponded to increases in other markers. this lends evidence to the idea that the patient had tumoral heterogeneity with different markers produced by tumors in different areas of the body. this is the first case of paraneoplastic -hcg production from an ovarian adenocarcinoma reported in the literature. we provide a treatment algorithm to evaluate for paraneoplastic hcg production when assessing for clinical trial eligibility (fig. paraneoplastic syndrome should remain in the differential diagnosis in patients found to have elevated levels of -hcg without evidence of intra- or extra-uterine pregnancy. informed consent to publish the information was granted from the patient. none of the authors have conflict of interest or competing interest. jg participated in the design of the manuscript, analyzed the biomarker data and drafted the manuscript. pp jg participated in the design of the manuscript, analyzed the biomarker data and drafted the manuscript. sp conceived of the study, and participated in its design and coordination and helped to draft the manuscript.

there is a broad range of possible diagnoses for an elevated beta human chorionic gonadotropin (-hcg) in the absence of intrauterine or ectopic pregnancy. when women of child bearing potential undergo evaluation for clinical trial, it is often unclear what course of evaluation to take when a pregnancy test is positive. we describe the clinical course of a patient with widely metastatic mucinous ovarian carcinoma with metastasis to the peritoneum, lymph nodes and liver. the patient was found to have a mildly elevated -hcg during initial evaluation for clinical trial. extensive work up for ectopic pregnancy, trophoblastic disease, and phantom -hcg were negative. the patient's -hcg levels continued to rise until initiation of therapy. she was treated on a phase i protocol with restaging scans revealing a partial response. the -hcg was retested and declined in conjunction with her response, consistent with paraneoplastic -hcg. here, we propose a decision making algorithm to evaluate a patient with an elevated -hcg undergoing assessment for clinical trial.

PMC4910296

pubmed-1124

there are 209,000 cases of and 102,000 deaths due to renal cell carcinoma (rcc) per year worldwide. rcc had been treated with cytokines with a modest response rate and some survival benefit. since 2005, the u.s. food and drug administration and european medicines agency have approved novel agents targeting the vascular endothelial growth factor pathways for patients with metastatic rcc (mrcc) on the basis of the results of large randomized clinical trials. single-agent interferon (ifn) is no longer regarded as a standard option for first-line systemic treatment of mrcc in western countries. in a large cohort in a retrospective japanese study, the median survival time was approximately twice as long as that in previous studies from north america and europe in the cytokine era. one of the reasons for the difference was considered to be related to varying individual sensitivities to cytokine treatments. racial differences might also affect biological characteristics of the tumors, leading to differences in frequencies of metastatic lesions and pathological features. previous reports demonstrated positive response rates of 10% to 20% in response to cytokine treatments. however, some patients with favorable-risk disease achieved a complete and long-lasting remission. recent studies suggest that stat3 polymorphism predicts a favorable response and survival benefit of ifn-alpha in japanese patients with mrcc. thus, cytokine treatments may be useful for some japanese patients with mrcc, even in the era of targeted therapy. the present study investigated outcomes in japanese patients with favorable-risk mrcc according to the memorial sloan kettering cancer center (mskcc) criteria who had been treated with ifn or tyrosine kinase inhibitor (tki) therapy as a first-line systemic therapy. a total of 48 japanese mrcc patients with favorable-risk disease as defined by the mskcc criteria who had been treated with immunotherapy or tki therapy at chiba university graduate school of medicine hospital (cu) or chiba cancer center (ccc), japan, from 1995 to 2014 were retrospectively enrolled in this study. ten patients were treated with tki therapy as a first-line therapy at ccc; the others were treated at cu. the mskcc criteria included karnofsky performance status<80%, elevated lactate dehydrogenase, low hemoglobin, elevated serum corrected calcium, and time from diagnosis to starting systemic therapy<1 year. data regarding clinical characteristics, including age, gender, clinical stage, histology of the primary tumor, metastasectomy, radiation, and radiofrequency ablation (rfa), were collected from 48 patients. if necessary, we performed metastasectomy, rfa, and radiation before and during systemic treatment. in principle, we performed metastasectomy when the patient would be a surgical complete response (cr). because systemic treatment response in liver metastasis was low in many cases, we tried to perform rfa for liver metastasis if possible. first-line systemic ifn therapy included ifn-alpha and ifn-gamma in 29 and 2 cases, respectively. first-line systemic tki therapy included sorafenib, sunitinib, and axitinib in five, eight, and four cases, respectively. first-line progression-free survival (pfs), overall survival (os), and first-line response rate were evaluated in all 48 patients. after sorafenib was approved for clinical use in 2008, we began to examine its clinical application for other potential molecular targets. we assessed the tumor response according to the recist (response evaluation criteria in solid tumors). statistical analysis was performed by using the student t-test, chi-square test, or mann-whitney u test, and survival curves (pfs and os) were created by using the kaplan-meier method with the log-rank test. comparisons of the clinical and pathological features of all 48 patients according to first-line therapy are summarized in table 1. the mean age at diagnosis was 60 years in the ifn group and 58 years in the tki group (no significant difference). there was no significant difference between the two groups in distribution of gender. before 2008, all patients were treated by immunotherapy. since 2008, 10 patients were treated with ifn and 17 patients were treated with tki as a first-line therapy. the initial clinical stage was 1 in 13 cases (42%), 2 in 7 cases (23%), 3 in 10 cases (32%), and 4 in 1 case (3%) in the ifn group. the initial clinical stage was 1 in six cases (35%), 2 in three cases (18%), 3 in four cases (24%), and 4 in four cases (24%) in the tki group. stage 4 was much more frequent in the tki group than in the ifn group (p=0.0276). histology was the clear-cell type in 26 cases (84%), sarcomatoid in 2 cases (6%), collecting duct in 2 cases (6%), and chromophobe in 1 case (3%) in the ifn group. metastasectomy from any organ was performed in 12 patients (39%) in the ifn group and in 8 patients (48%) in the tki group. radiation of any site was performed in three (10%) and one (6%) patient, respectively, and rfa to any organ was performed in two (6%) and two (12%) cases, respectively. duration from nephrectomy to systemic therapy was 34.1 months in the ifn group and 47.3 months in the tki group. there was no significant difference in the duration from nephrectomy to systemic therapy when comparing the two groups. in the ifn group, responses included cr in 3 cases (10%), partial response (pr) in 6 cases (19%), stable disease (sd) in 18 cases (58%), and progressive disease (pd) in 4 cases (13%). in the tki group, responses included cr in one case (6%), pr in seven cases (41%), sd in nine cases (53%), and pd in 0 cases (fig. the cr rate was higher in the ifn group than in the tki group, and the objective response rate (orr) and clinical benefit were higher in the tki group than in the ifn group, but these differences did not reach the level of statistical significance (p=0.649, p=0.212 and p=0.122, respectively). 2a shows os using a kaplan-meier curve, in which os was superior in the ifn group than in the tki group. median os in the ifn and tki groups was 71 and 47 months, respectively (p=0.014). median pfs was 20 and 16 months in the ifn and tki groups, respectively. in the first year after initial systemic therapy, pfs was superior in the tki group when compared with the ifn group (fig. the superior pfs of tki in the first year might influence the response rate, as 13% of the ifn group had pd in response to initial systemic therapy. median pfs in the first-line ifn group (n=14) and tki group (n=10) was 7 months and 7 months, respectively (p=0.380). four patients from the first-line ifn group had been treated using interleukin-2 as a second-line therapy. one patient from the first-line tki group had been treated with ifn as a second-line therapy. there was no significant difference in the number of favorable-risk mrcc patients receiving a second-line therapy on the basis of the selection of ifn or tki as a first-line therapy in this study. 4a presents os on the basis of metastatic sites. in patients with lung or lymph node metastasis median os in the first-line ifn group (n=23) and tki group (n=4) was 70 months and 16 months, respectively (p=0.230). 4b presents os in patients with metastatic disease at sites other than the lung or lymph nodes. a significant difference was found in os when comparing ifn or tki as a first-line therapy. median os in the first-line ifn group (n=8) and tki group (n=13) was 57 months and 47 months, respectively (p=0.032). these data suggest that first-line ifn therapy was not inferior to tki therapy when evaluated according to metastatic sites. this retrospective study showed that ifn was effective for mskcc-defined favorable-risk mrcc patients. median os in the ifn group (71 months) was longer than that in the tki group (47 months). median pfs in the ifn group (20 months) was not significantly different from that in the tki group (16 months). there was no significant difference in pfs after second-line therapy on the basis of the selection of ifn or tki as the first-line therapy. three patients (10%) in the ifn group and two patients (12%) in the tki group suffered from toxicities and could not continue ifn. because they could not continue their primary systemic treatment, this study demonstrated a higher response rate in the ifn group (29%) than in the tki group (47%). response rates in the range of 30% to 40% have been observed in response to recent tki treatment. furthermore, the response to ifn treatment seen in the present study is also superior to that seen in a previous report (10%-20%). it is possible that patients in previous reports included those with mskcc-defined intermediate- and poor-risk disease as well as patients with a different distribution of ethnicity than in the present study. a previous study of mskcc risk classification in japanese patients with mrcc showed that median os was not reached and that 3-year os was 80% among mskcc-defined favorable-risk patients. studies on japanese mrcc patients have showed varying survival times compared with studies conducted on north american or european patients. however, there were some differences in the distribution of patients among the different risk groups and in the survival time according to risk group when comparing japanese studies with other studies. another japanese retrospective study of 1,467 patients with mrcc showed that os was about 2 times longer than that seen in previous studies in north america and europe in the cytokine era. therefore, japanese mrcc patients might have better outcomes than do north american and european mrcc patients. ifn-alpha monotherapy is associated with an improvement in survival among patients with advanced rcc. however, previous trials have not shown the superiority of cytokine treatment monotherapy over other therapies. ifn-alpha was chosen as the comparator in several trials on the basis of data from previous studies and the widespread use of this agent. because ifn therapy is associated with a low response rate and substantial adverse effects, identification of reliable predictive markers for a favorable response to ifn is needed to establish optimal treatment strategies for patients with mrcc. a japanese genetic study was the first prospective study to demonstrate that a stat3 polymorphism can predict favorable response to treatment with ifn-alpha in patients with mrcc. another japanese study demonstrated that the sensitivity to ifn-alpha is increased by yb-1 suppression and that this suppression does not down-regulate ifn-alpha activation of t lymphocytes. further study should be performed to clarify the difference between japanese mrcc patients and those from other geographic regions and ethnicities. this study demonstrated that ifn was not inferior to tki therapy according to metastatic sites. a previous japanese study showed that it is possible to improve the success rate in treating advanced rcc patients, especially those with lung metastases, if combination therapy with interleukin-2 and ifn-alpha is chosen as the firstline treatment. that study showed an orr of 35.5% and a clinical benefit rate of 80.6% in patients with lung metastasis alone; those values were 60.0% and 80.0%, respectively, in patients with lung plus lymph node metastasis. on the other hand, in patients with lung plus bone metastatic sites, endpoint results from specific surveillance of sunitinib treatment of japanese patients showed that the orr for all mskcc-defined risk groups was 22.8% for patients with lung metastasis, 18.9% for patients with liver metastasis, and 14.9% for patients with bone metastasis. endpoint results from specific surveillance of sorafenib treatment of japanese patients showed that the orr of all mskcc-defined risk groups was 33.5% for patients with lung metastasis, 16.8% for patients with liver metastasis, 11.7% for patients with bone metastasis, and 12.5% for patients with brain metastasis. these data demonstrated that patients with lung metastasis experience a better response than do other patients when treated with immunotherapy or tki therapy. in the present study, the number of patients with metastatic disease was low, because the patient population consisted of those with mskcc-defined favorable-risk disease, and this phenomenon might have affected the results. the present study and previous reports showed that tki produces insufficient benefit in patients with metastatic disease at sites other than the lung or lymph nodes. because this was a retrospective study with a small number of patients treated with tki for first-line systemic treatment, our understanding of the use of a single tki agent for first-line systemic treatment is limited. in this study, recently, sunitinib and pazopanib have been recommended for use as single tki agents for first-line therapy of good- to intermediate-risk clear cell carcinoma on the basis of the results of large randomized clinical trials. further study is needed to determine appropriate first-line tki agents in favorable-risk patients. this retrospective study included patients with non-clear-cell histology in the ifn group. patients with sarcomatoid variants and collecting duct rcc have poor survival. in this group of enrolled patients, one patient with sarcomatoid carcinoma was alive and being treating with ifn 10 months after systemic treatment, whereas the other patient died 17 months after ifn treatment and pfs was 2.8 months. one patient with collecting duct carcinoma was dead 13 months after ifn treatment and pfs was 1.5 months, the other patient was alive at 68 months after ifn treatment and pfs was 50 months. in this study, some of the patients with a poor prognosis histology received a survival benefit. this seemed to be affected by good general condition and performance status. in the target therapy era, we might be able to achieve effectiveness in japanese patients with non-clear-cell, favorable-risk disease treated with ifn. further clinical study with a large number of patients is needed to clarify the treatment effects of ifn in non-clear-cell, favorable-risk patients. there is the possibility of bias in the initial stage and in the era of starting systemic therapy. our understanding of this study in mskcc favorable-risk mrcc is limited and needs to be developed further. further research about the molecular differences between japanese patients and those of other ethnicities may improve our understanding of why some mrcc patients in this study had markedly better responses to immunotherapy. further clinical study is needed to evaluate favorable-risk patients with regard to os and pfs in the selection of a first-line systemic therapy. collaborative group studies might help to boost the numbers of patients with this rare favorable-risk profile who are available for study. ifn is associated with a survival benefit in japanese patients with favorable-risk metastatic rcc in the era of targeted therapy. however, because the present study was a retrospective analysis, there is the possibility of outside factors influencing the results at the initial stage and in the era of starting systemic therapy.

purposesingle-agent interferon (ifn) is no longer regarded as a standard option for first-line systemic treatment of metastatic renal cell carcinoma (rcc) in western countries. however, some patients with favorable-risk rcc may still achieve complete and long-lasting remission in response to ifn treatment. the present study compared favorable-risk japanese patients with metastatic rcc japanese patients who had been treated with ifn or tyrosine kinase inhibitor (tki) therapy as a first-line systemic therapy. materials and methodsfrom 1995 to 2014, a total of 48 patients with favorable risk as defined by the memorial sloan kettering cancer center criteria who did not receive adjuvant systemic therapy were retrospectively enrolled in this study. we assessed the tumor response rate, progression-free survival (pfs), and overall survival (os). resultsthe objective response rate for first-line therapy was 29% in the ifn group and 47% in the tki group, but this difference did not reach the level of statistical significance. median os for ifn and tki was 71 and 47 months, respectively (p=0.014). median first-line pfs for ifn and tki was 20 and 16 months, respectively (no significant difference). first-line ifn therapy did not prove inferior to tki therapy in terms of os according to metastatic sites. conclusionsifn is associated with a survival benefit in japanese patients with favorable-risk metastatic rcc in the era of targeted therapy. further prospective study is needed.

PMC4355431

pubmed-1125

in 1982 chang and der, two postdoctoral fellows working in geoffrey cooper's laboratory, discovered kristen rat sarcoma virus and murine sarcoma virus; retroviral oncogenes related to rodent sarcoma virus genes. the human kras gene is a homolog of these two oncogenes. a normal form of human c-ras has been called kras or kras2 (kristen rat sarcoma viral oncogene homolog or alternatively kristen murine sarcoma virus2 homolog). in 1983, der described an abnormal form of the p21 protein expressed by colon and lung carcinoma cell lines and showed that the gene encoding this protein is able to transform nih3t3 cells. this finding was later confirmed by parada and weinberg, who described the transformation of nih3t3 cells by an activated kras oncogene. aberrant p21 proteins were encoded by the altered kras gene and their expression in carcinoma tissue was causally linked to an abnormal state of activation. since then, it has been accepted that kras is one of front-line sensors that initiate the activation of an array of signalling molecules allowing the transmission of transducting signals from the cell surface to the nucleus, thus affecting cell differentiation, growth, chemotaxis, and apoptosis. a signal transduction cascade initiated by the activated form of kras kras elicits changes in the cytoskeleton and consequently affects cell shape, adhesion and migration [4, 5]. in the following paragraphs, kras protein, gene, oncogenesis, and cancer therapy is reviewed kras belongs to a group of small gtp-binding proteins, known as the ras superfamily or ras-like gtpases. the entire ras superfamily is characterised by the presence of a catalytic g domain, but includes members with distinct evolutionary specializations with respect to different cellular process. the ras subfamily (ras, rho, rab, arf, rac, and ran) includes the most frequently studied proteins, such as harvey-ras (h-ras), neuroblastoma-ras (n-ras), and two variants of kristen-ras (k-ras)one, known as kras4a, which is weakly expressed in human cells and the dominant form, known as kras4b, which is much more highly expressed. the kras gene product, kras protein, contains 188 amino acid residues with a molecular mass of 21.6 kd and participates in intracellular signal transduction. as mentioned above, the kras protein remains inactive until it binds to gtp, as depicted in figure 2. once the gtp is bound to the kras protein, kras undergoes conformational changes that involve two regions of the protein, thus activating it. these two important regions are known as switch 1 (aminoacids 3038) and switch 2 (aminoacids 5967), which form an effector loop, controlling the specificity of the binding of this gtpase to its effector molecules. this conformational change in the kras protein affects its interactions with multiple downstream transducers gtpase-activating proteins (gaps)which amplify the gtpase activity of the ras protein 100,000-fold. the change also affects interactions with guanine-exchanging/releasing factors (gefs/grfs) promoting the release of gtp. the kras protein also has intrinsic gtpase activity, stimulated by gaps, which acts as a timer associated with direct interactions with the effectors. mutations found in an oncogenic form of the ras p21 protein impair gtpase activity and make the kras protein unresponsive to gap proteins. mutated forms of p21 rapidly exchange gdp for gtp, which it prefers as a substrate, thus inducing the active state. such aberrant forms of kras protein deregulate many effectors, thus affecting several important cellular pathways. many gtp derivatives targeting ras or raf effectors have been developed to repair the defective gtpase activity that influences the aberrant ras signalling. however, little is known about the specificity and transport of compounds modified by gtps through the plasma membrane. the first domain includes 85 amino acids at the n-terminus and is identical in the three forms of ras (kras, nras, and hras). the second domain contains 80 amino acids, with lower sequence identity (7080%) among the three forms of ras protein. these regions are important for the signalling function of the kras protein and jointly form the g-domain (amino acids 1165, figure 3). the g-domain of the kras protein includes the gtp-binding pocket, where p-loop-phosphate binding loops (aminoacids 1016 and 5659) interact with the b-phosphate and c-phosphate of gtp. the region between amino acids 32 and 40 (the core effector region) is essential for the interactions between the putative downstream effectors and gaps. ras protein also contains a hypervariable region (hvr) at the c-terminus (amino acids 165188/189; the third domain), which guides posttranslational modification and determines plasma membrane anchoring. this region plays an important role in the regulation of the biological activity of ras protein. switch regions i and ii play important roles in the binding of regulators and effectors. the phosphate binding pocket-p loop permits temporary binding of gtp to the ras protein. this is also the region of gtpase activity, which negatively regulates the ras protein via a ras-gtp hydrolysis reaction and binding of guanosine diphosphate. the kras protein acts like a plasma membrane-localized molecular switch, regulating multiple signal transduction pathways. it is synthesized in the cytosol, where it is farnesylated by farnesyl transferase at the cysteine residue of the carboxy-terminal motif caax (where c represents cysteine, a is an aliphatic amino acid, and x is any amino acid). the aax amino acid motif is cleaved by proteases, whereas the c-terminal carboxyl residue of the kras protein is methylated. cleavage of the axx peptide motif and methylation occur at the cytosolic surface of the endoplasmatic reticulum and are mediated by the ras-converting enzyme rce1. c-terminal farnesylation plays an important role in membrane localization. in the splice variant kras4a, the axx motif undergoes additional palmitoylation by palmitoyl transferase, resulting in proper targeting of kras4a to the membrane. however, there is no detectable palmitoylation of the predominant splice variant kras4b, which probably reaches the plasma membrane via a microtubule-dependent mechanism, thus avoiding the golgi apparatus [13, 15]. posttranslational farnesylation and carboxymethylation are believed to be important for the oncogenicity of the ras protein. treatment with farnesyl transferase inhibitors has been shown to inhibit anchorage-independent growth of both kras-transformed mouse fibroblasts and human tumour cells containing kras and nras mutations. activation of downstream signalling pathways by kras can also be triggered by signals from subcellular compartments, such as the endoplasmatic reticulum and the golgi apparatus [16, 17]. while wild-type kras usually promotes cell cycle progression, it can also induce growth arrest, apoptosis, and replicative senescence when increased to abnormal levels. this can be triggered by cellular stress, ultraviolet or ionizing irradiation, heat shock, and some cytokines. in these circumstances, triggering of growth arrest can represent a defence mechanism against inappropriate activation of ras. it has been demonstrated that the wild-type kras gene is a tumour suppressor that is frequently lost during tumour progression in many types of cancer. once the kras gene mutates, it acquires oncogenic properties (table 1) and seems to be causally involved in the development of various human cancers [19, 20]. loss of the wild-type kras allele has been observed in both human and mouse tumours, indicating that absence of the normal allele may facilitate transformation by one copy of the oncogenic kras allele. oncogenic mutations in the kras gene prevent the hydrolysis of gtp, thus permanently activating the ras molecules. expression of a mutated kras gene in fibroblasts has been shown to augment metalloproteinase 2 (mmp2) expression in the matrix and enhance the invasion of cancer cells. overexpression of this mutated form of kras also inhibits glycosylation of the integrin 1-chain, resulting in altered polarisation and increased adhesiveness of colon cancer cells. in addition, expression of this oncogenic form of kras protein has been shown to be associated with upregulated carcinoembryonic antigen (cea) expression and disturbance of epithelial cell polarization. there are two copies of the kras gene in the human genome, designated kras1 and kras2. the mrna encoded by the main kras2 is 5.5 kb long, and differs from transcripts of the transforming kristen murine viral gene by only six codons. analysis of human placental and embryonic cdna libraries has revealed that 900 bp of the kras1 gene is homologous to the corresponding sequence of the kristen murine sarcoma virus2 homolog, with one intervening sequence, and 300 bp of the kras2 is fully homologous to the viral counterpart. the kras1 gene is a pseudogene derived from kras2 by alternative mrna splicing. mcbride and colleagues found that the protooncogenes kras1 and kras2 are localized at human chromosomes 6 and 12, respectively. later, kras1 and kras2 were mapped by in situ hybridization to chromosome positions 6p11-12 and 12p11.1-12.1, respectively. alternative splicing of exon 4 produces two mrna forms, known as 4a and 4b. exon 5 can be skipped during alternative splicing, giving rise to isoforms krasa and krasb. the 6th exon encodes the c-terminal region in krasb and is not translated (the 3untranslated region, 3utr) in krasa. krasb is the predominant splice variant of kras2, and is referred to, briefly, as kras. there are indications that allelic losses of chromosome region 12p commonly occur in human cancers, and a frequently deleted region is near the kras gene at position 12p12-13. further, recent studies on lung adenocarcinoma suggest there is an association between the incidence of allelic losses in the 12p12-13 region and kras gene mutation. diagnostics of kras gene mutations in clinical setting is limited by two factors: first, in the time of testing, kras mutated tumour cells may be in minority, outbalanced by wild type tumour cells and wild type non-tumour cells present in the sample. second, analytically preferable snap-frozen tumour samples are rarely available for kras mutation testing. instead, formalin fixed paraffin-embedded (ffpe) tissue is used. there, integrity of dna may be severely compromised by procedure of formalin fixation (especially by its long duration and low ph). all the known principles of dna polymorphism detection are applicable to kras mutation detection and demand a dedicated review outside of the scope of this paper. more than 60 methods described can be divided into sequencing methods [3037], methods based on specific interaction with oligonucleotide, methods based on specific interaction with enzyme [3840], and conformational methods [4147]. while many specificity and/or sensitivity enhancement of methods were described as well [4853], analytical validation, systematic comparison, and assessment of methods side by side is lacking. to authors best knowledge, only communaut europene (ce) marked kras mutation detection kits are supplied by dxs (mutations in codons 12 a 13 are tested using principle of arms-pcr and scorpion primers, vienna-lab (reverse dot blot assay format), tib molbiol (kras lightmix clamped hybridization probes for codon 12), and invigene (qpcr with sequence suppressor agent stopprimer for the unwanted excess component, applicable for first two nucleotide positions in codons 12 and 13). kras expression is regulated both during the initiation of transcription by the binding of proteins to its promoter and during transcriptional elongation by micrornas affecting kras mrna stability. both human and murine kras gene promoters contain a nuclease hypersensitive polypurine-polypyrimidine element (nhppe). the g-rich strand of nhppe located in the proximal promoter sequence is able to form an intramolecular parallel g-quadruplex, consisting of three g-tetrads and three loops, which recognizes and binds nuclear proteins that are involved in transcriptional repression of kras expression. accordingly, it has been reported that sequestration of nuclear proteins that bind to nhpp by an oligonucleotide mimicking the kras g-quadruplex resulted in 40% inhibition of kras transcription, compared to controls. the transcription of kras is regulated, in part, by an interaction between the promoter region and the 65 kda esxr1 protein and, in part, by micrornas (mirnas). esxr1 is a human protein with an n-terminal homeodomain in the nucleus and a c-terminal proline-rich repeat region i in the cytoplasm. the n-terminal fragment of esxr1 binds to the taatgttatta consensus sequence in exon-1 of the kras gene, thus inhibiting its mrna expression. mirnas contain a 21-22 nucleotide long noncoding sequence that is able to regulate gene expression. in 2005 it was estimated that there are more than 500 mirnas, which collectively regulate approximately 30% of all human genes, including the ras gene family. regulation of gene expression by mirnas probably occurs as a result of imperfect hybridization of the mirna to the complementary sequences located in the 3untranslated region (3utr) of target messenger rna (mrna) species. this interaction between mirna and mrna both decreases mrna stability and represses protein synthesis by preventing access to ribosomes. interestingly, many altered mirnas have been identified in human cancers [6163], including some of the most thoroughly analyzed mirnas members of one group, the oncomirs, are upregulated in cancer and can act like oncogenes. the second group, the anti-oncomirs, probably act as tumour suppressors by targeting oncogenes, repressing the cell cycle and division of cancer cells. for example, mirna-let7 is an oncogene-antioncomir pair that negatively regulates ras protein levels and decreases cell proliferation rates [68, 69]. kras, nras, and hras harbour multiple let-7 mirna complementary sites (lcss) in their 3utrs. zhang et al. found that reducing the activity of let-7 in hela cells resulted in a 70% increase in ras protein levels, while takamizawa et al. found that let-7 expression was 80% lower in 60% of lung cancer adenocarcinoma and squamous cell carcinoma lines than in normal lung tissue. moreover, a correlation between low levels of let-7 mirna and significantly higher ras protein expression has been found in lung squamous cell carcinomas. these results suggest that let-7 is able to downregulate the expression of ras in human carcinomas. these molecular findings provide a strong rationale for developing novel therapeutic treatments aimed at decreasing kras protein expression in cancer cells. in many cases kras protein expression is dramatically increased due to mutations in the kras gene sequence, thus making cells refractory to current therapies, such as those involving use of epidermal growth factor receptor inhibitors. such oncogenic forms of the kras gene are prevalent in pancreatic carcinomas (> 80%), colon carcinomas (4050%), and lung carcinomas (3050%), but are also present in biliary tract malignancies, endometrial cancer, cervical cancer, bladder cancer, liver cancer, myeloid leukemia [73, 74] and breast cancer. mutations in the kras gene have important effects on the process of carcinogenesis, which depend on the cells and tissues involved. the mutations found most frequently in the kras gene of cancer cells are located at positions 12 and 13 in exon 1, and less frequently in codons 61, 63, 117, 119, and 146 [77, 78]. allelic mutations result in amino acid changes, namely gly to asp, ala, arg, ser, val, or cys in codon 12 and gly to asp in codon 13. somatic missense mutations at positions 12, 13, 61, and 63 enable perturbation of the intrinsic gtpase activity of the kras protein, resulting in reductions in gtp hydrolysis capacity. mutations in codons 12 (figure 4) or 13 are known to lead to conformational changes in the kras protein. mutation in codon 12 of the kras gene causes the encoded kras protein to freeze in its active state for a much longer duration than its nonmutated counterpart. mutations resulting in the substitution of amino acids 116, 117, 119, and 146 reduce the nucleotide affinity of the kras protein, thereby affecting the rate of gdp/gtp exchange. the oncogenic forms of the ras protein have a profound effect on the downstream effector pathways, resulting in much higher proliferation rates of cancer cells expressing such forms. the transforming ability of the kras oncogene may result from overexpression of the mutant kras allele or from deletion of the wild-type allele. overexpression of kras can also be induced by the loss of p16ink4 (cdkn2a), p19ink4 (cdkn2d), or p53. (2001) have shown that the wild-type kras allele can suppress the oncogenic function of the mutated allele. in addition, the radiosensitivity of tumour cells is altered by oncogenic ras expression, probably as a result of the effect of the kras mutation on several intercommunicating pathways. the prevalence of mutations in the kras gene at the time of diagnosis is highest in pancreatic cancers (> 80% of cases), notably pancreatic adenocarcinomas predominantly harbour kras forms with a guanine to thymine transversion in codon 12. wei and colleagues examined samples collected from 30 patients with pancreatic cancer and found that 24 of them showed mutations at codon 12 and only one at codon 13. however, concurrent kras mutations frequently occur in patients with pancreatic cancer. a positive association has been found in patients with pancreatic cancer between tobacco exposure and mutations in the kras gene. similar associations have also been reported for coffee drinking, and milk, butter, and alcohol consumption [88, 89]. however, no direct evidence of a causal relationship between these dietary components and mutations in the kras gene has been presented. the second highest incidence (about 50% of cases) of mutations in the kras gene is found in colon cancers [90, 91]. the first stage is characterized by the development of a small, benign tubular type of adenoma or polyp with sporadically detectable kras mutation(s). the second stage is more aggressive and is usually associated with patches of definitive carcinoma cells, which may grow into invasive cancers characterising the third stage. mutations of the kras gene have been identified in tissues from both adenoma and carcinoma cases, but at much lower frequencies in colon adenoma tissues than in carcinoma tissues [93, 94]. the incidence of mutation in the kras gene has been found to be low and to occur mainly in the small adenomas of patients with familial adenomatous polyposis, who have a predisposition to colon cancer in the kras gene associated with colon cancer appear most often in codons 12 (28%) and 13 (8%) of exon 1 and less frequently in codon 61. in colorectal cancer, the main substitution (gly to asp) has been found to occur in codon 12. mutation from ggt (gly) to gtt (val) in codon 12 has been observed more frequently in primary metastatic carcinoma, suggesting that this mutation may confer a more aggressive phenotype in colorectal carcinoma. a mutation in codon 13, resulting in the substitution of gly with asp, observed in colon cancer has been shown to be associated with reduced survival rates. this kind of kras gene mutation has also been shown to occur more frequently in unstable, than in stable, colon tumours [97, 98]. losses of kras wild type alleles in both mouse and human lung adenocarcinomas and squamous carcinomas have been found in many studies, notably in 67% to 100% of chemically induced murine lung adenocarcinoma cases harbouring a mutant kras. in humans, kras mutations appear in 1030% of lung carcinoma cases, demonstrating strong associations with a history of smoking and poor prognosis [100, 101]. among both current and former smokers, further, although some researchers have found sporadic kras mutations in non-smokers with early onset of cancer, smoking history is an important factor and is correlated with increased occurrence of mutations in the kras gene in lung cancer cases. mutations in the kras gene in codons 12 and 13 were detected in 21% of nsclc (non-small cell lung cancer) tumour samples examined in the tribute iii trial. nsclc patients have a tendency to accumulate activating mutations in either the egfr or kras genes. however, a clinical study has shown that mutations of these two genes are, in general, mutually exclusive. although higher kras mutational frequency is primarily found in cancers of the pancreas, colon and lung, possible links between kras hyperactivity and human breast cancer have been explored recently. hollestelle at al. found mutations in 12.5% of cases but the sanger cosmic database version 28 (http://www.sanger.ac.uk/genetics/cgp/cosmic/) records only a 5% incidence. the lower frequency of kras mutations in breast cancer cell lines suggests that the gene mutation may be less important in breast cancer carcinogenesis than in other forms of cancer, although mutations at a hotspot in the kras gene have been found in a small subset of breast cancers. many clinical trials have shown that a poorer response to chemotherapy, a shorter time-to-progression, and worse overall survival are consistently associated with specific mutations in oncogenes. kras is one of the most frequently mutated oncogenes in many cancers, and it is also one of the most important predictors of resistance to targeted therapy using egfr1 tyrosine kinase inhibitors (egfr-tkis). two of the most important egfr-specific tkis are gefitinib (iressa, zd1839) and erlotinib (tarceva). the first indications of the predictive strength of the association between the kras gene and therapeutic responses to the egfr-tki gefitinib were originally observed in nsclc patients with tumours bearing the wild-type form of the kras gene and constitutively activated egfr1 gene, due to activating mutations in exons 18 to 21 or high copy number/amplification of the egfr1 gene. clinically, better responses to tyrosine kinase inhibitor treatment were observed in patients with adenocarcinomas and well-differentiated tumours, female patients, non-smokers, and people of asiatic origin [107109]. clinical research data show that gefitinib monotherapy is well tolerated and active against a wide range of tumour types, including colon, head, neck, breast, prostate, and lung cancers, especially nsclcs. egfr-tkis are usually used as the second line therapy in patients after failure of chemotherapy. however, gefitinib did not pass the registration procedure in the european union because insufficient clinical benefit was demonstrated, probably because european clinical trials did not include sufficient good responders clinical data also suggest that the drug represents a new therapeutic option for nsclc patients with brain metastases. after the successful tribute and talent clinical trials, erlotinib (tarceva) was also approved by the us fda in 2002 as a second or third line treatment for nsclc after failure of standard chemotherapy. however, molecular analysis revealed that patients who have activating mutations in the kras gene (exon 1: codons 12, 13, or 61) with or without increases in egfr copy numbers did not derive benefit from this therapy and had about a 96% chance of disease progression. similarly, eberhard et al. first observed the relationship between kras mutations and the outcome of erlotinib therapy in a randomized phase iii clinical trial in which the drug was used, in combination with first line gold standard chemotherapy (carboplatin and paclitaxel), to treat advanced nsclc patients. patients with the kras mutation exhibited a shorter time to progression (three months) and a shorter overall survival (four months) when treated with a combination of erlotinib and first line chemotherapy, such as treatment with cisplatin, compared to the group with wild-type kras, for whom the time-to-progression was 12 months. most nsclc patients in the erlotinib treatment study had expressed wild-type kras, and their kras status had greater prognostic than predictive value as a biomarker. however, in colorectal cancer, mutations in the kras gene are important predictive (as well as prognostic) biomarkers, since the effectiveness of treatment with cetuximab and panitumumab is impaired in tumours with the activating mutation. information regarding the status of the kras gene allows the selection of appropriate therapies for patients who do not display activating mutations and the selection of alternative therapies for patients with mutations. although results pertaining to the role of kras in the prognosis of clinical outcome or prediction of therapeutic responses to egfr1 tyrosine kinase inhibitors are interesting, they need to be validated in larger and prospective trials, using standardized and sensitive mutation detection techniques. if the associations are confirmed, knowledge of the mutation status of kras in nsclc tumours could help physicians decide which patients should receive gefitinib and/or erlotinib. interestingly, kras gene mutations also seem to provide strong predictive indication of therapeutic responses to other classes of tyrosine kinase inhibitors, as recently demonstrated for the imatinib mesylate (glivec). imatinib is the standard drug for patients with chronic myeloid leukaemia (cml) and patients with gastrointestinal stromal tumours (gists), expressing the bcr-abl fusion protein and tyrosine kinase receptor c-kit, respectively. further, drug resistance to imatinib is usually attributed to mutation of the imatinib-binding sites of these proteins, although amplification of the bcr-abl fusion gene or overexpression of multidrug resistance proteins may be involved in some cases. however, a recent study by agarwal et al. colorectal cancer is another frequent neoplasia that is associated with activation of the egfr1 pathway, so it is not surprising that novel and successful therapeutic strategies for this condition involve egfr1 protein kinase inhibition. in contrast to nsclc, two monoclonal antibodies against egfr1, rather than small molecular inhibitors of egfr1, are generally used for treating colorectal cancer: cetuximab (erbitux) and panitumumab (vectibix). in accordance with the effect of small molecular egfr1 inhibitors in nsclc, kras alterations play a critical role in the response of colorectal cancer patients to such therapeutic monoclonal antibodies. indeed, kras mutation status is the most important predictor of resistance to cetuximab or panitumumab; both the median progression-free survival of cetuximab-treated patients and overall survival was recently found to be superior in a kras wild-type group than in a kras mutant group (31 versus 10 weeks, and 16 versus 7 months, respectively). on september 27, 2006, the us fda approved the completely humanized monoclonal anti-egfr1 igg2 antibody panitumumab (vectibix) for clinical use in the third line treatment of patients with metastatic colorectal carcinoma who had progressed after standard chemotherapy. kras panitumumab therapy was tested in a randomized study involving 463 patients, and the results showed that the wild-type kras gene is essential for its therapeutic activity. progression-free survival of patients with wild-type versus mutant kras gene tumours was 12 versus seven weeks, while response rates obtained in another study were 17% versus 0%. these findings strongly indicate that kras gene status should be routinely tested as a critically important diagnostic biomarker to determine which patients will derive therapeutic benefit from egfr1 inhibition. indeed, analysis of the kras gene status in colorectal cancer cases has become conditio sinequa non for deciding whether or not to apply cetuximab or panitumumab therapy in routine clinical practice and fda has updated vectibix and erbitux labels in 2009 to include this information. surprisingly, the effects of kras gene mutations on tumour sensitivity to cytotoxic chemotherapies and radiation have only been explored in a few studies. however, expression of a 12 val mutated form of kras has been shown to increase the resistance of cancer cells to radiation therapy. similarly, the presence of oncogenic kras has been found to significantly increase the sensitivity of cells to a novel class of anticancer agents, cucurbitacins, in a p53- or p21-dependent manner. in contrast, an ovarian cancer cell line tov-21 g bearing a mutant allele of kras is reportedly significantly more sensitive to cisplatin and radiation, but not to paclitaxel or campthotecin, than the corresponding kras wild type line. however, results of clinical studies by rosell and colleagues (1995) showed that patients with a mutation in the kras gene had poorer clinical responses to paclitaxel monotherapy than wild type controls, suggesting that kras gene status is a predictive marker of paclitaxel resistance. in a phase iii retrospective study on nsclc patients (tribute), randomly treated with carboplatin and paclitaxel with erlotinib or placebo, patients with kras mutant tumours showed poorer clinical outcomes when treated with erlotinib plus chemotherapy compared to chemotherapy alone. an updated clinical trial (crystal) involving 540 metastatic colorectal cancer patients demonstrated that cetuximab in combination with folfiri (folic acid, fluorouracil, and irinotecan) in first line therapy is highly effective against kras wild type, but not mutant, tumours. however, further analysis of the data showed that neither the response nor the progression-free survival of patients treated with chemotherapy alone were significantly affected by kras gene status, although the overall survival of patients with kras mutant tumours was significantly shorter than that of patients with kras wild type tumours. recently we have also shown that egfr may represent a predictive molecular marker for poor response to preoperative chemoradiotherapy in locally advanced gastric carcinoma. responses to chemoradiotherapy were found in 60% of egfr-negative patients, but only 13% of egfr-positive patients (p= .044), and pathologic complete responses were observed in 29% of patients with egfr-negative staining, but none (of eight) egfr-positive patients (p= .16). the above findings regarding the role of the kras gene in tumour responses to cytotoxic therapies appear to conflict somewhat. the predictive and prognostic significance of oncogenic kras seems to have been mixed in many studies, and the contributions of variations in the gene to clinical outcome appear to differ according to tumour types and therapeutic interventions. clearly, further studies are urgently needed to confirm and clarify the findings in large prospective biomarker-oriented clinical trials. other clinical trials have also demonstrated that activating mutations in the kras gene can contribute to tumour progression by affecting the expression of vascular endothelial growth factor (vegf), which plays a critical role in tumour angiogenesis. inhibition of kras expression by selected kras antisense oligonucleotides has been shown to be associated with significantly reduced secretion of vegf-a165 into the medium of colorectal cancer cell cultures. in addition, in a cohort of patients with pancreatic tumours, 25/33 (76%) with kras mutations showed higher vegf expression, and their median survival was shorter, than those with tumours expressing the wild-type allele. similar findings have also been reported from a study of nsclcs, in which higher vegf expression was observed in 50% of tumours bearing a kras gene mutation. although these studies suggest that kras gene status could play an important role in responses to anti-vegf targeted antiangiogenic therapy, a recent study by hurwitz and saini showed that groups of patients bearing either kras mutant or wild-type tumours derive therapeutic benefit from first line application of the anti-vegf monoclonal antibody bevacizumab (avastin). furthermore, although both groups of patients (i.e., those with wild-type kras and mutated kras genes) benefited from adding bevacizumab to chemotherapy, both progression-free survival and survival was better for wild-type kras patients, both with chemotherapy alone and with chemotherapy plus bevacizumab. bevacizumab did not increase the percentage of patients with mutated kras who responded to treatment. an optimal therapeutic drug should be able to specifically target the mutated kras gene or its product, have minimal systemic toxicity and be orally active. unfortunately, drugs like this remain to be developed and less efficient strategies need to be used in clinical trials. however, in addition to the cancer therapies mentioned above, several therapeutic agents and strategies can directly suppress the activating mutant form of the kras gene, and thus improve the efficiency of chemotherapy and biological therapy. one possible approach for inhibiting kras expression is to use antisense oligonucleotides or viral constructs delivering antisense sequences in order to inactivate the mutant oncogene rna message. in addition, synthesis of mutated kras protein has been repressed by applying a small interfering adenovirus-mediated rna (sirna), and the specifically designed sirna was shown to have prolonged anti-proliferative effects against various tumour cancer cell lines expressing mutated kras proteins. another, similar strategy to target mutant kras mrna is based on designing an mrna ribozyme that specifically interacts with a mutated form of the kras mrna and encodes catalytic rna molecules that bind to the mrna substrate by base-pair complementation, leading to translation arrest and/or degradation of the specific mrna. the kras-specific ribozyme strategy has also been shown to suppress successfully the proliferation of kras-mutated tumour cells. recently an interesting novel strategy employing farnesyltransferase inhibitors (ftis) was shown to inhibit the biochemical transactivation initiated by the mutated kras gene. farnesyl transferase is an enzyme that primarily regulates zinc metabolism by the addition of a farnesyl group to the cysteine residue of a protein. at least 30 proteins (including kras) require posttranslational farnesylation to reach their membrane positions and function properly in cell signalling. farnesyl inhibitors represent a novel class of biologically active anticancer drugs that inhibit cell growth. after the discovery that ras proteins have to be farnesylated to become functionally active, several farnesyl inhibitors were developed. however, phase ii and phase iii clinical trials conducted to date have found that kras ftis might not be sufficient to inhibit the mutated-overactive forms of kras protein. the reason for this is probably incomplete inhibition of farnesylation, because garnesylation of kras protein by geranyltransferase i leads to suppression of the effects of farnesyltransferase inhibitors [131, 132]. it should be noted that although kras inhibitory strategies have shown promise in preclinical trials and have been partially successful in clinical trials, there are insufficient data on their efficacy in combination with anti-egfr1 strategies to recommend their routine use as yet. the evidence from various studies summarized in this review demonstrates that the kras protein is an important signal transducer involved in the regulation of various cellular responses during cell proliferation, differentiation, and survival. a pivotal function of kras protein in the regulation of the mapk and pi3k/akt pathways is its effect on the proliferation rate of both normal and cancer cells. activating mutations of the kras protein, which frequently occur in cancer cells, overall, this review summarizes novel approaches allowing the management of cancers with or without kras mutations, and highlights the importance of early identification of somatic mutations in the kras gene in cancer biopsies .

the kras gene (ki-ras2 kirsten rat sarcoma viral oncogene homolog) is an oncogene that encodes a small gtpase transductor protein called kras. kras is involved in the regulation of cell division as a result of its ability to relay external signals to the cell nucleus. activating mutations in the kras gene impair the ability of the kras protein to switch between active and inactive states, leading to cell transformation and increased resistance to chemotherapy and biological therapies targeting epidermal growth factor receptors. this review highlights some of the features of the kras gene and the kras protein and summarizes current knowledge of the mechanism of kras gene regulation. it also underlines the importance of activating mutations in the kras gene in relation to carcinogenesis and their importance as diagnostic biomarkers, providing clues regarding human cancer patients ' prognosis and indicating potential therapeutic approaches.

PMC2896632

pubmed-1126

palisaded encapsulated neuromas clinically manifest as solitary, firm, non-pigmented, dome-shaped nodules on the face of adult patients. palisaded encapsulated neuroma is known as a benign tumor of the facial skin, and is rarely found in the oral mucosa. microscopically, the tumors are characterized by moderately cellular, fascicular proliferation of spindle cells that show some areas of parallel nuclei. a bundle of nerves interposed between the schwann cells typically aggregates in palisades and is identified by s-100 protein immunohistochemical stain. an alternate designation i.e. solitary circumscribed neuroma (scn) was proposed by fletcher in 1989. irrespective of the nomenclature, pen/scns are considered as reactive hyperplastic processes. in 2010, koutlas and scheithauer considered pen/scns as relatively common true neuromas of the skin or mucosa. as a peripheral nerve sheath tumor, pen accounts for only 0.04 to 0.05% of oral biopsy specimens. other peripheral nerve sheath tumors are neurofibroma, schwannoma (neurilemmoma), mucosal neuroma associated with multiple endocrine neoplasia iii, nerve sheath myxoma and granular cell tumor. in the mouth, pen is mostly found on the hard palate and maxillary labial mucosa as a small, superficial and usually painless nodule. the lesion is frequently diagnosed between the 5 and 7 decades of life, with equal sex predilection. a preferred treatment for pen is conservative local surgical excision; although gross total resection has been recently claimed to be the treatment of choice. a 48-year-old man was referred to the oral medicine department of babol dental school, complaining of a tongue mass persisting for one year. physical examination revealed an exophytic sessile mass measuring 0.3 0.4 cm with rubbery consistency on the anterior one-third of the dorsal surface of the tongue (fig. clinically, the overlying mucosa was depapillated and had increased vascularity. under the impression of a pg, excision of the mass was done and no recurrence was reported at 12 months postoperatively. histopathological sections showed an encapsulated mass within the connective tissue, composed of interlacing fascicles of spindle cells that were consistent with schwann cells. the nuclei, showing a parallel orientation within the fascicles, were characteristically wavy and pointed, with no significant pleomorphism or mitotic activity. the overlying epithelium was atrophic and no rete ridges were seen (figs. 3 and 4). giemsa special stain revealed no mast cells within the stroma, ruling out the differential diagnosis of neurofibroma. photomicrograph showing an encapsulated proliferation of neoplastic cells (hematoxylin and eosin staining; original magnification 40). no evidence of malignancy is observed (hematoxylin and eosin staining; original magnification 400). mucosal neuroma can be distinguished histologically from other neurogenic tumors such as neurofibroma, neurilemmoma and pen. briefly, mucosal neuroma is not encapsulated and does not have palisading nuclei; whereas neurofibroma and pen are encapsulated. mucosal neuromas are usually associated with the multiple endocrine neoplasia syndrome iii (men iii), a rare syndrome with potentially fatal consequences such as medullary carcinoma of the thyroid. other clinical signs of the patients with men iii can be considered in the diagnosis of oral lesions such as a mucosal neuroma. however, when oral lesions are present in absence of other diagnostic signs, histopathological evaluation can be helpful. the microscopic examination of the mucosal neuroma shows nerve bundles in various sizes surrounded by normal connective tissue, which are not usually seen in pen. a traumatic neuroma is not a true tumor, yet it develops as a proliferation of neural tissue that is caused by injury to a peripheral nerve. traumatic neuromas are usually associated with pain, ranging from pain on palpation to a constant severe pain. these include the presence of perineural cells surrounding individual microfascicles, the greater abundance of interstitial collagen, mucoid matrix and myelin components, and the more orderly parallel arrangement of axons in traumatic neuroma. antoni a, organized spindle cells in palisaded whorls, and antoni b, haphazardly distributed neoplastic cells, are two common patterns which are often found during histopathological examination of schwannomas. other microscopic criteria include verocay bodies and the more definite palisading in the nuclei than that in pen. contrary to the latter, it is extremely difficult to microscopically differentiate neurofibroma from pen, especially when an incisional biopsy has been performed. the absence of marked fibrous capsule and the irregular arrangement of the neoplastic cells are the main differential clues seen in neurofibroma compared with pen. the significant presence of mast cells, usually observed among tumoral cells of the neurofibroma, is also detectable using histochemical or immunohistochemical staining methods. as regezi and colleagues stated, pen/scn may be misdiagnosed clinically once identified somewhere in the mouth other than the palate. this may be an obvious clinical impression since intraoral pen/scns are mostly found on the hard palate. conversely, the tongue involvement comprises less than 8% of pen/scn cases. as for this case, the pen resembled a pg on the dorsal surface of the tongue (a common site for neurilemmoma and neurofibroma, but not for pen). an erythematous lesion in a less commonly affected site rarely happens to be a pen. besides, the tongue is a potential site for pg. have reported that pg is most commonly seen on the attached gingivae, tongue, lower lip and buccal mucosa. the age of patient may be an important clinical parameter when the list of differential diagnoses of a lesion is formulated. our patient was 48 years old, which was close to the recently reported average age for pg patients (52 years). pyogenic granuloma usually occurs in patients older than 39 years, with equal gender distribution. soft tissue enlargements of the oral cavity often present a diagnostic challenge because a diverse group of pathological processes can produce such lesions. pyogenic granuloma can manifest as a painless smooth or lobulated mass with a surface that bleeds quite easily. because of their high level of vascularity, young pgs are red, whereas older lesions are more collagenized and appear pink or normal colored. clinically, oral pg occurs as an exophytic lesion manifesting as small, erythematous papule on a pedunculated or sometimes sessile base. pyogenic granuloma arises in response to various stimuli such as chronic low-grade irritation, traumatic injury and hormonal factors. however, the effect of female hormones on oral pg was questioned by bhaskar and jacoway since they found lesions both in males and females with no sex predilection. palisaded encapsulated neuromas may be misdiagnosed clinically once they appear somewhere in the oral cavity other than the palate. a pen arising on the dorsum of the tongue may mimic a pg with similar clinical morphology. even the patient s age may be misleading. on the other hand, peripheral nerve sheath tumors must therefore be included in the list of differential diagnoses for a pg-like lesion on the tongue.

palisaded encapsulated (solitary circumscribed) neuromas (pens) are relatively common intraoral neurogenic tumors, which occur most frequently on the hard palate. herein, we describe the clinicopathological characteristics of a palisaded encapsulated neuroma of the tongue. this tumor was an exophytic sessile mass measuring 0.3 0.4 cm with rubbery consistency on the anterior one-third of the dorsum of the tongue. the tumor was excised under the impression of a pyogenic granuloma (pg). no recurrence was reported at 12 months postoperatively. histopathological examination showed a well-circumscribed mass that composed of interlacing fascicles of spindle cells. the cells were s-100 positive. the nuclei, showing parallel orientation within the fascicles, were wavy and pointed and showed no sign of mitotic activity. giemsa staining revealed no mast cells within the stroma.

PMC4749420

pubmed-1127

the syndrome with ectrodactyly, ectodermal dysplasia, cleft lip and cleft palate (eec) is a complex disease with a variety of abnormalities of the ectodermal and mesodermal germinal layer. the first author who described this disease was eckoldt in 1804. split hands or feet are characterized by agenesis of the third ray and possible fusion of the remaining fingers or toes. the ectodermal component of this syndrome includes hair with hypotrichosis, hypopigmentation, the teeth with hypodontia, enamel hypoplasia and microdontia and ultimately the nails, which present themselves dystrophic in most cases. a number of associated anomalies are also frequently found. in the 230 published cases, 84% of patients presented with split hands or feet. dysplasia of the ectoderm arises in 77% of patients and clefts appear in 68% of cases. important hints may indicate an eec syndrome already in the clinical examination of the patient and in the investigation of family history. two case reports of our department shall demonstrate the management of eec syndrome affected patients with all-in-one closure of the lip cleft and palate cleft and the treatment regimen in manifest ectodermal dysplasia. a newborn baby with a unilateral complete cleft lip and palate (left side- cleft palate width 23 mm) first child of non-consanguineous marriage was referred to our department. additionally, the child presented a deletion of the central finger on the right hand and fusion of the second and third finger on the left hand as well as fusion of the second and third toe on both feet. paper-thin, dry and reddened skin and sparse scalp hair were also visible (figure 1). the father suffered from the eec syndrome, too-, showing similar hand malformation and a bilateral cleft lip and palate, which was treated in multiple surgeries. in our patient, feeding of the child was possible with a palate obturator. for (naso)alveolar molding lip taping with an elastic plaster (dynacleft, barrie on, canada) the cleft lip width was still 12 mm. for improved soft-tissue conditioning, lip adhesion two months later, the one-step procedure of the cleft lip and palate closure was performed. the operative procedure involves firstly in intravelar veloplasty with microscopic view, secondly in restore the nasal floor with two choanes and pedicled flaps without push back and at the end doing only a gingivoperiosteoplasty but without touching the germ area. at the end, a palatal plate was fitted for 7 days. in our protocol, we do a secondary osteoplasty with 9/10 years of age. the operation time was 60 min for the palate. during the closure of the palate to prevent pressure damage on the tongue the mouth gag was often released. nevertheless, after surgery, the child had to be re-intubated at the intensive care unit due to an exfoliative stomatitis and dramatic swelling of the back of the tongue with impairment of the upper respiratory tract (figure 3). supportive treatment with an anti-edematous and anti-inflammatory medication (cortisone intravenously) was initiated the further post-operative course of treatment was without complications (figure 4). we suppose that there is a connection with the eec which makes the tissue more sensitive but this is a hypothesis that is not proven. the clinical examinations showed a complete cleft lip and palate (left side) and deletion of the central finger on the right hand, fusion of second and third finger of the left hand and fusion of the second and third toe on both feet. swelling of the back of the tongue and exfoliation after the all in one closure and before re-intubation. follow-up 6 months after surgery with harmonious upper lip and no abnormalities in the epidermis. until now, no treatment concerning hands and feet was performed. this case presents the sister of the above described boy, born 3 years and eight months later: born at 38 week of gestation with a birth weight of 2985 g she showed a bilateral cleft lip, syndactyly on all extremities and a conspicuous dryness of the skin (figure 5). clinical findings and the family history lead again to the eec syndrome. similar to the brother an obturator plate with nasoalveolar molding was adapted. at the age of 8 weeks a lip adhesion was performed. with 4.5 months the clinical examination of the patient 3 h after birth shows the typical characteristics for the eec-syndrome. no complications have occurred in wound healing due to the eec-syndrome until now, no treatment concerning hands and feet was performed.. characterized by ectrodactyly, ectodermal dysplasia, cleft lip and/or cleft palate. since then, numerous reports in the literature have expanded the clinical appearance. the transmission is usually autosomal-dominant trait with variable expressivity and reduced penetrance [4-6]. some authors believe that the classic case of the eec syndrome is caused by mutation of the p63 gene. the variability in the phenotypic expression is explained by the interaction of ectodermal with the mesodermal germ layer. the eec syndrome must be differentiated from other syndromes, which also show an ectodermal dysplasia and orofacial clefts as the rapp-hodgkin syndrome, the aec syndrome (syndrome with ankyloblepharon filiform adnatum, ectodermal dysplasia and cheilognathopalatoschisis, [10-12]). others have their own characteristics, for example the rapp-hodgkin syndrome presenting a short stature and special lineaments. the eec syndrome has to be distinguished from other diseases with acral anomalies and oral cleft, including the acrorenal syndrome and from the fetal alcohol syndrome. minor anomalies of the eec syndrome are renal malformations, deafness, mental retardation and choanal atresia. other recently reported associated anomalies are the insufficiency of the pituitary gland, anorectale malformations and hypoplasia of the thymus. until now, three types of eec syndrome and their respective gene loci were molecularly identified. balanced chromosome changes or interstitials deletions were found: type 1 is linked to gene locus 7q11.21q21.3, type 2 and type 3 with chromosome 19 locus with 3q21 (p63) [21-23]. recently, heterozygous mutations in the p63 gene have been shown to 3q27 by amino acid substitutions in the dna-binding domain, which are considered as the main cause for the formation of the gap in hands and feet [25-27]. the ultrasound in prenatal diagnosis plays an important role in the early detection of ectrodactyly and cleft lip and palate [28-30]. for a more accurate prenatal diagnosis of this syndrome, a molecular study was introduced. with the use of a dna extraction from fetal chorionic villi, a prenatal dna analysis can be carried out in a pregnancy at risk for the eec syndrome., eec children will be treated like other non-syndromic cleft patients. in the first 24 h after birth, an obturator plate and if necessary and due to dry skin possible, upper lip taping is adapted for alveolar molding. the gastric tube see in figure 4 was removed after the obturator plate was inserted. if the cleft lip remains more than 15 mm a lip adhesion is an option. normally, this will be performed at the age of 8 weeks, in the first case it was delayed due to surrounding circumstances. approximately 8 weeks later, a closure of all layers in a single operational step will be performed. one-stage procedures with 34 months can lead to disturbance in growth of the maxilla, but the extend was similar to the mean values of multistage procedures assessed in the eurocleft study. children and their parents have no further psycho-social stress due to multiple surgical interventions at an early age. the main therapeutic approach depends on the expression of the ectodermal dysplasia and should be evaluated individually for each patient. it is mandatory that the patient has a close follow-up with, if necessary, functional physiotherapy, speech therapy and early functional orthodontic care. whenever cases of eec syndrome occur, it is important, according to their phenotypic characteristics, to follow an interdisciplinary approach to reduce complications, to minimize undesirable sequelae and provide the best possible medical care. ethics and consent: a written consent from the parents for the publication of photos is available.

we report on siblings who suffer from eec syndrome and show our experiences of the " basel concept " of cleft lip/palate repair based on the early, one-stage closure of all components. it is performed in the age of 34 months to provide early normal conditions for anatomy and muscle function.

PMC4793795

pubmed-1128

chronic myelogenous leukemia (cml) represents about 1520% of all cases of adult leukemia in western populations. cml is a clonal myeloproliferative disease characterized by the presence in>95% of patients of the t(9;22)(q34;11) translocation known as the philadelphia chromosome. this translocation causes expression of the bcr-abl fusion protein, a tyrosine kinase with constitutively increased kinase activity which is thought to be necessary and sufficient for the initiation of cml. the development of small molecule tyrosine kinase inhibitors (tkis), such as imatinib mesylate, which inhibits the increased bcr-abl tyrosine kinase activity, have dramatically improved the prognosis of patients with cml [5, 6]. imatinib mesylate induces complete hematologic remissions and cytogenetic responses in the majority of patients in chronic phase cml, but the response in more advanced stages is usually only partial and less durable. about 4-5% of patients per year develop resistance to imatinib either because of bcr-abl gene amplification or more commonly point mutations in bcr-abl [7, 8]. if imatinib is discontinued because of toxicity or other reasons, the majority of patients relapse fairly promptly. one hypothesis that could explain the customary relapses after stopping therapy is that tkis and conventional cytotoxic drugs therapies are unable to eliminate all bcr-abl positive cells, presumably sparing a relatively small number of leukemic early progenitors and stem cells that are quiescent and are not killed by the inhibitors or other drugs at clinically tolerable concentrations. these cells constitute a reservoir of bcr/abl positive cells capable of functioning as leukemic stem cells or limited stem cells. if for any reason a patient has to stop therapy, these cells have sufficient self-renewal ability to recreate the disease by reconstituting the stem cell population and also enhancing the probability that the leukemic cells will develop resistance to the drugs, leaving bone marrow transplantation as the only option for survival. in order to search for critical differences in biochemical pathways and regulatory networks between cml and normal quiescent progenitors and stem cells that might ultimately serve as selective targets, we decided to compare the gene expression profiles of the normal and cml quiescent cell fractions. as a strategy to enrich for these quiescent cells, we isolated cd34+cells by positive selection from the mononuclear cells of normal bone marrow and cml blood samples and then separated the cd34+cells into g0 and g1/s/g2/m fractions by flow cytometry. we found 1, 204 genes significantly upregulated and 1, 133 downregulated in cml-g0 cells compared to normal g0 cells (resp., 3.1% and 2.9% of the genes represented on the affymetrix chip), thereby permitting us to compare gene expression profiles in highly enriched normal and leukemic quiescent progenitors and stem cells. a total number of eight patients diagnosed with ph+ cml (three in accelerated phase and five in chronic phase) were used in this study. the cml samples were all obtained from patients hospitalized at the memorial hospital during the period 19902006. the bone marrow samples were purchased from cambrex (cambrex bio science rockland, inc., mononuclear cells were isolated on a ficoll gradient (ficoll-paque plus, ge healthcare, cat #17-1440-03) from total nucleated cells of bone marrows of four healthy donors and peripheral blood of eight patients with untreated ph+ cml (five in chronic and three in early accelerated phase with 8.518% blasts in the peripheral blood). in the case of the patient samples, total cells after ficoll were frozen in liquid nitrogen in rpmi plus 10% dimethyl sulfoxide and 10% fetal calf serum and stored until selection. cd34+cells were positively selected using a midimacs immunomagnetic separation kit (miltenyi biotec, bergisch gladbach, germany, cd34 progenitor cell isolation kit, cat #130-0460701) after one round of purification, the recovered cells were passed through another round of purification using a second column. this way the purity of the cd34+recovered cells was 96100% as assessed by flow cytometry. for the statistics about the starting number of cells from each sample and the cd34 recovered fraction, cd34+cells were resuspended at a concentration of two million per 0.5 ml of staining buffer (sb: hbss without nahco3, 10 mm hepes, 1% bsa, 2% fetal calf serum) plus hoechst 33342 (bisbenzimide h 33342, cat #b2261, sigma, st. louis, missouri, usa) at a final concentration of 20 nm/ml and incubated for 45 in a water bath at 37c. after washing once with sb plus 10% hoechst, the cells were resuspended in 0.5 ml of sb plus pyronin y (cat #p9172, sigma) at a final concentration of 1 g/ml and kept in a water bath at 37c for 20, washed once and resuspended in 1 ml of sb. after being stained, the cells were sorted using a moflo flow cytometer (dakocytomation, dako colorado, inc. fort collins, colorado, usa) applying a gate in the region of logarithmic fluorescence intensity of 1000+/100 for both pyronin y (fl3) and hoechst (fl7). approximately 50,000 cells from the cml/g0 and cd34+/g1/s/g2/m fractions were analyzed for brdu incorporation using a roche kit (cat #11 296 736 001). cells were pulsed with brdu for an hour in complete growth medium, fixed with ethanol, stained with a mouse anti-brdu monoclonal antibody, and then incubated with an anti-mouse-ig fluorescein conjugated antibody. total rna was isolated from each group of cells sorted from the g0 control fraction (bm) or cml sample using trizol reagent (cat #15596-026, invitrogen corp., carlsbad, ca, usa). quality of rna was ensured before labeling by analyzing 5 pg of each individual sample using the rna 6000 picoassay and a bioanalyzer 2100 (agilent technologies, inc., samples with a rna integrity number (rin) greater than 7.0 were considered suitable for labeling. for each sample meeting this standard, 20 ng of total its rna were labeled using the genechip two-cycle target labeling kit (affymetrix, inc., santa clara, ca, usa). ten micrograms of labeled and fragmented crna were then individually hybridized to the human genome u133 plus 2.0 array (affymetrix) at 45c for 16 h. automated washing and staining were performed using the affymetrix fluidics station 400 according to the manufacturer's protocols. finally, chips were scanned with a high-numerical aperture and flying objective (fol) lens in the gs3000 scanner (affymetrix). in summary, from each sample (cml or bone marrow), we extracted rna and performed a separate gene expression profile and the changes in gene expression were derived from the statistical analysis in which we compared cml samples (eight independent gene expression data) versus bone marrow (five independent gene expression data). the microarray data were quantile-normalized, and the gene expression values were estimated using the rma method. a linear regression model was used to model the gene expression values, in which a batch factor was added to the model to account for potential batch effect since arrays were run in two distinct batches two years apart. differences between the g0 gene expression values of cml and normal samples were tested using the moderated t-statistics. storey's q-value that control false discovery rate was used to correct for multiple hypothesis testing. the microarray data have been deposited on the geo public repository (http://www.ncbi.nlm.nih.gov/geo/) under accession no. rt-qpcr assay was used to determine the level of expression of the genes we found up and downregulated on the microarray. we used the iscript one-step rt-pcr kit with sybr green (cat #170-8892, biorad, hercules, ca, usa) with the following conditions: 10 @ 50c, 5 @ 95c, 10 @ 95c, and 30 @ 60c using 1 ng of rna for each reaction as a template. all samples were run in quadruplicate on an abi 9700 platform (perkin elmer/applied biosystems, foster city, ca, usa). the relative expression of each gene was calculated using the ct method using gapdh as a reference gene. forward and reverse primers were designed in different exons, in order to avoid dna contribution to our final pcr product, using primer 3 software (available on line at: http://frodo.wi.mit.edu/). for the sequence of the primers used, see table 1 in supplementary material available online at doi:10.1155/2011/798592. three or four hundred total cd34+cells or cd34+g0 and g1/s/g2/m enriched cells per plate were assayed for colony growth in 1.3% methylcellulose as described in detail previously .the cloning efficiency (c.e.) values are the average of 4 plates counted for each bar shown. unless otherwise stated, either single (100 ng/ml) or three early acting cytokines: kl, fl, tpo (50 ng/ml each) with or without additional cytokines as noted: g-csf, gm-csf (10 ng/ml each), il-3, il-6 (20 ng/ml each), and epo 1 iu/ml were added the drugs shown to the cultures to stimulate or inhibit colony growth. unless otherwise noted, 3 cytokines refer to kl+fl+tpo and 5, 6, 7, or 8 cytokines refer to kl+fl+tpo+g-csf+gm-csf il-3 quadruplicate plates of each sample were counted at days 14 or 15 using an inverted microscope including estimates of colony lineage and size. a standardized scale and colorcode for estimating colony size has long been used in our laboratory which has been verified by plucking single large and multiple smaller (pooled) colonies and hemocytometer counts of the numbers of cells contained in the different sized colonies. gfu-gm: tiny<40 cells, small 40100, medium 100010,000, large 10,00040,000, x-large 40,000100,000, xx-large>100,000 cells; cfu-e and bfu-e and mixed: tiny<505000, medium 500050,000, large 50,00010, x-large 105 10, xx-large>5 10 cells. g-csf, gm-csf, and il-3 were obtained as gifts from kirin brewery co., gunma, japan and kl (kit ligand or scf, stem cell factor), fl (flt3 ligand), tpo (thrombopoietin), il-6, and epo (erythropoietin) were purchased from r&d systems, inc. cd 133/2 apc (293 c3) was purchased from miltenyi biotech, gladback, germany. cord blood samples were obtained from the new york blood center as samples judged too small for clinical use; three or 4 samples were pooled for our studies. defrosted mononuclear peripheral blood cells from eight cml patient samples or five fresh normal bone marrows were individually used to isolate the cd34+fraction using the midimacs immunomagnetic separation kit from miltenyi (see material and methods) with a percentage of purity of recovered cells varying between 95100%. cd34+cells from each samples were subsequently stained with hoechst 33342 and pyronin y and sorted individually according to their dye content (figure 1(a)). the region chosen for sorting the quiescent fraction (g0) allowed us to avoid collecting dead cells and cross-contamination with cycling cells. we also sorted the proliferating fraction (g1/s/g2/m), but due to its high heterogeneity, we did not conduct a detailed analysis on this fraction for comparison with the cd34+/g0 cells. table 1 summarizes the numbers and percentage of cd34+/g0 cells and cd34+/g1/s/g2/m recovered from each patient and normal bone marrow. after percoll and ficol separation of total blood cells from normal bone marrow or cml blood on average 22% of normal and 11% of cml mononuclear cells were recovered. after passing the mncs twice on miltenyi columns for positive selection of cd34+cells, 3.06% of normal and 3.15% of cml highly enriched cd34+cells were obtained from the mnc fractions. due to the low quality of rna recovered, one bm sample (# 2) was not used to generate microarray data. the cd34+cells were further separated into proliferating (g1/s/g2/m) and quiescent (g0) fractions by flow cytometer using hoechst and pyronin y staining. after sorting, the mean and range of recoveries of normal and cml cd34+/g1/s/g2/m were 18% and 14.7%, respectively, while the recoveries of normal and cml cd34+/g0 cells were 4.3% and 3.05%, respectively, or an average of 0.016 and 0.013%, respectively, of the total normal and cml starting cell populations. an average of 27% (2232%) of unstimulated cml cd34+g1/s/g2/m cells incorporated brdu after an incubation period of one hour while less than 1% of cml or normal cd34+g0 cells incorporated brdu without cytokine stimulation immediately after separation. figure 1(b) shows representative pictures of cml cd34+g1/s/g2/m and g0 cells immediately after separation after 1-hour incubation with brdu. the few g0 cells that incorporated brdu all showed punctated nuclear labeling indicating an early stage of dna synthesis while the g1/s/g2/m cells had varied nuclear staining patterns indicating different stages of dna synthesis. without cytokines, the viability of both normal and cml g0 and g1/s/g2/m cells declines rapidly and few viable labeled or unlabeled cells remain after 2-3 days and almost none after 4-5 days. however in the presence of 6 or 7 cytokines (kl+fl+tpo, each 50 ng/ml,+g-csf+gm-csf+il-3 il-6, each 10 ng (ml), viability remains excellent (95100%) and the majority of both normal and cml total cd34+cells and g0 and g1/s/g2/m cells are induced to proliferate rapidly in liquid culture with average doubling times of ~30 hours. continuous exposure to brdu (5 m) is toxic to both proliferating normal and cml cells, and viability declines rapidly after 2 days so results comparing incorporation of brdu during continuous exposure of cytokine stimulated g0 cells is limited to the first 48 hours. with stimulation by 7 cytokines, 92% and 94% of cml g0 cells incorporated brdu during continuous exposure for 24 and 48 hours, respectively, (average of 3 experiments) while the corresponding 24 and 48 values for normal g0 cells were 8% and 72%, respectively. these experiments suggest that the majority of both normal and cml cd34+g0 and g1/s/g2/m cells remain viable and can be stimulated to proliferate with 7 cytokines, but that the cml/g0 cells are more poised than the normal g0 cells to begin proliferating. to validate the robustness of our microarray data, we performed quantitative real-time pcr (qpcr) independently on each of four cml cd34+/g0 and two normal bone marrow cd34+/g0 samples that were different from the ones used to generate the microarray data. on each sample, we tested the expression of all the genes represented in figure 1(c), averaged the results obtained either from the four cml samples or two bm and then calculated the resulting fold change in expression for each gene between the two groups. since the amount of rna recovered after the sorting was very limited, we performed a single-step rt-qpcr using the ct method (the primers used are listed in table 1, in supplementary material available online at doi:10.1155/2011/798592). this way, we were able to use as little as 0.1 ng per reaction enabling us to do four replicates per gene tested. we found that out of fourteen genes tested, which were differentially expressed between the normal and cml/g0 by the microarray, thirteen were confirmed by qpcr (figure 1(c)). using a q value of less than 0.05 as a threshold, we found 1,204 genes significantly upregulated and 1,133 downregulated in cml/g0 compared to normal bm/g0 cells (for a complete list of the genes see supplementary material available online at doi:10.1155/2011/798592). as an additional criterion for selecting the genes significantly differentially expressed, we considered in the analysis only those with differences in expression higher than three folds. this resulted in 292 down- and 192 upregulated genes to be considered. using this as a starting point, we later extended the analysis to look for genes that could corroborate our initial tentative conclusions, but in this second step, we considered also genes that had at least a two-fold difference and more than one set of probes changed. we have grouped the genes according to their reported functions and discussed the possible significance of the most relevant findings regarding differences between normal and cml cd34+/g0 cells. in the genes linked to cell cycle regulation, we found an almost equal number of them differentially expressed characterizing cml/g0 cells as nonproliferative when compared to normal g0 cells, (e.g., upregulation of mtss and downregulation of cdc14b), and as proliferative via upregulation of cdc6 and cyclin b2. the most striking difference is in the number of genes upregulated in the cml/g0 cells that are either involved in dna replication (topo2a, rrm2, gins1 and 2) or are part of the mitotic spindle machinery (map9, cetn3, anln, dlg7). this subset of cml cells seems to be in a nonproliferative state but essentially ready to enter into the cell cycle upon stimulation, having the machinery for cell division and dna replication expressed and ready to work. this conclusion is compatible with findings reached independently by another group, showing that cml cells are much more easily triggered into cell cycle than their normal counterparts. among the most significantly differentially expressed genes that we found between the cml and normal quiescent cells, many of these genes the first three genes belonging to this group are prominin-1 (cd133), id1, and flt3. a second group includes genes that have been found overexpressed in both of two independent studies that have analyzed hematopoietic stem/progenitor cell transcriptomes, hlf, rbpms (hermes), gata3, tnfsf10 (trail), and crhbp [20, 21]. the third group includes: cd110/mpl, gbp2, sptbn1, arg2, birc3, crhbp, hla-e, hoxa3, hoxb6, spink2, nrip1, prkch, rapgef2, and tloc1, all genes that are overexpressed in hsc-enriched populations of bone marrow/cord blood and mobilized peripheral blood cells. last but not least, we found as differentially expressed msi2 (musashi-2), another well-known stem cell marker, hes-1 a hematopoietic stem cell marker and il7, that is, expressed in human adipose-derived stem cells. all these genes are overexpressed in hematopoietic stem/progenitor cells compared to more differentiated ones, but in our microarray, all of them are downregulated in the cml/g0 fraction compared to the normal/g0 fraction. this provides additional evidence that with the methods employed, we are indeed enriching for quiescent hematopoietic stem cells and early progenitors in normal bone marrow but when we apply the same technique to enriching cml quiescent stem and progenitor cells, the latter are in a more advanced stage of differentiation. because the cml g0 cells were enriched from the blood of patients with highly elevated wbc counts while the normal g0 cells were enriched from the bone marrow, this might offer a partial explanation. however, since previous labeling studies conducted in vivo in cml patients with massive myeloid expansion have shown there is continuous trafficking and exchange of early progenitors as well as maturing cells between the bone marrow, spleen, and blood and in whom the differential counts and proliferative kinetics of the bone marrow and circulating cells were very similar, it is more likely that the gene expression results accurately reflect the average results of the entire cml/g0 subpopulation. another element that supports our conclusion that the cml/g0 cells are more differentiated than the normal g0 cells is that six genes that belong to the polycomb repressive complex 1 (prc1), respectively, scml1, phf1, pcgf3, cbx7, l3mbt1, and 4, and one (epc2) belonging to the prc2 group, are downregulated in the cml/g0 fraction (all of them apart from scml1, with a difference in terms of relative gene expression under the twofold level, so they are not listed in table 1). the prc1 and prc2 complexes belong to the groups of epigenetic regulators and act as gene expression repressors. downregulation of genes belonging to these two groups in the cml/g0 fraction reinforce the idea that the bulk of quiescent cml cells belong to a more differentiated state than the normal counterpart, as also proposed for blastic phase cml cells in a previous paper by jamieson. another series of genes differentially expressed in the cml/g0 fraction enabled us to localize more precisely where the predominant myeloid expansion takes place.cml g0 cells express a series of megakaryocytic (nfe2, tesc and cd41) and erythrocyte markers (cd36, klf1, tfr2, ank1, and xk and four different hemoglobin chains (hbb hbq1 hbd, and hbg1) plus gata1, a gene whose expression is linked to hematopoietic cell differentiation. the overexpression of gata-1 is of particular interest since graf has shown that if gata-1 is expressed in myeloid cell lines, the cells ' phenotype is completely changed to erythroid, probably due to inactivation of the myeloid regulator pu-1 by gata-1. an unexpected finding, in view of the more prominent hyperproliferation of megakaryocytic than erythroid cells in cml, is that smad7, whose expression promotes megakaryocytic over erythroid differentiation, is downregulated in cml/g0 cells. on the other hand, two key genes promoting lymphoid differentiation (bcl6 and gata3) are downregulated and a gene expressed in neutrophils (ncf4) is upregulated, as might be expected. these data might be explained by the fact that cml g0 cells are neoplastic cells and therefore exhibit a common cancer-associated characteristic variously termed lineage infidelity, promiscuity, or ambiguity, a well-known phenomenon occurring in leukemia. it appears that the cells retain the phenotype of the original cells but at the same time deregulate many other pathways characteristic of other hematopoietic lineages, which could also explain why there's expression of fetal hemoglobin chain (hbg1) together with the adult hemoglobins. in conclusion, it appears that at least the majority of cml/g0 cells overexpress genes usually associated with erythro-megakaryocytic development which is probably correlated with the thrombocytosis frequently seen in patients with cml and also with the spontaneous growth of erythroid colonies in vitro by cml progenitors in the absence of erythropoietin, whereas normal progenitors always require epo. figure 2(a) shows the average results of multiple cloning experiments comparing the cloning efficiencies (c.e.s) of normal and cml total cd34+cells and the g0 and g1/s/g2/m subsets. no epo was added in any of the experiments, but the cml cells consistently produced erythroid colonies without epo, often including large or x-large bfu-e, and sometimes comprising over half of the total colonies, whereas in the absence of epo, the normal cells rarely produced any erythroid colonies and then only tiny or very small ones. in almost all experiments, the cml g0 cells generated more and larger erythroid colonies than the g1/s/g2/m cells. in other experiments not included in figure 2(a), the addition of epo to other cytokine combinations greatly augmented further growth of cml erythroid colonies as well as stimulating normal ones. it is also evident in figure 2(a) that cml total cd34+and cd34+g0 cells produced more total colonies than the corresponding normal cells when stimulated by the three early acting cytokines kl, fl, and tpo and to a lesser extend by kl+g and gm-csf, again showing the cml progenitors are more easily triggered into cycle than the normal cells. however, there was little difference or the normal g0 cells had higher total c.e.s when the cells were near maximally stimulated with 57 cytokines. figures 2(b) and 2(c) show typical experiments comparing the cloning results of two normal and two cml g0 cells in more detail. except for a few tiny or very small cfu-e, normal g0 cells shown in figure 2(b) produced only cfu-gm colonies without epo and had the greatest incremental growth of large and extra-large colonies with 57 cytokines; with addition of epo, about 1/4 to 1/3 of the normal colonies were erythroid or mixed, some very large. in marked contrast, the cml g0 cells shown in figure 2(c), when stimulated in the absence of epo by all the single cytokine and combinations shown (except g-csf alone and g-csf+gm-csf), produced a mixture of cfu-gm and cfu-e/bfu-e with about a third to one half of the colonies being erythroid or mixed and often very large. the maximum total cloning efficiencies of these two g0 samples were ~1424% after stimulation with 37 cytokines, but in other cml and also normal g0 samples total c.e.s of up to 4042% were observed after stimulation with multiple cytokines. no consistent differences were noted between the maximum total c.e.s between normal and cml cd34+cells or g0 or g1/s/g2/m subsets, although there was more variability in the quality of the cml samples. class i homeobox (hox) genes comprise a family of 39 transcription factors that share a highly conserved dna binding domain. since several of them have been shown to play a role in hematopoiesis, we looked at their expression profile in our microarray. we found three members of this family under expressed in cml/g0 cells: hoxb3, hoxa5, and hoxa3. hoxb3 is expressed in the primitive cd34+population, that is, highly enriched for human hematopoietic stem cells (hscs), and it is downregulated as the cells differentiate into committed progenitors, and together with hoxb4 it is required for normal hsc function. hoxa5 is another gene involved in hematopoietic lineage commitment and maturation, and it seems to act as a repressor of the generation or proliferation of erythroid progenitor cells. regarding hoxa3, there is not much information about its function in the hematopoietic system. taken together, the pattern of expression of the hoxa genes in our microarray suggests, again, that the cml cd34+/g0 stem progenitor cells are more mature than the normal counterpart. another two transcription factors are differentially expressed in the normal and cml/g0 fractions: nmyc is under expressed and wt1 overexpressed in cml/g0 cells. nmyc is a well-known oncogene found to be expressed in neuroblastomas and retinoblastomas and also in myeloid and lymphoid leukemias, but it has not previously been reported to be dysregulated in cml. this gene plays a role in preventing differentiation so its expression is downregulated in cells that progress through more mature stages in order to acquire their final phenotype. nmyc is under expressed in the cml/g0 progenitors so its level of expression may simply reflect their more advanced differentiation and more rapid maturation as previously reported. wt1 pattern of expression in normal hscs is biphasic: high in quiescent cd34+/cd38, low in committed progenitors, and high again in differentiated cells (cd34). so, how to explain the higher expression of wt1 in cml/g0 cells? it has been reported that the oncogenic signaling from bcr/abl can induce wt1 expression and that while in normal mice only a few immature cells in the bone marrow express wt1, when cml is induced the percentage of bone marrow cells expressing wt1 rises considerably. the effect of this gene if expressed in progenitors cells is to keep them in a state in which they are not responsive to differentiation inducing signals. so, it could be that while wt1 tends to keep the cml/g0 cells in an aberrant quiescent state other programs for differentiation are still turned on, such as those inducing differentiation in the m/e lineages, another manifestation of lineage infidelity. as a strategy to identify novel anticancer treatments specific for the cml quiescent population, we looked for genes that were upregulated in the cml fraction and that in the literature had been previously found to have a potential role in other type of cancers. following these criteria, we found three genes: pvt1, anxa2, and marcks. marcks is a gene important for cell proliferation: it has been reported that while its expression is low in cell lines that are actively proliferating its expression increases when they stop dividing and enter the g0 phase. additionally, the over expression of marcks inhibits proliferation of human tumor-derived choroidal melanoma cells. so its role in cml/g0 cells could be to keep them in an artificial quiescent state and as a consequence protect from the action of cytotoxic drugs. blocking marcks activity would be one step necessary to make these cells respond again to cytokine stimuli and make them reenter the cell cycle. marcks is a prominent intracellular substrate of protein kinase c: since different pkc inhibitors have been developed and available (like enzastaurin, ly317615.hcl), this hypothesis could be tested. anxa2 is a lipid- ca-actin binding protein that has been reported to be upregulated in different human tumors like hepatocellular and pancreatic carcinoma and acute promyelocytic leukemia. but while in these type of tumors it seems to have a positive role in promoting cancerogenesis and metastasis in other tumors, it seems to slow down their aggressiveness or tumor cell migration, like in osteosarcoma and prostate cancer. the different functional roles of anxa2 in different malignancies probably reflect its tissue specificity, so without further evidence, it would be premature to suggest it may have a specific role in the cml/g0 population. nonetheless, it remains a potential target candidate gene. the pvt1 gene encodes a number of alternative transcripts, but no protein or regulatory rna products have been found so far; recently, it has been suggested that this region might encodes for different mirnas where one at least seems to be oncogenic. the amplification of this locus has been shown to contribute to the pathophysiology of ovarian and breast cancer, and over expression of pvt1 has been detected in a subset of cases of aml and in other myeloid malignancies. pvt1 role in cancer seems to be that of an inhibitor of apoptosis, so this is another potential target gene that is worth consideration. these three genes were not identified as overexpressed in a previous work that did gene expression profile comparing total cd34+cml and normal cells, so it is plausible that the different expression levels of these three protein is due to the fact that they belong to the specific quiescent subpopulation of cd34+cml cells rather than the total cd34+/cml cells. the gene most downregulated in cml cd34+/g0 cells compared to normal bone marrow cd34+/g0 cells is prominin-1 or cd133 (19.6 fold). prominin-1 is a pentaspan transmembrane glycoprotein which was first isolated in 1997 from plasma membrane protrusions on murine neuroepithelial stem cells and was so named because of its prominent localization in these protrusions (from latin, prominere). there are two isoforms of the gene, ac133-1 and -2 (which is 27 nucleotides shorter): it was demonstrated that ac133-2 rather than ac133-1 is the predominant transcript expressed in hematopoietic stem cells (hscs) derived from fetal liver, bone marrow, and peripheral blood as well as in epidermal stem cells, a wide variety of fetal and adult tissues and several poorly differentiated human carcinomas, but not in more differentiated tumors. based on these findings it was postulated that ac133-2 might serve as a good marker of undifferentiated cells, including stem and progenitor cells present in stem cell niches in multiple fetal and adult tissues. in contrast, the undeleted ac133-1 transcript originally found in the retinoblastoma cell line was not detectable in fetal liver or kidney or in adult pancreas, kidney, placenta, or brain, but was strongly expressed in fetal brain, suggesting distinct roles for the two isoforms in development and homeostasis of different fetal and mature organs rather than redundancy. both cd133 isoforms localize to the plasma membrane and have been extensively used alone or in combination with other markers for the identification of stem and progenitor cells from many adult normal tissues and organs including leukemic stem/progenitor cells. most studies have reported cd133 expression is reduced or lost during later stages of differentiation, but in a recent report, using a knock-in lacz reporter mouse model (il10/cd133) and immunostaining, cd133 expression was observed in the full spectrum of undifferentiated and differentiated colonic epithelial cells in both mice and humans. both cd133+and cd133 metastatic cancer cells formed colonospheres and tumors in nod/scid mice that could be serially xenotransplanted, and it was noted the cd133 cells formed more aggressive tumors and were more enriched for phenotypic markers thought to be more typical of cancer initiating cells (cd44+cd24) than cd133+cells. in view of our finding that cd133 is downregulated in cml cd34+g0 cells compared to normal cd34+g0 cells, it is of particular interest that the authors suggested that its downregulation in aggressive colonic cancer may indicate transformation of primary cd133+cancer cells into more malignant cd133 metastatic tumors. the cd34 antigen has been widely used as a marker of human stem cells and progenitor cells for both clinical stem cell transplantation and laboratory studies characterizing and comparing normal and leukemic stem and progenitor cells, although it is recognized that a small subset of cd34 cells also have repopulating ability and can give rise to cd34+cells. coexpression of cd34 and cd133 has been observed, and the cells expressing both antigens were found to have a higher cloning potential than those only expressing cd34. numerous studies have led to the recognition that hscs are concentrated in the lin-cd34+cd38/lo fraction. of particular interest, wagner et al. observed that the more primitive cd34+cd38 slowly dividing cells expressed higher levels of cd133 than the fast dividing, presumably more mature, cd34+cd38+cells. unlike normal bone marrowenriched progenitors which form almost no erythroid colonies or only tiny ones in the absence of epo as shown in the examples in figures 2(a), 2(b), and 2(c), cml progenitors often produce erythroid colonies of varying sizes, some very large, after stimulation with various single cytokines or combinations of cytokines without epo. the production of erythroid colonies by cml progenitors in the absence of epo is consistent with the previous finding that bcr-abl tyrosine kinase supports normal erythroid development in erythropoietin-deficient murine progenitor cells. under epo deprived conditions, we observed marked inhibition of cml erythroid colony growth by several potent inhibitors of bcr-abl, thus providing evidence that bcr-abl increased tyrosine kinase activity cooperates with kl and other cytokine activated pathways in early cml progenitors to reprogram and distort their direction of lineage commitment, which in normal bone marrow and mobilized peripheral blood progenitors, and to a lesser extent in cord blood cells, is more dependent on epo for production of erythroid cells. the production of erythroid colonies by cml progenitors without epo at first appears counterintuitive because the major expansion in cml clearly occurs in the granulocyte lineage. however, it is quite compatible with the upregulation of the genes noted earlier that are involved in early erythroid development in cml cd34+g0 cells compared to normal cd34+g0 cells. as already noted, prominin-1 (cd133) is the most downregulated gene in cml cd34+g0 cells compared to normal g0 cells and expression of the cd133/2 antigen is also low in both cml cd34+g0 and g1/s/g2/m and bcr-abl driven all-3 cells compared to normal bone marrow or cord blood cd34+g0 and g1/s/g2/m cells (figure 3). unlike normal bone marrow or mobilized peripheral blood cd34+g0 or g1/s/g2/m cells which form no or only tiny erythroid clusters on stimulation with 3 to 7 cytokines without epo (figures 2 and 4), we observed that pooled cord blood g0 and g1/s/g2/m cells often produced small, medium, and even large erythroid colonies in the absence of epo (figures 4(b) and 4(c)). figure 4 summarizes a number of representative experiments comparing the total cloning efficiencies (c.e.s) of cd34+g0 and g1/s/g2 m cells from normal bone marrow, normal mobilized peripheral blood, pooled cord blood samples, and chronic phase cml peripheral blood samples. in all except some of the cord blood samples, the g0 cells had higher total c.e.s and almost always also produced larger gm and erythroid colonies (not shown) than the g1/s/g2/m cells (figure 4(a)), providing additional evidence that they are more primitive. to further examine the effect of cd133 on direction of lineage differentiation, we compared the formation of gm and erythroid colonies by cord blood cd34+quiescent and proliferating cd133+and cd133- cells. we observed that cord blood cd34+g0 133/2+cells form numerous myeloid colonies, some very large, but no erythroid colonies when stimulated by either 3 gfs or 7 gfs w/o epo (figure 5(a)). in contrast, while cord blood cd34+g0 cd133/2 negative cells had similar total c.e.s with 7 gfs w/o epo, they formed a mixture of myeloid and erythroid colonies with about a third of the latter being large or extra large. in a similar experiment shown in figure 5(b) with pooled cord blood g0 and g1/s/g2/m cells, again the cd133+cells produced only myeloid colonies and cd133+/2 negative cells from both the quiescent and proliferating fractions formed many erythroid colonies. the cells derived from the pooled cordblood samples shown in figure 5(b) had lower total c.e.s than those in figure 5(a), but both the g0 and g1/s/g2/m cd133/2 negative cells had higher percentages of erythroid and mixed colonies, some very large. whereas the results clearly demonstrate that cd133/2+cord blood-derived g0 and g1/s/g2/m cells in the absence of epo only form gm colonies and the cd133/2 cells form a mixture of erythroid and gm colonies, the distinction is less consistent and the results are more variable in comparable cml cells. figure 6(a) illustrates colony formation by cml g0 and g1/s/g2/m cells with relatively low c.e.s enriched from pooled samples of two chronic phase cml patients. both g0 cd133/2 positive and negative cells formed almost entirely tiny or small erythroid colonies when stimulated with 7 cytokines while only the cd133/2 negative g1/s/g2/m cells formed any colonies, again mostly tiny or small erythroid ones, but with some gm colonies. the three cytokines, kl+fl+tpo, stimulated growth of very few or no colonies. figure 6(b) shows an example of colony formation by cd34+g0 and g1/s/g2/m cells enriched from another chronic phase cml patient in which the cells formed mostly gm colonies, but with further separation of g0 cd133/2+cells, the total c.e. increased by about a third and there were higher proportions of large and x-large gm colonies and almost no even very small erythroid clusters. an example of a third cml cloning experiment is shown in figure 6(c) in which chronic phase cml g0 cells had very high total c.e.s when epo was added to the 7gfs, especially the cd133+cells. as usually observed, the g0 cells had higher c.e.s than the g1/s/g2/m cells. both the quiescent and proliferating cd133 negative cells formed mostly erythroid colonies while the cd133 positive cells formed predominantly gm colonies even in the presence of epo, although about 17% of the colonies were large or x-large bfu-e and mixed colonies. in summary, based on our observations so far, it appears that prominin-1, the product of the gene most downregulated in cml cd34+g0 cells, is also underexpressed on the surface of both cml cd34+g0 and g1/s/g2/m compared to normal bone marrow or cord blood cd34+g0 and g1/s/g2/m cells (figure 3). cord blood cd34+g0 133/2 positive cells form numerous myeloid colonies, some very large, but no erythroid colonies when stimulated by either 3 gfs or 7 gfs without epo (figures 5(a) and 5(b)). in contrast, under the same conditions, cord blood cd34+g0 cd133/2 negative cells form a mixture of myeloid and erythroid colonies with some of the latter being large or x-large. the role of (downregulated) cd133 in cml cd34+g0 and g1/s/g2/m cells is presently less clear and appears to be more complex. the cml g0 cells in figure 6(a) had low c.e.s and both the cd133 positive and negative fractions produced almost entirely tiny and small erythroid colonies even when stimulated by 7 cytokines, while only the g1/s/g2/m cd133 cells produced a substantial number of colonies, mostly erythroid. in the experiment shown in figure 6(b), the cml g0 cd133+fraction when stimulated with the same 7 gfs without epo increased the total c.e. by about a third compared to the total g0 cells, but the colonies were almost entirely gm, whereas the total g0 cells produced about 10% small- and medium-sized erythroid colonies. finally as shown in figure 6(c), the cml cd133+g0 cells when stimulated by 7 gfs+epo had one of the highest c.e.s (47.25%) we have observed with mostly large and x-large gm colonies, but also about 17% large and x-large bfu-e and mixed colonies, while the cd133 cells formed mostly erythroid colonies, mostly large or x-large. the above observations suggest that expression of cd133 in both normal and cml progenitors favors gm differentiation while cd133 negative cells produce a mixture of erythroid and gm colonies. however, the precise function of cd133 is still very uncertain and confounded by the necessity to use multiple cytokines to stimulate growth. cml and cord blood progenitors are less dependent on epo in producing erythroid cells than normal bone marrow progenitors, but addition of epo markedly shifts the cells toward erythroid differentiation. overall, the results suggest that prominin-1 may have an important role in determining the direction of lineage commitment, especially in cord blood and cml progenitors. we found no consistent difference in the numbers or sizes of the colonies produced by either normal or cml quiescent or proliferating cd133+or cd133 cells, although some experiments suggested enrichment of one or the other might further enhance their overall proliferative potential. an attempt was made to see if it was possible to correlate changes in gene and surface antigen expression as measured by flow cytometry in subpopulations of normal and cml cells, but because of the small number of cells usually recovered it was only possible to do limited surface phenotyping in a minority of enriched samples. examples of representative experiments showing similarities and differences in expression of surface antigens are shown in figures 7 and 8, and a summary of the overall results of multiple surface phenotyping experiments is given in figure 9. in these and other studies, there were insufficient cd34+total cells or subsets to compare additional surface antigens other than those shown. as illustrated in figure 1(a) and table 1, the cd34+g1/s/g2/m cells are usually much more numerous than the cd34+g0 cells so their phenotype is very similar to that of the total cd34+cells (not shown). figure 7(a) shows a typical study comparing surface markers of normal mononuclear cells from mobilized peripheral blood and the enriched total cd34+cells from the same sample showing marked enrichment of cd34+cells and reduced expression of antigens expressed on more differentiated cells, including cd14, cd45ra, cd90, cd3, and cd19. figures 8(a) and 8(b) show comparisons of cell surface antigen expression of normal and cml total cd34+and cd34+/g0 cells in several typical experiments. as would be expected, in most but not all normal and cml samples, expression of cd33, cd38, and cd45ra were reduced in the cd34+g0 cells compared to the total cd34+cells. figure 7(b) shows the changes that occur in surface antigens during 12 days in liquid culture when normal cd34+cells are stimulated to proliferate by two combinations of 4 cytokines. in the latter experiment, following stimulation with both cytokine combinations, cd34, cd38, glycophorin a, cd90, and cd45 ra expression rapidly declined and this usually occurred even faster in stimulated cml cd34+cells (not shown). most surface markers associated with granulocyte/macrophage, erythrocyte or megakaryocyte differentiation increased both in normal and cml cd34+cells (e.g., cd 14, 15, 36, 41), although cd61 declined slightly. as is evident from comparing individual experiments, there was considerable variation in both normal and cml individual samples, but we have nevertheless attempted to provide an overall summary in figure 9 of the most consistent findings in multiple experiments of the similarities and differences in surface antigen expression between normal and cml total cd34+cells and cd34+g0 cells and when the latter are stimulated to proliferate. overall, we did not detect any consistent differences between normal and cml total cd34+cells or in their g0 and g1/s/g2/m subsets except that the cml g0 cells usually had lower percentages of cells expressing cd38 and sometimes of hla-dr than the normal g0 cells, but the results were not consistent enough to draw any firm conclusions. this study was initiated based on the assumption that quiescent cml cells and early progenitor cells may differ in their pattern of gene expression from comparable normal cells and that if critical differences could be identified, they would help to reveal the underlying molecular mechanisms responsible for the excessive overproduction of the cml population. it was further hoped that some vulnerable differences would be discovered that would be susceptible to targeting by highly selective drugs, since it was assumed that the quiescent cells would be largely unaffected by existing bcr-abl inhibitors such as imatinib and dasatinib as well as other drugs active against proliferating cells. so far, there has been only one other study attempting this, which was performed using the same methods but using fewer samples (five cml and two normal) and an older microarray platform with considerably less genes represented (14,500 versus 38,500). because at least 10 cells were required for each sample for microarray analysis and the enriched cd34+g0 cells comprised less than 0.02% of the starting cell populations, it was difficult to obtain sufficient cells, especially patient samples, to carry out the study. we initially collected 10 cml samples, but 2 had insufficient rna so only 8 are included. we also performed microarray analyses on cd34+g0 and g1/s/g2/m cells enriched from cord blood and normal g-csf mobilized peripheral blood samples, but excluded them from the final analysis because some of the results differed from cells enriched from normal bone marrow samples and we considered the latter to be more appropriate normal controls. both the normal and cml quiescent and proliferating fractions consisted of 96100% cd34+primitive blast cells and less than 1% of cd34+g0 cells incorporated brdu, so almost all of the latter were either in g0 or early g1. because there are no definitive markers to distinguish stem cells from early progenitor cells, it is unknown what percentage of each was present in the cd34+g0 fractions, but we presume the majority of cells in both the normal and cml fractions were progenitors in various stages of development. ideally, we would have preferred to also compare normal and cml stem cells, but were unable to do this because of a lack of clear stem cell markers and insufficient cell numbers. some of the genes that were differentially expressed in normal and cml/g0 cells revealed a number of interesting findings which correlate nicely with some of the biological and functional abnormalities previously observed in cml cells. (i) in keeping with the gene expression data, normal and cml quiescent g0 cells are more highly enriched in primitive cells than the proliferating g1/s/g2/m cells. (ii) the cml g0 cells are in a slightly more advanced stage of development than the normal g0 cells, and as previously reported by graham et al., the cml cd34+g0 cells are more similar to the cd34+proliferating cells than are the normal g0 and g1/s/g2/m fractions. (iii) in keeping with their more advanced stage of development and their upregulation of genes involved in dna replication or part of the mitotic spindle machinery, cml/g0 cells are more poised to begin proliferating than normal g0 cells and are more sensitive to growth stimulation by single cytokines or combinations known to act on early progenitors and stem cells. while normal and cml/g0 cells are almost equally responsive to stimulation by multiple cytokines, the cml cells are triggered into cycle more rapidly. (iv) once cml quiescent progenitors are stimulated by cytokines to begin proliferating, they undergo further differentiation and maturation more rapidly than normal quiescent progenitors, but both granulopoiesis and erythropoiesis are usually less efficient than in normal hematopoiesis as shown in cloning experiments in which the cml cells form many more small cfu-gm, cfu-e, and bfu-e compared to normal progenitors [14, 32]. (v) whereas normal cd34+cells form almost entirely granulocyte/monocyte clusters and colonies in clonogenic experiments when stimulated by cytokines in the absence of erythropoietin, cml cd34+g0 cells consistently spontaneously form a combination of gm and erythroid colonies in the absence of epo. the gene expression data clearly shows that cml/g0 cells have marked overexpression of genes associated with development of the erythrocyte and megakaryocyte lineages, and graham et al. (vi) prominin-1 (cd133) is the gene most downregulated in cml g0 cells, and there is lower expression of cd133 on the surface of these cells. cord blood g0 cd 133+cells form only gm colonies without epo while cd133 cells form a mixture of gm and erythroid colonies. the downregulation of cd133 appears to be associated with the spontaneous formation of erythroid colonies by cml progenitors in the absence of epo, but its precise role remains to be better clarified. it has been known for many years that both normal and neoplastic cell populations contain significant numbers of resting or quiescent cells that are considerably less sensitive to the damaging effects of irradiation, cytotoxic drugs, and other injurious agents than are proliferating cells [59, 60]. the dormant state is a protective mechanism that is of crucial importance in enhancing a population's probability of survival under adverse conditions, and early on the concept that dormant cancer cells are important obstacles to curability was widely recognized by both basic and clinical scientists [15, 25, 61]. if one accepts the premises that almost all lethal cancers originate in adult stem cells or early progenitors functioning as stem cells, that these cells are essential for initiation, maintenance, and expansion of the cancers, and that a large fraction of these cells, like normal stem cells, reside in a quiescent state in which they are resistant to most therapies, then it is obviously important to better understand their derivation and properties, to determine how normal and cancer quiescent stem cells may differ, and to look for ways to develop specific targeted therapies based on these differences. activation of quiescent cells following a mitogenic stimulus by serum, cytokines, or other factors is highly complex and involves the coordinated and selective induction of expression and repression of hundreds of genes including specific cyclins, cyclin-dependent kinases (cdks), and protein kinase inhibitors (pkis). many cell cycle genes are transcriptionally silent in quiescent cells, and they express only a limited number of cytokine receptors, and recent studies have shown that sirnas and micrornas are also involved in repressing gene transcription and translation in quiescent cells. when one considers the staggering complexity of all of the cytokines and other regulatory factors and cellular interactions that determine whether a quiescent stem cell residing in its protected niche is going to divide while simultaneously deciding what kinds of cells to produce, it is hardly surprising that our present understanding of the mechanisms regulating stem cell behavior is very incomplete. in our analysis, it appears that in many cases, clusters of presumably related genes that are differentially expressed are all associated with a particular stage of development or function, suggesting that their common dysfunction in cml g0 cells may involve aberrant co-regulation. most authorities agree that the hsc population is heterogeneous, but it is still uncertain at what level of development the system permits changes to occur in phenotype and functionality, or when the differentiation hierarchy becomes fixed. circumstantial evidence for both normal and leukemic stem cells favors a heterogenic model in which there is a continuum of stem and early progenitor cells with gradually declining potentials for self-replication, pluripotency, and other stem cell properties, but that some cells may also exhibit flexibility in responding to different stochastic influences in their developmental milieus. some degree of reversibility may also exist whereby early progenitors can retain or reassume more primitive stem cell properties if needed, such as the ability for more extensive self-replication in order to replace or supplement damaged stem cells. however, it is likely that significant reversibility is restricted to early progenitors and that once they have become committed to differentiate along a particular lineage, it is doubtful that they can revert to functioning as stem cells. with regard to cancer stem cells, some years ago we postulated that most leukemias originate in limited stem cells which have more limited pluripotency than normal primitive hscs, but retain sufficient self-replicating potential to initiate a lethal leukemia. many current researchers now agree, although some prefer to call them leukemia or cancer initiating cells to distinguish them from true hscs. while cells undergoing differentiation and maturation can become temporarily arrested or slowed in their progression through other phases of the cell cycle under certain conditions (e.g., hypoxia, increased cell density, exposure to toxins, cytotoxic drugs, irradiation, or other damaging agents), it is usually only stem cells and primitive progenitors that remain in a quiescent state for extended periods under normal steady-state conditions. once progenitors become firmly committed to differentiation and maturation, serial cloning studies conducted in vitro and cytokinetic labeling studies with h-thymidine conducted in vivo [24, 62] have shown that both normal and leukemic cells usually proceed to undergo a variable but limited number of maturation divisions to produce terminally differentiated cells (which may be highly abnormal in leukemia and other malignancies), and which are incapable of reverting to regain significant self-renewal or other essential stem cell properties. while our in vivo h-thymidine labeling studies were less extensive in patients with lymphomas or solid tumors growing in ascetic form [63, 64], in cases in which it was possible to distinguish neoplastic cells in differing states of maturity, it appears that once the neoplasticcells become committed to maturation, if the environment is suitable, they usually continue to divide but are only capable of a limited number of divisions before dying spontaneously and are incapable of reproducing the disease. overall, our in vivo labeling studies strongly suggest that the number of dormant cancer stem and progenitor cells continue to increase as the population of cancer cells expands and that they, thus, constitute a progressively greater obstacle to curative therapy in many types of cancer [11, 25, 65]. the constitutive tyrosine kinase activity of the p210 protein causes abnormal phosphorylation of regulatory proteins in numerous interacting signaling pathways [3, 25, 66, 67]. the overall signaling networks altered by bcr-abl are highly complex, indeed reaching a level of complexity that some observers have likened to heisenberg's uncertainty principle in quantum mechanics. nevertheless, although the specific signaling changes responsible for each of the biological abnormalities that have been described are still incompletely defined, it is highly likely that the faulty signaling disrupts multiple interactive networks that normally tightly regulate the orderly well-coordinated processes of proliferation, differentiation, and maturation in normal hematopoiesis. this misregulation can probably explain all the abnormalities observed in early-stage cml including the initial overproduction of gm progenitors, the imbalanced lineage apportionment, the inefficiency of production of both granulocytes and erythrocytes, and all the other more subtle dysplastic morphological, biochemical, and functional changes that have been described. gleevec and some of the newer bcr-abl inhibitors are highly effective in globally inhibiting the increased tyrosine phosphorylation of multiple proteins involved in these signaling pathways [25, 6971] and since bcr-abl is usually the sole mutation in early stage cml, the progenitors are restored to near normal behavior when the kinase is adequately inhibited. at higher concentrations, the abl tki inhibitors are lethal to both fresh primary cml progenitors and bcr-abl-driven cell lines while at still higher concentrations, they also kill normal progenitors and cell lines not driven by bcr-abl, the exact normal: cml lethal concentration ratios depending on the particular cells and inhibitors. however, as suggested by the usual relatively slow induction of remissions in cml patients over the course of weeks or months, it is doubtful if the bcr-abl inhibitors when administered in clinically tolerable doses actually kill many of the proliferating cml progenitors and precursors. rather, by inhibiting bcr-abl's constitutive tyrosine kinase activity, they at least transiently restore the cells to functioning more normally, and in so doing the cml progenitors cease excessive cell production, presumably by reacquiring the ability to respond properly to quorum sensing signals that ensure maintenance of normal homeostatic cell density limits. meanwhile, the later cml progenitors which are already committed to differentiation continue to proceed through a limited number of maturation divisions and then die as terminally differentiated cells, just as do normal cells. after the body burden of leukemic cells has been sufficiently reduced, the residual normal stem cells are released from the cml cells ' (poorly understood) inhibitory effects and resume production, usually resulting in a complete hematologic or cytogenetic remission. the bcr-abl inhibitors are clearly a very important advance since they are able to induce durable remissions in the majority of cml patients in chronic phase, but they are not usually curative since most patients relapse if therapy is discontinued, probably because quiescent cml stem/progenitor cells are not killed by the drugs and are able to reproduce the disease [9, 72]. several mechanisms of resistance have also been well described as noted earlier [7, 8] thus, while gleevec and other bcr-abl tkis are very effective in the early stage of cml in largely eliminating the majority of proliferating ph+ progenitor and precursor cells, more attention should be given to seeking ways to selectively kill the quiescent leukemia stem and progenitor cells. while our own studies so far have not revealed any specific vulnerable targets, it is important that the search be continued. the alterations in gene expression described here must be confirmed in a larger number of patients, and if possible with further technological advances, in still more highly enriched populations of early progenitors and stem cells. as the search proceeds, the significance of some of the differences in gene expression reported here may become clearer and eventually lead to discovery of new ways to selectively kill the quiescent cml stem and progenitor cells. for a number of reasons, it has become increasingly difficult to obtain large enough samples of cml cells to carry out the rigorous procedures required to isolate sufficient numbers of highly enriched stem and progenitor cells for further studies, so this is another important issue that must be addressed. in a broader sense, it is perhaps even more important to design similar therapeutic strategies for other types of cancer. much of the recent development of anticancer drugs has been directed towards producing different classes of drugs that block segments of one or more signaling pathways that are known to be dysregulated by the particular initiating mutation(s) commonly found in different types of cancer. however in advanced malignancies it is often difficult to distinguish the importance of the primary causative mutation(s) compared to that of secondary or still later (passenger) mutations and the situation may become further complicated by multiple epigenetic changes. a huge number of new drugs of different classes are now available, but few cause complete or durable remissions and they are almost never curative. greater emphasis should therefore be placed on more clearly identifying and whenever possible selectively targeting the primary driving mutations in the cancer stem or early progenitor cells in early stage disease, and also in developing new strategies to selectively kill the quiescent stem or progenitor cells that escape most current therapies .

in comparing gene expression of normal and cml cd34+quiescent (g0) cell, 292 genes were downregulated and 192 genes upregulated in the cml/g0 cells. the differentially expressed genes were grouped according to their reported functions, and correlations were sought with biological differences previously observed between the same groups. the most relevant findings include the following. (i) cml g0 cells are in a more advanced stage of development and more poised to proliferate than normal g0 cells. (ii) when cml g0 cells are stimulated to proliferate, they differentiate and mature more rapidly than normal counterpart. (iii) whereas normal g0 cells form only granulocyte/monocyte colonies when stimulated by cytokines, cml g0 cells form a combination of the above and erythroid clusters and colonies. (iv) prominin-1 is the gene most downregulated in cml g0 cells, and this appears to be associated with the spontaneous formation of erythroid colonies by cml progenitors without epo.

PMC3062978

pubmed-1129

herpes simplex virus (hsv) is a neurotropic virus that has a large linear, double-stranded dna genome protected by a capsid with icosahedral symmetry surrounded by an envelope consisting of a lipid bilayer with embedded glycoproteins, having yet a proteinaceous region between the capsid and envelope called tegument. the hsv belongs to the family of herpesviridae, subfamily alphaherpesvirinae, and genus simplex virus [2, 3]. it is a virus that has a very complex life cycle and stands out as one of the most common pathogens in the etiology of sexually transmitted diseases worldwide. hsv infects the mucosa of the mouth, eyes, and the human anogenital tract. after primary infection, the virus replicates productively within mucosal epithelial cells and enters sensory neurons via nerve termini. the virus is then transported to neuronal cell bodies where latency is established. the virus can remain in this latent state indefinitely but can be reactivated at any time during the lifetime of the host [4, 5]. during latent infection, no infectious virus is produced from infected cells, symptoms are absent in the host, and the transmission does not occur. however, reactivation can occur only in some cells, in the absence of symptoms, enabling the transmission of the virus. this seemingly benign strategy has critical importance to the survival of the virus, where the infected cell continues throughout the life of the host, providing a reservoir for periodic reactivation. hsv is presented in the form of two distinct serotypes: herpes simplex type 1 (hsv-1) and type 2 (hsv-2), which are closely related but contain sufficient differences to enable type identification. hsv-1 is usually transmitted during childhood by nonsexual contact, typically found in orofacial lesions, with latency in the trigeminal ganglia. hsv-2 is the cause of most genital herpes and is almost always sexually transmitted, with latency in the lumbosacral ganglia. however, in the last decades, hsv-1 has been pointed out by several studies as a main causative agent of genital herpes, especially in college students [7, 8]. regardless of which serotype of hsv is acquired, the infections remain intermittent throughout the host's lifetime, in symptomatic or subclinical form with or without periodic reactivations. the extent and frequency of recurrent genital herpes are highly type-specific, with hsv-2 reactivation outpacing hsv-1 by three to one. thus, although an increase in genital infections attributable to hsv-1 has been well recognized in recent years, the situation regarding recurrence has apparently remained unaltered, with hsv-2 being the dominant agent. when there is a reactivation, the virus is excreted on the mucosal surfaces, allowing its transmission to susceptible individuals. most hsv-1 and hsv-2 infections are subclinical. however, when the infection is symptomatic, the clinical manifestations of hsv-2 are typically characterized by recurrent, painful, vesicular, and ulcerative lesions, located in the genital and anal areas. in contrast, symptomatic hsv-1 infections are usually manifested as recurrent orolabial and facial lesions. both hsv-1 and hsv-2 can cause genital herpes with greatest incidence among women of reproductive age, with risk of maternal transmission of the virus to the fetus and neonate. the acquisition of genital herpes during pregnancy has been associated with spontaneous abortion, intrauterine growth restriction, prematurity, and congenital and neonatal herpes. vertical transmission from an infected mother to her baby can cause severe disease resulting in sequelae or death of the infant. most neonatal infections result from exposure to hsv in the genital tract during passage through the birth canal, although they can also be transmitted to the fetus during the intrauterine phase. the risk of disease in the newborn is significantly higher when the mother acquires genital infection for the first time with hsv-1 or hsv-2 during pregnancy. recurrent infections are rarely associated with disseminated neonatal disease in the newborn of immune-competent mothers. in fact, the pregnant women who acquire genital herpes as a primary infection in the latter half of pregnancy, rather than prior to pregnancy, are at the greatest risk of transmitting the virus to their newborn [2, 3]. neonatal herpes has three major categories: skin, eye, and mouth disease (sem), central nervous system infection (cns), and disseminated infection (di). it has been observed that sem in itself is rarely fatal, but, without antiviral therapy, most cases progress to cns or di. clinically, cns disease typically presents with nonspecific symptoms such as lethargy, poor feeding, irritability, vomiting, and seizures. the disseminated infection is manifested in various combinations such as hepatitis, acute adrenal insufficiency, myocarditis, and consumption coagulopathy. in brazil, there is a major lack of studies on the prevalence of genital infection by herpes simplex virus. furthermore, the diagnosis of genital infection with these pathogens is not included among the mandatory prenatal examinations. thus, there is no official data available on infection during pregnancy nor on the likely consequences of such infections in newborns. in this study we evaluated the prevalence for herpes simplex virus types 1 and 2 genital infection among pregnant and nonpregnant women, its association with the presence of cervical abnormalities detected by colposcopy and cytology, sociodemographic characteristics, and reproductive activity. this study included 236 sexually active women, 106 (44.9%) of whom were pregnant and 130 (55.1%) nonpregnant, enrolled among those who attended the health service by spontaneous demand for cervical screening programme or to prenatal care, and agreed to participate in the study. the participants were residents in natal, rio grande do norte state, brazil, who sought gynecological care at two primary health care units from may 2010 until september 2011 and who agreed to participate in the research. study subjects were asked to fill in an anonymous questionnaire in order to identify different demographic and behavioral risk factors that may have implied their exposure to hsv-1 and hsv-2. the patient's ethnicity was identified based on self-reports according to the criterion of the brazilian institute of geography and statistics (ibge), which classifies ethnicity into five categories: white, black, mulatto, asian, and native. in this study, the black, mulatto, asian, and native categories were combined into a nonwhite category. data on sexual behavior included the age at the first sexual intercourse and the number of sexual partners during the lifetime. the study was approved by the ethics committee for medical research of the federal university of rio grande do norte (protocol 030/10cep/ufrn) and the written informed consent has been obtained from each subject. all women participating in this study underwent a clinical examination followed by a visual inspection of the vulva, vaginal walls, and cervix by colposcopy, with only two gynecologists, to detect possible abnormalities of these structures. during the examination, a solution of 5% acetic acid was applied initially and the first visual analysis was performed. after washing to remove the acetic acid, lugol solution of i2 (1%) in equilibrium with ki (2%) in distilled water was applied, and the second inspection was done. the colposcopy was considered with alteration, when at least one of the abnormal features (acetowhite lesions, punctuation, mosaics, inflammatory punctuation, congestion, and ulceration) in a localized area in the transformation zone was found. two specimens containing exfoliated uterine cervical cells were collected from each patient using a cervical brush. one of these specimens was used to obtain a smear on a slide that was stained by the papanicolaou method and analyzed by cytopathological examination, based on the bethesda system. we considered as normal cytology, or cytology without alterations, the samples that presented no pathological alteration or only inflammatory changes. cytology with alterations were the samples in which we detected the presence of atypical squamous cells of undetermined significance (asc-us), squamous intraepithelial lesions of low grade (lsil) or squamous intraepithelial lesions of high-grade (hsil). the other cervical specimen was conditioned in a tube containing a preserving solution (pbs+vancomycin+nystatin) and sent to a laboratory where it was processed for dna extraction. the tubes containing the cervical specimens were submitted to rigorous agitation before removal of the brush and were centrifuged at 300 g per 10 min. the supernatant was removed and the resulting pellet was processed for dna extraction using qiamp dna mini kit (qiagen, hilden, germany) following the manufacturer's recommendations. around 30 ng of the dna samples was submitted to a polymerase chain reaction (pcr) to amplify a 110 bp fragment of the human -globin gene, using the primers pco3+/pco4+ to analyze the quality of target dna and the absence of pcr inhibitors. the products of pcr were submitted to electrophoresis on 8% polyacrylamide gel, followed by silver staining. the positive samples for -globin were analyzed for the presence of dna from hsv-1 and hsv-2 in separated reactions by pcrs specific for each type. each reaction was composed of a master mix (promega, madison, wi, usa), 10 mm of each primer, and 2.5 mm of dna sample, to a final volume of 25 l. the pair primers hsv-1a (5-ccctgtctcgcgcgagccac-3) and hsv-1b (5-tcagccacccatacgcgtaa-3), which amplify a fragment of 142 bp, were used to detect the presence of hsv-1, while the primers hsv-2 (a) (5-ggacgaggcgccaaagcacacg-3) and hsv-2 (b) (5-tccgtccagtcgtttatcttcac-3), which generate a product 270 bp, were used to detect the presence of hsv-2. the conditions for both reactions were as follows: incubation at 50c for 2 min and denaturation of dna at 95c for 5 min, followed by 40 cycles of 94c for 1 min, 45 s at 58c for annealing, an extension step at 72c for 30 s, and a final extension step at 72c for 10 min. the products of pcrs underwent vertical electrophoresis on polyacrylamide gel at 8% and subsequent visualization by silver staining. statistical analysis of the results was performed using the chi-square test, while difference in proportion and associations between risk factors and hsv infection were analyzed by calculating the odds ratio (or) and their respective confidence intervals (95% ci). the analysis of individual questionnaires revealed that the profile of the segment of the population studied was characterized by being composed of women aged 1472 years, mean 30.3 10.8 years. most of them were less than 30 years of age, were of nonwhite ethnicity, were married or living in a stable relationship with her partner, had elementary education or less, had family income (monthly minimum wage) up to one minimum wage (approximately us$ 300.00), had their first sexual intercourse and the first pregnancy at age 18 or less, had more than one sexual partner in their lifetime, was not pregnant at the time of the survey, and had at least one pregnancy. the presence of any of the serotypes of hsv alone or both together was detected in 95 women, revealing an overall prevalence of 40.3% of genital infection in the studied population (23.7% hsv-1 alone, 11.9% hsv-2 alone, and 4.7% the two serotypes together). the presence of at least one of the serotypes of hsv was detected in 36/106 (34.0%) pregnant women and in 59/130 (45.4%) nonpregnant women. we observed a significant higher prevalence rate of hsv-1 infection among non-pregnant women (30.0%), when compared to pregnant women (16.0%) (p=0.0001). hsv-2 alone was found in 13/106 (12.3%) pregnant women and in 15/130 (11.5%) nonpregnant women. the coinfection by the two serotypes of hsv, in the same patient, was detected in 5.7% of pregnant and 4.7% of nonpregnant women (table 1). most of the participants in this study underwent morphological examinations by colposcopy (92.8%) and cytology (96.6%) to detect the presence of changes of the uterine cervix. the colposcopic examination was carried out on 90/106 (84.9%) pregnant women and in 129/130 (99.2%) nonpregnant women. in the group of pregnant women, the colposcopic examination showed that 38/90 (42.2%) had visible abnormalities of the uterine cervix. among nonpregnant women, the colposcopic examination showed that 45/129 (34.9%) had cervical changes (table 2). cytological examination was performed on 100/106 (94.3%) pregnant women and in 128/130 (98.5%) nonpregnant women (table 3). the cytological alterations were more prevalent in pregnant (41/100) than nonpregnant (22/128) women (p=0.0001). we also analyzed the correlation between the presence of genital infection by any of the two serotypes of hsv and morphological findings detected by colposcopy and cytological examinations. there was not any significant difference in the prevalence rates for hsv-1 between the groups with or without colposcopic abnormalities, in both pregnant and nonpregnant women. however, the prevalences of hsv-2 were significantly higher in women with colposcopy abnormalities in both pregnant and nonpregnant women, compared to those with normal colposcopy (table 2). similar results were found for women with or without cytological abnormalities (table 3). analysis of the association between genital infection by hsv-1 and hsv-2, each individually, and the considered variables revealed the absence of association between genital infection with hsv-1 and all variables tested (table 4). the genital tract infection by hsv-2 was found to be associated with morphological alterations detected by colposcopy or cytology, ethnicity, marital status, and number of lifetime sexual partners. the nonwhite and single women and those who had multiple partners presented a greater risk of acquiring genital hsv-2 infection (table 5). it has been shown that the prevalence of genital tract infection by hsv-1 and hsv-2 varies substantially in the different geographic regions, including those within the same country. in this study, we found an overall prevalence rate of 40.3%. the found prevalence rate was almost three times higher than that reported for united states women (14.0%). it was also higher than that described in a similar previous study involving women of natal, brazil (28.4%). considering each serotype of the hsv individually, hsv-1 was more prevalent than hsv-2, in the segment of the population studied, presenting coherence with the results reported in other studies, such as those reported for women of the united states, for women of israel, and for women of natal. this could be explained by changes in attitudes, behavior, and the sexual practices among adolescents, including oral-genital sexual contact. furthermore, the use of condoms for vaginal intercourse could have reduced the exposure to genital infection by hsv-2, contributing to an increasing proportion of cases of hsv-1, compared with hsv-2 as cause of genital herpes infection. hsv-1 was detected in 23.7% of women surveyed, presenting a prevalence rate almost equal to that found in a previous study for natal residents women (23.0%), but slightly smaller than the prevalence rate reported for women of the united states (32.0%). hsv-2 was detected in 11.9% of the study participants, representing double the prevalence rate of 5.4% reported by pereira et al. in 2012, but close to that described for american women (16.2%). still the prevalence rate described in this study was very similar to that reported for women of israel (13.3%), while it was less than the estimated prevalence for women of south america (varying between 20.0% and 40.0%). coinfection by the two serotypes of hsv was detected in 4.7% of the women surveyed, which was above that in previous research conducted by pereira et al. hsv-1 was more prevalent among nonpregnant women, whereas hsv-2 presented similar prevalence among pregnant and nonpregnant women. the prevalence of genital hsv-1 infection found in the nonpregnant women was higher than that described for women of the united states (14.0%). regarding pregnant women, hsv-1 was found with a prevalence rate very similar to that reported in a previous study in natal's women (23.0%). the prevalence rate of hsv-2 was practically equal to that described for women in korea (17.0%) but was less than that reported for united states ' women, approximately 22.0%. the prevalence rates found in nonpregnant women participating in this study for both hsv-1 and hsv-2 were higher than those described for women in the united states, which were 4.4% and 9.4%, respectively. pregnant women had higher percentages of abnormal results in both colposcopic and cytological examinations, when compared to nonpregnant women. we observed in this study a higher proportion of women infected with hsv-2 among those who had abnormal colposcopy and/or cytology, in both groups of pregnant and nonpregnant women. this suggests that hsv-2 has a higher ability to cause lesions in the genital tract. this result is consistent with the literature data reporting that the extent and frequency of symptomatic recurrent genital herpes is highly type-specific, with hsv-2 reactivations being much more frequent, outpacing hsv-1 by three to one. furthermore, it was shown that genital hsv-1 recurs infrequently and the rate of recurrences decreases rapidly over time, with a median recurrence rate declining by about 50% from the first to the second year of infection. when we evaluated the existence or lack of association between genital hsv-1 infection and sociodemographic variables and sexual activity, it was found that there was no association between the variables tested and genital hsv-1 infection among women of this study, corroborating with the results obtained in a previous study conducted in natal. however, a significant association was observed between the variables of ethnicity, marital status, and number of sexual partners over a lifetime and the occurrence of genital infection by hsv-2. no association was observed with chronological age, education, and age at first sexual intercourse. these results are consistent with those obtained for israel women, regarding education, age of first intercourse, and number of sexual partners. with regard to ethnicity,, the morphological alterations may not have been caused exclusively by hsv, once that there are other pathogens that cause cervical lesions, such as hpv, that were not analyzed in this study. besides, the studied population is limited to women attended in two primary health care units and may not be representative of the female population of natal. the analysis of a larger number of patients would allow obtaining more conclusive results. in conclusion, results of the current study show a high prevalence rate of both hsv-1 and hsv-2 in the studied population. the significant proportion of pregnant women infected by hsv-2 that presented morphological alterations in the uterine cervix suggests the importance of including the colposcopy or cytology exams as part of routine prenatal care.

objective. to evaluate the prevalence of hsv-1 and hsv-2 in pregnant and nonpregnant women, testing the correlation between dna of the viruses with colposcopic and/or cytological changes, and evaluate association with sociodemographic characteristics and sexual activity. methods. included in this study were 106 pregnant and 130 nonpregnant women treated at primary health care units of natal, brazil, in the period 2010-2011. the patients were examined by colposcopy, and two cervical specimens were collected: one for cytology examination and another for analysis by pcr for detection of hsv-1 and hsv-2. results. hsv-1 alone was detected in 16.0% of pregnant and 30.0% of nonpregnant women. for hsv-2, these rates were 12.3% and 15.5%, respectively. hsv-2 had a higher correlation with cytology and/or colposcopy changes than hsv-1 did. genital hsv-1 infection was not associated with any of the variables tested, whereas hsv-2 infection was associated with ethnicity, marital status, and number of sexual partners. conclusions. the prevalence of hsv-1 was higher than that observed for hsv-2 in both pregnant and nonpregnant women. the genital infection by hsv-2 was higher in women with changed colposcopy and/or cytology, and it was associated with ethnicity, marital status, and number of sexual partners.

PMC3972835

pubmed-1130

acute respiratory infections (aris) are important under-five morbidities causing lots of discomfort, frequent visits to a healthcare provider, admission to an indoor facility, and even mortality [1, 2]. india's reproductive and child health programme has components for the prevention and control of ari since 1992. aris, however, still continue to be the single largest contributor of childhood morbidity and mortality with estimated 35 episodes every year, 4 million pneumonias, and 1 million deaths [46]. estimates also indicate that 3050% of opd attendance and 2040% of hospital admissions may be attributed to ari and pneumonia. for a disease of such magnitude and severity, it is important that all aspects of its epidemiology have to be known. yet unfortunately, there are few studies reporting the detailed epidemiology of aris. of the few studies that exist, very few studies have been conducted in peri-urban communities and fewer involved active surveillance done prospectively by qualified and trained health practitioners. besides, most studies are 1 to 2 decades old [817]. in view of above, a prospective study to find out the current epidemiology of aris among infants and toddlers, the most affected age group, was planned. we report here the incidence, prevalence, clinical pattern, severity, seasonal pattern, and gender differences. this community-based follow-up study was conducted in 2011-12 at mehrauli, a peri-urban field practice area attached to the department of community medicine of a tertiary care teaching hospital of new delhi. optimum sample size was worked out to be 106 children or 5512 child-weeks of exposure. owing to logistics needed for the fortnightly follow-up, the study was restricted to one of the wards selected randomly (ward 4). cut-off age for enrollment of children was kept as 24 months so as to ensure a follow-up of 12 months before child ceased to be toddler. the only inclusion criterion was parents ' willingness to let their children participate, while exclusion criteria were two-fold: (i) child suffering from any chronic/severe illness and (ii) family of child not a permanent resident of ward 4. our sampling frame was constituted of 264 under-two children identified through a house-to-house survey one month prior to the study. of these, 23 were not eligible for being included in the study (1 had thalassemia, 1 had nephrotic syndrome, 1 had very low birth weight, and 20 were temporary residents). three parents refused to let their wards participate and were replaced by another eligible child residing closest to the refusal. history regarding presence of ari currently or in the past fortnight was elicited from a responsible caregiver and recorded on mics proforma of unicef. all children, whether or not their parents reported a current/past bout of ari, were assessed clinically by a qualified trained medical practitioner on the designated day. additional information on type of ari, its severity, other accompanying symptoms, and so forth was assessed and recorded in a separate interview schedule validated by a faculty from paediatrics department. background information on the physical, biological, and sociodemographic environment as well as the general health status of the child was noted. in context of physical environment, overcrowding, indoor air pollution, environmental tobacco smoke, and so forth history of breast feeding, immunization, and exposure to ari from siblings was assessed as part of the biological environment. education, occupation, income, and social class formed the main stay of our sociodemographic assessment. information collected on interview schedules was cross-checked for completeness and correctness by supervisors and a database was created using microsoft excel software. incidence density of all aris has been described in terms of mean number of episodes per 100 child-weeks of exposure. chi-square test has been used to detect statistical significance at 5% level of significance. a total of 2752 contacts were made with 67 boys and 39 girls at their residences. one enrolled subject went out of town for 2 months, thus reducing our observation period by 8 child-weeks to 5503 child-weeks of exposure. four-fifth of study subjects were from middle income group and the remaining from high income families. a little over 5% of the mothers were illiterate and 32.1% had less than five years of schooling. close to half of the subjects lived in overcrowded (47%) or ill-ventilated (21%) houses, and 14% of households did not have a separate kitchen and 18% were using biomass fuels in addition to liquefied petroleum gas (lpg). besides, 45% of study subjects were exposed to environmental tobacco smoke (ets). one-fourth of subjects were having mild-to-moderate protein energy malnutrition (pem). health assessment based on history as well as physical examination revealed that ari was the commonest illness (437 episodes in 105 children) followed by diarrhea (253 episodes in 85 individuals) and fever (69 episodes in 48 individuals). prevalence of ari, diarrhea, and fever was thus found to be 34.5, 19.9, and 5.4 percent, respectively. only 1 child did not seem to suffer from any type of ari during the study period, 105 (99.1%) children suffered from no pneumonia, cough, and cold (alone or in combination with other types of ari), 38 (35.8%) had pneumonia, and 5 (4.7%) had otitis media. of the 437 ari episodes, 390 (89.2%) affected the upper respiratory tract only, 47 (10.7%) were pneumonias, and 5 (1.1%) were otitis media. out of those children suffering from ari, proportions of children suffering from 1 to 3, 4 to 5, and 6 to 7 episodes of ari were 35.2, 45.7, and 19.1 percent, respectively. of the 38 children who suffered from pneumonia, 9 (23.7%) had two episodes. the mean duration of uri was 6.16 days (range: 414 days) as compared to 11.65 days for lri (range: 719 days). the overall incidence of ari (all types) was found to be 7.9 episodes/100 child-weeks of exposure; incidence was higher in infancy (9.4 episodes/100 child-weeks) as compared to toddlers (7.0 episodes/per 100 child-weeks). incidence of pneumonia was found to be 0.8 episodes/100 child-weeks (1.1 in infancy and 0.7 in toddlers). highest incidence of pneumonia was seen in children less than 2 months of age (1.7 episodes/100 child-weeks). incidence of no pneumonia, cough, and cold was nearly constant throughout infancy, decreasing in the second and third years of life (lowest incidence of 3.3 episodes/100 child-weeks seen in children of 3036 months). the incidence of pneumonia was one-tenth that of ari and that of severe pneumonia or otitis media was roughly one-tenth that of pneumonia. no case of otitis media was seen in infants less than 2 months of age and none of the toddlers were found to suffer from severe pneumonia. incidence of pneumonia was, however, noted to be higher in boys (0.9 episodes/100 child-weeks) as compared to girls (0.6 episodes/100 child-weeks). similar pattern was seen for severe pneumonias also (0.1 for boys as compared to 0.05 for girls). in contrast, the incidence of no pneumonia, cold, and cough as well as otitis media was found to be higher in girls. figure 1 shows the monthly incidence of ari (all types including otitis media), no pneumonia, cough, and cold, pneumonia, and otitis media among infants and toddlers. the monthly incidence of aris ranged from a low of 5.2 episodes/100 child-weeks (in may) to a high of 15.8 (in february). two peaks were seen with the more prominent peak falling in the month of february which coincided with spring season. incidence of pneumonia also showed a fluctuation, ranging from a low of 0.2 episodes/100 child-weeks in may to a high of 1.5 episodes/100 child-weeks in march (visible as a peak) and november (visible as a less prominent plateau). this community-based prospective study conducted in delhi provides information on risk of developing ari in tropical peri-urban settings of developing countries. our study had a very low attrition rate (1.6%) all of which was attributable to social migrations. we believe that the child-weeks lost to attrition were not systematically different from those included for analysis. besides, though living standards of delhi are better than those in other areas of india as a whole, owing to the lack of primary health care system and higher levels of pollution (as is the case in most urban areas), there is likely to be a balancing effect, thereby making our estimates representative of similar peri-urban areas. prevalence of ari in this study stood at 34.3% as compared to 19.9% and 5.4% for diarrhea and fever, respectively. the relative importance of ari as a cause of disease, not just mortality, in young children was, hence, reestablished. nfhs 3 reported that 5.8% of children under 5 years suffered from ari (cough plus short, rapid breathing) during the 2-week-period preceding the survey. the difference is due to variations in methodology (nfhs used a one-time survey technique conducted by nonmedical personnel and no examination was involved). have also documented ari to be a major cause of morbidity among rural children with prevalence rates of 35.4 per hundred days of observation. the bangladesh study, however, reports that nearly 9% of their study subjects did not suffer from any ari episode during the 12-month study period which is a highly desirable situation compared to only 0.9% in our case. our findings are also in concurrence with those reported by koch et al. in their greenland study. annual incidence of ari in this study was 4.1 episodes/child (7.9 epi/100 child-wks). acharya et al. in 2003 found ari incidence of 6.4 episodes per child per year. reported 3.7 episodes of ari among under-five children of wardha, maharashtra in 1996, while awasthi and pande from lucknow have reported the lowest ari incidence of 1.67 episodes. studies from neighbouring bangladesh too have reported annual ari incidence to be 5.5 episodes per child. although our observations fall within the range of what others have reported, still it would be the best not to compare our findings with that of others for the following three reasons: (i) while most workers have studied children up to 5 years of age, we focused on infants and toddlers exclusively, the age which is most affected by aris; (ii) some studies were conducted in part of the year only and not a full calendar year; and (iii) the questions used to estimate ari might have been different in different studies. we found annual pneumonia incidence to be 0.44 episodes/child (0.85 episodes/100 child-weeks) which is much higher than that reported by most workers and agencies. for example, the joint unicef-who document on pneumonia of 2006 reports an incidence of 0.30 episodes/child/year for india as a whole and rudan et al. singh and nayar have reported an annual incidence of pneumonia among under-five children of wardha (maharashtra) in 1996 to be 0.07 episodes/child, while awasthi and pande found pneumonia incidence of 0.09 per child per year in lucknow, up., however, report a higher pneumonia incidence of 0.52 episodes per child per year from rural udupi in karnataka. in bangladesh much lower incidence of acute lower respiratory infections (i.e., pneumonia) was reported (0.23 per child per year). the reason for the high prevalence of aris and higher incidence of pneumonia in the present study could be (i) higher levels of air pollution, (ii) overcrowded and ill-ventilated living conditions, and (iii) lack of a primary health care mechanism. the latter has also been documented in pakistan by singh and nayar which records that 13% of no pneumonia is likely to turn into pneumonia, and a significant proportion of these would be prevented if appropriate care is available. we found 10.1% of all ari episodes to be pneumonia and 0.7% to be severe pneumonia. awasthi and pande found 10% of respiratory disease to be pneumonia in lucknow, while acharya et al. reported 8.7% to be pneumonia and 0.5% to be severe pneumonia in udupi, karnataka. in contrast, 4% of ari episodes were reported to be pneumonia in bangladesh. on the other hand, incidence of otitis media in the current study (0.01%) is much lower than the 30% estimated incidence among ari cases as reported by simoes et al. for developing countries. the difference could be due to difficulty in making an assessment of otitis media which requires otoscopy, a procedure we could not conduct in field conditions. the mean duration of no pneumonia, cough, and cold was 6.16 days as compared to 11.65 days for pneumonia in our study. the bangladesh study reported that 46 percent of uri and 65 percent of alri episodes lasted 15 days or more without giving any more details. median duration of uri and lri episodes has been reported to be 14 days (range: 725 days) and 19 days (range: 939 days) in the greenland study. incidence of uri was the highest in the 1217-month-age cohort, while that for pneumonia was highest in 0-1-month-age cohort. the bangladesh study found the highest uri incidence among children 1823 months old, followed by infants 611 months old, while the highest pneumonia incidence was reported in infants 06 months old, followed by children 1218 months old. the greenland study also reported the highest prevalence of respiratory symptoms in the 611 months age group with a steep rise occurring from less than 5 months to 611 months and a decrease in incidence thereafter. thus, the risk of ari generally increases in the later part of life as a toddler, which could be due to the fact that children become more mobile at this age and interact with multiple caregivers and individuals (in contrast to mother only during early infancy) and they are therefore exposed to more numbers of ari cases/carriers. gender. our finding of slightly higher incidence of no pneumonia, cough, and cold in girls did not match the findings of nfhs which reported slightly higher prevalence among boys. the reasons for higher reporting for boys could be explained by the gender bias that is prevalent in our society with its attendant preferential treatment for boy-child, especially when history is the only method of assessment (nfhs methodology). the greenland study did not find any gender differential as far as uris were concerned, but that for pneumonia was higher in boys. the presentstudydemonstrated that uri peaks in spring season and to a lesser extent in autumn, while pneumonia peaks a little later. the bangladesh study noted a higher incidence of uri as well as pneumonia (alri) in monsoon and autumn (before winter). on the other hand, no seasonal pattern in the incidence of ari, uri, or lri was observed in the greenland study. the differences are possibly due to differences in the climatic conditions as well as housing conditions of the areas of study. the annual incidence of aris was 4.1 episodes/child, while that for pneumonia was 0.44 episodes/child. pneumonia incidence was higher than the estimates for india as well as for south asia as a whole. incidence of pneumonia was roughly one-tenth that of ari and that of severe pneumonia or otitis media was one-tenth that of pneumonia. since incidence of aris and pneumonia generally decreased with increasing age, targeting infants specifically for prevention and control efforts may be a more effective strategy. two fortnight-long intensive mass-media campaigns (pneumonia awareness and prevention fortnight) prior to holi (a festival of colors celebrated in the month of march commencing the spring season) and dusshera (indian festival celebrated in autumn during month of october/november), on the lines of breast feeding awareness week and malaria month, just before onset of the peak season, are also likely to be helpful in generation awareness and disease control. more of such studies with larger sample sizes and including rural as well as urban populations need to be conducted. (i) with the study being conducted in a small area, its findings may not be generalizable to other peri-urban settings, within and outside this country. (ii) period of recall of one fortnight, though accepted as standard for this type of study, may have led to missing out on many episodes (those starting after a particular visit and ending before the next), particularly when primary caregiver was not the respondent. (iii) primary researcher being a doctor was ethically bound to provide health education as well as medical guidance to children and their caregivers, thereby altering the natural history and may be even the incidence of aris.

acute respiratory infections (aris) in spite of being the single most important under-five morbidity have not been studied adequately in peri-urban settings in india. we conducted this study prospectively on a cohort of 106 children in a peri-urban area of delhi. the overall 2-week prevalence of all types of ari was 34.3%. annual combined incidence of all types of ari was 7.9 episodes/100 child-weeks; while that for no pneumonia, cough, and cold, pneumonia, and otitis media was 7.1, 0.85, and 0.09 epi/100 ch-wks, respectively. incidence of ari was higher in infancy (9.4 epi/100 ch-wks) as compared to toddlers (7.0 epi/100 ch-wks). pneumonia incidence was higher among boys (0.9 epi/100 ch-wks as compared to 0.6 for girls) and the highest in infants under 2 months of age (1.09 epi/100 ch-wks; p<0.01). incidence of severe pneumonia was roughly one-tenth that of pneumonia. incidence of both ari and pneumonia peaked in spring and autumn. mothers of infants, zespecially those under 2 months of age, need to be made aware of ari/pneumonia and iec campaigns may be aired more intensively keeping their peak season in mind.

PMC4897469

pubmed-1131

aplasia cutis congenita (acc) is a rare congenital malformation characterized by noninflammatory, well-demarcated defects of all skin layers, subcutaneous tissue, with possible co-defects in muscles, periosteum, bone and dura. it manifests usually as a solitary defect on the scalp, but sometimes may occur on the face, trunk or limbs. acc is most often a benign isolated defect, but can be associated with other physical anomalies or malformation syndromes. on the other hand, a split cord malformation (scm), also called a diastematomyelia, is a rare spinal anomaly and refers to a sagittal division of the spinal cord into two symmetrical or asymmetrical hemicords. variants of this malformation associated with a split of the spinal column, spinal bony spurs, myeloceles, myelomeningoceles, lipomas and dermal sinuses has been previously reported in the literature. however, the association of acc with scm is considered very rare variant and only two reports of this condition are available. a full-term girl, the first child of a 24-year-old mother was born with large skin, muscle, bone and dural defect in the lumbo-sacral area. the patient weighed 2800 g. the patient was evaluated by the pediatric clinic and no other congenital malformations were found. the lesion showed 8 5 cm skin defect, covered with transparent arachnoid membrane. underneath nerve tissue of the spinal cord was split by a perpendicular bony spur and connected from its tip to the upper lamina [figure 1a and b]. dura matter was seen on both sides of the lesion extending laterally over the paraspinal muscles. brain computed tomography (ct) scan showed mild ventriculomegaly without signs of increased intracranial pressure. spinal x-rays showed a bony spur on the l2 vertebral column and laminar defect in the lumbo-sacral area [figure 1c]. under general anesthesia and prone position, the arachnoid layer was removed and the split spinal cord was dissected from the bony spur. there was no neural placode and the spinal cord was found with full neurulation. the spur was seen extending from the posterior border of the vertebral body and penetrating the anterior dura [figure 2a]. however, dural folds around the base of the spur invaginating between the two hemicords were seen. fibrous attachment between the bony spur and the upper lamina was resected [figure 2b]. the bony spur is then resected from its base to expose the opened anterior dura of the spine [figure 3a]. the anterior dura was sutured [figure 3b], and the spinal roots were demonstrated [figure 3c]. posterior dura was dissected from both the sides from the subcutaneous tissue and reverted to midline and closure was done in a water tight fashion. skin defect was large and direct approximation of the lips of the skin was not possible. a wide subcutaneous undermining was done to allow a z-plasty-type flap closure. however, the post-operative follow-up showed necrosis in the lips of the flap. debridement of the necrotic lips was done and wound was allowed to heal by secondary closure with regular wet dressing and boric acid powder. (c) p-a spinal x-ray demonstrating the laminae defects in the lumbo-sacral region (1: bony spur, 2: fibrous band, 3: split spinal cord) (a) split spinal cord is dissected from the bony spur. (b) fibrous band is cut from the attachment site in the upper lamina (a) bony spur is resected from its base to expose the opening of the anterior dura. although the etiology is still uncertain, a variety of possible causes such as genetic syndromes, teratogens, intrauterine infection with varicella zoster or herpes simplex viruses, fetal exposure to cocaine, heroin, alcohol or antithyroid drugs, infarction of the placenta, and amniotic pathologies are described in the literature. the incidence is 1 to 3/2000 to 10,000 and 25% of the reported cases are familial with a vast majority (69%) showing an autosomal dominant inheritance or part of a syndrome. lesions can be multiple and on different surfaces of the body, but most of the cases have solitary scalp lesions (70%). it can also be associated with other physical anomalies such as defects of eyes, extremities, limbs, gastrointestinal system, genito-urinary system, and central nervous system. in our case, the defect was seen in the lumbo-sacral area which is besides considered very rare. scm is an unusual congenital anomaly characterized by sagittal clefting of the spinal cord or filum terminale. pang et al. proposed a unified theory of embryogenesis in which all double cord malformations result from a basic ontogenetic error occurring around the time when the primitive neuroenteric canal closes. this basic error is the key step in the formation of an abnormal (accessory) neuroenteric canal (fistula) through the midline embryonic disc that maintains communication between the yolk sac, which is of endodermic origin, and the amnion, which is ectodermic in origin. an endomesenchymal tract condenses around this accessory canal, splitting the developing notochord and causing two hemineural plates to form. scms are classified as one of 2 types according to the unified theory. in type i scm, the hemicords are always invested with individual dural sacs and the medial walls of the sacs always ensheath a rigid (bony or cartilaginous) midline spur. in type ii scm, hemicords are always within a single dural sac and the midline septum is composed of non-rigid fibrous or fibrovascular tissues. according to this classification, our case can be diagnosed as type i scm with completely separated dural sacs and a bony spur. cutaneous stigmata are more common in cases of scms than in other spinal dysraphism, with an incidence rate of 20 to 55%; hypertrichosis is the most frequent skin manifestation. the spinal cord was split by a perpendicular bony spur and connected from its tip to the upper lamina. the spur was seen extending from the posterior border of the vertebral body and penetrating the anterior dura. there was no neural placode and the hemicords were found with full neurulation reflected with the fully intact motor power in the lower limbs and excluding the diagnosis of myeloschisis. this association of both pathologies may be explained by an arrest during embryologic development of the skin and subcutaneous tissue formation (as known for acc) and of the regression of the neurenteric canal or the break between the ectoderm and endoderm forming the fistula due to common pathologic process, such as ischemia. in our case, the mother was previously healthy and there was no drug intake history which could be considered as teratogenic. recent studies demonstrated that magnetic resonance imaging (mri) and 3d ct are useful for the diagnosis of scm. in this case, however, we approached this variant as an open dysraphism without preoperative mri as the lesion was totally exposed and identifiable. careful intraoperative exploration was sufficient for the identification of the anatomy and the management of this variant.

a full-term newborn girl born with large skin, muscle, bone and dural defect in the lumbo-sacral area. the lesion included a split spinal cord by a perpendicular bony spur and connected from its tip to the upper lamina. patient was diagnosed with aplasia cutis congenita (acc) associated with type i split cord malformation (scm). neurological examination of the lower extremities was normal. spinal x-rays showed a bony spur on the l2 vertebral column and laminar defect in the lumbo-sacral area. lesion was operated and closed according to anatomic layers. clinical and intraoperative findings of this extremely rare case are discussed.

PMC4040027

pubmed-1132

air pollution is a health problem which results in several medical conditions in human beings. old persons, children, patients with cardiovascular problems, pregnant women, and fetuses are more susceptible to these pollutants. tehran is the capital of iran, a metropolitan area with more than 12 million inhabitants, more than 3 million cars and many factories, which all lead the city to be one of the most air-polluted cities in the world. in a study conducted in 2004 in tehran, the air quality over 262 days was worse than the standard levels specified by the u.s. comparing with past years, the quality of tehran's air in 2004 was still threatening to people, especially vulnerable populations. previous studies have indicated that there is a significant association between air pollution and a high rate of cardiovascular disease, including deep vein thrombosis and other atherosclerotic disorders such as myocardial infarction.[79] a study conducted in seoul, south korea, between 1995 and 1998 investigated the delayed effect of air pollution on mortality due to stroke, and the results showed that o3 and pm10 had the highest relationship with mortality due to stroke on the same day. meanwhile, co, so2, and no2 densities at 48 hours before indicated a higher risk for mortality due to stroke. a study conducted in isfahan, the second most air-polluted city in iran, showed that there is an association between air pollution and the development of atherosclerosis in its first stages in the early life and emphasized the importance of considering the harmful effects of air pollution on children. another study conducted in isfahan suggested an independent association between air pollution and systemic inflammatory and coagulation responses by studying a genetic polymorphism in a tissue factor in atherosclerotic lesions. although many studies have discussed the side effects of air pollution on human health, there is not yet a consensus on the vascular side effects of air pollution. in order to provide more comprehensive data on the effects of air pollution on the health, we investigated the association between air pollution in tehran and the number of stroke admissions in the main referral hospitals of tehran. the patients were admitted in eight referral hospitals, located in different areas of tehran. these are the main referral hospitals in tehran which figured out that more than 90% of patients with stroke would be admitted by them. complementary data including age, sex, risk, and modifying factors on stroke including hyperlipidemia, hypertension, cardiovascular disease, diabetes, smoking status, and type of stroke were obtained from the patient's file. in order to cover stroke in the younger group during analysis, daily information on tehran's air pollution in 2004 was supplied from the centre for control of traffic, transportation and air pollution of tehran. the data included daily levels of co, so2, nox, pm10, ozone (o3), and meteorological variables (temperature and humidity). we used the information from seven air-check stations of the eleven stations in tehran. we used the air quality index (aqi) to describe air quality which consists of six levels, which are shown in table 1. categories of pollutant density, necessary for calculating the air quality control index, are also shown in table 1. in this table, the average 8-hour density was used for co and o3 and the average 24-hour density was used for so2 and pm10. the density of pm10 was assessed by radiating beta ray, the density of co was assessed by using a non-dispersive infrared analyzer, the densities of o3 and so2 were assessed by using light spectrometry, and temperature and humidity were assessed by the vaisala model mp 113y and were analyzed continuously. due to the lack of information on no2, nox was used in some stations. according to the standard table of clean air, offered by the u.s. environmental protection agency, the density of no2 and nox was not mentioned in this classification. to evaluate the association between each pollutant and the rate of hospitalization separately, we used univariate analysis. we also used multi-variable poisson regression in which the number of hospitalizations for each day was the dependent variable and the previously mentioned air pollutants with a p value lower than 0.2 in the univariate analysis were independent variables. poisson regression was also performed separately for each stratum of the variables of age (cut-off point: 40 years), sex, and underlying diseases (diabetes, hypertension, hypercholesterolemia, cardiovascular diseases, and smoking status). in this analysis, the adjusted relative risk (rr) was defined as the increase in the rate of hospitalization by the increased level of pollutants. characteristics of studied subjects (n=1491) the statistical significance of association between the 24 hour average of air pollutants with the number of stroke admissions on the same day and 48 hours before in univariate analysis based on analysis of variance and univariate poisson regression is shown in table 3. statistical significance level of association of average air pollutants with number of hospital admission for stroke as shown in table 3, the variables o3, co, so2, temperature, and humidity on the day of stroke and the variables nox, co, so2, temperature, and humidity 48 hours before stroke had p values lower than 0.2 and were therefore entered into multivariate poisson regression. in the multivariate poisson regression, as shown in table 4, the same-day level of the pollutants had no significant effect on the number of admitted stroke patients. as shown in table 5, the level of nox at 48 hours before had a significant effect on the number of hospitalizations (p=0.02). association between the same-day level of the pollutants and stroke admission in the different variables strata through multivariate poisson regression association between the 48 h before stroke level of the pollutants and stroke admission in the different variables strata through multivariate poisson regression as shown in tables 4 and 5, multivariate poisson regression was used to assess the association of same-day and 48 hours before stroke pollutant levels in different variables strata. same-day temperature had a significant reverse association with hemorrhagic stroke admission (p=0.034), and in patients without a history of heart disease (p=0.046) or previous stroke (p=0.043). also, temperature at 48 hours before had a significant reverse association with hemorrhagic stroke admission (p=0.017). the humidity level 48 hours before had a direct significant association with the stroke admission of patients with the history of heart disease (p=0.007). same-day nitrogen oxide level had a significant direct association with the stroke admission of patients with the history of hypertension (p=0.031). the nitrogen oxide level 48 hours before stroke had a significant direct association with stroke admission of patients aged over 40 years (p=0.025), patients with the history of hypertension (p=0.005), and in patients without history of hyperlipidemia (p=0.032). the carbon monoxide (co) level 48 hours before stroke had a significant direct association with stroke admission in female cases (p=0.019), with ischemic stroke admission (p=0.013), stroke admission in patients with the history of hypertension (p=0.005), diabetics (p=0.009), and non-smoking cases (p=0.008). the sulfur dioxide level 48 hours before had a significant direct association with admission of patients with a history of heart disease (p=0.004) and past smokers (p=0.003). stroke is a multi-factorial disease that is influenced by several genetic and environmental factors including life style and environmental conditions. the level of nox on the same day had a significant association with the occurrence of stroke, and factors including co, so2, and nox, temperature and humidity 48 hours before stroke had a significant association with stroke admission. these associations were different among different subgroups of age, sex, history of underlying diseases, and type of stroke. it could be concluded that the effect of pollutants on stroke 48 hours before stroke was higher than its effect on the same day as stroke which might be due to a requirement for an incubation time of these pollutants at least 48 hours before influencing the brain. in this study, in comparison with other similar studies, more pollutants were used for studying this relationship. in a study conducted by lokken in the u.s.a. published in 2009, upon examining 1 101 patients with proven stroke, it was shown that observing hospitalized patients and not having a control group may have resulted in an underestimation of the relationship between air pollution and stroke. therefore, it might be inferred that the true associations are stronger than the associations which were shown in this study. in a study conducted by hu in the u.s.a. in 2008, it was determined that for people who live in polluted areas and areas without any green space, the risk of mortality is higher in cases of stroke. in our study, we found a similar result in that there was a relationship between mortality as a result of stroke with pollutants including carbon monoxide and ozone on the day of stroke and carbon dioxide 48 hours before stroke. in a study that was conducted by oudin in sweden in 2009, upon studying 556 912 persons (contrasting our study and most previous studies), it was shown that there was no association between air pollution, especially between the nox index and hospitalizations due to stroke. in a study conducted by wang in australia, it was found that there was a significant association between temperature and hospitalization due to stroke and even there was association between the type of stroke with temperature, similar to the results of our study. in a study conducted by henrotin in dordjon, france from 1994-2004, it was found that there was a positive relationship between increasing amounts of o3 and pm10 and ischemic stroke, but there was no important relationship with hemorrhagic stroke. however, in our study, there was a significant relationship between ischemic stroke and carbon monoxide 48 hours before stroke and a significant relationship between hemorrhagic stroke and temperature on the same day and 48 hours before stroke in which temperature was a protective factor. the hazards of air pollution should be considered in all age groups even in young adults, and the impacts on elderly should be underscored. in terms of limitations, also, it was not a study on the individual level, i.e., it was performed on the ecologic level and the results were analyzed on the group level, so there may be bias in this study. on the other hand, since tehran is a big city and there are few stations for assessing air pollutants, it was not possible to determine accurate amounts of dangerous pollutants in persons with stroke. also, the time of stroke was not accessible as an exact hour. in this study, potential confounding factors may have been due to risk factors which were dependent on time (time-varying), day, month, or climate conditions in which these confounding factors were considered in the multivariate analysis. since diagnosis of stroke was performed in this study without having any information of the air pollution status by the physicians, patients, and even the research team, a considerable bias is not expected. based on our findings and compared to previous studies, we can infer that air pollution and temperature are effective factors in the occurrence of cerebral stroke. however, they do not have any effect on mortality from stroke. although this study was conducted in 2004, but considering the large sample size and as the findings of this study are not time-dependant, they can be generalized to different population in different times. according to the significant relationship indicated in this study, it can be concluded that policies should be considered for decreasing air pollution and consequently decreasing stroke, complications, and the mortality rate due to stroke. this could be regarded as an effective step on behalf of the organizations responsible for a healthy environment. we suggest conducting more studies at individual level to describe the role of each pollutant in causing stroke in the future.

background: in this study, we aimed to assess the association between air pollution and cerebrovascular complications in tehran, one of the most air-polluted cities in the world, among different subgroups of patients with stroke in 2004. methods:in this ecologic study, we calculated the daily average levels of different air pollutants including co, nox, so2, o3, and pm10 and also humidity and temperature on the day of stroke and 48 hours prior to stroke in 1 491 patients admitted with the diagnosis of stroke in eight referral hospitals in different areas of tehran. then, we evaluated the association between the rate of stroke admissions and the level of the selected pollutants, humidity, and temperature on the day of stroke and 48 hours prior to stroke among different subgroups of patients. results:there was no significant association between the same-day level of the pollutants and the rate of stroke admissions, but an association was seen for their level 48 hours before stroke. these associations differed among different subgroups of age, sex, history of underlying diseases, and type of stroke. same-day temperature had a reverse association in patients with hemorrhagic stroke and in patients without a history of heart disease or previous stroke. a direct significant association was seen for humidity level 48 hours before stroke in patients with a history of heart disease. conclusions:it is inferred that air pollution has a direct association with the incidence of stroke and these association differs among different subgroups of patients. the results of this study are not time-dependant and can be generalized to different times and regions. moreover, these results may be useful for environmental health policy makers.

PMC3483001

pubmed-1133

a 26-year-old female patient was transferred to the samsung medical center from an outside institution due to severe refractory cardiogenic shock. the patient was diagnosed with non-hodgkin s lymphoma 2 years prior and underwent 6 cycles of chemotherapy, which included doxorubicin. after chemotherapy treatments were completed, the patient suffered from orthopnea and dyspnea, and an echocardiography revealed a severely depressed left ventricular (lv) ejection fraction (25%) and dilated lv. due to complications from cancer treatments, she had an episode of acute decompensated heart failure and was referred to samsung medical center. on initial presentation, vital signs included arterial blood pressure of 79/27 mmhg, heart rate of 133 beats/min, respiratory rate of 28 breaths/min, and body temperature of 35.9c. she had pulmonary edema with bilateral pulmonary congestion (fig. 1) and multiorgan failure with liver and kidney involvement. despite the use of inotropes and vasopressors, we were unable to achieve stable vital signs. percutaneous extracorporeal life support (p-ecls) was then placed using the left femoral artery and vein. however, the left leg became ischemic after several hours, and we decided to shift the cannulas to the right groin. the patient was brought to a hybrid operating room, and the groin was opened bilaterally. then, the arterial and venous cannulas were inserted through the common femoral artery and vein, and the catheter for the superficial femoral artery was inserted at the same time. the following day, transthoracic echocardiography revealed a distended left ventricle, and the chest x-ray showed worsening pulmonary edema. in this case, we determined that an atrial septostomy was not a viable option since both the femoral veins were already cannulated or had been surgically repaired. instead, we performed an emergency standard median sternotomy and inserted a vent catheter (malleable 20 fr.) with a tip-cut into the right upper pulmonary vein and passed it into the left ventricle. then, the inserted vent catheter was connected to the venous line of the p-ecls circuit via a y-shaped connector (fig., the pump flow was maintained at 2.4 l/min/m, obtaining a mean systemic pressure of 60 mmhg and central venous pressure of 8 mmhg. the flow through the vent catheter was measured to be 1 to 2 l/min. the patient was on p-ecls and left heart venting for 5 days. during this time, 3). transthoracic echocardiography revealed improved right and lv function and decreased chamber size. when the function of the right heart and the lung improved, the drainage from the femoral vein was gradually reduced by progressively clamping the venous line and lowering the r.p.m. in this way, the system was modified from p-ecls to paracorporeal lv assist device (lvad) by the complete clamping of the femoral venous drainage catheter. thus, the femoral venous cannula and the oxygenator were removed on postoperative day 5. the reasons for our decision were complete lv support, possible longer-term support due to the absence of the oxygenator and the low level of anticoagulation, and the prevention of recurrent lv distension. on postoperative day 8, we were able to wean the patient from lvad and remove all cannulas from her chest and groin. she was extubated and was finally discharged home on hospital day 28. during follow-up, the lv ejection fraction worsened from 40% to 20%, and the symptoms of dyspnea became worse than before hospital discharge. currently, this patient is on the heart transplant list and is waiting for transplantation. however, due to its inability to directly drain the left heart, its effectiveness in assisting the heart is limited. additionally, several factors including severely reduced lv function, blood from native pulmonary and bronchial circulation, and increased afterload due to retrograde perfusion from the arterial cannula may lead to lv distension. this resultant lv distension can cause pulmonary edema, pulmonary hemorrhage, and myocardial ischemia. although paracorporeal lvad placed through a median sternotomy provide better hemodynamic support without the risk of lv distension, complications of central cannulation such as bleeding and infection limit the widespread use of this technique. we report a case in which trans-sternal lv drainage was utilized while the patient was receiving p-ecls that was followed by a subsequent switch to paracorporeal lvad without further surgery. this strategy allowed the transformation of peripheral circulatory support into effective myocardial and systemic circulatory assistance and minimized the surgical risk. although p-ecls offers excellent support to the blood circulation, its effect on the heart is less favorable. the left atrium can receive blood from the right heart and bronchial circulation. in the case of severe lv dysfunction, the lv can not eject the received blood to overcome the increased afterload due to the retrograde p-ecls flow. the consequences of lv distension include pulmonary edema, pulmonary hemorrhage, right ventricular distension, and increased intraventricular pressure, which can lead to myocardial hypoperfusion and ischemia. the effect of p-ecls on lv distension was investigated previously by some authors. in an animal model of acute heart failure, kawashima et al. reported that the resolution of ventricular fibrillation was related to lv unloading and reduction in myocardial oxygen consumption. myocardial perfusion is proportional to the decrease in the lv wall tension and the compression of intra-myocardial coronary vessels. therefore, lv decompression favorably affects ventricular recovery and increases the possibility of weaning from p-ecls. for this reason, a careful evaluation of the status of the lv and prompt drainage in the case of a pressure increase there are several techniques to decompress the lv, including a percutaneous trans-septal left atrial approach, lv venting through the right upper pulmonary vein, and direct lv apex cannulation. although percutaneous lv venting does not require a surgical incision, the effectiveness of lv decompression can be limited according to the degree of mitral regurgitation. thus, surgical venting is a more favorable option than percutaneous septostomy. reported minimally invasive lv drainage in which an apical cannula is inserted into the lv apex transcutaneously. although direct drainage of the lv through a trans-sternal approach is technically more complex, it has the advantage of high efficacy with respect to the intraventricular dynamics. further, our group was more familiar with the trans-sternal approach at that time. management after an lv venting procedure is still controversial, particularly since there is uncertainty in terms of patient stability after weaning from p-ecls. there are three ways of weaning from venoarterial ecls, namely the one-stage removal of all ecls cannulae, vent catheter removal and subsequent venoarterial ecls weaning, and venous cannula removal and subsequent paracorporeal lvad weaning. in this case, we decided to shift to paracorporeal lvad from p-ecls by progressively clamping the venous line and lowering the flow to the oxygenator until complete exclusion from the circuit. this allows for a heparin- and oxygenator-free trial of extracorporeal circulation, which reduces the chances of bleeding or thromboembolism. the low risk of bleeding and thromboembolism allows longer-term support for heart transplant than venoarterial ecls. the other advantages of our strategy include prevention of recurrent lv distension and pulmonary edema. in summary, p-ecls offers excellent circulatory support in emergency settings and assures rapid and systemic perfusion. however, p-ecls can negatively affect lv physiology and can potentially jeopardize myocardial recovery. thus, a careful evaluation of the lv status and prompt drainage in the case of pressure increases should be considered. our strategy assures complete lv venting and allows for a simple conversion of p-ecls to paracorporeal lvad.

percutaneous extracorporeal life support (p-ecls) is a useful modality for the management of refractory cardiac or pulmonary failure. however, venoarterial p-ecls may result in a complication of left ventricular distension. in this case report, we discuss a patient with drug-induced dilated cardiomyopathy managed with venoarterial p-ecls and a left atrial vent catheter. the venoarterial p-ecls was modified to a paracorporeal left ventricular assist device (lvad) by removing the femoral venous cannula. after 28 days of hospitalization, the patient was successfully weaned from the paracorporeal lvad and discharged home from the hospital.

PMC4157508

pubmed-1134

adult-onset hearing loss is a highly prevalent yet relatively underrecognised health problem in the older adult australian population [1, 2]. because hearing loss is often progressive and gradual in its onset in most individuals, it is typically diagnosed and managed several years after its onset, often only after having led to multiple negative consequences including effects on employment, poor quality of life, social isolation, depressive symptoms, increased mortality risk, and reduced independence [39]. it is one of the leading causes of burden of disease prior to older age, for ages 4564 years, in men and women. further, as hearing loss interferes with so many of life's activities, it may prove to be a major impediment to society's need to have people remain longer in the workforce as the proportion of working age the annual cost of lost earnings due to workplace separation and early retirement from hearing loss was estimated at $6.7 billion, which is over half of the calculated economic impact of hearing loss ($ 11.75 billion, representing 1.4% of gdp). therefore there is a need to better understand the barriers that may exist to help seek an effective remediation for hearing loss in this population. hearing loss is a chronic problem and, contrary to current community perception and funding models of hearing services, hearing aids are typically a part of a rehabilitation program rather than provide a single and simple restorative solution to hearing loss. as such, hearing loss needs to be effectively managed under a biopsychosocial model of care, following the framework for intervention and treatment of the international classification of functioning disability, and health model. this framework not only considers the impairment per se, but also the impact that it has on the individual in terms of activity limitations (such as inability to perceive speech in noisy environments) and participation restrictions (such as the ability to fully participate in communication and conversational activities). nonetheless, hearing aid use is a measurable quantity and, therefore, the majority of studies that have evaluated functional and quality-of-life outcomes of rehabilitation programs for individuals with hearing loss have used this as a marker. multiple studies have identified that rehabilitation interventions can effectively address many of the difficulties associated with impaired hearing [1620]. importantly, evidence shows that the later hearing rehabilitation occurs in the course of hearing loss, the less likely older adults are to continue to use and derive benefit from hearing aids. despite this, several studies [22, 23] indicate high levels of unmet need for hearing health services and poor use of prescribed hearing aids. denial or nonacceptance of hearing loss and the stigma associated with hearing loss other reasons include an underestimation of the negative impacts of hearing impairment on overall health by general practitioners (gps) and older adults, leading to poor referral to appropriate medical and allied health practitioners, such as ear, nose, and throat specialists and audiologists. to date, the australian public health system does not have an effective and sustainable hearing loss screening strategy for late-onset hearing loss in adults to manage this problem. this paper aims to review the current pathway of detection, referral, and management of late-onset adult hearing loss in australia and to identify an alternative, more effective pathway for the future. australian population-based data describing prevalence, incidence, and risk factors for hearing loss have been identified in the blue mountains hearing study (bmhs) in 19972000 among 2956 participants of the blue mountains eye study (bmes) cohort (an overall response rate of 75.5% for the cross-section) [25, 26]. of these, hearing thresholds were measured in audiometric soundproof rooms by qualified audiologists and bilateral hearing loss was described by the pure-tone average of air-conduction thresholds at octave frequencies between 500 and 4000 hz (pta0.54 khz) in the better ear. risk factors measured (either via self-report or practitioner measurement) included self-reported health, noise exposure, and family history of hearing loss. in this study, we identified that a 33.0% prevalence of bilateral hearing loss existed in persons aged 50+years (51% showed hearing loss in the worse ear) consistent with that measured in the us-based epidemiology of hearing loss study (ehls). more specifically, mild hearing loss was present in 22.4% of participants, moderate in 8.9% and severe in 1.7% participants. for each decade beyond age 50, further, a history of having worked in a noisy environment predicted a 70% increased likelihood of any hearing loss, whereas family history predicted a 68% increased risk of hearing loss, which increased with greater magnitudes of loss. the overall 5-year progression of hearing loss, defined as a difference in pta>10 db, was moderately high at 15.7%, with the highest rate being evident in adults aged 80 years or older. additionally, for each decade of age over 60 years, the risk of incident hearing loss increased threefold. as well as health-related influences, our epidemiological study also assessed quality-of-life and mental health factors, such as cognitive function and depression. bmhs-i data showed that bilateral hearing loss was associated with poorer sf-36 scores in both physical and mental domains (decrease in physical component score (pcs) of 1.4 points, p=0.025; decrease in mental component score (mcs) of 1.0 point, p=0.13); with poorer scores associated with more severe levels of impairment (pcs ptrend=0.04, mcs ptrend=0.003). persons with moderate-to-severe hearing loss had slightly lower mean cognitive function scores than those without hearing loss (p<0.001). therefore, while milder levels of hearing losses were significantly more common in working-aged older adults, a lack of responsiveness to manage this early can lead to significant negative effects on quality of life, personal relationships, and ability to continue to work effectively. as the risk of hearing loss increases with advancing age, it seems that early detection and management would be critical to minimising any longer-term effects. stephens et al. suggest that the average consumer presenting at a hearing aid or rehabilitation clinic for the first time is aged ~70 years and has had hearing problems for about 10 years. as hearing loss significantly impacts on communication ability and communication is necessary for developing and maintaining effective relationships, it is likely that within this prolonged timeframe the individual and his/her family have experienced considerable frustration from the disability. the us national council on aging survey of 2069 hearing-impaired individuals and 1710 of family and friends demonstrated that hearing aid use is associated with lesser degrees of anger and frustration reported by family members. further, stark and hickson demonstrated benefits in hearing-related quality-of-life scales for both the individual with hearing loss and their significant other after hearing aid fitting, despite only 1/3 of the individuals with hearing loss showing initial motivation to attend the hearing appointment. certainly, we found that bmhs participants who used their hearing aid at least 1 hour/day or more were only one-third as likely to report depressive symptoms as infrequent users, multivariate adjusted or 0.32 (95% ci 0.140.76). despite this, bmhs findings showed that of 33.0% persons with measured bilateral hearing loss, only 33% owned hearing aids and, of these, only 25% used them habitually, similar to the rates of use reported in the ehls study. when stratified into magnitudes of hearing loss, bmhs data showed that hearing aids were owned by only 16.4% of individuals with a mild loss, compared with 55.8% with a moderate loss and 91.3% with a severe-profound loss (figure 1), suggesting that either there is a critical unmet need for hearing services in individuals with mild-moderate levels of hearing loss or that hearing aids are not needed for all individuals with lower magnitudes of loss or that the technology is too difficult to manage in this population. nonetheless, bmhs data showed that 33.4% of older adults with average hearing levels greater than 40 dbhl in the better ear did not own a hearing aid. while milder forms of hearing loss may be less correlated with hearing disability, dillon showed that more significant losses do show higher levels of benefit. further, bmhs data demonstrate that 53.5% of older adults with severe losses wear their hearing aids for over 8 hours per day compared to 24% of those with moderate losses and 13.5% with mild losses, suggesting an increased need for amplification for greater magnitudes of loss (figure 2). low rates for use of hearing services and hearing aids highlight barriers including cost and/or reluctance by many to accept their hearing loss (or those without self-perceived hearing disability). however, similar low rates of hearing service uptake and device use have been observed in the australian federal government office of hearing services program, where hearing services are largely provided free of charge to eligible older adults. therefore, we assume that under use of fitted aids by older adults in australia may suggest either poor targeting of individuals with hearing loss or fitting at too late a stage for derived benefit. substantial delays in accessing hearing services may impact effective hearing aid use because advancing age is associated with poorer auditory and cognitive processing, physical dexterity, and learning abilities making it more challenging to perceive sounds in competing noise environments, position a hearing aid in the ear, and to learn how to use new technology [3841]. additionally, there is an increased likelihood of other health problems coexisting so that the management of hearing loss may be considered less of a priority and prove to be burdensome. as the consequences of the hearing loss are more significant, this may lead to poorer motivation to manage the impairment and/or its impacts. there remains a large proportion of hearing-impaired adults who would benefit from hearing aids but who decide not to seek help. further, while bmhs showed that approximately one-third of people aged 50 years with measured bilateral hearing loss reported seeking help from their general practitioner (gp), a random cross-sectional survey of gp activity in australia between 2003 and 2008 identified that only approximately 3/1000 consultations for older adults included hearing loss management. similar studies of gps undertaken in uk identified that the chance of referral to hearing services for older adults who reported hearing loss was only about 50%. screening and intervention programmes have been recommended to improve this situation [21, 43]. screening programs are not systematically implemented throughout the australian population, their success at meeting the needs of the target population is not assured, and they have no automatic link to action if the need for action is detected. audiograms conducted by trained audiologists in soundproof booths, are currently used to diagnose hearing impairment and largely determine whether or not an individual is offered hearing rehabilitation. audiometry is expensive and may not necessarily be accessible to those needing it. particularly for late-onset hearing loss, it provides little information about effects of hearing loss on everyday functioning [45, 46]. it is important to note that while hearing impairment is extremely common in older adults, not all are significantly disturbed by this. the bmhs findings collectively show that severe hearing disability is strongly associated with measured hearing loss, poorer qol, and probable depression. this suggests that identifying hearing-related activity limitations and participation restrictions could potentially be effective in identifying persons more likely to have suffered an important impact from their hearing impairment and, thus, would be most likely to benefit most from using hearing aids. self-perception of a hearing disability (e.g., increasing social isolation) can often be an important reason to seek aural rehabilitation. in fact, dillon showed that the benefits reported by individuals with hearing aids appear to be only weakly correlated with hearing loss, particularly for mild-moderate losses. this may in part explain why at least 20% of individuals fitted with hearing aids do not wear them. on the other hand, benefits are actually more highly correlated with initial motivation and perceived listening difficulty [10, 47, 48]. thus, greater engagement by gps in hearing health could potentially be a cost-saving strategy, as gps are ideally placed to better motivate and identify older people with hearing loss disability, that is, those likely to benefit the most from a hearing aid, thereby improving the targeting of hearing-impaired patients for rehabilitation. there exists a need for a readily accessible screening test assessing hearing disability which could more accurately identify rehabilitation need, rather than just measurement of hearing loss. validated, self-administered questionnaires about hearing disability have been shown to detect functional hearing impairment accurately and, so, have been recommended as potential screening tools [4952]. in particular, it has been suggested that primary care services could cost-effectively be used to identify hearing disability using targeted questions, possibly alongside other screening interventions [21, 43]. previous work through uk gp-based case finding, which targeted people in the 5065-year age group, showed that effective hearing aid use can be at least tripled [30, 54]. one study assessed the patient's take-up of hearing disability screening and the subsequent take-up of hearing aids as an intervention for hearing disability. substantial benefits were reported in hearing aid benefit outcome inventories and moderate benefits in health utilities index and quality-of-life scores from amplification for this target group. another uk study of 604 gp patients, aged 5065 years, showed that the first posting of hearing disability questionnaires detected 78% of those prepared to accept hearing aids for the first time. the possession of hearing aids rose from 7% (at baseline) to 24% (after intervention), and 6 months later the hearing aids were being used regularly. the authors concluded that simple questionnaires are effective in detecting hearing disability in older adults and that this intervention was acceptable by many of those reporting significant hearing difficulties. given the pivotal role of the gp in the early identification and management of chronic health problems, at least in australia, the implementation of a gp-based hearing screening program for adults>50 years of age would be beneficial in addressing this problem. further, with the inadequacies of the medical model in the treatment of chronic health conditions and the move towards a model of patient-centred care, gps are effectively placed to assist with the minimisation of the stigma associated with hearing loss and enhancing patient self-motivation to manage this. current research identifies a critical role for gps in both detection and appropriate referral of many other disorders/diseases such as obesity [5658]. however, several such studies identified that the knowledge and attitudes of gps can be a major barrier to effective intervention within this process. hence, underlying reasons for low rates of gp involvement in hearing health could include lack of awareness/understanding of (a) simple tools to identify hearing loss and associated disability; (b) risk factors for age-related hearing loss and ways to use this information to identify at-risk patients; (c) adverse impacts caused by hearing loss on the mental and physical well-being of older adults (i.e., disability); and (d) the benefits of aural rehabilitation. given the increasing prevalence and disease burden of undetected hearing loss in older adults and the availability of effective interventions (e.g., hearing aids and/or assisted listening devices), there are 3 potential critical roles for the gp in hearing health: (1) early identification of patients with age-related hearing loss, as well as recognition of whether any negative consequences/disability has resulted; (2) assistance in reducing the stigma of hearing loss and motivating patients to seek further help; and (3) appropriate referral of these patients to hearing health providers. this could be achieved by sensitising gps to recognise at-risk individuals and providing targeted questions to identify hearing loss disability. we have identified an important role of gps in the process of targeting individuals with late-onset hearing loss and referral; however, the challenge that remains is how to effectively increase gps knowledge and practice behaviour in this area. possibly the most obvious method is through development of a continuing medical education (cme) program that targets the impacts of hearing loss and remediation and provides a reliable method of hearing screening in adults. the evidence for good outcomes of cmes measured by factors including increased knowledge and skills as well as altered attitudes and practice behaviours is varied and possibly depends partly on the learners and learning context. a review of the literature has identified that while the quality of evidence is not high, generally cme provides a strategy that increases knowledge and may elicit a change in practice behaviour. however, in a meta-analysis of the cme literature, forsetlund and colleagues report that education meetings are likely to only have a moderate effect on professional practice and a smaller improvement on patient outcomes. despite this, cook et al. demonstrated that while internet-based programs have a significant effect on knowledge and behaviour compared with no-intervention, there is limited evidence to suggest that it is superior to other methods of delivery of learning materials. therefore it is possible that both educational meetings and internet-based programs will have only a moderate impact in enhancing referrals to hearing healthcare providers. an alternative method of screening of hearing loss and disability which does not require gp involvement is telephone and/or internet screening using digits in noise [6264], which provides a quick, effective, and relatively inexpensive technique to detect hearing loss in adults [62, 63]. in addition, this presumably has a broader reach than gp screening because of the program's accessibility to individuals in rural and remote areas where worldwide shortages of healthcare professionals and services exist. further, it provides information about the individual's hearing to the significant proportion of individuals who were not intending to see a gp or hearing healthcare provider (as shown in). smits and colleagues [62, 64] developed the first telephone screening test which was introduced into the netherlands in 2003 as the national hearing test. the screening test used 23 monosyllabic digit triplets presented by a female speaker, adaptively varying in level by 4 db (to determine audibility) and then 2 db (to seek threshold) and embedded in a 73 dba speech noise, shaped to match the long-term average speech spectrum. they estimated the average signal-to-noise ratio (snr) for speech reception threshold (srt; 50% correctly identified) and characterised normal hearing using a criterion of 4.1 db snr, insufficient hearing between 4.1 and 1.4 db snr, and poor hearing>1.4 db snr. in 38 participants with varying levels of hearing, this screening test showed excellent test-retest reliability (< 1 db error), sensitivity (0.91), and specificity (0.93) when compared to an equivalent speech-in-noise test conducted under headphones and took approximately 3 minutes to complete. a similar telephone screening test telscreen using digit triplets embedded in spectrally shaped noise was developed and implemented in australia in 2007. the noise was amplitude modulated by a 20 hz sinusoid and had gaps in the frequency spectrum to increase the sensitivity of this test to identify sensorineural hearing losses (described in). significant correlations were found between telscreen and the individual's four-frequency pure-tone average (r=0.77, p<0.001) and telscreen and the presence of subjectively rated disability (r=0.65, p<0.001). smits and colleagues demonstrated that over 50% of those referred to medical or other professional hearing healthcare in the netherlands were compliant in following this advice. on the other hand, meyer and colleagues showed that only 36% of the 193 individuals who failed the telscreen in australia went on to receive medical or other professional support. it is not clear whether such differences in health-seeking behaviour are explained by cultural, social, or economic factors. another hearing screening program is the use of an automated face-to-face monosyllabic speech-in-noise test which aims to evaluate hearing disability in adults. the speech understanding in noise (sun) test was developed by paglialonga and colleagues [66, 67] and has been evaluated in multiple nonclinical sites with varying levels of ambient noise showing good sensitivity up to 65 dba. the sun test presents monosyllabic vowel-consonant-vowel sounds in a 3-alternative forced-choice paradigm. the response is provided through a touch screen, thereby avoiding tester scoring errors, and takes approximately 2 minutes to evaluate both ears. good associations were found between pure-tone audiometry and referral on the sun test which indicates the benefit of this test as a screening test for adult hearing loss. given the ageing demographic and increasing average life span in western countries, chronic hearing loss is projected to increase. a renewed focus on targeting the provision of hearing rehabilitation to people with self-perceived hearing disability, rather than those with only measured hearing loss, may lead to better long-term retention and use of aids. therefore, over time the costs saved by provision of an effective and better-targeted health intervention enabling improved daily functioning among older adults will no doubt demonstrate this strategy and will provide

adult-onset hearing loss is insidious and typically diagnosed and managed several years after onset. often, this is after the loss having led to multiple negative consequences including effects on employment, depressive symptoms, and increased risk of mortality. in contrast, the use of hearing aids is associated with reduced depression, longer life expectancy, and retention in the workplace. despite this, several studies indicate high levels of unmet need for hearing health services in older adults and poor use of prescribed hearing aids, often leading to their abandonment. in australia, the largest component of financial cost of hearing loss (excluding the loss of well-being) is due to lost workplace productivity. nonetheless, the australian public health system does not have an effective and sustainable hearing screening strategy to tackle the problem of poor detection of adult-onset hearing loss. given the increasing prevalence and disease burden of hearing impairment in adults, two key areas are not adequately met in the australian healthcare system: (1) early identification of persons with chronic hearing impairment; (2) appropriate and targeted referral of these patients to hearing health service providers. this paper reviews the current literature, including population-based data from the blue mountains hearing study, and suggests different models for early detection of adult-onset hearing loss.

PMC3655600

pubmed-1135

in some clinical situations, such as root canal overinstrumentation, apical resorption and teeth with open apices, there may be extrusion of the filling material, either gutta-percha, root canal sealer or both, due to the difficulty or impossibility to lock the master gutta-percha cone. in these situations, fabrication of an apical plug with calcium hydroxide and, more recently, with mineral trioxide aggregate (mta) has been suggested2,4,13,21,25,26. mta was introduced in the early 1990 's as an experimental material developed by dr. mahmoud torabinejad at loma linda university, usa. this material was originally indicated as a retrograde filling material for use in endodontic surgery and cases of intraradicular and furcal perforations18. since then, it has been used in different clinical situations, such as communicating internal and external resorptions, as capping material in mechanically exposed pulps, as intracoronal barrier during internal bleaching of endodontically treated teeth, and as apical plug in case of difficulty to lock the master gutta-percha cone4. these indications of mta are related to the possibility of use in moist environments, as in most aforementioned indications, and mainly to its biocompatibility4,26. the sealing ability of mta apical plug and its thickness have been investigated by several authors2,13,16,17,20,21,26. four-millimeter-thick plugs have been shown to be the most efficient with respect to root canal sealing ability and resistance to displacement13,20,21,26. all of these studies have sought an alternative to mta apical plug as well as its most appropriate thickness. wucherpfennig and green27 (1999) have called the attention to the fact that mta and portland cement were similar materials. other studies were conducted and confirmed this similarity by means of microbiological, chemical, physical and biological behavior tests1,5,8,10,11,15,23. the purpose of this study was to evaluate the sealing ability of apical plugs made of white and gray mta-angelus (angelus solues em odontologia, londrina, pr, brazil) and white portland cement (votorantim cimentos, votorantim, so paulo, sp, brazil) placed via the root canal and having different thicknesses (2, 5 and 7 mm). this study was approved by the institutional review board of the dental school of bauru, university of so paulo, brazil. ninety extracted human single-rooted teeth with intact roots and completely formed apices were used. the teeth were obtained from the files of the department of endodontics of the dental school of bauru and were kept in 10% aqueous formalin solution. the dental crowns were sectioned at the cementoenamel junction with a low-speed diamond saw (kg sorensen, so paulo, sp, brazil) under continuous water spray to obtain access to the root canal. the root canal length was determined by inserting a size 15 k-file (dentsply-maillefer instruments sa, ballaigues, switzerland) into the canal until its tip reached the apical foramen. the working length was established by subtracting 1 mm from this measurement. the stepback technique was employed and the root canal was flared using a size 60 k-file to the working length. instrumentation was aided by irrigation with 1 ml of 1% sodium hypochlorite solution (biodinmica qumica e farmacutica ltda, ibipor, pr, brazil) alternated with the sequence of instruments, followed by a final flushing with 1 ml of sterile water. the teeth were assigned to 3 groups (n=30), according to the material used for fabrication of the apical plugs: group a=placement of gray mta-angelus plugs; group b=placement of white mta-angelus plugs; group c=placement of white portland cement plugs. the groups were further subdivided into groups of 10 teeth each, according to the thickness of the apical plugs, namely 2, 5 and 7 mm (table 1). before standardization of the foraminal opening, the roots were made impermeable by application of a layer of epoxy adhesive (araldite-ciba-geigy s.a., taboo da serra, sp, brazil), followed by two coats of nail polish (cosbra cosmeticos ltda., so paulo, sp, brazil). the foramen diameter was standardized by inserting the 40 k-file 1 mm beyond the apical foramen, so that only the apical opening would not be impermeable. for fabrication of the apical plugs, the tested materials were applied with a size 4 lentulo spiral (dentsply-maillefer instruments sa, ballaigues, switzerland) at the apical end of the root, trying to fill it completely. the material was condensed with the tip of a size 40 k-file involved in cotton for achievement of the plug19. next, using a size 40 k-file with a rubber stop positioned 2, 5 and 7 mm shorter than the root canal length, the excess material was removed for fabrication of 2-, 5- and 7-mm-thick apical plugs, respectively. finally, the root canal walls were cleaned with the tip of an instrument wrapped in moist cotton. then, the canal entrances were sealed with epoxy adhesive and nail polish, and the roots were immersed in 0.2% rhodamine b solution (labsynth produtos para laboratrios ltda, diadema, sp, brazil) at ph 7.0 for 72 hours at 37c. after this period, the roots were removed from the dye, washed in running water for 24 hours, had the impermeable coating scraped away and were washed for additional 12 hours. the roots were then sectioned longitudinally in a buccolingual direction for exposure of the apical plugs, photographed with a digital camera (canon eos rebel 300 d) and analyzed by image tool software (university of texas health science center, san antonio, tx, usa). table 2 shows the percent marginal leakage for the different materials for each plug thickness. tables 3, 4 and 5 show the results of the kruskal-wallis statistical test for comparison among groups a (mta-angelus gray), b (mta-angelus white) and c (white portland cement) with respect to the plug thicknesses (2, 5 and 7 mm). a statistically significant difference (p<0.05) was observed between groups a and b as to the leakage in 2- mm-thick plugs, with better results for group a (table 3). materials did not show statistically significant difference (p>0.05) when groups with 5-mm-thick plugs were compared to each other (table 4). regarding the 7-mm-thick plugs, there was statistically significant difference (p<0.05) between groups a and b and between groups b and c, with worst results for group b in both comparisons (table 5). in figure 1 shows the graphic presentation of percent marginal leakage (0.2% rhodamine b) in the root canals, regarding the tested materials and plug thicknesses. it is possible to verify that 2-mm-thick plugs yielded the least satisfactory results in all groups, whereas the 7-mm-thick plugs yielded the best results for groups a and c, yet not for group b, in which the 5-mm-plugs had the best results as to dye leakage. this study investigated the sealing ability of gray mta, white mta and white portland cement used for fabrication of apical plugs, given that this procedure is often required in the clinical practice12,14,19, mainly in cases where appropriate adaptation of the master gutta-percha cone is difficult. torabinejad and chivian25 (1999) pointed out that the goal of an apical plug is to induce hard tissue formation, in order to prevent filling material extrusion in teeth with open apices. the use of methylene blue in marginal sealing studies has been questioned, due to its incompatibility with alkaline substances, which may induce discoloration of the dye. when calcium oxide is mixed with water, it results in the formation of calcium hydroxide, with a subsequent increase in ph, as previously demonstrated by duarte, et al.9 (2003). therefore, rhodamine b dye solution is more appropriate for evaluating the sealing ability of mta22,24. in the present study, 5- and 7-mm-thick plugs were more efficient for apical sealing than 2-mm-thick plugs, regardless of the material utilized (table 1 and figure 1), which is in agreement with the findings of previous2,13,21,26. in group b (white mta), the 5-mm-thick plugs had better performance than the 2- and 7-mm-thick plugs, yet without statistically significant difference. with regard to tested materials, no statistical difference was expected among them because the chemical components of mta and portland cement are the same, except for bismuth oxide, which provides radiopacity to mta8,10,11. camilleri, et al.7 (2005) evaluated the chemical constitution and biocompatibility of white and gray portland cement, white and gray mta, portland cement clinker without calcium sulfate and portland cement clinker without calcium sulfate with addition of bismuth oxide. they concluded that the chemical composition of the tested materials is similar, primarily containing tricalcium silicate and dicalcium silicate. the white cements differ from the gray cements by the small quantity of iron oxide (feo), while mta differs from portland cement due to the presence of bismuth oxide. there was no difference between white and gray mta, and the addition of bismuth oxide did not interfere with the biocompatibility of cements. in the present study, white mta showed poorer results than gray mta and white portland cement for all tested plug thicknesses (table 1). asgary, et al.3 (2005) observed significant differences between gray and white mta, especially in the contents of aluminum trioxide (al2o3), magnesium oxide (mgo) and iron oxide (feo). however, these differences are not enough to explain the results of the present study, in which gray mta showed better results than white mta as to dye leakage. matt, et al.21 (2004) observed similar results in their study, where apical plugs made with gray mta were more efficient than those made with white mta. as to the fabrication of apical plugs, torabinejad and chivian25 (1999) recommended carrying the mta with a large amalgam carrier to the root canal and then condensing the material to the apical end of the root with pluggers or paper points. sometimes, this procedure is difficult due to the root canal diameter and anatomy. in the present study, mta and portland cement were carried to the root canal with a size 4 lentulo spiral, according to the technique proposed by bramante, et al.6 (2004). the lentulo spiral is used to carry the mta in paste consistence more easily to the root canal end in a fast and correct manner. another important factor is material condensation at the end of the root canal because the apical plug should resist the filling material. this condensation is more effective when performed with a k-file compatible with the root canal diameter and with the tip wrapped in a cotton mesh. cleaning of the root canal walls and removal of excess material must be performed with the same k-file wrapped in moist cotton in sterile saline, not to interfere with the proper root canal filling. the findings of the present study showed that gray mta and portland cement had better sealing ability than white mta when used as apical plugs. dye leakage was smaller for 5- and 7-mm-thick plugs compared to 2-mm-thick plugs.

this study evaluated the sealing ability of apical plugs made of white and gray mta-angelus and white portland cement placed via the root canal and having different thicknesses (2, 5 and 7 mm). ninety extracted human single-rooted teeth were instrumented using a size 40 k-file to standardize the foraminal opening by the stepback technique. the teeth were assigned to 3 groups (n=30), according to the material used for fabrication of the apical plugs: a=gray mta; b=white mta; c=white portland cement. the groups were subdivided into groups of 10 teeth each according to the apical plug thickness (2, 5 and 7 mm). marginal apical dye leakage was assessed using 0.2% rhodamine b solution in which the specimens were immersed for 72 hours at 37c. the roots were sectioned longitudinally in a buccolingual direction for apical plug exposure, and digital photographs were taken and analyzed by image tool image-analysis software. data were analyzed statistically by kruskal-wallis and dunn's tests. significance level was set at 5%. the least percent leakage was observed for 5- and 7-mm-thick plugs (p<0.05). no significant difference (p>0.05) was found between gray mta and white portland cement. among the three materials analyzed, white mta presented the highest marginal leakage (p<0.05). the findings of the present study showed that gray mta and portland cement had better sealing ability than white mta when used as apical plugs. dye leakage was smaller for 5- and 7-mm-thick plugs compared to 2-mm-thick plugs.

PMC4327464

pubmed-1136

our patient, a 60-year-old woman, originally presented to her primary care physician for pelvic discomfort in september 2006. at that time, she underwent a pelvic ultrasound as well as a computed tomography (ct) scan of the abdomen and pelvis, which showed a complex ovarian mass. a pap smear performed one month later was positive for atypical glandular cells suspicious for adenocarcinoma. in november 2006, she underwent a total abdominal hysterectomy with bilateral salpingoophorectomy, omentectomy, and periaortic lymphadenectomy. upon intraoperative exam, her surgeons noted involvement of the omentum and appendix, as well as studding of the small bowel mesentery and right diaphragm. the pathologic specimen showed extension of the tumor throughout the fallopian tubes, appendix, omentum, and 5 out of 5 positive lymph nodes. the patient underwent placement of an intraperitoneal catheter and an intravenous port-a-cath for initiation of chemotherapy in december 2006. the remainder of the patient's past medical history is noncontributory as she was previously in excellent health prior to the diagnosis of ovarian cancer. unfortunately, she suffered a hypersensitivity reaction to the taxol, and was therefore switched to carboplatin and abraxane. she received a total of 8 cycles of that combination, with only 1 cycle postponed secondary to neutropenia. just before the 8th cycle, in order to assess her response to treatment, she underwent a ct scan of the chest, abdomen, and pelvis. in addition, her ca-125 level, which had previously reached a plateau of 30 u/ml, had risen to 123 u/ml. concerned about the possibility of drug-resistant disease, she was evaluated for enrollment in a trial of avastin and tarceva. she underwent a new ct scan of the chest, abdomen, and pelvis, in order to obtain baseline data for the trial (3 months after her previous ct scan). the new ct scan showed interval development of right axillary lymphadenopathy; the largest lymph node was 1.1 x 1.8 cm and suspicion of a new primary breast cancer was raised. we proceeded with breast magnetic resonance imaging (mri) with gadolinium which showed no suspicious lesions or masses. however, she developed a significant rash in association with these drugs and required dose reduction. in october 2007, almost a year after her initial ovarian cancer diagnosis, the patient reported the new-onset of right breast edema. although she had been previously followed for the right axillary lymphadenopathy, she had recently noticed an increase in erythema, thickness, and warmth of the skin of her right breast [fig 1, 2]. she was treated with a 10-day course of antibiotics, with no change in symptoms. she then underwent an ultrasound of her breast that showed an ill-defined hypoechoic area in the right upper outer quadrant with multiple enlarged lymph nodes. a subsequent mammogram showed scattered fibroglandular densities and an area of architectural distortion with a few small punctate calcifications. her gynecologic oncologist performed a fine-needle aspiration of the breast, which showed cells consistent with adenocarcinoma. she then underwent a second bilateral breast mri, which confirmed the presence of an area of heterogeneous enhancement measuring 8 x 4 cm, highly suggestive of cancer, with areas suspicious for tumoral extension to the chest wall [fig 3, 4]. because of these findings, the patient was referred to a breast surgical oncologist, who performed a punch biopsy of her right breast. pathologic analysis showed multiple foci of high-grade adenocarcinoma with dermal lymphatic invasion, with morphology similar to that of the previous ovarian cancer [fig 5]. furthermore, the breast tissue specimen immunohistochemistry results were positive for ca-125, but negative for estrogen receptor (er), progestin receptor (pr), and the her-2/neu oncoprotein. upon review by our institution's multidisciplinary tumor board, it was concluded that these results were consistent with an ovarian primary tumor. breast cancer is one of the most common primary malignancies in women, yet metastatic tumors to the breast are infrequent, accounting for only 0.5% to 1.3% of breast cancer cases 1. the most common source of metastasis to the breast is a contralateral primary breast tumor, frequently from transthoracic or lymphatic spread. a study by hadju and urban involving 4,051 breast cancer patients found an overall incidence of primary gynecologic cancers metastatic to the breast of 0.17%, with only 0.07% of metastatic disease originating from a primary ovarian tumor 3. the first case report of ovarian cancer with metastasis to the breast was in 1907 by sitzenfrey 4. to date, a total of only 39 such cases have been reported in the english-language literature 5. ovarian metastasis to the breast mimicking primary inflammatory breast carcinoma is even more infrequent, with only 6 previous cases reported [table 1]. inflammatory metastasis to a single breast was first reported by ibach in 1964 6, followed by 5 other case reports 2, 4, 7, 8, 9. of note, the most recent patients, including ours, all had a diagnosis of stage iiic papillary serous adenocarcinoma. in contrast to primary breast tumors, metastasis to the breast generally consists of firm, well-circumscribed, multinodular masses. in addition, the masses are usually superficial and less fixed to surrounding tissues, with the overlying skin generally of normal consistency. the most common form of clinical presentation (in 85% of patients) was a solitary tumor; only 4% of patients had diffuse involvement 4. furthermore, the most common location was the upper outer quadrant in 62% of patients 3. metastatic tumors to the breast more frequently present as well-circumscribed, non-calcified dense masses. they generally lack spiculation and microcalcifications as well as architectural distortion and other skin changes. however, because of the presence of psammoma bodies associated with some ovarian cancers, microcalcifications can be seen with ovarian metastasis 3, 10. breast metastasis from a primary ovarian tumor, however, commonly lacks a characteristic pattern, may be morphologically indistinguishable from its primary, and is associated with widespread dissemination. in addition, breast metastasis from a primary ovarian tumor generally is diagnosed an average of 2 years after the initial diagnosis of ovarian cancer 2. our patient developed a markedly diffuse inflammatory process of her right breast with features consistent with inflammatory breast cancer within 1 year after her initial diagnosis. histopathological analysis of breast and ovarian tumors can yield similar results. therefore, accurate differentiation is necessary, because treatment and prognosis differ significantly. the most common histologic variant of ovarian cancer associated with metastatic disease to the breast is papillary serous adenocarcinoma 3. immunohistochemistry may provide additional insight into the origin of the tumor. by combining the tumor markers oc125 and ov632, yamaski et al. found a sensitivity of 86% and a specificity of 89% for the diagnosis of metastatic ovarian cancer 10. secondary breast involvement from an ovarian tumor suggests widespread dissemination and is associated with a poor prognosis. according to several studies, after the detection of metastatic breast disease secondary to an ovarian primary tumor, survival times ranged from 13 days to 3.5 years 2, with most patients dying within 1 year 11. another study found a 1-year survival rate of 40% for patients with ovarian cancer who also had breast metastasis, as opposed to a 4-year survival rate of 75% for patients with primary breast cancer 12. inflammatory metastatic disease to the breast also confers a grave prognosis: patient survival ranges from 3 to 18 months (median, 6 months) after diagnosis of the metastasis to the breast [table 1]. extramammary tumors should be distinguished from primary breast tumors to avoid any unnecessary surgical procedures. correct diagnosis is vital: surgical interventions for patients with secondary breast cancers are potentially both diagnostic and palliative. ovarian metastasis to the breast should be treated as a systemic disease, with appropriate chemotherapeutic agents. mastectomy of the breast mass is likely best reserved for patients who are unresponsive to systemic therapy and require palliation 11. although ovarian metastasis to the breast presenting as inflammatory breast cancer is rare, it should be included in the differential diagnosis for any patient with a personal history of ovarian cancer. accurate differentiation is necessary because treatment differs significantly for patients with ovarian metastasis to the breast, as compared with patients with primary inflammatory breast cancer. ovarian metastasis to the breast confers a poor prognosis: patient survival ranged from 3 to 18 months, with a median survival of 6 months after the diagnosis of the breast metastasis.

background. primary ovarian carcinoma with metastasis to the breast is rare, with only 39 cases reported in the current literature. ovarian metastasis to the breast presenting as inflammatory breast carcinoma is even more infrequent, with only 6 cases reported. case. we present a patient who developed metastatic inflammatory cancer of the breast from a stage iiic papillary serous ovarian adenocarcinoma approximately 1 year after the original diagnosis. pathologic analysis confirmed the origin of the tumor: a high-grade adenocarcinoma morphologically similar to the previously diagnosed ovarian cancer. in addition, the tumor was strongly positive on immunohistochemistry for ca-125, identical to the ovarian primary. the patient died of diffuse metastasis 5 months after the breast tumor was noted. conclusion. although ovarian metastasis to the breast presenting as inflammatory breast cancer is rare, it should be included in the differential diagnosis for any patient with a personal history of ovarian cancer. accurate differentiation is necessary because treatment differs significantly for patients with ovarian metastasis to the breast, as compared with patients with primary inflammatory breast cancer. ovarian metastasis to the breast confers a poor prognosis: patient survival ranged from 3 to 18 months, with a median survival of 6 months after the diagnosis of the breast metastasis.

PMC2931350

pubmed-1137

despite efforts to combat human immunodeficiency virus type 1 (hiv-1) infection through the use of highly effective combination therapies, hiv-1 has continued to spread. by 2009, the number of individuals living with hiv-1 reached a staggering 33.3 million people worldwide. since the beginning of the epidemic almost 30 years ago, the proportion of hiv-1-infected women in this population has risen steadily, stabilizing recently at approximately 52%. women in sub-saharan africa are at particular risk, as evidenced by the greater prevalence of women (approximately 60%) in the hiv-1-infected population and the predominant transmission of hiv-1 through unprotected heterosexual intercourse. this route of transmission continues to prevail because effective methods of prevention, such as the male condom, are inconsistently used due to various social, cultural, economic, and religious issues. to address the critical need for an effective and acceptable means to check the spread of hiv-1, numerous investigators around the world are working toward the development of microbicides, which are formulated chemical entities that can be applied vaginally or rectally to prevent or eliminate hiv-1 transmission [25]. the ideal microbicide would be highly active against hiv-1 but may also have activity against other sexually transmitted disease pathogens. for optimal acceptability, a formulated microbicide should be colorless, tasteless, and odorless to allow for discretion in its use and should also be inexpensive and easy to apply [3, 6]. importantly, a topical formulation containing an active pharmaceutical ingredient (api) must be safe for topical vaginal and/or rectal use, causing no adverse changes in epithelial barrier functions and no local inflammation that might increase susceptibility to hiv-1 infection. although a microbicide is not yet available for worldwide use, the reverse transcriptase inhibitor tenofovir was recently shown to be a safe, effective microbicide api in women at risk for hiv-1 infection. our efforts have been directed toward the development of biguanide-based compounds for use in microbicides effective against hiv-1. polybiguanides (pbgs) are polycationic in nature and are made up of repeating biguanide units that are separated by hydrocarbon linkers of varying lengths. pbgs have been used safely for more than 30 years for vaginal disinfection (chlorhexidine digluconate), antimalarial therapy (proguanil), and treatment of type 2 diabetes (metformin). they are also used as the active ingredient in contact lens disinfectants, mouth rinses, and wound disinfectants [816]. our studies of pbg compounds as microbicide apis have encompassed activity, safety, and mechanism of action. early experiments with a small number of pbgs indicated that polyethylene hexamethylene biguanide (pehmb) was an effective hiv-1 inhibitor characterized by minimal in vitro cytotoxicity. expanded studies of structure-activity relationships among different pbg compounds demonstrated clear relationships between molecule structure and biological activity. furthermore, the results of these studies suggested that pehmb acted against x4 and r5 strains of hiv-1 as a viral entry inhibitor by interacting with the host cell rather than the virus. in a series of experiments focused on confirming this mechanism of action against hiv-1, pehmb (later designated nb325) was shown to inhibit hiv-1 infection by interacting specifically with the second extracellular loop of cxcr4, which serves as the hiv-1 coreceptor. additional investigations demonstrated that this interaction and the inhibitory effect on hiv-1 infection were persistent, providing protection from infection even after removal of the compound from the culture medium. the low in vitro cytotoxicity of pehmb (nb325) suggested that this compound would also be characterized as safe in a swiss webster mouse model used to assess cervicovaginal toxicity associated with compound exposure. previous studies using this murine model of microbicide toxicity (i) confirmed the cervicovaginal toxicity and inflammation associated with topical application of nonoxynol-9 (n-9) in women and (ii) corroborated differences in acceptability between two different formulations of the microbicide api c31 g. in previous mouse model experiments relevant to the present studies, in vivo exposure to unformulated 1% pehmb resulted in minimal epithelial damage and negligible local inflammation these results were consistent with those from in vitro studies of compound cytotoxicity, which demonstrated that pehmb was more than 350-fold less cytotoxic than n-9 [8, 20]. the objectives of the present study were to assess the safety of nb325 formulated at two concentrations (0.5% and 1%) and to investigate time-dependent effects of application on cervicovaginal integrity. experiments were focused on the acute time points of 10 min, 2 h, and 4 h postapplication, because these exposure durations were previously shown to provide important information for gauging acute epithelial toxicity following n-9 or c31 g exposure [2023]. the extended time points of 8 h and 24 h were also included to provide a full range of observations over a 24 h period. histological analyses of exposed tissues indicated little to no toxicity after exposure to 0.5% nb325 and minimal toxicity after exposure to 1% nb325 for both unformulated and formulated compound. interestingly, changes in epithelial integrity that were observed following exposure to nb325 were noted in the vagina rather than in the cervix, where n-9 toxicity was readily apparent in previous studies. these studies provide further evidence of the topical safety of biguanide-based compounds as microbicide apis. nb325 was synthesized as previously described for polyhexamethylene biguanide and pehmb [8, 18, 24]. the molecular mass of nb325 ranged from 900 to 1,900 da with a median molecular mass of approximately 1,400 da. gel formulation of nb325 was performed by the international partnership for microbicides using a hydroxyethyl cellulose (hec) based gel, otherwise known as the universal placebo. these experiments, which were similar to previously performed studies [20, 21, 23], used 5- to 6-week-old female outbred swiss webster mice (cfw) (charles river laboratories, wilmington, mass). prior to compound or formulation application, the mice were synchronized using a 0.2 ml subcutaneous injection of depo-provera (pharmacia and upjohn company, bridgewater, nj) at 7 and 3 days before the start of each experiment. the depo-provera was diluted in ringer's lactated saline solution (baxter, deerfield, ill) to allow administration of 3 mg/animal. mice were anesthetized with a formulation of ketamine/xylazine (100200 mg/kg and 510 ng/kg, respectively) before the intravaginal application of nb325. mice treated with saline alone or 1% n-9 (diluted in saline) were included as controls to evaluate the morphology of normal or damaged cervicovaginal mucosal tissue, respectively. after treatment, mice were sacrificed humanely, and the cervicovaginal tracts were surgically excised and prepared for histological examination. mice were sacrificed after exposure for 10 min, 2 h, or 4 h and after longer exposures for 8 h or 24 h. the durations of acute exposure were established previously to characterize the appearance of epithelial damage following a single microbicide application. the longer time points were shown to be useful for characterizing the time course of epithelial repair and resolution of tissue inflammation. all excised cervicovaginal tissues were formalin-fixed and embedded in paraffin using previously described procedures [20, 21, 23]. paraffin-embedded samples were stained with hematoxylin and eosin (h&e) for gross morphological analyses, and representative fields from each treatment group were documented in photomicrographs. although clinical studies of microbicide safety have included assessments of female reproductive tract health and integrity following application, these studies were often conducted at postexposure durations in excess of 24 h. as a result, information regarding the acute effects of microbicide exposure has been lacking. our in vivo studies of n-9 using a mouse model of cervicovaginal toxicity indicated the need to include acute and extended exposures in these experiments in order to observe both short- and long-term effects of topical application. as controls in these experiments, mice were exposed to either saline or unformulated n-9 (1%) to provide illustrations of normal or damaged cervicovaginal epithelial tissues, respectively. saline exposure for 2 h caused no damage to either the vaginal or the cervical epithelial tissue (figure 1); identical results were obtained after exposures of 10 min, 4 h, 8 h, or 24 h (data not shown). as in previous studies, n-9 exposure resulted in severe cervical epithelial shedding and breaks in the epithelia that were greatest at 2 h postexposure (figure 2(b)) and were still evident at 4 h and 8 h after n-9 application (figures 2(d), 2(f)). n-9-associated cervical damage was resolved by 24 h postexposure, as these tissues were similar in appearance to tissues from saline-exposed mice (data not shown). the vaginal epithelium was unaffected by n-9 exposure (figures 2(a), 2(c), 2(e)). initial nb325 mouse model studies involved the vaginal application of unformulated nb325 at concentrations of 0.5% or 1%. at its lower concentration (0.5%), unformulated nb325 caused little or no postexposure cervicovaginal epithelial damage (data not shown). although epithelial cell sloughing and breaks in the epithelium were observed sporadically in the vagina and cervix, respectively, these minor indications of toxicity were not apparent by 24 h postexposure (data not shown). exposure to 1% unformulated nb325 resulted in a slightly greater level of toxicity compared to 0.5% nb325. at 10 min postapplication, nb325 exposure resulted in no damage to the cervicovaginal tract (figures 3(a), 3(b)). in the vagina and cervix, the tissue appeared the same as the placebo control, the vaginal epithelium retained the keratin layer, the cervix had no cells shed into the lumen, and mucus production was suggested by the observation that mucus-producing cells were present in the epithelial layer. by 2 h and 4 h postapplication, the cervix was still unaffected (figures 3(d), 3(f)), whereas some toxicity was apparent in the vaginal epithelium (figures 3(c), 3(e)). at 2 h after application, the vagina began showing signs of toxicity in the form of cells appearing to loosen from the upper layers of the stratified squamous tissue and thinning of the epithelial layer. by 4 h after application, cells were actively shed from the vaginal epithelium and were present in the lumen. at the extended exposure durations of 8 h and 24 h, little to no toxicity was observed in the vagina (figures 4(a), 4(c)), although at 24 h some shed tissue was still apparent in the lumen. at 8 h postexposure, the cervical epithelium was generally intact, with evidence of a small number of cells present in the lumen (figure 4(b)). by 24 h postexposure, however, these luminal cells were no longer present, and the tissue appeared normal (figure 4(d)). to explore the potential cervicovaginal safety of the formulated compound, nb325 was incorporated into a hec-based gel, otherwise known as the universal placebo, at final concentrations of 0.5% and 1%. vaginal and cervical epithelial tissues from mice exposed to the gel without nb325 (placebo) were indistinguishable from saline-exposed tissues; there was no observable epithelial damage at any time point (figure 5 and data not shown). the effects of exposure to nb325 formulated at 0.5% were similar to those observed after exposure to unformulated nb325 at the same concentration (data not shown). in the vagina, indications of minor toxicity were observed at 8 h postexposure in the form of epithelial layer thinning, indicating that shedding may have occurred at some point between the 4 h and 8 h time points. by 24 h postexposure, epithelial damage was no longer apparent; tissues were similar in appearance to the controls. the cervix appeared to be unaffected by any length of exposure to 0.5% formulated nb325. similar experiments were performed to examine the effects of a formulation containing a higher concentration (1%) of nb325. at 10 min following application, minimal damage to the vagina was observed (figure 6(a)), whereas the cervix appeared normal and showed indications of mucus production (figure 6(b)). by 2 h after application, signs of toxicity in the vaginal tract were apparent, indicated by the presence of sloughed cells in the lumen and thinning of the epithelial layer (figure 6(c)). at 4 h after application, an increase in vaginal tissue damage relative to the 2-h exposure was observed (figure 6(e)). by 8 h and 24 h postexposure, however, vaginal epithelia appeared normal, with no observable residual tissue damage (figures 7(a), 7(c)). although cervical epithelial tissues exposed to formulated 1% nb325 were generally intact, some cell infiltration beneath the basal layer of the cervical epithelium was visible at 2 h and 4 h postexposure (figures 6(d), 6(f)). interestingly, the sporadic appearance of mild cervical epithelial damage was noted at 8 h after application (figure 7(b)). loose appearance of cells along the epithelial layer, suggesting the presence of epithelial cells in the process of shedding. at 24 h, however, the cervix appeared normal and intact (figure 7(d)). the vaginal and cervical epithelia within the female reproductive tract provide physical barriers that impede pathogen access and play host to cells that mount immunologic responses to those pathogens. the integrity of this physical and immunologic barrier is crucial to maintaining the health of the cervicovaginal environment; disruption of this barrier could result in an increased risk of infection by sexually transmitted disease pathogens. with regard to hiv-1, breaks in these natural barriers can provide a direct route that the virus can take to reach susceptible cells and establish infection. thus, assessment of cervicovaginal epithelial integrity following exposure to a candidate microbicide is an important part of demonstrating the safety of a topical vaginal formulation and its api. however, a complete evaluation of in vivo safety must also encompass other approaches, such as investigations of inflammatory cell infiltration [20, 21], assays of cytokine expression and release, and experiments to demonstrate increased susceptibility to infection following topical microbicide exposure. the present mouse model studies, which were performed to provide an initial evaluation of formulated nb325 safety, offer the basis for several conclusions. first, the results of experiments involving unformulated nb325 suggest a much greater level of safety relative to n-9, which has been shown in these and other studies to cause severe damage to cervicovaginal epithelial tissues. these studies corroborate and expand on previous results that demonstrated the minimal effect of unformulated pehmb on epithelial integrity and the absence of cd45-positive immune cell infiltration following exposure. the present studies indicate a similar level of safety for unformulated nb325, which was produced through the application of refinements to the synthetic methods used to produce pehmb [17, 18]. second, these results also indicate a relative level of in vivo safety for nb325 formulated in an hec-based gel. the effects of formulated nb325 on vaginal epithelial integrity are in sharp contrast to the severe and widespread cervical epithelial damage and tissue sloughing (as well as induction of immune cell infiltration) caused by the application of unformulated and formulated n-9 (conceptrol). in fact, the results of mouse experiments involving formulated nb325 are comparable to the results of similar experiments using 1% formulated c31 g, which was shown in several independent clinical trials (as the topical agent savvy) to be safe and acceptable for human application [2729]. however, because the 1% formulated nb325 appeared to be slightly more toxic in vivo relative to the formulation containing 0.5% nb325, the concentration of nb325 in future microbicide formulations will need to be considered further. the indication of concentration-dependent effects on epithelial integrity also hints at the bioavailability of nb325 in the hec-based formulation. although nb325 bioavailability was not addressed in the present studies, preliminary experiments involving hiv-1 infection of indicator cells in the presence of formulated nb325 indeed demonstrated antiviral activity attributable to nb325 (data not shown). however, the antiviral activity of nb325 in this transwell-based experimental system was partly obscured by the barrier effect of the viscous hec-based gel, indicating a limitation of this method for measuring drug availability and biological activity and the need for additional investigations in this direction. the third conclusion concerns the location of the relatively limited epithelial damage caused by unformulated and formulated nb325. when epithelial damage was observed as a consequence of nb325 exposure, it was found predominantly in the vagina and observed infrequently in the cervix. in contrast, previous investigations demonstrated that the severe epithelial damage caused by n-9 was confined to the cervix; the vaginal epithelium appeared to be resistant to any damage caused by a single application of n-9 [17, 20]. similarly, losses in epithelial integrity associated with c31 g exposure were found exclusively in the cervix. these differences may be related both to the chemical nature of each compound and the respective microenvironments of the vagina and cervix. nb325 is an aqueous, nonsurfactant compound with a net positive charge at physiological ph, whereas n-9 and c31 g are both surfactants. within the cervix, mucus released from the epithelial surface may interact with nb325 and protect the columnar epithelial cells from any toxicity associated with nb325. this layer of cervical mucus may not afford the same protection against surfactants such as n-9 or c31 g. conversely, the absence of mucus in the vagina may leave the vaginal epithelium vulnerable to the potential effects of nb325. however, the structure of the stratified squamous epithelium in the vagina may be more impervious to the surfactant properties of n-9 or c31 g. the present studies and results (i) stress the importance of considering cervicovaginal environmental factors in designing and evaluating candidate microbicides and (ii) highlight the potential impact of api and formulation chemistry on microbicide safety. microbicides shown to be safe but ineffective in clinical trials (ushercell, carraguard, and pro2000) may have failed due to electrostatic interactions between their polyanionic apis and charged seminal plasma components that interfere with their antiviral activities [30, 31]. because nb325 is polycationic indeed, cationic peptides endogenous to semen have been shown to provide an inherent antiviral activity against hiv-1. the effects of both male and female reproductive tract secretions on nb325 activity will be addressed as part of the preclinical development of this compound. in vivo experiments involving a mouse model of cervicovaginal toxicity provide support for the safe use of a gel formulation containing the biguanide-based antiviral compound nb325 as a topical vaginal microbicide. however, indications of minor dose-dependent effects on epithelial integrity and regional differences in the effects of nb325 on the cervicovaginal tract indicate the need for further preclinical studies to arrive at an optimal api concentration and formulation.

vaginal microbicides that reduce or eliminate the risk of hiv-1 sexual transmission must do so safely without adversely affecting the integrity of the cervicovaginal epithelium. the present studies were performed to assess the safety of the biguanide-based antiviral compound nb325 in a formulation suitable for topical application. experiments were performed using a mouse model of cervicovaginal microbicide application, which was previously shown to be predictive of topical agent toxicity revealed in microbicide clinical trials. mice were exposed vaginally to unformulated nb325 or nb325 formulated in the hydroxyethyl cellulose universal placebo. following exposures to formulated 1% nb325 for 10 min to 24 h, the vaginal and cervical epithelia were generally intact, although some areas of minimal vaginal epithelial damage were noted. although formulated nb325 appeared generally safe for application in these studies, the low but observable level of toxicity suggests the need for improvements in the compound and/or formulation.

PMC3202145

pubmed-1138

sarcoidosis is a chronic multisystemic disease of unknown origin; it is characterized by an accumulation of noncaseating epithelioid granulomas. this pathology affects most commonly the lung, skin, lymph nodes, eyes, and rarely the nervous system. the relationship between the occurrence of sarcoidosis and interferon alfa (ifn-) therapy in viral hepatitis c was suggested in earlier reports.[14] this was also supported by the spontaneous resolution of sarcoidosis after cessation of ifn- treatment for hepatitis c. reported clinical manifestations include cutaneous sarcoidotic lesions, pulmonary nodules, and peripheral neuropathy. in this paper, we report the second case in the literature of fatal central nervous system sarcoidosis secondary to ifn- and ribavirin treatment. we aim to underline the importance of screening for sarcoidosis before and during the follow-up of hepatitis c virus (hcv) patients undergoing antiviral therapy. since march 2002, a 47-year-old woman without any history of sarcoidosis was regularly monitored in consultation for chronic viral hepatitis c (genotype 1). in april 2007, iu/l compared to normal values of 40 iu/l; the serum hcv rna was 6.210 copies/ml. however, the physical and abdominal ultrasound examinations did not show any abnormalities. because of the presence of biological cytolysis, a percutaneous liver biopsy was performed and revealed severe hepatic fibrosis (metavir score a2/f3). then, the antiviral treatment was started, and the patient received once a week the pegylated inf-2a at the rate of 180 g that injected subcutaneously, and ribavirin 400 mg was administrated orally twice a day. the biological response was good, and the transaminases were standardized after 2 weeks of treatment. six weeks after the beginning of the treatment, the patient noticed weight loss of 5 kg associated with dyspnea and progressive appearance of skin small firm nodules on both her upper and lower extremities. chest x-ray was normal. however, thoracic computed tomography (ct) scan revealed pulmonary nodules associated with bilateral mediastinal lymphadenopathies, suggesting tuberculosis, lymphoma, and/or sarcoidosis. afterward, bronchoalveolar lavage fluid was performed and showed an increased number of lymphocytes with a normal amount of eosinophils and neutrophils. the histological study of transbronchial lung biopsy revealed a patchy distribution of mild interstitial and perivascular fibrosis, without distinctive granulomas or significant inflammatory cell infiltrations. finally, a biopsy of the skin nodules was performed and found a noncaseating epithelioid granuloma formation strongly suggestive of sarcoidosis [figure 1]. the serum angiotensin-converting enzyme was significantly elevated (130 u/l for the normal value<40 u/l); the diagnosis of sarcoidosis was retained and oral corticotherapy was started at the dose of 60 mg daily. no caseating epithelioid granuloma formation composed of macrophages, lymphocytes, and fibroblasts four days later, the patient suddenly presented a heaviness of the right upper limb predominant distally, associated with a right central facial paralysis and aphasia; however, she was lethargic and her ophthalmologic examination was normal. the cerebral magnetic resonance imaging (mri) showed a gyriform and nodular left frontal and parietal subcortical enhancement associated with an important perilesional edema [figures 2a b]. inf- and ribavirin therapies were discontinued, and intravenous bolus methyl prednisolone was then started at the rate of 10 mg/kg/day for consecutive 3 days; this was followed by prednisone (1 mg/kg/day). the neurological state of the patient worsened rapidly and the patient died a week later. cerebral mri in postgadolinium axial t1-weighted image (a) and flair image (b), showing a gyriform and nodular left frontal and parietal subcortical enhancement associated with an important perilesional edema more than 170 million people worldwide are infected with chronic viral hepatitis c. current antiviral treatments are effective in eradicating the virus in up to 60% of patients. pegylated ifn- plus ribavirin was found to be superior to all other protocols for sustained eradication of the hcv, especially in individuals with more resistant viral genotypes 1, 4, 5, and 6. although several reports have suggested an association between ifn therapy and sarcoidosis, this association was rarely described in the literature. in 1987, abdi et al. had described the first case of pulmonary sarcoidosis in a patient who received ifn- treatment for renal cell cancer. since then, various cases have been published suggesting a relationship between sarcoidosis and ifn treatment in patients with a variety of diseases, including renal cell carcinoma, hematological malignancies, and viral hepatitis. so far, more than 30 cases of sarcoidosis occurring in the context of chronic hepatitis c treated by ifn- have been reported in the literature.[24] reported clinical manifestations include cutaneous sarcoidotic lesions, pulmonary nodules, and peripheral neuropathy. in this paper, we report the second case in the literature of severe central nervous system sarcoidosis secondary to ifn- treatment. to the best of our knowledge, only one case of neurosarcoidosis associated with ifn therapy has been reported in the literature. most of the cases described in the literature occurred in patients who have received a treatment combining ifn- or pegylated ifn- and ribavirin. indeed, it is well recognized that ifn- is an immunomodulator that has not only direct antiviral activity but also powerful stimulation of the immune activities, especially on t-helper (th1) immune response[810] which is strongly involved in the pathogenesis of sarcoidosis. furthermore, granulomas in sarcoidosis are associated with an abundance of cd4 t lymphocytes and mononuclear phagocytes, which are being considered a result of cytokine stimulation and immunologic dysregulation. importantly, in cases of chronic hepatitis c, inf could induce and reactivate sarcoidosis, and inf-based combination antiviral regimens can not eliminate the occurrence of sarcoidosis. in contrast, ribavirin, an antiviral agent that increases the anti-hcv effect of inf in chronic hepatitis c, would also enhance th1 cytokine response while inhibiting th2 cytokine response. furthermore, there was no case report of sarcoidosis in patients treated using ribavirin only. this suggests that the combination of inf- and ribavirin enhances the immune response, consequently predisposing the patient to sarcoidosis. the mean time to the onset of the disease after starting inf- therapy is 4 months. in our case, manifestations of sarcoidosis occurred earlier, associating rapid deterioration of clinical symptoms, which lead to death in 10 weeks. most patients with inf- associated sarcoidosis had spontaneous resolution of the disease without immunosuppressive treatment. indeed, inf- treatment was discontinued in several cases and subsequent resolution of sarcoidosis within months has followed. in contrast, the treatment protocol was not modified in other cases, and the sarcoidosis resolved several months later, either during or after the achievement of treatment. indeed, steroids that are the main treatment for systemic sarcoidosis increase the hcv load in both in vitro and in vivo. the prognosis of peripheral neurosarcoidosis is better as compared to the central nervous system involvement, which leads to higher disability and mortality. in addition, neurosarcoidosis of the cns usually occur in the early stages of the disease, while peripheral nervous system and skeletal muscle sarcoidosis are typically seen in the chronic stages of the disease. this would suggest that our patient has recent neurosarcoidosis after introducing inf- and ribavirin therapy. based on this case report, inf- associated sarcoidosis might also include cns involvement and might lead to death. considering earlier reports of heterogeneous spectra of sarcoidosis manifestations, clinicians should be aware of associated potential complication while evaluating the benefit/risk ratio of the treatment in patients with chronic hepatitis c infection. therefore, patients suggested such treatments are recommended to be monitored for sarcoidosis before and during ifn therapy.

sarcoidosis is a chronic multisystemic granulomatous disease that is triggered by an autoimmune process. nowadays, this pathology represents a well-recognized but uncommon complication for antiviral treatment in hepatitis c virus (hcv) infection. herein, we report a remarkable case of 47-year-old woman treated for chronic hcv infection; the patient has developed interferon alfa-induced sarcoidosis involving the central nervous system. the evolution was fatal despite disrupting the antiviral therapy and initiating a high-dose corticotherapy. this complication of interferon alfa treatment was reported in the literature in only one case. through this case and a review of the literature, we aim to underline the importance of screening for sarcoidosis before and during the follow-up of hcv patients undergoing antiviral therapy.

PMC3385203

pubmed-1139

stroke is one of the leading causes of disability and mortality in many developed countries. approximately 10% of the deaths in the world are related to stroke and it is estimated that the incidence of stroke will increase during the next 20 years. dietary factors are associated with the risk of stroke, for example, by the impact on blood pressure, resistance to insulin, systematic inflammation, thrombosis, and oxidation. a diet rich in calcium, magnesium, and potassium may decrease the risk of stroke, whereas increasing intake of sodium can lead to higher blood pressure and risk of stroke, but the effect of the intake of iron is not completely clear. due to the fact that minerals are essential elements for human body, some researchers have investigated the association between stroke and dietary intake of minerals, but the results are inconsistent. so, we aimed to investigate the effect of dietary intake of minerals in patients with stroke. surveys for this case control study were performed in the alzahra hospital in iran from april 2010 through march 2011 we recruited subjects from two wards of this hospital; the incident stroke patients were referred from the inpatient wards of the neurology department and the control group from the normal population. the control group had neither history nor clinical evidence indicating a previous stroke, and their treatment at the outpatient department was not related to any cardiovascular disease, malignant tumor, or diabetes. we also excluded patients who had been on long-term modification of diet for medical reasons. finally, 46 men (aged 56 18 years) and 23 women (aged 52 7 years) with stroke were included in this study. information on typical consumption of food and demographic and lifestyle characteristics was collected in the interview. when patients were unable to answer, we asked for their next of kin to obtain answers. we used a food frequency questionnaire (19) that included 168 items covering foods commonly consumed in iran. we obtained the quantity of minerals for each food item from the food composition table. we used the software of fpii to assay collected information and t-test for comparison between groups. the study population consisted of 129 subjects, 69 patients with acute stroke, 46 men (aged 56 18 years) and 23 women (aged 52 7 years) and 60 controls (30 men and 30 women, 45 5 years of age). intake of energy and micronutrients in stroke subjects and controls are shown in table 2. intake of sodium in male and female patient with stroke was significantly higher than the control group. (p<0.05, p<0.001 in men and female respectively). comparison of mean intake of vitamins and minerals in the study subjects with the recommended dietary allowance (rda) are shown in tables 3 and 4. in male patients, intake of iron was 21/5 7/5 mg/day and in healthy men, intake of iron was 14/5 8/5 mg/day, whereas rda is 8 mg/day; therefore, intake of iron in the case group was significantly higher than the control group (p<0/05), but intake of iron in case and control women was not significantly different. intake of zinc in men with stroke was 17/2 8/5 mg/day and in healthy men was 13/3 7/3, and rda for zinc was 11 mg/day; so, intake of zinc in men with stroke was significantly higher than healthy men (p<0/05). but intake of zinc in women with stroke was 7/2 3/4 mg/day and rda is 8 mg/day, but intake of zinc in healthy women was 5/2 4/1 mg/day; so, this difference was not significant. however, intake of calcium in male patients was 1352 440 mg/day and rda is 1000 mg/day; whereas intake of calcium in healthy men was 972 335 mg/day; so, this difference was not significant. mean of anthropometric measurements in patients with stroke measurement of consumption of energy and micronutrients in stroke patients comparison of mean consumption of vitamins and minerals in male stroke patients and rda comparison of mean consumption of vitamins and minerals in female stroke patients with rda in this study, we found that men and women with stroke had a diet higher in sodium, the positive association between the intake of sodium and stroke was independent of the intake of potassium, and this was observed similarly for nonoverweight and overweight persons. findings from previous studies that have examined the relationship between the intake of sodium and risk of stroke have been inconsistent. our findings were supported by results of some previous studies; two studies of americans and japanese researchers reported that the intake of sodium was related to an increased risk of stroke and mortality and it was reported that about a daily intake of 100 mmol sodium maybe associated with 32% higher incidence of stroke among overweight americans. japanese men with an intake of 306 mmol sodium had a twof old increased risk of stroke compared with people with a daily sodium intake of 174 mmol. reported that a daily intake of 100 mmol sodium was related to 83% higher mortality from stroke. in addition, they found a strong positive association between intake of sodium and mortality from stroke for persons with either a body mass index (bmi)<25 or a bmi 25. reported that sodium was not significantly associated with risk of any stroke subtypes after potential confounders were controlled for. a prospective study from finland and another from japan showed no significant association between intake of sodium and incidence of stroke. however, another japanese study reported a significant association among men and women with a high intake of sodium (median daily intake of 7194 mg among men and 6478 mg among women). in addition, the national health and nutrition examination survey epidemiologic follow-up reported a positive association among overweight persons. high intake of sodium has been related to high blood pressure. in this study, we reported that men with stroke had a high-iron diet and we supposed that high intake of iron can increase blood pressure as a main cause of stroke, but we did not find this result in women. in a previous study, researchers reported that increased intake of iron may elevate the risk of stroke. they hypothesize that high intake of iron could increase the risk of atherosclerotic cardiovascular disease. in contrast, a previous cross-sectional study involving four countries showed a significant inverse association between intake of iron and blood pressure, whereas a recent study that was a randomized clinical trial did not observe any effect of reducing iron stores among phlebotomy on the risk of stroke and myocardial infraction after six years of intervention. so, more investigation is needed to diagnose the effect of iron on risk of stroke. in our study, we observed no association between intake of calcium and stroke. susanna et al. reported that intake of calcium was not significantly associated with risk of stroke after potential confounders were controlled for. in addition, the health professionals follow-up study observed no association between intake of calcium and stroke. the nurses health study reported an inverse association between intake of calcium, especially dairy calcium, and risk of stroke. likewise, in a cohort of japanese men and women, intake of dairy calcium was inversely associated with stroke mortality. in a previous study that was a randomized trial including 36,282 postmenopausal women, intake of calcium and vitamin d supplementation neither decreased nor increased the risk of stroke over a seven-year period. intake of calcium was positively associated with the risk of intracerebral hemorrhage in eight prospective studies of calcium intake in relation to stroke incidence or mortality; four reported an inverse association between stroke and intake of dairy calcium but not nondairy calcium, and no association was found for total intake of calcium from both dairy and nondairy foods. the reason for the inconsistent results for the association of calcium intake with stroke maybe due to the difference in the range of exposure or the lack of adjustment for potential confounders. in this study, a high intake of sodium was associated with a significantly increased risk of stroke and findings from this study did not report a protective effect of calcium on risk for stroke. the limitations of the present study are first, the estimated intake of sodium from the present questionnaire study was 50% lower than that estimated from dietary records. second, we estimated intake of sodium with the food frequency questionnaire, whereas urinary measurement is a better tool than a food frequency questionnaire. third, the diet was associated with a self-administered questionnaire that may have led to some errors in the measurement of dietary intake.

background: experimental studies provide evidence of a relationship between stroke and mineral intake but this information in human are still limited and inconsistent. the purpose of this study was to investigate sodium, calcium and iron intake and stroke in iranian patient and control population. materials and methods: in a case-control study with 46 stroke men (aged 56 18 years) and stroke women (aged 52 7 years) and 60 healthy people, we investigated the sodium, calcium and iron intake inthe patients. results:after adjustment for age, sex and cardiovascular disease we found that a high sodium intake was associated with a statistically significant higher risk of stroke (p<0/05). we saw a significant association between iron intakes in men (p<0/05). and calcium was not significant associated with risk of stroke (p for trend>0/05). conclusion: these findings in men and women suggest that a low sodium intake may play a role in primary prevention of stroke.

PMC3743321

pubmed-1140

in africa, pelvic inflammatory disease (pid) and its sequelae are a predominant cause of gynecologic morbidity [1, 2]. these include tubal factor infertility, ectopic pregnancy, chronic pelvic pain, and recurrent pelvic infections [3, 4]. hiv-1 seroprevalence in women with pid is consistently 27 times greater than measured in matched populations without pid [57]; both infections are most commonly acquired through unprotected sexual activity. prompt diagnosis and treatment of women with upper genital tract infections is important in reducing morbidity, but it is complicated by lack of a sensitive and specific clinical and laboratory diagnostic test. laparoscopy is the gold standard for the diagnosis of salpingitis, but is not practical for routine clinical practice. kiviat et al. evaluated women with clinical pid; evidence of endometritis as defined by 1 plasma cell (pc) and 5 polymorphonuclear lymphocytes (pmn) per high-powered field (hpf) was 92% sensitive and 87% specific compared with visual findings of salpingitis determined by laparoscopy. using the same diagnostic criteria in a study of acute salpingitis in kenya, plasma cell endometritis as defined by 1 pc/hpf was identified in 49% of women with salpingitis: this increased with disease severity and hiv-infection. studies on hiv-1-infected women have found an increased prevalence of plasma cell endometritis even in the absence of clinical disease [10, 11]. thus, we conducted this analysis to determine the optimum endometrial histopathological criteria for predicting salpingitis in a population with a high hiv-1 seroprevalence. we anticipate that these data will help to plan future clinical trials, increase the understanding of the pathogenesis of upper genital tract infection among hiv-1 infected women, and in certain circumstances provide a tool to confirm the clinical diagnosis of pid. briefly, between april 2000 and july 2002, women aged 1840 admitted to kenyatta national hospital (knh) acute gynecology ward with a complaint of lower abdominal/pelvic pain for 2 weeks or less plus one or more of the following signs or symptoms: temperature 38c, dysuria, and complaint of abnormal vaginal discharge were eligible for enrollment. after induction of anesthesia, an endometrial biopsy was obtained with a pipelle suction curette (unimar, inc., wilton, conn). at laparoscopy, samples from peritoneal fluid, tubal ostia, and pyosalpinx/tubo-ovarian abscess (toa) were obtained for n. gonorrhoeae and c. trachomatis pcr. using the jacobson and westrom criteria, the severity of acute salpingitis was graded as (1) mild (tubal erythema or edema, mobile tubes, and with or without spontaneous exudate), (2) moderate (marked tubal erythema and edema, limited tubal mobility, questionable or no tubal patency, and gross exudate), and (3) severe (pyosalpinx or toa). women desiring permanent sterilization underwent laparoscopic tubal ligation preceded by an endometrial biopsy obtained using a pipelle suction curette. hiv-1-seropositive controls were enrolled from an hiv care and treatment clinic at the center for respiratory disease research at the kenya medical research institute. subjects had no clinical evidence of pid. enrollment and study procedures of the hiv-1-seropositive control group are detailed elsewhere. after informed consent was obtained, an endometrial pipelle biopsy was obtained in the research clinic. samples from the cervix, endometrium, fallopian tube, and abscess were examined by pcr (roche molecular diagnostics, pleasanton, calif, usa) for n. gonorrhoeae and c. trachomatis. endometrial specimens were fixed in 10% buffered formalin, processed, and stained with hematoxylin, eosin, and methyl green pyronin. pmns in glands and pcs in stroma were counted per high-power field. one pathologist (nk) who was blinded to the patients ' diagnosis read the slides. serum was tested for hiv antibodies by elisa (detect hiv, biochem immunosystems, montreal, canada) with positive results confirmed by a second elisa (recombigen, cambridge biotech, ireland). univariate analyses used chi-square and fisher's exact tests for categorical data and student's t-test for continuous variables. logistic regression was done for multivariate analysis. one hundred and sixty women were enrolled with clinical pid, 140 (88%) had laparoscopically confirmed salpingitis, 125 (89%) of whom had an endometrial biopsy specimen: 56 (45%) had mild, 31 (25%) had moderate, and 38 (30%) had severe disease based on laparoscopic criteria. nineteen women had other diagnoses at laparoscopy including appendicular abscess (n=2), endometriosis (n=1), ovarian cyst (n=12), frozen pelvis (n=1), pelvic tuberculosis (n=1), cancer of the sigmoid volvulus with abscess (n=1), and ovarian torsion (n=1). asymptomatic women (n=20) desiring permanent sterilization underwent laparoscopic tubal ligation and served as hiv-1-negative controls. a single control subject had a sticky exudate emanating from the fallopian tubes and was excluded from the analysis leaving 19 hiv-1-seronegative controls. forty-five asymptomatic hiv-1-seropositive controls were enrolled from an hiv care clinic; one woman had c. trachomatis detected. forty-eight (38%) of the women with salpingitis were hiv-seropositive. women with salpingitis were younger, less likely to be married, and less likely to have ever used contraception (table 1). as expected, none of the hiv-1-seronegative controls had signs or symptoms consistent with pid, and none were infected with n. gonorrhoeae or c. trachomatis. however, t. vaginalis was detected in a similar proportion of salpingitis cases (23%) and hiv-seronegative controls (21%) (table 1). of the 125 women with salpingitis, endometrial biopsies from 107 (86%) were evaluated histological. inadequate biopsies corresponded to endometrial specimens demonstrating sloughing, frank pus, and lack of tissue. in general, more severe disease as demonstrated by higher clinical severity score (css) (15.5 versus 13, p<.03) and severity of salpingitis based on laparoscopic findings (p-trend< .04) was associated with unevaluable endometrial biopsy results (table 2). similarly, history of depomedroxyprogesterone acetate (dmpa) was associated with an increased likelihood of obtaining an unevaluable biopsy (p=.02). hiv-infected women were more likely to have an unevaluable endometrial biopsy (57% versus 36%, p<.05) than hiv-uninfected women. although not significant, participants with an inadequate endometrial histological specimen had a higher prevalence of gonorrhea compared to those with an adequate biopsy (23% versus 12% p<0.23) (table 2). in multivariate analysis, after controlling for factors found significant in univariate analysis, the use of dmpa at any time (adjusted or=3.1, 95% ci 1.18.5), hiv-1 infection for women with mild (aor=4.6, 95% ci 1.118.3) but not moderate salpingitis (aor=0.89, ci 0.155.3), or severe salpingitis (aor=2.63, ci 0.6810.2) was associated with an increased odds of an unevaluable endometrial biopsy. in addition, 12 (63%) of 19 specimens from hiv-1-seronegative subjects were evaluable for histopathology. we reviewed the distribution of pmn and pc by hiv-1 serostatus and severity of salpingitis. women with severe salpingitis regardless of hiv-1 serostatus had the highest frequency of pmn and pc per high-power field. only two patients with hiv-1 infection and salpingitis did not have pmn found in the endometrium. although pmn density did not increase with severity of salpingitis among women with hiv-1 infection (p-trend =.49), this association was significant for hiv-1-uninfected women with salpingitis (p-trend =.05). in contrast, the frequency of pcs increased with severity of salpingitis among those with hiv-1 infection (p-trend =.04), but not among hiv-1 uninfected (p-trend =.14). furthermore, hiv-1 infection was associated with a higher frequency of pcs/hpf (p-trend<.001), and presence of lymphoid follicles (p<.04). only 2 (6%) of 34 hiv-1-infected women with salpingitis did not have any plasma cells present in the endometrium versus 23 (41%) of 56 hiv-1-uninfected women with salpingitis. we next set out to determine the sensitivity, specificity, and positive predictive value of four histopathologic criteria for diagnosis of endometritis in comparison to the laparoscopic diagnosis of salpingitis. the four rules evaluated included: (a) 3 pmn and 1 pc per high-power field, (b) 1 pmn and 1 pc per high-power field, (c) 1 pmn per high-power field, and (d) 1 pc per high-power field. women with moderate and severe disease were grouped together and compared to women with mild salpingitis and to the two control groups. table 3 outlines the comparison between the laparoscopic diagnosis for mild and moderate/severe salpingitis and the four histological rules stratified by hiv-1 serostatus. because the diagnosis of the moderate and severe disease requires more objective evidence of tubal inflammation (e.g., pus from tubes, pyosalpinx, abscess, and fresh adhesions) than mild disease, we chose to gauge the sensitivity of each histological rule using laparoscopic evidence of moderate/severe salpingitis as the gold standard. rule a, although less sensitive than rules b through d for women with moderate/severe salpingitis (hiv-seropositive=74% versus 63%; hiv-seronegative; 93% versus 75%), was the most specific, demonstrating endometritis in 25% and 7% of hiv-1-seronegative and hiv-1-seropositive controls, respectively, in comparison to 58%67% and 38%62% for rules b through d. among the 19 women enrolled with a clinical diagnosis of pid, but who did not have salpingitis on laparoscopy, rule a had the least false positive, while rule d, at least one plasma cell, scored the highest false-positive rate. this study had three key findings: (1) 3 pmn and 1 pc per hpf as a histologic criteria for the diagnosis of moderate to severe salpingitis, while performing better than the other criteria, appears to have limited utility even more so for cases of mild salpingitis; (2) endometrial specimens were often unevaluable for histopathology, and unevaluable specimens were more likely in subjects with severe salpingitis and hiv-infection, and thus may affect the utility of endometrial histopathology to confirm the clinical diagnosis of pid in similar settings; (3) the pmn response increased with disease severity for hiv-1 seronegative but not hiv-1 seropositive women with salpingitis. since kiviat et al. published their paper, histologic endometritis has been used as a surrogate marker for salpingitis, especially in the study of mild to moderate pid. even though the criteria for histologic endometritis had never been validated in hiv-1-infected populations, several studies of pid were conducted in high hiv-1 seroprevalence settings [6, 7, 9, 12, 14]. 1990, criteria for 5 pmns and 1 pc for the diagnosis of pid. in the kiviat et al. cohort, n. gonorrhoeae and/or c. trachomatis was found in 49% of the patient population; in comparison, the cohort in our study had a high hiv-1 prevalence and a combined gonorrhea and/or chlamydia prevalence of 18% (table 1). similar to another report, only 72% of endometrial biopsies in our study were evaluable. the increased frequency of unevaluable endometrial biopsies in women with severe salpingitis, likely due to increased endometrial sloughing and presence of pus, and hiv-1 infection further limits the utility of endometrial histopathology as a diagnostic tool for studies of pid in similar populations. the low sensitivity of histologic endometritis for mild salpingitis amongst women symptomatic for pid was unexpected. studies of endometritis in populations of asymptomatic women have consistently demonstrated a relatively high prevalence of endometritis [10, 15, 16] which led authors to describe endometritis as an intermediate infection to pid.. studied hiv-1-infected women presenting to a family planning clinic and found endometritis in 38% of participants. this is a higher prevalence than what we found in hiv-1-negative women (16%) and a lower prevalence than what we found in hiv-1-seropositive women (57%) with mild salpingitis using less stringent criteria for endometritis. an alternative explanation may result from the subjectivity of the laparoscopic criteria for mild salpingitis that leads to misclassification of cases. the distribution of pmns and pcs in the endometrium of women with salpingitis was affected by hiv-1 serostatus and disease severity. pmns are only found in the healthy endometrium during menses, and form part of the endometrial immune response, they are also the first line immune defense against bacterial infections. the increased density of pmn with severe disease in hiv-1-uninfected but not in hiv-1-infected women with salpingitis is not well understood. consistent with other studies [7, 9, 10, 14], we found increased pc endometritis with hiv-1 infection. this could represent hiv-1 infection in the genital tract; chronic plasma cell endometritis [11, 14]; or the presence of opportunistic infections. reported an association between hsv-2 seropositivity and plasma cell endometritis; notably hsv-2 is extremely prevalent among hiv-1-infected persons (kais 2007. evaluated 20 endometrial biopsy samples from women with asymptomatic histologic endometritis and failed to detect herpes simplex virus by pcr, and cytomegalovirus was detected equally in women with and without histological endometritis. one limitation of this study is that hiv-1-infected controls did not undergo laparoscopic evaluation. therefore, unlikely we can not firmly exclude subclinical salpingitis from this population as we can for the hiv-1-seronegative controls. furthermore, we did not attempt to detect suspected etiologies of endometritis such as bacteria other than n. gonorrhoeae and c. trachomatis including m. genitalium and potential etiologies such as cytomegalovirus and herpes simplex virus infection. such data might help to elucidate the reason for the different findings among hiv-1-seropositive and hiv-1-seronegative women with salpingitis in regards to endometrial histopathology. this study raises some important questions regarding pid and its sequelae. with increased access to highly active antiretroviral therapy (haart), hiv-1-infected population data from uganda plus others have demonstrated reduced fertility in hiv-1-infected women regardless of disease stage. further research is required to determine if women using haart return to normal fertility or not. lastly, although endometrial histopathology serves as a reasonable surrogate for salpingitis in hiv-1-uninfected populations, its utility in populations with a high hiv-1 seroprevalence appears to be limited. discovery of a sensitive and specific biomarker or set of biomarkers for salpingitis could facilitate further research on pid and its sequelae in such settings .

study objective. to identify sensitive and specific histological criteria for endometritis in women with laparoscopically-confirmed acute salpingitis. methods. women, age 1840 years of age presenting with complaints of lower abdominal pain 2 weeks and no antibiotics use in past two weeks, were enrolled. they underwent clinical examination, screening for hiv; other sexually transmitted infections plus endometrial biopsy sampling for histopathology. diagnostic laparoscopy confirmed the diagnosis of acute salpingitis. controls were women undergoing tubal ligation and hiv-1 infected women asymptomatic for genital tract infection. results. of 125 women with laparoscopically-confirmed salpingitis, 38% were hiv-1 seropositive. nineteen hiv-1 negative controls were recruited. for the diagnosis of endometritis, 1 plasma cells (pc) and 3 polymorphonuclear lymphocytes (pmn) per hpf in the endometrium had a sensitivity of 74% for hiv-1-seropositive, 63% for hiv-1-seronegative women with a specificity of 75% and positive predictive value of 85% regardless of hiv-1-infection for predicting moderate to severe salpingitis. for hiv-1-seronegative women with mild salpingitis, 1 pc and 3 pmn had a sensitivity of 16% and a ppv of 57%. conclusion. endometrial histology, did not perform well as a surrogate marker for moderate to severe salpingitis, and failed as a surrogate marker for mild salpingitis.

PMC3177090

pubmed-1141

chf is not only the failure of the heart to generate sufficient cardiac output, but is a multisystemic disorder with immune activation leading to increased concentrations of several cytokines. in chf several studies showed increased concentrations of proinflammatory cytokines such as tnf, interleukin (il)-1, il-6, il-18, and cardiotrophin-1 (ct-1) [25]. one of the most examined proinflammatory molecules in chf is tnf. tnf is a trimeric 17-kda polypeptide mainly produced by monocytes and macrophages. short-term tnf expression is thought to be an adaptive mechanism; whereas prolonged expression causes left ventricular dysfunction and cardiomyopathy leading to chf propagation. however, tnf influences not only the heart itself but causes endothelial dysfunction and peripheral muscle wasting. cardiotrophin-1 (ct-1) is a member of the il-6 cytokine family that consists of il-6, il-11, ciliary neurotrophic factor (cntf), cardiotrophin-1 (ct-1), cardiotrophin-like cytokine (clc), leukemia inhibitory factor (lif), neuropoietin (npn), and oncostatin m (osm) and has recently been supplemented by the addition of two newly characterized cytokines: il-27 and il-31. all these cytokines bind to a specific receptor chain (il-6r, il-11r, or lifr for ct-1, lif, osm). following cytokine binding the cytokine/receptor complex associates with glycoprotein 130 (gp130) causing tyrosine phosphorylation of gp130 and the signal is transduced via the janus kinase (jak)/signal transducer and activation of transcription 3 (stat3) pathway [810]. ct-1 is expressed in a time-dependent manner during embryogenesis of organs, is expressed in the heart during life, induces cardiac myocyte hypertrophy, and is able to prevent myocyte apoptosis via a mitogen dependent kinase pathway [8, 11]. increased ct-1 concentrations were detected in patients with acute myocardial infarction and chronic heart failure (chf). furthermore, ct-1 plasma concentrations correlate with the severity of left ventricular dysfunction [1114]. however, ct-1 has not only effects on myocytes but also on vasculature by decreasing systemic vascular resistance in an animal model, by induction of acute phase proteins in rat hepatocytes, and by attenuation of endotoxin-induced acute lung injury. there are several studies showing that in chf pbmcs produce tnf [18, 19]. but so far the mechanisms responsible for tnf production in these cells under these circumstances are not determined. in this study we investigated whether ct-1 induces tnf expression in human pbmc of healthy volunteers. recombinant human ct-1 was purchased from r&d systems (wiesbaden, germany) and dissolved according to the manufacturer's instruction. actinomycin d, brefeldin a, and parthenolide were purchased from sigma chemicals (deisenhofen, germany). the blocking antibody against ct-1 was purchased from r&d systems (wiesbaden, germany). human peripheral blood mononuclear cells were obtained from healthy volunteers by ficoll-paque (amersham bioscience, uppsala, sweden) centrifugation. the cells were washed three times with pbs, resuspended in rpmi 1640 supplemented with 10% fetal calf serum, 1% penicillin, streptomycin (all from biochrom ag, berlin, germany), and cultured in plastic dishes at 37c in a humified 5% co2 atmosphere. cells were cultivated for 24 hour with rpmi 1640 supplemented with 10% fetal calf serum, 1% penicillin, streptomycin. afterwards, cells were subconfluent and medium was replaced by fresh medium. after 24 hours, over 90% of pbmc were alive tested by trypan blue exclusion. primary cultures from human vein endothelial cells were purchased from promocell (heidelberg, germany). cell culture was done according to the manufacturer's manual in endothelial growth medium with 2% fetal calf serum (egm, promocell, heidelberg, germany). cells were grown to confluence in collagen i coated tissue culture plastic (becton dickinson, franklin lakes, usa). all stimulants, inhibitors and media were without significant endotoxin levels according to the manufacturers ' instructions. pharmacological agents, dissolved in fresh medium, were added to the cells for defined time intervals and concentrations. as a control, approval for this study was given by the ethics committee of the friedrich schiller university of jena, and subjects gave their written informed consent according to the university guidelines. total rna from cultivated pbmc was extracted according to the rneasy protocol (qiagen, hilden, germany). one g of total rna was reversely transcribed into cdna in a volume of 20 l with avian myeloma leukaemia virus (amv) reverse transcriptase and oligo dt primers (promega, madison, usa) according to the manufacturers manual. real-time pcr measurement of tnf cdna was performed with the light cycler instrument using the fast start dna master sybr green i kit (roche diagnostics, mannheim, germany). for verification of the correct amplification product, the specific primer for human tnf was purchased from r&d systems. the amplification program for tnf consisted of 1 cycle of 94c with a 4-minute hold followed by 40 cycles of 95c with a 45-second hold, 59c annealing temperature with a 45-second hold, and 72c with a 45-second hold. the specific primer pair for gapdh was: sense primer 5 ggg aag gtg aag gtc gg 3, antisense primer 5 tgg act cca cga cgt act cag 3. the amplification program for gapdh consisted of 1 cycle of 95c with a 30-second hold followed by 30 cycles of 95c with a 5-second hold, 59c annealing temperature with a 10-second hold, and 72c with a 20-second hold. each reaction (20 l) contained 2 l cdna, 2.5 mm mgcl2, 1 pmol of each primer, and 2 l of fast starter mix (containing buffer, dntps, sybr green dye and taq polymerase). a negative control without cdna was run with every pcr to assess the specificity of the reaction. pcr efficiency was determined by analysing a dilution series of cdna (external standard curve). the identity of the pcr product was confirmed by comparing its melting temperature (tm) with the tm of amplicons from standards or positive controls. gapdh was analyzed in parallel to each pcr and the resulting gapdh values were used as standards for presentation of tnf transcripts. tnf concentrations in the culture supernatants were determined by elisa (quantiglo, r&d systems, wiesbaden, germany) according to the manufacturer's instructions. nuclear extracts were achieved by the epiquik nuclear extraction kit i (epigentek, ny, usa) according to the manufacturer's manual. afterwards, protein concentrations of nuclear extracts were determined according to the bradford methode. for determination of nfb 2 g of nuclear proteins were used and further analyzed by gel electrophoretic mobility shift assay (emsa) according to the suppliers manual. emsa kits and probes were purchased from panomics, redwood city, usa. for intracellular staining peripheral blood was collected in lithium-heparin tubes. 100 l of blood was added to rpmi-1640 medium including brefeldin a (final concentration: 1 g/ml) (sigma, taufkirchen, germany), and incubated for 6 hours time at 37c. were stained with monoclonal antibodies against the surface antigens cd3 (coulter-immunotech, krefeld, germany), cd4 (caltag, hamburg, germany) cd8 or cd14 (bd-pharmingen, heidelberg, germany) (15 minute, rt), followed, after a washing step, by fixation with 100 l 2% paraformaldehyde for 10 min at rt. after a wash the cells were incubated in 100 l permeabilisation solution (0,1% saponin and 0,1% nan3 in pbs) together with 1 l directly conjugated anti-tnf antibody (bd-pharmingen, heidelberg, germany) for 15 minute at rt. followed by a wash with permeabilisation solution the cells were resuspended in pbs/2% fcs and fluorescence intensity was analyzed by flow cytometry (facscalibur, becton-dickinson, heidelberg, germany). for analysis regions were defined by forward scatter and side scatter as well as cd3/cd4- or cd3/cd8-lymphocyte populations and cd14 monocyte population. data were analyzed with cellquest software. because the amount of the cytokines produced was different in each experiment, the effects on tnf production were normalized to unstimulated cells, which were set as one. data were analysed by nonparametric methods to avoid assumptions about the distribution of the measured variables. in the first sets of experiments we analysed whether ct-1 is able to induce tnf in pbmc. as shown in figure 1(a), ct-1 induced in a concentration-dependent manner tnf in the supernatant determined by a commercial available elisa. maximal tnf concentration was found after 3 to 6 hours and declined afterwards reaching nearly control values after 24 hours, indicating that ct-1 causes only a transient tnf release in pbmc. in the next experiments we determined intracellular tnf protein in monocytes, cd4 and cd8 lymphocytes after stimulation with various concentrations of ct-1 in the presence of brefeldin a using immunofluorescent flow cytometry. intracellular tnf determination in cd4 and cd8 lymphocytes did not show an effect of ct-1 on tnf expression (data not shown). in monocytes we found a concentration-dependent increase of intracellular tnf after ct-1 application (figure 1(b)). these results showed that ct-1 induced tnf in pbcm independent of culture conditions and independent of determination methodes. on tnf mrna level we found maximal mrna after 1 hour. blocking ct-1 by an antibody against ct-1 inhibited ct-1 induced tnf mrna (data not shown) indicating that tnf induction is specifically caused by ct-1. with the next experiments we addressed the question whether tnf protein expression is dependent on mrna synthesis and intracellular protein transport. in figure 3 it is shown that both inhibition of mrna synthesis by actinomycin d and intracellular protein transport by brefeldin a were able to abolish ct-1 induced tnf protein induction in the supernatant. as shown in figure 4 ct-1 caused a concentration-dependent nfb translocation to the nucleus determined by emsa reaching maximal translocation with 100 ng/ml ct-1. in the next sets of experiments we used emsa to verify that nfb activation was responsible for ct-1 induced tnf expression in pbmc. human umbilical vein endothelial cells (huvecs) stimulated with tnf were used as a control. unstimulated cells did not show significant nfb protein in the nucleus; whereas ct-1 caused translocation of nfb into the nucleus. parthenolide, an inhibitor of nfb activation, was able to inhibit nfb translocation to the nucleus (figure 5). nfb translocation is essential for tnf expression as shown in figure 6(a) and 6(b). because parthenolide was able to inhibit tnf expression both on protein and mrna level we conclude that ct-1 not only was responsible for nfb translocation to the nucleus but this translocation was responsible for tnf expression. using flow cytometry we found in monocytes an increase of intracellular tnf after ct-1 application which could be inhibited by parthenolide (figure 6(c)). these results show that ct-1 induced tnf in pbcm independent of culture conditions and independent of determination methodes and nfb seems to be essential for the effect of ct-1 on tnf induction in pbmc. the first result of our study is that ct-1 is able to induce tnf mrna and protein in pbmc of healthy volunteers. tnf is increased in serum of patients with chf and correlates with the severity of heart failure, cachexia, and clinical outcome. tnf may be involved in progression of chf because high levels of tnf can induce left ventricular dysfunction, ventricular remodelling, cardiomyopathy, and pulmonary edema [22, 23]. cultured human pbmc can synthesize and secrete tnf. in heart failure, both the heart itself and activated monocytes are able to secrete tnf [18, 24]. furthermore, the capacity of pbmc of chf patients to secrete tnf is increased compared to control. our data are in good agreement with these former studies and in opposite to shimokawa et al. who found decreased cytokine generation capacity of monocytes in severe heart failure after stimulation with lipopolysaccharide. besides the hypothesis that in chf the failing heart itself is the main source of tnf it is speculated by other groups that activated monocytes are responsible for increased tnf serum concentrations. monocytes may be activated by lps from the gut because the barrier function of the gut by cardial edema is disturbed and bacteria can easily translocate from the gut lumen to the blood stream. as a third possibility our data suggest at least in theory a new mechanism for tnf production of pbmc in heart failure. ct-1 produced by the failing ventricle is able to induce tnf in pbmc without lps. the here presented mechanism might also explain why tnf may be still elevated in chf even after edema were treated successfully with diuretics and the integrity of gut mucosa was restored. furthermore, our data support the study of petretta et al. who found that tnf is not produced by the failing heart or the gut in patients with mild to severe heart failure. the second result of our study is the fact that ct-1 activates the nfb system in a concentration-dependent manner in pbmc of healthy volunteers our in vitro data are in line with studies that found an activation of the nfb system in peripheral blood cells in chf. jankowska et al. reported an activation of the nfb system in peripheral blood leukocytes in chf patients measured by immuncytochemistry. found an augmented activation of nfb activation in blood mononuclear cells using electromobility shift assay in patients with chf compared to healthy controls. the exact pathway responsible for nfb activation in chf is still unknown and remains to be determined. but within 3 hours, there is no cytotoxic effect as shown by o'neill et al. in. we also used high ct-1 concentrations compared to concentrations reported in patients with chf by ng et al.. on the other hand a paper published in 2008 reported serum ct-1 concentration in healthy controls and patients with metabolic syndrome of about 100 ng/ml. so far serum concentration of ct-1 in healthy controls and patients is a matter of discussion. but independent of reported ct-1 serum concentration the concentration of ct-1 should be much higher in the myocardium which is the source of ct-1 in chf. exact intramyocardial ct-1 concentrations are not determined so far, only mrna and immunohistochemical studies showed increased ct-1 in hearts of patients with chf. in our experiments both tnf mrna expression and tnf protein production of pbmc showed a large standard variation. first one explanation for the large standard deviation may be a different genetic susceptibility of pbmc from different persons to stimuli. second, we used the low basal mrna concentration as the basis of normalization explaining the large standard variation. third, the fact that the increase of tnf mrna expression after ct-1 application is much higher compared to the increase of protein in the supernatant may be explained methodically. because in chf many proinflammatory cytokines are elevated and pbmc are activated, it is not easy to study the effect of a single cytokine in pbmc of patients with chf. for this reason we used pbmc from healthy volunteers in culture and stimulated them with recombinant ct-1. in conclusion, interestingly, in our study lps is not needed for elevated tnf expression in pbmc. elevated tnf concentrations may be important in the pathogenesis and perpetuation of heart failure by modulating systemic metabolism, causing apoptosis and having a negative inotropic effect. in the light of our results modulating ct-1

chronic heart failure (chf) is associated with elevated concentrations of tumor necrosis factor (tnf) and cardiotrophin-1 (ct-1) and altered peripheral blood mononuclear cell (pbmc) function. therefore, we tested whether ct-1 induces tnf in pbmc of healthy volunteers. ct-1 induced in pbmc tnf protein in the supernatant and tnf mrna in a concentration- and time-dependent manner determined by elisa and real-time pcr, respectively. maximal tnf protein was achieved with 100 ng/ml ct-1 after 36 hours and maximal tnf mrna induction after 1 hour. elisa data were confirmed using immunofluorescent flow cytometry. inhibitor studies with actinomycin d and brefeldin a showed that both protein synthesis and intracellular transport are essential for ct-1 induced tnf expression. ct-1 caused a dose dependent nuclear factor (nf) b translocation. parthenolide inhibited both nfb translocation and tnf protein expression indicating that nfb seems to be necessary. we revealed a new mechanism for elevated serum tnf concentrations and pbmc activation in chf besides the hypothesis of pbmc activation by bacterial translocation from the gut.

PMC2836137

pubmed-1142

since the particle size is a key consideration in nuclear transport, three nps of different sizes (15.0 1.2, 8.5 0.8, and 5.5 0.8 nm, respectively) were synthesized to study the size effect of the nanoparticle on nuclear internalization (see tem images in figure s1). after modification with a dense shell of the das, the hydrodynamic diameters of these nps (termed 15-np, 8.5-np, and 5.5-np), as measured by dynamic light scattering (dls), were 37.8 1.3, 18.2 1.2, and 11.7 1.5 nm, respectively. to prevent mutual interference between tumor targeting and nanodrug capture, a directional modification was performed on the nrs (65 nm 20 nm), which means the aptamer and the cs were separately modified on the end faces and the side face of the nr, rather than being randomly spread. the principle of this selective modification process was based on the preference of ctab to accumulate on the side face of nr, which makes its end faces more reactive to thiolated dnas. specifically, the aptamer at a relatively low concentration was first used to occupy the nr ends. subsequently, the cs at a high concentration was added to replace ctab on the nr side face. to make the resulting nanomaterial biocompatible, thiolated peg was used, followed by several washing steps. via dna hybridization, as characterized by tem (figure 1), nps were exactly immobilized onto the nr sides, leaving the nr ends bald, indicating successful fabrication of the side-assembly nanostructures (termed 15-np/nr, 8.5-np/nr, and 5.5-np/nr). the self-assembly process was further investigated with dls and uv vis absorption spectroscopy. the results from different angles all demonstrated the successful assembly of nps and nrs resulting from dna hybridization (see details in figures s2a and s2b). tem images of 15-np/nrs, 8.5-np/nrs, and 5.5-np/nrs. 15-nps, 8.5-nps, and 5.5-nps mostly attach onto the nr sides, but not the nr ends, indicating the successful fabrication of the side-assembly nanostructures. the scale bar represents 50 nm. after synthesizing and characterizing these nanoassemblies, we next investigated their nir-response and drug-carrying capability. the efficient photothermal effect of nrs was verified by the rapid temperature rise of the nr medium when irradiated by the nir laser (see details in figure s3a). then the nir-activated release of nps from nrs was demonstrated by the reduced average size (dls) and the disassembled structure (tem) of the 15-np/nrs after exposure to the laser (figure s3b). to fabricate the nuclear-uptake nanodrug delivery system, doxorubicin (dox), a widely used anticancer drug, was chosen as the model and loaded on the nps by intercalating into the (cgt)6/(acg)6 duplexes of the das (table s1). the drug payload of nps was measured by monitoring the dox fluorescence from the supernatant after nps were centrifuged down. as shown in figure 2a, a gradual decrease of dox fluorescence was observed when increasing the molar ratio of nps. by interpolating from a standard calibration curve, the dox payload of each 15-, 8.5-, and 5.5-np was 450 19, 277 28, and 40 13 molecules, respectively. the stability of np/dox complexes was evaluated via a drug leakage experiment using mini dialysis units. as shown in figure 2b, the release of dox from nps was rather slow, with less than 30% of the entire payload detected in the solution after 60 h, in comparison to the rapid diffusion of free dox, indicating high stability of the np/dox complexes. furthermore, the nanoasemblies stored at 4 c for 8 weeks remained mostly intact. (a) dox fluorescence spectra of the supernatant after centrifuging to precipitate the das-modified nps, the dox concentration was fixed at 2 m when increasing the 15-np-das/dox mole ratio. (b) dox leakage dynamics from np-dox complexes (dox: 10 m). (c) clsm images of cem cells after incubation with 15-nps, 8.5-nps, and 5.5-nps (which represent the das-modified nps of 15, 8.5, and 5.5 nm, respectively) at 37 c for 10 or 22 h. the green and blue fluorescence arises from the tamra fluorophore labeled on the 3 end of das and hoechst 33342, respectively. the scale bar represents 5 m. having confirmed the potential of using the np/nr nanoassemblies as nir-responsive drug nanocarriers in buffer solution, we proceeded to test their performance in cells. a nondrug-resistant leukemia cell line, cem, was first used as the cell model. to monitor the cellular uptake and intracellular distribution of nps of different sizes, the das was labeled with a 5-end tamra fluorophore (das-tmr). after modification with das-tmr, the fluorescent particles were incubated with the cem cells at 37 c for different lengths of time. then confocal laser scanning microscopy (clsm) measurements were performed, and the results are shown in figure 2c. nps of 15 nm were mainly localized in the cytoplasm, even after 22-h incubation, as indicated by the tamra fluorescence signal outside the nucleus. in contrast, 5.5-nps accumulated in the nucleus after incubation for 10 h, demonstrating rapid nuclear uptake. for 8.5-nps, no obvious signal was observed in the nucleus for 10-h incubation, but the nucleus emitted tamra fluorescence after incubation for 22 h, indicating that 8.5-np-dass can enter the nucleus starting from 10 h. to strike a balance between drug loading capability and nuclear translocation efficiency, the 8.5-np was used as a model nuclear-uptake nanoscaffold of dox in the following study. to achieve active tumor targeting, sgc8, an aptamer that can specifically bind to protein tyrosine kinase 7 (ptk7, kd=0.8 nm) which is overexpressed on the membrane of cem cells but not ramos cells, the specific binding of sgc8, nr-sgc8, and np/nr-sgc8 to the target cem cells, rather than nontarget ramos cells, was demonstrated by flow cytometry (figure 3a). also, the specific cellular uptake and cytoplasmic location of nr-sgc8s were visualized with clsm (figure s4). moreover, the amount of the internalized nps delivered by the nr-sgc8s was higher than that of equivalent free nps (figure s5), which may have resulted from the high payload and the favorable cell-uptake size of the nanoassembly, as well as the promotion of the cell-internalizing aptamer. specific cell binding and photocontrolled intracellular distribution of np/nr-sgc8s.(a) flow cytometry assay proving the specific binding of sgc8, nr-sgc8, and np/nr-sgc8 to target cem cells not to nontarget ramos cells (lib represents a random library sequence). (b) clsm images of cem cells after treatment with 15-np/nr-sgc8s without (i) and with (ii) nir irradiation or after treatment with 8.5-np/nr-sgc8s without (iii) and with (iv) nir irradiation. from left to right: fluorescence image for np-tmr, nr-cy5, and overlay of the np-tmr, nr-cy5, and hoechst 33342 fluorescence channels plus the bright field channel. the scale bar represents 5 m. the nir-responsive behavior of 8.5-np/nr-sgc8s and 15-np/nr-sgc8s in cem cells was investigated with clsm. without laser treatment, the 8.5-np signal was observed in the cytoplasm and overlapped with the nr-sgc8 signal (figure 3b). however, upon nir irradiation, 8.5-nps were found in the nuclei, while nr-sgc8s remained in the cytoplasm, indicating that 8.5-nps were released from nrs after exposure to the laser and then diffused into the nuclei. the 15-nps remained in the cytoplasm irrespective of nir irradiation, corresponding well with their inability to undergo nuclear internalization. the photocontrolled nuclear internalization of 8.5-nps was further confirmed by using inductively coupled plasma atomic emission spectrometry (icp-aes, figure s6). on the basis of the fluorescence quenching of dox by intercalating into the gc duplex, the intracellular distribution of dox was investigated by treating cem cells with nonfluorophore-labeled 8.5-np-dox/nr-sgc8s. after nir irradiation and then incubation for another 22 h, the recovered fluorescence of dox was highly accumulated in the nuclei, with a relatively small amount in the cytoplasm, indicating that most dox were released in the nuclei (figure s7). however, without nir treatment, the intranuclear dox fluorescence was rather weak, showing a slow and sustained release of dox in the cytoplasm. as a control, cells were treated with free dox, and the dox signal was found throughout the cells, resulting from concentration-gradient diffusion. furthermore, the negligible influence of the laser irradiation on the stability of the np-dox complex was confirmed by the small dox signal change from the 8.5-np-dox/nr-sgc8s-treated cem cells before and right after laser exposure (figure s8). these results show great potential of the 8.5-np-dox/nr-sgc8 system for nir-controlled intranuclear drug delivery. the therapeutic effect of this 8.5-np-dox/nr-sgc8 system on cem and ramos cells was tested by mts assay. as shown in figure 4 and figure s9, the nanomaterials themselves and the pure nir irradiation had little negative impact on either cem or ramos cells (the cell viability of both cell lines remained above 95%), indicating excellent biocompatibility of these nanomaterials and the laser. for free dox, a dose-dependent cytotoxicity was observed on both cem and ramos cells. however, when treated with 8.5-np-dox/nr-sgc8s, only cem cells showed dose-dependent cell inactivity, indicating the selective cytotoxicity of dox delivered by this nanoassembly platform. after nir irradiation, a dramatic decrease of cell viability on cem cells was caused by 8.5-np-dox/nr-sgc8s with a nearly 3-fold lower ic50 of 0.36 m compared to that without nir irradiation (1.22 m). to verify whether the enhanced therapeutic efficacy originated from the synergy of dox, photothermal effect, and np/nr nanocomplexes, cem cells were incubated with free dox and non-dox-loaded 8.5-np/nr-scg8c (the dox loading site of das was replaced with a common dna duplex) together and then irradiated with the nir laser. the therapeutic effect of this case was lower than that of the nir-activated 8.5-np-dox/nr-scg8c, indicating that the synergistic effect was not an important consideration in this system (figure s10). thus, it is reasonable to attribute the enhanced killing efficiency to the released 8.5-np-dox from the nanotruck. to ensure that the nuclear accumulation of nanodrug induced higher cell apoptosis, the nir-activated 15-np-dox/nr-sgc8 system was used as a non-nuclear-uptake control. as shown in figure s11, with nir irradiation, the cytotoxicity of 8.5-np-dox/nr-sgc8s was 24% higher than that of 15-np-dox/nr-scg8c, while no obvious difference was observed in either case without nir irradiation. these results demonstrate that this nuclear-uptake nanodrug delivery system can greatly enhance the therapeutic efficacy on the target cancer cells. viability of cem cells (a) and ramos cells (b) with different treatments. the error bars represent the standard deviation of three independent experiments. to investigate the ability of this nuclear-uptake nanodrug delivery system to address the mdr problem, k562/d, a drug-resistant cancer cell line with overexpression of p-gp (figure s12), was used, while its specific internalizing aptamer, kk1b10, was used as the targeting ligand to functionalize the nanotruck. the specific binding of kk1b10, nr-kk1b10, and np/nr-kk1b10 with k562/d cells was proven by flow cytometry (figure s13). as shown in figure 5 and figure s14, enhanced killing efficiency was achieved by incubating k562/d cells with 8.5-np-dox/nr-kk1b10s with nir irradiation, while a much lower therapeutic effect of free dox was detected for this cancer cell line. to confirm that the enhanced therapeutic effect originates from the intracellular accumulation of dox by this nir-responsive nanodrug delivery system, flow assay was performed to measure the dox signal in k562/d cells under different treatments. upon nir irradiation, the dox fluorescence from the sample incubated with 8.5-np-dox/nr-kk1b10s was 2.5-fold higher than that from the sample incubated with free dox (figure s15). in contrast, without laser treatment, the cells incubated with 8.5-np-dox/nr-kk1b10s produced a modest dox signal. these results demonstrate that this nuclear-uptake nanodrug delivery system can recover the chemotherapeutic sensitivity of k562/d to dox by bypassing cell membrane-expressed p-gp. viability of k562/d cells treated with free dox or nir-activated 8.5-np-dox/nr-kk1b10s. in summary, we have developed a dna-based nanoassembly platform for cancer therapy. unlike traditional intranuclear transport strategies of nanoparticles, no nuclear localization signal (nls) peptides are required in our design, and the nuclear uptake of nanodrugs is mainly attributed to small particle size, thus avoiding complicated nls modification processes and maintaining the valid occupancy of drug-loading probes on the np surface. by using this photocontrolled, size-transformable nanosystem, nanodrugs can be efficiently transported across the cell membrane and enter the nucleus in a coordinated and harmonious manner. furthermore, this dna-based nanoassembly platform can accumulate chemotherapeutic drugs in the nuclei, thus greatly enhancing their therapeutic efficacy against drug-resistant cancer cells by effectively bypassing p-gp. this proof-of-concept structure also opens a new door in the use of nanoassemblies for the design of drug delivery systems for biological and clinical research. to comprehensively evaluate the superiority of this nuclear-uptake nanodrug delivery system, further efforts are being made on the testing in tumor-bearing mice models. on the other hand, since the tissue penetration of the nir laser is limited to around ten millimeters, an alternative strategy for activatable dissociation of the nanoassemblies are needed to apply this system to treatment of drug-resistant metastatic tumors. all dna strands were synthesized on an abi 3400 dna synthesizer (applied biosystems, foster city, ca, usa), and the specific sequences are listed in table s1. both the synthesis and the deprotection processes were conducted as described by the reagent manufacturers. then, the dnas were precipitated by high-salt ethanol in a freezer at 20 c for 30 min and collected by centrifugation at 4000 rpm for 30 min. subsequently, the dna precipitates were dissolved with 400 l of 0.2 m triethylamine/acetate (glen research corp). the purification step was performed by hplc (prostar, varian, walnut creek, ca, usa) with a c18 column (5 m, 250 mm 4.6 mm, alltech) using acetonitrile and 0.1 m triethylammonium acetate (teaa) aqueous solution as the mobile phase. after being dried by a rotary evaporator, the purified dnas were detritylated with 80% acetic acid, precipitated with cold salted ethanol, collected by centrifugation, and dried by vacuum. finally, the dna products were obtained, and their concentrations were measured with a uv vis spectrometer (cary bio-300, varian). nps of 5.5 and 8.5 nm were synthesized by a seed-mediated growth method and then washed by centrifugation to remove hexadecyltrimethylammonium bromide (ctab). the modification of nps with the drug-loading/attaching dna strand (das) was conducted following a reported protocol. the thiolated das (0.2 mm, 20 l) was deprotected by 10 mm tris(2-carboxyethyl) phosphine (tcep, neutral ph, thermo scientific) at room temperature for 60 min and then mixed with 1 ml of nps (20 nm). after incubation for 16 h, the mixture was salt-aged by slowly adding 200 l of nacl (1 m) and allowed to incubate for 16 h. then, the excess dnas were twice removed by centrifugation, and the precipitate was resuspended in 250 l of 1 pbs. silver nanorods were synthesized and washed according to the procedure in our previous report, and the concentration was determined through the longitudinal absorption band of the uv vis spectrum. the selective modification of nr was performed according to a reported protocol with some adjustment. briefly, nrs were incubated with targeting aptamers (nr/aptamer ratio was 1:100) in 2 mm ctab solution for 12 h. then, the capture strands (cs) were added (nr/cs ratio was 1:500) and allowed to incubate for another 12 h. the adsorbed ctab was further displaced with thiolated peg. after that, the modified nr was salt aged by slowly adding 1 m nacl to give a final 0.3 m concentration of na, and the mixture was held at room temperature for at least 12 h. after washing 5 times by centrifugation, the resultant nrs were resuspended in 1 pbs for further use. to fabricate the self-assembly nanocomplexes, the das-modified nps of 5.5, 8.5, and 15 nm were mixed with the modified nrs at a np/nr ratio of 20:1, 15:1, and 10:1, respectively, and incubated at room temperature for at least 24 h. the mixture was then gently centrifuged to remove unbound nps. for dox loading, nps were modified with das whose 3-end portion can form a (cgt)6/(acg)6 duplex with a corresponding cdna. the dox loading was conducted by mixing dox with np-dass, incubating at room temperature for 30 min, and then centrifuging to collect the np/dox complexes. the number of dox per np was determined by measuring the fluorescence intensity of unbound dox in the supernatant and then interpolating from a standard linear calibration curve. for the dox leakage assay, 150 l of np/dox complexes was added to a mini dialysis unit [3.5 molecular weight cutoff (mwko), thermo scientific], and the equivalent of free dox was used as a control. each unit was immersed in 3 ml of 1 pbs in a 5 ml beaker with gentle stirring at 450 rpm. at each given time point, a 100-l aliquot of the dialysis solution was collected for dox fluorescence measurement. after that, the collected solution was returned to the corresponding beaker. cem (human acute lymphoblastic leukemia) and ramos (human burkitt s lymphoma) were purchased from american type culture collection. k562/d (doxorubicin-resistant chronic myelogenous leukemia) was generously provided by dr. troy a. a. harkness of the department of anatomy and cell biology, college of medicine, university of saskatchewan. cem, ramos, and k562/d cells were cultured in rpmi 1640, rpmi 1640, and imdm medium, respectively, supplemented with 10% fbs (heat-inactivated; gibco) and 100 iu/ml penicillin cells (5 10 in 100 l of medium) were incubated with free dox, fluorescent nanoparticles, or nanocomplexes at 37 c with 5% co2 for different time lengths. after several centrifugation/washing steps, the cells were suspended in 1 pbs. for photoactivation, cells were irradiated with nir laser (600 mw/cm) for 10 min. bisbenzimide hoechst 33342 (sigma-aldrich) was used for nuclear staining by incubating with cells at 37 c for 20 min. fluorescence imaging was performed on a leica tcs sp5 confocal microscope (leica microsystems) with a 63 oil-immersion objective. in most cases, the red color represents the fluorescence of cy5 (em=670 nm), the pink color represents the fluorescence of dox (em=600 nm), and the green color represents the fluorescence of tamra (em=570 nm). cem cells (1 10) were incubated with 8.5-np/nr-sgc8s or 15-np/nr-sgc8s at 37 c with 5% co2 for 6 h. then the cells were washed with pbs three times, irradiated with nir laser for 0 or 10 min, and incubated at 37 c with 5% co2 for another 22 h. to extract nuclei, the cells were collected by centrifugation, resuspended in 10 mm tris-hcl buffer (ph 7.4) containing 100 mm nacl, 1 mm edta, and 1% triton x-100 at 4 c for 10 min and finally centrifuged at 1000 g for 3 min. after several centrifugation/washing rounds to remove the adsorbed nanoparticles on the nuclear membrane, the collected nuclei were lysed by a lysis solution containing 0.5% triton x-100 and 1 m naoh with sonication. subsequently, the nanoparticles from the nuclei were digested by incubating with aqua regia at 65 c overnight and diluted in 2% hno3 solution. nps accumulated in nuclei were measured by quantifying au element by inductively coupled plasma atomic emission spectrometry (icp-aes). to evaluate the cell binding affinity of different nanocarriers, the aptamer was labeled with a fluorescein (fitc). cells were incubated with free aptamers, nr-aptamers, or 15-np/nr-aptamers at 4 c for 30 min. after removal of unbound materials by several centrifugation/washing steps, the cells were analyzed on a facscan cytometer (accuri c6) by counting 20 000 events. the cell viability under different treatments was determined by celltiter 96 cell proliferation assay (promega). cells were incubated with free dox, np/nrs, or np-dox/nrs at 37 c with 5% co2 for 2 h and then centrifuged to precipitate. the supernatant (80%) was removed, followed by adding equivalent fresh culture medium (10% fbs). for nir-responsive regulation, cells were irradiated with a nir laser (808 nm, 600 mw/cm) for 10 min, followed by additional incubation to allow further growth for 48 h. then, 80% of the medium was removed and replaced with 20 l of mts reagent diluted in 100 l of rpmi 1640. the resulting cell samples were incubated at 37 c for 12 h. finally, the absorbance at 490 nm was collected using a tecan safire microplate reader, and cell viability was calculated using the equation provided by the manufacturer.

the development of multidrug resistance (mdr) has become an increasingly serious problem in cancer therapy. the cell-membrane overexpression of p-glycoprotein (p-gp), which can actively efflux various anticancer drugs from the cell, is a major mechanism of mdr. nuclear-uptake nanodrug delivery systems, which enable intranuclear release of anticancer drugs, are expected to address this challenge by bypassing p-gp. however, before entering the nucleus, the nanocarrier must pass through the cell membrane, necessitating coordination between intracellular and intranuclear delivery. to accommodate this requirement, we have used dna self-assembly to develop a nuclear-uptake nanodrug system carried by a cell-targeted near-infrared (nir)-responsive nanotruck for drug-resistant cancer therapy. via dna hybridization, small drug-loaded gold nanoparticles (termed nanodrugs) can self-assemble onto the side face of a silver gold nanorod (nr, termed nanotruck) whose end faces were modified with a cell type-specific internalizing aptamer. by using this size-photocontrollable nanodrug delivery system, anticancer drugs can be efficiently accumulated in the nuclei to effectively kill the cancer cells.

PMC4296921

pubmed-1143

public health policy decisions must balance a range of scientific, budgetary, social, and political considerations. ideally, each of these elements should be considered in a transparent fashion before reaching a decision or implementing a specific policy. while socio-political considerations will always be somewhat subjective, scientific evidence can in theory for example, in the setting of a high-profile outbreak, the probability of making political gains or alleviating public fears is not objectively quantifiable (despite their importance to the decision-making process), but scientific outcomes, such as potential trajectories of the outbreak under different policy decisions, can be estimated quantitatively with appropriate tools using the best available data as inputs, such as the known incubation period. in the realm of infectious diseases, the tools for integrating and translating scientific data into policy-relevant outcomes are often classified in the domain of mathematical models, which are defined here as quantitative frameworks for the analysis of dependent happenings (events where the number affected at one time depends on the number already affected). for example, systems of diagnosis and treatment are represented in mathematical terms such as the rate of movement from an infectious to a treated state. these models have the ability to translate existing scientific evidence into projected outcomes at the population level for both endemic diseases like tuberculosis (tb) and epidemic situations such as the ebola virus disease (evd) outbreak in west africa in 20142015, in a way that is transparent and verifiable or refutable by external observers. these estimates can also help with clinical decision-making at the individual level, to improve patient outcomes. unfortunately for most public health decisions regarding the control of infectious diseases, such models are seldom constructed and when they are, they often have limited impact upon the decision-making process. this is likely due to several factors, including perceptions that models are too complex to understand or too dependent on assumptions, coupled with a history of insufficient communication between public health practitioners with specific policy questions and modellers with the quantitative tools to address them. here, the potential role of mathematical modelling in decision-making for health policy in the realm of infectious diseases is explored, and key reasons why mathematical models have historically not fulfilled this potential are evaluated. to do this, the current status of modelling in public health decision-making is first outlined and a case study modelling question described. details of how to construct a relevant model and how to link it to policy are then given, and some of the potential limitations and challenges of using modelling described. finally, a framework by which improved collaborations between public health stakeholders and modellers may broadly benefit public health is proposed. the use of structured frameworks for applying evidence to public health decision-making is well established. for example, the world health organization (who) advocates the use of the grade process, which is a framework that connects a public health question to an evidence-based analysis and recommendation. the united states preventive services task force (uspstf) similarly uses decision-making algorithms to assess the level and quality of evidence to support the introduction of specific interventions. however, these frameworks for using scientific evidence to support policy decisions often lack quantitative assessments of how different decisions will impact health at a population level. this is especially true in the realm of infectious diseases, where dynamics of transmission may cause great disparity between the individual-level benefit or harm of an intervention (for example, side effects of a vaccine for a rare disease such as polio that may outweigh an individual s risk of contracting the disease) and its population-level impact (for example, maintaining elimination of polio through herd immunity). as a result, in settings where population-level benefits are unproven, interventions with strong scientific evidence for individual effectiveness may be recommended over those with a potentially dramatic impact for populations. this decision-making process, if uninformed by insight at the population or system level (as provided by models), may perversely result in outcomes that are good for certain people, but bad for the population as a whole. models can address this knowledge gap by estimating the effects of interventions when the collection of population-level empirical evidence (e.g., from cluster-randomized trials) is infeasible, unethical, or untimely. for example, mathematical models suggested that universal voluntary hiv testing and immediate antiretroviral therapy (art) might dramatically reduce future hiv transmission, even though the individual-level effectiveness of art at higher cd4+t-cell counts is small, and reduced transmission at the population level is difficult to prove empirically. by projecting population-level effects of potential interventions, the models informed not only key policy decisions but also the design of future clinical trials. despite the potential impact that model outputs can have on public policy decisions, the use of models by public health decision-makers has traditionally been limited. many public health and policy decisions must be reached rapidly, in too short a time for new models to be developed, parameterized, and calibrated. modellers must therefore achieve a balance between anticipating future policy questions (in which case models may ultimately not speak to the specific policy question at hand) and responding to existing questions (in which case models may be constructed too late to inform policy decisions). in addition, as mentioned above, complex models that are poorly presented are unlikely to be used by time-pressured policymakers. furthermore, it remains unclear in most settings how to weigh evidence from models against other epidemiological and clinical data. as described below these aspects of models are often not well-understood by public health stakeholders, and as a result, model outputs may be seen as difficult to interpret and untrustworthy. a framework by which modellers and decision-makers can work together to more appropriately incorporate evidence from infectious disease models into public health decisions, without over- or underemphasizing the importance of those models, is proposed here. to demonstrate the utility and process by which mathematical models can inform infectious disease policy, the case study of a new molecular diagnostic test for tb is used: the xpert mtb/rif test (xpert). xpert provides a comparatively rapid, point-of-treatment diagnosis in under two hours, if placed in settings where individuals present for initial tb diagnosis and/or follow-up evaluation. xpert is also substantially more sensitive than the most widely used diagnostic test for tb worldwide (sputum smear microscopy). however, at over 10 times the cost of sputum smear microscopy (which costs less than $2 fully-loaded per test, compared to about $20 for xpert), scale-up of xpert has the potential to dramatically increase the cost of tb control in high-burden settings. the key policy-related questions around the use of xpert are the following: do the clear individual-level benefits of improved diagnosis translate into population-level effects on transmission, and if so, would scale-up of xpert have sufficient impact to justify the added cost (i.e., would xpert be cost-effective)? these questions can be, and have been, addressed effectively using mathematical modelling. in the case of xpert, an initial modelling study projected the impact on tb-associated morbidity and mortality in six countries of southern africa. this study adopted a regional approach, which allowed the authors to use a single model framework (due to similar epidemics across the six countries) and existing data (which are reported on the national level). a global model would likely have required more model complexity, whereas a sub-national model might have been limited by available data or generalizability. the authors aimed primarily to publish their results in the scientific literature, although the model has subsequently been used in country-level discussions and extended to other regions. the model predicted a relatively large potential population level impact of xpert on tb transmission and mortality, based on the assumption that increased rapid diagnosis would increase treatment rates. in the absence of pre-existing data, this model had to make a number of reasonable simplifying assumptions, including the proportion of individuals with tb who would ultimately be diagnosed by the existing algorithm in the absence of xpert and the speed at which that diagnosis might happen. these results which reflected the best available data and assumptions at the time were used to support policy recommendations to scale up xpert in the region and worldwide. subsequent clinical trials revealed that xpert did not identify many more patients than were already being started on treatment, due to unexpectedly high levels of empiric treatment practices in tb-endemic settings. using this new information, the model was then revised to account for empiric treatment practices, and new estimates predicted a much smaller impact of xpert. several of these models were extended into cost-effectiveness analyses of xpert scale-up. this case study illustrates the ability of models to iteratively incorporate updated data, leading to better estimates and highlighting existing weaknesses in both model assumptions and available data over time. a pertinent translation of individual-level effect to population impact is also displayed. unfortunately, the case study also demonstrates the challenges in linking model results to policy. major obstacles exist to the implementation of xpert, especially in trying to use xpert as a true point-of-care test. nevertheless, despite its impact on population health being initially relatively uncertain, xpert has received strong support from policymaking bodies such as the who, based primarily on systematic reviews of sensitivity and specificity. this recommendation places pressure on many high-burden countries to scale xpert up, and at tremendous expense. even in light of emerging data and updated model projections that suggest xpert may not improve population-level outcomes, recommendations to implement xpert have become increasingly strong, partially due to political momentum and the known individual-level benefits of xpert. the policy modelling disconnect in recommendations for xpert contrasts, for example, with that for systematic screening for tb in high-risk populations. systematic screening for tb has been shown in multiple mathematical models to have a potentially dramatic impact at the population level, but the benefits of systematic screening at the individual level are difficult to prove. the recommendation for systematic screening is therefore much less enthusiastic. as a result of this discrepancy between individual-level evidence (which is easier to collect directly but arguably less important to public health) and population-level evidence (which is difficult to collect directly and thus often requires models but is critical to public health decision-making), many countries are pressured to implement xpert rather than systematic screening. this pressure exists despite the evidence from models that systematic screening might have much greater impact on reducing tb at the population level and potentially at a more favourable cost effectiveness ratio. in summary, as shown by the case study of xpert, modelling interventions is often the only way to evaluate the comparative effectiveness (and cost-effectiveness) of interventions at the population level in the short term. in doing so, models may not only help to prioritize those interventions that might have greatest impact at the population level, but may also identify the data elements needed to better inform estimates of such impact for different public health policies. this process which ideally occurs iteratively as new data emerge can lead to better alignment between research efforts and policy priorities. however, major obstacles exist to the implementation of this process, and current practice continues to prioritize infectious disease interventions with more benefit for individuals than for populations. developing a useful model includes identifying, in sequence (1) a useful question and its epidemiological context, (2) a framework through which that question could be addressed, (3) the parameters required to address the specified question using that framework, and (4) the empirical evidence available to inform meaningful values of those parameters (for examples and further details see publications by vynnycky and white and keeling and rohani). once a question, framework, parameters, and empirical evidence have been identified, the model can then be used to inform decision-making by projecting the potential outcomes associated with different policy decisions. for example, in the xpert case study, the question of interest was how big would the impact of this new diagnostic test be? the framework utilized was a transmission model that used both natural history and tb control parameters, such as treatment success, informed by country-level tb programme data. for models to be useful to decision-makers in general, useful models are built to answer a key question that should guide the structure and complexity of the model (rather than the model determining the question). one such question might be to evaluate the expected epidemiological and economic impact of different strategies for scaling up xpert for tb diagnosis (e.g., centralized or in individual clinics), or the required bed capacity during the recent evd outbreak. defining a central question also helps to inform the structure of the model, which should incorporate relevant scientific data (e.g., transmission rates, existing levels of infection control and treatment). the epidemiological setting is also important; for example, a model of implementing xpert should include not only the sensitivity and specificity of the test but also the diagnostic processes, underlying disease prevalence, and clinical algorithms in the chosen setting. a model of tb diagnosis in the usa would need to account for immigration, for instance, whereas a model of tb in sub-saharan africa would require a more detailed description of art scale-up. in some cases first-pass results across a range of settings and interventions; in other cases (or when more precisely calibrated results are needed), separate models will be required for each setting. in general, models allow for an exploration of the system and give a holistic picture of the realm of possible outcomes. as such, uncertainty and sensitivity analyses around the main components of the model are critical. inputs, such as the proportion of patients accessing different diagnostic services, into uncertainty in model sensitivity analyses aim to attribute portions of this uncertainty to specific parameters. in a one-way sensitivity analysis, for example, a key parameter (such as the tb transmission rate) might be set sequentially to its highest or lowest plausible values, and the model results assessed at each of those points. in the case of xpert, population-level impact has been shown to be very sensitive to existing levels of empirical therapy for tb. broader consideration of model uncertainty would explore the impact of a range of plausible empirical treatment levels as well as other model parameters (for example, transmission rates) or indeed do a more comprehensive sampling over all parameters. ultimately, the estimates of any model can only be as accurate as their supporting data, but models can also describe that uncertainty to decision-makers, allowing them to make the most appropriate decisions given existing, imperfect evidence. as such, modelling results with wide confidence intervals that reflect this uncertainty are often valuable to policymakers, as they demonstrate the current state of knowledge. the alternative, where false confidence in predictions is gained via modelling based on strong unsupported assumptions, must be avoided despite the temptation of the clarity of results that such assumptions can provide. models can inform infectious disease public health policy in at least three ways (see figure 1). firstly, models can systematically use epidemiological data to better understand the larger systems in which policy decisions must be made. for example, mathematical models of xpert scale-up in africa have suggested that baseline diagnostic patterns affect the incremental benefit of a novel, more sensitive test, thereby suggesting that policymakers should target xpert roll-out to areas with the weakest existing diagnostic systems. secondly, as described above in the case of universal hiv testing and treatment, models can apply a transparent framework to compare the potential population-level impact of interventions in situations where collecting empirical evidence might be logistically, monetarily, or ethically infeasible. even when broader empirical studies are feasible, interim policies must nonetheless be set; models can help these policies make maximum use of existing evidence before definitive results are known. for example, modelling estimates for the recent evd outbreak in west africa published in september 2014 predicted that without interventions, liberia and sierra leone would have approximately 550 000 reported ebola cases by january 2015. the predictions over a shorter timeframe were closer to what actually occurred; for estimates of case numbers by september 2014, the model overestimated the number of cases by only 8.8% in liberia, and underestimated the number of cases by 7.6% in sierra leone. these results, however, demonstrated at the time what most needed to be done to control the outbreak. wrong but can still be useful. furthermore, the results made under the assumption of no intervention highlight the impact that outbreak control interventions had on the magnitude of the outbreak and these could later be compared to an alternative model structure that incorporates those interventions to further evaluate the impact of those measures. by highlighting how serious things could be if nothing was done, models emphasized the need for control interventions and the aspects of those interventions that might be most important from an epidemic control perspective. thirdly, modelling can point to data gaps that, if filled, could better assist decision-making and control of infectious diseases in the future. for example, tb models might find that the comparative impact of xpert scale-up strategies depends strongly on the amount of ongoing tb transmission in a community, which in many places may not be known. these results could motivate further data-gathering activities (e.g., molecular epidemiological characterization of acommunity, or synthesis of existing programmatic data on tb incidence) that could help to improve decision-making related to xpert scale-up in the future. for the spread of rubella, modelling has already led to the collection of new missing data. in each of these cases, mathematical models provide public health decision-makers with key pieces of knowledge that can inform evidence-based decision-making. furthermore, unlike expert opinion (which often holds sway purely on the basis of reputation or existing dogma), models accomplish this task in a way that is quantitative and open to questioning (or modification) by others in the field. when a model s structure, methods, assumptions, and parameters are laid out in a reproducible manner with direct communication and guidance to those with less methodological expertise, their results should be transparent and accessible rather than being perceived as a while in theory, models are fully transparent, many models are made so complex that few outside the modelling community can fully understand their mechanics. in addition, while models should be tailored to answer a specific policy question of interest, they are often presented in such a fashion that does not speak readily to key policy decisions. modellers must strive to produce transparent outputs that can directly inform the policymaking process, even when this requires some simplification to be made. an important way to improve transparency is to publish the raw data as well as any modelling code. whether provided in the appendix of the publication or in online format, this would provide readers with access to the model and the ability to closely review its methods, thus making a more informed determination as to whether the assumptions and data used were sufficient. open data and code would also allow for the model to be improved and developed iteratively by others in the modelling community to answer other policy-relevant questions. in addition, care must be taken when broadly applying a model specifically structured to answer a certain question. for example, a modelling evaluation of xpert scale-up across southern africa is unlikely to provide useful guidance on where to place xpert machines in the usa, or whether to supplant other funds to pay for xpert testing. however, models can be, and often are, reconstructed as new evidence or considerations come to light. the development begins with models that provide initial insight; such initial models are gradually replaced by more complete models that incorporate updated information. this process of iteratively evaluating modelling output provides a framework in which to place new evidence and improves our understanding of both the problem and the utility of the modelling tool being applied. while the need for such iteration can be seen as a problem with the initial model or input data, it is more appropriately seen as reflecting the natural course of scientific inquiry, in which better data and better tools to utilize those data are continually being developed. presenting the uncertainty around modelling results, as described above, presents a further challenge as it often reflects limited available data on key parameters. in such cases, modellers should honestly portray this uncertainty rather than providing results that appear more reliable, and policymakers should make decisions based on this uncertainty rather than requesting results that are more precise. not including such uncertainty may be justified in specific cases such as when the infectious disease situation being modelled (e.g., when considering just a no intervention scenario) is unrealistic and specific policy decisions are not based on this quantitative value but is generally not recommended. there are also significant ethical considerations that must be taken into account when using the results of mathematical models to design public health interventions. these include considering the values and preferences of the target population as well as the available resources. determinants of health behaviour must be viewed in a social context, including the cultural beliefs, historical patterns, and choices available to the local population. if applied in a vacuum, modeling results may not be relevant to the target population and the estimated impact of a chosen intervention will likely not be realized. how can we improve the utility of modelling for infectious disease relevant to public health decision-making in the future? one important component of any such strategy should involve ongoing collaboration and interaction between infectious disease modellers and public health stakeholders. such communication and collaboration enables decision-makers to appropriately understand the complexity of model structure and uncertainty in modelling results, and modellers to inform additional refinements or data-gathering efforts to reduce that complexity and uncertainty. in addition, both modellers and public health policymakers must view the results of models within the social context of the target population to consider the ethical impact of applying modelling results to specific settings. fostering such collaboration will improve the availability of models to public health practitioners, as well as the quality of model structure and relevance of results. it will also improve the likelihood that the perspectives and needs of all critical stakeholders are included. to promote such public health stakeholder collaboration and optimize the role mathematical modelling can have in public health decision-making in the field of infectious diseases, an iterative process for model development is recommended (figure 2). the key stages in this process are: (1) policymakers engage modellers early in the decision-making process and inform them of the key public health questions that are being considered in a given population and/or clinical setting. (2) modellers use this information to construct models that are most likely to effectively address these questions. (3) modellers strive to reduce, or fully justify, the complexity of their models and explain the context and uncertainty of their outputs to decision-makers and others who could openly interrogate their methods. (4) decision-makers seek to incorporate model results into their decision-making process (including decisions for more data gathering) and inform modellers of where model structures, outputs, and uncertainty could be refined for future decision-making. to succeed in this endeavour, it is important that modellers and decision-makers build mutual trust over time; these steps are difficult to complete in a one-off fashion for each new question that arises. platforms for such interaction, such as conferences and workshops, should be developed and promoted to stimulate discussion and interaction around the important questions and how to address them, including how to share key data. as effective communication is only possible when modellers and stakeholders speak the same language, it is critical that these communities work together to establish long-term collaborative relationships. as an example of such longer-term collaboration between infectious disease modellers and infectious disease policymakers, for example, the tb modelling and analysis consortium (tb mac) brings together quantitative researchers, policymakers, tb programmes, and donors to identify tb control questions that require modelling input. discussion and interaction between tb control stakeholders is also supported by the tb modelling group at johns hopkins, which holds frequent international conference calls to examine the latest research and areas of interest. such multidisciplinary collaboration is also being seen in other infectious disease fields, where modelling studies have been used to assist public health interventions and policy-making decisions around hiv, influenza, and evd. while such relationships take time to build, are difficult to incentivize from both the academic and public health perspectives, and may not yield immediate results, increased communication between modellers and public health policymakers is arguably the only viable path towards bringing the wealth of existing epidemiological evidence to bear in making public health decisions for infectious diseases. infectious disease modelling can provide important and useful data to inform public health policy by improving our knowledge of epidemic disease spread, comparing the impact of potential public health interventions and understanding gaps in existing data used to inform public health decision-making. for models to be most useful, challenges in applying modelling results to public health practice, including the complexity of model structure and uncertainty of model outputs and their relevance to important policy questions, must be understood and considered. while modelling will not provide all the answers for public policy, it can provide useful quantitative evidence when large clinical studies are not possible or are still underway. a framework that can be used to improve the process of applying modelling to public health decision-making for infectious diseases is proposed. collaboration between public health stakeholders and modellers is essential to heighten the transparency and public health relevance of models, to optimize the use of epidemiological data for decision-making, and to develop policies that incorporate scientific evidence to improve the control of infectious diseases worldwide.

summarythe dominant approach to decision-making in public health policy for infectious diseases relies heavily on expert opinion, which often applies empirical evidence to policy questions in a manner that is neither systematic nor transparent. although systematic reviews are frequently commissioned to inform specific components of policy (such as efficacy), the same process is rarely applied to the full decision-making process. mathematical models provide a mechanism through which empirical evidence can be methodically and transparently integrated to address such questions. however, such models are often considered difficult to interpret. in addition, models provide estimates that need to be iteratively reevaluated as new data or considerations arise. using the case study of a novel diagnostic for tuberculosis, a framework for improved collaboration between public health decision-makers and mathematical modellers that could lead to more transparent and evidence-driven policy decisions for infectious diseases in the future is proposed. the framework proposes that policymakers should establish long-term collaborations with modellers to address key questions, and that modellers should strive to provide clear explanations of the uncertainty of model structure and outputs. doing so will improve the applicability of models and clarify their limitations when used to inform real-world public health policy decisions.

PMC4996966

pubmed-1144

castleman's disease is a rare b-cell non-clonal lymphoproliferative disorder first described over 50 years ago characterized by its variegated presentation. it can practically affect any region within the body, the most common being the chest in about 70%, the abdomen in about 15% and the remaining occurring within the neck. this condition may resemble other entities causing lymphadenopathy including lymphomas, infectious or inflammatory causes. the predominant histopathological variants include the more common hyaline vascular type, the plasma cell type which is usually associated with poems syndrome, castleman's disease seen with hhv-8 infection usually found in hiv and immunosuppressed patients and an unspecified form of multicentric castleman's disease. castleman's disease is clinically classified into a unicentric variety, which is usually asymptomatic, or a multicentric variety, which can be associated with systemic inflammatory state manifesting with constitutional symptoms such as fever, night sweats and weight loss, depending on the number of lymph nodes involved [1, 2]. in certain cases, this systemic inflammatory state can be complicated by secondary amyloidosis characterized by deposition of serum amyloid a protein within the extracellular tissue. castleman's disease has not demonstrated any sex predilection, with unicentric variety peaking in incidence within the second to fourth decades of life, while multicentric variety occurs in older populations. secondary (aa) amyloidosis has been reported with both unicentric and multicentric variants of castleman's disease. the prognosis of castleman's disease is related to the extent of systemic involvement either directly from the disease itself or from co-existing systemic amyloidosis. untreated systemic amyloidosis also often has an unrelenting clinical course, leading to multiorgan failure and death. the degree of regression of amyloidosis itself is often contingent upon the variant of castleman's disease, with surgical excision of the primary tumor in a unicentric variant being potentially curative [1, 2]. we report a rare association of unicentric castleman's disease with secondary (aa) amyloidosis. a 51-year-old african-american man who had been born and raised in the united states first presented to the medical clinic with complaints of generalized weakness, fatigue, unintended weight loss, anorexia and progressively worsening abdominal distension of 3 months duration. physical examination at the time was significant for a firm, indurated right-sided submandibular mass, hepatomegaly and mild epigastric tenderness. an initial set of laboratory studies showed abnormal liver enzymes (alanine transaminase of 61 iu/l, aspartate transaminase of 83 iu/l, markedly elevated alkaline phosphatase of 1,003 iu/l and gamma-glutamyl transferase of 1,879 iu/l with normal bilirubin levels). additional work-up done for evaluation of abnormal liver enzymes including viral hepatitis panels (hepatitis a, b and c), anti-nuclear antibody, anti-smooth muscle antibody, anti-liver kidney microsomal antibodies and anti-mitochondrial antibody were negative. the patient underwent biopsy of the submandibular mass that revealed features of castleman's disease (fig. 1). a subsequent liver biopsy revealed perisinusoidal deposition of eosinophilic, amorphous material within the extracellular matrix with hepatocyte atrophy, consistent with hepatic amyloidosis (fig. bone marrow biopsy revealed diffuse extracellular eosinophilic, amorphous material consistent with amyloidosis with increased kappa light chain-restricted plasma cell count (6% of hematopoietic bone marrow cells) (fig. the patient underwent a colonoscopy that revealed no gross mucosal lesions; biopsies were unremarkable. a definitive diagnosis of secondary (aa) reactive amyloidosis with hepatic involvement ascitic fluid analysis revealed an elevated serum-ascites albumin gradient of 1.7 and very low protein of 0.9 g/dl. he was treated with intravenous antibiotics. a computed tomography scan of the abdomen done at the time revealed dilated loops of small bowel consistent with small bowel obstruction, which resolved with conservative management. he was not considered for chemotherapy in view of active infection and was not a liver transplant candidate because of his poor physical condition. the patient was discharged to be readmitted only 2 weeks later with recurrent ascites from decompensated liver disease. his clinical condition rapidly deteriorated with superimposed severe metabolic acidosis resulting from acute renal dysfunction. castleman's disease often presents in sixth to seventh decades of life with more than half of affected patients being male. patients with multicentric castleman's disease universally present with peripheral lymphadenopathy as seen in our patient. only a few cases of secondary (aa) amyloidosis complicating castleman's disease [7, 8, 9] have been reported in the literature. extensive hepatic involvement from primary systemic amyloidosis is seen in almost two-thirds of the patients [10, 11], but to a lesser degree in secondary (aa) amyloidosis [12, 13]. hepatic amyloidosis is often asymptomatic, the most common presentations being hepatomegaly in more than two-thirds of those affected and elevated alkaline phosphatase. hepatic amyloidosis is characterized by parenchymal replacement by amyloid leading to pressure atrophy of the hepatocytes. ascites, as seen in our patient, is a rare finding and is often a function of decreased cardiac contractility from amyloid infiltration or hypoalbuminemia from nephrotic syndrome. our patient had a normal cardiac ejection fraction of 71% on echocardiogram, but was profoundly hypoalbuminemic from heavy proteinuria. he was observed to have cholestatic liver function tests with jaundice, which is exceedingly rare and often portends poor outcome [15, 16]. he also likely had collateral gastrointestinal amyloidosis with symptoms like unintended weight loss and was found to have intestinal pseudo-obstruction as well, which likely resulted from enteric neuropathy from amyloid deposition. it has been noted in a small-size study that use of ursodeoxycholic acid could be of benefit in hepatic amyloidosis, with improvement in serum alkaline phosphatase and gamma-glutamyl transferase levels. the role of liver transplantation was studied extensively in familial variants of amyloidosis [19, 20, 21], to a lesser degree in primary (al) amyloidosis, but not in secondary reactive amyloidosis. however, the crux of treatment of secondary (aa) reactive amyloidosis lies at treating the underlying precipitating inflammatory condition. there has been a steady increase in survival in patients with reactive amyloidosis secondary to advances in treatment strategies for underlying inflammatory disorders. excision of unicentric castleman's tumor often leads to regression of aa amyloidosis by suppressing cytokine production. however, our patient did not show an optimal clinical response even after excisional biopsy of the submandibular castleman's tumor. to our knowledge, this case is one amongst only few that presented systemic amyloidosis complicating castleman's disease. this case is unique in that extensive, diffuse amyloid deposits were observed in the liver with cholestatic jaundice. it is also the first reported case where secondary amyloidosis failed to regress even after removal of the primary trigger, the focal castleman's tumor. the authors do not have a direct financial relation with the commercial identities mentioned in the paper that might lead to a conflict of interest.

we report this case of secondary amyloidosis associated with castleman's disease. a 51-year-old man presented with systemic symptoms of generalized weakness, fatigue, unintended weight loss, anorexia and progressively worsening abdominal distension. on examination he was found to have an indurated right-sided submandibular mass and tense ascites. he was found to have multiorgan dysfunction with deranged liver function tests and renal failure. ascitic fluid analysis revealed evidence of spontaneous bacterial peritonitis. biopsy of the submandibular mass revealed angiofollicular lymph node hyperplasia consistent with a diagnosis of castleman's disease. a subsequent liver biopsy showed extensive deposition of amyloid protein. bone marrow biopsy also showed the presence of amyloid and increased kappa light chain-restricted plasma cells. the patient was not considered a candidate for chemotherapy or solid organ transplantation in view of active sepsis and poor physical condition. secondary systemic amyloidosis complicating castleman's disease is very rare. untreated secondary systemic amyloidosis often has a rapidly fatal course, such as seen in our patient.

PMC3843903

pubmed-1145

this is especially true about microorganisms, which reside and thrive in almost all environments on earth, including some considered extremely harsh. common environmental factors that affect the activities of microorganisms include temperature, ph, water availability, nutrient limitation, presence of various chemicals, osmolarity, pressure, and radiation. consequently, for every microorganism the ability to adapt rapidly to changes in environments is essential for its survival and prosperity. many single stress-induced regulatory circuits have been identified, which enable cells to cope with specific stresses. however, given that microbial cells live in a dynamic environment where multiple factors fluctuate constantly at the same time, stress responses are generally carried out by a regulatory network composed of a series of individual circuits which are highly connected. most of our understanding of microbial stress response mechanisms has come from the study of model microorganisms, particularly escherichia coli and bacillus subtilis. extensive physiological and genetic analyses of the stress response systems in these two bacteria have helped us to elucidate the complexity of the process, function of critical proteins, and regulation. while model organisms will continue to provide insights into the fundamental properties of the stress response systems, efforts should be extended to other microorganisms, especially those that are of scientific, environmental, and economic importance. as one of representatives, the family of shewanellaceae (order alteromonadales, class -proteobacteria) is emerging in recent years. the genus shewanella consists of rod-shaped, gram-negative, aerobic or facultatively anaerobic, polarly flagellated, readily cultivated -proteobacteria [58]. shewanellae are renowned for its ability to use a diverse range of electron acceptors for anaerobic respiration, including fumarate, nitrate, nitrite, thiosulfate, elemental sulfur, trimethylamine n-oxide (tmao), dimethyl sulfoxide (dmso), fe(iii), mn(iii) and (iv), cr(vi), u(vi), as(v), v(v), and others [10, 11]. as a result of this property, shewanellae have drawn much attention in the fields of bioremediation, biogeochemical circulation of minerals, and bioelectricity [12, 13]. in addition, shewanellae have now served as the model for ecological and evolutionary studies at the whole genome level because of its diverse habitats and the availability of up to 26 genome sequences [14, 15]. however, stress responses have focused nearly exclusively on shewanella oneidensis, the first genome of the shewanellae to be sequenced. the availability of the genome sequence allowed development of high-throughput technologies such as microarrays and proteomics tools, with which an array of assays has been carried out to decipher the ability of s. oneidensis to respond to and survive external stresses. while impacts of most of common environmental factors have been examined, oxidative stress imposed by h2o2 is surprisingly untouched. in this paper, we consider all insights into the stress response mechanisms revealed thus far in s. oneidensis and broaden our discussion to other sequenced species if necessary. stress response to sudden fluctuation in growth temperature, has become a model system for studying the impact of environmental stresses on biological systems. the hallmark of this adaptive cellular response is the induction of a limited set of proteins, called heat shock proteins (hsps) or cold shock proteins (csps). in general, hsps play important roles in protein folding, degradation, assembly of protein complexes, and transport of proteins across membranes whereas csps function as rna chaperons to regulate ribosomal translation, rate of mrna degradation and termination of transcription [1719]. using whole-genome dna microarrays, temporal gene expression profiles of s. oneidensis mr-1 in response to temperature variations have been investigated [20, 21]. both heat and cold shock responses appear to share a couple of common features, including that approximately 15% of the total genes are significantly affected (p<0.05) over a 25-min period, that the global changes in mrnas are rapid and transient, and that a similar set of proteins are induced to manage energy production and protein damage. for instance, most of genes encoding enzymes in the entner-doudoroff pathway and the pentose cycle are highly induced upon a temperature alteration. in the case of heat shock response, two lines of evidence suggest that s. oneidensis copes with the situation with mechanism similar to that employed by e. coli. first, the majority of the genes that showed homology to known hsps in e. coli such as dnak, dnaj, groel, groes, grpe, htpg, and lon/la proteases were highly induced. second, the identified consensus sequences (cttgaaa-13/15bp-ccccat) of both bacteria for heat shock gene promoters are virtually the same (figure 1), indicating that the induction of most hsps owns to a rapid and transient increase in the intracellular concentration of an alternative factor, encoded by rpoh. after numerous attempts, we failed to remove rpoh from the genome, implicating that is essential in s. oneidensis (unpublished result). additionally, some hypothetical proteins (i.e., so2017) are under the control of, suggesting that s. oneidensis recruits new proteins to overcome increased temperature (table 1). unlike e. coli, possesses three (of which two (so1648 and so2787) are cold inducible) whereas e. coli has nine (of which four are cold inducible). both so1648 and so2787 are important in growth at low temperatures evidenced in the mutational analysis. the s. oneidensis genome carries two more genes encoding csd(cold shock domain)-containing proteins (so0733, 203 aa; so1732, 224 aa) whose c-terminal lacks sequence similarity to any known proteins. intriguingly, such a structure has been found only in eukaryotes, with the exception of mycobacterium. neither so0733 nor so1732 is found to be induced upon a decrease in temperature or influences growth at low temperature, indicating that these csd-containing proteins may not be involved in cold stress response. s. piezotolerans wp3 is another shewanella that has been studied in respect of response to low temperatures. strikingly, none of its csps are cold inducible, suggesting that these proteins may not play an indispensible role in the process. these include increased production of epa (eicosapentaenoic acid) and bcfa (branched-chain fatty acid), induced expression of rna helicase dead which may facilitate transcription, morphological changes in cell membrane, and elevated assembly of lateral flagella (the organism possesses both polar and lateral flagella.). in addition, a novel filamentous phage (sw1) is found to be significantly induced at low temperature but the significance of this event in the cold adaptation of s. piezotolerans wp3 is unknown. microorganisms live in a volatile environment where extracellular ph changes frequently. to minimize the acid- or alkaline-induced damage, various adaptive strategies have evolved [28, 29]. studies on e. coli have revealed that bacterial cells activate outward h pumps such as k/proton antiporters in response to acute cytoplasmic acidification and sodium proton antiporters, which bring in 2 h for each na extruded, to adapt to alkaline ph in the presence of na. to survive upon prolonged acid stress exposure, cells rely on the arginine and glutamate decarboxylase/antiporter systems, which are thought to counteract external acidification through the consumption of intracellular protons and the generation of alkaline amines. additional acid tolerance responses include regulation of proton permeability by induction of membrane proteins and lipid modification enzyme. in the case of alkaline stress, amino acid metabolic enzymes such as tryptophan deaminase (tnaa) and o-acetylserine sulfhydrylase a (cysk) are induced to reverse alkalinization by metabolizing amino acids to produce acidic products. the response of s. oneidensis to acid and alkaline stresses intersects with other stresses evidenced by elevated expression of rpos, a central regulator of stationary-phase gene expression. it is reasonable to speculate that s. oneidensis cells upon altered ph mimic those at the stationary phase. in respect of response to acidic ph, the most important and effective player of e. coli in mediating acid resistance is the glutamate-dependent (gad) system, which is missing in all sequenced shewanellae. additionally, none of genes encoding h ex-pumps are found to be induced. instead, proteins showing substantial induction are rather diverse, including those functioning in cell envelope structure (e.g., csg genes), glycogen biosynthesis (glg operon), fatty acid metabolism (fadba), glutamate synthesis (gltbd), phosphate transport (so1724 and pstb-1), and regulation (e.g., rpos and phou). this observation indicates that the molecular effects of acute acidic ph are profound and multifarious. upon alkaline ph, as in e. coli na/h antiporter systems (nhaa) are particularly important in maintaining a ph-homeostatic mechanism, thus enabling s. oneidensis to survive and adapt to external alkaline conditions. the most important one is regulation of aquaporins in the outer membrane for water intake by the stationary-phase sigma factor, rpos. it is common that upon the stress condition k uptake is activated and k ions are maintained at high levels. additionally, cells accumulate neutral, polar, small molecules, such as glycine betaine (gb), proline, trehalose, or ectoine. these compatible solutes serve as osmoprotectants and are synthesized and/or imported into the cell. many shewanella species are marine microorganisms and therefore are naturally tolerant to relatively high levels of salt. although some like s. oneidensis, are obtained from freshwater environments, they are able to grow in the presence of up to 0.6 m nacl. genes encoding k uptake proteins, na efflux system components, and glutamate synthesis are found to be highly induced. nonetheless, some novel mechanisms are observed. genes encoding proteins involved in accumulation of compatible osmolytes are either missing in the genome or transcriptionally unaffected when encountered stress. interestingly, genes encoding tca cycle are particularly active, probably producing much needed atp for ion transport. this may also explain that s. oneidensis shows reduced motility and chemotaxis responding capability under the stress given that the assembly of flagella is extremely energy consuming. although dna is the major chromophore in general, effects of radiation are in fact pleiotropic [35, 36]. s. oneidensis, one of the most radiation-sensitive organisms known so far, is approximately 1 order of magnitude more susceptible to all wavelengths of solar uv, uv, and ionizing radiation than e. coli [35, 3740]. this is strikingly because the organism similar to e. coli possesses the complete set of genes for photo-reactivation, and nucleotide excision repair, and sos response, primary mechanisms that protect cells from dna damages and radiation-induced oxidative stress [16, 41, 42]. all of these s. oneidensis genes appear to be functional and crucial in the cellular response to radiation, supported by significant upregulation in transcriptional analyses. it is interesting to note that shewanella strains vary significantly in their susceptibility to radiation although compared to e. coli they are still much less resistant. the general trend is that the more radiation exposure is in the habitat where the organisms are isolated the less sensitive they are. for instance, s. oneidensis mr-1 from lake sediment and s. putrefaciens 200 from a crude oil pipeline are more sensitive to radiation than s. algae from the surface of a red alga and s. oneidensis mr-4 from the surface of the black sea. it has been suggested that the hypersensitivity to radiation may be in part due to the activation of prophage [3840]. radiation has been used as a standard approach to induce prophage in a variety of bacteria [43, 44]. in s. oneidensis, upon radiation the majority of lambdaso, muso1, and muso2 genes are induced and phage particles have been found in the cultures, indicating that a great number of cells are lysed by lytic phages. it has also been implicated that a large number of iron-containing proteins may be partially accountable for the susceptibility. compared to e. coli which hosts only five to seven cytochrome c proteins, s. oneidensis contains 41 such proteins, some of which are electron transport proteins and essential in respiration [45, 46]. damages on these proteins by reactive oxygen species (ros) generated in cells upon radiation would likely cause two detrimental results. first, damaged proteins per se may be dysfunctional, directly reducing ability to survive or thrive. second, damaged proteins release irons into cultures, which further induce ros production. this second wave of ros may be more fatal because it comes at the onset of recovery of seriously damaged cells. furthermore, the finding that the intracellular mn/fe concentration ratios correlate well with resistance to radiation may explain the hypersensitivity of s. oneidensis, which has the lowest ratio among bacteria tested so far [35, 49]. many of metal elements are required for microbial growth mostly as cofactors in metabolic pathways. shewanellae have attracted much attention because of their ability to reduce metal ions including chromium, cobalt, iron, manganese, technetium, uranium, and vanadium, some of which are not needed and highly toxic for most organisms [10, 51, 52]. at the low level these metal ions are taken as electron acceptors by cells and mildly induced some stress-associated genes. however, at the high concentration some of them elicited a distinctively different pattern [5460]. the cellular resistance mechanisms displayed by microorganisms are diverse and include biosorption, diminished intracellular accumulation through either direct obstruction of the ion uptake system or active chromate efflux, precipitation, and reduction of metals to less toxic form. multiple regulatory circuits are found to work together to cope with the stress response of s. oneidensis to heavy metal compounds. the major ones include those modulating oxidative stress protection, detoxification, protein stress protection, iron acquisition, and dna repair. the molecular response of s. oneidensis to heavy metal shock elicits a distinctively different transcriptional profile compared with metal reduction [5360]. this observation is consistent with that metal reduction and toxicity resistance mechanisms are to be unlinked cellular processes. responses of s. oneidensis to acute stresses imposed by a variety of heavy metals share a common strategy: survive first and then exert both general and specific stress responses. as a result, s. oneidensis up-regulates its resistance-nodulation-cell division (rnd) protein family genes that facilitate cation export and thus confer heavy metal resistance. once the first line of defense is initiated, cells employ both general and specific stress responses that are inseparable from each other to recover from the crisis. alternative sigma factors including rpos, rpoh, rpoe, along with stress-response-related genes are induced, leading to induction of a variety of detoxification, resistance, and transport functions. such coordinated expression of stress response and detoxification mechanisms in s. oneidensis may offer an advantage to thrive in anoxic metal-reducing conditions in aquatic sediment and submerged soil systems where substantial amounts of heavy metals can be generated. the first is that genes/proteins involved in iron transport are transcriptionally active and implicated to play an important role in the process. although induction of siderophore biosynthetic and iron transport genes may not be a direct consequence of intracellular iron limitation, several lines of evidence suggest that it is more likely to be indirect by interfering with the fur (ferric uptake regulator) protein, which eventually results in derepression of the iron regulon. several reports have demonstrated that co, mn, or other divalent cations interact with the fur-binding sites [62, 63]. moreover, iron-chelating siderophores from other microorganisms have been shown to be able to bind other metals, such as thorium, uranium, vanadium, and plutonium [64, 65]. by increasing siderophore production the other is that sulfur transport and assimilation is promoted. while the underlying mechanism is currently unknown, an explanation is offered. in s. oneidensis, reactive oxygen species (ros) produced in cells by heavy metal stresses can damage iron-containing proteins. as cysteine residues in these proteins are essential to their functions, an extra mount of cysteine is needed for protection. to this end, cells elevate transportation of inorganic sulfate which is reduced and incorporated into bioorganic compounds via assimilatory sulfate reduction, which is the major route of cysteine biosynthesis in most microorganisms. as a potential strategy for the reductive immobilization or detoxification of environmental contaminants, in situ bioremediation has received much interest and attention in last 20 years and are becoming more prevalent today. as its intrinsic feature, the application puts its work force, mostly bacteria, in situ facing the unpredictability of individual microbial processes and constant fluctuations in environments. thanks to the availability of the s. oneidensis genome sequence, stress responses of the microorganism have been extensively investigated, generating a handful of insights into mechanisms adopted to cope with detrimental conditions. nonetheless, adaptive mechanisms of shewanella to environmental stresses are still a large playing field for three reasons. first, a number of common stressful agents, especially reactive oxygen species, are not visited. second, the complex components and regulation in the bacterial stress responses discussed in this paper are mostly based on transcriptional profiling and thus experimental validation is urgently warranted. last, but definitely not the least, the genus is composed of members which are not only isolated from extremely diverse habitats but also lack unifying phenotypic features, prompting exploration to be extended to other ecological groups of the shewanellae.

the shewanellae are ubiquitous in aquatic and sedimentary systems that are chemically stratified on a permanent or seasonal basis. in addition to their ability to utilize a diverse array of terminal electron acceptors, the microorganisms have evolved both common and unique responding mechanisms to cope with various stresses. this paper focuses on the response and adaptive mechanism of the shewanellae, largely based on transcriptional data.

PMC3168786

pubmed-1146

since the beginning of mankind nature has been contributing considerably to drug discovery for human beings by providing remedial treatments. one of nature's treasures is the marine biotope, which occupies almost three quarters of the earth's surface (fenical, 1993; whitehead, 1999). marine natural products play an increasingly important role in biomedical research and drug development, either directly as drugs or as lead structures for bioinspired chemical drug synthesis (molinski et al., many marine natural products, especially those isolated from macroorganisms, have already undergone clinical trials (newman and cragg, 2004). during the last decades, however, repeated isolation of known metabolites and a reduced hitrate of novel compounds from marine macroorganisms were observed. hence, natural product chemists are turning their interest to so far less investigated drug sources, such as marine fungi and bacteria, which turned out to be a vast untapped reservoir of metabolic diversity. thus, research on chemistry of natural products derived from marine microorganisms has increased tremendously in recent years due to the demand for compounds having potential pharmaceutical applications or economical value as cosmetics, drugs, fine chemicals and functional personalcare products (andersen and williams, 2000). in contrast to macroorganisms, microorganisms represent promising natural product sources having the advantage of feasible and sustainable production of large quantities of secondary metabolites with reasonable cost, by largescale cultivation and fermentation of the source organisms (waites et al., 2001). furthermore, to adapt and survive in the marine ecosystem, characterized by very special conditions that differ from those found in other habitats, marine microorganisms sometimes accumulate structurally unique bioactive secondary metabolites not found in terrestrial organisms (bhakuni and rawat, 2005). natural products research still has an enormous unexploited potential, and the significant advantages and disadvantages of natural productderived molecules as drug candidates for development have been highlighted in numerous articles (rogers, 2004). the importance of natural product discovery from microorganisms started only after the largescale production of penicillin (1) during world war ii (numbers 1101 in bold refer to chemical structures 1101 at the end of this article). after the end of the war, pharmaceutical companies refocused on the search for new bioactive biomolecules. in the 1970s for example, cholesterol biosynthesis inhibitors, compactin (2) (larsen et al., 2007) and mevinolin (3) (araki and konoike, 1997) were discovered. the discovery of compactin and mevinolin enabled the development of the highly successful statin therapeutics (4) (endo, 1992), which even today are considered as block buster in pharmaceutical sales. the discovery of streptomycin, gentamicin, omegamycin (5) and other antibiotics pushed the pharmaceutical industry to implement large research and developing programs based on natural product discovery, with a recent emphasis on marine microbial fermentation based technologies. the water column of the oceans contains approximately 10 bacterial cells per millilitre (hagstrm et al., 2002). marine bacteria and fungi are of great interest as novel and rich sources of biologically active products. they live in close association with softbodied marine organisms, which lack obvious structural defence mechanisms, and thus rely on chemical defence by production of bioactive secondary metabolites, either by themselves or by associated microflora, to survive in their extreme habitat (jensen and fenical, 1994). in the last decades, the number of reported secondary metabolites from marine bacteria and fungi has steadily increased (fenical, 1993; kobayashi and ishibashi, 1993; bernan et al., 1997; faulkner, 1997; 1998; 1999; 2000; 2001; blunt et al., 2003; 2004; 2005; 2006; 2007; 2008; 2009; hill, 2003), thus reflecting the growing attention by groups from academia and industry. in the year 2007 alone 961 new compounds were described from marine microorganisms reflecting an increase of 24% compared with the number of compounds reported for 2006 (blunt et al., 2009). in the following, selected examples of new secondary metabolites from bacteria and fungi, published in the period 200709, that live in association with marine macroorganisms, such as sponges, algae and mangrove plants, are presented, with special emphasis on bioactive products and their modes of their action, as well as source organisms and place of origin. chemical structures are only shown for new compounds, or for previously reported compounds with newly reported biological activities. since the discovery of penicillin in 1928 (fleming, 1929), intensive studies, mainly on soilderived bacteria and fungi, demonstrated that microorganisms are a rich source of structurally unique bioactive substances (fenical, 1993). the increasing need for new antimicrobial agents able to control emerging diseases or resistant strains of microorganisms inspired a growing number of research groups to explore the oceans for new bioactive compounds. throughout the years, extensive screening programs were developed worldwide and great efforts have been devoted aiming of the isolation of new metabolites from marine microorganisms. cultures of the marine bacterial isolate brevibacillus laterosporus png276 obtained from papua new guinea yielded a new lipopeptide named tauramamide (6), together with its methyl (7) and ethyl esters (8). structures were elucidated by analysis of nmr and ms data and by chemical degradation as well as by total synthesis of tauramamide (6) and tauramamide ethyl ester (8). compounds 6 and 8 showed potent [minimum inhibitory concentration (mic) values of 0.11 m] and relatively selective activity against the important grampositive human pathogen enterococcus sp. the ethyl ester (8) showed weaker activity against multidrugresistant staphylococcus aureus, but neither compound was appreciably active against the yeast c. albicans. tauramamide (6) is a new lipopeptide antibiotic that contains two d amino acids and is acylated at the nterminus. both structural features are hallmarks of nonribosomal peptide synthase biosynthetic origin (desjardine et al., 2007). a member of the new bacterial genus marinispora (strain nps008920) was isolated from a sediment sample collected in cocos lagoon, guam. chemical investigation of this strain afforded a series of novel 2alkylidene5alkyl4oxazolidinones, lipoxazolidinone a (9), b (10) and c (11). compounds 911 showed broad spectrum antimicrobial activities similar to those of the commercial antibiotic linezolid (zyvox) (barbachyn and ford, 2003). lipoxazolidinones a (9), b (10) and c (11) and the hydrolysis product 12 were screened against a panel of various grampositive and gramnegative bacteria. compound 9 showed broad spectrum activity, with mic values ranging from 1.56 to 15.57 m against grampositive bacteria and 37.38 m against two strains of haemophilus influenzae. compounds 10 and 11 showed also broad spectrum antibacterial activity, albeit with lesser overall potency than 9. in contrast, the hydrolysis product of 12 showed only weak activity against mssa (methicillinsensitive s. aureus), indicating the importance of an intact oxazolidinone ring system. while the oxazolidinone heterocycle is a common structural motif shared by the lipoxazolidinones and linezolid, the compounds are clearly distinguished as 4 and 2oxazolidinones, respectively, and each class is uniquely substituted. thus, the 4oxazolidinones offer a unique scaffold of compounds with antibiotic therapeutic potential (macherla et al., 2007). the new marine actinomycete, nps12745, was recently isolated and described from a marine sediment collected off the coast of san diego, california. the analysis of the fulllength 16s rrna sequence indicated that nps12745 is a novel strain of the recently described marine actinomycete genus marinispora. chemical investigation of this novel strain yielded a series of new chlorinated bisindole pyrroles, lynamicins ae (1317). the bisindole pyrrole derivatives are small molecules, and include chromopyrrolic acid which was previously isolated from chromobacterium violaceum (hoshino et al., 1993) as well as lycogarubins ac known from the myxomycete lycogala epidendrum (frde et al., 1994; hashimoto et al., the antibacterial activity of the compounds against a panel of grampositive and gramnegative bacteria was studied and substances 14 and 15 were found to be active against s. aureus (mssa, mrsa: methicillin resistant), staphylococcus epidermidis and enterococcus faecalis, suggesting potential for treatment of nosocomial infections (mcarthur et al., 2008). screening of 100 bacteria, which were isolated from intestinal tract of fish that landed on the baluchistan coast that borders the gulf of karachi, pakistan, afforded an isolate of pseudomonas stutzeri (cmg 1030) that showed pronounced inhibitory activity against several pathogenic bacteria, including mrsa strains. chemical investigation of the ethyl acetate extract yielded a new antibacterial metabolite named zafrin (4methyl5,6,7,8tetrahydro1 (4h)phenanthrenone) (18). the mic of zafrin (235.85589.62 m) compared favourably with other novel antimicrobials such as 2,4diacetylphloroglucinol (2.384.76 mm) (isnansetyo et al., 2003). interestingly, the killing rate of zafrin against bacillus subtilis was faster than for ampicillin, vancomycin or tetracycline. zafrin does not target the bacterial cell wall and its pattern of lysis resembles that of compounds such as nisin (14.91 m) and triton x100, which disrupt the cell membrane. it was suggested that the mode of action of zafrin is via the disruption of the cytoplasmic membranes, since the molecule is amphiphilic (uzair et al., 2008). alaa 2000, which was isolated from the marine red alga laurenica spectabilis collected from rasgharib coast of the red sea, egypt, was found to be active against pathogenic microorganisms with mic values ranging from 0.1 to 10 g ml. chemical and biological screening of the crude extract of this strain afforded the new bioactive compound ayamycin [1,1dichloro4ethyl5(4nitrophenyl)hexan2one] (19), which is structurally unique since it contains both chlorine and rarely observed nitro groups, beside being structurally related to compounds such as chrysophanol 8methyl ether (20), asphodelin (21) and justicidin b (22). the isolated compounds were tested for their antimicrobial activities against grampositive and gramnegative bacteria as well as against pathogenic fungi such as candida albicans, aspergillus niger and botrytis fabae. the most active compound was the new ayamycin (19) with mic values ranging from 0.31 to 1.57 m (elgendy et al., 2008). from a marine sediment sample (collected near la jolla, ca) at a depth of 51 m, the actinomycete strain cnq418 was isolated. this strain shared 89.1% 16s rnra gene sequence similarity with its nearest neighbour streptomyces sannurensis. two prominent products named marinopyrroles a (23) and b (24), were isolated and identified as new secondary metabolites. xray analysis of marinopyrrole b showed that the natural product exists as an atropoenantiomer with the mconfiguration. the newly isolated substances 23 and 24 displayed noteworthy activity against methicillinresistant s. aureus, with an mic90 of less than 2 m. for each of the compounds, cytotoxicity against a human cancer cell line (hct116: colon carcinoma) was less pronounced (8.8 and 9.0 m for compounds 23 and 24 respectively) (hughes et al., 2008). the marinederived fungus nigrospora sp. was isolated from a sea fan that was collected near similan island, thailand. when grown in 500 ml erlenmeyer flasks containing potato dextrose broth for 4 weeks, this strain produced four new metabolites named nigrospoxydons a c (2527) and nigrosporapyrone (28), together with nine known compounds. the crude ethyl acetate extract obtained from the culture broth showed antibacterial activity against standard s. aureus atcc 25923 (sa) and methicillinresistant s. aureus (mrsa), with mic values of 64 and 128 g ml respectively. only compound 25 and the known compound (+) epoxydon (29) showed activity against both strains, while the remaining compounds were inactive. compound 25 was more active than 29 against sa (mic 152.38 m), but was less active against mrsa (mic>304.76 m). compound 29 gave an mic value of 820.51 m against both strains (trisuwan et al. a marine aspergillus species (family trichocomaceae) was isolated from the surface of the marine brown alga sargassum horneri collected at gadeok island, busan, korea. the fungal broth yielded a new polyoxygenated decalin derivative, dehydroxychlorofusarielin b (30), which was found to exhibit mild antibacterial activity against s. aureus, methicillinresistant s. aureus, and multidrugresistant s. aureus with mic values of 142.36 m for all strains (nguyen et al., 2007). fungi of the genus penicillium are known to produce a large variety of compounds with a wide range of biological and pharmacological activities. the fungal broth yielded two new metabolites, penicipyrone (31) and penicilactone (32), together with three known macrolides (+) brefeldin a (33) (+) brefeldin c (34) and 7oxobrefeldin a (35). compounds 32, 33 and 35 were tested for antimicrobial activity against methicillinresistant s. aureus sk1 and microsporum gypseum shmu4. compound 33 showed the strongest antifungal activity against m. gypseum shmu4 with mic value of 228.57 m, whereas the remaining compounds were inactive (mic>700 m). when tested against methicillinresistant s. aureus sk1 all compounds gave mic values of> 700 m (trisuwan et al., 2009). the culture broth of a marine fungal strain belonging to the genus exophiala (family herpotrichiellaceae) afforded the new aspyrone derivatives chlorohydroaspyrones a (36) and b (37). the fungal strain was isolated from the surface of the marine sponge halichondria panicea collected on bogil island, jeonnam province, korea. compounds 36 and 37 displayed moderate to weak antibacterial activity when tested against s. aureus, methicillinresistant s. aureus or multidrugresistant s. aureus, showing mic values of 284.09, 568.18 and 568.18 m, respectively, for compound 36, as well as 284.09, 284.09 and 568.18 m, respectively, for compound 37 two new compounds, named xanalteric acids i (38) and ii (39), were isolated from the fungus alternaria sp., isolated from fresh healthy leaves of the mangrove plant sonneratia alba (sonneratiaceae), collected in dong zhai gang mangrove garden on hainan island, china. compounds 38 and 39 exhibited weak antibiotic activity against multidrugresistant s. aureus with mic values of 686.81343.40 m (kjer et al., 2009). the marinederived fungus, ascochyta sp. ngb4, was isolated from a floating scrap of festering rope that had been collected at a fishing port in nagasaki prefecture, japan. chemical investigation of this strain yielded a new spirodioxynaphthalene metabolite, named ascochytatin (40). the relative stereochemistry of the compound was determined by xray crystallographic analysis, and the absolute stereochemistry was identified by the modified mosher's method. a sensitive screening method for antibacterial agents that inhibit essential encoding genes (yycg/yycf) for the bacterial twocomponent regulatory system (tcs), a fundamental system of bacterial response to environmental stress, the difference in sensitivity of b. subtilis 168 and cnm2000 towards 40 suggested that 40 inhibited the function of tcs (yycg/yycf) in b. subtilis. compound 40 exhibited relatively strong and specific activity against grampositive bacteria and against the yeast c. albicans. compound 40 exhibited cytotoxicity to both a549 (human lung carcinoma cell line) and jurkat cells (human leukaemia cell line) with ec50 values of 4.8 and 6.3 m respectively (kanoh et al., 2008). f14 was isolated from seawater collected from the mangrove stand at kei ling ha lo wai, sai kung, hong kong. chemical investigation of its fermentation broth yielded nine compounds, which were tested for antifouling activity towards macro and microfouling organisms. antilarval activity was assessed in settlement inhibition assays against the barnacle balanus amphitrite and the bryozoan bugula neritina. cinnamic acid (41) and bis (2ethylhexyl) phthalate (42) were found to be potential natural antifouling agents inhibiting larval settlement of b. neritina (ec50=77.77 14.19 m and lc50>1351.35 m) and b. amphitrite (ec50=23.54 4.49, treatment with high concentration of bis (2ethylhexyl) phthalate (42) (> 256.4 m) was found to cause aggregation of barnacle cyprids due to possible interactions of this compound with the hydrophobic sites on cell membranes. notably, bis(2ethylhexyl)phthalate is a common plasticizer, which was proven in this study to be produced by the fungus itself and not as a result of labware contamination. the compounds were further tested for antibacterial activity using standard disc diffusion assay against six bacterial species, obtained from natural marine biofilms in hong kong water. the bacterial strains included four larval settlementinducing bacteria: loktanella hongkongensis (ust950701009), micrococcus luteus (ust950701006), rhodovulum sp. (ust010723008) and two marine pathogenic bacteria: pseudoalteromonas piscida (ust010620005) and vibrio harveyi (ust020129010). cinnamic acid (41), cyclo(phepro) (43) and cyclo(valpro) (44) showed antibacterial activity against l. hongkongensis with mic values of 1351.35, 819.67 and 813.0 m respectively. cyclo(phepro) (43) showed further antibacterial activity against m. luteus and ruegeria sp. with mics of 409.83 and 819.67 m (strain g 100/2), which was isolated in a screening programme for new marine secondary metabolites from endophytes of several types of algae, together with three known substances. the antifungal activity of chaetocyclinone a (45) was tested against selected phytopathogenic fungi. the compound exhibited an inhibitory activity at a dose of 89.1 m against phytophthora infestans. the other new compounds showed neither antibacterial nor antifungal activity in a standard agar plate diffusion assay. no cytotoxic properties against the tumour cell lines hm02 (stomach), hepg2 (liver) and mcf7 (breast) could be observed up to a concentration of 28.7 m. the results suggested the compound to be derived from the polyketide pathway (lsgen et al., 2007). a new difuranxanthone, asperxanthone (48), and a new biphenyl, asperbiphenyl (49), were obtained from a fungal strain, identified as aspergillus sp. (mf93), which was isolated from sea water collected in quanzhou gulf, fujian province, china. compounds 48 and 49 showed moderate inhibitory activity against tobacco mosaic virus, a typical plant virus of the tobamovirus group, with inhibitory rates of 62.9% and 35.5%, at concentrations of 0.62 and 0.48 mm, respectively (wu et al., 2009). marine microorganisms are often taxonomically unique, which makes them interesting as potential sources of new drug leads. one of the major areas of research on marine natural products is devoted to the discovery of new anticancer drugs. in 1997, a novel depsipeptide named thiocoraline was isolated from the mycelial extract of the bacterium micromonospora marina associated with a marine soft coral in the indian ocean. thiocoraline inhibited dna polymerase and is currently in preclinical phase by the pharmaceutical company pharmamar (romero et al. 768), which was isolated from the red alga acanthophora spicifera, was active towards a panel of human tumour cell lines. chemical investigation of this fungus yielded the novel macrolide apralactone a (50), a 14membered phenyl acetic acid macrolactone, as well as six further curvularin macrolides. the isolated compounds were tested against 36 human tumour cell lines, comprising 14 different solid tumour types. the novel macrolide apralactone a (50) showed moderate concentrationdependent cytotoxicity with a mean ec50 value of 9.87 m. the most active metabolite (+) (10e,15r)10,11dehydrocurvularin (51), displayed concentrationdependent cytotoxicity with a mean ec50 value of 1.25 m, combined with significant in vitro tumour cell selectivity towards nine of the 36 tested tumour cell lines, which indicated 25% of selectivity (using an individual ec50 value< 1/2 of the mean ec50 value as threshold for above average sensitivity). these nine above average sensitive cell lines included bxf 1218l (bladder cancer, ec50=0.43 m), bxf t24 (bladder cancer, ec50=0.5 m), cnxf sf268 (glioblastoma, ec50=0.36 m), lxfa 289l (lung adenocarcinoma, ec50=0.28 m), maxf 401nl (mammary cancer, ec50=0.4 m), mexf 462nl (melanoma, ec50=0.38 m), mexf 514l (melanoma, ec50=0.5 m), ovxf 899l (ovarian cancer, ec50=0.58 m) and prxf pc3 m (prostate cancer, ec50=0.4 m) (greve et al., 2008). two new natural products (z)6benzylidene3hydroxymethyl1,4dimethyl3methylsulfanylpiperazine2,5dione (52) and (3s,3r)3(3hydroxybutyl)7methoxyphthalide (53), together with three known compounds were isolated from the culture broth of an unidentified marinederived fungus of the order pleosporales (strain crif2). compound 54, which was previously known only synthetically, was isolated for the first time as a natural product. compounds 52 and 54 exhibited weak cytotoxic activity when tested against a panel of cancer cell lines (prachyawarakorn et al., 2008). investigation of natural products produced by the marinederived fungus spicellum roseum, isolated from the sponge ectyplasia perox collected from the waters around the caribbean island of dominica, afforded two new cyclohexadepsipeptides, named spicellamide a (55) and spicellamide b (56). the absolute configuration of the compounds was deduced after hydrolysis using marfey's method, chiral chromatography, as well as noesy and modelling data. the isolated peptides were tested for their cytotoxic activity using the celltiterblue cell viability assay, against rat neuroblastoma b104 cell line. compound 56 exhibited an ec50 value of 10.03 m while compound 55 was less active with an ec50 of 49.83 m (kralj et al. (strain cnt016), which was isolated from a marine mud sample collected in palau island, yielded two new secondary metabolites named spiromassaritone (57) and massariphenone (58). the isolated compounds were subjected to cytotoxicity assays against the human colon carcinoma cell line (hct116) and also screened for antimicrobial activity. the crude extract as well as however, none of the compounds isolated showed significant activity against hct116, c. albicans or s. aureus (abdelwahab et al., 2007). the marinederived fungus aspergillus carbonarius was isolated from a marine sediment collected at weizhou island of china. chemical investigation of this strain when grown in liquid medium afforded two new secondary metabolites, carbonarones a (59) and b (60). inhibition of the human leukaemia cell lines k562 was measured by the sulforhodamine b (srb) assay. the cytotoxic effects of 59 and 60 were preliminarily evaluated against k562 (human leukaemia), p388 (murine leukaemia), a549 (human lung carcinoma), bel7402 (human hepatoma) and hl60 (human promyelocytic leukaemia) cell lines. both compounds 59 and 60 exhibited moderate antiproliferative activity against k562 cell lines with ec50 values of 244.54 and 121.39 m, respectively, while they were inactive against the other cell lines tested (ec50>436.68 m) (zhang et al., 2007). the fungus aspergillus ustus was isolated from the marine sponge suberites domuncula, which had been collected from the adriatic sea. from cultures of this strain grown on both biomalt agar and barleyspelt solid media seven new drimane sesquiterpenoids (6167), including the threoisomers 66 and 67, the crude etoac extract of a. ustus displayed cytotoxic activity against the murine lymphoma cell line l5178y at a concentration of 10 g ml. compounds 64, 65 and the known compound res11492 (68) exhibited ec50 values of 13.11, 1.77 and 4.75 m, respectively, with 65 being the most active congener discovered in this study. all other compounds were inactive at the range of concentrations analysed (0.110 g ml). all cytotoxic compounds featured an olefinic ester side chain comprising two (63 and 64) or three conjugated olefinic double bonds (68) with a terminal carboxylic, aldehyde or methyl substituent (liu et al., 2009). the fungus petriella sp. isolated from the sponge s. domuncula that had been cultured in aquaria for 4 weeks yielded three new infectopyrone derivatives (6971) together with the cyclic tetrapeptide wf3161 (72). the cyclic tetrapeptide wf3161 was primarily responsible for this activity; the ec50 value was< 0.18 m (proksch et al., 2008). the marinederived fungus aspergillus aculeatus cri32304a, obtained from the marine sponge xestospongia testudinaria collected from ton sai bay, phi phi islands, krabi province, thailand, afforded a new tyrosinederived metabolite, aspergillusol a (73), in large quantities. aspergillusol a selectively inhibited glucosidase from the yeast saccharomyces cerevisiae (ec50=465 2 m), but it was inactive towards glucosidase from the bacterium bacillus stearothermophilus (ec50=1060 20 m). the compound also displayed weak cytotoxic activity towards molt3 (acute lymphoblastic leukaemia), hucca1 (human lung cholangiocarcinoma), and a549 cell lines with ec50 values of 19, 50 and 74 m respectively (ingavat et al. aspergiolide a (74), a novel anthraquinone derivative with naphtho[1,2,3de]chromene2,7dione skeleton, was isolated from cultures of the marinederived fungus aspergillus glaucus. the fungal strain was obtained from a marine sediment collected from mangrove roots in fujian province, china. the compound selectively inhibited the proliferation of a549, hl60, bel7402 and p388 cancer cell lines (du et al., 2007). recently, animal tests with mice indicated that aspergiolide a also inhibited tumour growth in vivo (sun et al., 2009). a marinederived isolate of the common terrestrial fungus, aspergillus versicolor (mstmf495), was recovered from a beach sand sample collected at low tide from cottesloe, western australia. the fungal strain yielded a new alkaloid, cottoquinazoline a (75), and two new cyclopentapeptides, cotteslosins a (76) and b (77). cotteslosin a (76) exhibited weak cytotoxic activity against human melanoma (mm418c5, ec50=103.93 m), prostate (du145, ec50=141.73 m), and breast (t47d, ec50=148.03 m) cancer cell lines (fremlin et al., 2009). fungi of the genus pestalotiopsis are characterized by their extensive distribution and wide genetic and biological diversity., obtained from fresh healthy leaf material of rhizophora mucronata (rhizophoraceae) collected in dong zhai gangmangrove garden on hainan island, china, yielded five new cytosporones j n (7882), new coumarins, pestalasins a e (8387), a new alkaloid named pestalotiopsoid a (88) (xu et al. f (8994) (xu et al., 2009b). among the isolated compounds only pestalotiopsone f (94) exhibited moderate cytotoxicity, with an ec50 value of 26.89 m, when tested against the murine cancer cell line l5178y (xu et al. three new oxaspiro[4.4]lactam containing diketopiperazine alkaloids, 6methoxyspirotryprostatin b (95), 18oxotryprostatin a (96) and 14hydroxyterezine d (97), as well as 14norpseurotin a (98) and the 29nordammarane triterpenoid 6,16diacetoxy25hydroxy3,7dioxy29nordammara1,17(20)dien21oic acid (99) were obtained from marinederived aspergillus sydowi pfw113. the fungal strain had been isolated from a driftwood sample (pfw1) collected from the beach of baishamen, hainan, china. compounds 9597 displayed weak cytotoxic activity against a549 cells, with ec50 values of 8.29, 1.28 and 7.31 m respectively. compound 95 also exhibited slight cytotoxicity against hl60 cells (ec50=9.71 m). furthermore, compounds 98 and 99 showed significant antimicrobial activities against escherichia coli, b. subtilis and micrococcus lysoleikticus with mic values of 3.74, 14.97 and 7.49 m for compound 98, and 10.65, 5.33 and 10.65 m for compound 99, respectively (zhang et al., 2008b). (eg5), collected from waters around egypt (suez canal, egypt). chemical investigation of the fungal culture resulted in the isolation of the new chromone derivative, chromanone a (100), which was evaluated for its cancer chemopreventive activity, especially for prevention of the initiation stage of carcinogenesis by modulation of carcinogen metabolizing enzymes. carcinogens are activated by cytochrome p450 1a (cyp1a) and detoxified by glutathione stransferases (gst), quinine reductase (qr), and epoxide hydrolase (meh). chromanone a (100), in 18.18 m concentration, inhibited cyp1a activity up to 60% of the stimulatedcyp1a in murine hepatoma cells (hepa1c1c7), and significantly induced gst but not total thiols at low concentrations. the compound did not affect qr activity, but it significantly enhanced meh activity in hepa1c1c7 cells (p<0.050.01) in a dosedependant manner. also, chromanone a (100) showed potent radical scavenging activity against hydroxyl radicals starting from a dose of 45.45 m (p<0.05), which may be responsible for its inhibitory effect on induced dna damage in cells (gamaleldeen et al., diabetes mellitus is a debilitating and often lifethreatening disorder with increasing incidence throughout the world (who, 1985). literature surveys show that more than 400 plant species were reported to have antidiabetic activity, and most of the antidiabetic natural products were, so far, isolated from plants (mukherjee, 1981; rai, 1995). in contrast, marine bacteria and fungi are poorly investigated for antidiabetic activity, but may be of great promise in the search for new antidiabetic drugs for the future. sf5060, isolated from an intertidal sediment collected at gejae island, korea, yielded the known compound aquastatin a (101). the compound exhibited potent inhibitory activity against protein tyrosine phosphatase 1b (ptp1b) with an ec50 value of 0.19 m. protein tyrosine phosphatases (ptps) constitute a large family of enzymes, which are responsible for modulation of tyrosine phosphorylationdependent cellular events. studies demonstrated that ptp1b, an intracellular nonreceptor type ptp, negatively regulates insulin and leptinreceptor mediated signalling pathways. thus, its inhibition may represent an outstanding, novel therapy for type 2 diabetes and obesity. aquastatin a (101) was found to inhibit ptp1b activity in a competitive and selective manner as demonstrated by kinetic analyses and testing over a small panel of other ptps respectively. in addition, hydrolyzing studies of the compound suggested that the dihydroxypentadecyl benzoic acid moiety present in the molecule was responsible for the inhibitory activity (seo et al., 2009). table 1 contains a selection of the most active secondary metabolites isolated from marine bacteria and fungi during the period between 2007 and 2009. marinederived fungi and bacteria constitute a promising source of unique metabolites with considerable pharmaceutical and therapeutical potential. common biological assays usually focus on antimicrobial and cytotoxic activities as demonstrated throughout the literature. whereas more effective and safe drugs in the field on infectious diseases and cancer are certainly needed, many other pharmacologically active compounds may be overlooked. thus, it is suggested to broaden biological screens for the discovery of exceptional and rarely investigated biological activities, which may be important for the therapy of chronic diseases. examples mentioned in this review include the potent ptp1b inhibiting activity of aquastatin a (101) which may be a promising therapeutic agent for treatment of type 2 diabetes and obesity, as well as the carcinogen metabolizing enzymes modulatory activity of chromanone a (100), which could be helpful in preventing the initiation stage of carcinogenesis. such activities trigger the continued interest in marine microbial natural products and reflect the need for more intensive investigation of their chemical and pharmacological properties. literature surveys showed that fungi of the genus aspergillus are among the most heavily studied fungal strains as shown in our review (6 investigated aspergillus species out of a total of 20 fungal species). this genus is characterized by its worldwide and frequent distribution, and its species are causative agents of stored products decay, thus they are also important in view of health hazards. nevertheless, members of this genus are renowned for their ability to produce a huge number of structurally unprecedented bioactive metabolites. studies showed that the tendency of biosynthetic genes to form adjacent clusters proves helpful in allocating secondary metabolite genes present in fungal genomes (keller et al., 2005, fox and howlett, 2008), yet such an analysis can not predict gene expression and, thus, product formation. recent advancements in molecular biology of fungal secondary metabolism may offer a better insight into how biogenetic gene clusters are regulated and whether their expression is affected by environmental changes and culture conditions (delany et al., 2000; keller et al., 2005, fox and howlett, 2008). a better understanding of such regulation and the influencing factors may help to induce and optimize secondary metabolite production under laboratory conditions to yield bioactive natural products with significant pharmaceutical potential.

summarymarine bacteria and fungi are of considerable importance as new promising sources of a huge number of biologically active products. some of these marine species live in a stressful habitat, under cold, lightless and high pressure conditions. surprisingly, a large number of species with high diversity survive under such conditions and produce fascinating and structurally complex natural products. up till now, only a small number of microorganisms have been investigated for bioactive metabolites, yet a huge number of active substances with some of them featuring unique structural skeletons have been isolated. this review covers new biologically active natural products published recently (200709) and highlights the chemical potential of marine microorganisms, with focus on bioactive products as well as on their mechanisms of action.

PMC3815768

pubmed-1147

if one accepts the behavioral model of the factors related to the development of insomnia and its transition from to chronic or insomnia proposed by spielman and colleagues,12 a question logically arises about the optimal means of treating short-term insomnia. possible strategies might range from watchful waiting, as it is likely that a substantial number of persons with short-term insomnia may have complaints that improve with time. an alternative might be to intervene aggressively in those with short-term insomnia in order to prevent the development of chronic insomnia. if clinicians were able to determine when and how to intervene in the transition from acute to chronic insomnia, a substantial number of cases of chronic insomnia might be prevented from developing. unfortunately, little information has accrued on the best ways to identify at-risk individuals and intervene in the process. one study suggested that it may be possible to identify vulnerable individuals with a questionnaire that assesses the effect of stress on their sleep.13 this form of secondary prevention might establish the utility of heightened surveillance of persons at risk for developing chronic insomnia and justify more aggressive interventions in primary care. cognitive behavioral treatment of insomnia has demonstrated efficacy,1416 but its use is limited by the availability of qualified practitioners. many clinicians have few options for employing behavioral interventions for insomnia and may have difficulty identifying qualified persons to whom interested patients can be referred. limited reimbursements for behavioral interventions for sleep disorders may also limit the willingness of practitioners to provide these services.17 although behavioral treatments thus are effective for insomnia, the limited number of qualified practitioners limits the availability of this treatment in many situations. for many clinicians, the most readily available treatment for short-term insomnia may be pharmacotherapy. one of the most common interventions for short-term insomnia is thus pharmacotherapy with a hypnotic agent. currently available therapies include benzodiazepines, non-benzodiazepine gabaergic medications, the melatonin receptor agonist ramelteon, and sedating antidepressants.18 many patients report use of over-the-counter medications most of which contain antihistamines but evidence suggests that while the sedating effect of antihistamines may be helpful for a few days it becomes indistinguishable after several days.19 probably the most commonly used sedating antidepressant is trazodone, but evidence for its efficacy is limited and it may have significant adverse effects.20 benzodiazepines are often used to treat short-term insomnia but clinicians may be concerned about the possible development of tolerance in some patients. little specific information is available to guide the choice of one agent over another in short-term insomnia, although clinician preferences and concerns about the development of dependence may be important factors in medication selection. clinicians are increasingly likely to prescribe one of the nonbenzodiazepine gabaergic medications such as zolpidem, eszopiclone, or zaleplon in preference to benzodiazepines. although effective and safe pharmacologic treatments are available for insomnia, the prescribing information for most medications such as zolpidem include the recommendation that it be taken only when the user will be able to devote 8 hours or more to sleep. in addition, most current pharmacotherapeutic agents do not have demonstrated efficacy in promoting sleep maintenance, although formulations of zolpidem and eszopiclone may be useful in promoting sleep throughout the night.21 as noted, motn insomnia arises in individuals who may have little or no difficulty in initiating sleep but who awaken after several hours and then have difficulty returning to sleep. as noted above, a significant number of persons may complain of nocturnal awakenings followed by protracted wakefulness. a challenge in treating this prevalent form of insomnia arises from the length of action of medications typically used for insomnia, including benzodiazepines such as temazepam or nonbenzodiazepine gabaergic agents such as zolpidem. these medications have half-lives that range from 1.4 to 4.5 hours for zolpidem to more than 20 hours for several of the benzodiazepines. even those medications with short half lives may have significant residual daytime sedating effects when used for motn insomnia. sleep medications may have significant residual daytime effects that affect cognitive skills such as reaction time, motor coordination and memory.22 these skills may be particularly relevant to driving an automobile, a skill that may often be used by insomnia patients in the morning after having taken a medication. several studies have shown that medications such as zolpidem may have significant negative impacts on real-world driving ability after having been taken at night.23,24 it is thus unsurprising that several studies have used driving as a criterion for evaluating the morning after effects of insomnia medication use. in one study, both the long half-life drug flurazepam and the shorter half life drug temazepam had significant effects on driving 12 hours after they had been taken. betts and birtle25 evaluated the effect of single doses of either flurazepam 15 mg or temazepam 20 mg administered in counter-balanced order on driving performance on a closed course. the driving performance of 12 participants, all of whom were women, was evaluated in the morning between 9.00 and 11.00 am, 12 hours after they had taken the drug. participants in each condition displayed substantially more driving errors in driving over a course with barriers that required weaving or the equivalent of changing lanes. these results thus show that residual daytime effects on driving performance may be present even with the relatively shorter half-life medication temazepam. some evidence has accumulated for similar residual effects of the non-benzodiazepine drugs. in a controlled environment, partinen et al26 gave zolpidem 10 mg, temazepam 20 mg, or placebo to women with insomnia at 2.00 am and studied their performance in a driving simulator at 7.30 am, 5.5 hours after taking the medication. a battery of computer-administered neuropsychological measures was completed in the morning and polysomnographies (psgs) were done each night. participants were 23 women with primary insomnia as defined as having a) complaint of difficulty in initiating or maintaining sleep, or of nonrestorative sleep, for 1 month; b) the sleep disturbance or related daytime fatigue caused clinically significant impairment, and c) the sleep disturbance did not occur in the context of other disorders. all were between 35 and 60 years of age (mean age 49.5 years), had driver s licenses for at least 5 years, and reported driving at least 5000 km each year. the primary endpoint for the study was the mean time to a collision in the driving simulator, a variable that reflected sustained attention and reaction time in the driving simulator. no group differences were found across conditions (placebo, zolpidem, temazepam) in mean time to a collision. in secondary endpoints, neither reaction time nor memory score showed significant group differences, however, a significant effect was found for zolpidem in a measure of how well the person was able to maintain lane control over 100 km of simulated driving. although these group results suggest little effect of the drugs on driving and memory performances, the authors of this study note that they observed substantial interindividual differences in performance that were possibly clinically significant. the total number of accidents in the driving simulator, for example, was 6 for participants in the drug conditions but only 1 in the baseline and placebo conditions. several participants thus showed much worse performance in the simulator after drug administration, suggesting that some individuals make be substantially impaired even 5.5 hours after ingestion of either temazepam or zolpidem. clinicians should therefore be alert to the possibility that some individuals may be highly susceptible to residual effects of sleep medications and exercise appropriate caution in prescribing them for patients who may have to engage in complex mental activities the morning after taking them. another study27 compared the residual daytime sedating effects of either zaleplon 10 mg or zolpidem 10 mg after motn awakening. thirty-seven adults with insomnia (mean age 44 years) received either a medication or placebo four hours after bedtime, and residual sedation was evaluated by sleep latency tests at hourly intervals after they awakened 4 hours later and for up to 7 hours after taking the medication. residual effects of the medications were assessed through repeated sleep latency tests as well with self-reports of concentration ability and the digit symbol substitution test (dsst). the dsst is a paper and pencil test that requires individuals to rapidly substitute numbers in a series of boxes according to a key while their performance is timed. it is often considered a measure of psychomotor speed and attention that is sensitive to the effects of a sedating medication. persons receiving the 10 mg dose of zolpidem showed significant effects on the sleep latency test, self-report of concentration, and dsst compared to zaleplon 10 mg and placebo for up to 7 hours after having received the drug. these results thus suggest that a standard dose of zolpidem (10 mg) may be associated with significant cognitive effects as long as seven hours after taking it. currently-available treatments for insomnia thus may pose significant risks for individuals alertness, psychomotor speed, and driving performance the morning after they are taken. these effects may be present in susceptible individuals for as long as 7 hours after taking a drug such as zolpidem, and it is possible that residual effects may be present for even longer periods if longer half life medications are used. it is thus clear that although currently available medications are clearly efficacious in promoting sleep onset in individuals with insomnia and may be useful in improving sleep maintenance, they may have lingering effects the morning after they are taken that have important implications for patients function and safety. the need for new agents that improve sleep hoch et al for example, showed that sleep restriction could improve sleep continuity in older persons, decreasing motn awakenings. other studies have been consistent in suggesting that the behavioral technique of sleep restriction can improve sleep continuity. in this strategy, the patient is asked to keep a sleep diary for several weeks in order to determine the amount of time spent in bed and the amount of time actually spent in sleep. the patient is then asked to spend slightly less time in bed than he or she is usually asleep. this treatment strategy has been shown to decrease motn awakenings in studies of chronic insomnia14 and might be expected to be effective in other contexts as well. as noted above, however, the limited availability of qualified persons to deliver behavioral sleep medicine services is an important drawback so that pharmacotherapy will continue to be an important option for motn insomnia as well. given the problems with residual daytime sedation and the possible effects of the time required for oral doses of sleep medications to take effect, the usefulness of several novel formulations of sleep medications have been investigated.28 given the possibility that sublingual administration might be associated with more rapid onset of action of zolpidem, several studies have evaluated this route of administration for this medication. staner et al29 investigated the utility of a sublingual formulation of zolpidem using it to assist in sleep initiation after participants had napped during the day. in this model of insomnia, having participants nap in the afternoon before later trying to reinitiate sleep served to reduce sleep drive so that the they would have difficulty in falling asleep. in a group of 21 healthy volunteers with a mean age of 26.7 years, 2 doses of sublingual zolpidem (5 and 10 mg) were compared to a standard oral formulation of zolpidem (10 mg). study results showed that the sublingual 10 mg dose produced shorter latencies to persistent sleep compared to the standard oral dose (12.8 vs 18.4 minutes) with similar effects on sleep onset latency and latency to stage one sleep. no significant group differences were observed for sleep maintenance variables or on subjective measures of sleep quality and all side effects were moderate or mild and resolved. these authors conclude that a sublingual formulation of zolpidem may be clinically useful given the reduction in time to sleep onset observed in this study. roth and colleagues30 evaluated the pharmacokinetic and pharmacodynamic characteristics of low-dose sublingual zolpidem. in this study, 24 participants (mean age 34.7 years, 13 men and 11 women) who were healthy and without sleep complaints completed a double-blind, placebo-controlled crossover trial of the daytime sedating effects of 3 doses of sublingual zolpidem (1.0, 1.75, and 3.5 mg). the purpose of this study was thus to evaluate the sedating effects of several doses of zolpidem during the day, provide data on the time course of objective and subjective effects of the medication, and allow an investigation of the pharmacokinetic characteristics of these doses and their relation of the effects of the medication to its blood levels. daytime sedation was measured objectively by the digit symbol substitution test (dsst) and subjectively via self-report ratings of sedation on a visual analog scale (vas). memory for words and reaction time were also measured to provide additional objective evaluations of the cognitive effects of the medication. blood samples for pharmacokinetic evaluations were collected prior to the initial dose and for periods up to 12 hours after each dose. results of this study showed that both the 1.75 mg and 3.5 mg dose, but not the 1.0 mg, of sublingual zolpidem showed significant sedating effects on the dsst at 20 minutes after drug administration. the effect of the 3.5 mg dose was substantially greater than that of the 1.75 mg dose on this measure. significant effects of the medication compared to placebo lasted up to 90 minutes, although participants dsst scores did not return to levels essentially identical to those in the placebo group until 180 minutes after drug administration. subjective reports of sedation paralleled results of objective testing, although participants reports of sedation did not return to baseline levels until 300 minutes after drug administration. the 3.5 mg dose showed maximum effects on reaction time at 20 minutes, while the 1.75 mg and 1.0 mg doses showed maximum change at 1 hour. for the two lower doses, the observed change in reaction time was not statistically significantly different from placebo. on the word recall measure, the time of maximal change from placebo was 20 minutes for the 3.5 mg dose but 1 hour for the 1.75 and 1.0 mg doses. here again, the changes from baseline for the lower two doses were not significantly different from placebo levels. pharmacokinetic analyses showed that for these participants the maximal drug concentration and areas under the curve were proportional to the dose. the half-life of zolpidem was slightly longer than 2.3 to 2.5 hours, with a time to maximal concentration of 36 to 38 minutes. a pharmacokinetic study with elderly persons was presented by krystal et al (reported in lankford31). in that study, the pharmacokinetics of sublingual zolpidem were studied in healthy elderly volunteers. in the elderly, at the 3.5 mg dose both the maximum concentration and the area under the curve were elevated relative to younger adults. the 1.75 mg dose in the elderly resulted in maximum concentrations and areas under the curve that were somewhat lower than those found in younger adults. the elimination half-life, however, was similar for older as well as younger persons. lankford suggests that this finding supports the recommendation that the lower dose of sublingual zolpidem may be most appropriate as a starting point for older persons.31 in another study, roth and colleagues32 report a randomized, double-blind, placebo-controlled, three-way crossover trial of sublingual zolpidem tartrate in 82 adults (mean age=45.9 years; 24 men and 58 women) with a dsm-iv diagnosis of primary insomnia and a history of motn insomnia with an average of 2.2 awakenings per night. individuals were eligible to participate if, in a preliminary evaluation, they showed psg evidence of prolonged time in returning to sleep after a scheduled motn awakening. individuals participated in three treatment episodes consisting of two consecutive nights of dosing with placebo, sublingual zolpidem 1.75 mg, or sublingual zolpidem 3.5 mg. dose of placebo or medication was administered after awakening the participants four hours after initial lights out (without regard to the participant s sleep stage at time of awakening). treatment episodes were separated by a 5- to 12-day washout period and delivered in a randomization sequence in which all participants received each treatment condition. the primary efficacy variable was the participant s average latency to persistent sleep after the motn awakening. study results showed significant effects of both doses of sublingual zolpidem on key sleep parameters. both doses of zolpidem were associated with a significant decrease in psg-measured latency to persistent sleep (from a mean of 28.1 minutes for placebo to 16.9 and 9.7 minutes for the 1.75 mg and 3.5 mg doses of zolpidem, respectively) as well as in patient-reported sleep onset latency. both doses of zolpidem were associated with significant increases in total sleep time both as measured by psg and patient report. the 3.5 mg dose of zolpidem was associated with significantly better ratings of sleep quality in comparison to placebo, as well as in ratings of level of refreshed sleep and ability to function the next day. this study included evaluation of the objective and subjective effects of zolpidem treatment on morning functioning. participants completed the dsst and a visual analog scale (vas) asking for self-report of level of sedation on each morning of the treatment periods. results of this evaluation showed that neither dsst performance nor the va s ratings differed significantly across conditions five hours after administration of zolpidem or placebo. it may be noted, however, that subjects reported some subjective sedation up to 5 hours after medication administration. it is thus not clear precisely how long patients must sleep to avoid any subjective morning sedation. no serious side effects were noted in this study, although 14 of the 82 participants reported at least one adverse event during the study. all adverse events were mild and of short duration, allowing the authors to suggest that sublingual zolpidem may be a safe and effective treatment for motn insomnia. studies of sublingual zolpidem thus show that this form of the drug is likely to be effective in short-term insomnia. this dosing form s rapid onset of action may confer benefits for patients taking the medication at typical bedtimes, as shown in the study by staner et al.29 standard doses may be associated with clinically significant residual daytime sedation so that standard doses may not be safely used in patients with motn insomnia. at lower doses, however, the residual daytime effects of zolpidem may be reduced and it may thus be useful in motn insomnia. it should be noted, however, that at least one study suggested that the subjective sedating effects of zolpidem persisted as long as five hours after dosing, a factor that may be important depending on time of administration and time of arising. still, although standard 5 and 10 mg doses may be associated with morning sedation if taken after midnight,27 lower doses of sublingual zolpidem may be less likely to cause morning sedation and may thus be useful for treating short-term insomnia characterized by difficulty in initiating sleep and in motn insomnia.

insomnia affects a significant proportion of the general population and an even greater proportion of patients seen in general medical care. insomnia has multiple negative effects on health status, decreases quality of life, and is associated with increased health care costs. current treatments for insomnia include pharmacologic and behavioral strategies. pharmacologic treatments may be effective for short-term and middle-of-the-night (motn) insomnia, but the usefulness of many sleep medications is limited by the residual daytime sedation with which they are associated. this problem is especially important in the case of motn insomnia, when only a few hours may elapse between the time a patient takes the medication and when he or she must rise. the development of sublingual and low-dose formulations of zolpidem raises the possibility that pharmacologic therapy may allow patients with motn insomnia to be effectively treated with a decreased risk of residual daytime sedation. current studies of this strategy are promising, and several formulations are in the process of being brought to market.

PMC3630934

pubmed-1148

jamaica, like many other caribbean countries, has experienced an increase in the prevalence of diabetes over the last 50 years. in cross-sectional studies of selected adult populations, the prevalence of diabetes has increased from 1% in 1960 to between 13%17.9% in the mid-1990s [14]. data from the 2008 island-wide jamaican health and lifestyle survey estimated the prevalence of diabetes among 1574-year-old jamaicans to be 7.9% after adjusting for sampling methodology. the role of the well-established risk factors for diabetes in jamaica such as obesity, hypertension and family history of the disease has been investigated. in the spanish town study, few studies in the caribbean and other regions undergoing the epidemiological transition have examined the contribution of novel risk factors on diabetes risk using population based data. sleep is one such risk factor for diabetes that has not been previously explored. in western societies, a decreasing trend in sleep hours in the society coincides with the increasing diabetes prevalence. sleep duration extended beyond or curtailed before the normal sleep period of 7-8 hours has been associated with metabolic and endocrine changes [9, 10]. curtailed sleep has been shown to increase insulin resistance, a precursor of type 2 diabetes. shortened sleep duration has also been demonstrated to produce an adverse hormonal profile (increase in cortisol, ghrelin, and a reduction in leptin) and increased inflammatory markers [1012]. sleep deprivation would therefore be expected to affect both diabetes prevalence and glycemic control. while several cross sectional and cohort studies have investigated the relationship between sleep duration, diabetes prevalence and glucose control, none of these studies have been conducted in black populations undergoing the epidemiological transition [1316]. additionally, the relationship between sleep and diabetes has not been consistently demonstrated in black populations. we therefore examined the relationship between sleep duration and diabetes prevalence and glycaemic control (assessed by glycosylated haemoglobin) in jamaican adults. we also evaluated whether any relationship between sleep and diabetes prevalence was independent of traditional risk factors for the disease such as age, obesity and family history of diabetes. the jamaican health and lifestyle survey ii was a cross-sectional survey conducted by the epidemiology research unit of the tropical medical research institute (tmri) and the ministry of health, between 2007 and 2008. the primary sampling units were enumeration districts randomly selected from each of the fourteen parishes in the island using probability proportionate to size. within each enumeration district, systematic random sampling was used to select households beginning at a random starting site. within each household, a single respondent between the ages of 1574 was selected using the kish methodology. once an eligible individual was selected to participate in the study, interviewers were required to revisit households where the participant was not home at the time of first contact three times before the household participant was deemed a refusal. approximately 30 participants per enumeration district were selected resulting in a final sample of 2848 persons. the survey included an interviewer administered questionnaire where information on demographics, education, socioeconomic status, personal and family medical history and emotional health was collected. trained interviewers measured height in centimetres using a portable stadiometer and weight in kilograms using an electronic digital scale. the body mass index (bmi) was calculated using the weight (kilograms) divided by height (metres) squared. participants were seated for 5 minutes before measurement and 3 measurements (each one minute apart) were performed. participants were visited on a subsequent day in order to obtain fasting finger-stick blood samples for glucose using an accutrend glucometer (roche diagnostics gmbh, germany). glycosylated haemoglobin was also measured from the capillary blood sample using a nycocard hba1c reader (axis shield) in those with diabetes or an elevated fasting glucose at evaluation. the study was approved by the university of the west indies, faculty of medical sciences, ethics committee and written informed consent was obtained from each participant before enrolment. sleep quality was assessed by asking the question do you wake up several times during your sleep? participants were classified as having diabetes if they had a fasting capillary glucose 6.1 mmol/l when tested or if they responded yes to the question, have you been prescribed medication for your diabetes? participants with a glycosylated haemoglobin of 7% or less were classified as having controlled diabetes, while those with a value above 7% were classified as having uncontrolled diabetes. participants were classified as hypertensive if their mean systolic blood pressure (sbp) 140 mmhg and or mean diastolic blood pressure (dbp) 90 mmhg or if they answered yes to the question have you been prescribed medication for your high blood pressure? participants were classified as depressed if they had seriously considered suicide in the last year or if they answered yes to either of the following questions during the past month have you been bothered a lot by little interest or pleasure in doing things? or during the past month have you been bothered a lot by feeling down, depressed or hopeless ?. they were also classified as depressed if they answered positively to at least three of the following questions: during the past month have you been bothered a lot by: (i) feeling sad or lonely, (ii) feeling guilty or worthless, (iii) change in appetite or (iv) change in sleeping patterns ?. respondents were categorised into three groups: high activity, medium activity or low activity/inactive-based on their response to a study questionnaire which included questions on work-related and leisure time physical activity. participants were categorised nondrinkers if they answered no to the question do you ever drink alcohol? or if they reported abstaining from alcoholic beverages for more than a year. participants were classified as smokers if they reported smoking 100 or more cigarettes in their life. data were analysed using stata version 9.1 (stata corporation, college station, tex). participants were divided into six groups based on the total hours spent sleeping: <6 hrs 6-7 hrs, 7-8 hrs, 8-9 hrs, 9-10 hrs and>10 hrs. analysis was done separately for men and women as there was evidence of interaction between sleep duration and sex on preliminary analysis. trends across sleep duration categories were assessed using a non-parametric test for trend. those sleeping 8-9 hours were used as the referent group based on a smoothed plot of diabetes prevalence and hours of sleep which did not show any significant difference in the odds of diabetes in men or women sleeping between 6 and 9 hours. adjusted odds ratios were obtained from a base model that included age, obesity and family history of diabetes. additional confounders were added to this model and only those variables that significantly improved the model were retained. to assess the effect of sleep on the control of diabetes, analysis was limited to those participants who were identified as having diabetes for more than one year. multivariable logistic regression adjusting for age, sex and insulin use, using good versus poor control as the outcome, was used to assess the effect of sleep on diabetes control. analysis for this study was restricted to respondents who had complete data for diabetes diagnosis, sleep duration, and potential confounders. of the 2,848 individuals who participated the final sample had a higher proportion of urban dwellers than the total sample (63% versus 57%; p=0.02) but there were no other differences in the demographic factors assessed. the population was predominantly black (94.3%), female (69%), with a mean (se) age of 42 16 years, bmi of 27.6 6.6 kg/m, and reported sleep duration of 8.2 1.8 hours. approximately 12% (men 11%, women 13%) had diabetes, with 29% diagnosed with diabetes at the time of the survey. the median duration of diabetes was 7.0 years, with 18% reporting treatment with insulin. women were more likely to have depression/depressive symptoms, live in crowded conditions, be classified as physically inactive and report a family history of diabetes. women had a higher mean bmi and were more likely to report receiving advanced education than men. sex specific characteristics of the sample by sleep duration category are presented in tables 2 and 3. in both sexes, there was an inverse relationship between bmi and reported hours of sleep. in men, the proportion of alcohol drinkers was inversely associated with the number of hours of sleep. in women, age, post-secondary education and high physical activity were inversely associated with the number of hours of sleep. in univariate analysis, using participants sleeping between 8-9 hours per night as the referent, men who reported sleeping more than 10 hours per night had an increased likelihood of diabetes (or [95% ci]=3.97 [1.5710.1]). when adjusted for age, bmi and family history of diabetes the odds of diabetes increased for each of the sleep categories and also became significant in those who reported sleeping less than 6 hours with an or [95% ci]=2.65 [1.096.48] (see table 4). adjustment for depression, alcohol use, smoking, physical activity and education did not significantly affect these findings. in univariate analysis in women, there was no difference in the likelihood of diabetes in any sleep category compared to the referent group. after adjusting for age, bmi, and family history of diabetes the odds of diabetes were significantly lower in those who reported sleeping less than 6 hours (or [95% ci]=0.43 [0.230.78 ]) (see table 4). the results were unchanged after adjusting this model for depression, physical activity, alcohol use, smoking, crowding and educational status. the relationship between reported hours of sleep and the prevalence of diabetes did not change when analysis was restricted to those participants with established diabetes or those diagnosed as having diabetes at the time of the survey, though many of the associations were no longer statistically significant due to the reduced sample size. obesity did not modify the association between sleep and diabetes prevalence in this study. reported duration of sleep and diabetes control was examined in 228 participants (26% men) who had diabetes for more than 1 year. approximately two-thirds (69%) had an hba 1c less than 7.0%. participants who had controlled diabetes were older (median age (interquartile range) 59 [4868] versus 54 (4463) years) but there were no differences in the reported hours of sleep between the groups. using those sleeping 8-9 hours as the referent, there was no significant association between good diabetes control and sleep duration on univariate analysis. this remained unchanged after adjusting for insulin use and age (data not shown). we found a significant relationship between sleep duration and diabetes prevalence among jamaican adults, although the relationship differed between the sexes. in men, both shorter and longer hours of sleep were associated with an increased likelihood of diabetes, and this relationship remained significant after adjustment for potential confounders. conversely in women, shorter hours of sleep were associated with a reduced likelihood of diabetes, even after adjustment for the same confounders. our findings in men are consistent with those of other studies which have examined the relationship between sleep duration and diabetes. in a cross sectional study of 323 men and 417 women aged 2164 years, chaput found an increased likelihood of diabetes for those sleeping 5-6 hours and 9-10 hours in both sexes. other studies, such as the lifestyle survey of korean men have also found an association between either short or long sleep duration and diabetes prevalence in men. contrary to what was expected, women who slept less than 6 hours had a reduced likelihood of diabetes. while some studies have found no association between sleep deprivation and diabetes or sex differences in the association between short sleep duration and diabetes [13, 24], none of these studies have suggested that there might be a protective effect from lack of sleep. while these women had a higher bmi, they were more physically active and better educated. the association between sleep and diabetes was still significant after adjustment for these potential confounders. in a study of korean men, sleep deprivation was associated with diabetes prevalence in the nonobese participants; however, we found no difference in the association according to body mass index in the jamaican women. sex differences in the relationship between sleep and diabetes prevalence could be attributed to biological differences in sexual hormones that affect sleep or differences in stress and the stress response. short and long sleep duration has been shown to affect metabolic and endocrine control [7, 9]. sleep deprivation affects serum leptin (an appetite suppressive hormone) and ghrelin (an appetite stimulatory hormone). there are few data examining the effect of sleep on these hormone levels but hours of sleep have been negatively correlated with ghrelin levels and sleep deprivation has been shown to result in lower levels of leptin. sleep deprivation may also reduce the amount of rapid eye movement sleep, interfering with brain glucose utilization and resulting in increased serum glucose levels. sleep disorders are associated with increased sympathetic activity, which leads to an increase in gluconeogenesis and glycogen breakdown, thus inducing insulin resistance. the association between sleep and diabetes prevalence may be a result of confounding from obesity. lack of sleep as well as longer hours of sleep has also been associated with increased obesity. obesity, a strong diabetes risk factor, can also result in poor sleep quality and interrupted sleep. in our analysis, the effect of the association was still present even when adjusting for differences in bmi. sleep apnea, which can result in insulin resistance, can also be considered another risk factor for diabetes and may result in excessive sleepiness and longer reported hours of sleep.. some complications, such as peripheral neuropathy, which are worse at night, can interfere with the ability to sleep and thereby result in an association between sleep and diabetes control. additionally, insulin, typically reserved for patients with poor glucose control, may be associated with a higher risk of hypoglycaemia, especially at nights and this may also interfere with sleeping patterns in patients concerned about this risk. the relationship between diabetes and sleep, however, was still present even when restricted only to those diagnosed with diabetes at the time of the survey suggesting that the association may not be a result of having diabetes or its treatment. we did not demonstrate an association between sleep and diabetes control in our analysis even with adjustment for age or insulin use this may be a result of insufficient power to detect this effect. overall glucose control was good in this sample with over two-thirds having an hba1c of 7% or less. there was no evidence that sex modified the relationship between glucose control and hours of sleep. while there was no statistically significant difference in the prevalence of depression or poor quality sleep with reported hours of sleep in the study, these conditions appeared to be more common in those who reported sleeping the recommended number of hours. adjusting for depression did not make any difference in the association between diabetes prevalence and hours of sleep in the analysis. it was not found to be a significant predictor of the presence of diabetes, and adjusting for sleep quality did not affect the association between diabetes and hours of sleep in multivariable analysis. the female predominance has been seen in our previous national survey and may reflect the household structure in jamaica; as for participants to be eligible for selection, they needed to spend at least 3 nights at home. in other analyses, we have corrected this by applying survey sampling weights; however, as we were interested in the relationship between sleep and diabetes, we did not make the adjustment for this paper. the cross-sectional design restricts the ability to infer causality as the temporal relationship between sleep duration and diabetes can not be established; however, previously conducted cohorts have shown that sleep duration is a likely risk factor for diabetes mellitus. another limitation of the study was the inability to account for sleep apnoea and diabetic complications including chronic pain which were not measured and could potentially produce a relationship between sleep and diabetes prevalence by interfering with sleep or through changes in physical activity. the definition of diabetes was based on capillary glucose and not plasma; however, this technique still provides a useful estimate of diabetes prevalence from a large nationally representative sample and had been considered as an acceptable means for diagnosing diabetes in previous who criteria. glycosylated haemoglobin was measured using a point of care testing machine (nycocard) which may tend to underestimate the true value but allows subjects to be appropriately classified for clinical purposes and provides a better estimate of overall glucose control than a single finger stick glucose measurement. sleep duration and quality were self-reported which may be subjective, but this is considered equally effective as actigraphy in measuring sleep patterns of individuals. as the assessment took place at one point in time, we may have failed to identify changes in the pattern of sleep that may be of importance in this association. our findings support the growing evidence that sleep may play a role in the prevention of diabetes, particularly in black men living in developing countries. we are unaware of any other studies conducted in predominantly black developing countries to examine this issue. adequate sleep may be an important public health initiative to stem the diabetes epidemic in the region. further study of the reasons for the sex differences in the association between sleep and diabetes and to determine the physiological and biological mechanisms underlying the associations between sleep duration and diabetes needs to be conducted.

background. there are limited data on sleep duration and diabetes from developing countries. we therefore examined the relationship between reported hours of sleep, diabetes prevalence and glucose control in jamaican adults. methods. data on reported hours of sleep and diabetes (based on glucose measurement and medication use) from a national survey of 1574-year-old jamaicans were analyzed. results. the 2,432 participants (31% m, age 42 16 years, bmi 27.6 6.6 kg/m2, diabetes prevalence 12%) reported sleeping 8.2 1.8 hours. in men, sleeping less than 6 hours (or (95% ci)=2.65 (1.096.48)) or more than 10 hours (or (95% ci)=4.36 (1.5612.19)) was associated with diabetes when adjusted for age, bmi, and family history of diabetes. in women sleeping less than 6 hours was associated with a reduced likelihood of diabetes after adjusting for the same confounders (( or (95% ci)=0.43 (0.230.78)). there was no significant association between sleep and glucose control. conclusion. insufficient and excessive sleep was associated with increased diabetes prevalence in jamaican men but not women.

PMC3227472

pubmed-1149

several clinically significant antibiotics as well as widely used drugs against common diseases have been derived from this unique genus affiliated with the order actinomycetales. diverse members of this order including streptomyces have been isolated from previously unexplored natural habitats to nourish the current microbial antibiotic searching programs [2, 3]. jaj06 is a gram-positive, moderately halophilic streptomyces strain, which has previously been isolated from hypersaline coastal solar saltern at tuticorin, india. this strain produces an antimicrobial polyketide compound which has been reported to have potent antimicrobial activity against a set of bacteria and yeast with significant minimal inhibitory concentrations. production of antibiotic compound in jaj06 has been reported to have seawater dependence. like many other complex medium components, seawater has nondefined composition which might affect the reproducibility of the production profile of microorganisms. to maintain a reproducible production profile, media components and their optimum levels are critical to the secondary metabolites produced by microorganisms. in the field of antibiotics, much effort was directed toward optimizing production rates and directing the product spectrum. production of microbial secondary metabolites in a microbial system can be improved by optimization of physical parameters and nutritional constituents of production medium. the optimization experiments are usually performed using nonstatistical one-factor-at-a-time [9, 10] and statistical experimental design approaches [11, 12]. however, the former one is highly laborious and time consuming than the statistical methods. consequently, statistical experimental design techniques especially plackett-burman design (pbd) and response surface methodology (rsm) are widely used to select the significant variables and obtain the optimal levels, respectively [7, 1118]. the application of these statistical experimental design techniques in media optimization can result in improved product yields, reduced process variability, reduced time, and overall costs, compared with conventional practice of single factor optimization [7, 13]. plackett-burman design has been applied by several researchers to select influencing factors among the constituents of complex medium [1517]. optimization of selected, highly influencing factors can be done using response surface methodology with either central composite design (ccd) or box-behnken design experiments. in present work, efforts taken to expel the seawater from the production medium of jaj06, with incorporation of chemically defined salt formulations. further, in order to enhance the antibiotic production by jaj06, production medium was optimized using a successive optimization strategy, selection of media components that significantly influence the antibiotic production using plackett-burman design and optimization of these media components using rsm with box-behnken design. jaj06 was previously isolated from a coastal solar saltern soil and extensively studied for their antibacterial secondary metabolite. the strain was maintained over the surface of isp4 agar slants supplemented with 3% of sea salt (w/v). a nutrient medium contained 10 g of starch, 4 g of yeast extract, 2 g of peptone, 1 g of mgso4, 2 g of caco3, 0.04 g of feso47h2o, and 0.1 g of kbr in 1 l of sterile seawater was taken as basal production medium for further modification and statistical optimization. in order to replace the chemically nondefined seawater, two defined salt formulations were screened and compared with seawater to support antibiotic compound in jaj06. according to previous reports, two salt formulations were prepared with some modifications: salt formulation i contained 12 g of nacl, 0.35 g of kcl, 0.22 g of cacl22h2o, 10.7 mg of h3bo3, 7.3 mg of srcl2, 1.3 mg of naf, and 26 g of cocl26h2o in 1 liter of deionized water; salt formulation ii contained 15 g of kcl, 0.22 g of cacl22h2o, 10.7 mg of h3bo3, 7.5 mg of srcl2, 1.3 mg of naf, and 26 g of cocl26h2o in 1 liter of deionized water. spore suspension of jaj06 was prepared in distilled water from cultures grown on modified isp-4 medium supplemented with 3% of sea salt (w/v) at 30c for 7 days. the suspension was then added to isp-2 broth in 250 ml erlenmeyer flask at a rate of 10 spores in 50 ml liquid medium. cultures were incubated on a shaker at 120 rpm at 30c for 3 days and used as seed stocks. for antibiotic production, strain jaj06 was inoculated into production medium and incubated on a shaker at 120 rpm for 8 days at 30c. cell-free supernatant of fermentation broth was recovered by centrifuging it at 10000 rpm for 10 min. ethyl acetate was added to the supernatant in 1: 1 proportion and the mixture was agitated for 10 min. the solvent layer containing antibiotic substance was separated from broth and it was further centrifuged at 5000 rpm for 15 min to remove traces of fermentation broth. the antimicrobial crude extract was concentrated tenfold using a rotational vacuum concentrator and used for antibacterial assay. the extracted crude substance was assayed in triplicate for their antimicrobial activity against bacillus subtilis mtcc 441 by agar diffusion plate assay [7, 20]. the crude extract was loaded on 6 mm sterile discs, dried, and placed on nutrient agar plate inoculated with b. subtilis suspension adjusted to a mcfarland standard of 0.5, which is equivalent to 1.5 10 cfu/ml. the plates were incubated at 37c for 24 h and the inhibition zone formed around the disc was measured with transparent ruler in millimeter.. confirmed that the size of the zones of inhibition can be considered as measure of antibiotic titre. therefore, the antibiotic activity was expressed as units of activity per millilitre the crude substance of culture, where 1 u was defined as a 1.0 mm annular clearing around the antibiotic disk. plackett-burman design (pbd) was employed for screening the most significant medium components for growth and antimicrobial compound production by streptomyces sp., pa, usa) was used for the experimental designs and subsequent analysis of the experimental data. in the experimental design, 7 medium components (independent variables) were screened by representing them at two levels, low () and high (+) in 12 trials. table 1 shows media components, symbol code, and actual low and high level of the variables. table 2 shows the detail of the design, each row represents a trial, and each column represents an independent variable. the experiment was carried out in triplicate and the average antimicrobial activity against b. subtitles was taken as the response. the variables with confidence levels above 90% were considered to have significant effect on antimicrobial compound production and thus used for further optimization. response surface methodology (rsm) was used with box-behnken design to optimize the selected media constituents: starch, kbr, and caco3 for enhanced antibiotic production in jaj06. the three medium components (independent variables) were studied at three different levels: (), (0), and (+) for low, intermediate, and high concentrations, respectively (table 3). the experiment was carried out in 17 trials (table 4) with five replicates at the centre point and the values of responses were the mean of two replications. for statistical calculations, coding of the factors was done according to the following equation: (1)xi=xix0xi, i=0,1,2,3, ,n, where xi was the coded value of an independent factor, xi was the actual value of an independent factor, x0 was the actual value of an independent factor at the center point, and xi was the step change value. for predicting the optimal point, a second-order model was fitted to correlate the relationship between independent variables and response. the behaviour of the system was explained by the following quadratic equation: (2)y=0+ixi+ijxixj+iixi2, where y is the predicted response, 0 is the intercept term, i is the linear coefficient, ij is the quadratic coefficient, ii is the interaction coefficient, and xixj represent the independent variables. the design expert trial package (version 7.0) the statistical significance of the model was verified by applying the analysis of variance (anova). overall model significance was determined using fisher's f-test and its associated probability p(f). lack of fit values lower than 0.05 indicates that there might be a contribution to the variables-response relationship that the model does not take into account. the quality of the polynomial model equation was judged statistically by coefficient of determination (r) and adjusted r. the fitted polynomial equation was then expressed in the form of three-dimensional response surface plots, to illustrate the relationship between the responses and the experimental levels of each independent variable. the design expert's numerical optimization method was employed to optimize the level of each variable for maximum response. the combination of different optimized variables, which yielded the maximum response, was experimentally validated by culturing jaj06 in optimized and unoptimized production medium. the cell-free culture broths were collected and extracted with equal volume of ethyl acetate and the top organic layer was dried for further analysis. the dried ethyl acetate extracts were resuspended in methanol and assayed as above for antibiotic activity. the maximal antibiotic activity of jaj06 in three different media prepared separately with nondefined sterile seawater and two chemically defined salt formulations was examined in shake flask cultures. growth and antibiotic activity exerted by streptomyces sp. however growth rate in both seawater and sodium chloride based salt formulation seemed to be the same, while the growth rate and antibiotic activity are slightly lower in salt formulation ii than those of the other two. the main effect of each variable on antibiotic activity was calculated to determine the medium components which influence the antimicrobial compound production by streptomyces sp. table 6 represents the effect, standard error, t-value, p value, and confidence level of each component from the result of antibiotic assay given in table 2. the medium components were screened at the confidence level of 92.5% on the basis of their effects. it was indicated that starch (x1), kbr (x5), and caco3 (x7) had apparent influences in antibiotic production by jaj06. confidence levels of these three variables were higher than 90% which indicates their significant contributions than those of other media components. the same was confirmed from the pareto graph (figure 1) in which higher effects were presented in the upper portion and then progress down to the lower effects. it directly shows that the most important factors influencing antimicrobial compound production were starch, kbr, and caco3. based on the results of the plackett-burman design, starch, kbr, and caco3 were chosen as most influencing media components and further optimised using response surface methodology. in this approach, the batch runs were conducted in box-behnken design experiments and results to determine the effect of independent factors on the response along with the predicted values are shown in table 4. the regression equation coefficients were calculated and the data was fitted to a second-order polynomial equation. the response of antibiotic activity (y) can be expressed in terms of the following regression equation: (3)y (antibiotic activity) =165.34+13.54a+7.29b 5.83c0.43ab+2.50ac+0.85bc 14.13a221.63b218.71c2, where y represented the response of antibiotic activity, and a, b, and c were the coded values of starch, kbr, and caco3, respectively. the anova was performed to inspect the second-order response surface model and results are given in table 7. the anova showed that the model was highly significant, as it was evident from the low p value (< 0.0001) of the fisher's f-test. significance of model was also supported by statistically insignificant lack of fit, as was evident from the lower calculated f value (4.01). the model r of 0.9831 implied that model equation could explain 98.31% of the total variation which suggested a good agreement between predicated values and experimental data. diagnostic plots were drawn to judge the model adequacy and clarify the signs of any problems in the experimental data. plot of observed response (antibiotic activity) versus predicted reponse is shown in figure 2(a). in this case, predicted values were in agreement with observed ones in the range of the operating variables. the normal probability plot of the studentized residuals was used to check for normality of residuals (figure 2(b)). a linear pattern observed in this plot suggests that there was no sign of any problem in the experimental data. figure 2(c) represents a plot of studentized residuals versus predicted values to check for constant error. residuals displayed randomness in scattering and suggested that the variance of the original observation was constant. the three-dimensional (3d) response surface plots were drawn to illustrate the individual and interactive effects of starch, kbr, and caco3 on antibiotic production by jaj06 (figure 3). each 3d plot presented the effects of two variables while the rest one was held at middle level. there was insignificant mutual interaction between starch and kbr as well as starch and caco3 (figures 3(a) and 3(b)), respectively. with the increase of the concentration of starch from 2 to 17.5 g/l (coded value, 1.0 to 0.75), the antibiotic activity significantly increased at moderate concentration of kbr (coded value, 0.5); however, decreased antibiotic activity was observed with any further increase of kbr even at high concentration of starch (figure 3(a)). when the concentration of caco3 was just beyond the middle level (coded value, 0.25), the antibiotic activity increased with increasing concentration of starch from 2 to 15 g/l (coded value, 0.1 to 0.5) and further increase of starch to its high level resulted mild decrease in antibiotic production (figure 3(b)). with the increase of the concentration of kbr from 0.02 to 1.1 g/l (coded value, 1 to 0.15), the antibiotic activity significantly increased to certain level at a low concentration of caco3 (coded value, 1) and further slightly increased at a moderate level of caco3 (coded value, 0.25). lower concentration of caco3 was found to be supportive for antibiotic activity; however the activity was suppressed when the concentration of caco3 was higher in production medium. on the basis of numerical optimization, the quadratic model predicted that the maximum antibiotic activity was 169.07 u/ml, when the optimal values of test factors in the coded units were starch=0.37, kbr=0.24, and caco3=0.20 (figure 4), which were 7.4 g/l starch, 0.048 g/l kbr, and 0.8 g/l caco3, respectively. the validation of the statistical results using the optimized medium was accomplished by carrying out shake-flask experiments in triplicate. the maximum antibiotic activity unit obtained experimentally was found to be 173.3 u/ml, (table 8) which is in close agreement with the prediction value (169.07 u/ml). therefore, the developed model was considered to be accurate and reliable for predicting the production of antibiotic by streptomyces sp. the final optimized medium contained 7.4 g of starch, 4 g of yeast extract, 2 g of peptone, 1 g of mgso4, 0.8 g of caco3, 0.04 g of feso47h2o, and 0.048 g of kbr in 1 l of sodium chloride based salt formulation i. their antibiotic producing capability is not a static property and it can be significantly affected by constituents of production medium [24, 25].. undefined nature of seawater can affect the reproducibility of the production profile of actinomycetes. in this study, the seawater has been expelled from the production medium with incorporation of chemically defined salt formulations. among the two defined salt formulation, this type of chemically defined salt formulation has already been reported for consistent production of bioactive compounds from seawater dependent salinispora tropica strain nps21184. small manipulations in the culture medium composition can exert significant effect on secondary metabolites biosynthesis in microorganisms [7, 26]. several researchers working on antibiotics discovery programs have applied pbd and rsm as statistical tools to recognize, manipulate and optimize influencing medium constituents and recorded the increased antibiotic production. for instance, wang et al., applied rsm approach for medium optimization for antibiotic production by xenorhabdus bovienii and recorded 37.8% increase in antibiotic activity. recently, chen et al. reported 2.7-fold increase in antibiotic production by bacillus sp. zjuibe-076 using rsm approach. in the present study, pbd and rsm were applied for medium optimization for antibiotic production by streptomyces sp. jaj06 and recorded 26.8% increase in antibiotic activity. the results of pbd revealed that the crucial media components related to the antibiotic production by jaj06 were starch, kbr, and caco3. raytapadar and paul reported starch as a significant media component for production of antibiotic from streptomyces aburaviensis 1da-28. similarly, caco3 has been identified as a crucial ingredients related to the production of cyclic hexapeptide antibiotic by streptomyces alboflavus. rsm was found to be very effective in optimizing the selected medium components evident from positive diagnostic plots (figure 2) and r value 0.9831 which was comparable with the earlier reports [7, 27]. jaj06 as a function of various salt compositions and levels of ingredients in production medium. pbd and rsm were found to be very effective in selecting and optimizing the medium components in manageable number of experimental trials with overall 26.8% increase in antibiotic activity. moreover, the optimum culture medium obtained in this experiment will be useful for further study with large scale fermentation in a fermenter for the efficient production of antibiotic from this streptomyces sp.

streptomyces sp. jaj06 is a seawater-dependent antibiotic producer, previously isolated and characterised from an indian coastal solar saltern. this paper reports replacement of seawater with a defined salt formulation in production medium and subsequent statistical media optimization to ensure consistent as well as improved antibiotic production by streptomyces sp. jaj06. this strain was observed to be proficient to produce antibiotic compound with incorporation of chemically defined sodium-chloride-based salt formulation instead of seawater into the production medium. plackett-burman design experiment was applied, and three media constituents, starch, kbr, and caco3, were recognised to have significant effect on the antibiotic production of streptomyces jaj06 at their individual levels. subsequently, response surface methodology with box-behnken design was employed to optimize these influencing medium constituents for the improved antibiotic production of streptomyces sp. jaj06. a total of 17 experiments were conducted towards the construction of a quadratic model and a second-order polynomial equation. optimum levels of medium constituents were obtained by analysis of the model and numerical optimization method. when the strain jaj06 was cultivated in the optimized medium, the antibiotic activity was increased to 173.3 u/ml, 26.8% increase as compared to the original (136.7 u/ml). this study found a useful way to cultivate streptomyces sp. jaj06 for enhanced production of antibiotic compound.

PMC3885193

pubmed-1150

a 31-year-old multiparous turkish woman was scheduled for cesarean section under spinal anesthesia at 37 weeks and five days gestation because of hemorrhage due to secondary placenta previa. invasive blood pressure, central venous pressure, and heart rate were stable during the surgery. rates of maternal hypertension, pre-eclampsia, anemia, and infection in the pregnant chronic dialysis patient are high. however, our findings suggest that with careful, close, and effective monitoring preoperatively and intraoperatively, spinal anesthesia can be safely performed for cesarean section in patients undergoing hemodialysis. fertility is reduced in patients with renal disease, so pregnancy in patients with end-stage renal failure is uncommon. however, confortini et al in 1971 reported the first case of a 35-year-old end-stage renal failure patient on hemodialysis (hd) who achieved a full-term pregnancy.1 the major issues to be dealt with in this type of patient are the possible complications of pregnancy, including onset or exacerbation of systemic arterial hypertension which may evolve into pre-eclampsia or even eclampsia, premature delivery, or failure of the fetus to grow. another important point to define is that of full-term pregnancy in patients on dialysis.2 the placenta usually implants in the upper uterine segment. however, in some cases, it implants in the lower uterine segment, either covering the internal cervical os, or lying in close proximity to it. this abnormal implantation into the lower segment, called placenta previa, is an important cause of bleeding in the second half of pregnancy and during labor, and is associated with significant maternal and perinatal morbidity and occasionally mortality.3 there are many reports outlining the safe and successful use of peripheral regional blocks in dialysis-dependent patients if there is no platelet dysfunction or coagulation abnormality. in fact, peripheral regional anesthesia techniques have been used in patients with chronic renal failure (crf) for the creation of arteriovenous fistulae. in this paper we share our experience of spinal anesthesia in a pregnant woman with crf on dialysis and needing an emergency cesarean section due to placenta previa. a 31-year-old woman with seven gravidas, four paras, two abortions, and three live children was referred to us at 37 weeks and five days gestation. she had suffered from crf since the age of 29 years, and had been undergoing hemodialysis three times per week. the patient had had a medical abortion one year earlier when she was five months pregnant due to an intrauterine ex-fetus that developed secondary to her renal disease and the patient was recommended not to become pregnant again. having noticed the current pregnancy too late, the patient was then undergoing four hours of dialysis three times a week, and increased to four hours per day for the previous seven months. one hour after her last dialysis, she was hospitalized in gynecology services due to vaginal bleeding and cramps. the patient was being monitored for delivery and upon an increase in the amount of vaginal bleeding and detection of placenta previa during ultrasonographic examination, it was decided to perform an emergency cesarean section. preoperative laboratory values for the patient are summarized in the table. in the preoperative preparation room, central venous catheterization was performed under local anesthesia via the right internal jugular vein. invasive arterial catheterization was performed from the right radial artery (because an arteriovenous fistula was being used for dialysis on the left side). the patient had been taking methyldopa as an antihypertensive during the preoperative period but had severe hypertension at presentation (180/110 mmhg), so nitroglycerin infusion was started. her activated partial thromboplastin time being normal (table 1), six hours having elapsed since her last dialysis (ie, the dialysis-dependent antiaggregant effect having receded), and considering the risks of anesthesia, it was decided to use spinal anesthesia in view of its additional antihypertensive effect. spinal anesthesia with 8 mg of hyperbaric bupivacaine was successfully performed using a 27-gauge spinal needle at the l3/4 intervertebral space in the sitting position. spinal anesthesia level having reached the t5 and t6 dermatomes, the operation was started at the third minute. a 2220 g baby with an apgar score of 6 in one minute and 8 in five minutes was delivered four minutes after the beginning of surgery. invasive blood pressure (bp), electrocardiography (ecg), heart rate (hr), and pulse oximetry (spo2) were monitored during surgery. hypotension, probably related to sympathetic blockage, developed following spinal anesthesia, so the nitroglycerin infusion was terminated without the need for sympathomimetic medication. thereafter, the patient was taken to the intensive care unit (icu) with a bp of 119/71 mmhg, a hr of 83 beats per minute, and a sensory spinal anesthesia level at the t9 and t10 dermatomes. during the operation, the patient was not given any liquids other than 1 u of erythrocyte suspension due to her anemia. she was given an additional 2 u of erythrocyte suspension while she was kept in the icu. she recovered without any problems, returned to regular hemodialysis on the first postoperative day, and was discharged from the hospital four days after the operation after adjustment of her antihypertensive therapy and on a dialysis program of four-hourly sessions three days a week. clinical assessment on the day of discharge revealed no complications of spinal anesthesia, such as headache, nausea, change in bp (in particular, hypotension) or neurological deficit. meanwhile, the baby was taken for ventilator treatment in the neonatal intensive care unit due to respiratory distress syndrome. having been treated for abo isoimmunization and neonatal jaundice, the baby was discharged from hospital 32 days after delivery. childbearing is an important issue in women with renal disease.4 although not common, pregnancy in chronic dialysis patients does occur. in fact, the percentage of successful pregnancies in women on chronic dialysis may be increasing.5 however, pregnancy has generally been regarded as very risky in these women.4 maternal complications associated with crf include pre-eclampsia, worsening renal function, preterm delivery, anemia, chronic hypertension, and cesarean delivery.6 hypertension is the most common life-threatening problem in these patients.4 in preparation for elective surgery, patients with crf should receive dialysis the day before the operation. this is essential to achieve a volume status as close to normovolemic as possible, to allow the patient to tolerate fluid loads associated with surgery, and to obtain normal electrolyte concentrations. otherwise, patients have to be managed medically and receive dialysis after the operation.7 our patient had to be operated on six hours after her last dialysis, at which time her volume and electrolyte balance could not be fully established. the preoperative evaluation of the patient with crf should focus on the comorbidities associated with kidney disease and on the signs and symptoms of uremia, fluid overload, and inadequate dialysis. laboratory studies should be aimed at assessing electrolyte concentrations, acid-base status, urea and creatinine levels, hematocrit, platelet count, and coagulation.7 blood gas values were also monitored in our patient as part of her preoperative laboratory examination. particular attention was paid to serum bicarbonate levels, which were in the 1820 meq/l range.8 electrolytes should not be measured immediately after dialysis due to incomplete equilibration between plasma and intracellular fluids. potassium levels above 5.5 meq/l are usually considered a contraindication to elective surgery because tissue trauma and cell death can cause potassium to increase to life-threatening levels. an ecg is usually obtained as well to screen for changes caused by electrolyte abnormalities.7 no indications of hyperkalemia were observed in our patient s laboratory data or on her ecg. platelet dysfunction is not related to a low platelet count, and can be detected only by the bleeding time, measured as the time to cessation of hemorrhage after a standardized skin incision.9 however, this test seems to have a limited predictive value for clinical bleeding and is not commonly used. patients who are receiving adequate dialysis are less likely to have significant platelet dysfunction and their risk of bleeding should not be excessive.7 control of anemia is important because this is a significant cause of left ventricular hypertrophy, heart failure, and angina. a hemoglobin of 11 to 12 g/dl is considered optimal,10 and this value is also used as a target before surgery, although this practice is not supported by clinical evidence. correction of anemia also helps to improve the platelet dysfunction associated with renal failure.11 our patient was given 1 u of erythrocyte suspension during the operation and 2 u after the operation due to the presence of anemia (see table). she was also given erythropoietin, and was discharged from the hospital on the fourth postoperative day with an acceptable hemoglobin value. if fluid balance is likely to be a problem, central venous monitoring may be useful, but the need for invasive arterial monitoring should be considered carefully before potentially damaging an artery that may be used later to form an arteriovenous fistula. when positioning patients for surgery, care should be taken to protect shunts or fistulae.12 delayed gastric emptying may increase the risk of aspiration during general anesthesia. if anticoagulants have been used during hemodialysis, at least six hours should elapse before siting a regional block. it is wise to confirm that clotting is normal by checking the activated partial thromboplastin time. when performing a block it is essential to use aseptic technique. presence of any peripheral neuropathy should be documented if regional blocks are to be used.12 intravenous access is usually difficult in patients with crf, and central venous access is often needed. the veins and arteries of the nondominant upper extremity should be spared from vascular cannulation, because they may be needed for dialysis access in the future. subclavian vein cannulation should also be avoided because this procedure is frequently complicated by thrombosis, which compromises dialysis access. therefore, we opted to do central venous cannulation via the internal jugular vein in our patient. we also carried out invasive arterial monitoring via the right radial artery because there was an arteriovenous fistula on the left side for dialysis. during all these procedures, we were extremely careful to maintain sterile conditions due to the risk of infection in this type of patient. the choice of hemodynamic monitoring technique should be based on the history and characteristics of the individual patient and should be directed towards specific hemodynamic goals. patients with renal diseases undergoing high-risk procedures often need invasive hemodynamic monitoring with arterial and central venous catheters.7 we considered it appropriate to carry out preoperative arterial and venous monitoring in view of our patient s clinical condition (ie, anemia, dialysis six hours earlier, and severe hypertension, along with normal bleeding tests). hypertension in crf patients is usually volume-dependent and responds to adequate dialysis, but most patients will also require pharmacologic therapy. current recommendations for long-term crf management set a bp goal of lower than 130/80 mmhg.13 preoperative bp in our patient was high (180/110 mmhg). nitroglycerin infusion was started at the initiation of invasive arterial monitoring, and the infusion rate was adjusted (0.251.0 g/kg/min) until the target bp (130/80 mmhg) was reached. nitroglycerin infusion was preferred because of its rapid onset and offset, its cardiac protective effect, its lack of vasodilatory properties, and its low risk to the baby. improvements in dialysis and medical treatment have increased the number of dialysis-dependent crf patients being considered for surgery, including obstetric procedures. in patients with crf necessitating dialysis, mortality rates of 4 to 10% have been reported, with morbidity rates approaching 50%.14 this increased rate of complications is probably due to the low renal reserve of patients with crf and their reduced ability to respond to the stress, fluid load, and tissue trauma caused by surgery. however, additional morbidity is created by organ dysfunction and the coexisting diseases frequently encountered in these patients. pregnancy adds further risks, including pre-eclampsia, polyhydramnios, intrauterine growth retardation, preterm delivery, low birth weight, and the potential for a stillbirth. we believe that pregnant crf patients requiring dialysis can be urgently and safely operated on using a careful anesthesia method after a detailed renal and hematological preoperative assessment and rapid but detailed preparation.

background: chronic renal failure is strongly associated with poor pregnancy outcome. women dependent on hemodialysis before conception rarely achieve a successful live birth. case presentation: a 31-year-old multiparous turkish woman was scheduled for cesarean section under spinal anesthesia at 37 weeks and five days gestation because of hemorrhage due to secondary placenta previa. spinal anesthesia with 8 mg of hyperbaric bupivacaine was successfully performed. invasive blood pressure, central venous pressure, and heart rate were stable during the surgery. the mother returned to regular hemodialysis on the first postoperative day. conclusion:pregnancy is uncommon in women with chronic renal failure requiring chronic dialysis. rates of maternal hypertension, pre-eclampsia, anemia, and infection in the pregnant chronic dialysis patient are high. however, our findings suggest that with careful, close, and effective monitoring preoperatively and intraoperatively, spinal anesthesia can be safely performed for cesarean section in patients undergoing hemodialysis.

PMC2915524

pubmed-1151

bisphosphonates are have been used for many years for a variety of conditions including paget's disease, osteoporosis, multiple myeloma, and hypercalcemia of malignancy. a number of randomized clinical trials have shown that they increase bone density and reduce the incidence of fractures in osteoporosis. although bisphosphonates are generally safe and effective, concerns have been raised about the potential risk of over-suppression of bone turnover during long-term use. have reported on nine patients who sustained spontaneous non-spinal fractures while on alendronate therapy. schneider also described a 59-year-old previously healthy woman who experienced two non-traumatic stress fractures of the femur, 4 years apart, while on alendronate therapy. reported a 35-year-old man who, after 6 years of treatment with 10 mg/day alendronate, had a sub-trochanteric fracture of the right femur after mild trauma. a bone biopsy showed a lack of osteoid on trabecular surfaces and an absence of tetracycline labeling, suggesting marked suppression of bone turnover. here, we describe a 63-year-old korean woman who presented with non-traumatic spontaneous diaphyseal fractures of both femurs and delayed fracture healing after 5 years bisphosphonate therapy. a 63-year-old woman was admitted to hospital because of severe pain in both anterior thighs for 5 months. when she presented with osteoporosis and degenerative arthritis 5 years ago, she started to take alendronate 70 mg/wk, alfacalcidol 0.5 g/day and calcium citrate 1,900 mg/day. three years later, she switched to risedronate 35 mg/wk and calcitriol 0.25 g/day because of dyspepsia. she had total abdominal hysterectomy with bilateral salpingo-oophorectomy 35 years ago due to endometriosis. at the time of admission, her height was 147 cm, and her weight was 54 kg; these had been 158 cm and 55 kg in her fourth decade. there was no history of any trauma, falling, or medication that predisposed to osteoporosis and fracture. her lifestyle had not been sedentary because she had to work in the fields for her living. physical examination revealed blood pressure of 100/80 mmhg, pulse rate of 80 beats/min, respiratory rate of 20 breaths/min, and body temperature was 36.5. cardiac and abdominal examinations were normal. here walking pattern laboratory tests showed hemoglobin 12.2 g/dl, white blood cell count 4,910/mm, platelet count 334,000/l, serum calcium 9.3 mg/dl, serum phosphorus 3.2 mg/dl, total protein 7.5 g/dl, serum albumin 4.7 g/dl, uric acid 5.1 mg/dl, and alkaline phosphatase 72 iu/l. daily urinary calcium excretion was 369.2 mg (normal, 70 to 180), and daily urinary phosphorous excretion was 959.92 mg (normal, 400 to 1,300). serum parathyroid hormone (pth) was 18.92 pg/ml (normal, 10 to 65), and 25-(oh)-vitamin d, determined by commercially available radioimmunoassay kit (diasorin, stillwater, mn, usa), was 15.33 ng/ml (normal, 9.0 to 37.6). osteocalcin was 18.93 ng/ml (normal postmenopausal, 19.6 to 41.2), serum c-telopeptide, 0.301 ng/ml (normal postmenopausal, 1.008), and urine n-telopeptide was 55.7 nbce/mm cr (normal postmenopausal, 6.0 to 125.72). simple x-rays of the thoracic and lumbar spine showed diffusely decreased vertebral height with osteoporosis and multiple compression fractures of t4, t5, t11, l1, l2, l4, and l5 vertebrae. there was no additional compression spinal fracture compared with x-rays taken 2 years earlier (fig. 1). the most recent bone mineral density (bmd), measured by dual-energy x-ray absorptiometry (qdr-4500a, hologic, waltham, ma, usa), showed a t-score at the third lumbar vertebra of -3.8 and a total hip t-score of -3.3 (table 1). all of the results showed severe osteoporosis, and no improvement in bmd was seen, despite bisphosphonate treatment. whole spine magnetic resonance imaging revealed multiple compression fractures in the t4, t5, t11, l1, l2, l4, and l5 vertebral bodies and diffuse disk bulging at l2-3, l3-4, and l4-5, with degenerative changes of facet joints and thickening of ligamentum flavum. a whole-body bone scan, which was obtained 2 hours after injecting technetium-99 m hydroxymethylene diphosphonate (hdp) intravenously, showed intense uptake at both distal femurs. simple x-rays also showed fracture lines in both distal femur shafts, compatible with sites of pain (fig. 2). after spinal nerve block with walking rehabilitation therapy was done for pain control, pain was not improved. therefore, we speculated that the delayed fracture healing of both distal femurs due to the long-term bisphosphonates therapy was the main cause of the pain. bisphosphonate therapy was discontinued. however, the pain continued, and the fracture lines seemed to become aggravated and showed delayed fracture healing. however, the patient had surgical internal fixation at both femoral diaphyses because of non-union of the femoral fractures even after 6 months of observation without bisphosphonates (fig. the elapsed time from the first visit to surgical internal fixation was 7 months. during the operation, severe osteoporotic fracture was noted, but structural displacement was mild. bone biopsy performed with surgical fixation showed decreased trabecular bone with massive fibrosis in the marrow space. alendronate, risedronate, ibandronate, and zoledronate, which are classified as amino-bisphosphonates, have much higher potency because they contain nitrogen in their side chain. however, concerns have been raised about potential risk of over-suppression of bone remodeling during long-term use. prolonged use of bisphosphonates may suppress bone turnover to the point that micro-damage persists and accumulates. in experimental animals, alendronate has been shown to inhibit normal repair of micro-damage arising from marked suppression of bone turnover, which results in macro-cracks. chronic over-suppression of bone turnover by bisphosphonates may allow secondary mineralization to continue, resulting in hard, brittle bone with an increased risk for fracture. other supportive evidence on over-suppression includes several reports of jaw osteonecrosis in patients treated with high doses of bisphosphonates. recently, odvina et al. reported nine patients (eight postmenopausal women and one man) who sustained unusual spontaneous non-spinal fractures while on alendronate therapy (10 mg/day or 70 mg/wk) for 3-8 years. six of the nine patients had delayed or absent fracture healing for 4 months to 2 years during alendronate therapy, and four showed delayed fracture healing for 8-12 months even after discontinuation of alendronate. although co-administration of estrogen or glucocorticoids appears to be a predisposing factor, this apparent complication also occurred with bisphosphonate monotherapy. our case report described a woman who experienced non-traumatic spontaneous stress fractures while on bisphosphonate therapy and non-union of the femoral shaft fracture despite discontinuation of bisphosphonates. we were able to ensure good adherence to medication by her self-report and serial measurements of urinary n-telopeptide, one of the bone turnover markers, which showed a decrease of 62.5%, from 40.8 to 15.3 nbce/mm cr, during the first 3 months after initiation of bisphosphonate therapy and similar levels afterwards. therefore, this case had the possibility of delayed fracture healing due to suppression of bone turnover by long-term use of bisphosphonates. other possible causes of insufficiency or pathological fracture include osteoporosis-include osteomalacia, osteogenesis imperfecta, bone tumors (primary or metastatic), and paget's disease of bone. however, she had no definite clinical and laboratory evidence of such diseases. the residual effect on bone density is known to remain for 3 years after drug withdrawal, and it is possible that the suppressive effect of bisphosphonates on bone resorption might also be cumulative over time. therefore, close monitoring and assessment of fracture healing after internal fixation in this patient was mandatory, considering the risk of re-fracture. the fixed pins were maintained, and she showed full union status 6 months after internal fixation. in this patient, the biochemical markers such as n- and c-telopetides and serum osteocalcin showed normal levels and did not reveal magnitude of the suppression of bone turnover. the discordance between the histomorphometric and biochemical markers of bone turnover could be related to the variable degree of suppression at different skeletal sites, as the changes in biochemical markers are more reflective of changes in the whole skeleton. additionally, this patient showed somewhat elevated daily urinary calcium excretion, with normal serum calcium, phosphorus, and pth level. the active vitamin d, calcitriol, was thought to be the cause of this hypercalciuria. although previous studies have shown the efficacy of bisphosphonates in the first 5 years of therapy in terms of improving bone density and reduced risk of fractures, additional studies are needed to determine how long bisphosphonates can safely be given. recently, black et al. have compared the effects of discontinuing alendronate treatment after 5 years versus continuing for 10 years. the results confirmed the safety of alendronate for up to 10 years, including no increased fracture risk with long-term use. however, even those who discontinued alendronate after 5 years showed no higher fracture risk, other than for clinical vertebral fractures, compared with those who continued alendronate. these results suggest that discontinuation of alendronate for up to 5 years does not appear to significantly increase fracture risk, except for the patients at very high risk of vertebral fractures. furthermore, considering some definitive case reports, we must emphasize the need for awareness of recent controversies about the effect of long-term reduction of bone turnover on bone strength, especially the occurrence of awkward fractures at an unexpected site, as in this patient. the benefits of prolonged use of bisphosphonates must be carefully weighed against the potential adverse effects of over-suppression of bone metabolism.

bisphosphonates are potent inhibitors of bone resorption and widely used to treat osteoporosis. extensive studies have shown that therapy with bisphosphonates improves bone density and decreases fracture risk. however, concerns have been raised about potential over-suppression of bone turnover during long-term use of bisphosphonates, resulting in increased susceptibility to and delayed healing of non-spinal fractures. we report a patient who sustained non-traumatic stress fractures in bilateral femoral shafts with delayed healing after long-term bisphosphonate therapy. she underwent open reduction and surgical internal fixation. although bisphosphonates effectively prevent vertebral fractures, and their safety has been tested in randomized trials, we must emphasize the need for awareness of the possibility that long-term suppression of bone turnover with bisphosphonates may eventually lead to an accumulation of fatigue-induced damage and adverse skeletal effects such as delayed fracture healing.

PMC3295996

pubmed-1152

apart from the correlation studies mentioned above, the ability to innovate and solve novel problems flexibly, proxies for flexible cognitive capacities and potentially for domain-general intelligence, have not been investigated comparatively. few experimental studies have specifically focused on innovativeness, and flexible problem solving per se. the majority of experiments in animal cognition, in both the physical and social domain, present animals with specific problems and investigate how the animals solve them in order to examine specific cognitive abilities/processes. mostly, these tasks have been tailored to be ecologically valid for one particular species, or have focused on contexts/ questions so specific that they could not be reproduced in other species easily (e.g., dolphins; food-storing srub jays). other problem solving tasks, particularly in physical cognition, have secondarily become comparative paradigms and have been established as so-called benchmark tests for examining the existence of certain cognitive abilities in different species, e.g., the trap-tube for examining an understanding of causality in terms of surface continuity, povinelli s cane task and heinrich s string-pulling task for testing responsiveness to connectivity etc. most of these typically started off from a single experiment designed for testing a particular species and some subsequently applied to other species, sometimes without paying sufficient attention to species differences in morphological (hand or beak), behavioral (e.g., object exploration, affordance learning) and perceptual features (e.g., field of vision), in addition to psychological variables (such as motivational, emotional or attentional states, inhibitory control or neophobia/neophilia). yet all these factors can potentially have a big impact masking cognitive skills actually present in a species and producing misrepresentative results. another methodological problem of comparative cognition is that paradigms are applied to many species, but with slightly converted methodologies (better fitting the newly compared species demands), hence at a cost of comparability. if the methodology is not standardised, it is hard to interpret the findings of comparative studies, because any detected differences between species could be owing to the different procedures. an odd handicap for comparative cognition in this context appears to be that modification or improvement of an already used comparative paradigm, instead of merely replicating it in a new species, may increase the chances of a study to become published. often however, a direct comparison would have been scientifically more valuable than yet another improvement to an existing experimental paradigm. recently, this has been acknowledged and several research groups have begun to run comparative studies with the exact same methods. the difficulty of comparative cognition therefore is to find comparative paradigms that are compatible with many different species (i.e., that are ecologically valid for all the species to be compared, and not influenced by potentially confounding species-specific variables), and that have a standardised methodology that can be applied to different species in exactly the same way. because of the potentially confounding impact of different methodologies, the same cognitive ability should be investigated with not just a single but several tests with slightly different angles in any given species. recently, comparative studies carry out entire batteries in different species tests, e.g., those comparing cognitive abilities in the social and physical domain. yet, what is missing is to have a battery of tests establishing species differences that might affect performance in different cognitive tests, such as object exploration, motivation, attentiveness and fear/neophobia. a new such comparative approach is the multi-access-box (mab), recently published in plos one (see fig. 1). it presents the animal with a novel problem that can be solved in four different ways, thus offering the possibility to examine species differences in how novel problems are perceived, explored and approached and in which order solution(s) are discovered. this provides several data that can be used for establishing a behavioral (e.g., object exploration,) and psychological profile (e.g., motivation, flexibility, impulsivity, persistence, inhibitory control) and hence extract behavioral and perceptual determinants of different species performance in the tasks. simultaneously, it is a suitable paradigm to collect data about problem solving ability, innovativeness and flexibility, i.e., theoretical covariates of general intelligence, across species in a standardized manner. multi access box (mab) (as in plos one, copyright 2011 by the public library of science. reprinted with permission of the author). a food reward presented in the center of a transparent box can be retrieved by one of four possible methods, which are built in the four walls of the mab: opening a window, pulling a string, inserting a ball or inserting as stick tool. the mab approach comprises not just one but several solutions to an extractive foraging problem at the same time (food out of reach in the center of a transparent box), i.e. it consists of a battery of alternative tasks that all lead to the same goal. two solutions (opening a window and pulling a string) could be discovered by haptic exploration (touching the box at particular sites), while the other two additionally required the handling of objects, either wooden sticks or marbles, as tools (inserting a ball or a stick tool into specific openings). the other important feature of the mab is that subjects were forced to continue exploring alternative solutions, once they had successfully discovered and consistently used one particular solution, by blocking the one in use. this creates an order system which allows to detect species differences in which tasks are approached and explored first and how, how many solutions are discovered and how fast, whether and how quickly the subjects switch between options or whether they focus or settle on particular ones, as well as which tasks are problematic and why. in this manner we can detect not only species differences in problem solving performance, but also learn about the various underlying non-cognitive factors that may affect it. although designed for large scale comparisons of different closely- and distantly related species from different ecological backgrounds, the initial mab study compared just two avian species from different families, a corvid, the new caledonian crow (ncc; corvus moneduloides) and a parrot, the kea (nestor notabilis) (see fig. 2). both species are known for their large brains, their innovativeness and problem solving skills, but nccs are naturally tool-using species while kea have not been observed to use tools in the wild, but are famous for their neophilia. subjects were exposed to the transparent mab with the food reward in the center, which could be extracted by the four different methods corresponding to the four walls of the box. once a method was mastered, it was blocked and the bird s performance in reaching criterion in any of the others was recorded until all four methods had been discovered. figure 2. kea and new caledonian crow using the stick (left) and the ball-shaped (right) tool on the multi access box. found that one kea and one ncc detected all four solutions, demonstrating that the solutions offered were within both species capacity. the kea were much quicker in discovering multiple solutions than the habitually tool-using nccs and showed more individual variation. the keas were also more flexible once openings were blocked, switching to other solutions much quicker than the ncc. innovation rate as well as performance in this paradigm were strongly impacted by differences in exploration technique and neophilia rather than by cognitive discrepancies. the highly neophilic kea explored the apparatus more in a haptic than in a visual manner. they found its functional properties, while manipulating the affordances of the mab they perceived as most salient. in contrast to the kea and probably due to their more visually guided exploration technique, the nc crows had problems solving the window solution. the window mechanism could not be deduced by visual inspection alone (without knowledge of hinge-mechanisms), but could be readily discovered by haptic exploration. another difference was that the nc crows tended to persist with the first option that worked, whereas the kea, owing to their higher level of neophila, switched between solutions. differences in beak morphology also affected the birds performance: the kea had problems maneuvering the stick tool because of their beak curvature, whereas the crows with their straight beaks had a good grip of the tools. yet, the nc crows used their straight beak more for pecking than tearing actions, which would have been advantageous in detecting the mab apparatus s affordances in case of the window option (grasping and pulling the window crank). an important new tool that could be incorporated in the mab procedure and that could be revealing in comparisons of flexible problem solving may be reversal learning. species with different ecological backgrounds may have been selected for different strategies in trial and error learning and problem solving. in terms of energy pay-off it may, under certain circumstances, be advantageous to persist (e.g., in the case of nccs fishing for particularly nutritious wood-boring beetle larvae in rotten wood as, which can take considerable time but has a high potential return). in other contexts it may save energy to give up if something does not work and try something else instead. reversal learning tasks reflect differences in flexibility and are informative of how fast animals can adjust their behavior to new external feedback, let go of previously reinforced behavioral patterns, but at the same time they offer a measure of persistence. to illustrate how reversal learning could be implemented, we present some data not published in the original auersperg et al. once a subject had discovered all solutions, we incorporated a reversal learning task for the two solutions incorporating a tool (see fig. 2). for the two successful subjects, uk, a ncc and kermit, a kea, the last used tool option was blocked and the previous tool option was reopened. as can be seen the crow required a similar amount of trials to relearn the previous option as the kea, although of course data on more individuals would be desirable. illustrate how even diminutive differences in non-cognitive behavioral components such as neophilia or morphology can mask and/or interfere with the respective cognition involved and impact on the species performance. it highlights how different performance in problem solving task are not always symptomatic of species differences in cognitive ability or general intelligence. it highlights in particular, what major impact differences in object exploration (haptic or visual exploration mode) and affordance learning, which have only recently become a topic in animal cognition, can have on performance in artificial experimental tasks, and hence how this affects the comparability of two species in the same task. in future comparative research, establishing behavioral and psychological profiles of the species to be compared ought to precede comparative tests of specific cognitive skills or general intelligence. this may help to identify problem solving tasks that are equivalently applicable to the target species and hence achieve a high degree of

comparative cognition aims at unfolding the cognitive processes underlying animal behavior and their evolution, and is concerned with testing hypotheses about the evolution of the brain and intelligence in general. it is a developing field still challenged by conceptual and methodological issues. systematic cross-species comparisons of cognitive abilities, taking both phylogeny and ecology into account are still scarce. one major reason for this is that it is very hard to find universally applicable paradigms that can be used to investigate the same cognitive ability or general intelligence in several species. many comparative paradigms have not paid sufficient attention to interspecific differences in anatomical, behavioral and perceptual features, besides psychological variables such as motivation, attentiveness or neophobia, thus potentially producing misrepresentative results. a new stance for future comparative research may be to establish behavioral and psychological profiles prior or alongside to comparing specific cognitive skills across species. potentially revealing profiles could be obtained from examining species differences in how novel experimental (extractive foraging) tasks are explored and approached, how solutions are discovered and which ones are preferred, how flexibly multiple solutions are used and how much individual variation occurs, before proceeding to more detailed tests. such new comparative approach is the multi-access-box. it presents the animal with a novel problem that can be solved in several ways thus offering the possibility to examine species differences in all the above, and extract behavioral and perceptual determinants of their performance. simultaneously, it is a suitable paradigm to collect comparative data about flexibility, innovativeness and problem solving ability, i.e., theoretical covariates of general intelligence, in a standardized manner.

PMC3376048

pubmed-1153

parasitic intestinal nematodes are widespread, affecting human and vertebrates. worldwide, more than one-third of mankind is infected with helminths of which 100200 million people are infected with strongyloides [2, 3] and approximately 800 million with trichuris. the investigated nematodes strongyloides ratti and trichuris suis are very closely related to their human-pathogenic homologues strongyloides stercoralis and trichuris trichiura [5, 6]. in contrast to immune responses to microbes with mainly inflammation, the immune responses to helminths are mostly less intense and highly regulated. modulation of the host's immune response reported from t. suis ova can be beneficial for an attenuation of inflammatory bowel diseases (ibd) such as crohn's disease and ulcerative colitis [8, 9]. helminths release multiple excretory/secretory (e/s) products which enable them to establish, survive, and reproduce in their hosts successfully [10, 11]. in case of s. ratti and t. suis, these e/s products include antioxidative proteins such as thioredoxin (trx), heat shock proteins, and numerous proteases as well as protease inhibitors, galectins, and orthologous of host cytokines [10, 1216]. trx has also been reported in e/s products of multiple helminths [1720]. recently, these e/s proteins have also been detected in extracellular vesicles from helminths. trx or the trx system in general is widespread from archaea to human consisting of trx, the trx reductase, and nadph. hereby, trx is reduced by the trx reductase in an nadph-dependent manner. in general, trx superfamily members regulate thiol-based redox control, operating as protein disulfide oxidoreductases, and protect cytosolic proteins against aggregation in the cell. its redox-regulating activity is important for dna replication, maintenance of the cellular redox state, and, therefore, the cellular homeostasis and antioxidant defense [22, 25]. furthermore, trx is part of multiple cellular pathways and capable of regulating transcription factor activities, inhibition of apoptosis, protection from high-energy oxygen radicals, and regeneration of denatured proteins and is critical for signal transduction through thiol redox control as well as more specific processes like presenting antigens [22, 23, 2628]. without a signal peptide, trx is secreted by a nonclassical secretory pathway by various cells [29, 30]. the numerous extracellular activities of trx include anti-inflammatory and antiapoptotic, and thus cytoprotective effects [3133]. of interest, multifunctional prokaryotic trx, which displays unrelated properties, that is, antioxidant activity and promotion of dna replication, has been described as moonlighting protein [3436]. in the e/s products of strongyloides and of multiple other helminths numerous multifunctional proteins have been detected like the moonlighting enzymes enolase and glyceraldehyde-3-phosphate dehydrogenase [10, 13, 3739]. while trx is well characterized, less is known about the functions of trx-lp. the trx-lp, a member of the trx superfamily, is a fusion protein composed of the classical trx domain (wcgpc) at the n-terminus and a c-terminal proteasome-interacting thioredoxin (pith) domain, formerly known as duf1000 (protein families database, http://pfam.xfam.org/family/pf06201). it is larger than the classical trx (12 kda), which is highly conserved in all species [23, 25]. proteins of the trx superfamily have been reported in various protozoan parasites including plasmodium, trypanosoma, and toxoplasma [4043] and in the trematode clonorchis sinensis. besides thiol-based redox control, eukaryotic trx-lps are also involved in signaling processes as cofactors of certain enzymes, regulating specific signal proteins [45, 46]. for example, the human trx-related protein (trp32), known as txnl-1, protects the cell against glucose deprivation-induced cytotoxicity and is involved in activation of antiapoptotic akt/pi3k signaling as well as pten (phosphatase and tensin homologue deleted on chromosome ten) inhibition [47, 48]. another example is the thioredoxin domain containing 17 (txndc17), also known as trx-related protein of 14 kda (trp14), which is stat-3-dependent and responsible for the drug resistance in human colorectal cancer cells. trp14 also shows, like trx1, s-nitrosylase activity and furthermore is able to control the tnf-/nf-b signaling pathway [4951]. in addition, pten is also an interaction partner of human trx and among others trx controls the tnf-/nf-b signaling pathway as well [52, 53]. the novel thioredoxin-related transmembrane protein tmx4 is a type i transmembrane protein with its trx-like domain inside the er which possibly plays a role in the correct folding of proteins inside the er due to its reductase function. since trx have been reported to act as chemoattractant for leukocytes and to induce cytokines we wanted to examine if srtrx-lp has similar impact on monocytic cells. in the present study we cloned and characterized two trx-lps and investigated some functional activities including their chemotactic activity, their ability to promote wound healing processes in the intestinal epithelial cell (iec) caco-2 model, and their involvement in cytokine release in a three-dimensional- (3d-) cell culture model the s. ratti life cycle was maintained in our laboratory as reported [13, 15]. animal experiments were approved by and conducted in accordance with guidelines of the animal protection board of the city of hamburg (g21131/591-00.33). the life cycle was maintained using wistar rats by serial passage and the developmental stages isolated as described. s. ratti and t. suis extracts were prepared from freshly harvested life stages as described before [13, 15]. pcr products and plasmids were sequenced by the dideoxy termination method of sanger performed by eurofinsgenomics.eu. for homology searches further, for bioinformatics analyses the expert protein analyses system (expasy) proteomics server of the swiss institute of bioinformatics (http://expasy.org/tools/) was used. to obtain the conserved domains of the trx-lps the protein families database (pfam) of the usa server (http://pfam.xfam.org/family/pf06201) was used which represents proteins by multiple sequence alignments and hidden markov models (hmms). multiple sequence alignments were performed by the program clustal_w2 (http://www.ebi.ac.uk/tools/msa/clustalw2/) from the european bioinformatics institute which is part of the european molecular biology laboratory (embl-ebi). srtrx-lp and tstrx-lp sds-page bands were excised, cut into small cubes, and transferred to microtubes and in gel digestion was performed as described elsewhere. briefly, gel pieces were destained using 30% acetonitrile (acn), 0.07 m nh4hco3, reduced with 20 mm dithiothreitol and alkylated by 1% acrylamide, and dehydrated using 100% acn. acn was removed and the gel pieces were dried using a vacuum centrifuge and rehydrated in 0.1 m nh4hco3 containing 0.5 g of trypsin (promega, mannheim, germany). a sufficient volume of 0.1 m nh4hco3 was added to cover the gel pieces completely and digestion was performed at 37c overnight. the peptide containing supernatant was transferred to new microtubes and the gel pieces were extracted with 50% acn, 0.1% trifluoroacetic acid followed by 0.1 m nh4hco3 and acn. samples were dried in the vacuum centrifuge, resuspended in 5% acn and 5% formic acid, desalted using c18 stagetips, dried again, and resuspended in 5% acn and 5% formic acid. for reversed phase chromatography in house manufactured analytical columns were used. using 100 m inner diameter fused silica capillaries, spray tips were generated with a p2000 laser puller (sutter instruments, novato, ca, usa) and packed with 5 m reprosil-pur 120 c18-aq particles (dr. maisch, ammerbuch-entringen, germany). peptides were loaded directly on the analytical column using a nanoflow uhplc system (easy-nlc 1000, thermo fisher scientific, bremen, germany) at a flow rate of 1 l/min solvent c (water with 0.1% formic acid). peptides were eluted applying a 60 min linear gradient from 100% solvent a (water with 5% dmso, 0.1% formic acid), to 65% solvent a, 35% solvent b (acn with 5% dmso, 0.1% formic acid) at a flow rate of 400 nl/min. eluting peptides were ionized in the positive ion mode at 1.6 kv in the nanospray ion source of an orbitrap velos mass spectrometer (thermo fisher scientific, bremen, germany). survey scans (m/z 400 to 1200) were performed in the orbitrap analyzer at a resolution of 30,000 followed by fragmentation of the 10 most abundant ions in the linear ion trap by collision induced dissociation. dynamic exclusion was set to 30 sec with an exclusion list size of 500. files were analyzed using maxquant (version 1.5.2.8) using the following settings: protein n-terminal acetylation and oxidation of methionine were set as variable modifications and propionamide at cysteine was set as fixed modification; enzyme specificity was set to trypsin and up to two missed cleavage sites were allowed. data were searched against a database consisting of all s. ratti and t. suis entries from uniprot/trembl (version from 12/01/2014, 12,462 entries) as well as common contaminations. s. ratti and t. suis rna were isolated from adult parasitic females as described before and the cdna was synthesized by using the first strand cdna kit from new england biolabs inc. reverse primers were generated using the online tool provided by clontech (http://bioinfo.clontech.com/infusion/) (tstrx-lp: forward: aaggtcgtcatatgatggct ataaaggagataa; reverse: tcctcgagaattcctaatgagcttctccctt; srtrx-lp: forward: aaggtcgtcatatgatggctataaaggagataa; reverse: tcctcgagaattcctaatgagcttctccctt). fragments were amplified by pcr using the infusion hd cloning kit from clontech according to the manufacturer's instructions and the phusion high-fidelity dna-polymerase from thermo scientific (waltham, usa). the trx-lp pcr fragments from s. ratti and t. suis were cloned into pjc45 vector and iba 3 plus vector, transformed into escherichia coli stellar cells (clontech, usa) and sequenced (eurofins mwg). the s. ratti and t. suis trx-lps were expressed in lipopolysaccharide- (lps-) free e. coli strain clearcoli bl21 (de3) (lucigen simplifying genomics), which do not trigger the endotoxic response in human cells, in luria-bertani medium containing 100 g/ml ampicillin. the expression of the his-tag fusion proteins was induced by isopropyl--d-thiogalactopyranoside (iptg, final concentration 1 mm) and the expression of the strep-tag fusion proteins by anhydrotetracycline (aht, final concentration 200 g/l), for 5 h at 37c. the bacterial cells were collected by centrifugation (6,000 g) for 15 min and kept at 20c until use. recombinant proteins were purified by using ni affinity chromatography (qiagen, hilden, germany) or strep-tactin superflow plus (qiagen, germany) according to the manufacturer's instructions. the imidazole or desthiobiotin was removed by dialysis overnight using phosphate-buffered saline (pbs, ph 7.4). even though the endotoxin-free e. coli strain was used the lps inhibitor polymyxin b (sodium dodecyl sulfate polyacrylamide gel electrophoresis (sds-page) was applied to verify expression and purity of the proteins, which were visualized by coomassie brilliant blue g-250 staining. after sds-page and the following transfer onto nitrocellulose membranes, the membranes were incubated with the anti-his6-peroxidase (2) (mouse monoclonal; 1: 5000; roche life science, mannheim, germany) overnight at 4c. according to the method of holmgren (1979) as well as luthman and holmgren (1982), disulfide reduction activity was measured by reduction of insulin [61, 62]. in this test, the turbidity of the sample was measured, which is caused by the precipitating reduced insulin. the resulting decrease in absorbance, the srtrx-lp was repeatedly regenerated by dtt. here, the regeneration of active trx-lp is faster than the direct reduction of insulin by dtt. initially, 1.6 mm insulin (bovine pancreas, sigma-aldrich, hamburg, germany) was prepared by a suspension of 50 mg of insulin in 2.5 ml 100 mm potassium phosphate buffer (ph 6.5) for the reaction approach. here, the ph was first adjusted to 3 with 1 m hcl solution to completely dissolve the protein and the ph was adjusted to 6.5 with 1 m naoh. the solution was supplemented with dh2o to a volume of 5 ml. thereafter, a master mix of 825 l 1.6 mm insulin (160 m final volume) and 4675 l pe (100 mm potassium phosphate, 2 mm edta, ph 6.5) buffer was prepared. srtrx-lp was tested at a concentration of 1 m (30 g/ml), 2.5 m (75 g/ml), and 5 m (150 g/ml). in an interval of 1 min over a period of 40 min, the reduction of insulin by srtrx-lp was measured. as a negative control, the relative specific enzymatic activity was calculated by the following formula: a650 1000/mg protein concentration in the reaction mix. according to the method of wollman et al. (1988), the trx-lp from either s. ratti or t. suis was reduced by 100 mm dtt for 1 h at room temperature (rt) and dialyzed against 80 mm hepes and 10 mm edta buffer for 1 h at 4c to remove dtt. the buffer was mixed with 1.7 m igm (piercetm mouse igm isotype control, thermo scientific, czech republic) and 0.5 l, 1 l, and 5 l of the reduced trx-lp solution for overnight reaction at rt. for protein size determination sds-page analysis healthy volunteers served as source for peripheral blood mononuclear cells (mnc) and polymorphonuclear cells (pmn) purified from venous blood samples (collected in sodium citrate tubes). first, erythrocytes were sedimented from anticoagulated blood samples by addition of equal amounts of 6% hydroxyethyl starch (heas-steril, fresenius, friedberg, germany). mncs were separated from pmn as reported before by density centrifugation using a two-level density gradient consisting of mono-poly resolving media (1.114 g/ml; mp biomedicals, stockholm, sweden) and lymphoflot (1.077 g/ml; bio-rad, dreieich, germany). the cells were washed carefully with pbs, followed by a centrifugation step at 1,800 rpm for 10 min. this step was optionally repeated one more time, if too many platelets were present. while the mncs were added to the thp-1 media, the pmns were resuspended in hbss both at a concentration of 5 10 cells/ml and stored on ice until further use. to analyze the immunological effect of srtrx-lp and tstrx-lp, the recombinant proteins were used as stimuli in a 3d-coculture model, composed of human intestinal epithelial and dendritic cells (dcs), derived from monocytic thp-1 cells, grown on a collagen scaffold that mimics the in vivo natural microenvironment. the human intestinal epithelial cells, caco-2 cells, were grown in dmem media (with 10% fcs, 1% nonessential amino acids, 1% pen/strep; liefer-co) until denseness of 7080% was reached and seeded on 12-well plates in thincerts tc inserts (greiner bioone) followed by the addition of 200 l collagen (university hospital wrzburg) to each insert. prior to adding the caco-2 cells, the collagen was incubated 1 h at 37c for gelation. to detach the caco-2 cells from the flask the cells were trypsinized prior to transfer 10 cells/well into the collagen-layered inserts and incubated for 2 h at 37c and 5% co2 to let them adhere on the collagen. for differentiation to dcs, thp-1 cells were washed twice in pbs and seeded in serum-free rpmi 1640 media supplemented with il-4 (1000 iu/ml; peprotech, hamburg, germany) and gm-csf (1000 iu/ml; peprotech) and were grown for 710 days. subsequently the generation of mature dcs was verified by staining 10 washed cultured cells with phycoerythrin- (pe-) conjugated monoclonal anti-cd86 (b7-2) antibodies (mouse anti-human cd86-pe-conjugated antibody; becton-dickinson bioscience, san diego, usa, and a pe-conjugated isotype control; pharmingen, leiden, netherlands) analyzed by flow cytometry (cellquestpro; bd) (data not shown). after proper development of both cell types, the caco-2-collagen inserts were transferred to the wells with grown dcs, which were floated with dmem media (10% fcs, 1% nonessential amino acids, 1% pen/strep). the trx-lps were added as stimuli (5 g, 10 g, and 25 g/ml), while the ufm-1 activating protein uba-5 (25 g/ml) from the nonparasitic nematode caenorhabditis elegans served as negative control. further controls were performed with the bacterial cell wall components lps (1 g/ml; sigma-aldrich, taufkirchen, germany) and lipoteichoic acid (lta, 0.1 g/ml; sigma-aldrich, taufkirchen) to analyze potential endotoxin contaminations and to compare both responses. the supernatants were taken after 24 h, 48 h, and 72 h and stored at 20c until further use. for detection of the cytokines tnf-, il-10, il-22, and tslp in cell supernatants, kits from ebioscience (san diego, usa) were used according to the manufacturer's instructions. here, il-10 was detected with a sensitivity of 2 pg/ml, il-22 and tslp with a sensitivity of 8 pg/ml, and tnf- with a sensitivity of 4 pg/ml. to measure the binding affinity of the s. ratti and t. suis trx-lps to certain cell types, the purified proteins were labeled using the alexa fluor 647 protein labeling kit microscale (a30009) from invitrogen (oregon, usa) according to the manufacturer's instructions. the binding affinity for both trx-lps to monocytes, lymphocytes, and granulocytes from peripheral blood, as well as to the cell lines thp-1 cells (undifferentiated and differentiated) and caco-2 cells, were tested. the fluorescently labeled proteins were tested in four different concentrations (0.1 g and 0.2 g [data unpublished] and 0.4 g and 0.6 g). each sample, which consisted of srtrx-lp or tstrx-lp and the cell type to be tested, was brought to a volume of 200 l with pbs and incubated for 30 min. after incubation, samples were washed twice, resuspended in 150 l pbs, and analyzed by flow cytometry on a facscalibur cytometer (bd biosciences), with 10,000 events collected from the gated populations. for further characterization of the binding specificity, cells were preincubated with 0.1 g and 0.2 g (data not shown) or 0.4 g and 0.6 g of unlabeled protein for 30 min prior to the addition of the corresponding labeled proteins. the data were analyzed with cellquestpro. to evaluate the chemotactic activity of human monocytic thp-1 cells, boyden chambers were used as described previously [68, 69]. dtt (100 mm) reduced trx-lps from s. ratti and t. suis were tested at concentrations of 3 ng, 30 ng, 300 ng, and 1 g each in 100 l. the assay was performed with negative controls (random migration) such as chemotaxis buffer (pbs containing cacl2, mgcl2, and bsa) and thp-1 media (rpmi containing hepes and 10% fcs) and as positive control lps at 100 ng, since lps induces migration of monocytic cells. thp-1 cells (2 10) were allowed to migrate through polyvinyl-pyrrolidone-free polycarbonate filters (pore size: 3 m; nuclepore, tbingen, germany) within 90 min at 37c and 5% co2. afterwards, migrated cells were counted by using an inverted zeiss microscope (axiovert 25). to monitor epithelial cell migration of caco-2 cells and the ability of trx-lps to improve the wound healing process, we used the cytoselect 24-well wound healing assay (cell biolabs, inc.) according to the manufacturer's instructions. by means of the cytoselect wound healing 500 l of a caco-2 cell suspension (containing 0.5 10 cells) was added to each well after the inserts had firm contact with the bottom of the wells. after overnight incubation, a monolayer was formed, the inserts were removed, the cells were washed, and the different stimuli were added. we used both trx-lps, from s. ratti and t. suis, in concentrations of 3 ng, 30 ng, 300 ng, 1 g, 10 g, and 25 g per 500 l. as a positive control the human epidermal growth factor (egf; 0.5 ng, 5 ng, 10 ng, 15 ng, and 25 ng) was included in order to get the proper concentration for maximal wound healing effects. as negative control cell media and lps were added. an inverted digital microscope (evos fl thermo fisher scientific) by advanced microscopy group was used for observation (4x magnification). the cells were incubated for 4 days, whereby each 24 h a picture was taken and the percent closure was calculated. statistical differences between groups were analyzed with the t-test for independent samples or the mann p<0.05 was taken as moderate evidence of significance and p<0.01 as strong evidence of significance. srtrx-lp is represented by the cluster sr00399 and was abundantly found in s. ratti e/s products of parasitic s. ratti females. the partial sequence was identified as the thioredoxin family protein and was used to obtain the full-length cdna sequence by pcr. further, the full-length cdna sequence of the t. suis hypothetical protein m513 (accession no. the protein sequence of the recombinantly expressed s. ratti and t. suis trx-lps have been verified by mass spectrometry. conserved domains of the trx-lps from the intestinal helminths s. ratti and t. suis were ascertained by the protein families database (pfam). neither the trx-lp from s. ratti nor the trx-lp from t. suis contain a signal peptide. both proteins have an n-terminal thioredoxin domain containing the active side motif cxxc (cgpc) and a c-terminal pith (proteasome-interacting domain of thioredoxin-like) domain. the alignment of the amino acid sequences from different organisms revealed a relatively low degree of identity between the different species. between the trx-lps from s. ratti and t. suis the degree of identity (39%) was not as high as between trx-lps from s. ratti and b. malayi (56%). trx-lps (94%), similar to the sequences of s. ratti and s. stercoralis (99.9%) (data not shown). comparing the other aligned helminth protein sequences, the similarities to the s. ratti and the t. suis trx-lps varied between 35% and 56%. the comparison of the redox-regulating protein between s. ratti and homo sapiens showed 43% identity. the aligned helminth sequences share, except for the trematode schistosoma mansoni, the catalytic site sequence (cgpc) with the human trx-lp sequence of the active site. there are always two cysteines which are separated by two amino acids, mostly glycine and proline. instead of a glycine, the s. mansoni catalytic site sequence has an arginine (r) (figure 1). both parasite trx-lps have a trx-like domain (left) as well as the pith domain (right) (figure 2; phyre2:). srtrx-lp and tstrx-lp were recombinantly expressed in endotoxin-free e. coli as his-tagged proteins and as strep-tagged proteins. the amount of purified his-tagged proteins, however, was higher than the amount of purified strep-tagged proteins. thus, after preliminary tests with strep-tagged proteins, we further worked with his-tagged proteins. both parasite proteins were verified by western blot using anti-strep and anti-his antibody (figure s1) and mass spectrometry. (1) insulin reduction. for measurement of the functional activity of srtrx-lp using insulin, the precipitation of free insulin -chains was measured spectrophotometrically at a wavelength of 650 nm according to holmgren (1979) as well as luthman and holmgren (1982) [61, 62]. a concentration of 1 m (30 g/ml), 2.5 m (75 g/ml), and 5 m (150 g/ml) of the srtrx-lp was used and the measuring time was plotted against the rate of precipitation (a650/min 10), which was about 0.064 a650/min at the highest concentration. srtrx-lp reduces insulin with a relative specific activity of 1556.67 and is regenerated by dtt whereby in the negative control and the lowest concentration of srtrx-lp only a slight precipitation of insulin could be measured (figure 3). its molecular weight is about 950 kda and it contains 26 interchain disulfide bridges that are potential substrates for trx and thus for trx-lp. additionally to the insulin reduction activity assay, the dithiol-disulfide oxidoreductase activity of the trx-lps was analyzed by an igm reduction test according to wollman et al. as positive control igm was reduced by 100 mm dtt at which bands at about 70 kda (heavy chain igm) and 25 kda (light chain igm) occur (figure 4, 3rd lanes). only exposing igm to the highest amount of srtrx-lp, five main bands were identified (figure 4(a), lane 7). in addition to the bands at 70 kda and 25 kda, similar to the reduction of igm with dtt, and the band at 250 kda, now bands at about 30 kda, representing monomeric s. ratti trx-lp and 60 kda representing dimeric s. ratti trx-lp, were determined. almost similar protein bands have been observed when t. suis trx-lp was analyzed (figure 4(b)); however, t. suis trx-lp also at the low and intermediate concentration leads to the reduction of igm. further, bands at 140 kda (heavy chain dimers of igm) were predominant at all tstrx-lp doses (figure 4(b)). the binding ability to other immune cells as well as mucosal caco-2 cells was examined by facs (figure 5). monocytes, lymphocytes, and neutrophils as well as caco-2 cells, thp-1 cells, and thp-1-derived dendritic cells (dcs) were exposed to alexa flour-labeled trx-lps. thus, srtrx-lp (figure 5(a)) as well as tstrx-lp (figure 5(b)) proteins strongly bound to monocytic cells shown in a dose-dependent manner for peripheral monocytes (srtrx-lp: mfi 175185; tstrx-lp: mfi 1960), thp-1 cell line (srtrx-lp: mfi 36108; tstrx-lp: mfi 38133), and generated dcs (srtrx-lp: mfi 85170). srtrx-lp and at lower degree tstrx-lp also bound to caco-2 cells (srtrx-lp: mfi 4552; tstrx-lp: mfi 1442) and with limited affinity to neutrophilic granulocytes (srtrx-lp: mfi 15-16; tstrx-lp: mfi 1750) and lymphocytes (srtrx-lp: mfi 911; tstrx-lp: mfi 1020). in order to verify the differentiation of thp-1 cells to dcs by il-4 and gm-csf, cd86 localized on the surface of differentiated dcs but not on thp-1 cells (data not shown). the s. ratti and t. suis trx-lps were examined for their ability to induce the release of cytokines in human 3d-cocultures of intestinal epithelial cells (iec) and dcs. the release of the inflammatory (tnf-), anti-inflammatory (il-10), and th2-related cytokines (il-22, tslp) was analyzed. in preliminary experiments, the optimized concentrations of lps and lta were determined as 0.5 g/ml and 0.1 g/ml (data not shown). 200 g/ml t. suis extract was used as a positive control and cell culture medium was used as a negative control (figure 6(a)). the trx-lps were tested at concentrations of 3 ng, 30 ng, 300 ng, 1 g, 10 g, and 25 g (each per ml). the reduced state (reduction via dtt) and the oxidized state (freshly purified protein, only partly reduced, see igm reduction) of the trx-lps made no difference in the cytokine response (data not shown). this observation indicated that the immune responses the proteins triggered are probably active site-independent. 10 g and 25 g of both helminthic trx-lps are the most representative concentrations inducing the highest cytokine release. cocultured cells exposed to t. suis (ts) extract showed in particular an enhanced production of il-10 and il-22 after 48 h and an even higher release of il-10 after 72 h, while the proinflammatory cytokine tnf- was downregulated (figure 6(a)). srtrx- as well as tstrx-lp induced initially a slightly pronounced release of proinflammatory tnf- after 24 h (p<0.01), followed by an increased production of il-22 and tslp after 48 h of incubation (p<0.01). in response to the exposure of the cocultures to trx-lps in particular the th2-associated cytokine il-22 was produced after 48 h and 72 h (p<0.01). at a concentration of 25 g of tstrx-lp, the tnf- release increased after 48 h and even dominated the il-22 production. after 72 h, the il-22 and tslp production was dominating the overall tnf- production. 10 g/ml of trx-lps appears to be slightly more potent with respect to cytokine release than 25 g of protein with statistical significance only between the il-22-inducing srtrx-lp concentrations after 48 h (p<0.01) (figure 6(b)). therefore, we investigated the chemotactic activity of the parasite trx-lps for monocytic thp-1 cells by using boyden chambers. different trx-lp concentrations (3 ng, 30 ng, 300 ng, and 1 g; each per 100 l) from both studied parasites were added to the lower compartment of the chambers. in the negative control, a few cells migrated through the membrane, while the cell migration using lps as stimulant was significantly increased. among the different applied trx-lp concentrations the highest migration rate was detected at 3 ng. the overall cell migration was higher in case of s. ratti trx-lp than after stimulation with the tstrx-lp and half bell-shaped dose-response curve reported for chemokines is more pronounced in case of the tstrx-lp (figure 7). as an important functional activity it was investigated whether the trx-lps from both nematode parasites express wound healing activity. therefore, the effect of different concentrations of trx-lps on epithelial cell (caco-2) wound closure (figure 8, data, and figure 9, microscopic photography) was analyzed. compared to the untreated cells, where the wound-like area narrowed 1015% every day, the stimulated cells showed almost twice as much growth. 300 ng/500 l of both parasite trx-lps are the most potent concentration for promoting the wound healing process as well as 10 ng of egf, which was included as positive control, while 3 ng and 30 ng and concentrations upon 1 g (each per 500 l) have a more moderate effect on wound healing. the wound healing process was highly significantly promoted by egf and tstrx-lp (p<0.01) as well as significantly promoted by srtrx-lp (p<0.05). trx is a physiologically important multifunctional protein and prokaryotic trx has been described as so-called moonlighting protein [34, 35]. the multiple biological functions comprise features as growth factor and antioxidant, as inhibitor of apoptosis and transcriptional factor, and as chemokine [22, 23, 2528]. very little is known about trx-lps, in particular about those from helminths and their potential role in parasite-host interaction. there is only one publication about an endoplasmic reticulum located trx transmembrane related protein from the trematode clonorchis sinensis, containing a trx domain with the active site motif cys-pro-ala-cys (cpac). this redox molecule is suggested to serve as protection against host- and parasite-generated ros. contrariwise, the s. ratti trx-lp has the catalytic domain sequence of the uniformly small (12 kda) ubiquitous trx proteins (wcgpc) but has a size of approximately 30 kda. comparably, the t. suis trx-lp has a size of approximately 33 kda and the same catalytic domain sequence as the classic trx. in the present study, trx-lp from two parasitic nematodes, s. ratti and t. suis, were cloned, expressed, and characterized for the first time. in case of both helminths the protein was present in the e/s products of the parasites [13, brattig et al. the molecular mass (3033 kda) as well as the proteins structure suggested similar functions to those of the human trx-related protein (trp32), also known as txnl-1, which protects the cell against glucose deprivation-induced cytotoxicity and is involved in antiapoptotic signaling [47, 48, 71]. like srtrx- and tstrx-lp, trp32 consists of an n-terminal trx and a c-terminal pith domain as well. trx-lps are known to have several binding partners and substrates they associate with by means of their trx domain, which exerts redox-active functions. the c-terminal pith domain is able to interact with the 26s proteasome by the substrate-recruiting factor of the 26s proteasome eef1a1 [72, 73]. similar to trx, trx-lps of eukaryotic cells are also multifunctional and involved in different cellular processes including cofactor functions or the regulation of specific signaling proteins which may indicate possible moonlighting properties that have to be demonstrated in the future [3436]. comparisons of trx-like homologues by multiple sequence alignments revealed a high sequence similarity between trx-lps from t. suis and from t. trichiura (94% identity). apart from this, the protein alignment showed a relatively low degree of similarity (35%56%) between different nematodes, either parasitic or nonparasitic. except for s. mansoni all other species had the strongly conserved n-terminal trx catalytic site sequence (cgpc). at the c-terminus all trx-lps possess the pith domain. like trx, the analyzed parasite proteins have no signal peptide and are released from cells by nonclassical protein export [29, 75]. trx-lp has also various roles in several human cellular and extracellular processes, since reactive oxygen species (ros) occur in the normally functioning metabolism. the dithiol-disulphide oxidoreductase activity of both recombinant s. ratti and t. suis trx-lps was either analyzed by insulin reduction according to holmgren (1979) or igm reduction according to wollman et al. the relative specific activity of trx from e. coli amounts to a value of 4930 units. findings that measured relative specific activity of the srtrx-lp has an activity of about 1557 units show that it has a comparable activity to classical trx. (1988) have already shown that recombinant human trx is able to reduce the disulfide bridges of murine igm. therefore, we suggested trx domain containing trx-lps may also have the ability to reduce igm. we could show that indeed both trx-lps reduced the s-s bonds of igm. since all tstrx-lp used doses resulted in the formation of the same bands in sds-page, this trx-lp appears to be more active than the s. ratti trx-lp. even at the lowest concentration minor protein bands the more intensive they were the higher the added concentration of tstrx-lp was. a reduction of igm by not fully removed dtt can be excluded since then the strength of the formed bands would be the same in each approach. although even at the lowest concentration bands have been formed, they were more intensive at the highest concentration. furthermore, in the igm reduction assay of srtrx-lp no bands were existent at the lowest and the intermediate concentration of the added protein. through those activity assays it could be demonstrated that the recombinantly expressed trx-lps have redox functions and are able to act as classical trx. in further analysis it has been reported to be released by monocytes and also to be chemotactic for monocytes, neutrophils, and t lymphocytes. accordingly, we have observed that s. ratti and t. suis trx-lps exhibit chemotactic activity for monocytes and have the ability to interact with them. an attraction of monocytic cells to a nematode-dwelling site could subsequently lead to an activation of the cells leading to a consecutive generation of wound healing fostering cytokines like il-22 and immunoregulatory interleukins [7880]. both parasite trx-lps bound to monocytic cells, to the thp-1 cells, and to peripheral monocytes although in some facs analysis there were only limited counting events. of interest, the parasite redox-regulating proteins also bound to caco-2 cells and more weakly to lymphocytes and granulocytes. thus, trx-lps seem to interact with intestinal epithelial cells, the first-line host cells that get exposed to e/s products released by the colonizing parasitic females, and also with second-line cells, the monocyte-derived dcs. of interest, trx has been reported to possess immunological activities. thus, it has been attributed to an anti-inflammatory role besides suppression of apoptosis and fostering cell growth [32, 8183]. trx can interact with immune cells and facilitates the production of tnf- [31, 84] by monocytic lineage, but it is also able to counteract the production of inflammatory cytokines such as tnf- [85, 86]. in the present study, 3d-coculturing of the intestinal epithelial caco-2 cells and thp-1-derived dcs was performed. hereby, parasite trx-lps induced the release of proinflammatory tnf- in the first day of the culture and at high concentration after 48 h followed by a prevailing generation of the th2-related cytokine il-22 besides lower levels of tslp and il-10. il-22 may be predominantly released by activated dcs in the cell cultures after 2-3 days [78, 80, 87]. il-22, particularly produced by immune cells present beneath the epithelium, as the innate lymphoid cells [78, 80, 88], acts through signal transducer and activator of transcription (stat-3) and is important in maintaining the homeostasis of the gut and therefore serves the protection from intestinal inflammation. an important source of il-22 in acute colitis is tlr-stimulated cd11c dcs which are located in the surficial mucosal epithelium of the gut and are getting activated by invading pathogens like bacteria or parasites. these cells initiate, via il-22 and thus stat-3, processes that are important for a proper stress response, mucosal wound healing, and apoptosis pathway [78, 79, 89]. il-22 may profoundly increase the proliferation and turnover of iecs and the production of mucus and antimicrobial peptides. accordingly, the release of proteins from intestinal nematodes like trx-lps may contribute to preserve or restore the integrity of the intestinal barrier. thus, there are three possible pathways for helminthic trx-lps to act: firstly, secreted trx/trx-lp protects the parasite against high ros production initiated by the host's first-line immune response via cells of the monocyte-macrophage linage. trx may be important for redox control at wound margins, since much ros emergence was proven there [91, 92]. therefore, among others, it serves the migration of cells and closure of wounds. then, antioxidant molecules are probably important to maintain the balance in order to prevent stress-induced cell death. secondly, secreted trx-lp stimulates mucosal dcs to generate high levels of il-22 which promotes epithelial cell proliferation and the preservation or restitution of the integrity of the intestinal barrier. in the present study we had shown that 300 ng of parasite trx-lps promoted the wound healing process of epithelial caco-2 cells. a third possible function of trx-lp secreted by the parasite may be to mimic antioxidant molecules of the host and may lead to interference reactions in the host's antioxidant metabolism concerning the substrates and binding molecules. thus, recent reports indicated that distinct molecules secreted by helminth parasites can foster wound healing and modulate the host's immune response. in summary, we identified and characterized the secreted trx-lps from s. ratti and t. suis. both multifunctional proteins expressed antioxidative activity and the capability to interact with the host's mucosal cells, indicated by chemotactic activity for monocytic cells, binding to host's epithelial cells as well as to immune cells, by the release of cytokines. in particular, the promoting wound healing effect indicates the involvement of trx-lp in many pathways that are initiated in the local parasite-host interaction

the cellular redox state is important for the regulation of multiple functions and is essential for the maintenance of cellular homeostasis and antioxidant defense. in the excretory/secretory (e/s) products of strongyloides ratti and trichuris suis sequences for thioredoxin (trx) and trx-like protein (trx-lp) were identified. to characterize the antioxidant trx-lp and its interaction with the parasite's mucosal habitat, s. ratti and t. suis trx-lps were cloned and recombinantly expressed. the primary antioxidative activity was assured by reduction of insulin and igm. further analysis applying an in vitro mucosal 3d-cell culture model revealed that the secreted trx-lps were able to bind to monocytic and intestinal epithelial cells and induce the time-dependent release of cytokines such as tnf-, il-22, and tslp. in addition, the redox proteins also possessed chemotactic activity for monocytic thp-1 cells and fostered epithelial wound healing activity. these results confirm that the parasite-secreted trx-lps are multifunctional proteins that can affect the host intestinal mucosa.

PMC5107843

pubmed-1154

human leukocyte antigen (hla) matching significantly reduces the risk of graft rejection and graft failure after solid-organ transplantation [13] and graft-versus-host disease (gvhd) after hematopoietic stem-cell transplantation (hsct) [49]. these pathological conditions evolve due to an alloreactive immune response that is initiated through interaction of allogeneic hla with antibodies or the t-cell receptor (tcr). the subsequent immune response directed against allogeneic hla impairs transplant outcome, emphasizing the need to avoid alloreactive responses after transplantation. the highly polymorphic hla system can be subdivided into two major classical classes: hla class i and hla class ii. in general, hla class-i molecules (hla-a, -b, and -c) present endogenous peptides of 811 amino acids in length that can be recognized by cd8+t cells, while hla class-ii molecules (hla-dr, -dq, and -dp) present exogenous peptides of 1318 amino acids in length that can be recognized by cd4+t cells. hla class-i molecules consist of a polymorphic alpha chain and a nonpolymorphic beta-2-microglobulin and have a rather closed peptide binding groove. on the other hand, hla class-ii molecules consist of a polymorphic alpha and beta chain and have a more open structure. acquiring hla-matched donors for transplantation is very challenging, due to the high level of polymorphisms in the hla system. hla incompatible transplantations can therefore not be avoided for a large number of patients. in those cases where a fully hla-matched donor is not available, there is a clinical need to predict whether a certain hla mismatch will elicit severe b-cell and t-cell-mediated alloreactive responses or not. there is cumulating evidence that these high-risk hla mismatches (so-called nonpermissible mismatches/unacceptable mismatches) and well-tolerated hla mismatches (so-called permissible mismatches/acceptable mismatches) exist, as epidemiological studies have shown that permissibility of hla-mismatched combinations is highly variable [6, 7, 10]. for example, hla-b44:02 and hla-b44:03 mismatching leads to the induction of allospecific cd8+t cells in vitro and bone marrow-allograft rejection in vivo. the amino-acid sequences of hla-b44:02 and hla-b44:03 differ only in one amino acid, indicating that even small amino-acid changes between hla molecules can result in major alloreactive immune responses after transplantation. on the other hand, hla class-i mismatches that are highly diverse may well be tolerated in hsct. differences in permissibility between hla-mismatched combinations may be explained by a different impact of amino-acid polymorphisms on peptide-binding features. some amino-acid sequence polymorphisms will alter peptide-binding motifs and peptide-hla complex conformation, thereby potentially inducing alloreactive immune responses, while others will not alter peptide-hla landscapes. characterizing the permissibility of hla mismatches prior to transplantation allows selection of the most optimal donor-recipient match and thereby will help to diminish the risk of posttransplantation complications after hla incompatible transplantations. however, epidemiological studies do not provide a universal tool for defining permissibility for every hla-mismatched combination, as these data are limited to the specific hla-mismatched combinations studied; very large study populations would be required to study all potential combinations. several approaches have therefore been developed to define permissibility of hla-mismatched combinations; some of these approaches are very useful in predicting alloreactivity. we here review the current knowledge regarding hla-directed alloreactivity and the various in vitro and in silico methodsthat can be used to predict this alloreactivity. hla alloreactivity in transplantation involves both b-cell- and t-cell-mediated responses. three mechanisms of alloreactivity directed towards allogeneic hla have been described: direct, indirect, and semidirect allorecognition. igg hla alloantibodies directly recognize intact allogeneic hla molecules that are present on the cell surface. these antibodies play a pivotal role in solid-organ transplantation and probably also have a role in hsct [1518]. the humoral response directed against allogeneic hla can be established upon exposure to allogeneic hla during pregnancies, blood transfusions, or (previous) transplantations. during this response these peptides can subsequently be presented on hla class-ii molecules that are present on the cell surface. recognition of these hla class-ii presented hla-derived epitopes by cd4+t cells results in b-cell activation and igm to igg isotype switching. donor-specific igg hla antibodies (dsa) that are subsequently produced can bind directly to small polymorphic amino-acid residue patches that are present on the molecular surface of hla antigens [2022], thereby inducing rejection of graft tissue/cells, designated as antibody-mediated rejection. in addition to alloantibodies, alloreactive t cells can also directly recognize intact allogeneic hla molecules. there is compelling evidence that cross-reactive t cells are involved in direct t-cell recognition [2431]. these cross-reactive t cells initially react towards a foreign peptide, for instance, a viral peptide, presented by self-hla. however, these t cells can also respond to allogeneic hla presenting a self- or viral peptide [2431]. although these cross-reactive t cells can persist over time, direct t-cell recognition is predominantly involved in the acute stage of alloreactivity. intact hla molecules present on resident donor-derived antigen-presenting dendritic cells are considered to be the driving force behind direct recognition in solid-organ transplantation, since parenchymal cells within transplanted tissues are unable to induce direct t-cell recognition (reviewed in). because these dendritic cells are depleted over time, the contribution of direct recognition in chronic graft rejection after solid-organ transplantation is limited [32, 33]. in contrast to direct t-cell recognition, indirect t-cell recognition is considered to be mainly involved in later stages of alloreactivity. during indirect recognition, t cells recognize processed epitopes derived from allogeneic hla that are presented by hla molecules that are likely shared between donor and recipient [35, 36], as t cells are restricted to self-hla. indirect t-cell recognition is also involved in the formation of hla alloantibodies, since t-cell recognition of b-cell presented hla epitopes is required in this process [19, 37]. thus, indirect t-cell recognition may also partly contribute to early alloreactivity, as indirect recognition can amplify the direct recognition response. in semidirect allorecognition, allogeneic hla: peptide complexes are transferred from allogeneic cells to autologous dendritic cells, resulting in a chimeric antigen-presenting cell. transfer of allogeneic hla: peptide complexes can be achieved through secretion of endosomes containing hla: peptide complexes or through cell-to-cell contact between donor and recipient dendritic cells. antigen-presenting cells that acquire intact allogeneic hla: peptide complexes on their cell surface may elicit both direct and indirect alloreactive t-cell responses. although in vivo evidence for the role of the semidirect allorecognition pathway in graft rejection and gvhd is limited, it has been shown that this pathway is able to elicit cytotoxic alloimmunity in vitro and in vivo and that the transfer of allogeneic hla: peptide complexes likely occurs in an in vitro system of gvhd. humoral sensitization to hla class-i and class-ii epitopes and the subsequent production of hla-specific antibodies can occur upon pretransplant exposure to allogeneic hla. the presence of dsa before transplantation is related to antibody-mediated rejection and significantly impairs graft prognosis [15, 16]. therefore, evaluation of hla-sensitizing events (i.e., pregnancies, blood transfusions, and previous transplants) is generally included in standard pretransplantation screening. pregnancy is a major contributor to hla sensitization, as approximately 30% of the pregnancies results in child-specific sensitization towards hla-a, -b, -c, and/or -dr loci. moreover, the hla sensitization frequency increases with the number of full-term pregnancies. blood transfusions can induce hla sensitization in approximately a third of the solid-organ transplantation recipients. however, blood transfusions have a less prominent effect on hla alloimmunization than pregnancy and solid-organ transplantation [44, 45]. in addition to the classical sensitizing events, hla alloantibodies can also be raised against epitopes in allergens, ingested proteins, and microorganisms that are cross-reacting with hla. although the presence of these natural dsa in kidney recipients is associated with the induction of mild episodes of antibody-mediated rejection, these patients have favorable graft outcome. therefore, the existence of these natural dsa prior to transplantation is currently not a contraindication for transplantation. although dsa detection methods are important tools for risk assessment prior to transplantation, pretransplant evaluation of preformed dsa remains challenging. for example, antibodies might become undetectable at the moment of transplantation due to the decay of antibody levels over time. the clinical relevance of these preexisting low dsa levels is highly variable; some preformed dsa will elicit hla alloreactivity in vivo, whereas others will not. currently used detection methods may thus not detect the whole repertoire of clinically relevant dsa. the complement-dependent cytotoxicity (cdc) crossmatch assay (reviewed in) is a potent manner to measure the presence of clinically relevant antibodies, whereas other dsa detection assays, like the hla-based enzyme-linked immunoabsorbent assay (elisa) and luminex-based assays [50, 51], provide valuable but limited information about the clinical relevance of identified dsa. currently, the cdc assay seems to be a potent indicator for alloreactivity, while in vitro dsa detection methods can further support the matching procedure for solid-organ transplantation. combining in vitro assays with an in silico prediction method allows identification of acceptable hla mismatches towards which a recipient will likely not develop antibody-mediated responses. assessment of humoral sensitization to allogeneic hla was initially performed by the cdc crossmatch assay. this assay measures the presence of preformed or de novo formed antibodies through their induction of complement-dependent lymphocyte killing. a positive cdc test was associated with a significantly impaired outcome after kidney transplantation [49, 52]. despite its potency to mimic the in vivo situation, cdc crossmatch assays lack sensitivity and may show false positive results. to overcome these problems, a more sensitive assay was developed: the flow cytometry-based crossmatch (fcxm) assay. however, both fcxm and the classical cdc crossmatch test correlate equally well to clinical outcome after kidney transplantation. the lack of sensitivity and specificity of cytotoxicity crossmatch assays has led to development of solid-phase assays, such as the hla-based elisa and luminex assays [50, 51]. these solid-phase methods, particularly luminex, are very sensitive and specific; relevant anti-hla class-i and class-ii antibody profiles in solid-organ transplant recipients can be identified and monitored over time. combining antibody profiles that are present in solid-organ transplant recipients, with hla typing of the donor, designated as virtual crossmatching, allows identification of dsa and therefore might be useful in risk stratification prior to solid-organ transplantation (reviewed in [56, 57]). unfortunately, estimation of the clinical relevance of dsa detected with solid-phase assays remains challenging, as tools to discriminate between nondetrimental dsa and deleterious dsa are lacking. nevertheless, the presence of class-i and class-ii dsa detected by luminex in the absence of positive cdc assay is suggested to be indicative for impaired graft outcome in kidney transplantation. in vitro cdc-based dsa detection assays have their limitations; these assays are not suitable to determine hla-mismatch permissibility for highly sensitized transplantation candidates. because of the high sensitization levels in those individuals, cdc assays often become almost completely positive, which complicates selection of suitable cdc-negative donors that will not elicit hla alloreactivity in vivo. therefore, alternative in silico methods were sought to predict acceptability of hla-mismatched combinations. the in silico algorithm hlamatchmaker is based on the principle that hla-specific alloantibodies can bind to distinct amino-acid polymorphisms (immunogenic epitopes) present on hla antigens [20, 21]. multiple polymorphic amino-acid residues on the molecular surface of hla antigens have been identified. some of these residues are inaccessible for antibodies, since they are located near the cell membrane or within peptide-binding groove of the hla molecule, while other residues are fully accessible for antibodies [20, 21]. hlamatchmaker uses this knowledge to predict which hla mismatches are not able to induce complications in transplantation recipients by defining the acceptable mismatches [20, 21]. initially, hlamatchmaker defined immunogenic epitopes as antibody-accessible, linear sequences of amino-acid polymorphisms (triplets) [20, 21]. triplets that are present in donor hla antigens, but not in the recipient hla antigens, were considered to elicit humoral responses [20, 21]. on the other hand, triplets that are present in both donor and recipient hla antigens were considered as acceptable [20, 21]. thus, hlamatchmaker provides a tool for identification of acceptable hla mismatches. the clinical applicability of hlamatchmaker in matching strategies has been extensively evaluated. it has been shown that the triplet version of hlamatchmaker is a potent indicator for the presence and magnitude of allogeneic hla-directed antibody responses in renal transplantation and during pregnancy [59, 60]. in contrast, the number of triplet mismatches was not indicative for the induction of t-cell alloreactivity. this lack of correlation between triplets and t-cell alloreactivity is probably caused by alternative epitope binding by t cells or by the involvement of larger polymorphic sequences in t-cell alloreactivity. with regard to hsct, the number of triplets did not correlate to acute gvhd, engraftment, or survival. despite its applicability in hla-matching strategies, the triplet version of hlamatchmaker represents an incomplete repertoire of immunogenic epitopes, as only linear sequence positions are implemented. this hiatus has resulted in the development of a redefined version of hlamatchmaker that identifies eplets. eplets are immunogenic hla epitopes that are critical for antibody binding and consist of polymorphic amino-acid patches located at the molecular surface of hla molecules. these polymorphic patches may consist of polymorphisms in linear sequence positions and three-dimensional polymorphic patches in discontinuous sequence positions. therefore, implementation of eplets into the algorithm has led to a more accurate definition of structural hla epitopes. evaluation of the eplet version of hlamatchmaker has shown a similar performance in predicting allogeneic hla acceptability compared to the triplet version. nevertheless, the eplet version of hlamatchmaker provides further discrimination of highly divergent hla specificities. although conflicting results were reported with regard to the prognostic information that is provided by hlamatchmaker on graft outcome ([ 6366], reviewed in), it is generally accepted that hlamatchmaker is a suitable tool to analyze serum antibodies and to identify acceptable mismatches in solid-organ transplantation. however, hlamatchmaker is inappropriate for hsct donor selection. in addition to the number of eplets as determined by hlamatchmaker, additional determinants can be used to define allogeneic hla acceptability, for instance, physiochemical properties of polymorphic amino acids. differences in physiochemical properties between mismatches, including electrostatic potential and hydrophobicity, are useful to predict hla class-i- and class-ii-specific alloantibody responses prior to solid-organ transplantation [6870]. with higher physiochemical disparity between hla mismatches, the risk of antibody development increases after kidney transplantation [6870]. these observations suggest that differences in physiochemical properties between polymorphic amino acids may be relevant in defining acceptable hla mismatches. the presence of t-cells directly recognizing intact allogeneic hla molecules was previously shown in individuals suffering from graft rejection after solid-organ transplantation [71, 72] and gvhd after hsct. there is compelling evidence that direct t-cell alloreactivity results from cross-reactive t cells that are initially primed by a foreign peptide, for instance, a viral peptide [2431]. for example, the hla-b08:01-presented ebv peptide flrgraygl is recognized by an ebv-specific tcr, that possesses cross-reactive capacities towards hla-b44:02-presented peptide eeyqafty [24, 75]. thus, the hla-b08:01-presented peptide flrgraygl elicits a public immune response. during a public immune response, the immune response directed against an identical epitope virus-specific t cells can be detected in high levels in healthy individuals, it is likely that cross-reactive virus-specific t cells may be present in both solid-organ transplantation recipients and hsct donors prior to transplantation. the presence of virus-specific t cells that are cross-reactive with allogeneic hla in these individuals may significantly contribute to complications after transplantation. however, most virus-specific t-cell responses do not have the propensity to induce public tcr responses nor predictable cross-reactivity with allogeneic hla. a single viral infection can therefore result in the establishment of multiple t cells that are cross-reactive to multiple hla molecules, whereas other viral infections do not give rise to these cross-reactive t cells. in addition, virus-specific t cells with the same antigen specificity, but different tcrs, elicit different unpredictable patterns of alloreactivity [26, 79]. the molecular mechanism behind t-cell cross-reactivity is complex and currently incompletely understood. t-cell cross-reactivity assumably arises due to structural homology of hla: peptide complexes (reviewed in) rather than sequence homology of the presented peptides. despite their sequence dissimilarity, the structure of flrgraygl and eeyqafty epitopes in the context of their presenting hla molecules is quite similar. therefore, molecular mimicry likely attributes to the observed cross-reactivity between these epitopes. on the other hand, cross-reactive tcr in mice can dock to self-mhc: peptide complexes in a different orientation than to allogeneic mhc: peptide complexes, suggesting that cross-reactivity can be established without molecular mimicry. thus, direct alloreactivity is a complex immune response that can only partially be explained by molecular mimicry. since the molecular mechanism behind direct t-cell recognition is poorly understood, prediction of alloreactivity based on viral history is complex. knowledge about viral history is therefore not sufficient to predict direct t-cell alloreactivity directed towards allogeneic hla. since direct t-cell allorecognition was studied intensively over the past decades, several alternative approaches to predict direct t-cell alloreactivity in vitro and in silico have been developed. cytotoxic t lymphocyte precursor assays (ctlp) determine permissibility of hla mismatches through in vitro evaluation of effector cytotoxic t-cell induction. this chromium 51 (cr) release-based assay, initially described by brunner et al. further development of this assay has resulted in an assay that estimates the extent of alloreactive t-cell responses directed towards allogeneic hla. since individual allogeneic hlas can be linked to ctlp frequencies, these assays are a useful approach to distinguish between permissible and nonpermissible mismatches in vitro. more importantly, a high ctlp frequency correlates reasonably well with clinical outcome in vivo; high ctlp frequencies were associated with graft rejection after solid-organ and tissue transplantation [73, 84, 85] and with gvhd and impaired survival after allogeneic hsct [82, 83, 86]. association between graft failure and the presence of primed cytotoxic t lymphocytes in sensitized transplant candidates (e.g., women after previous pregnancy) was shown as well. despite the usefulness of ctlp assay in estimating t-cell alloreactivity, the time-consuming and laborious character of this assay is a major drawback. in order to overcome these disadvantages, alternative in silico approaches amino-acid polymorphisms at tcr-recognition and peptide-binding regions between hla class-i mismatches were analyzed for their physiochemical and/or position characteristics and were correlated to ctlp outcome. these analyses resulted in the establishment of a novel algorithm, which aims to predict hla class-i mismatch-specific ctl alloreactivity. although the algorithm can predict ctlp outcome reasonably well, usage of this model for donor selection seems limited; this tool does not predict gvhd development in patients receiving hsct. the first clinically relevant model that successfully estimates the effect of direct recognition in hsct has recently been developed. this hla-dpb1-restricted model is designated as the t-cell epitope (tce) model. this model has been based on in vitro data from two alloreactive t-cell clones isolated from an hsct patient with graft rejection due to an hla-dpb1 mismatched graft. membrane-bound intact hla was essential for recognition of the hla-dpb1 mismatch by the alloreactive t-cell clones; the clones did not respond to b-lymphoblastoid cell lines transduced with a truncated mismatched-hla-dpb1 construct that did not lead to cell-surface expression of hla-dpb1. thus, it seems likely that these two alloreactive t-cell clones recognized the hla-dpb1 mismatched antigen in a direct manner. in order to identify patterns of recognition of other alleles, the t-cell clones were further tested for their recognition of other hla-dpb1 alleles. alleles were divided into three different immunogenic levels: highly immunogenic (i.e., both clones recognized the alleles), intermediate immunogenic (i.e., one of the clones recognized the allele but the other did not), or nonimmunogenic (i.e., both clones did not recognize the allele). since testing of all hla-dpb1 alleles in vitro is very time consuming, immunogenicity of other hla-dpb1 alleles was extrapolated, based on similarities between the peptide-binding grooves of the in vitro tested alleles and the not-tested hla-dpb1 alleles. subsequently, hla-dpb1 mismatches were labeled as permissive or nonpermissive based on their immunogenic level and the concept of thymic education. for example, when the hla-dpb1 allele of the donor belongs to the highly immunogenic group, then donor t cells should be educated not to respond to hla-dpb1 alleles belonging to the highly immunogenic group and, in theory, will also not respond to lower immunogenic alleles. therefore, when the recipient has an hla-dpb1 allele belonging to the same or a lower immunogenic group, then the hla-dpb1 mismatch will be permissive in the graft-versus-host (gvh) direction. on the other hand, since the hla-dpb1 allele of the recipient is not immunogenic, recipient t cells are able to respond to (higher) immunogenic alleles of the donor. thus, such mismatches are nonpermissive in the host-versus-graft (hvg) direction. nonpermissive mismatches, defined by the tce model, are highly correlated to alloreactivity as reflected by gvhd, graft rejection, and transplant-related mortality after hla-dpb1-mismatched hsct [4, 9092]. counterintuitively, in these situations, the direction of the nonpermissiveness appears not to be important: both hvg and gvh nonpermissive mismatches lead to alloreactivity in the gvh direction (i.e., gvhd) [4, 91]. therefore, both hvg and gvh nonpermissive mismatches are considered overall nonpermissive [4, 91]. the in silico model histocheck has been developed to estimate t-cell alloreactivity between hla class-i and class-ii mismatches. histocheck calculates a matching score for any donor-recipient combination based on their hla typing, the so-called sequence-similarity matching score. the sequence-similarity matching score is determined by comparing differences in amino acids between hla alleles with regard to their functional similarity and their location in the hla molecule; amino-acid positions involved in tcr recognition and hla-peptide binding are implemented in the sequence-similarity matching score. as a high sequence-similarity matching score represents a high level of dissimilarity between donor and recipient, correlation of the sequence-similarity matching scores with clinical outcome was expected. however, histocheck is not indicative for transplant outcome in vivo, as sequence-similarity matching scores showed no correlation with gvhd after hsct [9496]. the inability of histocheck to be indicative for t-cell alloreactivity may be explained by several limitations of this model: histocheck does not integrate the presence of alloreactive donor t cells nor viral history in its algorithm. additionally, the concepts of aforementioned molecular mimicry between hla: peptide complexes and unconventional docking of tcr are not included in histocheck. since these aspects of direct t-cell recognition are complex and not fully understood, establishment of reliable, clinically relevant tools to predict direct t-cell recognition remains challenging. an alternative approach to predict direct t-cell alloreactivity is to analyze the impact of amino acids at certain locations within hla molecules. several amino-acid substitutions in the peptide-binding domain of hla class-i molecules are related to an increased risk of gvhd, whereas other amino-acid substitutions are related to a diminished relapse risk. the effect of specific amino-acid changes on alloreactivity was recently investigated in a large cohort. in this study, the impact of changes on hla class-i positions 9, 99, 116, and 156 for peptide binding alteration and position 77 for killer cell immunoglobulin-like receptor binding was investigated in recipients of an allogeneic hsct with a single allelic mismatch at either the hla-a, -b, or -c locus. particularly amino-acid changes at position 116 in hla-c were associated with an increased acute gvhd risk [97, 98], but also changes at position 99 for hla-c and position 9 for hla-b were associated with clinical t-cell alloreactivity. by determining the effect of specific amino acids within the hla molecule, multiple amino-acid positions have been identified that influence transplantation outcome; this knowledge may be used for donor selection. indirect recognition of allogeneic hla acts via presentation of peptides derived from allogeneic hla molecules. over 350 of these indirectly recognizable hla-derived peptides t-cells recognizing these peptides likely play a role in alloreactivity; the erection of indirectly recognizing t cells after solid-organ transplantation was strongly correlated to both acute [100102] and chronic graft failure [102, 103]. furthermore, the presence of circulating t-cells recognizing allogeneic hla epitopes in an indirect manner was predictive of rejection. as mentioned previously, indirect t-cell recognition is considered to be a slower alloreactive response than direct t-cell recognition [33, 34]. the proposed slower rate of indirect t-cell recognition may be related to the idea that indirectly recognizing t cells arise from the naive pool, whereas directly recognizing t cells likely evolve from the memory pool, as the latter t cells are supposedly cross-reactive. since direct recognition has received most attention historically, not many methods are available to predict indirect recognition of hla disparities; there is no in vitro system available and only one in silico model. we have recently developed a model for in silico prediction of indirectly recognizable hla-derived peptides, the so-called pirches model (predicted indirectly recognizable hla epitopes). indirect t-cell recognition that targets allogeneic hla depends on hla-derived peptides that differ between host and graft. hla-derived peptides that are identical between donor and recipient should be ignored by the alloimmune system, as t-cells recognizing these peptides should have been deleted from the repertoire due to thymic selection. thus, the hvg reaction of graft rejection after solid-organ transplantation should be evoked by donor-specific peptides, whereas gvhd after hsct should be evoked by recipient-specific peptides. we have designated the donor-specific peptides that can be recognized by the recipient as hvg-pirches and the recipient-specific peptides that can be recognized by the donor as gvh-pirches. in order to elicit indirect t-cell recognition, allogeneic hla proteins need to be processed into peptides and these peptides need to be presented on shared hla. since both steps are determined by certain motifs in the protein sequences, both antigen processing and antigen presentation pathways our pirches model uses these predictions to define permissibility of hla mismatches. for hla class-i peptide presentation (designated as pirche-i), the pirches model first determines proteasomal cleavage of all hla molecules of the donor and recipient into peptides and transport of those peptides via the transporter associated proteins (tap) into the endoplasmic reticulum (er). subsequently, the binding affinities of the predicted cleavage products to hla class-i alleles are predicted, as a derivative of peptide presentation by the hla class-i molecules that are shared between donor and recipient. prediction of hla class-ii-presented epitopes (pirche-ii) is restricted to hla-binding affinity predictions of peptides, since (enzymatic) cleavage patterns have not been clearly defined yet. on the basis of their performance, we implemented netchop, netmhcpan, and netmhc-ii or netmhciipan (reviewed in [106109 ]) in our pirches model to predict the number of pirche-i and pirche-ii. netchop is a potent predictor of proteasomal cleavage and tap transport, whereas netmhcpan predicts binding affinity to hla class i. netmhc-ii can predict peptide binding to hla class-ii alleles for which binding data exist, whereas for netmhciipan these data were extrapolated to other alleles. both hla class-i- and hla class-ii-binding predictors have good predictive capacities and are frequently used to identify viral epitopes. the first construction of the pirches model was based on predicting hla class-i-derived peptide presentation on shared hla-dr and used the binding affinity predictions of netmhc-ii. after kidney transplantation with hla class-i mismatches, mismatches that led to allogeneic hla-specific antibody production correlated to higher numbers of hvg-pirche-ii compared to mismatches that did not led to antibody production, suggesting that indirect recognition of hla-derived epitopes was required for hla-specific igg antibody production. for hsct, the situation is more difficult, as alloreactivity after hsct not only involves cd4+t-cell recognition and stimulation of b cells but clearly involves cd8+t-cell recognition of alloantigens as well. moreover, usage of netmhciipan was incorporated, as netmhc-ii can only predict binding to a limited number of hla-dr alleles. indeed, after hla-mismatched hsct, high numbers of both gvh-pirche-i and -ii are correlated to clinical alloreactivity (thus et al., manuscripts in preparation). in the current pirches model, we regarded any difference in presentable peptides derived from donor-versus-recipient alleles as a pirche (i.e., only one amino-acid difference is regarded as difference). the model can likely be improved when the t-cell recognition is more specifically elucidated. it is well known that some positions of peptides are more important in tcr binding than others [123, 124], as amino acids that are lying deep inside the peptide binding groove of the presenting hla molecule are likely not seen by the tcr. furthermore, polymorphisms leading to different peptide properties (e.g., polar versus nonpolar and hydrophobic versus hydrophilic) may lead to more pronounced t-cell recognition. these refinements are currently being studied for their effect on the predictive potential of the model. hla mismatches can cause severe posttransplantation complications such as graft rejection and gvhd. in these complications, the induction of both antibody production and t-cell recognition may play a role. interestingly, permissibility of hla-mismatched combinations is highly variable; some mismatches are poorly tolerated, whereas others are highly permissible. although the degree of hla amino-acid sequence disparity varies largely amongst different hla mismatches depending on the allelic versus antigenic nature of the mismatch and the hla locus, the number of polymorphic amino-acid residues in itself is not predictive for the permissibility of hla-mismatched combinations, as multiple additional factors are involved. both the nature and the position of the amino-acid polymorphisms within the mismatched hla, as well as their effect on neighboring amino acids, determine the permissibility of hla-mismatched combinations. several approaches have been developed to predict the permissibility of hla mismatches, thereby aiming to improve donor selection procedures. the objective of all these approaches is to predict the development of the abovementioned antibody and t-cell recognition of allogeneic hla. several well-established in vitro assays can be used to detect dsa that are related to impaired graft survival. in addition to these assays, hlamatchmaker is a well-validated tool to identify which hla mismatches do not induce alloreactive humoral responses in transplantation recipients. although hlamatchmaker is a powerful predictor for acceptable hla mismatches in solid-organ transplantation, this tool is not suitable for predicting hla permissibility in the setting of hsct. with regard to direct t-cell recognition, the risk for clinical alloreactivity can be estimated with the in vitro ctlp assay. in addition to this in vitro assay, several in silico approaches aim at predicting direct recognition-based t-cell alloreactivity. for example, the tce model can assess nonpermissive hla-dpb1 mismatches for hsct. the relevance of the tce model has not yet been investigated in solid-organ transplantation. practically, one should note that hla-dpb1 is rarely typed prospectively in the setting of solid-organ transplantation, as donor availability is more restricted than for hsct. although histocheck has been developed to estimate direct recognition in silico for all hla loci, this model does not correlate to alloreactivity in vitro nor in vivo. alternatively, several studies have identified amino-acid positions that are influencing transplantation outcome; this information can be implemented in donor selection procedures. this model predicts hla-derived epitopes that can be presented on shared hla classes i and ii. both pirche-i and pirche-ii are well correlated to alloreactivity after hsct. with regard to pirche-ii, increasing numbers of pirche-ii are correlated to antibody production after solid-organ transplantation. alloreactivity after transplantation can unlikely be attributed to one single pathway of hla recognition. to determine the relative contribution of direct and indirect recognition, combining the different methods of predicting alloreactivity would be of interest. direct and indirect recognition may act synergistically, and therefore the combination of a positive ctlp assay and a high number of pirches may lead to a more pronounced alloreactive response. furthermore, combining the pirches and the tce models for hla-dpb1 mismatches might allow identification of hla-dpb1 mismatches recognized in both direct and indirect manners. moreover, a combination of low pirche-ii and low number of eplets as determined by hlamatchmaker may be favorable in solid-organ transplantation. in conclusion, over the past decades, many approaches have been developed to predict alloreactivity after transplantation in vivo, some attempts leading to more successful predictors than others. the failure of multiple tools to predict alloreactivity is not surprising, as knowledge about alloreactivity is still limited. however, multiple approaches seem to be clinically relevant and some are currently implemented in clinical practice. further improvement of the definition of hla-mismatch permissibility, and implementation of these definitions into the donor-selection procedure, will eventually lead to reduced alloreactivity, thereby improving clinical outcome after solid-organ transplantation and hsct.

human leukocyte antigen (hla) mismatching leads to severe complications after solid-organ transplantation and hematopoietic stem-cell transplantation. the alloreactive responses underlying the posttransplantation complications include both direct recognition of allogeneic hla by hla-specific alloantibodies and t cells and indirect t-cell recognition. however, the immunogenicity of hla mismatches is highly variable; some hla mismatches lead to severe clinical b-cell- and t-cell-mediated alloreactivity, whereas others are well tolerated. definition of the permissibility of hla mismatches prior to transplantation allows selection of donor-recipient combinations that will have a reduced chance to develop deleterious host-versus-graft responses after solid-organ transplantation and graft-versus-host responses after hematopoietic stem-cell transplantation. therefore, several methods have been developed to predict permissible hla-mismatch combinations. in this review we aim to give a comprehensive overview about the current knowledge regarding hla-directed alloreactivity and several developed in vitro and in silico tools that aim to predict direct and indirect alloreactivity.

PMC4020392

pubmed-1155

in hiv-1 infection, depletion of t cells is caused by productive virus infection and fas-mediated apoptosis of infected and uninfected cells [1, 2]. in addition, chronic immune activation, especially of cells of the innate immune system, together with accompanying, counteracting endogenous anti-inflammatory mechanisms, further contributes to t-cell depletion [3, 4]. hiv infection of plasmacytoid dendritic cells causes persistent activation, resulting in excessive production of proapoptotic interferon (ifn)-, as well as immunosuppressive indoleamine-2,3-dioxygenase and transforming growth factor (tgf)- [413]. in the case of monocytes/macrophages, translocation of microbial products, especially lipopolysaccharide and dna, across the damaged intestinal epithelium, results in persistent systemic activation of these cells due to interaction with toll-like receptors 4 and 9, as well as with cytosolic pathogen nucleic acid sensors [1423]. the resultant production of proinflammatory cytokines, especially tnf-, drives t-cell activation and activation-induced cell death [6, 21, 22]. sustained immune activation is associated with disease progression, aids, and death. while highly active antiretroviral treatment (haart) is able to suppress viral replication to levels of<25 copies/ml plasma and partially restore circulating cd4 t cells, it is unable to normalize immune activation [21, 25]. immune activation in hiv infection is associated with the presence of circulating proinflammatory/anti-inflammatory and antiviral cytokines/chemokines, as well as with other biomarkers of immune activation, which vary qualitatively and quantitatively with disease progression [2631]. however, relatively little is known about the profile of circulating biomarkers of immune activation in the setting of advanced hiv-1 subtype c infection, as well as the usefulness of its measurement, not only in monitoring response to haart, but also as a strategy to detect virologic treatment failure. black, adult (18 years) participants attending the antiretroviral clinic at a district hospital in pretoria, south africa, were included in this study. ethics approval was granted by the research ethics committee, faculty of health sciences, university of pretoria (ethics committee approval number 46/2011). all participants gave informed consent and whole blood samples were collected in edta vacutainers, processed within 24 hours to separate the plasma component by centrifugation, and stored at 70c for up to 37 months. cd4 t-lymphocyte counts (cd4) (beckman coulter sa (pty) ltd.) and hiv-1 rna (vl) (nuclisens hiv-1 viral load assay v1.2 or v2.0) were measured by standard flow cytometric and pcr-based procedures respectively, according to manufacturer's instructions. sixty hiv-infected participants were followed from pre-treatment to approximately 6 months on haart as part of a larger study on immune reconstitution inflammatory syndrome (iris). pre-treatment samples were taken prior to the initiation of haart in patients presenting with cd4 counts 200 cells/l blood or who stage 4 disease. twenty patients were randomly selected from those who started haart, were clinically stable, did not develop clinical signs of iris during the first six months of treatment, and were virologically suppressed (vl<50 copies/ml plasma) at approximately 6 months of haart (suppressed group). drug regimens consisted of two nucleos(t)ide reverse transcriptase inhibitors (nrtis) (stavudine (d4 t)+lamivudine (3tc), n=18, or tenofovir (tdf)+3tc, n=2) and one nonnucleoside reverse transcriptase inhibitor (nnrti) (efavirenz (efv), n=14 or nevirapine (nvp), n=4). two patients were started on ritonavir-boosted lopinavir (lpv/r) for clinical reasons. a second group consisted of 30 participants failing haart as evidenced by two successive vl results of>1000 copies/ml plasma at least eight weeks apart despite intensive adherence counselling (failing group). drug regimens consisted of two nrtis (d4 t+3tc, n=23 or zidovudine (azt)+3tc, n=7) and one nnrti (efv, n=20 or nvp, n=10). participants had been referred for drug resistance testing and study samples were taken at the time of referral. they had been on haart for a median time of 30 months (range 997 months) and had been failing treatment for a median of 15.5 months (range 538 months). five patients (17%) had been referred from peripheral clinics and the duration of treatment failure could not be determined. three patients (10%) had experienced treatment interruptions at some time before treatment failure and 13 (43%) never had a suppressed vl while on haart. all patients with cd4 200 cells/l (n=21) were on cotrimoxazole or dapsone prophylaxis. a third group (n=8) of black, hiv-uninfected, healthy control subjects was also included in the study. the median ages of the control, suppressed, and failing groups were 29 (range 2449), 41.5 (2563), and 40.5 (2755) years, respectively, and the corresponding male: female ratios were 1: 0.6, 1: 4, and 1: 4. these were selected on the basis of being largely representative of t-cell, monocyte/macrophage, dendritic cell, and natural killer cell activation. circulating cytokines/chemokines were measured using (i) the bioplex suspension bead array system (bio-rad laboratories inc., hercules, ca, usa) (il-6, il-10, ifn-, tnf-, ccl2/mcp-1, ccl3/mip-1, ccl4/mip-1, and cxcl10/ip-10) or (ii) conventional elisa, namely, ifn- (ebioscience inc., san diego, ca, usa); tgf-1 total (biolegend, san diego, ca, usa); cxcl9/mig and stnf-r1 (raybiotech inc., norcross, ga, usa); and scd14 (abcam, cambridge, ma, usa). c-reactive protein (crp) and 2-microglobulin (2 m) were assayed by nephelometry (siemens healthcare diagnostics, bn prospec nephelometer, newark, usa). previously published ranges for each of these parameters together with supporting references are shown as supplementary data (see supplementary material available online at http://dx.doi.org/10.1155/2014/198413). as participant groups consisted of 30 individuals, data were considered to be nonparametric and distribution-free statistical tests implemented in stata v11.2 (statacorp). median concentrations of each parameter were compared between cohorts using the wilcoxon mann-whitney test for independent groups and wilcoxon signed rank sum test for matched groups. correlations between parameters were determined using the spearman correlation test for the hiv-infected pre-haart group (n=20), as well as for this group combined with the group failing haart (n=50). statistical significance was set at p 0.05. cd4counts, hiv-1 vl, and levels of inflammatory biomarkers are shown in table 1. as expected, plasma vl decreased from a median of 53,000 to<50 rna copies/ml plasma and there was a significant increase in the circulating cd4 count (83 to 208 cells/l; p<0.0001) in the suppressed group. with respect to the circulating biomarkers of immune activation, cxcl9, cxcl10, tgf-1, stnf-r1, 2 m, and scd14 were significantly elevated (p<0.03) and ccl4 significantly decreased (p=0.04) in the pre-haart group relative to the control group, while ifn- was moderately increased but not significantly so (p=0.07). following 6 months of haart, cxcl9, cxcl10, 2 m, ifn-, il-6, tnf-, and stnf-r1 were significantly decreased (p<0.01), ccl4 increased (p<0.001), while tgf-1 and scd14 also remained elevated despite undetectable plasma vl. it is difficult to attribute major significance to the decreases in tnf- and il-6 as the pretherapy values for both were low. no difference was observed in ifn-, ccl3, and crp either between the hiv-infected and uninfected control group or the virologically suppressed group pre- and post-haart. in the failing group, the same 5 biomarkers (cxcl9, cxcl10, tgf-1, 2 m, and scd14) were also significantly elevated compared with the control group (p<0.02), the values for cxcl10 and 2 m being somewhat lower than those of the pre-haart group (p<0.03), while those of cxcl9, tgf-1, and scd14 were essentially comparable (p>0.5). although the value for ccl2 was significantly lower and that of il-10 higher than the corresponding values of the control group, interpretation is difficult as these values were low in both groups. correlations between cd4, vl, and the various biomarkers in the pre-haart group are shown in table 2. cd4 counts correlated negatively and significantly with vl and with stnf-r1 and ccl2. significant positive correlations were also observed between several of the biomarkers including, but not limited to, ifn-, cxcl10, ccl2, ccl3, and tnf-. although not shown, correlations for the composite group (consisting of the pre-haart and failing groups) were generally comparable, albeit weaker, with the exception of cd4 count with vl (r=0.64, p<0.001), while the following modest correlations were found: (i) ccl4 with cxcl9, il6, ccl3, and ifn- (r=0.30, 0.43, resp.; p<0.03, p<0.001); and (ii) 2 m with cd4 counts, il-6, and ifn- (r=0.28, 0.43, resp.; p<0.05, p<0.02). our findings in patients infected with hiv-1 subtype c are consistent with the coexistence of distinct mechanisms of immune activation, which appear to be differentially affected by successful haart [21, 25]. although only moderately elevated pre-haart, it is likely that ifn-, probably originating from cd4 and cd8 t cells, underpins the increases in cxcl9 and 10, a contention supported by the strong, positive intercorrelation between ifn- and ccl10, as well as that of ccl9 with ccl10. other cell types such as dendritic cells and monocytes may also contribute to the increases in these cytokines pre-haart following exposure of the cells to alternative activators such as ifn-1 [11, 32, 33]. the unexpectedly low level of ifn-, as well as those of ccl2 and 3, may be due to advanced immunosuppression in the setting of high levels of tgf-1 in this group of patients. in the case of 2 m, cxcl 9 and 10, and tnf-r1 (a surrogate for tnf), haart-associated decreases most likely reflect efficient viral suppression and consequent decreased turnover and reactivity of both cd4 and cd8 t cells. the absence of effects of haart on plasma scd14, as previously reported by us and others [17, 21], as well as the increase in ccl4, is consistent with ongoing chronic inflammation due to sustained activation of monocytes/macrophages, even in the face of virally suppressive therapy, and may persist for several years [21, 35]. in this setting, the persistent activation of monocytes/macrophages, predominantly the subtype which coexpresess cd14 and cd16, is most likely driven by the process of microbial translocation [21, 24, 36]. the consequence is sustained generation of proinflammatory mediators and cytokine-driven t-cell death pathways. interestingly, sandler et al. recently reported significant positive correlations between plasma scd14, il-6, crp, serum amyloid a, and d-dimer in patients infected with hiv-1 subtype b. subjects with the highest quartile of plasma scd14 concentrations had a 6-fold higher risk of death than those in the lowest quartile. in addition, supported by the findings of the current study, endogenous, monocyte/macrophage-targeted, anti-inflammatory mechanisms are also likely to contribute to ongoing immunosuppression with tgf-1 appearing to play a pivotal role. notwithstanding platelets, plasmacytoid dendritic cells, macrophages of the m2 phenotype, and immunoregulatory cd8 t cells, immunosuppressive and profibrotic tgf-1 is likely to originate predominantly from regulatory t cells [38, 39]. in this context it is noteworthy that extensive fibrosis of the t-cell zone of lymphoid tissue appears to be a significant factor in the failure of t-cell reconstitution following successful haart. persistently elevated plasma levels of tgf-1 and scd14, even in the setting of ostensibly successful haart, may therefore identify a subset of patients at highest risk of a poor outcome. in the group of patients failing haart, the circulating concentrations of cxcl9, cxcl10, and 2 m were also significantly higher than those of the control group and, with the exception of cxcl9, significantly lower than the pre-haart values for the suppressed group. the circulating concentrations of scd14 and tgf-1 in the failing group were comparable to those of the suppressed group both before and after therapy. persistent elevations, or a rebound following an earlier decrease, in plasma cxcl9, cxcl10, and 2 m appear to be associated with a poor response to haart, suggesting that serial measurement of these biomarkers may be a useful adjunctive strategy. with respect to previous studies, our findings are generally in agreement with a recent study by kamat et al. in which elevated circulating concentrations of cxcl9, cxcl10, scd14, and soluble il-2 receptor (sil-2r) represented a profile which distinguished viremic and aviremic subjects infected with hiv-1 subtype b from uninfected, healthy control subjects. in agreement with the report of kamat et al., we also detected a significant, negative correlation between numbers of circulating cd4 t cells and vl but failed to show a correlation between these disease markers and cxcl10 in the pre-haart group. however, this correlation was detected when the pre-haart and failing groups were combined, most likely due to increased statistical power. we also detected a significant positive correlation between cxcl9 and cxcl10, while in contrast to these authors, a significant, positive correlation between cxcl10 and ifn- was evident as can be expected in conditions of chronic inflammation. notwithstanding the different viral types investigated, several other important differences underscore the strengths of the current study. most importantly, the profile of biomarkers of immune activation measured by kamat et al., which did not include 2 m or tgf-1, was not measured serially in a single cohort of patients pre- and post-haart as done in the current study, which may account for the observed lack of effect of haart on ifn- in the former study. limitations, however, are (i) small sample sizes; (ii) measurement of circulating biomarkers at a single time point (6 months) following initiation of haart in the suppressed group; and (iii) no pretherapy measurement of circulating biomarkers prior to initiation of therapy in the failing group. nonetheless, the general agreement with previous studies, predominantly in the setting of hiv-1 subtype b infection, supports the reliability of our findings. in conclusion, successful administration of haart to patients with hiv-1 subtype c infection is accompanied by significant decreases in circulating biomarkers associated with t-cell activation and turnover (ifn-, cxcl9, cxcl10, stnf-r1, and 2 m). serial measurement of 3 of these (cxcl9, cxcl10, and 2 m) may represent a useful adjunct to measurement of viral loads in monitoring responses to haart. in addition, persistently elevated levels of scd14 and tgf-1, despite successful haart, are consistent with chronic activation of monocytes/macrophages and possible risk of a poor outcome, underscoring the adjunctive therapeutic potential of monocyte/macrophage-targeted anti-inflammatory chemotherapy in patients with advanced hiv infection.

few studies have examined immune activation profiles in patients with advanced hiv-1 subtype c infection or assessed their potential to predict responsiveness to haart. bioplex, elisa, and nephelometric procedures were used to measure plasma levels of inflammatory biomarkers in hiv-1 subtype c-infected patients sampled before and after 6 months of successful haart (n=20); in patients failing haart (n=30); and in uninfected controls (n=8). prior to haart, cxcl9, cxcl10, 2 m, stnf-r1, tgf-1, ifn-, il-6, tnf, and scd14 were significantly elevated in hiv-1-infected patients compared to controls (p<0.01). all of these markers, with the exception of stnf-r1, were also elevated in patients failing haart (p<0.05). the persistently elevated levels of cxcl9, cxcl10, and 2 m in patients failing therapy in the setting of a marked reduction in these markers in patients on successful haart suggest that they may be useful not only to monitor immune activation during haart, but also to distinguish between good and poor responders. in the case of scd14 and tgf-1, the levels of these biomarkers remained persistently elevated despite haart-induced virological suppression, a finding that is consistent with ongoing monocyte-macrophage activation, underscoring a potential role for adjuvant anti-inflammatory therapy.

PMC3997875

pubmed-1156

six specimens of k. sectatrix (2 males with mean weigh of 950 50 g, mean body length 376.5 30.4 mm; 4 females with mean weigh of 868 146 g, mean body length 361.2 22.9 mm) were caught by commercial trawlers in angra dos reis (2300 s 4410w), rj. fishes were kept in thermal boxes filled with ice prior to being transported to the laboratory and then immediately dissected. both stomach and intestine were removed and examined individually using a stereoscopic microscope. nematodes found were fixed in 95 parts of ethanol 70%, three parts formaldehyde 40% and two parts of glacial acetic acid, cleared in lactophenol and studied and measured using light microscopy. for a detailed study of some structures, samples of eggs were extracted from a dissected uterus of a dissected female and the spicules were obtained from a dissected male. drawings were made using a drawing tube attached to a light microscope olympus bx 51, magnifications of 40x, 100x, 200x, 400x and 1000x. for scanning electron microscopy (sem), specimens were dehydrated in a series of ethanol washes, dried by evaporation with haexamethyldisilazane, coated with gold and scanned in a jeol jsm 6460-lv sem. the identification at the genus level was based on moravec (2007) and anderson et al. host identification was based on the illustrated key by menezes and figueiredo (1985); nomenclature and classification are updated according to fishbase (froese&pauly 2012). holotype, allotype and paratypes are deposited in the oswaldo cruz institute helminthological collection (chioc), rj. 1line drawings of pseudascarophis brasiliensis sp. nov. collected from the stomach of kyphosus sectatrix from rio de janeiro, brazil. a: anterior end of male, lateral view; b: cephalic end of female, apical view; c: region of vulva, lateral view; d: fully developed egg; e: posterior region of female, lateral view; f: posterior region of male, ventral view; g: posterior region of male, lateral view; h: right spicule, ventrolateral view; i: distal end of left spicule, ventrolateral view. bars=a, c, g: 50 m; b: 2 m; d, h, i: 20 m; e, f: 75 m. 2scanning electron micrographs of pseudascarophis brasiliensis sp. nov. collected from the stomach of kyphosus sectatrix from rio de janeiro, brazil. a: cephalic end, apical view (a: pseudolabia; b: tooth-like digitiform process; c: cephalic papillae; arrow head: amphid); b: cephalic end, ventrolateral view (c: cephalic papillae); c: deirid; d: lateral alae, lateral view; e: lateral alae, ventral view; f: posterior end of female, ventrolateral view (arrow head: phasmid); g: posterior end of male, lateral view (p: caudal papillae; lp: lateral caudal papillae; arrow head: phasmidial papilla); h: area rugosa of male. bars=a, b, c: 2 m; d: 5 m; e, g: 20 m; f, h: 10 m. diagnosis-females larger than males, anterior part of body more slender than posterior part; cuticle thick and transversely striated. cephalic end rounded in both sexes, four submedian inconspicuous cephalic papillae, visible only by sem (fig. 2a, b) and pair of lateral amphids, posterolateral to pseudolabia (fig. two lateral pseudolabia t-shaped in apical view, emerging externally and somewhat elevated in relation to lateral margins of oral aperture, arching medially to join lateral walls of anterior part of buccal cavity and lacking apical protrusions (figs 1b, 2a, b). four anteriorly directed tooth-like digitiform processes (2 subdorsal and 2 subventral), emerging sub-marginally from internal surface of oral cavity, not projecting beyond anterior margin of it (figs 1b, 2a, b). deirids bifurcated (fig. vestibule long, with distinct funnel-shaped prostom visible in lateral view (fig. nerve-ring encircles muscular oesophagus near its junction with vestibule, excretory pore slightly posterior to nerve ring (fig. 2d, e), extending from level of prostom to that of anterior ends of subventral caudal alae in males and anterior to the level of anus in females. male (based on holotype and 9 paratypes)-body 12.8 (10.3-15.4) mm long, maximum width at middle of body 82.5 (70-100); width at level of nerve ring 42.6 (38-54), of oesophago-intestinal junction 55.8 (41-78) and of anus 59.6 (51-81). vestibule including prostom 136.4 (130-145) long; prostom 10 (8-12) long, 10.4 (8-12) wide in lateral view. length of muscular oesophagus 330 (290-390); length of glandular oesophagus 5.5 (4.3-6.6) mm; length ratio of muscular and glandular parts of oesophagus 1:16.6 (1: 14.4-21.47); length of entire oesophagus and vestibule representing 45.5 (41-50)% of total body length. nerve-ring situated at 163.5 (140-180) from anterior extremity; deirids and excretory pore at 58 (50-65) and 180 (150-225), respectively, from anterior end. posterior end of body spirally coiled provided with vesicular caudal alae (figs 1 g, 2 g). pre-anal papillae: three pairs of subventral pedunculate papillae, of which second and third pairs close to each other (fig. one pair of lateral pedunculate papillae somewhat posterior to cloacal aperture, which may occur at cloacal line. postanal papillae: six pairs present, first four pairs subventral and pedunculate, fourth pair smaller than others, last two pairs sessile near tail tip, located at the same line, in which one is lateral and large and one ventral and very small where phasmidial openings are located (fig. at least three longitudinal lines of serrate ventral cuticular ridges (area rugosa), anterior to cloaca, about 190 long (figs 1 g, 2h). left spicule 380.6 (344-418) long, broad with circular rounded anterior end and somewhat inflated dorsoventrally at distal thin tip (fig. 1i); its shaft 161 (145-178) long, forming 44.6 (2.1-46.3)% of overall length of spicule (measured in 3 males). right spicule 108.8 (100-116) long, stout with rounded distal end and thin tip (fig. tail conical, 237 (200-280) long, with rounded tip. female (based on allotype and 9 paratypes, all gravid)-body 17.7 (15.9-19.8) mm long; maximum width at middle of body 139.2 (100-190); width at level of nerve ring 46.9 (41-54), of oesophago-intestinal junction 64.7 (52-80) and of anus 66.5 (50-86). vestibule including prostom, 131.2 (110-143) long; prostom 12 (11-13) long, 10.4 (8-12) wide in lateral view. length of muscular oesophagus 381.7 (300-465); length of glandular oesophagus 6.1 (5.3-6.7) mm; length ratio of muscular and glandular parts of oesophagus 1:16.1 (1:12.8-18.9); length of entire oesophagus and vestibule representing 36.4 (33-38)% of total body length. deirids, nerve-ring and excretory pore located at 61.2 (50-68), 152.5 (130-171) and 185.1 (149-220), respectively, from anterior extremity. vulva posterior to middle of body, situated at 11.6 (10.9-12.3) mm from anterior end of body, at 65.8 (60.1-70.5)% of body length; vulvar lips not elevated (fig.1c). tail conical, 123.9 (110-150) long, with rounded tip (figs 1e, 2f). phasmidial opening in small lateral papillae about 10 from tail tip (figs 1e, 2f). mature eggs (containing larvae) oval, 31.1 (30-33) long and 20.9 (20-22) wide, thick-walled, with smooth surface and distinct polar knobs, one tuff of four thin filaments emerging from each polar knob (fig. type-locality-angra dos reis (2300 s 4410w), rj. type data and depository-holotype (male specimen) chioc 35848a; allotype (female specimen) chioc 35848b; paratypes chioc 35849a (2 male specimens), chioc 35849b (2 female specimens). host-parasite data-prevalence: four infected fishes of six analysed; mean intensity of infection: 10 10.8 (3-26); mean abundance: 6.7 9.8. etymology-the specific name refers to the country where the specimens were collected. the taxonomy and classification of cystidicolidae has been complex because this group of nematodes exhibit small size; thus some of their morphologically important features are visible only by sem (moravec 2007, moravec& justine 2010). therefore, many of the previous studies lack morphological details and provide inadequate descriptions. cephalic structures are generally considered to be important for the classification of cystidicolidae, although their significance in generic discrimination is still under discussion and more evidence is necessary not only from electron microscopy, but also molecular data (ferrer et al. 2005, moravec et al. 2006, moravec 2007, moravec&gonzlez-sols 2007, moravec&klimpel 2007, 2009). however, there is an increasing consensus in the literature for defining cystidicolid genera based on head morphology. several genera of cystidicolidae (ascarophis van beneden, caballeronema margolis, capillospirura skryabin, cystidicoloides skinker, pseudascarophis and similascarophis muoz, gonzlez&george-nascimento) are very similar to each other, with minute differences represented by details of their cephalic structures, which are only visible by sem. moreover, there exist various intermediate features that can be interpreted as interspecific rather than intergeneric differences (moravec&klimpel 2007). indeed, many members of these genera have been reported within ascarophis (ferrer et al. 2005) or transferred to it (moravec 2007, moravec&gonzlez-sols 2007, moravec&justine 2007). in fact, the latter authors have stated that it is apparent from sem studies that the shape and size of pseudolabia, the shape of the mouth and the development of submedian labia (from well-developed to absent) may differ among ascarophis species. consequently, ascarophis has been defined as a catch all genus, which also includes species with filamented and non-filamented eggs (ferrer et al. the general morphology of the new species agrees with most diagnostic features described for pseudascarophis, which was erected to accommodate p. kyphosi, a parasite of the congeneric host kyphosus cinerascens (forskl) from japan (ko et al. 1985). indeed, the structure of the mouth is almost identical between both species, indicating that the specimens studied here belong to pseudascarophis, in agreement with ko et al. (1985), as well as with the latest review of cystidicolidae provided by moravec (2007). the homogeneity of cephalic structures, therefore, confirms the validity of the genus pseudascarophis. the only discrepancies between the new species and the generic diagnosis provided by ko et al. (1985) are the presence of lateral alae, cephalic papillae (referred as indistinct in the type species and consequently in the genus), three pairs of precloacal and one pair of adcloacal papillae in males (instead of only 3 pairs of precloacal and none adcloacal papillae) and the smooth egg shell instead of rugged shell as in p. kyphosi. the presence of four submedian cephalic papillae is a characteristic of spirurine nematodes (moravec 2007) and these structures, apparently inconspicuous in p. kyphosi, probably were overlooked by ko et al. the presence of lateral alae is an uncommon feature in cystidicollids, except for two genera, i.e., ctenascarophis mamaev and metabronema (taylor) (crites et al. apparently, p. kyphosi lacks lateral alae, since these structures were not described by ko et al. however, to be conclusive about the presence or absence of this feature in pseudascarophis, the genus must be reviewed and all previous described species must be better studied, mainly because some of them (i.e., p. tropica and p. genypteri) seem to be misclassified. other differences between the new species and p. kyphosi are based on morphometry. males of both species are similar in size, although the description of p. kyphosi is based on only two specimens. however, the new species has a longer glandular oesophagus (4.3-6.6 mm vs. 2.9-3.0 mm), a longer tail (200-280 vs. 125-150), longer spicules (left 344-418 vs. 185-210 and right 100-116 vs. 80-90) and, as mentioned above, it has a different pattern of caudal papillae. measurements of p. kyphosi females are also based on only two specimens, who are longer than the new species (27.2-33.4 mm vs. 15.0-19.8 mm) and consequently all other measurements are larger. in addition, some morphometric relationships were different when comparisons were made after calculating some of these from the data provided by ko et al. in fact, the new species has a relatively longer oesophagus (32.3-38.2% of body length vs. 23.3-28.3%) and tail (0.6-0.8% of body length vs. 0.4%). eggs of both species are similar in length, but those of p. kypsosi are thinner (14-17 vs. 20-22) and have more filaments (at least 6) in the tuffs of polar knobs, rather than four as in the new species. at present, two other species have been described in pseudascarophis, namely, p. tropica and p. genypteri (soloveva 1996, muoz&george-nascimento 2001). however, both of them have some features which differs them from the diagnosis of this genus, especially in the morphology of the cephalic end, casting doubts on their generic identity. in fact, the inclusion of p. tropica in pseudascarophis is based on ambiguous diagnostic criteria such as the structure of head end, digestive system and reproductive system (soloveva 1996); although this species is described as having four teeth-like formations slightly protruded from outside of oral opening, but these structures are not depicted and specimens were not studied by sem. on the other hand, the description of p. tropica suggests various similarities with ascarophis parupenei moravec, orecchia and paggi (e.g. morphology of cephalic end and posterior end of male, posterior extremity of female with a small appendix and non-filamented eggs) described from parupeneus indicus (shaw) (mullidae) (moravec et al. 1988), congeneric of parupeneus chrysopleuron (temminck&schlegel) which is the type host of p. tropica. the other species, p. genypteri, a parasite of genypterus chilensis (guichenot) (ophidiidae) from chile (muoz&george-nascimento 2001), was originally assigned to this genus by lacking cephalic papillae, submedial and medial labia, as well as because of the progressive prominence of cuticular striations from anterior to posterior body regions and by having the anterior third of body wider than the posterior region. at specific level, p. genypteri was distinguished from p. kyphosi because it has larger spicules, rounded pseudolabia that join in the middle of the oral opening, eight digitiform buccal processes, unfilamented eggs and four pairs of preanal and five pairs of postanal papillae, the same set of differences allow distinguishing it from the new species. p. genypteri was considered different from ascarophis by two characteristics, i.e., their pseudolabia appear to be rounded, instead of being conical as in ascarophis and the anterior third is thicker than the rest of the body. n. by owing its ambiguous diagnosis, its similarity with a. parupenei and due to the broader spectrum of morphological features which this genus includes. on the other hand, p. genypteri is provisionally retained in pseudascarophis, based on the criteria of muoz and george-nascimento (2001) for separating it from ascarophis and by the presence of digitiform buccal processes, until new evidence can help to clarify its generic status.

a new species of pseudascarophis (nematoda: cystidicolidae) found in the stomach of kyphosus sectatrix (linnaeus) (kyphosidae), off rio de janeiro, brazil, is described. the new species can be differentiated from the other congeners by the presence of lateral alae, distinct but inconspicuous cephalic papillae at the anterior end, three pairs of precloacal and one pair of adcloacal papillae in males, egg morphology and morphometry of glandular oesophagus and spicules. pseudascarophis tropica is transferred to ascarophis as ascarophis tropica (solov'eva) comb. n. due to its ambiguous diagnosis.

PMC3970610

pubmed-1157

we now have quite detailed knowledge of the partners of the plk4 family of kinases at centrioles. in c. elegans, zyg-1 is targeted to centrioles by spd-2 [5, 6] whereas in drosophila, asterless has this function. targeting in mammalian cells requires the respective counterparts of both proteins cep192 and cep152 [8, 9] that can each interact with plk4 s cryptic polo-box domain. procentriole formation can be initiated at multiple sites not only when plk4 is overexpressed [3, 4, 10] or when its scf-dependent proteolysis is prevented [11, 12], but also when expression of its targeting subunit is elevated. despite this extensive knowledge several substrates of plk4/zyg-1 have been identified to date that include sas-6, cep152, and a component of -turc, gcp6, but it is not clear how phosphorylation of these proteins might affect centriole duplication. to address this question we chose to identify centriole proteins that could be phosphorylated by plk4 in vitro. to this end we purified an active form of drosophila plk4 expressed in e. coli that was able to undertake known autophosphorylation [1620] and was also active toward an artificial substrate (figure s1a available online). we first tested whether this preparation of plk4 would phosphorylate proteins found in the outer layers of the centriole [21, 22]. this revealed that plk4 could weakly phosphorylate its partner protein, asl (figure s1b), and cep97 (figure s1c), a protein that complexes with the cp110 centriole capping protein. however, it could not phosphorylate the microtubule wall-associated protein, sas4 [21, 2426], (figure s1b); rcd4, a poorly characterized centriole duplication protein (figure s1c); or bld10/cep135, a protein required for maintenance but not formation of the core centriole [27, 28] (figure s1c). we then asked whether the core centriole proteins ana2 and sas6 might be substrates as both are essential for centriole duplication in drosophila [29, 30] and their respective counterparts in c. elegans, sas-5 and sas-6, are immediately downstream of zyg-1 in the recruitment hierarchy of centriole proteins in c. elegans [5, 6]. strikingly, plk4 could strongly phosphorylate ana2 but not sas6 (figures 1a, s1d, and s1e), suggesting the possibility that ana2 might be the plk4 substrate that triggers centriole duplication. to test the above hypothesis, we first mapped the sites on ana2 phosphorylated by plk4 in vitro and tested the significance of their modification. mass spectrometric analysis revealed multiple plk4 phosphorylation sites of which four serine residues (s318, s365, s370, and s373) (figures 1b and 1c, arrows, figure s1 g) stood out because their total spectral counts (times a particular phospho-peptide was detected) were much higher than any others. moreover, they seemed to be the only plk4 sites in the c-terminal part of ana2 as their mutation to alanine prevented phosphorylation by plk4 in vitro (figures 1d and s1f). their functional importance was also suggested by their conservation within the stan motif that characterizes ana2 orthologs (figure 1c) and the finding that phosphorylation of the same sites could be detected in vivo (see figure s1 g and legend). to test their biological significance, we asked whether ana2 with alanine substitutions at these sites (ana2-4a) would permit centriole duplication. for this purpose we first established two d.mel-2 cell lines, stably expressing untagged versions of either wild-type ana2 (ana2-wt) or ana2-4a that each lacked the utrs of the endogenous gene. three 4-day treatments of control d.mel-2 cells with ds ana2-utr rna led to complete loss of centrioles from 68% of cells (data not shown). by contrast, depletion of endogenous ana2 from the line expressing the ana2-wt transgene had no significant effect upon centriole number, indicating that it can fully substitute for the endogenous protein. however, expression of transgenic ana2-4a not only failed to rescue endogenous ana2 depletion, but also had a significant dominant-negative effect, an increased proportion of cells lacking centrioles following control-rnai (figures 1e and 1f). together this demonstrates the functional importance of these four conserved serines in the stan motif of ana2 for centriole duplication. we next considered whether phosphorylation of ana2 by plk4 might affect its interaction with other components of the centriole duplication machinery. to this end we loaded recombinant gst-ana2 onto beads, incubated with either active or inactive (plk4) kinase and then with s-methionine-labeled centriole proteins synthesized in vitro. we were unable to detect binding of ana2 to either rcd4 or ana1; its binding to sas4 showed no change; and its weaker binding to bld10 showed a 3.5-fold increase in response to ana2 s phosphorylation state (figures 2a and s2a). however, sas6 showed a dramatic increase in binding to ana2 phosphorylated by plk4 (figures 2a and 2b). the c-terminal part of ana2 containing the stan motif was necessary and sufficient for this phospho-dependent interaction with sas6 (figure 2c), leading us to test the consequences of mutations at its four plk4 sites. we found that the ana2-4a mutant was unable to interact with sas6 even after incubation with active plk4 (figure 2b), indicating that phosphorylation on these sites is required. when we mutated individual serines to alanines, the strength of the interaction was diminished, particularly with s370a mutant, but not completely abolished (figure s2b). thus plk4 phosphorylation of ana2 on all four residues is critical to mediate its interaction with sas6 in vitro. to validate these findings in vivo, we cotransfected d.mel-2 cells with sas6-myc and flag-ana2 (either wt or 4a) and either active plk4 mutated in its degron (plk4) or inactive plk4 (nondegradable and kinase-dead following flag-pulldown we could detect sas6 associated with ana2-wt but not ana2-4a and only when coexpressed with the active form of plk4 (figure 2d). this verifies our in vitro findings that following phosphorylation by plk4, ana2 is able to interact with sas6. sas6 provides a structural basis for centriole architecture; its oligomers adopt a 9-fold symmetrical arrangement to form the cartwheel structure of the procentriole [31, 32]. stil (human ana2) and hsas6 are the first proteins to follow plk4 to a dot-like structure marking assembly of the procentriole [9, 22, 33]. sas6 is essential for correct centriole structure in drosophila although, unlike plk4, its overexpression does not lead to proper centriole formation in eggs. however, boosting expression of both sas6 and ana2 stimulates formation of multiple microtubule organizing centers in eggs and tubular aggregates linked to disengaged centrioles in spermatocytes. interestingly, however, such sas6 and ana2 could be recruited to centrioles only if plk4 were also overexpressed in spermatocytes leading to centriole overduplication. these earlier findings might be accounted for if the phosphorylation of ana2 by plk4 triggered the first step in cartwheel formation by sas6, leading to procentriole formation. to address the above hypothesis, we first needed to examine the progressive recruitment of ana2 and sas6 to centrioles in their duplication cycle relative to the outer centriolar marker d-plp. at mitotic entry, each centrosome comprises a pair of orthogonally engaged centrioles, which we refer to as mother and daughter, surrounded by peri-centriolar, microtubule-nucleating material. the daughter centriole is immature at this stage and matures during mitosis. in drosophila cells, the mother centriole is encircled by a d-plp ring and during maturation, two horns of d-plp progressively extend around the daughter to give a complete ring by metaphase/early anaphase. once the d-plp ring is complete, the paired centrioles disengage during late anaphase so that each newly born cell exits cytokinesis into g1 with two well-separated centrioles (figure s3). at mitotic entry, sas6 and ana2 are both present in two discrete puncta, one in the center of the mother centriole, the other marking the daughter and yet to become encircled by d-plp. when the mother and mature daughter disengage, they each have a single dot of ana2 or sas6 at their center. then, in late anaphase/telophase, a second ana2/sas6 dot appears at the periphery of each physically separated centrioles, marking the site of procentriole formation (figure s3). with this knowledge, we could then address the interdependencies of ana2 and sas6 for their loading onto centrioles. we found that both ana2-wt and the ana2-4a mutant localized to centrioles, arguing that ana2 recruitment does not require its plk4-dependent association with sas6 (figure 3a). we then explored the ability of endogenous ana2 to localize to centrioles in the absence of sas6 and found this to be largely unaltered (figure 3b). we then explored the reciprocal possibility by depleting ana2 and assessing the localization of sas6. we found that this diminished the level of sas6 by 2- to 3-fold and resulted in centrioles that had only a single central punctum of sas6. sas6 failed to load onto anaphase/telophase centrioles in ana2-depleted cells so that the majority of interphase centrioles retained only a single sas6 punctum (figures 3c and 3d). thus sas6 loading and the consequential formation of the procentriole are dependent on ana2. because phosphorylation of ana2 by plk4 is required for ana2 to bind sas6, we determined the effects of plk4 depletion and found that this had similar consequences to ana2 rnai for sas6 loading (figures 3c and 3e). this accords with a requirement for ana2 to be phosphorylated by plk4 in order to interact with and therefore load sas6 onto the centriole. finally, to determine whether phosphorylation of the four plk4 sites within the stan motif was critical for sas6 recruitment, we asked whether ana2-4a would block the recruitment of sas6. for this purpose we depleted the endogenous ana2 from our cell lines overexpressing either ana2-wt or ana2-4a and simultaneously monitored the localization of the transgenic ana2 proteins and endogenous sas6. the great majority (91%, n =34) of interphase centrioles in cells with endogenous ana2 substituted by ana2-wt had two colocalizing puncta of ana2 and sas6 on both mother and daughter/procentriole (figure 4) as expected from our above study of untreated cells (figure s3). in striking contrast, when endogenous ana2 was substituted with ana2-4a, the majority (85%, n =20) of interphase centrioles had puncta of ana2 on mother and daughter, but sas6 was associated only with the mother (figure 4). this further demonstrates that ana2 is able to load onto the site of procentriole formation irrespective of whether it can be phosphorylated by plk4. however, plk4-mediated phosphorylation of ana2 is necessary in order to recruit sas6 for procentriole formation. together our findings suggest a series of events that include disengagement of centrioles at the end of mitosis and the initiation of procentriole formation accompanied by re-engagement by loading sas6. this would accord with the finding that centrioles of sas6 mutant spermatocytes in drosophila lose both their 9-fold symmetry and their engagement; the former being consistent with sas6 s role in establishing the cartwheel structure, the latter suggesting that sas6 is also required to maintain the orthogonal link between mother and daughter. here we observe that disengagement of the mother/daughter pair occurs immediately following the maturation of the daughter centriole, a process that we see through completion of a ring of d-plp that encircles the daughter s ana2 and sas6. this has similarities to the plk1-dependent maturation and disengagement of the mother/daughter centriole pair of human cells as they pass through mitosis [37, 38]. effectively, these processes constitute duplication licensing; they activate a site on the daughter centriole and clear sas6 from the perimeter of the mother, allowing both mother and daughter to initiate procentriole formation. in accord with this notion, we see the recruitment of new ana2 and sas6 onto the mother and daughter only once they have disengaged. it is of interest to compare our findings on sas6 recruitment in drosophila to events in human cells where sas6 is destroyed during g1. a recent study has shown that sas6 is first transiently recruited to the lumen of the mother centriole in s phase before being repositioned to the site of procentriole formation, events that are dependent upon stil (human ana2) and plk4. this contrasts to drosophila where sas6 is stable at the core of the centriole once it is incorporated, and only its initial incorporation into procentrioles appears to be dependent on ana2 and plk4. our evidence strongly suggests that the very first act of procentriole formation requires ana2 to be phosphorylated by plk4. a mutant form of ana2 unable to be phosphorylated at the plk4 sites permits neither sas6 recruitment nor centriole duplication, and depletion of either plk4 or ana2 similarly prevents the spatio-temporal events of sas6 loading. thus, although we can not exclude the possibility that other protein kinases can also phosphorylate ana2 in vivo, it seems most probable that ana2 s phosphorylation by plk4 initiates centriole duplication because plk4 is the only known protein kinase whose activity is sufficient for de novo centriole formation. the phosphorylation of ana2 in its stan motif enables it to recruit sas6, presumably to form a new cartwheel structure and establish engagement of the new procentrioles to both old mother and daughter. how does ana2 itself become recruited onto the site of procentriole formation and how is new ana2 (and hence sas6) restricted to this single site? what is the architecture of the ana2-sas6 complex? as we progress further in understanding how the centriole components are pieced together and how these events are controlled by reversible phosphorylation and regulated protein stability, the answers to these questions will surely emerge.

summarycentrioles are 9-fold symmetrical structures at the core of centrosomes and base of cilia whose dysfunction has been linked to a wide range of inherited diseases and cancer [1]. their duplication is regulated by a protein kinase of conserved structure, the c. elegans zyg-1 or its polo-like kinase 4 (plk4) counterpart in other organisms [24]. although plk4 s centriolar partners and mechanisms that regulate its stability are known, its crucial substrates for centriole duplication have never been identified. here we show that drosophila plk4 phosphorylates four conserved serines in the stan motif of the core centriole protein ana2 to enable it to bind and recruit its sas6 partner. ana2 and sas6 normally load onto both mother and daughter centrioles immediately after their disengagement toward the end of mitosis to seed procentriole formation. nonphosphorylatable ana2 still localizes to the centriole but can no longer recruit sas6 and centriole duplication fails. thus, following centriole disengagement, recruitment of ana2 and its phosphorylation by plk4 are the earliest known events in centriole duplication to recruit sas6 and thereby establish the architecture of the new procentriole engaged with its parent.

PMC4229625

pubmed-1158

genomic islands (gis) are clusters of foreign genes acquired from nongenealogical organisms through horizontal gene transfer (hgt). previous studies have elucidated some hgt mechanisms, including (i) transformation, (ii) conjugation, (iii) transduction, and (iv) gene transfer agent. the occurrences of hgt make considerable contribution to genome evolution, which is especially evident in pathogenic organisms or antibiotic resistant organisms [6, 7]. such quantum-leap evolution can cause drastic changes to species, especially in bacteria, and shape the world where humans live [810]. therefore, it is practically significant to explore origins of gis (i.e., donors of gis). besides, the occurrence of hgt between highly divergent organisms has great impact on phylogenetics, which can disclose the evolutionary relationship of organisms. the acquired gis or biological features may contaminate the correctness of phylogenetic realtions therefore, exploring the origin donor of gis can also contribute to the analysis of genealogical phylogenetics. some previous research works of constructing donor-recipient network based on individual genes have been carried out [11, 12], where the network is composed of a set of vertices (i.e., organisms) and edges, which connect vertices and reveal the occurrences of hgt between organisms. by studying the visualized networks, the researchers could uncover the hidden mechanisms of hgt such as genomic biases or barriers, dna repair bypasses, and eukaryotes origins and evolutions. while using individual genes for studying donor-recipient network can reveal the mechanisms of hgt to some degree, a hgt event usually occurs in a cluster of sequential genes instead of single genes separately. therefore, it may not truly reflect the donor-recipient networks accurately if using single-gene-based analysis. available gi detection tools these days make it possible to generate donor-recipient network based on gis. current gi prediction tools can be grouped into three categories: (1) sequence composition based approach, (2) comparative genome analysis approach, and (3) integrative approach. the most representative signatures include g+c content, dinucleotide biases, codon usage, mobility genes (including transposases and integrases), and trna genes [14, 15]. related tools using this kind of approach include alienhunter, centroid, gidetector, gihunter, pai ida, and sigi-hmm. comparative genome approach uses the phylogenetically close species as reference genomes and identifies subsequences that are unique in the query genomes and treats them to be gis. the integrative approach uses the prediction results of the above programs to obtain census gis. the availability of these gi tools, thus, provides us with a chance to study donor-recipient relationship through gis. in this paper, we propose using gis to trace the origins of gis and study donor-recipient networks across organisms. to make our donor-recipient networks meaningful, we model edges as weighted, which can be represented by the number of gis that a donor genome contributes to a recipient genome. in a previous study, it was hypothesized that if a hgt happened between two organisms, a series of subsequent directional transfers should be very likely to arise. therefore, it is reasonable to hypothesize that if two nongenealogical organisms harbor more occurrences of hgt, the more confident donor-recipient relationship is between them. in this study, we would also like to check whether donor-recipient relationship is random or biased. previous studies have shown that hgt is not a random event but of preferences to occur. it has been found that hgt occurs among organisms which share similar factors such as genome size, genome g/c composition, carbon utilization, and oxygen tolerance., we will describe the dataset and our computational framework in detail (it is freely available for noncommercial use at http://www5.esu.edu/cpsc/bioinfo/software/gidonor). in section 3, we will illustrate the usage of computational framework on three case studies and discuss our predicted results with visualized networks. finally, we draw a conclusion in section 4 and discuss our possible future work. genbank, an open-access resource which is established and maintained by the national center of biotechnology information (ncbi), houses all publicly available biological sequences such as genomic sequences and protein sequences. to trace gi donors, we collected all available prokaryotic nucleotide sequences from genbank, which covered 162 million sequences with 150 billion nucleotides bases in total. genbank provides different data formats for feeding different programs. for local based blast search in our framework, this format is small in terms of size, so that it is convenient to download, and it can also be transformed into fasta format. for alienhunter, used for gi detection in our framework, we used fasta format. more specifically, we fed alienhunter with fasta nucleic acid files with the extension of essentially, our framework relies on two kinds of bioinformatics tools, sequence similarity search tool and gi prediction tool. we used blast as the sequence similarity tool since it is accurate and efficient in terms of computing time. we used sequence composition based gi tools for predicting gis in our framework because this kind of approach can be applied to any query genome sequence. by integrating multiple bioinformatics tools, our framework can process sequenced genomic data automatically and obtain final predicted donor organisms. the framework consists of five steps (also shown in figure 1), includingobtaining gis in a query genome with sigi-hmm;collecting initial candidate donor genomes by blast;predicting complete gi lists in candidate donor genomes using alienhunter;obtaining final donor genomes through overlapping;visualizing donor-recipient relationships.each step of our computational framework will be described in the following subsections. obtaining gis in a query genome with sigi-hmm; collecting initial candidate donor genomes by blast; predicting complete gi lists in candidate donor genomes using alienhunter; obtaining final donor genomes through overlapping; visualizing donor-recipient relationships. sigi-hmm, an open-source program, is based on genome composition analysis and is available for local installation, as well as web gui on islandviewer. sigi-hmm first analyzes the codon usage of each gene, provides the score for each gene based on the codon usage, and thus can find alien genes based on codon usage scores. because sigi-hmm produces the highest precision rate, guaranteeing the predicted gis to be true gis, we adopted it as the gi prediction tool in query genomes. because islandviewer has provided predicted gis by the program of sigi-hmm, we took advantage of it and obtained predicted gis for any query genome from islandviewer. in order to automatically collect gis provided by islandviewer, we developed a perl script to send out query genome information to islandviewer's server and extract gi ranges from the islandviewer server. blast is extensively used in sequence similarity measurement due to its efficient computation, high accuracy, and the availability of cross-platforms. therefore, blast was incorporated into the framework for searching initial candidate donor genomes, which should contain genomic fragments similar to gi sequence in the query genomes. in blast, the cutoff value e is used to evaluate the similarity between genome sequences. in this study, we set e value of 10 as the cutoff to find our candidate donors. the blast output contains information of genome sequence alignments, alignment score, and e values, and such information can be processed systematically through open source of bioperl. therefore, we wrote a perl script that uses bioperl modules to extract relevant information from blast outputs. the initial candidate donor genomes obtained by blast search may contain some false positive donors (i.e., the genome fragments similar to those gis in the query genome are also transferred from donor genomes); thus a filtering process should be conducted to remove such false positives and obtain final donor genomes. theoretically, the final candidates should possess a characteristic; that is, the detected similar genomic fragments from blast should be original (in other words, they are not gis) in the corresponding hosts. in order to check whether such genomic fragments are original or not, we must use gi tools to check whether they are gis or not. we incorporated a gi tool alienhunter in our framework to extract a complete list of gis for all initial candidate donor genomes. we chose the alienhunter tool in this step because previous assessment study on available gi tools had shown that alienhunter possesses the highest recall rate, compared with other sequence compositions including sigi-hmm, islandpath, pai ida, and centroid. in other words, alienhunter can predict the most complete lists of gis in any candidate donor genome. this is very crucial because we can filter out more initial candidate donors and guarantee the final identified donors to true donors. in that sense, final donor genomes were obtained by filtering out initial candidate genomes (obtained from section 2.2.2), where genomic fragments similar to recipients of gis were also predicted as gis from section 2.2.3. more formally, let a set {g, s, g} represent the information from previous steps, where g denotes the set of gis of a query genome obtained from sigi-hmm, s denotes the set of initial candidate donor genomes obtained from blast, and g denotes the set of gis on initial candidate genomes predicted from alienhunter. furthermore, for each of them,(i)g={gii 0 }, (ii)s={s(i, j)i, j 0 }, (iii)g={gi, j, 0 }, where gi denotes the ith gi in query genome, s(i, j) denotes the jth initial candidate donor for potentially donating ith gi (gi) on query genome, and g denotes uth gi for a candidate donor (s(i, j)). g={gi, j, 0 }, for any given query genome, a list of final candidate donor genomes can be obtained by running the previous steps in our framework. in order to quantitatively visualize the number of donations from donors, we intended to produce a donor-recipient weighted network, where nodes denote donors and the recipient and the weights corresponding to edges are the number of hgt occurrences (i.e., quantified by the gi transfers) between two organisms. by looking at heavy weighted edges in networks therefore, we utilized it to generate the donor-recipient network in our framework. we have applied our computational framework on three bacterial cases, including donor prediction of mycobacterium tuberculosis h37rv, herminiimonas arsenicoxydans, and a hgt network establishment of three species in thermoanaerobacter (t. pseudethanolicus atcc 33223, t. tengcongensis, and t. strain x514). the possible hgt mechanisms of these species had been studied previously, and thus our predicted results could be investigated by comparing previous studies. mycobacterium tuberculosis (m. tuberculosis) is a bacterial species that causes most cases of tuberculosis (tb). m. tuberculosis h37rv is the best characterized strain of m. tuberculosis and had been sequenced and analyzed biologically. previous work that combined genome-wide parametric analysis showed that m. tuberculosis encompassed 48 gis, which consist of 4.5% of the genome (199 kb), and include 256 genes [35, 36]. through applying our framework in m. tuberculosis h37rv, we hope to reveal the origins of gis and provide a complete list of gi donors to substantially enrich the information of mycobacterial pathogenicity. figure 3 displays all predicted final candidate donors from our framework, where species with the same genus have been dyed with the same colors and positioned next to each other for better visualization. as shown in figure 3, the predicted donor genus which contributed the most is gordonia, followed by nocardia and rhodococcus in descending rank. the number of gis, in which each genus of donors contributed to the recipient h37rv, has been summarized in figure 4. when comparing our predicted donors of h37rv's gis with the predicted potential donors from previous studies, we found that there are a lot of matching predictions. for instance, three donors with the highest donations, including gordonia, nocardia, and rhodococcus, were also detected as their potential origins of gis (figures 3 and 4). besides, we also incorporated bradyrhizobium and corynebacterium into our final candidate donors. in addition, our framework has detected a new potential donor, bifidobacterium animalis, which has not been reported in previous studies. we strongly believe in this as one of the high potential donors since b. animalis resides in the body of most mammals including humans, which may interact with m. tuberculosis and transfer genes to m. tuberculosis. herminiimonas arsenicoxydans (h. arsenicoxydans) is an arsenite-oxidizing bacterium that belongs to heterotrophic betaproteobacterium. it was isolated from heavy-contaminated sludge with arsenic and other heavy metals from industrial wastewater treatment plants. under aerobic conditions, it can oxidize arsenite to arsenate and produce at least two arsenate reductases. it was revealed to be able to resist against numerous heavy metals such as se, mn, cr, cd, sb, and ni. all of those competences enable its widely ecological usage in arsenical polluted environment. a better understanding of h. arsenicoxydans can be beneficial for arsenical polluted remediation. like previous network, species of the same genus have the same colors, and they are placed next to each other in the network. as we can see in the network of figure 5, janthinobacterium marseille (j. marseille) is a highly frequent donor (the occurrence of hgts is 11 times). actually, j. marseille belongs to the order burkholderiales, which has been reported to be the major gene donation source for h. arsenicoxydans. both our predicted results and previous studies strongly indicate that this is the donor for h. arsenicoxydans. we also notice that the number contributed by the genus of ralstonia is 16 times, which is also very significant. these findings strongly indicate that species in the burkholderiales order are major contributors to gis found in h. arsenicoxydans. another noticeable gis contributor was from the pseudomonadales order (figures 5 and 6), which was also consistent with previous study. therefore, we can conclude that the origins of gis in the genome of h. arsenicoxydans are from burkholderiales and pseudomonadales. thermoanaerobacter is a genus that contains a cluster of thermophilic and anaerobic bacteria distributed in high-temperature surroundings like springs. they can absorb heat from surroundings as their source of energy to drive their metabolism. therefore, it will be particularly interesting to study the adaptability of thermophile, examine the evolution path, and ultimately uncover the origins of such special features. a simplified directed network of donor-recipient relationship has been generated in previous work. the directed network was focused on three members of thermoanaerobacter, including t. pseudethanolicus strain atcc33223, t. tengcongensis, and t. strain x514. we extended the previous network with more predicted donors as shown in figures 7 and 8. as you can see, our directed network has expanded previously studied network on a basically consistent condition. for instance, we predicted one gi in t. strain x514 that originally belongs to clostridium thermocellum atcc 27405. this is consistent with their predicted result even though they considered it as a mediator, which played an agent role in the transfer. we also detected seven gi transfers between t. pseudethanolicus strain atcc33223 and t. strain x514 and one gi transfer from t. pseudethanolicus strain atcc33223 to t. tengcongensis mb4. most noticeably, t. brockii finnii ako-1 was present as the donor for all three query genomes as shown in figure 5. we hypothesize that t. brockii finnii ako-1 interacts with these three thermoanaerobacter species and may contribute heat-resistant related genes to these species. hgt has provided organisms apportunities to obtain special features from foreign organisms. in order to reveal genetic sources of hgt, the predicted results in this study were consistent with previous studies, strongly indicating the correctness of our computational framework overall. in addition, our framework has also discovered some new donors not reported in previous studies, and further investigation of these new discoved donors indicates that they are possible donors in the biological and evolutionary perspective. while there is no standard benchmark to measure the accuracy of our framework, it should be noted that the accuracy of our framework depends on the performance of other prediction tools. on the one hand, on the other hand, we adopted sequence composition analysis tools, which is generally applicable to any sequenced query genome, but the prediction is not the most accurate one when compared to comparative genome analysis gi tools. for instance, a genome with a typic genome size will take about one hour to complete the entire process of gi search. thus, for a query genome, it could generate dozens of initial candidate donor genomes, and thus it takes about a day and night to complete the whole process. in this study, we just studied three query genomes, for the purpose of testing the correctness of our computational framework. in the next stage, we will use a cluster of computers or superpower computers, to predict hgt donors for all sequenced bacterial and archaea genomes using our framework. we will build a large-scale donor-recipient network based on all the results. we believe that such kind of networks will reveal a panoramic view of gene transfer information across microbial organisms and provide some insights into evolutionary biologists to study genome evolution.

genomic islands (gis) are chunks of genomic fragments that are acquired from nongenealogical organisms through horizontal gene transfer (hgt). current researches on studying donor-recipient relationships for hgt are limited at a gene level. as more gis have been identified and verified, the way of studying donor-recipient relationships can be better modeled by using gis rather than individual genes. in this paper, we report the development of a computational framework for detecting origins of gis. the main idea of our computational framework is to identify gis in a query genome, search candidate genomes that contain genomic regions similar to those gis in the query genome by blast search, and then filter out some candidate genomes if those similar genomic regions are also alien (detected by gi detection tools). we have applied our framework in finding the gi origins for mycobacterium tuberculosis h37rv, herminiimonas arsenicoxydans, and three thermoanaerobacter species. the predicted results were used to establish the donor-recipient network relationships and visualized by gephi. our studies have shown that donor genomes detected by our computational approach were mainly consistent with previous studies. our framework was implemented with perl and executed on windows operating system.

PMC4897231

pubmed-1159

fatty acids are hydrocarbon chains with a carboxyl group at one end and a methyl group at the other. the biological reactivity of fatty acids is defined by the length of the carbon chain and by both the number and position of any double bonds present. while saturated fatty acids do not contain double bonds within the acyl chain, unsaturated fatty acids contain at least one double bond. when two or more double bonds are present, unsaturated fatty acids are referred to as pufa. there are two families of pufa, and they are classified as omega-3 (n-3) and omega-6 (n-6) based on the location of the last double bond relative to the terminal methyl end of the molecule. linoleic acid (la, c18:2n-6) (precursor to the n-6 series of fatty acids) and -linolenic acid (ala, c18:3n-3) (precursor to the n-3 series of fatty acids) are the simplest members of each family of pufa and are termed essential fatty acids as the body can not synthesise these. pufa regulate a wide variety of biological functions, depending on the location of the last double bond, which range from blood pressure and blood clotting to the correct development and functioning of the brain and nervous system. in addition, lipid mediators generated from long-chain (lc-) pufa (arachidonic acid (aa) in the n-6 series and eicosapentaenoic acid (epa) and docosahexaenoic acid (dha) in the n-3 series) have important roles in immune regulation and inflammation. the main dietary sources of la include plant oils such as sunflower, safflower, and corn oils (table 1), but they are also present in cereals, animal fat, and wholegrain bread. rich dietary sources of ala include green leafy vegetables, flaxseed, and rapeseed oils (table 1). over the last few decades, extreme qualitative nutritional changes have taken place with increased levels of fatty acid consumption. today, industrialised societies are characterised by an increase in saturated fat, omega 6 pufa, and trans fatty acid intake, as well as an overall decrease in omega-3 pufa intake. fatty acids now represent 2842% of total energy consumed by european populations [4, 6], whereas, in ancestral nutrition, fatty acid consumption was only approximately 2030% of total energy [4, 7, 8]. as a result of the increased consumption of la-rich vegetable oils associated with the western diet, n-6 pufa consumption has become progressively much higher than that of n-3 pufa. optimal dietary intakes of the n-6: n-3 ratio should be around 14: 1. however, according to the nutritional changes described above in the western diet, this ratio has now increased to be within the range of 10: 1 to 20: 1. in parallel, there are coinciding increases in the incidence of diseases involving inflammatory processes such as cardiovascular disease, obesity, ibd, rheumatoid arthritis, and cancer. a study carried out by hassan and hanachi, involving 984 iranian women, suggested that a good dietary pattern rich in fruits, legumes, vegetables, cereals, and fish, rich in n-3 pufa, can decrease the likelihood of developing the metabolic syndrome. another study performed in france, involving 912 men, concluded that a low consumption of fish rich in n-3 pufa is associated with a higher probability of developing the metabolic syndrome. thus, high intake of n-6 pufa, along with low intakes of n-3 pufa, shifts the physiological state to one that is proinflammatory and prothrombotic with increases in vasospasm, vasoconstriction, and blood viscosity and the development of diseases associated with these conditions. pufa play an important role in the composition of all cell membranes where they maintain homeostasis for correct membrane protein function and influence membrane fluidity, thus regulating cell signalling processes, cellular functions and gene expression. other functions of pufa require their metabolism to more highly unsaturated members of their family. for example, la is converted to aa (20:4n-6) via -linolenic acid (gla, 18:3n-6) and dihomo--linolenic acid (dgla, 20:3n-6). by the same set of enzymes, ala can be converted to epa (20:5n-3) and dha (22:6n-3). the primary site for pufa metabolism is the liver; however, it can also take place in various other tissues. it is these longer chain metabolites of la and ala that are of major clinical importance within different organs such as the brain, kidney, and liver [1517]. cyclooxygenases (cox) and lipoxygenases (lox) can convert aa to the 2-series of prostaglandins, the 2-series of thromboxanes, and the 4-series of leukotrienes. these are very important, active and short-lived hormones termed eicosanoids which are involved in various pathological processes involving inflammatory conditions such as atherosclerosis, obesity, and ibd. since pufa give rise to a variety of biologically active compounds which all have important roles in pathological and physiological processes, a proper understanding is needed regarding the contribution these active compounds have on the coinciding increases in inflammatory diseases seen with the disruption of the balance in the ratio of n-6: n-3 associated with the western diet. linoleic acid can be metabolized to other more unsaturated, long-chain members of the n-6 family by the insertion of additional double bonds during consecutive elongation and desaturation mechanisms (figure 1). the initial rate limiting desaturation of la to gla is catalysed by the enzyme delta-6-desaturase (fads2). elongation then takes place to convert gla to dgla, by elongation of very long-chain fatty acids (elovl) 5, and finally a cycle of elongation and desaturation by delta-5-desaturase (fads1) generates aa. the importance of the fads2 gene in lc-pufa synthesis has recently been demonstrated in mice [19, 22]. the first study by stoffel et al. demonstrates that loss of the fads2 gene abolishes synthesis of lc-pufa with further downstream effects on the cox and lox pathways, eventually leading to hypogonadism and sterility of male and female mice. further demonstrated by this fads2 null model was the pivotal role pufa-substituted phospholipids play in establishing cell polarity, shown here for tight junctions of sertoli cells of the testis and the gap junction network between ovarian follicle cells. stroud et al. demonstrated impairment of male reproduction and also both dermal and intestinal ulceration in fads2 null mice. elongation of very long-chain fatty acids (elovl) 5 is one of seven mammalian fatty acid condensing enzymes involved in microsomal fatty acid elongation. studies using liver microsomal protein from elovl5 null mice found greater tissue accumulation of gla and a decrease in the levels of downstream metabolism products such as aa for n-6 metabolism and dha for n-3 metabolism. the metabolic consequence of this reduction of aa and dha was the activation (or derepression) of sterol regulatory element-binding protein (srebp)-1c. activation of this transcription factor (as will be discussed in further detail later) in elovl5 null mice resulted in the activation of further genes involved in fatty acid and triglyceride synthesis, which culminated in the development of hepatic steatosis. there are many other factors involved in the regulation of delta-5-desaturase and delta-6-desaturase enzyme activity. for example, decreased activity in both delta-5 and delta-6 desaturases have been demonstrated in the liver of obese nafld patients. low delta-6-desaturase enzyme activity was reported in diabetic rats where insulin acts as a well-known delta-6-desaturase stimulator. since la and ala are metabolized by the same set of enzymes, a natural competition exists between these two fatty acids, whereby delta-5-desaturase and delta-6-desaturase will exhibit affinity to metabolize n-3 over n-6 pufa, provided that they exist in a ratio of 1: 14. however, the higher consumption of la, as now seen in the western diet, shows an increase in the preference of these enzymes to metabolize n-6 pufa, leading to aa synthesis, despite the fact that these enzymes show higher affinity for n-3 pufa. supplementation of the diet with epa and dha has been shown to correct this imbalance by partially replacing aa from the cell membranes of platelets, erythrocytes, neutrophils, monocytes, and hepatocytes where aa is usually found in high proportions. the intermediates of pufa metabolism can either be incorporated into phospholipids or undergo further elongation/desaturation steps. in the n-6 pathway, aa, synthesized from the desaturation of dgla by delta-5-desaturase (fads1), can be further elongated by elovl2 to docosatetraenoic acid (c22:4n-6) or to its respective set of eicosanoids via cox and lox enzymes. the importance of elovl2-derived pufa in mammals has recently been demonstrated in elovl2-ablated mice, thus demonstrating the importance of this elongase enzyme. this study showed the role elovl2 plays in the elongation of c20 and c22 pufa in order to produce c24:4n-6 up to c30:5n-6 pufa in testis, where they are required for normal spermatogenesis and fertility. binding of growth factors and hormones to membrane receptors leads to activation of phospholipase a2 which releases aa from the cell membrane where the free acid can become a substrate for eicosanoid biosynthesis through the activities of cox and lox. the eicosanoids derived from aa are synthesized in larger quantities than ever before due to increases in dietary intake. eicosanoids are biologically active lipids and include prostaglandins (pgs), thromboxanes (txs), leukotrienes (lts), and hydroxyeicosatetraenoic acids (hetes) which have all been implicated in various pathological processes such as inflammation and cancer (table 2). when they are present in high quantities, they influence various metabolic activities besides inflammation such as platelet aggregation, haemorrhage, vasoconstriction, and vasodilation. in general, aa-derived eicosanoids are proinflammatory but they have important homeostatic functions in regulating both the promotion and resolution of inflammation in the immune response. in contrast, it is known that the n-3 pufa and their lc-derivatives mostly promote anti-inflammatory activities. in a recent study involving 250 clinically stable, chronic obstructive pulmonary disease (copd) patients, higher intakes of n-3 pufa were associated with lower proinflammatory cytokine concentrations (e.g., tumour necrosis factor alpha (tnf)) while higher n-6 pufa intake was associated with higher proinflammatory interleukin-6 (il-6) and c-reactive protein (crp) concentrations in the diseased state. while copd is a complex chronic inflammatory condition, it is interesting to see the association between dietary intake of n-6 versus n-3 pufa on serum inflammatory markers associated with the disease. despite ample evidence that increased dietary consumption of n-6 pufa induces a proinflammatory response in the host, it must be reported that recent studies have also shown the opposite [34, 35]. a recent review has suggested that n-6 pufa have some anti-inflammatory actions such as those of the n-3 pufa. for example, mean serum crp concentrations tended to decrease with increased n-6 pufa consumption in both japanese men and women. nevertheless, evidence of these associations is limited. metabolism of aa by the cox enzymes (cox-1, a constitutive enzyme, or cox-2, an inducible enzyme) leads to the synthesis of the 2-series of prostaglandins: pge2, pgi2, pgd2, and pgf2 (largely produced by monocytes and macrophages) and thromboxanes a2 and b2. the synthesis of aa-derived eicosanoids is, however, dependent on the concentration of dgla, as dgla competes with aa for cox and lox. when dgla is in excess, it inhibits the synthesis of aa-derived eicosanoids due to its higher affinity for the cox and lox enzymes. the activity of 5-lox metabolises aa to hydroxyl and hydroperoxy derivatives: 5-hete and 5-hydro-peroxyeicosatetraenoic acid (5-hpete). these derivatives in turn produce the 4-series of leukotrienes: leukotriene a4 (lta4), leukotriene b4 (ltb4), leukotriene c4 (ltc4), leukotriene d4 (ltd4), and leukotriene e4 (lte4). monocytes, macrophages, and neutrophils produce ltb4, while mast cells, eosinophils and basophils produce ltc4, ltd4, and lte4. for example, pgi2 and pge2 exert their acute inflammatory response in arthritis [42, 43]. pge2 can also increase its own synthesis through induction of cox-2 leading to the production of the proinflammatory cytokine il-6 in macrophages [41, 44]. ltb4 has many proinflammatory functions, acting as an important activator of neutrophils, a chemotactic agent for leukocytes, induces release of lysosomal enzymes, accelerates reactive oxygen species (ros) production, and increases vascular permeability. ltb4 also leads to the production of inflammatory cytokines like tnf-, interleukin 1 beta (il-1) and il-6 by macrophages. however, the overall pathophysiological outcome will depend on the cells present, the nature of the stimulus, the timing of eicosanoid generation, the concentrations of different eicosanoids generated, and the sensitivity of target cells and tissues to the eicosanoids generated. in contrast, epa can also act as a substrate for cox and lox enzymes and gives rise to an entirely different set of eicosanoids (table 2). these are the 3-series prostaglandins and thromboxanes and the 5-series leukotrienes, which are considered to be less inflammatory or even anti-inflammatory in comparison to the eicosanoid family derived from aa. the mode by which prostaglandins and leukotrienes exert their biological homeostatic and inflammatory actions depends on binding to their respective g-protein coupled receptors (gpcrs). specific gpcrs have been identified for all the prostanoids, where there are at least nine known prostanoid receptor forms in mouse and man [47, 48]. although most of the prostaglandin gpcrs are localised at the plasma membrane of platelets, vascular smooth muscle cells, and mast cells, some are situated at the nuclear envelope. four of these receptor subtypes bind pge2 (ep1ep4), two bind pgd2 (dp1 and dp2), and more specific receptors bind pgf2, pgi2, and txa2 (fp, ip, and tp, resp.). pge2 and pgi2 are the predominant proinflammatory prostanoids, and, through their activation of ep2 and ip, respectively, they can increase vascular permeability and leukocyte infiltration. in individuals with asthma, thus, during asthmatic attacks in humans, pgd2 is released in large amounts by mast cells. pgd2 can also promote inflammation via dp2 through activation of eosinophils [47, 51]. interacts with btl1 and btl2 through which important roles in host defence of cells and inflammation are mediated. ltb4 induces leukocyte infiltration and as already mentioned above leads to the release of proinflammatory cytokines. as an example, in patients with ibd, the colonic mucosa contains 3- to 7-fold higher counts of cells expressing the 5-lox pathway, thus increasing the tissue synthesis of ltb4. ltc4 and ltd4 can contract smooth muscle by interacting with two subtypes of cysteinyl leukotriene receptors, cyslt1 and cyslt2. a mechanism has been proposed whereby a coordinated program for resolution initiates in the first few hours after the inflammatory response. a switch occurs whereby the aa-derived prostanoids and leukotrienes, which have set the inflammatory response to begin, undergo further metabolism to become another generation of eicosanoids derived from aa termed lipoxins and hence terminate inflammation at the local contained sites. since these lipoxins are involved in the resolution of the acute inflammation that occurs as a result of the overproduction of the proinflammatory eicosanoids derived from aa, they are said to have pro-resolving and anti-inflammatory functions. these events coincide with the biosynthesis of resolvins and protectins from n-3 fatty acids, which act to shorten the period of neutrophil infiltration. however, while the initial response of the aa-derived eicosanoids to promote inflammation is beneficial in one respect, for example, in the control of blood flow and vessel dilation, the increase in the ratio of n-6: n-3 pufa leads to an overall increase in the production of proinflammatory cytokines and an unnecessary over reactive inflammatory response leading to the pathogenesis of inflammatory diseases. in addition, the decrease in consumption of n-3 pufa which leads to an overall decrease in resolvin and protectin production is detrimental to the inflammatory response as these products, which have the ability to dominate the resolution phase of inflammation, can no longer exert this potential; thus, the inflammatory response can not be terminated effectively. nuclear receptors are a family of ligand-activated transcription factors that either directly or indirectly control various genes of lipid metabolism and inflammatory signalling. upon ligand binding, nuclear receptors can undergo conformational changes which dissociate corepressors and facilitate recruitment of coactivator proteins to enable transcription activation [21, 56]. lc-pufa and their eicosanoid derivatives can act as ligands for these transcription factors and hence elicit changes in gene expression by governing the activity of nuclear transcription factors. the regulation of gene expression by dietary fats is believed to be one of the greatest factors impacting on the development of certain diseases of affluence related to the metabolic syndrome, such as hepatic steatosis and nafld. the peroxisome proliferator-activated receptor (ppar) family is composed of three proteins: ppar, ppar/, and ppar, and, although they each have different tissue distributions, their biological functions overlap. the ppars have emerged as important regulators of metabolic and inflammatory signalling, in both metabolic disease and immunity. the role ppar plays in the regulation of genes involved in lipid metabolism was first identified in the early 1990s, on the basis of being a target of the hypolipidaemic fibrate drugs and other compounds that induce peroxisome proliferation in rodents [57, 58]. pufa, especially those of the n-3 family and their eicosanoid derivatives, are ligands for the ppars. the n-3 fatty acids epa and dha have been shown to be more potent as in vivo activators of ppar than the n-6 fatty acids [5962]. once ppars become activated, they form heterodimers with the retinoid x receptor (rxr) and these dimers then bind to ppar responsive elements (ppres) in target genes to alter coactivator/corepressor dynamics and induce transcription. ppar has recently been shown to exert hypolipidaemic effects through activation of skeletal muscle, cardiac and hepatic genes encoding proteins which are involved in lipid oxidation [6365]. thus, the ppars, particularly ppar, play an important role in insulin sensitization, atherosclerosis, and metabolic diseases. in the regulation of inflammatory signalling, nfb, another transcription factor regulated by pufa, is found in almost all animal cell types, has a crucial role in inflammatory signalling pathways, and plays a key role in regulating the immune response to infection. it controls several cytokines (e.g., il-1, il-2, il-6, il-12, and tnf-), chemokines (e.g., il-8, monocyte chemoattractant protein-1), adhesion molecules, and inducible effector enzymes (e.g., inducible nitric oxide synthase and cox-2). nfb becomes activated as a result of a signalling cascade triggered by extracellular inflammatory stimuli (such as free radicals, bacterial or viral antigens), which involves phosphorylation of an inhibitory subunit of nfb (ib), which in turn allows the translocation of the remaining nfb dimer to the nucleus, with the result of an increase in expression of inflammatory genes. since the n-3 lc-pufa show anti-inflammatory action, they inhibit nfb activity. as an example, both epa and dha have been shown to block the activity of nfb through decreased degradation of ib, in human monocytes and human thp-1 monocyte-derived macrophages [67, 68]. however, this effect is not observed to the same extent with n-6 lc-pufa, due to potency in the inhibition of nfb. interestingly, 5-lox, the enzyme which converts aa to the 4-series leukotrienes and 5-hete, translocates into the nucleus in association with nfb [70, 71]. srebp-1c is a transcription factor required for the insulin-mediated induction of hepatic fatty acid and triglyceride synthesis. responsive targets in mammalian cells include genes of fatty acid metabolism, such as fatty acid synthase (fas), and its expression is most commonly found in high levels in macrophages, liver, white adipose tissue, adrenal glands, and the brain of both mice and humans. for example, n-3 lc-pufa have been shown to suppress srebp-1c gene expression and so inhibit transcription of lipogenic and hepatic genes involved in lipid biosynthesis [73, 74]. studies have shown that a decrease in hepatic srebp-1c leads to a decrease in hepatic fas, thus lowering lipid accumulation within the liver [7577]. however, the n-3 pufa are more potent inhibitors of srebp-1c, than the n-6 pufa, and this will be discussed in more detail further on. more recently, the liver x receptors (lxr- and -) have been shown to play a major role in lipogenesis through regulation of transcription of the gene encoding srebp-1c. this study concluded that the downregulation of srebp-1c transcription by n-3 pufa results from attenuated transactivation of the ligand-activated nuclear receptor lxr-. a more recent study in mice fed an n-3 pufa depleted diet showed increased activation of srebp-1c and related pathways which was consistent with increased lxr activity, thus highlighting the importance of n-3 pufa depletion related to lipid accumulation in the liver however, in another study by pawar et al., fish oil fed rats showed a suppression of hepatic srebp-1c target genes, but no change in expression of genes directly regulated by lxr. inhibition of lxr may also be an indirect effect of pufa stimulation of ppar transcription factors. cross-talk between ppar and lxr via srebp-1c has been reported, whereby overexpression of ppar inhibited lxr-induced srebp-1c promoter activity, through a reduction of lxr binding to its activator, rxr. both n-6 and n-3 however, it is well known that n-3 pufa are more potent ligands to these nuclear receptors than n-6 pufa. through n-3 pufa-mediated activation of ppar and inhibition of srebp-1c, lipid biosynthesis can be reduced and lipid degradation can be increased [21, 29]. by targeting the transcription of various nuclear receptors involved in regulating lipogenic gene expression through dietary fatty acids, prevention of certain diseases related to the metabolic syndrome, such as hepatic steatosis and nafld, can be reduced in the future. the contribution n-6 pufa make to the development of liver disease due to the increased consumption of la-rich foods and the decreased consumption of ala rich foods is phenomenal and will be discussed in further detail. already discussed are the positive contributions of n-3 pufa in the prevention of lipid biosynthesis in various organs, such as the liver, for example, through the activation of ppar and inhibition of nfb and srebp-1c. however, since these n-3 pufa are more potent ligands for these nuclear receptors and western diets overall consumption of n-6: n-3 has increased dramatically over the last 50 years in particular, what now becomes the fate of the these nuclear receptors and how have our dietary changes impacted upon our health status through regulation of inflammatory gene expression? more importantly, determination of the molecular and cellular mechanisms regulated by pufa may help identify novel sites for pharmacological intervention. clinical studies indicate that inflammation is at the base of many diseases including nafld, cardiovascular disease, atherosclerosis, ibd, and neurodegenerative diseases such as ad (figure 2). the contribution of n-6 pufa to these inflammatory conditions will be reviewed below with a particular focus on nafld. nafld is often described as the hepatic component of the metabolic syndrome and is rapidly becoming a serious public health problem. the range of liver damage associated with nafld begins with steatosis and can often persist to further steatohepatitis (nash), advanced fibrosis and cirrhosis. occurrence of nafld is much higher in subgroups of the population with obesity, metabolic syndrome, and type 2 diabetes, whereby prevalence in developing the disease for those with type 2 diabetes may be as high as 70% [82, 83]. both nutritional factors and alterations in lipid metabolism of the liver are the primary metabolic abnormalities which lead to hepatic steatosis. the role of n-3 lc-pufa as a potential therapeutic target in the pathogenesis of nafld has recently been demonstrated. within the liver, n-3 lc-pufa presence is associated with an increased ability to direct fatty acids away from triacylglycerol storage and to enhance their oxidation. however, n-3 lc-pufa levels are decreased in the hepatic tissue of patients with nafld [86, 87]. depletion of n-3 lc-pufa within the livers of nafld patients is a major problem as liver fatty acids now become directed away from oxidation and secretion and instead towards triacylglycerol storage. in addition, a higher n-6: n-3 lc-pufa ratio within the liver of nafld patients may contribute to the development of fatty liver due to a derangement in the capacity to regulate liver lipid metabolism. a recent comparative review also demonstrated various mechanisms through which consumption of fish oil has been beneficial in the alleviation of nafld such as (i) decreased plasma nonesterified fatty acids (nefa) concentrations; (ii) decreased de novo lipogenesis, very low-density lipoprotein (vldl) export, and plasma triglyceride concentrations; (iii) decreased adipocyte size and visceral fat content. the mechanisms which lead to the development of fatty liver, such as impaired fatty acid oxidation and increased de novo fatty acid synthesis, are regulated by hepatic gene transcription. n-3 lc-pufa regulate lipid metabolism in the liver by acting as ligand activators of the transcription factor ppar. activation of ppar results in the upregulation of genes which are involved in fatty acid and lipid metabolism and which stimulate fatty acid oxidation [17, 89]. in two separate studies employing murine models of nash, administration of a ppar agonist prevented steatohepatitis and reversed the established disease [90, 91]. vldl is a type of lipoprotein made by the liver from triglycerides, cholesterols, and apolipoproteins. within the bloodstream, vldl transports cholesterol from the liver, thus enabling fats to move within the bloodstream, and it is here that vldl itself also acts as a precursor to low-density lipoprotein (ldl), often referred to as bad cholesterol. ppar activation increases the secretion of apoliopoprotein b-100 (apo b-100), which is the main structural protein of vldl, and upregulates the expression of liver fatty acid binding protein (lfabp) which is essential for the secretion of apo b-100 [92, 93]. since n-3 lc-pufa upregulate ppar, hepatic fatty acid oxidation has the potential to occur within the liver, and, since more apo b-100 is secreted out of the liver, less vldl is synthesized, with the result of less of this harmful cholesterol entering the bloodstream, where the downstream further effects on the development of atherosclerosis are attenuated. however, with the reduced availability of n-3 lc-pufa from dietary intake and the increases in n-6 pufa consumption, ppar does not become activated to its full potential. this results in pufa favouring fatty acid and triglyceride synthesis over fatty acid degradation. as demonstrated by ppar mice, rates in their ability to oxidise fatty acids are decreased during periods of food deprivation; thus, they develop characteristics of adult-onset diabetes including fatty livers, elevated blood triglyceride concentrations, and hyperglycemia. n-3 lc-pufa are also involved in the negative regulation of the transcription factor srebp-1c within the liver, thus acting as inhibitors in the expression of lipogenic genes such as fas. the effect n-3 lc-pufa have on srebp-1c is to reduce endogenous lipid production and accumulation of triglycerides in the liver, and this is achieved by reducing the amount of mature srebp-1c available for de novo lipogenesis within the nucleus. therefore, depletion of n-3 lc-pufa and an increase in the ratio of n-6: n-3 lc-pufa in the liver of nafld patients results in fatty acid and triacylglycerol synthesis over oxidation, again leading to fatty liver. a recent study by pachikian et al. using mice fed a depleted n-3 pufa diet showed increases in hepatic activation of srebp-1c leading to increased lipogenesis, contributing to hepatic steatosis. this is consistent with a previous study in rats fed an n-3 pufa-depleted diet whereby hepatic accumulation of triglycerides and esterified cholesterol led to both macro-and microvesicular steatosis caused by changes in the fatty acid pattern that resulted from n-3 pufa depletion. another mechanism involved in the depletion of n-3 lc-pufa from the liver of obese nafld patients and which further exacerbates the disease progression is the decreased liver fatty acid delta-5 and delta-6 activity in these patients. impairment of these enzymes affects the desaturation and elongation pathways of la and ala, which are required for the synthesis of their lc-pufa derivatives within the liver. decreased activity in both delta-5 and delta-6 desaturases has been demonstrated in the liver of obese nafld patients. this may be attributed to the lower intake of ala (n-3 precursor), the imbalance in the n-6: n-3 lc-pufa ratio which occurs in the liver and higher consumption of trans isomers (18: 1, n-9 trans) inhibiting delta-6 desaturase. the depletion of n-3 lc-pufa within the liver of these patients resulting from the decrease in delta-5 and delta-6 desaturase activity may lead to further development of steatosis by altering the activity of ppar and srebp-1c. this will determine a metabolic imbalance favouring lipogenesis over fatty acid oxidation since n-3 lc-pufa depletion induces srebp-1c expression and upregulation of lipogenic genes. in general, it is also understood that the adipose tissue acts as a suitable biomarker for dietary fatty acid intake. considering that in nafld, there is an enhancement in n-6 adipose tissue content and a significant decrease in n-3 adipose tissue content, this suggests that while there is an adequate amount of n-6 fatty acids for metabolism within the liver, n-3 fatty acids can not be metabolized to the same extent due to inadequate dietary intake. also, decreased dietary intake of n-3 pufa constitutes a limiting factor for the production of n-3 lc-pufa in liver lipids of nafld patients, resulting from the competition between the two metabolic pathways (figure 1), particularly at the desaturation steps thus, a dietary imbalance comprising inadequate intake of n-3 pufa and an excess intake of n-6 pufa leads to defective desaturation of pufa. oxidative stress caused by the accumulation of liver triglycerides and insulin resistance are major contributors in the pathogenesis of nafld. both oxidative stress and mitochondrial dysfunction are often associated with the increased production of ros and proinflammatory cytokines related to nafld. recent human studies have described a strong association between the severity of nash and the degree of oxidative stress [100102]. the increased prooxidant activity associated with oxidative stress leads to elevation in hepatic lipid peroxidation status. lipid peroxidation can also cause immunological dysfunction, which could lead to the development of hepatic fibrogenesis. this could potentially lead to an increase in the release of 4-hydroxy-20-nonenal (hne), which can bind hepatocyte proteins forming new antigens and therefore provoking a harmful immunological response. for example, seki et al. reported a correlation between hepatic expression of hne and the degree of severity of necroinflammation and fibrosis. oxidative stress associated with nafld has also been shown to increase production of proinflammatory cytokines. this hepatotoxicity associated with the production of inflammatory cytokines induced through oxidative stress may indirectly activate transcription factors such as nfb. the accumulation of nefas within hepatocytes of nafld patients is another source of nfb activation. oxidative stress and changes in dietary intake trends may contribute to low hepatic lc-pufa. the increase in lipid peroxidation associated with nafld, as discussed, may contribute to the decrease in lc-pufa, as they are particularly susceptible to lipid peroxidation [105, 106]. thus, oxidative stress-dependent lipid peroxidation may represent an alternative mechanism to liver n-3 lc-pufa depletion in nafld; since pufa are more susceptible to peroxidation and the greater availability of n-6 lc-pufa in the livers of nafld patients results in enhanced peroxidation of these la derived lc-pufa into their eicosanoid derivatives. for example, ltb4, an aa-derived eicosanoid, is involved in acceleration of ros production. the increased production of proinflammatory cytokines and eicosanoids, produced from n-6 pufa metabolism, cause enhanced liver kupffer cell production of inflammatory cytokines causing activation of nfb, further exacerbating systemic and hepatic insulin resistance with worsening inflammation and fibrosis. insulin resistance as seen in nafld may be related to the depletion in n-3 lc-pufa because they are expected to modify membrane-mediated processes such as insulin signalling. in summary, the depletion of n-3 lc-pufa, the decrease in the ratio of product/precursors of lc-pufa, the increase in n-6 pufa, and the increase in n-6 lc-pufa derived eicosanoid production within the liver all contribute to the development of nafld and related pathophysiologies such as insulin resistance. recently, the relationship between the n-6: n-3 pufa ratio within the liver and severity of steatosis was demonstrated. in this study, patients with nafld showed significant correlation between the n-6: n-3 pufa ratio and the quantity of hepatic triglycerides, as a marker of the severity of hepatic steatosis. defective desaturation of pufa due to inadequate intake of n-3 pufa, and a higher intake of n-6 pufa further enhances the contribution of desaturase inhibition in nafld. characterised by low-grade arterial inflammatory lesions that can mature along with disease progression. it is the underlying cause of coronary heart disease (chd), and abnormalities in the metabolism of essential fatty acids that are characteristic of the associated risk factors. under normal physiological conditions, healthy endothelial cells synthesise and release adequate amounts of no, pgi2, and pge1, maintaining a downstream balance between pro- and anti-inflammatory molecules. however, in atherosclerosis, this balance becomes disrupted, leaning towards an increase in the production of proinflammatory cytokines such as il-1, il-2, il-6 and tnf-, resulting in the further progression of the disease. these proinflammatory cytokines can induce oxidative stress by enhancing the production of ros by monocytes, macrophages, and leukocytes. since pufa and their eicosanoid derivatives modulate inflammation, they play a significant role in this disease. decreases in ala-derived lc-pufa such as epa and dha seen in endothelial cell pufa deficiency, increases the production of proinflammatory cytokines and free radicals which results in the development of insulin resistance. as an example, early studies in greenland eskimos, a population consuming a high-fat diet, but rich in n-3 pufa, showed that ingestion of epa and dha led to decreases in the mortality rate from cvd. similarly, japanese populations eat more fish than north americans and present a lower rate of acute myocardial infarction and atherosclerosis [112, 113]. other later studies have further demonstrated strong associations between n-3 pufa intake and decreased risks of cvd [114116]. the role of n-6 pufa in cvd is much more complex than the role of n-3 pufa. studies have shown that txa2 promotes the initiation and progression of atherosclerosis by regulating platelet activation and leukocyte-endothelial cell interactions. ltb4 acts as a potent chemotactic agent, inducing the generation of ros, activating neutrophils, and inducing the aggregation and adhesion of leukocytes to the vascular endothelium. since aa is derived from la, a reduction of la intakes will reduce tissue aa content, which in turn will reduce any inflammatory potential and therefore lower the risk for cvd. endothelial dysfunction (ed) is a characteristic of early-state atherosclerosis common in patients with insulin resistance and diabetes. a recent review by simopoulos reported that diets enriched in la increase the la content of ldl and its susceptibility to oxidation, whereby oxidative modification increases the atherogenicity of ldl cholesterol. studies have also shown that in patients with type 2 diabetes susceptible of developing ed, there are substantial increases in la concentrations in all ldl subfractions. cellular oxidative stress associated with la oxidation of ldl and la mediated ed is a critical signal transduction pathway involved in nfb activation, whereby nfb is critical for the expression of inflammatory genes associated with ed. the susceptibility of ldl to oxidation by la and its associated metabolites is linked to the severity of coronary atherosclerosis development [121, 123]. despite the evidence to suggest that n-6 pufa consumption increases the risk of developing cvd, recent evidence has suggested that both la and ala have the ability to prevent cvd. in this study, la significantly reduced levels of crp, an inflammatory marker, upregulated in cvd in japanese men. however, other evidence to suggest that n-6 pufa have an anti-inflammatory effect when consumed in such high quantities, such as that seen in the western diet, is limited. since it has been proposed that diets high in la reduce ala metabolism and since ala metabolites such as epa/dha have been shown to reduce mortality rates from cvd [111113], the balance of n-6 to n-3 pufa is important in the prevention of atherosclerosis and cvd. ibd is classified as a group of chronic systemically natured diseases of unclear pathology which cause inflammation of the digestive tract, including crohn's disease (cd) and ulcerative colitis (uc). while environmental factors indeed play a significant role in the etiology of the disease, more recent attention has been placed on various dietary and nutritional factors, specifically the lipid components of the diet as triggers of ibd [125, 126]. it is difficult to suggest that dietary influences or supplementation can reduce the incidence of ibd or impact beneficially (through anti-inflammatory effects) upon the disease progression since, like many chronic diseases, ibd is multifactorial. despite this, lower prevalence of ibd has been observed with consumption of diets rich in n-3 lc-pufa derived from fish oils, such as that seen of the greenland eskimos [127, 128]. it has also been reported that patients of ibd who supplement their diets with n-3 pufa show anti-inflammatory actions, with decreased production of ltb4 by neutrophils and colonic mucosa, resulting from incorporation of the n-3 pufa into the gut mucosal tissue [129, 130]. a recent study using il-10 knockout mice (mice that spontaneously develop colitis) demonstrated significantly reduced colonic inflammation when fed n-3 pufa-rich fish oil as compared with mice that were fed n-6 pufa-rich corn oil. in japan, increased reports in the incidence of ibd correlate with the increased dietary intake of n-6 pufa [132, 133]. importantly, while n-3 pufa show decreased production of ltb4 by neutrophils and colonic mucosa [129, 130], metabolism of aa increases the production of ltb4 within the inflamed intestinal mucosa of ibd. a more recent report demonstrated abnormal prevalence of the enzymes that coordinate to generate ltb4 from membrane-derived aa in active ibd biopsies. the recruitment of neutrophils and other leukocytes to the ibd gut mucosa seen with colonic injury may be a direct result of the increased ability to generate ltb4 from aa. it is clear from the literature that n-3 pufa have a positive effect on reducing the risk of ibd [135137]. the situation is less clear for n-6 pufa, although the proinflammatory eicosanoids derived from aa have been shown to play a crucial role in the pathogenesis of all these related inflammatory disorders. as n-3 pufa have been shown to alleviate the progression of ibd, while n-6 pufa have been implicated in the origin of ibd, the importance of a balance in the ratio of n-6: n-3 pufa in today's dietary regime is highlighted. rheumatoid arthritis is a long-term disease that leads to inflammation of the joints and surrounding tissues, causing pain, swelling, and impaired function. it is characterised by infiltration of t-lymphocytes, macrophages, and plasma cells into the synovium, with the initiation of a chronic inflammatory state that involves the overproduction of proinflammatory cytokines. studies have shown that aa-derived eicosanoids, pge2, and pgi2 play a role in the pathogenesis of rheumatoid arthritis [42, 139]. pgi receptor-deficient (ip) mice subjected to collagen-induced arthritis (cia) showed a significant reduction in arthritic scores and reduction in il-1 and il-6 levels in the arthritic paws. inhibition of both pge receptors (ep2 and ep4) suppressed inflammatory events and arthritis in cia. supplementation with n-3 pufa has been demonstrated to modulate the activity of inflammatory factors that cause cartilage destruction during arthritis [138, 140]. moreover, decreasing n-6 pufa intake (especially aa) down to less than 90 mg/day through an anti-inflammatory lactovegetarian (versus normal western) diet was shown to improve the clinical symptoms associated with rheumatoid arthritis. ad is the most common form of dementia in the elderly, clinically characterised by memory dysfunction, loss of lexical access, spatial and temporal disorientation, and impaired judgement. the pathogenesis of ad is extremely complex, with genetic factors, education, and lifestyle all playing crucial roles in disease onset. however, a poor understanding of the pathogenesis of ad means that there are no curative treatments yet available. recently, much interest has been shown in the role of diet in both the pathogenesis and prevention of this disease. the role of n-6 pufa and oxidised eicosanoid derivatives of n-6 pufa have recently been reviewed as contributing to -amyloid deposition, a hallmark of ad onset and progression [142, 143]. aa is distributed in several different cell types in both the grey and white matter in the brain. the role aa plays in oxidative stress and lipid peroxidation has already been discussed in relation to nafld; however, oxidative stress and production of ros has also been suggested to play a role in ad, thus suggesting a role of aa and lipid oxidation products (eicosanoids) in the onset and progression of the disease [144, 145]. furthermore, the enhanced consumption of n-6 pufa leads to an excessive production of the proinflammatory cytokines derived from aa through cox and lox enzymatic activity which lead to brain damage [146, 147]. as an example, a study using transgenic mice with memory impairment and -amyloid deposition, fed a diet poor in n-3 pufa but rich in n-6 pufa, showed that they were found to have a significant decrease in the postsynaptic receptor complex in the brain which regulates memory and learning and a net potentiation of programmed cell death. studies have shown that dha provides support to learning and memory events in animal models of ad and protection against the disease [149151]. another recent epidemiological study indicated a relationship between higher fish consumption and improved cognitive function in later life. both dha and epa have been shown to competitively counteract the production of proinflammatory eicosanoids derived from n-6 pufa in the brain of ad patients. the neuroprotective role of epa has been demonstrated since epa competes with aa for incorporation into cell membrane phospholipids and for oxidation by the cox enzyme, thus exerting anti-inflammatory actions. the resulting production of anti-inflammatory pge3 might result in decreased levels of proinflammatory pge2. the balance between the n-6: n-3 pufa ratio may therefore play a crucial role in the onset of ad. a recent study showed that a lower n-6: n-3 pufa ratio was associated with a lower incidence of dementia, especially in depressed patients. furthermore, we have previously demonstrated in patients with major depression, increases in plasma aa and il-6 associated with inflammation. therefore, a dietary pattern consisting of lower n-6 pufa and higher n-3 pufa or a more balanced n-6: n-3 pufa ratio may be therapeutic in the pathogenesis of ad. increases in the ratio of n-6: n-3 pufa, characteristic of the western diet, could potentiate inflammatory processes and consequently predispose to or exacerbate many inflammatory diseases. the change in ratio and increase in n-6 pufa consumption change the production of important mediators and regulators of inflammation and immune responses towards a proinflammatory profile. chronic conditions such as cvd, diabetes, obesity, rheumatoid arthritis, and ibd are all associated with increased production of pge2, ltb4, txa2, il-1, il-6, and tnf-, whereby the production of these factors increases with increased dietary intake of n-6 pufa and decreased dietary intake of n-3 pufa. in conclusion, the unbalanced dietary consumption of n-6: n-3 pufa is detrimental to human health, and so the impact of dietary supplementation with n-3 pufa upon the alleviation of inflammatory diseases, more specifically, nafld needs to be more thoroughly investigated.

omega-6 (n-6) polyunsaturated fatty acids (pufa) (e.g., arachidonic acid (aa)) and omega-3 (n-3) pufa (e.g., eicosapentaenoic acid (epa)) are precursors to potent lipid mediator signalling molecules, termed eicosanoids, which have important roles in the regulation of inflammation. in general, eicosanoids derived from n-6 pufa are proinflammatory while eicosanoids derived from n-3 pufa are anti-inflammatory. dietary changes over the past few decades in the intake of n-6 and n-3 pufa show striking increases in the (n-6) to (n-3) ratio (~15: 1), which are associated with greater metabolism of the n-6 pufa compared with n-3 pufa. coinciding with this increase in the ratio of (n-6): (n-3) pufa are increases in chronic inflammatory diseases such as nonalcoholic fatty liver disease (nafld), cardiovascular disease, obesity, inflammatory bowel disease (ibd), rheumatoid arthritis, and alzheimer's disease (ad). by increasing the ratio of (n-3): (n-6) pufa in the western diet, reductions may be achieved in the incidence of these chronic inflammatory diseases.

PMC3335257

pubmed-1160

myeloid sarcoma (ms) are solid tumours composed of immature myeloid cells involving an extramedullary site. these tumours are also named chloroma in view of their green coloration due to high myeloperoxydase content. ms occurs mainly in patients with known acute myeloid leukaemia (aml), myeloproliferative disorder or myelodysplastic syndrome [1, 2]. in few cases, ms may be the presenting feature of aml, and the most common sites of involvement are bones, soft tissue, lymph nodes, skin, gastrointestinal tract and body cavities. presentations in the female genital tract (fgt) are uncommon. radioiodine (i) is used in the treatment of thyroid cancer in order to eliminate residual thyroid tissue following total thyroidectomy and to treat metastatic disease [3, 4]. it is known that ionizing radiations, including i, are highly effective in producing chromosomal aberrations that sometimes are linked to the occurrence of secondary leukaemia. aml is an uncommon complication of exposure to i, occurring mostly after a cumulative dose higher than 800 mci [3, 5]. although cases of patients developing leukaemia after low-dose radioactive iodine are reported, the link with the treatment is still a matter of debate. we report a case of acute myeloid leukaemia revealed by a ms of the uterine cervix in a 48-year-old woman, 17 months after receiving a total dose of 100 mci i for papillary thyroid cancer. a 48-year-old woman, gravida 3, para 3, was referred to our unit in april 2007 for a large uterine cervical mass detected during an intrauterine device change. her medical history was marked by a total thyroidectomy for papillary carcinoma performed 17 months before. she received a single dose of 100 mci radioiodine (i) and a suppressive dose of thyroid hormone. six months later she had a negative whole-body i scan. on admission, besides pallor and moderate asthenia, the physical examination revealed a large gray-green-tinged cervical mass extended to both parametriae. her last gynecological examination and pap smear (one year before) were normal, as were the last laboratory examinations. cervical smear performed by the gynecologist revealed the presence of atypical squamous cells of undetermined significance (ascus-bethesda system 2001). imaging confirmed the presence of a homogeneous cervical tumour measuring 6 cm, extending to both parametriae. cervical biopsy showed cervical stroma being infiltrated by sheets of medium sized immature cells, many of which had clear cytoplasm (fig. 1; hematoxylin and eosin stain; original magnification 200). 2; original magnification 200), cd 117 and cd 34 antigens, leading to the diagnosis of ms. laboratory examinations revealed the following values: hemoglobin 5.4 g/dl, hematocrit 16%, white blood cell count 5.1 10/mm with 75% of blast cells and a platelet count of 19 10/mm. a bone marrow biopsy confirmed the diagnosis of acute aml type m2 according to the french-american-british classification scheme. cytogenetic studies on bone marrow cells failed to show any translocation or inversion, but demonstrated a trisomy 3 confirmed by fish. induction treatment was carried out using high-dose cytarabine and daunorubicin according to lam 2006 protocol. as the medullogram showed 66% pathological blasts 15 days after the beginning of the treatment, the patient underwent reinduction therapy using the same drugs. the patient's course was complicated by febrile neutropenia and staphylococcal sepsis which was successfully treated. a post-chemotherapy medullogram done prior to discharge in may 2007 showed a hypocellular marrow with 3% blasts (1% pathological blasts). one month later, a bone marrow biopsy showed the persistence of 11% pathological blasts. a compensation treatment according to the lam 2006 protocol (high doses of amsacrine and aracytine) was performed. they occur mainly in patients with known aml, myeloproliferative disorder or myelodysplastic syndrome. in very few cases ms of the uterine cervix as an initial clinical presentation of acute myeloid leukaemia is uncommon [1, 2]. radioiodine is used in the treatment of thyroid cancer in order to eliminate residual thyroid tissue following total thyroidectomy and to treat metastatic disease [3, 4]. aml is an uncommon complication of exposure to i, which when it occurs, does so mostly after cumulative doses higher than 800 mci [3, 5]. although cases of patients developing leukaemia after low-dose radioactive iodine are reported, the link with the treatment is still a matter of debate. in this report the patient had received a single dose of 100 mci i for the treatment of a thyroid cancer 17 months before the diagnosis. ms occurs most commonly in bone, periosteum, soft tissue, lymph nodes and skin, whereas the fgt is rarely involved [1, 2]. the ovaries and breasts deserve special mention as sites of involvement, but garcia et al only 23 cases of ms of the uterine cervix have been reported before. the majority of patients with ms of the cervix present vaginal or postcoital bleeding. diagnosis is especially difficult when the tumour mass is isolated with no evidence of systemic aml. in these cases, ms are frequently misdiagnosed in biopsies and the most common incorrect diagnosis cited is large cell lymphoma. cytochemical and immunohistochemical studies are extremely helpful for establishing the correct diagnosis in such cases. prognosis of ms of the uterine cervix is poor, ranging from an average survival of 9 months in patients without manifest leukaemia to 3.2 months for patients with manifest aml at presentation. in our case she was asymptomatic and an examination of peripheral blood and bone marrow after the diagnosis of fgt involvement revealed aml m2. the development of aml is a rare but known complication of radioiodine therapy usually occurring after a cumulative dose of more than 800 mci. however, a few cases of aml after a lower dose of i have already been reported. table 1 summarizes a review of published reports of acute myeloid leukaemia in patients treated with i for thyroid disorders. two groups can clearly be distinguished: patients who developed leukaemia 12 to 24 months after the radioiodine therapy, and those whose disease occurred after a period longer than 2 years. cytogenetic analysis of bone marrow showed described chromosomal rearrangement in cases 6 and 7 (trisomy 8 and t(15,17), respectively). in our patient we do not know whether these cases of aml can be considered as a second neoplasia or as a secondary effect of radioactive treatment. nevertheless, ionizing radiation, including i, is known to be highly involved in producing chromosome aberrations that could be linked to the occurrence of secondary leukaemia [8, 9]. it has actually been shown that the frequency of complex abnormalities in karyotypes is higher in radioiodine treatment-related aml than in de novo aml. it is unclear whether treatment with low-dose radioactive iodine contributed to the development of leukaemia in the patients described. the development of aml after low-dose radioiodine could represent a therapy-induced complication. alternatively, we could also hypothesize that the bone marrow of these patients shows individual susceptibilities that put them at greater risk for the potential damaging effect of i therapy. finally, these patients could represent a part of the population that would have developed aml without any i therapy. as the incidence of leukaemia after low-dose radioiodine therapy is unclear, a strict hematological follow-up of patients treated with any dose of i therapy is recommended to accurately detect any hematological complication which might have been underestimated. unusual presentations, such as chloroma of the uterine cervix, may reveal myeloid malignancy and should therefore be kept in mind.

the development of acute myeloid leukaemia after low-dose radioiodine therapy and its presentation as a myeloid sarcoma of the uterine cervix are both rare events. we report a case of acute myeloid leukaemia revealed by a myeloid sarcoma of the uterine cervix in a 48-year-old woman, 17 months after receiving a total dose of 100 mci 131i for papillary thyroid cancer. a strict hematological follow-up of patients treated with any dose of 131i is recommended to accurately detect any hematological complications which might have been underestimated. unusual presentations, such as chloroma of the uterine cervix, may reveal myeloid malignancy and should be kept in mind.

PMC2918821

pubmed-1161

ras is a disorder characterized by recurring ulcers confined to the oral mucosa in patients with no other signs of disease but many investigators believe that immunologic disorders, hematologic deficiencies and allergic or psychological abnormalities may play a role. ras are classified as minor (< 1 cm in size) ulcers healing faster without scars and major (> 1 cm in size) which take longer time to heal and often scar. the third type is herpetiform ulcers which manifests as recurrent crops of dozens of small ulcers throughout the oral mucosa. ras minor composes from 70% to 87% of all forms of ras and a recent study places its frequency rate at 17.7% in the general population. ras is characterized by multiple, recurrent, small, round, or ovoid ulcers with circumscribed margins, erythematous haloes and yellow or grey floors, it usually presents first in childhood or adolescence and then can occur later in adult life. apthous ulcers, which usually occur on the non-keratinized oral mucosa, can cause considerable pain and may interfere with eating, speaking and swallowing. investigators drew an analogy between ulcers developing at sites of trauma and the positive pathergy reaction in bechet's disease. other associated factors include systemic diseases and nutritional deficiencies, food allergies, genetic predisposition, immune disorders, the use of certain medications and human immunodeficiency virus infection. about 50% of first-degree relatives of patients with recurrent apthous stomatitis also have the condition suggesting genetics as one of the associated factors in its etiology. the clinician should routinely perform a blood test to rule out iron, vitamin b12 or folate deficiency as well as a complete blood count. elimination diets or dietary supplementation if a hematinic deficiency is involved may resolve symptoms completely. ras and recurrent intraoral herpes are the two most commonly encountered recurring oral lesions in the dental office. because the general frequency and clinical similarity of these conditions often make it difficult to distinguish one from the other, therapeutic intervention may be inappropriate since the former is an autoimmune phenomenon and the latter is a viral infection. aphthous ulcers are one of the most common oral diseases world-wide but oral lesions similar to aphthous ulcers may be present in several systemic diseases. there are several diseases that should be included in the differential diagnosis of a patient who presents with a history of recurring ulcers of the mouth such as behet's syndrome, recurrent herpes simplex virus infection, recurrent erythema multiforme and cyclic neutropenia so a thorough history and clinical evaluation of the patient is must. diagnosis is on clinical grounds alone and must be differentiated from other causes of recurrent ulceration, particularly behet disease-a systemic disorder in which aphthous-like ulcers are associated with genital ulceration and eye disease (particularly posterior uveitis). levamisole is a levisomer of tetramisole (( -)-2,3,5,6-tetrahydro-6-phenylimidazole [2,1-6] thiazole monohydrochloride) and has been used as a broad spectrum anti-helminthic drug since 1966. this drug commonly used by gastroenterologists, having a wide range of immunomodulatory actions, has been used successfully as monotherapy and an adjunct to treatment in a variety of diseases. it has been successfully used in the treatment of parasitic, viral and bacterial infections including inflammatory skin diseases. it has also been used in combination with other drugs for treating a number of dermatologic disorders, e.g. in combination with cimetidine for treating recalcitrant warts, with prednisolone for treating lichen planus, erythema multiforme and aphthous ulcers of the oral cavity. levamisole has been tried in multiple chronic oral ulcerative lesions such as mucous membrane pemphegoid, oral lichen planus (olp) and pemphigus vulgaris with varied results. in one study conducted by lu et al., all patients were given 150 mg/day of levamisole and 15 mg/day of prednisolone for 3 consecutive days each week, along with topically applied dexamethasone orobase. the addition of levamisole to prednisolone produced improved results in the management of above stated mucocutaneous disorders. in yet another study, it has also been concluded that for erosive olp patients, the combination therapy is superior to the single therapy of levamisole or of chinese medicinal herbs as studied by serum levels of squamous cell carcinoma associated antigen determined by a microparticle enzyme immunoassay. adverse affects of levamisole are mild and infrequent and include rash, nausea, abdominal cramps, taste alteration, alopecia, arthralgia and a flu-like syndrome and rarely cause agranulocytosis. agranulocytosis is commonly seen in those patients with human leukocyte antigen-b27 positivity and in those patients who have undergone long-term levamisole therapy. it is more widespread in south asia (53%) than in other regions of the world. it was concluded in one study that routine administration of intestinal anthelmintic agents results in a marginal increase in hemoglobin (1.71 g/l), which could translate on a public health scale into a small (5-10%) reduction in the prevalence of anemia in populations with a relatively high prevalence of intestinal helminthiasis. since ras is commonly associated with hematinic deficiencies, this drug can be used as an adjunct for its management. a study published in 1978, renoux et al. have reported that levamisole increased cellular immunity and has been approved for many autoimmune and inflammatory diseases. histologically, ras are mucosal ulcerations with a mixed inflammatory infiltrate and large granular lymphocytes predominating in the preulcerative and healing phases and okt8 cells predominating in the ulcerative phase. increased adherence of neutrophils may help perpetuate the ulceration and release of tumor necrosis factor (tnf) has also been reported. as recurrent aphthous ulcerations (rau) are common oral inflammatory lesions, tnf-alpha plays an important inflammatory mediator and a critical cytokine for adequate host defense. a study by sun concluded that a significantly higher than normal serum level of tnf-alpha (normal 3.8 pg/ml) can be detected in 20-39% of patients in the ulcerative stage of major, minor or herpetiform ulcerations. the serum tnf-alpha level may be associated with the severity and the stage of ras. it has been concluded that levamisole can modulate serum tnf-alpha levels in ras patients. interleukin-6 (il-6) is a pro-inflammatory cytokine that has effects on cellular and humoral immunities and levamisole and levamisole plus chinese medicinal herbs can modulate the serum il-6 level in ras patients. the therapeutic effect of ras can be monitored by a reduction of serum il-6 level in rau patients. it was also suggested that the combination therapy is superior to the single therapy of levamisole only. in a study conducted to evaluate the effect of levamisole on the immune system of patients with ras or olp, it was found a significant improvement in clinical symptoms and normalization of the decreased cd4/cd8 ratio in rau patients after levamisole treatment. moreover, the decreased cd4/cd8 ratio, which persisted until the remission stage in the untreated ras patients, reverted to normal in the active late stage in the levamisole-treated patients. this reversion of aberrant cellular immunity in an earlier stage of the ulcer cycle may explain why ras patients experience symptom improvement after antihelminthic drug therapy.. topical medications such as antimicrobial mouth-washes and topical corticosteroids (dexamethasone) can achieve the primary goal to reduce pain and to improve healing time but do not improve recurrence or remission rates. in severe conditions of major apthous stomatitis cases of major ulcers that are characterized by pain and dysphagia and that are recurrent usually require systemic therapy. several systemic drugs have been used to treat major ulcers including systemic corticosteroids, dapsone, colchicine, thalidomide, pentoxifylline, low-dose interferon- and levamisole. the therapeutic choice of drug depends on the severity of the disease, the number of ulcers, their location and duration and the level of associated orofacial pain. however, despite detailed clinical, immunologic, hematologic and microbiologic investigation, the etiology of ras remains unknown. at present, topical steroids and antimicrobial mouth rinses are the mainstays of treatment, but there is still no means of preventing recurrence of the oral ulceration. though the primary goals of therapy for ras are relief of pain, reduction of ulcer duration and restoration of normal oral function, secondary goals include reduction in the frequency and severity of recurrences and maintenance of remission with levamisole showing variable efficacy. thus, ras can be effectively managed with a variety of topical and systemic medications. levamisole hydrochloride may reduce healing time and reduce the number of ulcers, but an older study found only subjective improvement. this drug has proven to increase hemoglobin concentration of the patient along with regulating immune system of the ras patients. prolonged use of this drug should be avoided due to its adverse side-effects especially agranulocytosis. recurrent apthous stomatitis is a multifactorial condition and it is likely that immune-mediated destruction of the epithelium is the final common pathway in rau's pathogenesis. levamisole hydrochloride may reduce healing time and reduce the number of ulcers with its immune regulation and improve hematologic picture and thus can be considered as one of drugs for the treatment modality of recurrent apthous stomatitis.

recurrent aphthous stomatitis (ras) is a common mucosal condition producing painful ulcerations in the oral cavity and considerable clinical morbidity. the etiology remains obscure, though local trauma, psychologic stress, hematinic deficiencies and immune dysregulation have been implicated. though the primary goals of therapy are symptomatic relief of pain, the clinicians are aiming toward reducing the frequency, duration, number of ulcerations and increasing ulcer free periods with systemic drug therapy if topical medications appear ineffective. levamisole, an antihelminthic drug has been tried with promising results in patients with severe ras providing long-term benefits.

PMC3983748

pubmed-1162

brown sequard syndrome resulting from compression due to an epidural hematoma is a relatively rare occurrence, more so with a spontaneous history. she underwent an open door laminoplasty for evacuation of the hematoma. following surgery the patient responded rapidly and currently at 18 months in the emergency room when a patient is clinically diagnosed as a case of brown sequard syndrome it is important to ask for an mri scan of the cervical spine. hematoma in the cervical epidural space should be considered in the differential diagnosis of brown sequard syndrome especially in the elderly with history of doubtful trivial trauma. brown sequard syndrome is an incomplete spinal cord lesion characterized by a clinical presentation reflecting hemi-section of the spinal cord. this is referred to as ipsilateral hemiplegia and contralateral pain and temperature sensation deficits (anaesthesia). the most common cause is penetrating trauma such as a gunshot wound or stab wound to the spinal cord, however spinal tumours and blunt trauma to the spine have also been implicated as potential causes. hematoma is also a cause of brown sequard syndrome but is very rare and usually occurs with predisposing risk factors for bleeding (anticoagulant therapy, hypertension). brown sequard syndrome as a result of cervical epidural hematoma is a rare entity with only a handful of cases reported in literature. we describe a case of brown sequard syndrome in a 65 year old female without any underlying risk factors, presenting with sudden onset hemiparesis rapidly progressing to hemiplegia (within a span of days) due to a cervical epidural hematoma following a doubtful history of trivial trauma. a previously healthy 65 year old female presented to us with the complaint of right side hemiplegia without any significant history of trauma. on subsequent inquiry she gave a history of brisk involuntary hyperextension of the neck following which she developed sudden onset hemiparesis, progressed to hemiplegia within a span of five days. she did not have a history of any congenital or acquired disorder of coagulation. on elaborate neurological survey it was found that motor power of the patient s right side upper and lower limb was of grade 0/5 with anesthesia of left side below c3. she was evaluated with a cervicodorsal mri scan, which showed a hyper intense space occupying lesion suggesting an epidural hematoma at the c3-c4 level (fig.1). the patient was taken up for emergency surgery. with the patient in prone position under general anaesthesia, a posterior midline incision was taken exposing the tips of the spinous processes from c3 to c5 levels. two bony gutters were drilled bilaterally at the border of the exposed laminae by means of an air drill. in our case, the left side border of the laminae was excised from its cranial to caudal end with a kerison rongeur and the spinous processes and the laminae were pushed laterally as if to open a door, thereby exposing the spinal canal (hirabayashi s open door laminoplasty). a. t2 weighted transverse section of the cervical cord showing an area of heterogeneous hyper intensity compressing the cord. b. t1 weighted transverse section of the spine showing an isointense lesion compressing the cord. c. t2 weighted sagittal cut of the cervical spinal cord showing heterogeneous hyper intense signal of the hematoma. postoperatively the patient was immobilized with a hard cervical collar and physiotherapy (passive mobilization) was started. four months following the surgery the patient regained her motor strength to grade 3/5 with partial return of sensory functions. at twelve months follow up motor power of the affected side improved to grade 5/5 with regaining of normal sensory functions on opposite about 40% of the cases reported in the literature till date do not have any demonstrable etiology and are therefore referred to as idiopathic spontaneous cervical epidural hematoma. these need to be differentiated from other well known causes such as neoplasm and systemic diseases, anticoagulant therapy, hypertension or vascular malformations and pregnancy for planning of the management and to predict prognosis. there is controversy regarding the source of the hematoma; is it arterial or venous? the proponents of the venous origin theory maintain that the sudden increase in intra-thoracic and intra-abdominal pressure leads to the rupture of the thin walled epidural veins. thus during activities like coughing, sneezing, straining during defecation and micturition, vomiting and coitus these thin walled epidural veins may rupture and lead to the generation of the hematoma. however several authors have pointed out that since the epidural venous pressure is less than the intrathecal pressure, thus these ruptured veins are an unlikely source to produce a hematoma large enough to cause compression of the thecal sac and develope brown sequard syndrome. after study of the arterial structures of the cervical epidural region it has been hypothesized that extreme movements at the cervicodorsal junction could result in tearing of the arteries. the high arterial pressure can lead to development of hematoma large enough to cause compression of the dural sac leading to the clinical syndrome of cord compression. the most common presentation of spontaneous cervical epidural hematoma is acute onset of neck pain, which is usually radiating in nature and the localization depends on the involvement of specific nerve roots. the second most common symptom is weakness of the limbs below the level of compression. the weakness gradually increases over days but complete loss of motor power has not been reported and this deficit rarely recovers spontaneously. mri is the diagnostic tool of choice in spontaneous cervical epidural hematoma. on t2 weighted images the hematoma appears as an area of heterogeneous hyper- intensity of the cord with focal hypo-intense areas. on t1 weighted images the lesion is usually iso-intense in the acute phase; however chronic hematomas may be hyper- intense. the treatment of choice in spontaneous cervical epidural hematoma is emergency surgical decompression although a few cases have been reported in literature to have recovered without any surgical intervention. the procedure of choice is a laminectomy, although a hemi-laminectomy or laminoplasty could be performed depending on the extent and localization of the hematoma. ispontaneous cervical epidural hematoma leading to a brown sequard syndrome is a rare entity in clinical practice and it has a fatal progressive course in cases where the diagnosis is delayed. spontaneous cervical epidural hematoma may present as hemiparesis prompting the emergency room physician to make an erroneous diagnosis of cerebrovascular accident, leading to delay in the diagnosis. prompt diagnosis of the condition and urgent decompression is vital to prevent irreversible damage of the cord. a thorough clinical examination is a must followed by a mri scan of the cervical spine to exclude this rare entity. although there have been rare reports of spontaneous recovery, surgical decompression is the preferred modality of treatment. in cases presenting as hemiparesis, sensory examination of opposite side an mri can delineate the cause and surgical decompression is warrented in cases of spontaneous epidural hematoma that causes neurodeficit.

introduction: brown sequard syndrome resulting from compression due to an epidural hematoma is a relatively rare occurrence, more so with a spontaneous history. we report one such case. case report: we present a 65yr old female presenting with hemiplegia with contralateral anesthesia. magnetic resonance imaging showed a hematoma in the epidural space in the c3-c4 region. she underwent an open door laminoplasty for evacuation of the hematoma. following surgery the patient responded rapidly and currently at 18 months follow up she is neurologically grade 5/5 with normal sensations. conclusions:in the emergency room when a patient is clinically diagnosed as a case of brown sequard syndrome it is important to ask for an mri scan of the cervical spine. hematoma in the cervical epidural space should be considered in the differential diagnosis of brown sequard syndrome especially in the elderly with history of doubtful trivial trauma.

PMC4722547

pubmed-1163

a confirmed case was defined as invasive disease caused by n. meningitidis of serogroup w135 2a p1.2,5 or belonging to the et-37 complex. a probable case was defined as illness in a pilgrim or a pilgrim contact, with either invasive disease due to n. meningitidis serogroup w135 of unknown serotype (identified by polymerase chain reaction [pcr] or detection of specific antigens) or with a clinical diagnosis of invasive meningococcal infection without microbiologic confirmation. cases included were those with dates of hospital admission from march 18, 2000, until july 31, 2000. nonpilgrim case-patients were classified as 1) living in the same household as a pilgrim during the 7 days before the date of onset, 2) being in contact with a pilgrim but not living in the same household during the 7 days before the date of onset, or 3) having no identified contact with a pilgrim. a questionnaire was sent by e-mail in april 2000 to the national surveillance centers in europe, and interviews of cases were conducted by telephone or in person. for each case, information was anonymously requested on demography, ethnicity, clinical symptoms, medical history, housing situation, meningococcal vaccination history, contact with hajj 2000 pilgrims, and travel to saudi arabia. additionally, the number of visas delivered for the hajj 2000 was obtained from saudi embassies, and information was collected in france on the observance of the specific prophylactic measures for pilgrims and their household contacts. as cases occurred predominantly in france and the uk, only these two countries were considered in further analysis. the case-fatality rate (cfr) observed in cases from france was compared with the cfr of all n. meningitidis infections reported to the national surveillance system in france during 19951999. the same comparison was performed for the uk. the probability of dying from the outbreak strain was estimated for france and the uk by using a logistic regression model. in addition to the outcome (death), variables included in the model were age and having an epidemic case versus a national surveillance case. consecutively, the age-adjusted relative risks (rr) of dying from the epidemic were estimated from the odd ratios by the log link function. to evaluate the impact of the french control measures implemented on april 8, we compared the number of cases in france with those in the uk before and after april 8 for a) pilgrim and household contacts, and b) out-of-household contacts and those for whom no contact with a pilgrim was identified. the ratio of cases in france after and before the intervention was compared with the same ratio in the uk. an effective intervention would be expected to result in a measure of impact less than one, and vice versa. the descriptive analysis was carried out with epi info (centers for disease control and prevention, version 6.04c). the logistic regression was performed with stata version 6.0 (stata corporation, college station, tx). data on cases reported during 19951999 were issued from the public health laboratory service in the uk and from the institut de veille sanitaire in france. from march 18 to july 31, 2000, some 90 cases of serogroup w135 meningococcal disease were ascertained from nine european countries (the uk, france, the netherlands, germany, finland, sweden, belgium, switzerland, and norway) (figure 1). questionnaires were fully completed for 80 cases (89%), and partly completed for 10 cases. eighty-four isolates (93%) were confirmed as n. meningitidis serogroup w135 serotype 2a subtype p1.2,5. six probable cases were diagnosed by soluble antigen detection (one case) or pcr (five cases). cases of w135 meningococcal disease reported per country in europe after hajj 2000, march 18july 30, 2000. the peak of the outbreak was rapidly reached in week 14, two weeks after the first return of pilgrims from mecca. since that time of 90 cases, 45 (50%) occurred during the first 4 weeks after the first return of pilgrims. in the uk, the first reported cases occurred within 1 week after the hajj and increased rapidly to a peak of 12 cases in week 14 (figure 2b). in france, the outbreak started and peaked in week 13 (figure 2c). for the other countries, cases occurred sporadically during the 4 months after the hajj. cases of w135 invasive meningococcal disease by week of hospital admission, march 1july 2000: a. europe (90 cases), b. the united kingdom (42 cases), and c. france (24 cases). twelve cases (13%) were in pilgrims (all vaccinated with vaccine against meningitis a and c before traveling to mecca), 31 (34%) in household contacts of a pilgrim, and 21 (23%) in contacts outside the household; for 26 cases (29%), no pilgrim contact was identified. a total of 19,749 pilgrims from the uk and 19,100 from france participated in the hajj 2000. eight cases of meningococcal disease occurred in the uk and four in france, giving incidence rates in the pilgrim population of 41 and 21/100,000, respectively. no cases occurred in pilgrims from other countries, although germany had 18,000 pilgrims and the netherlands had 4,500 pilgrims. for finland, sweden, belgium, switzerland, and norway, pilgrims were affected first (all cases in pilgrims were reported in the 4 weeks after the hajj): the peak of cases occurred in week 13, household contacts cases peaked in week 14, out-of-household contact cases peaked in week 16, and cases with unknown or no identified contact with a pilgrim peaked in week 19 (figure 3). cases of w135 invasive meningococcal disease, by week of hospital admission and type of contact, europe, march forty-seven (54%) of the 87 patients whose sex was known were female. fifty-one (65%) of the 78 nonpilgrim patients were<5 years of age. the median age of the pilgrim patients was 51 years; for nonpilgrims, it was 2 years. information on clinical features was available for 69 cases, including meningitis (30 cases), septicemia (23 cases), or both (16 cases). arthritis (six cases), osteomyelitis (one), and pneumonia (one) were also reported from patients with septicemia. thirteen patients had underlying long-term diseases, but none had preexisting immunodeficiency. in the uk, 75% of patients were of indian ethnicity; in france, the majority (74%) were north african. fourteen patients died (cfr 15.6%, 14/90) (table 1). in france, 4 (16.7%) of 24 case-patients died, compared with 152 (10.3%) of 1,481) observed for meningococcal disease due to all serogroups of n. meningitidis in france from 1995 to 1999. the age-adjusted rr of dying during the outbreak was 1.26, (95% ci [0.52; 3.06], p=0.63). in the uk, 8 (19.0%) of 42 patients died, compared with 862 (8.3%) of 10,448 observed for meningococcal disease due to all serogroups of n. meningitidis in the uk during19951999. the age-adjusted rr was 1.99 (confidence interval 1.02; 2.74, p=0.06). there was no evidence that the rr in france differed from the rr in the uk (p=0.55). the netherlands, germany, finland, sweden, belgium, norway, and switzerland. the median length of stay in saudi arabia for pilgrim case-patients was 21 days (range 1440). the median interval between the beginning of the hajj and the date of onset of disease was 16 days (range 1129); the median interval between return from the pilgrimage and the onset of disease was 2 days (range 08). among cases with pilgrim contact, the median interval between return of the pilgrim from mecca and onset of disease was 8 days for household contacts and 6.5 days for out-of-household contacts (p=0.58). further characteristics of pilgrim cases and cases by type of contact with a pilgrim are shown in table 2. regarding the assessment of the french recommendations, the comparison between france and the uk of the ratio of cases after and before interventions were put in place was 2.43 for pilgrims and their household contacts. this result of>1 yields no evidence that the french measures had a positive impact in preventing cases in pilgrims and their household contacts (p=0.27) (table 3). the ratio among out-of-household and no known contacts was 0.56, indicating a possible positive impact of the measures in limiting the spread of the outbreak strain, although the result was not statistically significant (p=0.62). ratio is divided by the same ratio in the united kingdom and its 95% confidence interval. an international coordination group was set up within 2 weeks after the outbreak was recognized in europe, followed by an early warning alert to all the european countries. this facilitated information sharing, standardization of the case definition, and implementation of a standardized questionnaire for the investigation. the willingness of participant countries led to a satisfactory completion rate for reports, allowing a precise description of the outbreak throughout europe. however, case ascertainment may have varied in different countries since some countries identified cases through microbiologic findings only and some through clinical as well as microbiologic findings. in 1987, an outbreak of meningococcal disease linked to the hajj was described in several european countries, but the description was limited to pilgrim cases and a few secondary cases (13). in the hajj 2000 outbreak, the added value of molecular biological investigation, together with the epidemiologic investigation, allowed us to describe a w135 clonal outbreak and the diffusion of this strain from pilgrims to the general population (5). in sweden, n. meningitidis w135 of the same serotype and subtype has been documented since 1979, but pulsed-field gel electrophoresis and the sulfadiazine resistance of the w135 isolates indicate that the outbreak was probably due to a new strain of w135 meningococci (8). after its description in 1968 and during the 1970s, n. meningitidis w135 was considered a minor serogroup, of little clinical importance (9). only in the early 1980s was this organism described as a fully pathogenic strain, as an important new cause of disease in europe and the united states and as an emerging cause of meningococcal disease in africa (10,11). during the 1990s, n. meningitidis w135 represented 2.6% to 4% of all reported n. meningitidis in the uk, france, and the united states (1214). the first two cases of meningococcal disease in pilgrims due to w135 associated with the hajj were described in 1993 in saudi arabia in an indonesian and an american pilgrim (15). from 1998 to march 2000, fewer than two cases of the w135 2a: p1-5,2 strain were reported yearly in england and wales (kaczmarski eb, pers. comm.) and two cases per year in france (taha mk, pers. comm.). the outbreak strain belonged to the et-37 complex, which is mainly composed of serogroup c (16). it causes disease in clusters and has a higher transmissibility than other strains (5,17,18). although the cfrs in cases from france and the uk were high, the age-adjusted rrs of dying during the outbreak were not significantly higher than those observed in the routine surveillance of meningococcal disease due to all serogroup of n. meningitidis in these two countries. thus, the outbreak strain appears to be of similar virulence to n. meningitidis serogroups that normally cause meningococcal disease in the uk and france. cfrs have been shown to be linked with age and to increase among very young and older people (19). the initially large number of cases in older people at the beginning of the outbreak might explain this finding. methods used to evaluate the impact of the specific control measures implemented in france intended to take into account differences in meningococcal disease incidence rates between the two countries and potential differences in pilgrims initial carriage of the outbreak strain at their return from mecca. since the number of cases in each group (pilgrims, household, out of household, and no identified contact with a pilgrim) was low, the power of the test did not allow identification of the difference of impact between them. defining other groups could not have allowed conclusions to be drawn, since the number would have also been low. information collected from the only manufacturer of rifampicin in france indicated that the total number of doses distributed to pharmacies represented only half the doses needed to treat the target group (approximately 100,000 persons living in pilgrims households), indicating that compliance with the recommendations was low. in addition, all those who were provided treatment may not have taken it effectively, although compliance would not be expected to be a major problem with only 2 days of medication. as of the end of march 2001 in france, no cases were reported in persons who had taken rifampicin and no strain of n. meningitidis w135 resistant to rifampicin had been isolated at the nrc. for the prevention of cases among pilgrims and household contacts, the<1 ratio between france and the uk indicated that the measure had no impact in preventing cases in pilgrims and pilgrims household in france. this might be due to the delay of 2 weeks between the first return of pilgrims and the release of the measure, an interval during which transmission of the pathogenic strain occurred inside the pilgrims households. the absence of significant impact of the measure to limit the diffusion of the pathogenic strain to the out-of-household contacts and persons with no contacts identified may be explained either by the very small number of cases considered or by potential misclassification. cases in the general population may also have been underestimated in comparison with the likely high case ascertainment in pilgrims. however, such underestimates are unlikely since virtually all invasive strains of n. meningitidis are sent to the reference laboratory in france and the uk. however, data for cases of w135, 2a p1.2,5 obtained from national reference laboratories in france and the uk for september 2000february 2001 indicated that 13 cases were reported in the uk and 9 in france, suggesting that there was no long-lasting effect of the measure and that immunity to the strain was probably increasing in the population (20). in the uk, carriage studies showed that this strain was still circulating within the muslim community (stuart jm, pers. the results of the measures implemented in france do not allow us to draw conclusions for use of mass prophylaxis in the future, mainly because of the small number of cases in our study. following this outbreak, france and the uk, among other countries, recommended quadrivalent vaccine for travelers to the hajj 2001 (21,22; pers. subsequent quadrivalent vaccine coverage was estimated to be 47% and 65% in the uk and in france, respectively. another outbreak of meningococcal disease caused by n. meningitidis w135 2a p1.2,5 occurred in hajj pilgrims and their contacts in 2001; most cases were from saudi arabia and the uk. during the period march 28june 29, 2001, 10 cases of meningococcal disease due to w135 2a p1.2,5 were reported to the nrc in france (0 deaths) and 25 in the uk (8 deaths) (2325). since may 2001, quadrivalent vaccine is now a requirement for all pilgrims to future hajj pilgrimages (26).

the 2000 hajj (march 1518) was followed by an outbreak of neisseria meningitidis w135 2a: p1.2,5 in europe. from march 18 to july 31, 2000, some 90 cases of meningococcal infection were reported from nine countries, mostly the united kingdom (uk) and france; 14 cases were fatal. although most early cases were in pilgrims, the outbreak spread to their contacts and then to those with no known pilgrim contact. in france and the uk, the outbreak case-fatality rate was compared with the rate reported from national surveillance. the risk of dying during this outbreak was higher in france and the uk, although the difference was not statistically significant. prophylaxis for all pilgrims and their household contacts was offered in france; in the uk and other european countries, prophylaxis was recommended only for close contacts. no difference in transmission rates following intervention was detected between france and the uk.

PMC2732506

pubmed-1164

the data presented are based on the retrieval of relevant medical literature by searching pubmed with the terms deferasirox (dfx) and non-transfusion-dependent thalassemia (ntdt) for studies published between 2000 and 2015. the cochrane database for systematic reviews and clinical trial registries was also searched, and pertinent reviews were identified (searches last updated august 1, 2015). thalassemia is a complex entity related to a group of inherited diseases, caused by defective or absent hemoglobin chain synthesis leading to anemia. in general, the severity of the disease depends on the genotype inherited without a definite genotype phenotype correlation due to the presence of several genetic, along with environmental factors, which can alter clinical expression jointly to secondary and tertiary genetic modifiers.1 however, patients with ntdt do not require regular rbc transfusions for survival, but may require occasional transfusions owing to infection or pregnancy or may require more regular transfusions later in life due to splenomegaly or other complications.2 therefore, ntdt encompasses a great variety of syndromes mixed in terms of their molecular background, clinical course, and severity, with the sole common characteristic of independence from regular transfusions.3 currently, beta-thalassemia intermedia, alpha-thalassemia (mainly hbh disease), and mild/moderate forms of hbe/beta-thalassemia are the most prevalent forms in the world.4 despite the lack of a stable transfusional iron overload, the majority of patients with ntdt accumulate iron. ineffective and expanded erythropoiesis are both responsible for the activation of known and unknown signals of epcidin suppression and of a consequent increased intestinal absorption of iron.5 thus, patients with ntdt progressively increase their iron stores which may become clinically significant in the second decade of life and is responsible, along with chronic anemia and hemolysis, for most complications observed in older untreated patients.6 however, it is conceivable that, particularly in the more severe forms, some complications could be ascribed to transfusion therapy (either intermittent or regular) as observed for the increased risk of endocrinopathy.7 patients with ntdt accumulate iron chiefly in the liver and scantly in the heart, which may explain the tendency to not develop myocardial siderosis as compared to patients with thalassemia major (tm).8,9 however, the liver iron overload shown in patients with ntdt has been found to be similar to that of patients with beta tm.10 the elevated iron burden, despite occurring with differences in iron metabolism, pathophysiology and loading rate, is directly involved in the development of several complications or may add in some way to their severity.11 in fact, evaluating a series of unchelated patients by r2 and r2*magnetic resonance imaging (mri), a liver iron concentration (lic) of 5 or more mg/g dry weight (dw) was found to be the cut-off able to accurately discriminate between patients with and without morbidities.12 recently, patients with ntdt were also found to have an increased risk of hepatocellular carcinoma and those affected showed a lic of 8.5 mg/g dw (median: 8.5; interquartile range: 4.517.8).13 obviously, chelation practice has been routinely performed in the management of iron overload in patients with ntdt, as their anemia contraindicates phlebotomy, but for a long time only as good clinical practice and without both the use of guidelines and the evidence of clinical benefit as observed in their tm counterparts. the optimal care study was the first retrospective study highlighting a protective effect of iron chelation therapy against several complications of ntdt such as pulmonary hypertension and endocrinopathies and thus reinforced the indication to accurately chelate this category of patients.7 on the other hand, it was demonstrated that an increase in serum ferritin level over time was associated with worsening of hepatic fibrosis in patients with ntdt who are not receiving iron chelation treatment.14 the evidence of these studies suggested to scrupulously estimate iron loading particularly at liver level to control and prevent such iron burden with effective iron chelation therapy. guidelines on ntdt chelation treatment have been recently established and recommend initiation of chelation therapy in patients with either ferritin levels higher than 800 ng/l or lic above 5 mg/g dw.15 however, measurement of ferritin may underestimate the level of iron and sometimes among the main ntdt subtypes an irregular correlation exists between ferritin level and lic, as measured by r2 mri or superconducting quantum imaging device.16,17 therefore, a decision-making algorithm has also been created to aid monitoring of iron burden and initiation of chelation therapy.18 until 2005, the two drugs were available to treat iron overload in a variety of hematologic disorders: deferox-amine (dfo), administered mainly using continuous slow subcutaneous infusion, and the oral iron chelator deferiprone (dfp).19,20 the dfo, a hexadentate chelator binding iron at a 1:1 molar ratio, was introduced in clinical practice over 40 years ago to decrease iron overload.21 however, the need for frequent and prolonged subcutaneous administration has been associated with undesirable adverse effects and noncompliance to treatment resulting in elevated risk of iron-induced complications.22,23 the oral three times a day agent dfp, a bidentate hydroxypyridone with a small molecular weight, was first used and approved in europe in 1999 for the treatment of iron overload in tm when dfo was contraindicated or inadequate. us food and drug administration approval for clinical use of dfp was delayed until october 2011 because of the lack of traditional safety and efficacy trials comparing dfp and dfo. while dfo and dfp alone and in combination have been widely used in several trials involving patients with tm and proved to be effective in the reduction of iron burden,2427 the scientific evidence of their efficacy in the setting of ntdt is very incomplete and limited to specific subpopulations.28 recently, calvaruso et al described the first 5-year long-term randomized clinical trial comparing the effectiveness of dfp vs dfo in patients with thalassemia intermedia (ti) showing that long-term iron chelation therapy with dfp is similarly effective as dfo. however, the use of dfp was accompanied by the occurrence of rare but serious adverse events during treatment, such as neutropenia and agranulocytosis.29 the once daily oral iron chelator, dfx (exjade, novartis pharmaceuticals corporation, basel, switzerland), was introduced later, but has rapidly shown to be effective for reduction of body iron in iron-overloaded patients with transfusion-dependent anemias. it is a tridentate chelator that mobilizes iron stores by binding selectively to the ferric (fe) form of iron.30,31 the efficacy of dfx has also been demonstrated in sickle-cell disease and in bone marrow failure syndromes, such as myelodysplastic and aplastic syndromes, diamond blackfan and fanconi anemia.3234 in a phase i/ii trial with 49 patients with hf-related hereditary hemochromatosis, dfx also proved to be effective in reducing iron overload.35 in the past few years, several clinical trials have shown that accurate monitoring and dose adjustment of dfx was safe and effective in the long-term management of iron-overloaded patients with tm. briefly, it has been assessed that dfx at a dose of 20 mg/kg per day can stabilize serum ferritin levels and lic, while at doses of 3040 mg/kg per day is able to reduce these parameters and achieve negative iron balance in patients with transfusional iron overload.36 pharmacokinetic and pharmacodynamic properties of dfx have been mainly assessed among patients with tm and have been extensively reviewed elsewhere.37,38 however, studies from the myelodysplasia population seem to indicate that dfx has a constant pharmacological profile, independently from the underlying disease or race.39 the dfx is currently the only chelator to have gained approval for the treatment of iron overload in patients with ntdt in the usa (patients 10 years of age with an lic 5 mg fe/g dw and sf>300 ng/ml) and in europe (lic 5 mg fe/g dw and sf>800 ng/ml with inadequate response or contraindication to dfo).40 to date three small studies and one large randomized trial have evaluated the safety and efficacy of dfx in patients with ntdt with iron overload (table 1). in the prospective open label study by voskaridou et al 11 patients received dfx at a starting dose of 1020 mg/kg per day, according to the baseline iron burden, with subsequent dose adjustments according to efficacy and adverse events. after 1 year of treatment, significant improvement of mean liver t2*(p=0.02) was observed in the eight patients who completed the study.41 in the study by ladis et al,42 eleven patients were enrolled to receive dfx at 10 or 20 mg/kg per day for 24 months. mean lic, measured by mri-t2 *, and mean serum ferritin were significantly reduced (p=0.005 and p<0.05, respectively) in the nine patients completing the study both at 12 and 24 months and five patients achieved lic <3 mg fe/g dw. in both studies, cardiac t2*and left ventricular ejection fraction remained normal in all patients.41,42 thalassa, a randomized, double-blind, placebo controlled phase ii trial, is the largest study to investigate the safety and efficacy of dfx in reducing iron overload in patients with ntdt.43 the trial included 166 patients with -thalassemia intermedia (n=95), -thalassemia (n=22) and hbe/-thalassemia (n=49), and was conducted over 1 year. iron-overloaded patients (10 years of age with lic 5 mg fe/g dw and serum ferritin>300 ng/ml) were randomized to dfx starting doses of 5 or 10 mg/kg per day or matching placebo. after 1 year of treatment with dfx mean lic decreased significantly from baseline in both starting dose groups (dfx 5 mg/kg per day: 2.330.70 mg fe/g dw; p=0.001 and 10 mg/kg per day: 4.180.69 mg fe/g dw; p<0.001) compared to placebo. the decrease in lic, measured by r2-mri, was more significant (p=0.009) for the dfx 10 mg/kg per day group compared with the lower dose group (1.850.70 mg fe/g dw). similarly, serum ferritin decreased significantly with dfx from baseline to week 52 compared to placebo (least squares mean 121 ng/ml in 5 mg/kg per day group, 222 ng/ml in 10 mg/kg per day group,+115 ng/ml for placebo; p<0.001). patients who completed the thalassa core study were eligible to enter the 1-year extension phase, where patients were continued on dfx or were switched from placebo.44 verall, 133 patients entered the extension phase, including 48 who crossed over from placebo. patients randomized to receive dfx in both phases (n=110) achieved a mean absolute reduction of lic of 7.14 mg fe/g dw from baseline and a mean decrease of serum ferritin of 450 ng/ml. patients who switched over from placebo achieved a mean absolute reduction of 6.66 mg fe/g dw from baseline. at the end of the extension phase the proportion of patients achieving an lic of<5 mg fe/g was 38.6% overall (39.1% randomized to dfx in the core study; 37.5% originally randomized to placebo). a subanalysis was performed evaluating lic reduction in various subgroups, based on baseline lic, baseline serum ferritin, age, sex, race, splenectomy status, and underlying ntdt syndrome.45 across all subgroups, patients receiving dfx showed a greater reduction in lic compared with patients who received placebo with better results in patients in the 10 mg/kg per day starting dose group. the most frequently reported adverse events were mild to moderate in severity. in the thalassa study adverse events assessed to be drug related by the investigators were reported in 24.1% of the patients and were mostly gastrointestinal disorders (mostly nausea and diarrhea), which resolved spontaneously or with dose adjustment or drug interruption. as for renal function, no progressive increases in serum creatinine were observed. in patients treated for 2 years, five experienced two consecutive increases>33% above baseline and above upper limit of normal.43,44 no similar reports by voskaridou et al41 and ladis et al,42 although in the latter at the end of the 2nd year of treatment serum creatinine increased and creatinine clearance decreased compared to baseline, but neither reached abnormal values. in all three studies mean alt levels decreased over time, suggesting a corresponding improvement in liver function. only one patient in the thalassa extension study experienced hepatitis, which was suspected to be drug related.42 in general efficacy was achieved at relatively lower doses compared to patients with transfusional iron overload. however, monitoring for efficacy and adverse events with adequate dose adjustments remains pivotal in all patients. the most recent study was a multicenter trial performed in iran by karimi et al who treated 50 -thalassemia inter-media patients with serum ferritin>1,000 ng/ml with dfx for 12 months, observing a significant decrease of ferritin starting at 4 months of treatment.46 the recent definition of serum ferritin thresholds to predict clinically relevant lics together with more and more wide access to mri technology have led to the frequent diagnosis of iron overload in patients with ntdt, where initiation of chelation therapy is indicated. as a consequence, to control iron imbalance and to prevent iron toxicity, the long term use of a safe and effective chelator is required. an extensive experience gained from studies in patients with tm with over 150,000 patient years of drug exposure has definitively shown that dfx has a favorable side-effect profile in patients with transfusion-dependent thalassemia (tdt), with treatment-related adverse events comprising gastrointestinal, renal and dermatologic effects that were generally mild and reversible on cessation of treatment.47 in this review the restricted experience from the results on 238 patients with ntdt under continuous dfx treatment were evaluated. these studies involve small numbers of patients followed for 13 years who generally had never been transfused and encompasses two pilot studies, a prospective, placebo-randomized trial with its 2-year extension study and a retrospective study.4146 overall, dfx, at doses ranging from 10 to 20 mg and in a dose-dependent manner, was effective in reducing lic and/or ferritin in patients with different subgroups of ntdt. similarly to tdt, drug-related adverse events reported during these studies, were manageable, self-resolving, and typically did not necessitate discontinuing therapy, even as patients achieved low lic levels toward the end of the study.48 following monthly monitoring, incidences of liver and renal abnormalities were low and nonprogressive. mild, nonprogressive increases in serum creatinine levels were also observed in a few patients; these increases were generally within the normal range and rarely exceeded twice the upper limit of normal. taken together, these data suggest that the use of dfx can successfully manage iron overload in patients with ntdt. however, further data and larger study populations are needed to explore the safety profile of this drug in this group of patients (table 2). post-marketing surveillance studies and information from the ongoing thetis trial will provide additional assessment of the long-term efficacy and safety of dfx.49 given the need for lower doses as compared to tm, less toxicity and less morbidity are expected in ntdt than that observed when dfx was initially administered in patients with tm. obviously, in most ntdt forms, lifelong treatment with iron chelation may not be necessary and several attempts at improving drug efficacy and reducing drug toxicity have been given particular attention, as the need to interrupt chelation if treatment goals are reached. in fact, a prudent and conservative approach has been adopted in the thalassa trial in the sense that lic <3 mg fe/g dw was used as an indicator to interrupt iron chelation therapy in the hypothesis that it could represent a low, acceptable iron burden.43 in the described post hoc analysis, a consistent safety profile was nevertheless demonstrated as patients approached this target, indicating that such low iron burdens may be obtained with minimal risk of overchelation.48 this approach, now included in current guidelines for chelation therapy in ntdt, obviously will guarantee from the observed risk in tdt that overchelation could further reduce glomerular filtration rate also in ntdt.50 however, it should be taken into account that cases of glomerular hyperfiltration may be observed in patients with ntdt and that the administration of dfx could bring the glomerular filtration rate levels under control.51 thus, it could be argued that occasionally a potential adverse event may become a useful strategy against the potential damage of persistent glomerular hyperfiltration. while a severe or>5 mg fe/g dw lic was clearly associated with complications, the level of acceptable iron burden and iron associated toxicity in ntdt may be different and transiently modifiable by occasional transfusional requirement. currently, in line with the thalassemia international federation guidelines for dfx use in patients with ntdt, iron chelation should be stopped in patients reaching lic of 3 mg fe/g dw or sf of 300 ng/ml, when mri is unavailable, as safety data do not exist to support continued chelation with dfx below this level.15 on the other hand, due to the permanent progressive iron accumulation, therapy should be restarted when patients re-achieve a lic of 5 mg fe/g dw thus realizing a gray zone (from 3 to 5 mg fe/g dw), where patients are either interrupting treatment or waiting to restart it. it has also been observed that each genetic entity of ntdt has different erythroid activity, hepcidin levels and occasional transfusional iron loading, which may generate in some cases and in the presence of nearly normal lic level, high levels of saturation of transferrin which in turn produces labile iron species and potential organ damage.52,53 given that dfx has been shown not only to control iron burden but also labile plasma iron, the chelatable form of non-transferrin-bound iron, there could be the space to test dfx for a maintenance and or a transient therapy in such circumstances.54 as dfx remains within the therapeutic range over a 24-hour period, it offers a complete chelation coverage at standard doses and can therefore better control labile plasma iron.55 further studies are needed to fully evaluate the efficacy and the safety of alternative administration schedules (ie, alternate days, three times/week) and/or reduced doses of dfx to control iron stores in this gray zone, where a maintenance chelation therapy could be acceptable. further studies are also needed to better delineate the appropriate schedule of treatment of dfx to induce a neutral iron balance according to the increased risk of renal injury when a considered safe or normal iron burden has been reached. on the other hand, consideration should be given in the future also to better tailor initial dfx therapy to the basal iron depot, to different subtypes of ntdt, to splenectomy status and to the rate of occasional transfusional iron intake, all conditions which may affect iron balance in ntdt. of particular interest, over the long-term use of dfx, will be also the prospective determination of the impact of iron chelation on most common complications and survival in patients with ntdt. the thetis trial will focus on the effects of 5-year treatment with dfx on the endocrine profile. the favorable outcome of dfx on osteopenia and osteoporosis observed in patients with tm could be expected also in ntdt.56 similarly, the reported long-term effects of dfx treatment on liver fibrosis should be also readdressed in ntdt.57 currently, to improve anemia and reduce the occasional transfusional requirements, patients with ntdt are frequently treated with older drugs such hydroxycarbamide58 and new agents such as those interfering with the activity of several transforming growth factor- family cytokines involved in late stages of erythropoiesis59,60 and jak2 inhibitors.61 thus, the efficacy, safety, and pharmacokinetics of dfx should also be evaluated in patients concomitantly receiving some of these drugs, taking into account that the potential interference of such drugs with mechanisms regulating the iron absorption, could further address and limit iron overload. in conclusion, following the results of the thalassa and extension studies, dfx has become the current gold-standard for iron chelation in patients with ntdt. however, prospective data from a randomized comparison with other chelating agents and from a magnitude of drug-exposure comparable to that obtained for patients with tm should be performed to obtain a more accurate and complete evaluation of its profile in patients with ntdt.

it has been clearly shown that iron overload adds progressively significant morbidity and mortality in patients with non-transfusion-dependent thalassemia (ntdt). the lack of physiological mechanisms to eliminate the excess of iron requires effective iron chelation therapy. the reduced compliance to deferoxamine and the risk of severe hematological adverse events during deferiprone treatment have limited the use of both these drugs to correct iron imbalance in ntdt. according to the principles of evidence-based medicine, following the demonstration of the effectiveness and the safety of deferasirox (exjade) in a prospective, randomized, controlled trial, deferasirox was approved by the us food and drug administration in may 2013 for the treatment of iron overload associated with ntdt. this review, assessing the available scientific literature, will focus on the profile of dfx in the treatment of non-transfusional hemosiderosis in patients with ntdt.

PMC4687615

pubmed-1165

hepatitis c virus (hcv) infection is reported to have a prevalence of approximately 3% worldwide. majority of patients with chronic hcv have a mild, asymptomatic elevation in serum transaminase levels with no significant clinical symptoms. around 25% of patients with chronic hcv have persistently normal alanine aminotransferase (pnalt). definition of normal alanine aminotransferase (alt) has changed over time and reference range for normal alt differs based on different laboratory cutoffs. prati et al. in 2002 suggested new cutoffs with 30 u/l (international unit) for men and 19 u/l for women compared to 40 u/l and 30 u/l for men and women, respectively. a 2009 american association for the study of liver disease (aasld) practice guideline suggested an alt value of 40 u/l on 2-3 different occasions separated by at least a month over a period of 6 months. others have used 3 different alt levels equal to or below upper limit of normal (uln) separated by at least 1 month and sometimes over a period of 18 months. it was generally thought that people with pnalt have a mild liver disease and the degree of liver fibrosis is minimal [614]. based on this, later on, it was realized that a considerable number of such patients developed significant inflammation and fibrosis over time. more recently, treatment has been recommended along the same lines for patients with pnalt as patients with elevated alt. although more data is becoming available about the relationship of liver enzymes and course of chronic hcv infection, data regarding hcv infection and pnalt is relatively scarce. because of variation in the definition of pnalt, fewer studies have looked at the relationship of pnalt with chronic hcv infection using updated normal alt definitions. department of hepatology at the university of illinois (u of i) medical center, chicago, had a database of over 1200 patients with chronic hcv infection. medical records of these patients were reviewed in an effort to characterize patients with chronic hcv infection and pnalt. histological and clinical parameters for patients with pnalt as well as elevated alt were analyzed. database of patients with hcv infection presenting to u of i medical center, chicago, was reviewed. patients with biopsy proven hcv infection and a detectable hcv ribonucleic acid (rna) in blood were chosen. of these, patients with an alt at liver biopsy, at least one additional over the next 12 months, and liver biopsy slides available for review were identified. most of the liver biopsy procedures were done at u of i medical center and in cases where biopsies were done at outside facility they were read again at u of i medical center. two expert hepatologists, who were masked to clinical data, assigned knodell et al. intervals for alt measurement were chosen around the time of liver biopsy as well as 3, 6, and 12 months after biopsy. patients with end-stage renal disease like those on dialysis and stage iv chronic kidney disease with creatinine clearance of 1529, those who received organ transplant, those with co-infection with hiv, those who were positive for hepatitis b surface antigen (hbsag), and those receiving antiviral therapy for chronic hcv were excluded. pnalt was defined as alt 30 u/l on at least 2 different occasions over 12 months. strict pnalt was defined as alt 30 u/l for males and 19 u/l for females. demographic data including age at biopsy, gender, and race were recorded. clinical data included body mass index (bmi), alcohol use, tobacco use, and presence of diabetes mellitus (dm). hcv virus was further characterized by recording hcv rna levels, genotype, and duration of infection. histological data included individual markers of inflammation like portal tract inflammation, piece meal necrosis, and lobular inflammation as well as fibrosis according to knodell et al. scoring system. inflammatory score (sum of portal tract inflammation, piece meal necrosis, and lobular inflammation) and histologic activity index (hai) score (sum of inflammatory score and fibrosis) were calculated. histologic data from pnalt was then compared with patients from elevated alt group. finally, clinical characteristics of pnalt with advanced fibrosis were compared with pnalt but with no advanced fibrosis. independent sample t-test and chi-squared test were used to calculate p values where appropriate. a total of 243 patients out of a database of 1200 patients with hcv satisfied the study criteria. main reasons to exclude a large number of patients were a lack of detectable rna despite biopsy report, outside biopsy report but slides not available for review, single or no alt value, and patients undergoing treatments. those analyzed were further divided into pnalt, strict pnalt, and elevated alt group. 32 (13%) of these patients were identified as pnalt group and 211 (87%) were identified as elevated alt group. only 13 (5%) patients satisfied criterion for strict pnalt and this group was not analyzed further. the range of alt values at different time intervals was specified (table 1). 24 (75%) of pnalt patients were females while 85 (40%) with elevated alt were females. 13 (41%) with pnalt were african american (aa) compared to 87 (41%) with elevated alt, 14 (44%) were caucasian (w) compared to 79 (38%) with elevated alt, and 5 (15%) were hispanic (h) compared to 44 (21%) with elevated alt. there was no statistically significant difference in the racial distribution between pnalt and elevated alt group. there was a higher frequency of women in the pnalt group compared to the elevated alt group (p=0.001). diabetes and alcohol use were more common among patients with elevated alt compared to pnalt (p=0.04 and 0.049, resp.). most notably, patients with pnalt had a higher rate of cirrhosis (p=0.007). there were no differences in age at biopsy, tobacco use, bmi, rna level, and duration of infection between pnalt and elevated alt groups (table 2). further evaluation of liver histology showed no statistically significant difference in mean fibrosis score, mean portal tract inflammation score, mean piecemeal necrosis score (pmn), mean lobular inflammation score, mean histologic activity index (hai) score, and mean inflammatory score between pnalt group and elevated alt group (table 3). comparison of clinical characteristics of pnalt group with advanced fibrosis with pnalt group without advanced fibrosis showed that only platelet count was significantly different between the two groups (table 4). tables 5 and 6 characterize the distribution of hcv genotypes based on pnalt and hai score, respectively. the natural history of chronic hcv infection with pnalt is poorly understood [1820]. we attempt to describe the characteristics of patients with pnalt, which constitutes almost 2530% of patients with chronic hcv infection. firstly, a high proportion of patients with pnalt had advanced fibrosis, and degree of inflammation was not significantly different than chronic hcv infection with abnormal alt. secondly, it was difficult to identify a substantially large set of patients with hcv infection and pnalt given that there is a significant fluctuation in the alt level over time [9, 15]. we chose duration of 12 months to observe the levels of alt instead of 6 months period. it is becoming clear that 6 months is probably too short given that in some cases alt level may fluctuate after initial period of stability [7, 2124]. most patients with pnalt were females, which is consistent with earlier findings [79]. similarly, age at biopsy, bmi, rna level, and duration of infection were not significantly different between the two groups. hcv genotype distribution showed that a majority (81%) of patients belonged to genotype 1 and it is a well-characterized fact. there was no significant difference in terms of distribution of genotypes between the 2 groups (table 5). also there was no significant difference in hai according to genotype distribution (table 6). hcv genotyping was performed in 181/243 (75%) patients and was missing in 62 (25%) patients. the likely reason was transition from paper to electronic records in 1990s and loss of some data. within pnalt, those with advanced fibrosis differed from those without advanced fibrosis by platelet count only. similarly, pnalt patients were divided based on low-normal alt (< 19) and high-normal alt (2030) for comparing hai scores among them but no significance was seen (table 7). studies to date have been mentioning a milder disease for pnalt in terms of fibrosis and necroinflammation [79, 2628]. some studies have pointed to this fact as well [14, 29, 30]. this is an interesting finding given that despite significant inflammation (comparable to abnormal alt) the alt levels in some of these patients have been consistently low. similarly, advanced fibrosis was more common in pnalt group as compared to the elevated alt group (p=0.007). it is thought that alt levels normalize in patients with advanced fibrosis and that is why some authors will advocate doing liver biopsy in patients with hcv infection and normal alt levels. it is interesting to note that the 6 patients with pnalt who had cirrhosis also had evidence of thrombocytopenia. our results indicate that platelet count can be used as a marker to predict fibrosis in patients with pnalt. for instance, almost all patients in the study group had an alt measured around biopsy but only slightly more than half had alt measured around 12 months. second, sample size was relatively small and might not be a true representative of patients with pnalt. this might in particular be valid for pnalt with advanced fibrosis as 8 (25%) out of 32 patients with pnalt had f3-f4 while only 19 (9%) out of 211 patients with elevated alt had f3-f4 (p=0.007). it is not clear if the outcome would have been the same if denominator for pnalt was high. small sample size was caused mainly as described before as well as comorbid conditions like advanced kidney disease, hiv, hbsag positive, and being on antiviral treatment. for example, 11 patients with pnalt were excluded as they had esrd; alt levels are known to be lower in esrd [34, 35] secondary to an impaired immune response in patients with esrd. this raises concern that those with pnalt and severe liver fibrosis may have been in biochemical remission. for example, of the 8 patients with severe liver fibrosis (stages 3 and 4) and pnalt, only 2 patients had 4 alt measurements over 12 months (over the period of 0, 3, 6, and 12 months), while 3 patients had 3 alt measurements over 12 months, and the remaining 3 patients had only 2 alt measurements over the 12 months period. thus, it is not possible to say with certainty that all patients with pnalt and severe liver damage had uniformly low alt all along. in conclusion, histological changes observed in hcv patients with pnalt will argue that alt is not a reliable indicator of hepatic inflammation or fibrosis. female gender, absence of dm, and abstinence from alcohol were associated with pnalt. these findings indicate the need for more studies with higher number of pnalt patients to look at the relationship of pnalt with changes occurring at histological and molecular levels.

patients with chronic hepatitis c virus (hcv) infection and persistently normal alanine aminotransferase (pnalt) are generally described to have mild liver disease. the aim of this study was to compare clinical and histological features in hcv-infected patients with pnalt and elevated alt. patients presenting to the university of illinois medical center, chicago, who had biopsy proven hcv, an alt measurement at the time of liver biopsy, at least one additional alt measurement over the next 12 months, and liver biopsy slides available for review were identified. pnalt was defined as alt 30 on at least 2 different occasions over 12 months. of 1200 patients with hcv, 243 met the study criteria. 13% (32/243) of patients had pnalt while 87% (211/243) had elevated alt. significantly more patients with pnalt had advanced fibrosis (f3 and f4) compared to those with elevated alt (p=0.007). there was no significant difference in the histology activity index score as well as mean inflammatory score between the two groups. in conclusion, in a well-characterized cohort of patients at a tertiary medical center, pnalt did not distinguish patients with mild liver disease.

PMC4033356

pubmed-1166

understanding the biomechanics of the native pcl provides a framework for reconstruction by replicating the anatomy.15) early biomechanical studies characterized the rehabilitationindividual main bundles of the pcl as anterolateral (al) and posteromedial (pm) bundles.16,17) the al bundle is more taut in flexion and more lax in extension; the reverse is true for the pm bundle, which is more taut in extension and more lax in flexion.17,18) in this setting, the al and pm bundles mainly function individually at the flexed and extended positions, respectively. however, more recent biomechanical studies have suggested that, based on length and spatial orientation, the two bundles of the pcl may have a co-dominant relationship rather than a reciprocal one.15,19-21) this concept means that both bundles function through the range of motion (rom) in a synergistic fashion rather than a reciprocal one. mauro et al.19) reported no difference in the in situ forces between the al and pm bundles at any of the flexion angles, using a robotic testing system. ahmad et al.21) reported that the pm bundle becomes more horizontal with increasing knee flexion and this orientation increased the ability of the pm bundle to resist posterior tibial translation. using magnetic resonance imaging (mri) and a dual-orthogonal fluoroscopic system, papannagari et al.20) reported that both bundles showed elongation and change of orientation of up to 120 of knee flexion. race and amis22) conducted the first biomechanical comparison between isometric single and double bundle reconstruction; their results showed over-constraint of the isometric single bundle reconstruction in extension with underconstraint at higher degrees of flexion. the double bundle reconstruction resulted in restoration of the posterior laxity from 0 to 120 to within 1 mm of the intact specimens. harner et al.8) also reported that double bundle reconstruction resulted in better restoration of posterior stability, compared with single bundle reconstruction in cadaveric knees. however, in some studies,4-6,23,24) in terms of posterior stability, few differences were observed between single and double bundle pcl reconstruction, even though some different results were reported with different experimental settings. the influence of the femoral attachment site, as well as the number of bundles, was further evaluated.1,2,7) in a study using variable femoral attachment sites, mannor et al.7) reported that a shallow femoral insertion allows for better control of posterior translation. however, they could not prove the possibility of graft elongation resulting from high graft tension. shearn et al.1) reported that the placement of a second bundle in the middle or distal position resulted in a significant reduction in al bundle tension and in cooperative load-sharing (with the bundles functioning together). however, placement of the second bundle in a proximal position resulted in reciprocal loading (with one bundle functioning in flexion and one in extension). the majority of studies have reported improved outcomes from preoperative level of function; however, when compared with the preinjury activity status, the results are less successful.15) the objective knee scores seem to lag behind those of subjective self-reported scoring after surgical reconstruction; one possible explanation is residual laxity, which has been demonstrated using many reconstructive techniques.15) most studies have reported residual laxity ranging from 2 to 6 mm indicating that the surgical result will depend upon the surgical technique.25-33) few clinical studies comparing the outcomes between single and double bundle pcl reconstruction have been reported. wang et al.34) reported no significant difference in the functional score or radiologic evaluation. three studies (houe and jorgensen,35) fanelli and larson,36) and kim et al.37)) also reported no difference in subjective and objective outcomes. only one recent study, by yoon et al.,38) reported better stability and international knee documentation committee (ikdc) distribution; however, they also stated that it is unclear whether double bundle is definitely superior clinically and functionally because there was no difference in the subjective scores. pcl injuries have potential for intrinsic healing; several mri studies have reported that the pcl healed with continuity but also with residual laxity.39-41) in most pcl injuries, some portion of the pcl, or at least the meniscofemoral ligament, is preserved, therefore, in an acute or subacute stage, the pcl has a higher likelihood of spontaneous healing than the anterior cruciate ligament (acl) does.25) many mri studies have reported that because the ligament is surrounded by a thick synovial sheath that is hardly torn completely and the meniscofemoral ligament remains attached to the lateral meniscus, an injured pcl can heal itself.39-42) treatment of the isolated pcl injury should depend on the injury status, which is determined by the amount of posterior laxity, the patient's age and level of activity. in young patients, we can perform cylinder cast immobilization in order to prevent posterior sagging if the instability is less than 8 mm side to the side difference (which means that there is a stepping between the medial tibial and femoral condyles at 90 of flexion of the knee joint) and there is some continuity remaining according to the mri.9,43) however, during cast immobilization, in order to prevent posterior sagging of the proximal tibia, the cast should be changed if the patient feels that his knee, especially the proximal tibia, is moving anteriorly and posteriorly in the cylinder cast. cylinder cast immobilization is usually maintained for six weeks and then the brace is used with the attachment of two springs with a tibial supporter in order to prevent posterior translation of the tibia for another six weeks.9) another option for conservative treatment of the isolated pcl injury is an immediate rehabilitation and quadriceps strengthening exercise program, especially for elderly patients. we recommend pcl reconstruction in patients with more than grade ii pcl injury, even for isolated pcl injury in young patients.25) the remnant pcl fibers would be helpful for the improvement of vascularization, and therefore, will promote healing of the graft, and the mechanoreceptors will provide mechanical stability. the center of the femoral tunnel was chosen so that the distal edge of the graft was 2 mm apart from the articular cartilage margin, by placing the guide pin 5-6 mm proximal to the articular cartilage at the 11 or 11:30 o'clock position (left knee), depending upon the graft diameter. a tibial tunnel could be created by placement of a guide pin just distal to the center of the tibial insertion or just lateral and distal to the center area in the remnant pcl. the graft can then pass along the medial border of the remnant pcl towards the femoral tunnel, which was located anteromedial to the pcl (fig. in the case of healed pcl with residual laxity, tensioning with an al bundle reconstruction using a modified inlay technique could be used, and to get very good stability if the remnant pcl is thick and there is a normal signal in the mri studies when the injury is chronic (more than 12 months). however, this technique is a technically demanding procedure and a bigger surgical scar may be produced.29,30,45,46) for al bundle reconstruction for the single bundle reconstruction, the femoral tunnel should be made at a distal (shallow) and anterior portion. this means that the femoral tunnel should be placed distally (shallow), usually 5-6 mm, from the articular margin, and vertically. remnant pcl fibers may provide a soft tissue cushion effect between the graft and the bone at the entrance to the tunnel, which is helpful to prevent the killer turn effect at the femoral and tibial tunnel orifice. if there is no remnant pcl or a very thin pcl remnant, we should do double bundle reconstruction (fig. 2).47) pcl injuries are frequently combined with posterolateral rotatory instability (plri), which occurs in about 43%-80% of cases.47,48) although the causes of failure of pcl reconstruction are multifactorial, one of the most common causes is a neglected plri.49,50) therefore, identification of concomitant injuries is important in order to obtain a good result. currently, plri can only be evaluated through a physical examination. in particular, 1 to 2 plri (grade 1, external rotation [er] using a dial test<10 without varus instability; grade 2, er 10 or posterolateral tibial subluxation with grade 0-2 varus instability; and grade 3, er 20 or posterolateral tibial subluxation+grade 3 varus instability)48) often goes unnoticed, especially when the tests are performed with the muscle tensed in acute stage patients with pain. therefore, plri assessment should be performed several times and should become a routine procedure before surgery for the patient under anesthesia.48,51) why is the plri misdiagnosed, especially in grade ii plri? in our opinion, the reason is that in the pcl and posterolateral corner injured patient, the lateral tibial plateau is posterolatearally subluxed at 90 of knee flexion. if a dial test or posterolateral drawer test is performed in this situation, it is difficult to find more er of the leg or subluxation of the posterolateral tibial plateau. therefore, in pcl and posterolateral corner injured patients, reduction of the knee to the normal position using the dial test and posterolateral drawer test is important for making a diagnosis of plri.51) we determined that a reduction of the knee in the anteroposterior direction would increase the degree of tibial er in combined pcl-posterolateral corner injuries.51) when we performed the dial test in the prone position, this position was also helpful for the same reason. in the prone position, posterior sagging of the proximal tibia would be reduced, which was better than the supine position.51,52) for treatment of plri, grade ii injury could be managed with a posterolateral corner sling (plcs) through the fibular head.48) however, in grade iii plri, anatomical reconstruction would be preferable, as described by laprade and wentorf.53) in contrast to acl rehabilitation, accelerated pcl postoperative rehabilitation is generally undesirable and more conservative methods are recommended than acl reconstruction.54,55) however, the rehabilitation protocol of a pcl reconstruction is not well established and only a slow and conservative rehabilitation is proposed.14) for example, early weight bearing is believed to be hazardous to the pcl because pcl reconstruction is often associated with either a medial or lateral collateral ligament repair or reconstruction and it can cause over-stressing these structures.54,56) anatomically, the tibial plateau is inclined posteriorly and an axial load placed on the tibia by weight bearing at relatively extended positions produces an elemental force in the anterior direction. therefore, the joint is stabilized somewhat by weight bearing.57,58) in addition, weight bearing can have several benefits. firstly, the patient would have better static stability when standing on both legs, thereby minimizing the risk of falls. fourthly, weight bearing itself can be a co-strengthening exercise and proprioceptive training.54,56,59) finally, most patients have a tendency to flex their operated knee to prevent weight bearing.14) this means that a posteriorly directed force can be prevented if weight bearing is performed in the fully extended position. accelerated rehabilitation does not mean rapid range of motion exercise.14) within 0 to 30 of flexion, the hamstring can not produce a posterior shear force and the anterior angle of the patellar tendon is always larger than that of the hamstring tendons.60,61) therefore, within this range of motion, co-strengthening could be performed using calf raising and mini-squatting exercise. quadriceps strengthening extension exercise at angles less than the quadriceps neutral angle produces anterior tibial translation, which is antagonistic to the acl but synergistic to the pcl. therefore, after a pcl reconstruction, quadriceps strengthening knee extension should be restricted to between 60 of flexion and full extension of the knee.62,63) in current pcl studies, there has been a shift in biomechanics from reciprocal functioning to co-dominance. surgical devices and reconstructive techniques of the pcl have been developing and a more active approach is used than the past. it is still uncertain whether single or double bundle reconstruction is superior, because of conflicting biomechanical studies and notable limitations of the clinical studies. the remnants of pcl fibers, placement of the femoral tunnel, and combined plri are other hot issues in reconstruction. after the reconstruction of the pcl, a more active and systemic exercise program and early weight-bearing training are increasingly being recognized as important.

there is little consensus on how to optimally reconstruct the posterior cruciate ligament (pcl) and the natural history of injured pcl is also unclear. the graft material (autograft vs. allograft), the type of tibial fixation (tibial inlay vs. transtibial tunnel), the femoral tunnel position within the femoral footprint (isometric, central, or eccentric), and the number of bundles in the reconstruction (1 bundle vs. 2 bundles) are among the many decisions that a surgeon must make in a pcl reconstruction. in addition, there is a paucity of information on rehabilitation after reconstruction of the pcl and posterolateral structures. this article focused on the conflicting issues regarding the pcl, and the scientific rationales behind some critical points are discussed.

PMC3858094

pubmed-1167

use of multiagent chemotherapy pre- and postoperatively has significantly improved the outcome in the last 30 years, leading to a 5-year disease-free survival for patients with localized tumors in the 20% to 60% range. despite the use of these drugs, approximately 30% of patients with localized disease and 60% of patients with pulmonary metastases succumb to the illness. cytogenetic analysis has revealed multiple chromosomal rearrangements without a typical translocation, as can be seen in ewing's sarcoma. in recent years, the immunocytochemical subclassification of osteosarcomas has significantly enhanced the accuracy of pathological diagnoses, suggesting that new immunochemical markers could further improve diagnosis and prognosis. recently, salas et al. introduced ezrin expression as a prognostic factor for the survival rate of patients with conventional osteosarcoma, correlating its expression with tumor progression. it was also shown that ezrin is useful as an immunohistochemical marker to differentiate between chondroblastic osteosarcomas and conventional chondrosarcomas. however, other osteosarcoma markers are required to further characterize this complex, multifactorial neoplasia. antibodies to tumor mark are being used to treat different forms of cancers. among the currently fda approved antibodies, some of them are now under clinical trials to osteosarcoma (http://www.clinicaltrials.org/). the success of the treatment is somewhat related to the antibody origin; in general it is expected that humanized or fully human antibodies are better tolerated than murine monoclonal ones. to isolate such potential biopharmaceuticals, the use of the phage display technique can lead to the isolation of either antibodies or peptides able to discriminate tumor cells. in a traditional approach, the identification of the tumor marker is the first step, after that it is necessary to isolate an antibody against this marker. using a fab phage display library, these steps can be merged into one, and it is possible to identify antigens without previous knowledge. the use of complex antigens such as cell membranes broadens the possibility of finding differentially expressed markers. however, as a more complex antigen source is used, the techniques employed to separate bound phages from unbound phages become more difficult. this usually makes selection on cell surfaces much more complex than selection using purified antigens. focusing on this challenge, different selection procedures have been developed. among these procedures, a method called brasil (biopanning and rapid analysis of selective interacting ligands) was specifically designed to isolate phages able to bind to the cell surface. in order to isolate anti-osteosarcoma fully human fabs, we used a previously constructed combinatorial fab phage display library produced with antibody repertoires from osteosarcoma patients, relying on the fact that these antibody repertoires could be enriched with antibodies against the patients ' own tumors. here, we report the utilization of this library for panning fabs against the surface of osteosarcoma cells. the selection procedure was adapted from that of the brasil method for using a phage antibody library. this is the first report of the use of the brasil method with a human fab library. after three rounds of selection against the cell surface of an osteosarcoma cell line, we were able to identify many reactive fabs, most of them sharing similar v genes. five fabs were chosen for further analysis, including western blot, cell elisa, and immunocytochemistry. our data revealed that these fabs recognize a membrane antigen that is more widely expressed in the osteosarcoma cells compared to normal osteoblast and fibroblast cells. these results suggest that these human fabs could be further used to improve the diagnosis and prognosis of osteosarcoma. the human osteosarcoma cell lines u2 os (htb-96) and saos-2 (htb-85), and the fetal normal osteoblast cell line hfob1.19 (crl-1172) were purchased from atcc and cultured as recommended. a short-term culture of normal human fibroblasts was cultured at 37c in 5% co2 with ham's f10 medium supplemented with 100 u/ml of penicillin, 100 g/ml of streptomycin, and 10% fbs. a combinatorial fab phage display library generated from the antibody v regions of eleven osteosarcoma patients, containing 2.7 10 different forms, was constructed previously and used for selection according to the brasil method. briefly, the cultured cells were collected with pbs and 5 mm edta and then washed with the medium defined for each lineage, resuspended in culture medium containing 1% bsa at a cell density of approximately 1 10 cells per ml, and incubated with 1 10 plaque forming units (pfu) of phage for approximately 1.5 hours on ice with sporadic gentle mixing. after that, the cell-phage suspension was transferred to the top of a nonmiscible organic lower phase (a 9: 1 mixture of dibutyl phthalate: cyclohexane) and centrifuged at 1000 g for 10 minutes at room temperature. the tube was snap frozen in liquid nitrogen, and the cell-phage pellet was used to infect a log-phase culture of escherichia coli (strain xl1-blue). in the selection procedure using the surface of u2-os cells, we also performed a preclearing step before the third selection cycle. to do this, the phages were incubated with normal hfob 1.19 osteoblasts, and, after separation by centrifugation through the organic phase, the supernatant containing the unbound phages (in the aqueous upper phase) was incubated with u2-os osteosarcoma cells as described above. the selected phages were amplified by e. coli infection according to the procedure described elsewhere and were then used in the next selection cycle. dna was extracted from the bacterial pellet obtained after each round of selection using a qiaprep spin miniprep kit (qiagen), and then used to transform hb2151 e. coli cells for production of soluble fab without the filamentous phage gene iii fusion protein partner. individual carbenicillin-resistant hb2151 colonies were picked and grown overnight (on) at 37c in a 96 deep well plate in 1 ml sb medium containing carbenicillin (100 g/ml) and glucose (1%). after this incubation, the cultures were used to produce two replica plates: one for a glycerol stock and the second for the production of the soluble fabs themselves. the original on culture plate was centrifuged, and plasmid dna was extracted from the e. coli using the qiaprep kit. fab production was performed by inoculation of 1.5 ml of sb medium containing carbenicillin (100 g/ml) and glucose (1%) with 50 l of the on culture. cultures were incubated at 37c, shaking at 250 rpm, until they reached an od of 0.9 at 600 nm. the cultures were then centrifuged, and fresh sb medium containing carbenicillin (100 g/ml) and iptg (2 mm) was added, followed by incubation at 30c for an additional 18 hours. supernatants containing the soluble fabs were used in the dot blot and elisa assays. for large-scale fab production, the procedure was the same as described above, except that phages were produced in 100 ml of sb medium e. coli culture. supernatants were concentrated using centriprep 10 filter units (millipore) and buffer exchanged in pbs. purification of fabs was performed using ni-nta resin (qiagen) under nondenaturing conditions according to the manufacturer's instructions. sequencing reactions were prepared with reverse primers specific for the vh and vl regions (ch: 5cgcctgagttccacgacacc3, mmb4: 5gcttccggctcgtatgttgtgt3, c: 5agaggagtccagatttca3, and mmb5: 5cgtttgccatcttttcataatc3) and were performed using et terminator (ge-healthcare) in a megabace 500 plus sequencer (molecular dynamics). alignments were done using igg blast at the ncbi blast server (http://www.ncbi.nlm.nih.gov/blast) and with the program bioedit. the kabat numbering and cdr definitions were adopted from andrew martin's web site (http://www.bioinf.org.uk/abs/). ninety-six well plates were coated with 100 l of a 10 g/ml total protein solution prepared from osteosarcoma and osteoblast cells as described in the next section. the plates were then blocked with 3% bsa and incubated with 100 l of the induced supernatant from each selected clone. the supernatant from the empty parental plasmid (pcomb3x) e. coli culture was assayed as a negative control. fab binding was detected with a rat anti-ha (hemagglutinin decapeptide tag) hrp-conjugated antibody from roche, followed by the abts peroxidase substrate. for selecting individual clones, a threshold value was arbitrarily set at ten times greater than the value obtained for the empty vector and at least three times greater than the value obtained for the incubation with proteins from normal osteoblast cells. cell elisa was performed according to the protocol adapted from williams and sharon (2002). briefly, polystyrene 96-well tissue culture plates were seeded with 2 10 u2-os, saos-2, or fibroblast cells in 200 l of culture medium defined for each cell lineage supplemented with 10% (v/v) fbs and incubated for 30 hours. the cells were fixed with 4% formaldehyde in pbs for 20 minutes at room temperature followed by two washes with pbs. the washed cells were incubated with 100 l of the induced supernatant from each clone or with the purified fab. protein extracts from u2-os and fibroblast cells were prepared in cold lysis buffer (0.5% np-40, 0.3% triton x 100, 50 mm tris hcl ph 8.0, 5 mm mgcl2, 0.5 mm edta, 1 mm atp, 1 mm dtt, 10% glycerol) and complete mini-edta-free protease inhibitor cocktail tablets from roche. total protein extracts were separated by sds-page under reducing conditions and transferred to nitrocellulose membranes (ge-healthcare). after blocking with 5% skim milk tbst at room temperature for 1 hour, the membranes were probed with one of the five purified fabs (0.02 g/ml) for 2 hours at rt and washed 3 times with tbst (50 mm tris-hcl, ph 7.5, 150 mm nacl, 0.05% tween 20). the membranes were then incubated with a rabbit anti-ha (hemagglutinin decapeptide tag) antibody (santa cruz) diluted 1: 1000 for 1 hour, washed again and incubated with anti-rabbit hrp at a 1: 5000 dilution. bands were visualized using an ecl supersignal west pico chemiluminescent substrate detection kit (thermoscientific). to control loading differences, a rabbit anti-alpha-tubulin antibody (abcam) was used instead of the selected fabs. cultures of u2-os and human fibroblast cells grew until they reached 7090% confluency on a slide chamber. the cells were then washed twice with pbs and fixed and permeabilized by immersion in precooled methanol for 6 minutes at 20c. after two washes with pbs, the slides were incubated with 2% bsa (w/v) and 5% normal goat serum (v/v) for 30 minutes. after an overnight incubation at 4c with 15 l of purified fabs, the slides were washed and incubated with 1: 200 anti-ha antibody (santa cruz) for 45 minutes, followed by an incubation with a goat anti-rabbit igg-fitc at 1: 2000 (sigma) in a moist chamber in the dark. after addition of dapi i, the slides were observed with an axiolab fluorescence microscope (zeiss) using the applied imaging cytovision software. archived, formalin-fixed, paraffin-embedded tissue sections (4 m) were deparaffinized in xylene and rehydrated using a series of alcohol and distilled water solutions. endogenous peroxidases were quenched by incubation with 10 v h2o2 for 10 minutes, followed by microwave antigen retrieval in 10 mm sodium citrate buffer, ph 6.0. purified anti-osteosarcoma fabs at 200 g/ml, diluted to 1: 200 (n-h7) and 1: 20 000 (o-g11), were incubated with tissue sections for 1 hour at room temperature. after rinsing with phosphate-buffered saline, the slides were incubated for 30 minutes with rabbit anti-ha antibody (santa cruz), diluted 1: 200 in 1% bsa-pbs, and then incubated with a biotinylated goat anti-rabbit igg (rockland). after the antibody incubations, the slides were washed with tris-based buffer and then incubated with streptavidin-conjugated horseradish peroxidase (lsab+ kit, dako) and dab as the chromogen. the sections were counterstained with harry's hematoxylin and covered with entellan (merck). to select recombinant antibody fragments that bind to osteosarcoma cells, we used a human fab phage display library constructed from pbmcs of eleven osteosarcoma patients using two different cell lines: saos-2 osteosarcoma cells (n fab clones) and u2-os osteosarcoma cells (o fab clones). both panning approaches were repeated three times. for the u2-os cells, we included a negative selection cycle before the third round, in which the phages were first adsorbed to normal hfob 1.19 osteoblast cells, followed by panning against osteosarcoma cells. one hundred eighty three clones from the second and third rounds of selection from both approaches were screened by dot immunoblot using an anti-ha antibody to identify fab expressing clones. we found that 67% of the n clones and 46% of the o clones gave positive signals, demonstrating that these clones express reactive fabs (data not shown). individual fab-expressing clones were tested for the ability to bind to osteosarcoma cell proteins by elisa using two different strategies. the first approach evaluated fab binding to fixed osteosarcoma cell monolayers, and the second approach evaluated fab binding to total protein extracts from osteosarcoma cells. seventy-nine clones from the n system and eighty-eight from the o system were tested. clones showing an a450 of less than 0.1 (similar to supernatants without fab) were considered nonbinders. the most reactive clones were tested further in another elisa assay using protein extract from osteosarcoma cells and normal osteoblast cells. triplicates of 27 clones were tested in this second trial, including 16 from the second and 6 from the third rounds of the n system and 2 clones from the second and 3 from the third round of the o system. the results of this assay confirmed the reactivity of the fabs with osteosarcoma cells (figure 1). the vh and vl coding regions of the 20 most reactive clones were determined by sequencing (figure 2). analysis of the deduced amino acid sequences of the corresponding v genes indicated that all vh and v chains were distinct from the sequences (51 vh and 74 v) previously described from the original library of randomly chosen clones. the vh sequences revealed that all clones belonged to the vh3 family and that their cdr3 varied in length from 6 to 14 amino acid residues. the majority of the clones (12/20) had a vh3-7 gene segment and a cdr3h of eight amino acids in length. the presence of the amino acid cysteine (c) at position 79 in framework 3 is a striking characteristic, and it was found in 12 clones harboring the vh3-7 gene segment, as can be seen in the n-h7 clone. the amino acid sequences encoded by the v genes also differed from those reported for the unselected repertoire. the o2 v family clones n-e8 and o-c10 had a conservative valine substitution at position 48 (i48v), and clones o-f4 and o-g11 (b3 v family) had a nonconservative phenylalanine substitution at this same position (i48f). this rare mutation is reported to occur in less than 1% of the v sequences, and was present in different clones of the original library. the b3 family clones also presented a previously observed conservative change at the key position 64 (g64a). the predominance of clones harboring the vh3.7 (12/20) and a17 (11/20) gene segments supports the specific ligand selection. based on the results of the elisa and the dna sequencing, we chose five different fabs for further analysis emphasizing their reactivity. the clones chosen were: n-h7 (vh3-7a17, frequency 11/20), n-e8 (vh3-23o2, frequency 1/20), n-h10 (vh3-20a30, frequency 1/20), o-f4 (vh3-23b3, frequency 1/20) and og-11 (vh3-74b3, frequency 2/20). the fabs were produced in 100 ml cultures and purified using metal affinity columns before use in further analyses. immunoblot experiments were carried out for an initial characterization of the molecules in whole cell lysates derived from the osteosarcoma cell line u2-os or from normal fibroblasts that were detected by the chosen fabs. from this analysis, an intense 80 kda band and a weaker 50 kda band were observed for all analyzed fabs, suggesting that all clones recognized the same proteins and that these proteins are present in both osteosarcoma cell lines (saos-2 and u2-os). the same pattern was observed at a lower intensity when normal fibroblasts were probed, suggesting that these proteins are overexpressed in malignant bone cells (figure 3). further analysis of fab reactivity was addressed by comparing the ability of the antibody fragments to bind to monolayers of osteosarcoma cells and normal fibroblasts by cell surface elisa. figure 4 shows the confirmation that the purified fabs recognized a protein present in both kinds of cells (tumor and normal human fibroblast). however, the signal obtained was at least twice as strong for the tumor cells as for the normal fibroblasts, suggesting overexpression of the antigen in the osteosarcoma cells. the clones obtained from selection in saos-2 cells (the n system) were tested against saos-2 and u2-os osteosarcoma cell lines. the clones from the o system were assessed using only u2-os cells in addition to the normal human fibroblasts. the antigen-binding specificity of each selected fab was also evaluated by measuring the cell surface binding capacity using an immunofluorescence assay. considering that the five fabs apparently recognized the same protein, further investigations were done mainly with the n-h7 (figure 5, panels (a) and (b)) and o-g11 (figure 5, panel (c), (d), (e) and (f)) fabs. these fabs were chosen based on the frequency of n-h7, whose vh and vl sequences were shared with 10 other selected clones, and on singularity of o-g11, as it came from the third round of the o system, after depletion on normal osteoblast cells. the immunofluorescence staining pattern suggested that these two fabs interact with a cell membrane component. the staining was dot like for the osteosarcoma cell line u2-os (figure 5, panels (b) and (d)), but only a vague staining was observed for the normal fibroblasts (figure 5, panels (a) and (c)). immunohistochemistry analyses performed using archived normal bone and osteosarcoma sections confirmed the membrane staining pattern. panels (e) and (f) of figure 5 show the reactivity of the o-g11 fab in a normal bone section and in an osteosarcoma section, respectively. there was visible staining in the bone marrow adipocytes and in the osteoblasts in the normal tissue (figure 5, panel (e)), but staining was less intense than the staining observed in osteosarcoma tissues (figure 5, panel (f)). this work has focused on the isolation of antibodies against osteosarcoma cells using a human fab phage display library that was constructed from antibody repertoires of osteosarcoma patients. the selection was accomplished using whole cells as the antigen source, with the goal of isolating novel antiosteosarcoma antibodies. this strategy poses an advantage over the traditional strategy using protein extracts, as the library probes the cell surface allowing the identification of protein and nonprotein antigens. despite some intrinsic difficulties, such as the binding to a rare antigen and the loss of nonbinder phages associated with this approach, is the brasil method, described as a very efficient way to rescue ligand phages. until now, this technique has been used only with peptide libraries [18, 19]. we performed three rounds of selection, and the reactivity analysis of the second and third rounds revealed that after two rounds we were able to identify fabs that bind to osteosarcoma cells. the ability to select specific tumor binders is usually attributed to the depletion step, but the omission of this step does not impair the isolation of specific binders [21, 22]. our data suggest that the introduction of a negative selection step (only before the third selection cycle for the o system) did not significantly improve the isolation of specific fabs, since the n and o fabs apparently recognized the same antigen (figure 3). the lack of more effective selection in the o system could also be a consequence of the small number of positive clones in round 2, just prior to the depletion step (table 1). selected fab clones were chosen based on their fab coding sequences (figure 2) and on their reactivity to tumor antigens assayed as a monolayer of osteosarcoma cells (table 1) and total protein extracted from cells (table 1, and figure 1). these assays were carried out to favor the binding of antibodies that recognize the physiological conformations of the antigen(s). the five clones that were further characterized all recognized the same antigen (figure 3), despite the fact that some of them reacted differently in the cell elisa or protein elisa assays, suggesting that these fabs may recognize different epitopes. comparing the elisa results (figures 1 and 4), we observed that the results were similar if we used fibroblasts or normal osteoblasts, as negative controls. also, it is remarkable that the majority of these clones (11 out of 20) harbored the same sequence (a17, for v and vh3.7 for the heavy chain, figure 2). this can not be attributed to a bias in the fab library, since all of the sequenced clones from rounds two or three had different vh and v sequences compared to the original library. the emergence of clones with a restricted diversity of v gene fragments is a feature that accounts for the selection of specific ligands, as was reported when other antibody phage display libraries were used to isolate high affinity immunoglobulins [22, 24]. clones sharing vh3-7 and a17 were the majority of the clones identified in our selection process. there was one exception among the 20 sequenced clones: clone n-b1, which has the vh3-7 gene associated with an a30 v gene. the effect of this rare association on affinity and selectivity can be further addressed. apparently, all of the five chosen clones, each representing a distinct gene family, recognized the same protein profile. this was also true for fabs selected against different osteosarcoma cell lines, saos2 and u2-os (clones from the n and o systems, resp.). similar results have been reported by aryee and coworkers regarding six different scfvs selected against fli1. the immunodominance phenomenon has been frequently observed in phage display analysis. in two separate studies with melanoma, one using a scfv phage display library constructed from blood from melanoma patients and the other using an fab library, the authors were able to isolate only one positive scfv and fab, respectively [26, 27]. this is in agreement with our results using two different cell lines, saos-2 and u2-os, as the antigen source. this does not exclude the possibility of binding to different epitopes on the same protein, and further epitope mapping must be carried out. another interesting characteristic was the ability of the selected antibody to bind to the antigen in both native and denaturing conditions (figures 1(a), 1(b) and 3), suggesting a linear rather than a conformational epitope. the immunofluorescence staining pattern (figure 5) was typical for fabs recognizing a membrane-associated ligand, as expected for a cell surface selection procedure. the background in immunohistochemestry was high, and although it was possible to see staining of normal cells, the staining was stronger with the osteosarcoma tissues. the o-g11 fab gave a very strong background even when used as much as 1: 20 000 dilution (estimated concentration of 0.1 ng/ml). usually the concentration of commercial antibodies is about 200 g/ml, and they are used at dilutions of 1: 501: 200 in immunohistochemistry assays. o-g11 recognized the osteoblasts in a very strong way and also reacted with adipocytes in the bone medulla but did not stain the blood vessel (data not shown). it is difficult to measure the strength of the signal in osteosarcoma cells and compare it to the signal strength from normal controls in cell imaging approaches, such as immunofluorescence and immunohistochemistry. the higher level of the antigen in the osteosarcoma cells was confirmed by cell surface elisa (figure 4). in these assays our results showed that the antigen recognized by these fabs was expressed at a level two times higher in the osteosarcoma cells than in normal tissue. this antigen is a potential marker for osteosarcoma, and investigation into the identity of this antigen should be completed. in conclusion, this work describes the isolation of five different human fabs that recognize osteosarcoma-associated antigens. these monoclonal antibody fragments harbored different vh and vl domains but apparently recognized the same protein. our data suggest that this protein epitope is found in lower amounts in normal cell lines than in osteosarcoma cell lines and is an immunodominant antigen. as these are fully human antibodies, they can be further characterized, aiming their use as biopharmaceuticals.

osteosarcoma, a highly malignant disease, is the most common primary bone tumor and is frequently found in children and adolescents. in order to isolate antibodies against osteosarcoma antigens, a combinatorial osteosarcoma fab library displayed on the surface of phages was used. after three rounds of selection on the surface of tumor cells, several osteosarcoma-reactive fabs were detected. from these fabs, five were better characterized, and despite having differences in their vh (heavy chain variable domain) and v (kappa chain variable domain) regions, they all bound to a protein with the same molecular mass. further analysis by cell elisa and immunocytochemistry suggested that the fabs recognize a membrane-associated tumor antigen expressed in higher amounts in neoplasic cells than in normal tissue. these results suggest that the human fabs selected in this work are a valuable tool for the study of this neoplasia.

PMC2796230

pubmed-1168

knee osteoarthritis is known to cause not only restrictions in joint functions, but also major problems, such as the wear of articular cartilage and pain due to inflammatory damage to the surrounding tissues1, 2. if the pain due to osteoarthritis persists chronically, cytokines will increase in the spinal cord due to inflammatory stimulation coming from peripheral regions, and the increase in cytokines will induce inflammatory responses to cause damage to spinal cord nerve cells. if pain signals continuously extend from the peripheral joint regions to the spinal cord, spinal cord nerve cell damage will increase to develop chronic pain along with neuropathic pain, such as hyperalgesia3. in this case, to regenerate the synapses of damaged spinal cord nerve cells, growth-associated protein-43 (gap-43), which is a substance related to nerve regeneration, increases in the posterior horn of the spinal cord4. among the many methods of treating osteoarthritis patients, exercise not only reinforces the regenerative capacity of articular cartilage and improves the collagen synthesis network, but it also strengthens the muscles and ligaments around the knee joints5. in addition, exercise is known to not only suppress the production of pre-inflammatory cytokines, such as il-6, il-8, and tnf-, and increase the secretion of il-10, which has anti-inflammatory effects to reduce inflammatory responses in the joints and the spinal cord, but it also increases the expression of neurotrophic factors, increased neurotrophic factor expression could promote the gap-43 expression, thereby enhancing the nerve regeneration capacity3, 6, 7. as such, the purpose of exercise treatment for osteoarthritis patients is to not only enhance joint functions, but also relieve pain, thereby enhancing quality of life. therefore, the present study was conducted to examine the effects of exercise on the recovery of spinal cord nerve cells damaged due to pain signals, which are a major symptom of osteoarthritis. experimental procedures were performed in accordance with the protocols established by the institution of animal care and use committee (iacuc) at the daegu university, based on the nih guidelines for the care and use of laboratory animals (nih, 1996). adult male sprague-dawley rats (810 weeks of age, weight 250300 g, n=40) were used and housed at a controlled temperature at 25 2 c with 12 h light/dark cycle and free access to food and water. induction of osteoarthritis by monosodium iodoacetate (mia, sigma, st louis, mo, america) was performed briefly, 3 mg mia in 50ul saline was injected through the patella tendon into the right knee joint8. injected rats were randomly divided into 4 groups: sham control group without mia injection (sg), control group with injected mia (cg), oa without exercise (neg), oa with exercise (eg). three weeks after oa induction, exercise group was habituated on motor-driven treadmill at a speed of 10 m/min for 2 days to reduce their stress. the exercise group was submitted to 4-week training program on a treadmill for 5 days/week, 30 min/day, 16 m/min velocity which corresponded to approximately 6070% vo2 max. spinal cord were removed, postfixed for 30 min, then rinsed and stored in 0.2 m phosphate buffer (pb) overnight. spinal cord were sectioned with a microtome in serial section of 30 um, collected on slides and sections were performed immunohistochemistry. briefly, sections were rinsed 5 min and incubated for 1hr rt in tbs (tris-buffered saline) containing 5% donkey serum (sigma aldrich, wien, austria), 1% bsa (bovine serum albumin, sigma-aldrich). the sections were incubated for immunohistochemistry with the primary antibody (rabbit polyclonal gap-43, 1:500, chemion international, usa) overnight at 4c. subsequently, the sections were rinsed 5 min, after which the abc complex (vector laboratories) was applied to each section for 1hr at room temperature, antibody binding was visualized using a commercially available dab substrate solution (vector laboratories). for quantitative analysis of positive immunoreactivity was measured using computer-assisted image analysis and is reported here as the proportional area of tissue occupied by immunohistochemically stained. data was calculated by pixel and were analyzed using spss for windows version 18.0. and expressed as mean standard deviation (sd). in this study, a results of measuring the expression of gap-43, gap-43 was observed in all groups, showed that the significant difference in each group (table 1table 1.the comparison of expression of ngf in spinal cord between four groups unit; pixelexpressions of gap-43 (mean sd)group (n=40)sg (n=10)cg (n=10)neg (n=10)eg (n=10)8,306.6 541.711,558.2 881.618,213.5 603.322,986.4 1239.6sg: sham group; cg: control group; neg: no exercise group; eg: exercise group; mean sd: mean standard deviation. significant difference from sg., significantly higher gap-43 expression were found in neg and eg groups. in particular, it was confirmed that the highest expression of gap-43 in the group which performed treadmill exercise. sg: sham group; cg: control group; neg: no exercise group; eg: exercise group; mean sd: mean standard deviation. if the pain signals generated by the knee joint are continuously delivered to the spinal cord, cytokines, which are an inflammation-inducing substance, will increase in the spinal cord to cause inflammatory responses in the spinal cord so that nerve cells are damaged and the sensory neurons in the spinal dorsal horn become sensitive, resulting in the occurrence of neuropathic pain, such as hyperalgesia4, 9. when the central nervous system s nerve cells have been damaged, activities for the protection and regeneration of the damaged region increase. astrocytes, which are neuroglia cells, proliferate, neurotrophic factors, such as ngf, brain-derived neurotrophic factor (bdnf), and neurotrophic-3 (nt-3), increase, and these neurotrophic factors lead to increases in the expression of gap-43, which acts directly in the secretion of neurotransmitters and axonal regeneration10, 11. in the present study, to examine whether exercise affects the expression of gap-43, which plays important roles in nerve cell regeneration and recovery in osteoarthritic white rats spinal cords, rats were induced to perform treadmill exercises, and the state of the expression of gap-43 in the posterior horn of the spinal cord was examined through immunohistochemical staining. upon examining the state of the expression of gap-43, it could be seen that gap-43 increased in the cg compared to the sg, and this can be judged as indicating spinal cord nerve cell damage due to osteoarthritis, as presented in a study conducted by orita et al. in addition, orita et al. observed the gap-43 expression in the spinal cord, which did not clearly increase at the early stage of the onset of osteoarthritis, but it remarkably increased from 14 days after the onset, and the lesion progressed to 28 days after the onset when the experiment terminated. this is consistent with the results of the present study, indicating that the gap-43 expression significantly increased in the neg compared to in the cg. therefore, gap-43 seems to have increased over time through natural healing to heal the damaged nerve cells. the significantly higher expression could be seen in the eg, which performed exercise, compared to the neg. based on the results of an analysis of previous studies, this result can be judged as indicating that the damaged nerve cells were actively being recovered as gap-43 increased thanks to exercise. when the above-mentioned results were viewed comprehensively, it could be seen that exercise increased the gap-43 expression in the spinal cord to promote the regeneration of spinal cord nerve cells damaged due to chronic osteoarthritis. also, the increase in the regeneration of nerve cells damaged due to inflammatory responses is thought to have positive effects on treatment for pain relief.

[ purpose] the purpose of the study was to investigate the effects of exercise on the recovery of spinal cord nerve cells damaged due to pain signals which are a major symptom of osteoarthritis. [subjects and methods] adult male sprague-dawley rats (n=40) were used and induction of osteoarthritis by monosodium iodoacetate. injected rats were randomly divided into 4 groups: sham control group without mia injection (sg), control group with injected mia (cg), oa without exercise (neg), oa with exercise (eg). sham control group was injected normal cell line instead of mia. the exercise group was submitted to 4-week training program on a treadmill for 5 days/week, 30 min/day, 16 m/min velocity, then spinal cord were removed and measured the gap-43 expression by immunohistochemistry analysis. [results] in this study, a results of measuring the expression of gap-43. gap-43 was observed in all groups, showed that the significant difference in each group. [conclusion] it could be seen that exercise increased the gap-43 expression in the spinal cord to promote the recovery of spinal cord nerve cells damaged due to chronic osteoarthritis.

PMC5088153

pubmed-1169

dyspnea is the aversive and threatening cardinal symptom in prevalent diseases such as asthma and chronic obstructive pulmonary disease (copd) and associated with great individual and socioeconomic burden. in chronic respiratory conditions the adequate perception of dyspnea plays a key role as it has a strong influence on health behavior and course of disease. notably, the perception of dyspnea is not tightly related to objective lung function but is modulated by cognitive and affective factors [36]. the few available neuroimaging studies investigating the neural processing of dyspnea [714] a dual pathway model has been suggested [15, 16] with one pathway including ventroposterior thalamic areas and sensorimotor cortices processing the sensorimotor aspects of dyspnea. the second pathway including medial-dorsal thalamic areas, insula, amygdala, and cingulate cortex is believed to process the affective aspects of dyspnea. of all these areas the paralimbic insula with its implication in interoceptive and emotion-related processing seems to play a key role [4, 11, 16, 17]. notably, recent studies have demonstrated that negative emotions are related not only to increased perception but also to changes in the neural processing of dyspnea. patients suffering from chronic dyspnea tend to avoid discomfort by reducing daily-life physical activities. in particular the fearful anticipation of dyspnea has been hypothesized to lead up to this spiral of decline. indeed, recent studies demonstrated that the anticipation of dyspnea is associated with increased physiological fear responses, especially in anxious individuals. although the fearful anticipation of dyspnea might play a fundamental role for disease progression the underlying brain processes have rarely been studied. investigations on the anticipation of pain, a similarly aversive bodily sensation, indicate that pain-sensitive areas are already activated during pain anticipation [2325]. moreover, brain activation during pain anticipation predicts and influences the subsequent perception and neural processing of pain [2729]. anticipatory changes of brain function in areas with high importance for emotion processing such as insula, anterior cingulate cortex (acc), amygdala, and midbrain/periaqueductal gray (pag) were particularly relevant [26, 30, 31]. if brain activation during the anticipation of dyspnea would indeed influence and shape subsequent dyspnea perception, this might be particularly relevant for a better understanding of dyspnea avoidance behavior in patients suffering from chronic dyspnea and for the development of tailored treatment strategies. therefore, we used functional magnetic resonance imaging (fmri) to investigate the brain processes underlying the anticipation of resistive-load-induced dyspnea in healthy volunteers. specifically, we tested the hypotheses that the anticipation of dyspnea is processed in brain areas related to the perception of dyspnea and would involve prominent activations in emotion-related areas. moreover, we hypothesized that brain activation during dyspnea anticipation would relate to brain activation during subsequent dyspnea perception. we recruited 46 healthy subjects without history of respiratory disease from a large database of genotyped individuals (table 1). genotype related differences concerning the neural processing of dyspnea as well as habituation effects have been reported elsewhere [32, 33] while the current analyses specifically focus on anticipatory processes. all data were collected on one day and normal lung function (forced expiratory volume in one second in% predicted>80%) was confirmed by standard spirometry on the day of the experiment. written informed consent was obtained prior to the study. the study protocol was approved by the ethics committee of the medical association hamburg (pv3662). volunteers breathed through a face mask connected with an mri compatible pneumotachograph (zan 600 unit, zan messgerte gmbh, oberhulba, germany). the set-up contained ports for recording of end-tidal co2 pressure (petco2) and peak inspiratory mouth pressure (pi) and a two-way nonrebreathing valve. the inspiratory port of the valve was connected to a 2.6 m tube for the easy manual introduction and removal of mr-compatible resistive loads in the scanner environment by the experimenter. this breathing circuit allowed continuous measurements of respiratory parameters including petco2, peak inspiratory pressure, tidal volume (vt), breathing frequency (f), minute ventilation (ve), and inspiratory time (ti). we explained dyspnea to our participants as a sensation of difficult and uncomfortable breathing. in a pretest subjects were placed in a supine position and presented with inspiratory resistive loads of increasing magnitude. each load was presented for 24 s and dyspnea intensity subsequently rated on a borg-scale (0= not noticeable to 10= maximally imaginable). load magnitude was increased until subjects reliably reported a sensation of severe dyspnea (borg score 5). the respective load was then used to induce severe dyspnea during scanning (mean load resistance=2.23 kpa/l/s, sd=1.18). for the baseline condition of mild dyspnea the smallest resistive load that was reliably rated as different from unloaded breathing was used (mean load resistance=0.25 kpa/l/s, sd=0.18). subjects learned the association of colored cues in the shape of a cross and experimental conditions both during a computer-based standardized instruction outside the scanner and during a short test run within the scanner where subjects were also acquainted with the button response system. thus, subjects were well familiar with the cue, stimulus association prior to the acquisition of functional mri data. immediately after pretest and standardized instructions, subjects entered a 3-tesla trio-magnetom scanner (siemens, medical solutions, erlangen, germany) with the face mask tightly fitted. visual cues and borg-scales were projected into the scanner bore via a mirror and condition markers were sent to zan-system using presentation software (neurobehavioral systems, inc., subjects were presented with the visual color-coded cue for either mild or severe dyspnea followed by the respective load (figure 1). each anticipatory period lasted for 6 s. then the cue, a thin cross, turned into a solid cross and the preselected load was introduced manually for 24 s as in our previous fmri studies using similar stimuli [11, 12]. each load was followed by two borg rating scales: one on dyspnea intensity and one on dyspnea unpleasantness during the preceding block. following the final dyspnea ratings subjects were presented with two additional borg-scales asking to indicate the level of fear experienced on average during the cue conditions (anticipation) of mild and severe dyspnea, respectively (figure 1). immediately following the brain scan subjects rated the perceived quality of dyspnea on a verbal descriptor list outside the scanner. imaging was performed on a 3-tesla trio-magnetom scanner (siemens, medical solutions, erlangen, germany) using a standard 32-channel head-coil. for each data volume we acquired 48 continuous axial-slices in descending order with 2 2 mm in-plane resolution, 2 mm slice thickness, and a 1 mm gap using t2-weighted parallel echoplanar imaging (tr=2870 ms, te=25 ms, flip angle=80, and field of view=208 208 mm) with grappa acceleration (r=2). depending on the time spent on ratings subjects needed 1318 min to complete the protocol. following fmri, we acquired a high-resolution t1-weighted structural brain scan using a standard mp-rage sequence (1 1 1 mm spatial resolution, tr=2300 ms, te=2.98 ms, flip angle=9, and field of view=256 256, 240 slices). means of intensity, unpleasantness, and anticipatory fear ratings were compared between mild and severe dyspnea conditions using paired t-tests. respiratory parameters for each block and condition were analyzed as dependent variables in separate one-way repeated measures anovas across the four conditions (anticipation mild, mild dyspnea, anticipation severe, severe dyspnea) followed by bonferroni-corrected paired t-tests to further explore significant main effects. analyses were calculated with spss 20.0 software (spss inc., chicago, il) using a significance level of p<0.05. all steps of fmri data preprocessing and statistical analysis were carried out using spm8 (http://www.fil.ion.ucl.ac.uk/spm/), with the exception of noise-correction, which was carried out using fsl-melodic 3.0. from the ten presented blocks of each condition, the first two blocks of each condition (i.e., 2 anticipation mild, 2 mild dyspnea, 2 anticipation severe, and 2 severe dyspnea) served as adaptation phase and did not enter the analyses. a custom template within standard space was created from the t1 images of all participants using the dartel-protocol implemented within spm8. after normalization to the custom-made t1-template using linear and nonlinear transformations, noise was identified based on a probabilistic independent component analysis. preprocessed data were whitened and projected into a 40-dimensional subspace using principal component analysis and further decomposed into sets of vectors that describe signal variation across the temporal domain (time courses) and across the spatial domain (spatial maps) by optimizing for non-gaussian spatial source distributions. each component was categorized as either function-related (resting-state networks or paradigm related) or noise-related (e.g., noise due to respiration, cardiac activity, motion, or scanner drifts) by considering the spatial pattern, the time course, and the power distribution following a heuristic described by kelly et al.. two independent raters showed high interrater agreement (96.6%, cohen's kappa=0.8). noise-corrected functional data were smoothed using an 8 8 8 mm full-width at half-maximum gaussian filter. for statistical analysis data were high-pass filtered with a 128 s cut-off, while serial correlations were accounted for by using an autoregressive model. data modeling on the first level involved separate regressors for each condition (cue mild, mild dyspnea, cue severe, severe dyspnea, and ratings) based on the canonical haemodynamic response function implemented in spm8. on the subject-level we contrasted cue severe with cue mild and severe with mild resistive-load-induced dyspnea to extract brain areas that show more activation during the anticipation and perception of severe versus mild dyspnea, respectively. these two contrast images per subject were then entered into separate random-effects group analyses. next, we investigated how dyspnea-related brain areas that also showed activation during dyspnea anticipation interacted with other brain areas during the anticipation of severe as compared to mild dyspnea. for these psychophysiological interactions (ppi), we extracted the average individual time courses from a volume centered on the peak voxel of the (anticipation severe versus anticipation mild) contrast for each of the investigated areas (left insula, parietal operculum, and cerebellum, see results) and used the anticipation of severe versus mild dyspnea as modulatory experimental factor. given the assumed prominent role of the insular cortex in processing the affective qualities of perceived dyspnea [11, 16, 39, 40], we investigated the influence of brain activation during dyspnea anticipation on individual average right insular activation during the subsequent perception of resistive-load-induced dyspnea. individual parameter estimates from the perception contrast (severe dyspnea versus mild dyspnea) served as covariate for the anticipation contrast (anticipation severe dyspnea versus anticipation mild dyspnea). finally, we were interested how anticipatory fear is related to anticipatory brain activation by using individual ratings of anticipatory fear (fear during anticipation of severe dyspnea minus fear during anticipation of mild dyspnea) as covariate for the anticipation contrast (anticipation of severe dyspnea versus anticipation of mild dyspnea). for statistical inference on our results, we used a two-step approach: first, we tested for significantly increased activation throughout the entire brain exceeding a whole-brain family-wise error corrected threshold of p<0.05 within a cluster of more than 30 contiguous voxels. for the second analysis we chose the following bilateral regions of interest (rois): insula, anterior cingulate cortex, amygdala, and a midbrain-region including the pag. bilateral masks for insula, anterior cingulate cortex, and amygdala were generated from the automated anatomical labeling (aal) template described by tzourio-mazoyer et al.. a midbrain roi centered on pag was defined using an 8 mm sphere around the average coordinates for pag activation reported by linnman et al.. the selection of these rois was based on results of previous studies on the anticipation of aversive stimuli including pain [26, 30, 31, 4345]. activation within each roi was considered significant, if exceeding a threshold of p<0.05 after family-wise error correction within the roi. as expected, post hoc t-tests showed significantly increased peak inspiratory mouth pressure and inspiratory time, as well as decreased breathing frequency during severe compared to mild dyspnea. during the two anticipation periods subjects showed similar breathing patterns with no significant differences in respiratory parameters except for petco2, which was slightly lower during the anticipation of severe as compared to mild dyspnea. similarly, subjective dyspnea ratings confirmed successful induction of mild and severe dyspnea, respectively (figure 2). ratings for intensity and unpleasantness of resistive-load-induced dyspnea were significantly higher during severe (mean/sd=4.6/1.3 and 3.5/1.6, resp.) than during mild dyspnea (mean/sd=0.8/0.5 and 0.5/0.6, resp.). likewise, the anticipatory fear was significantly stronger for severe as compared to mild dyspnea (mean/sd=2.7/2.5 and 0.4/0.8, resp.). verbal descriptor ratings revealed that resistive-load-induced dyspnea was mainly perceived as increased work and effort of breathing. when contrasting the perception of severe dyspnea with mild dyspnea the whole-brain analysis confirmed the activation of a bilateral cortical network with activation peaks in pre- and postcentral cortices, sma, parietal opercular cortex, cerebellum, and right insular cortex (table 3). the roi-based analysis yielded additional significant activation of the left insula (figure 3(a), table 3). for anticipation of severe dyspnea versus anticipation of mild dyspnea the whole-brain analysis yielded significant activation that localized to the bilateral occipital pole and the left parietal operculum and cerebellum (table 4). further activation was found in bilateral insular cortex, which proved significant for the left anterior insular cortex in the roi-based analysis (figure 3(b), table 4). activation during dyspnea anticipation and dyspnea perception showed substantial overlap within the parietal operculum and the cerebellum (6th cerebellar lobule), while insular activation during dyspnea anticipation was more anterior compared to insular activation during dyspnea perception (figure 3(c)). next, we investigated the interactions between anterior insula, parietal operculum, and the 6th cerebellar lobule with other brain areas during the anticipation of dyspnea using ppis. however, the roi-based approach showed significantly increased interactions of left anterior insula and parietal operculum during dyspnea anticipation with the right insular cortex and the acc (figures 4(a) and 4(b)). the left 6th cerebellar lobule showed a significantly increased interaction with bilateral amygdala (figure 4(c)). furthermore, we looked at the relationship of right insular activation during dyspnea perception with anticipatory brain activation. the roi-based analysis showed that right insular activation during dyspnea perception was significantly correlated with activation in the midbrain/pag during the anticipation of severe versus mild dyspnea (figure 5(a)). ratings of anticipatory fear revealed a significant positive correlation with anticipatory brain activation within acc and right insular cortex in the roi-based analysis (figure 5(b)). the present study investigated brain activations associated with the anticipation and perception of resistive-load-induced dyspnea in healthy subjects. our analyses confirmed the involvement of a previously described set of brain areas for the perception of dyspnea [4, 16, 17]. this network included sensorimotor areas (pre- and postcentral gyri, sma, and parietal operculum), bilateral insular cortex, and the cerebellum. importantly, within the insular, parietal opercular, and cerebellar cortex activation was already increased during the anticipation of dyspnea. anticipatory and dyspnea-related activation overlapped within parietal operculum and cerebellum, while activation within the insular cortex was more anterior during anticipation as compared to perception of resistive-load-induced dyspnea. during the anticipation of dyspnea, left anterior insula and parietal operculum showed increased connectivity with acc and right insular cortex, while the cerebellum showed increased interaction with the bilateral amygdala. notably, midbrain/pag activation during dyspnea anticipation correlated with right insular activation during the subsequent perception of dyspnea. finally, activation in the right insular cortex and acc during the anticipation of dyspnea showed a significant positive correlation with anticipatory fear. taken together, the present study reveals prominent activation in several emotion-related brain areas during the anticipation of resistive-load-induced dyspnea, which were paralleled by increased anticipatory fear. thus, both behavioral and functional brain data underline the relevance of affective processes during the anticipation of dyspnea, which in turn partly relate to the subsequent processing of perceived dyspnea. first, conditioning studies demonstrated increased physiological fear responses during the anticipation of dyspneic breathing occlusions and hyperventilation including increased startle reflex magnitudes [21, 22]. the present study extends these findings to increased subjective fear reports and the involvement of fear-related brain areas during the anticipation of resistive-load-induced dyspnea. second, studies examining the anticipation of other aversive stimuli such as pain [23, 30], restricted breathing, negative affective pictures [43, 44], monetary loss, and hyperventilation cues reported comparable activations in emotion-related brain areas as the present study. these included prominent activations in anterior insula, amygdala, anterior cingulate cortex, and pag. these areas, especially amygdala and insula, have also been described as parts of a salience network for the detection of threatening stimuli. third, studies comparing anticipation with perception of aversive stimuli such as pain similarly demonstrated overlapping brain activation patterns [2325, 30]. more specifically, the prestimulus connectivity of anterior insula and midbrain/pag and anticipatory activation in anterior insula, anterior midcingulate cortex, and amygdala have been found to influence both, brain activation during actual pain perception and behavioral markers of pain. fourth, previous studies have linked activation in insula and extended amygdala to the affective unpleasantness of dyspnea [11, 40]. this supports the suggested relevance of these two brain areas for affective responses (e.g., fear) towards upcoming dyspnea, which is further supported by the present correlation between anticipatory fear ratings and anticipatory insular activity. finally, overlapping activation for dyspnea anticipation and perception localized to the 6th cerebellar lobule. this cerebellar subdivision has been shown in neuroimaging and lesion studies to be relevant for emotional processes [49, 50] including the processing of different aversive stimuli such as pain and negative affective pictures. although cerebellar activation has frequently been reported for various dyspneic stimuli [8, 9, 5254], its particular contribution to dyspnea perception is only poorly understood. the present observation of anticipatory activity paralleled by strong amygdala interactions is in line with a previously suggested involvement in both, sensorimotor and affective aspects of dyspnea. the present findings suggest a neural correlate for the recently proposed link between anticipatory fear and later avoidance behavior as one underlying cause of negative health outcome in chronic dyspnea. several clinical studies [6, 55] have demonstrated that dyspnea specific fears or worries about physical exercise are related to worse performance in exercise tests and worse outcome of pulmonary rehabilitation in patients with copd. these findings suggest that irrespective of disease severity anticipatory fear of dyspnea leads to unfavorable health behavior such as avoidance of higher exercise levels. a similar connection between fear of bodily symptoms (e.g., lower back pain), avoidance behavior, and subsequent negative course of disease has already been established in the fear avoidance model of pain. notably, pain research has already demonstrated the beneficial effects of cognitive behavioral treatments for reducing anticipatory fear of pain and improving the course of disease. although dyspnea and pain are processed by distinct neural pathways, similarities concerning the emotion-related processes during the anticipation of aversive bodily sensation can be assumed. therefore, adapting these treatments that have been proven successful in chronic pain to the treatment of anticipatory fear of dyspnea in patients suffering from chronic dyspnea seems promising. findings of reduced gray matter volume in, for example, acc and amygdala, in patients suffering from chronic obstructive pulmonary disease provide first evidence that chronic dyspnea indeed impacts the neural structure of emotion-related areas, potentially related to anticipatory fear. the following limitations of the present study should be kept in mind: to keep the contingency of anticipation and dyspnea periods, anticipatory fear was not assessed immediately after each anticipation cue. a prompt rating after the anticipation period would certainly allow a more precise assessment of anticipatory fear and would also reflect potential fluctuations over time. next, we investigated resistive-load-induced dyspnea causing a sensation of increased work and effort of breathing. thus, our results can not be generalized to other qualities of dyspnea such as air hunger and chest tightness. furthermore, our data on predominantly young healthy subjects can not be generalized to older subjects in general and subjects suffering from chronic dyspnea in particular. therefore, further research is needed to investigate whether anticipatory fear and respective brain activation patterns within our experimental setting are suitable approximations to understand avoidance behavior in everyday life including reduced physical activity in patients suffering from chronic dyspnea. respective findings would open a new avenue to behavioral training aimed at reducing anticipatory fear of dyspnea in the treatment of chronic dyspnea. furthermore, anticipatory midbrain/pag activation was associated with subsequent dyspnea-related activation of the insular cortex. during dyspnea anticipation the prominent involvement of emotion-related areas such as insula, acc, and amygdala is suggested as potential correlate of anticipatory fear of dyspnea, which might underlie the development of unfavorable health behaviors in patients suffering from dyspnea.

dyspnea is common in many cardiorespiratory diseases. already the anticipation of this aversive symptom elicits fear in many patients resulting in unfavorable health behaviors such as activity avoidance and sedentary lifestyle. this study investigated brain mechanisms underlying these anticipatory processes. we induced dyspnea using resistive-load breathing in healthy subjects during functional magnetic resonance imaging. blocks of severe and mild dyspnea alternated, each preceded by anticipation periods. severe dyspnea activated a network of sensorimotor, cerebellar, and limbic areas. the left insular, parietal opercular, and cerebellar cortices showed increased activation already during dyspnea anticipation. left insular and parietal opercular cortex showed increased connectivity with right insular and anterior cingulate cortex when severe dyspnea was anticipated, while the cerebellum showed increased connectivity with the amygdala. notably, insular activation during dyspnea perception was positively correlated with midbrain activation during anticipation. moreover, anticipatory fear was positively correlated with anticipatory activation in right insular and anterior cingulate cortex. the results demonstrate that dyspnea anticipation activates brain areas involved in dyspnea perception. the involvement of emotion-related areas such as insula, anterior cingulate cortex, and amygdala during dyspnea anticipation most likely reflects anticipatory fear and might underlie the development of unfavorable health behaviors in patients suffering from dyspnea.

PMC5018326

pubmed-1170

it provides an impervious seal, fills the irregularities and minor discrepancies between the root canal wall and core filling material, and assists in microbial control if microorganisms were left on the root canal walls or in the tubules.[15] ideally, a thin layer of the sealer should be evenly applied to canal walls prior to the placement of the core filling material. the thickness of the endodontic sealer layer is very influential in the quality of the root canal filling.[612] an inadequate sealer coating may result in voids and permit bacterial microleakage which leads to endodontic failure. on the other hand, excess placement of the sealer can result in its extrusion beyond the apical foramen which can prevent or delay healing. moreover, most sealers dissolve over time and the dissolution is probably responsible for the increase in leakage along the root fillings over time.[1720] therefore, the amount of sealer should be kept to a minimum and should only be found in a thin layer between the gutta-percha and the wall of the canal. several techniques of sealer placement have been described in the literature, such as the use of a file, lentulo spiral, absorbent paper point, gutta-percha cone, and an ultrasonic file. each technique may produce different distribution of the sealer onto the canal walls, which may affect the sealing. at present, there is no evidence to suggest that one method is better and reliable than others. hence, the purpose of this study was to evaluate the influence of three most commonly used methods of sealer placement on the sealing ability of the sealer. one hundred and nineteen (119) human permanent central incisors teeth that had no caries, restorations, or any other noticeable defects were collected, stored in 0.9% isotonic saline, and used in this in vitro study. the crowns of the teeth were removed at the cementoenamel junction by using a hard tissue cutter (exact, germany) under water cooling. the working length was determined by introducing a size 10 k file into the canal until it could be seen at the apical foramen. this length was measured and the working length was set 1 mm short of the resultant measurement. all the teeth were instrumented to a size f3 protaper (dentsply maillefer, switzerland) following the full sequence recommended by the manufacturer. during preparation and between each protaper file, the canals were irrigated with 2 ml of 5.25% naocl by using a disposable syringe and a 25-gauge needle. also a size 10 hand file was introduced to remove any debris and to ensure the patency of the apical foramen. all root canals were then irrigated with 5 ml of 17% ethylene diamine tetra acetic acid (edta) followed by 5 ml of 5.25% naocl. finally, the root canals were flushed with distilled water and dried with absorbent paper points. the instrumented teeth were divided randomly into 3 experimental groups of 33 teeth each in addition to 2 groups which served as positive and negative control groups of 10 teeth each [table 1]. groups, number of specimens, and sealer placement techniques root canal obturation was performed by using the cold lateral condensation technique. after sealer application according to the groups as shown in table 1, the prefitted size 30 master gutta-percha cone was placed. the process was repeated until the spreader penetrated only into the coronal one-third of the root canal space. excess gutta-percha was removed with a heated instrument and the remainder was condensed vertically with a cold plugger. the teeth were stored in 100% humidity at 37c for 7 days to allow the sealer to set completely. after 7 days the external root surfaces were coated by two layers of nail polish except the coronal orifices. in the positive control group, no sealer was used and the nail polish was applied as the experimental group. while in the negative control group, the instrumented canals were filled with the sealer using rotary lentulo spiral and cold lateral compaction. then, the external root surfaces were entirely coated with two layers of nail polish, including the coronal orifices. each tooth was subsequently immersed in an aqueous solution of 2% methylene blue dye with ph 7.0 in an individual container and kept in the incubator at 37c for 3 days. the specimens were then decalcified in 5% nitric acid for 72 h and dehydrated gradually in ascending concentrations of alcohol to 100%. methyl salicylate was used overnight to clear the teeth. for linear dye penetration assessment, each tooth was sectioned longitudinally by using a hard tissue cutter (exakt, japan). measurements were done by a blinded assessor under a light microscope (leica, germany) at x20 magnification. the coronal leakage was measured to the nearest 0.01 mm, from the coronal end of gutta-percha, to the most apical extent of dye, taking into consideration the region of highest penetration. this was completed using leica image analyzer software (leica, germany), connected to the microscope. ten teeth of each experimental group were randomly selected and dye penetration was measured again after 1 week by the same investigator to determine examiner reliability. the data of the first and second measurements were tested using a single-measured intraclass correlation statistic (icc). the difference in the amount of linear dye penetration between groups was compared using anova. the icc was 0.99 (95% ci: 0.991.00) suggestive of a high examiner reliability. due to technical problems during the experiment, one specimen was lost in group g1, resulting in 32 samples for this group. the positive controls demonstrated complete dye penetration throughout the length of the canal in all teeth. in contrast, the negative controls showed no evidence of leakage in any of the samples. means of linear dye penetration and standard deviations for all groups are summarized in table 2. there was no significant difference (p=0.305) of dye penetration among all groups. one of the objectives of root canal treatment is to provide a hermetic seal of root canal space. this seal is usually produced by using a semisolid or solid core material in a combination with the endodontic sealer. a solid core can not produce the desired hermetic seal; thus, the endodontic sealer is required to provide three-dimensional obturation. the experimental system of this study was tested by using both positive and negative control groups. the positive control specimens showed total dye penetration throughout the root canal, which indicated that it is absolutely necessary to use a sealer to fill voids and gaps between the core material and the root canal walls and further confirmed the fact that filling the root canal with only the core obturating material without a sealer resulted in an increased leakage. however, the negative control specimens demonstrated no dye penetration, which indicated that two coatings of nail polish were an effective means of preventing dye penetration. the results of this study showed no statistically significant difference (p=0.305) in microleakage among the three different tested techniques of sealer placement. however, the rotary lentulo spiral group produced the highest value of microleakage and the master gutta-percha coating group had the smallest mean microleakage value. it was expected that the rotary lentulo spiral group will produce a better adaptation of the sealer onto the canal walls with even thickness which in turn leads to a better seal but the results of this study did not support our assumption. first, more amount of sealer was introduced into the canal as compared with other techniques, and as the sealer shrunk during setting, more gaps and voids might had been created that had contributed to the highest value of microleakage. second, a high volume of the sealer material may also interfere with the placement of additional accessory points which leads to less gutta-percha volume percentage compared to the amount of sealer. third, the use of rotary lentulo spiral during sealer placement may force some air bubbles into the material that will lead to void formation and microleakage, whereas, the endodontic sealer coating of master gutta-percha cone produced less sealer thickness with less potential void formation compared to the other techniques that eventually might have contributed to the smallest microleakage value obtained by this group. our results are in accordance with wiemann et al. 's, who compared the influence of four methods, file, lentulo spiral, ultrasonic files, and master gutta-percha, of sealer placement on the sealer sealing ability. in addition, they reported that less sealer was present in the apical third compared to the coronal and middle thirds of the root canal. kahn et al. investigated the efficacy of six methods of sealer placement using clear plastic blocks with simulated curved canals. they concluded that the lentulo spiral and the max-i-probe delivery system were the most effective means of sealer placement, followed by ultrasonic and sonic files, and the least effective methods were the paper point and the k file. in this study, the three methods of sealer placement showed comparable results and could be used in clinical practice. however, as the master gutta-percha coating technique had produced the lowest microleakage values, it would be suggested to be used for better results. the master gutta-percha coating technique is the simplest method among the three methods tested and it requires no additional instruments and procedures. further research perhaps is needed to study the effect of different sealer placement methods with different obturation techniques. within its limitations, this study showed that the three tested techniques of sealer placement provided a comparable seal. however, the master gutta-percha coating technique could be preferable as it produced the least leakage value, and no extra instrumentation and procedures are needed in its application.

aim: the aim of this in vitro study was to evaluate the sealing ability of an endodontic sealer following different techniques of its placement. materials and methods: a total of 119 permanent human anterior teeth were prepared by using manual protaper and randomly divided into three equal groups of 33 teeth each. the teeth were obturated with the cold lateral condensation technique and ah26 sealer which was placed by using the following: g1: rotary lentulo spiral; g2: manual lentulo spiral; and g3: master gutta-percha coating. the remaining 20 teeth served as positive and negative controls. the samples were immersed in the methylene blue solution for 3 days and longitudinally sectioned for dye penetration assessment and analyzed using a stereomicroscope. results:there was no statistically significant difference (p=0.305) among the three groups. however, the rotary lentulo spiral technique and the master gutta-percha coating technique showed the highest (4.5 mm) and the lowest (3.8 mm) microleakage values, respectively. conclusion:different techniques of sealer placement used in this study provided a comparable seal. however, the master gutta-percha coating technique might be preferable because of its ease of use.

PMC3410337

pubmed-1171

diabetes mellitus is a metabolic disorder in which a combination of hereditary and environmental results in abnormally high blood sugar levels (hyperglycemia). the abnormal high blood sugar level is due to defects in either insulin secretion or insulin action in the body. diabetes mellitus is characterized by hyperglycemia, lipoprotein abnormalities, raised basal metabolic rate, defect in enzymes, and high oxidative stress which induced damage to pancreatic beta cells. it is the most common endocrine disorder that impairs glucose homeostasis resulting in severe diabetic complications including retinopathy, angiopathy, nephropathy, and neuropathy and causing neurological disorders due to perturbation in utilization of glucose. currently, in the united states, up to 1 in 3 new cases of diabetes mellitus diagnosed in youth younger than 18 years is t2 dm, with a disproportionate representation in ethnic minorities, occurring most commonly among youth between 10 and 19 years of age. this trend is not limited to the united states but is occurring internationally; it is projected that by the year 2030, an estimated 366 million people worldwide will have diabetes mellitus. the number of individuals with type 2 diabetes mellitus (t2 dm) is increasing with a rate of three new cases every ten seconds, and it is being diagnosed at younger age. multiple risk factors behind the disease include chronic stress and depression, environmental pollutants and poisons, obesity and overnutrition, and sedentary life style. india having the highest number of diabetic patients in the world, the sugar disease is posing an enormous health problem in the country. calling india the diabetes capital of the world, the international journal of diabetes in developing countries says that there is alarming rise in diabetes in india. an estimated 3.4 million deaths occur due to consequences of high blood sugar. who also estimates that 80 percent of diabetes deaths occur in low- and middle-income countries and projects that such deaths will double between 2005 and 2030. studies have revealed its use in anti-inflammatory, antimicrobial, antioxidant, and anti tumor process. various types of preparations, extracts, and individual compounds derived from this species have been found to possess a broad spectrum of pharmacological effects on several organs such as the brain, blood, and cardiovascular and nervous systems as well as on different biochemical processes and physiological functions including proteosynthesis, work capacity, reproduction, and sexual function. studies are needed to examine the potential use of species of passiflora extract in the prevention of pathologies, such as cardiac ischemia, renal ischemia, and neurodegenerative diseases and diabetes, where oxidative stress damage to protein seems to play a major role. medicinally, the fruit has been used in amazonia as a preventative for yellow fever, gallstones, rabies, and ulcers. that region also prescribes a leaf decoction for preventing malaria and other fevers and for easing stomach upsets. passion fruit is proved to have analgesic (pain-reliever), antianxiety, anti-inflammatory, antispasmodic, cough suppressant, aphrodisiac, central nervous system depressant, diuretic, hypotensive (lowers blood pressure), and sedative activities. besides, it is traditionally reported to possess anticonvulsant, antidepressant, astringent, cardiotonic (tones, balances, and strengthens the heart), disinfectant, nervine (balances/calms nerves), neurasthenic (reduces nerve pain), tranquilizer, and vermifuge (expels worms) activities. it may have promising and powerful effects on neurological disorders and chronic diseases such as heart disease and cancer. so far, no study has been carried out to reveal the antihyperglycemic effect of p. ligularis. this study was undertaken to find out antioxidant and antidiabetic potential in aqueous fruit extract of p. ligularis. fresh fruits of passiflora ligularis were collected from munnar, kerala, and authenticated by dr. g. v. s. murthy botanical survey of india, tamil nadu agricultural university, coimbatore (voucher number bsi/src/5/23/2012/tech/495). the fruits were washed thoroughly with water and the peel was removed; then the pulp was collected. the aqueous extract was concentrated using a rotary evaporator at room temperature for 3 days to obtain a dark brown pigment and weighed. phytochemical screening was done for analyzing the presence of secondary metabolites that are responsible for curing ailments [8, 9]. adult male albino rats weighing about 150200 g were obtained from the animal house of karpagam university, coimbatore, and used for the study. rats were housed at constant temperature of 22 5c with a 12-hour light, 12-hour dark cycle, and fed on pellets with free access to tap water. all the experiments were carried out according to the guidelines recommended by the committee for the purpose of control and supervision of experiments on animals (cpcsea), government of india. the wistar albino rats weighing between 150 and 180 g were used for the study. 250, 500, 1000, and 2000 mg/kg of the aqueous extract of passiflora ligularis were administered orally to four groups of five animals each. another group of five rats served as control and this received 1 ml of physiological saline. they were all placed under observation for 24 hours for the signs of lethality, toxic symptoms, behavioral changes, or deaths. diabetes was induced by a single intraperitoneal injection of streptozotocin (30 mg/kg) in water. hyperglycemia was confirmed after 72 hrs by the elevated blood glucose and the behavioral changes (excess thirst and frequent urination). the rats with blood glucose level more than 240 mg/dl were used for the study. the glucose tolerance test was studied in the aqueous extract of passiflora ligularis on diabetic rats. the animals were divided into 5 groups (n=3) as follows: group 1: control rats; group 2: diabetic control rats; group 3: rats treated with 200 mg/kg of aqueous extract of fruit of p. ligularis; group 4: rats treated with 400 mg/kg of aqueous extract of fruit of p. ligularis; group 5: rats treated with 600 mg/kg of aqueous extract of fruit of p. ligularis. group 1: control rats; group 2: diabetic control rats; group 3: rats treated with 200 mg/kg of aqueous extract of fruit of p. ligularis; group 4: rats treated with 400 mg/kg of aqueous extract of fruit of p. ligularis; group 5: rats treated with 600 mg/kg of aqueous extract of fruit of p. ligularis. fasting blood sample was drawn from the tail and blood glucose level was measured by using heamoglucostrips in glucometer (life scan, johnson and johnson ltd.) and it was also confirmed by o-toluidine method. for gtt, control and diabetic control rats were given water only. group 3, 4, 5 rats were treated with their corresponding concentration 200, 400, and 600 mg/kg of aqueous fruit extract of p. ligularis, respectively. three more blood samples were collected at 60, 120, and 180 minutes after the glucose load. group 1 served as control, normal healthy rats given normal pelleted diet and 1.0 ml citrate buffer as vehicle, group 2 rats were induced with diabetes by a single intraperitoneal injection of 30 mg/kg bw of streptozotocin and kept without any treatment for 30 days, group 3 rats were induced with diabetes as mentioned in group 2 and treated with glibenclamide (1.25 mg/kg bw) orally through oral intragastric tube, for a period of 30 days, group 4 rats were induced with diabetes as mentioned in group 2 and treated with passiflora ligularis (400 mg/kg bw) orally for a period of 30 days, group 5 rats were treated with passiflora ligularis alone (400 mg/kg bw) orally for a period of 30 days, and the fruit aqueous extract (400 mg/kg) was given orally through intragastric tube for 30 days. the extract was administered orally by intragastric tubes for the study period of 30 days and then they were sacrificed under mild chloroform anesthesia. the organs liver, kidney, and pancreas were collected in saline and used for antioxidant analysis. serum cholesterol and hdl was estimated by one step method using diagnostic reagent kit manufactured by span diagnostics ltd. triglycerides were estimated by gpo-pap, end point assay using diagnostic reagent kit manufactured by span diagnostics ltd. the activities of serum aspartate aminotransferase (ast) and alanine aminotransferase (alt) were estimated by using commercially available kits. the activities of serum alkaline phosphatase were also estimated. total protein and albumin in the serum urea in the serum was estimated by using the diagnostic kit based on the dam method; creatinine in serum was estimated by using the diagnostic kit based on the alkaline picrate method. bilirubin in serum was estimated by using the span diagnostic kit. in the present study, antioxidant activity of aqueous fruit extract of passiflora ligularis was analyzed in different organs, namely, liver, kidney, and pancreas. after 30 days the rats were sacrificed under mild chloroform anesthesia and the organs were collected in saline liver which was used for the estimation of glycogen. all the tissues were used for estimation of protein, enzymic antioxidants such as superoxide dismutase, catalase, gpx, and nonenzymatic antioxidants such as vitamin c, vitamin e, and reduced glutathione. the statistical comparison among the groups was performed with one-way analysis of variance followed by duncan's multiple range test (dmrt) using spss version 10 (spss, chicago, il). phytochemicals play an important role in plant defense against prey, microorganism, and stress as well as interspecies protections. hence, phytochemical screening serves as the initial step in predicting the types of potential active compounds from plants. phytochemical screening of p. ligularis revealed the presence of various phytochemicals (table 1). in particular the aqueous extract of passiflora ligularis revealed the presence of alkaloids, tannins, phenolic compounds, flavonoids, steroids, cardiac glycosides, terpenoids, and carbohydrates. in acute toxicity study, the experimental rats had slept several hours, after administration of passiflora ligularis extract to the wistar albino rats when compared to normal control rats. but there were no gross behavioral changes or morphological changes like respiratory distress, hair loss, restlessness, convulsions, laxative, coma, weight loss, urination, itching, and so forth. there was no lethality and no toxic reaction was found at any of the doses selected till the end of the treatment. figure 1 shows the blood glucose levels in gtt of control and experimental groups of rats after oral administration of glucose. the aqueous fruit extract of passiflora ligularis was administered orally (200, 400, and 600 mg/kg, for 15 days) to experimental animals. in diabetic rats, the peak increase in blood glucose concentration was observed after 60 min and it remained high over 120 min. passiflora ligularis treated diabetic rats showed significant decrease in blood glucose concentration at 60 min and at 120 min interval and the glycemic index was found to be 28.3%, 33.3%, 29.2%, respectively (figure 2). among the various doses (200, 400, and 600 mg/kg) of p. ligularis on ogtt in normal and diabetic rats, 400 mg/kg brought an effective hypoglycemic effect when compared to other doses. this effect may occur due to reduction in intestinal glucose absorption or induction of glycogenic process along with reduction in glycogenolysis and glyconeogenesis. therefore, this effective dosage, 400 mg/kg of aqueous fruit extract of p. ligularis, was used for further antidiabetic studies in wistar albino rats. the observed diabetic untreated rats were increased in serum glucose in due to the effect of stz which cause tissue damage in pancreas that destroy cells and result in insulin deficiency. insulin deficiency ultimately causes increased blood glucose. in diabetic control rats, there is significant elevation of glucose. streptozotocin causes selective destruction of cells of islets of pancreas and brings an increase in blood glucose levels. it is evident from the present investigation that administration at the dose of 30 mg/kg body weight causes significant diabetogenic response in albino rats. from these results given in table 2, that reduction in blood glucose levels brought by aqueous extract of p. ligularis was quite comparable with reduction brought about by glibenclamide. a significant elevation in hemoglobin and increase in glycosylated hemoglobin noticed in diabetic rats were normalized to near normal with the administration of aqueous fruit extract of p. ligularis and glibenclamide. reduction in hemoglobin in diabetic rats is due to the interaction of excess glucose with hemoglobin to form glycosylated hemoglobin (table 2). glycosylated hemoglobin (hba1c) was almost doubled in stz rats and it decreased significantly when treated with p. ligularis and maintains the hemoglobin and glycosylated hemoglobin in their normal range. a significant elevation in serum lipids was observed in diabetic rats when compared with control rats (table 2). in case of insulin deficiency as in diabetes mellitus, lipolysis is not inhibited and therefore this leads to hyperlipidemia. on oral administration of passiflora ligularis fruit extract to diabetic rats for 30 days significantly reversed these values to near normal. this may be due to the increase in insulin secretion by passiflora ligularis which decreases the total cholesterol and total triglycerides and increases hdl level. table 3 shows the level of hepatic and renal markers; the levels of urea, creatinine, and bilirubin were significantly increased in diabetic group and treatment with passiflora ligularis extract for 30 days significantly reversed these values to near normal. rise in serum level of ast and alp have been attributed to the damaged structural integrity of the liver. the significant decrease in liver enzymes, namely, ast and alp levels, was noticed after oral administration of aqueous extract of p. ligularis as compared to diabetic animals. it implies the normal functioning and protective effect of p. ligularis liver and supports hepatoprotective nature of p. ligularis. the results from table 3 show that the serum total protein level in diabetic control rats was significantly reduced. increase in serum protein, that is, the ratio of albumin and globulin in diabetic rats treated with aqueous extract of p. ligularis and standard drug, was observed. administration of passiflora ligularis fruit extract decreased the level of liver markers in diabetic treated rats. stz causes damage to liver, kidney, and pancreas as well as the hyperglycemia related changes which may persist in the tissues. the changes on protein levels in tissues such as liver, kidney, and pancreas of the experimental animals are given in table 4. the level of protein in liver and kidney was decreased in diabetic group on comparison with control group. on treatment with aqueous fruit extract of passiflora ligularis and standard drug glibenclamide to diabetic rats for 30 days the values the reduction of the level of total proteins in induced rats was attributed to localized damage in the endoplasmic reticulum which results in the loss of p450 leading to its functional failure with a decrease in protein synthesis. the rise in protein levels in the treated groups suggests the stabilization of endoplasmic reticulum leading to protein synthesis. in this study, the liver glycogen level was decreased significantly in group ii diabetic rats, compared to glibenclamide as standard and passiflora ligularis treated groups. liver glycogen content was significantly reduced in stz induced diabetic rats (figure 3). glycogen is the primary intracellular storage form of glucose and its levels in various tissues are a direct reflection of insulin activity as insulin promotes intracellular glycogen deposition by stimulating glycogen synthase and inhibiting glycogen phosphorylase. the significant increase of liver glycogen level in the extract-treated diabetic groups may be due to reactivation of the glycogen synthase system. the experimental results indicate that the aqueous fruit extract of passiflora ligularis has considerable antidiabetic activity and is capable of maintaining the liver glycogen level. table 5 demonstrates the results of the antioxidants enzymes levels of sod, catalase, and gpx in experimental rats. these enzymatic antioxidants are significantly decreased in different organs (liver, kidney, and pancreas) due to the inadequacy of the antioxidant defences in combating ros mediated damage and when they are treated with aqueous fruit extract of passiflora ligularis the activity of these enzymes was increased and may help to control the free radicals when compared to diabetic rats and the effect produced by aqueous fruit extract of passiflora ligularis was comparable with that of standard drug glibenclamide. implication of oxidative stress in the pathogenesis of diabetes is suggested, not only by oxygen free-radical generation, but also due to nonenzymatic protein glycosylation, autooxidation of glucose, impaired glutathione metabolism, alteration in antioxidant enzymes, lipid peroxides formation, and decreased ascorbic acid levels. in addition to gsh, there are other defense mechanisms against free radicals like the enzymes superoxide dismutase (sod), reduced glutathione (gsh), and catalase (cat) whose activities contribute to eliminate superoxide, hydrogen peroxide, and hydroxyl radicals. the decreased activities of cat and sod in diabetic rats may be a response to increased production of h2o2 and o2 by the autoxidation of glucose. these enzymes play an important role in maintaining physiological levels of oxygen and hydrogen peroxide by hastening the dismutation of oxygen radicals and eliminating organic peroxides and hydroperoxides generated from inadvertent exposure to stz. the observed increases in the antioxidant enzymes in diabetic treated rats are due to the presence of secondary metabolites in the aqueous fruit extract of passiflora ligularis. the aqueous fruit extract passiflora ligularis is rich in flavonoid content which provide to have good antioxidant potential and it is able to reverse the changes in diabetic control rats. table 6 indicates a significant reduction in the nonenzymatic antioxidants like glutathione (gsh) vitamins c and e in diabetic rats when compared with control rats. the levels of these antioxidants were significantly increased in different organs (liver, kidney, and pancreas) of diabetic rats by treating with aqueous fruit extract of passiflora ligularis. it is a direct scavenger of free radicals as well as a cosubstrate for peroxide detoxification by glutathione peroxidases. oxidative stress in diabetes decreased the level of gsh in different organs of rat when compared to control. oral administration of aqueous fruit extract of passiflora ligularis for 30 days showed significant elevation in all the nonenzymatic antioxidants values and reached near normal values. this indicates that administration of aqueous fruit extract of passiflora ligularis can reduce the oxidative stress leading to less degradation of gsh due to less production of ros in diabetic stage. table 7 explains a significant reduction in the lipid peroxidation in liver, kidney, and pancreas of control and experimental animals. in liver, kidney, and pancreas tissues of diabetic rats, lipid peroxidation (lpo) levels hydroxyl radicals are the major active species that cause lipid oxidation and significant biological damage. the ability of the passiflora ligularis extracts to quench hydroxyl radicals seems to be directly related to inhibiting the process of lipid peroxidation. after oral administration of passiflora ligularis extract for 30 days the elevated values restore back to near normal level. both of the treated groups showed significant decrease in lipid peroxidation, suggesting its role in protection against lipid peroxidation. in conclusion, the result of this study shows that oral administration of the aqueous extract of p. ligularis reduces blood glucose, serum lipids which could be due to improvement in insulin secretion by recovery of pancreatic cells. p. ligularis possesses antioxidant potential which may be used for therapeutic purposes mainly in the prevention of oxidative damage that occurs during diabetes. presence of alkaloids and flavonoids of p. ligularis has also been found to be beneficial in controlling diabetes and many other diseases as evident from this study. therefore, it is concluded that the aqueous extract of p. ligularis possesses antidiabetic activity and it may prove to be effective for the management of diabetes.

diabetes mellitus is the most common endocrine disorder that impairs glucose homeostasis resulting in severe diabetic complications including retinopathy, angiopathy, nephropathy, and neuropathy causing neurological disorders due to perturbation in utilization of glucose. hypoglycemic activity was detected in aqueous extract of passiflora ligularis, a traditionally used medicinal plant, using streptozotocin (stz, 30 mg/kg body weight) induced diabetic rat model. oral administration of aqueous extract of passiflora ligularis to diabetic rats for 30 days resulted in a decrease in blood glucose. the diabetic rats had decreased levels of serum total protein, albumin, globulin, and albumin/globulin ratio as compared to control rats. in addition, the activities of hepatic and renal markers were significantly elevated in diabetic rats as compared to control rats. treatment with aqueous fruit extract of p. ligularis and glibenclamide reversed these parameters to near normal. extract at a dose of 400 mg/kg given orally for 30 days showed significant elevation in enzymatic (sod, catalase, and gpx) and nonenzymatic antioxidants (vitamin c, vitamin e, and reduced glutathione). plant extract treated groups showed significant decrease in lipid peroxidation (lpo). aqueous extract of passiflora ligularis fruit can decrease the blood glucose and reduce the oxidative stress by removing free radicals in diabetes.

PMC4897570

pubmed-1172

the " gold standard " for assessing fibrosis, liver biopsy, is recommended prior to the initiation of antiviral therapy; in addition, it is vital for monitoring fibrosis progression. unfortunately, this procedure is invasive, prone to complications, including hemorrhage and death, and has a high risk of sampling error. biochemical markers for liver fibrosis (fibrotest) and necroinflammatory features (actitest) are an alternative to liver biopsy, in patients with chronic hepatitis c. since the first publication, which included a validation period, those tests have been validated in different populations by the same reference laboratory and by an independent group. the tests combine five components (2-macroglobulin, haptoglobin, apolipoprotein a1, -glutamyl transpeptidase (ggt), and total bilirubin) for fibrotest and same plus alanine aminotransferase (alt) for actitest. the aim of this study was to assess the inter-laboratory variability of fibrotest and actitest, including their six serum liver components, in patients with chronic liver disease, and to identify factors associated with that variability. our concern was to assess whether the analytical methods adapted on the different analyzers were associated with significant variability in fibrotest and/or actitest values. moreover, we aimed to compare the variability of fibrotest and actitest in relation to the method of expressing enzymatic activity; in particular, in terms of absolute values or as multiples of the upper limit of normal. since we and others have demonstrated that current definitions of normal values may be inappropriate [8-10] in routine practice, the definition of the upper limit of normal (uln) of alt and ggt varies between laboratories, but is rarely detailed. because numerous medical guidelines make reference to alt and ggt expressed as multiples of the uln (uln units), variations in the definition of normal may have important practical consequences. the main characteristics of the included patients are outlined in table 1. according to each patient and laboratory, details of the fibrotest and actitest assays there was no significant difference between centers for fibrotest using ggt expressed in international units [mean (sd)=0.57 (0.26), range=0.480.65, f-ratio=0.27, p=0.27]. for fibrotest using ggt expressed in uln units [mean (sd)=0.55 (0.27), range=0.450.68, f-ratio=1.26, p=0.27], there was a significant difference between three centers (center 5 had higher means values than center 2 and 4; p=0.02 for both comparisons). fibrotest and actitest variability according to laboratories (centers) and units of enzymatic expression: international units (iu) and upper limit of normal (unl). characteristics of included patients hcv hepatitis c virus; hiv human immunodeficiency virus; sd standard deviation. there was no significant difference between centers for actitest using alt and ggt expressed in international units [mean (sd)=0.32 (0.26), range=0.380.53, f-ratio=1.21, p=0.30] and for actitest using alt and ggt expressed in uln units [mean (sd)=0.44 (0.27), range=0.270.43, f-ratio=0.81, p=0.59). the details of the liver proteins and total bilirubin assays according to each patient and laboratory are outlined in figure 2. there were no significant differences according to testing center for any of these assays (between centers or versus the reference center): (2-macroglobulin [mean (sd)=2.89 (1.16) g/l, range=2.693.33, f-ratio=0.72, p=0.67], haptoglobin [mean (sd)=0.98 (0.58) g/l, range=0.921.03, f-ratio=0.07, p=0.99), apolipoprotein a1 [mean (sd)=1.30 (0.51) g/l, range=1.161.42, f-ratio=1.21, p=0.30] and bilirubin [mean (sd)=28.8 (66) micromol/l, range=15.851.1, f-ratio=0.51, p=0.85]. one analyzer (advia) gave lower mean apoliprotein a1 levels [1.06 (0.43) g/l) than the other analyzers [1.33 (0.52) g/l; p=0.02]. the details of the alt and ggt assays, according to each patient and laboratory and expressed in international or uln units, are given in figure 3. there was no significant difference between centers for alt expressed in international units [mean (sd)=70 (47) iu/ml, range=5786, f-ratio=1.30, p=0.25]. however, when the assays used pyridoxal phosphate as in the reference center, the mean alt was higher [78 (50) iu/ml] than assays not using pyridoxal phosphate [60 (42) iu/ml; p=0.003]. for alt expressed in uln units [mean (sd)=48 (37), range=3771, f-ratio=1.65, p=0.12], there was a significant difference between center 1 and all centers (p=0.009 vs center 2, p=0.008 vs center 3, p=0.04 vs center 4, p=0.04 vs center 5, p=0.02 vs center 6, p=0.03 vs center 7, p=0.01 vs center 10 and p=0.001 vs center 11). there were no significant differences between centers for ggt expressed in international units [mean (sd)=130 (158) iu/ml, range=5786, f-ratio=1.30, p=0.25] or in uln units [mean (sd)=109 (121) iu/ml, range=78154, f-ratio=1.46, p=0.17]. however, and despite the use of the same szasz method, one automate (dade behring rxl) gave higher ggt mean values [165 (200) iu/ml] than the others [120 (143) iu/ml; p=0.06]. alanine aminotransferase (alt) and -glutamyl transpeptidase (ggt) variability according to laboratory and units of enzymatic expression: international units (iu) and upper limit of normal (unl). passing-bablok linear regression analyses of all samples between laboratories and the reference center are summarized in table 2. the intercept and slope between the reference center and other laboratories were excellent for the three proteins with only one decrease for apolipoprotein a1 in a single center using the advia analyzer. for ggt, centers using the rxl analyzer had a higher slope (greater than 1). passing-bablok analysis between laboratories and reference center (lab 1) for each component concordance rates (kappa statistics) among laboratories are given in table 3; all were statistically significant. when ggt and alt were expressed in international units, fibrotest and actitest kappa statistics were all greater than 0.50 with only 0.8% cases (3 out of the 384 comparisons) with a discordance of more than one fibrosis stage. in contrast, when ggt and alt were expressed in uln units, fibrotest and actitest kappa statistics were lower than 0.50 in 11 comparisons (out of the 16 comparisons versus the reference laboratory) with 5% of cases (21 out of the 384 comparisons) with a discordance of more than one fibrosis stage or greater than one activity grade. concordance rates (kappa statistics) of laboratories with reference center (lab 1), according to the expression of ggt and alt activities this study showed that the variability of fibrotest and actitest values, among nine different laboratories, was acceptable and without clinical consequences for the prediction of the stage of liver fibrosis or grade of activity. this finding is important since it confirms that those tests can be routinely computed from the results of the six individual components obtained by non-centralized measurements. online assessment is available using the website. to guarantee the quality of this assessment, it was necessary to identify the factors associated with the variability of the six components. this study confirms that the expression of alt and ggt in multiples of the upper limit of reference values should be avoided. despite efforts to standardize enzymatic assay methods, homogeneity of alt results has not been achieved as attested by external quality controls, and identical limits of reference values can not be defined. many clinicians believe that expression of the results as multiples of the upper limits of reference ranges can reduce inter-laboratory variability. our study confirms previously observed results, that this method of expression is, in fact, worse than that using international units both for alt and ggt. in our reference center, the reference limit recorded was similar to the described mean value from a recent study and lower than in the other laboratories. if actitest was expressed in a standardized way, using the upper limit of each laboratory for ggt and alt, this induced lower concordance rate than actitest using international units. to increase inter-laboratory coherence in the results of enzymatic activities, standardized assays against a reference method should be employed, with calibration of the assay using a commutable enzymatic material. the values of this calibrator must be assigned by a reference method. for proteins and bilirubin assays this was anticipated for 2-macroglobulin since the same analyzer was used in all laboratories. although the use of three different analyzers, haptoglobin has the best homogeneity. in fact, the assays of these two proteins are standardized against the crm 470 reference material. this reference product is now used in different measurement procedures to attain results numerically the same, whatever the clinical conditions. for apolipoprotein a1, this is due to the use of a different reference material to standardize the assay. overall, the data from the laboratories were linearly related with the reference center with a slope close to 1 and a non-significant analytical imprecision; there were few pairs of assays outside the confidence limits and the samples were adequately distributed over the investigated range. as previously observed, when ordinary linear regression (in combination with correlation analysis in the passing bablock method) gave poor estimates, in particular for ggt and alt assays, we found several analytical reasons for the poor performance. enzymatic measurement with the szasz method (standardized against the original for ggt), and with the standardized method according to the international federation of clinical chemistry (using pyridoxal phosphate for alt), would probably reduce the variability. because of their predictive values and their reproducibility in different populations, biochemical markers could be used as surrogate markers for liver biopsy both for the initial decision of liver biopsy and for the follow-up of chronic hepatitis c patients. to date, liver biopsy has been considered mandatory for the management of patients infected by hepatitis c virus (hcv). reviews of morbidity and mortality of intercostal liver biopsy observed a mean occurrence of pain in 30% of patients, 3 out of 1,000 endured severe adverse events, and 3 out of 10,000 died. even liver biopsy is dependant on the inter- and intra-observer (pathologist) differences. there are also potential problems with liver biopsy sampling variation. in a study with three consecutive samples through a single entry site, only 50% of patients with cirrhosis were scored as cirrhosis on the three samples. it is therefore possible that biochemical markers such as those described may provide a more accurate (quantitative and reproducible) picture of fibrogenic events occurring within the liver. furthermore, and because treatment is now so effective in patients with genotype 2 or 3 infection, the utility of biopsy in this setting could be challenged. when ggt and alt are expressed in international units, fibrotest and actitest can be computed from different laboratories with acceptable variability. to increase inter-laboratory coherency, standardized methods and enzymatic calibration expression of alt and ggt in multiples of the upper limit of reference values should be avoided. the serum of 24 informed patients (21 with chronic hepatitis c and 3 with decompensated alcoholic cirrhosis) were prospectively collected in the department of hepato-gastroenterology of the piti-salptrire hospital, in paris, france. sera were separated in the above reference laboratory, conserved at+4c and distributed to ten different laboratories, in france, within 24 hours. for two laboratories, serum was missing for at least one patient; therefore, these laboratories have been excluded from the core analysis. sensitivity analyses including these two excluded laboratories did not change the results or conclusions (data not shown). characteristics of the analyzer, reagents and analytical methods employed used in the nine included laboratories are detailed in table 4. eleven different analyzers were used. for the measurement of alt activity, five laboratories used a standardized method according to the ifcc, with pyridoxal phosphate, and four without pyridoxal phosphate. for the measurement of ggt activity, the nine laboratories used the szasz method; including in four a recommended method of standardization. laboratory analyzers and biochemical methods bn2, rxl, vitros 250: dade behring, marburg, germany. immage, cx5, cx7: beckman coulter, brea, california, usa. advia 1650: bayer diagnostics, tarrytown, new jersey, usa. analytical measurements of 2-macroglobulin and haptoglobin were standardized against the certified international reference material 470 (crm 470). apolipoprotein a1 assays adapted on the different analyzers were standardized against the reference material of world health organization-international federation of clinical chemistry sp1-01 (who-ifcc sp1-01), except on the advia-bayer-analyzer (advia). total bilirubin was assayed by diazoreactions methods. statistical analysis used multiple measure variance analyses and passing-bablok linear regression analyses for the comparison of inter-laboratory results, and kappa statistics for the predicted histological features. multiple comparisons used bonferroni (versus control) and tukey-kramer multiple-comparison tests. number cruncher statistical systems software was used. the linear relationship between laboratories and reference center were assessed with confidence limits for the slope and the intercept and the number of pairs out of bounds; they were used to determine whether there was only a chance difference between the slope and 1 and between the intercept and 0. ph, fib, dm, ga, db, pcl, gd, dd, tk, ms, dt and et performed the assays.

backgroundbiochemical markers for liver fibrosis (fibrotest) and necroinflammatory features (actitest) are an alternative to liver biopsy in patients with chronic hepatitis c. our aim was to assess the inter-laboratory variability of these tests, and their 6 components (-glutamyl transpeptidase, alanine aminotransferase, 2-macroglobulin, haptoglobin, apolipoprotein a1, and total bilirubin) and to identify factors associated with this variability. resultsserum of 24 patients with chronic hepatitis c or severe alcoholic liver disease were prospectively recorded and analyzed in one reference center and in 8 additional laboratories. when -glutamyl transpeptidase and alanine aminotransferase were expressed in international units, there was no significant difference between laboratories in the results of fibrotest or actitest; kappa statistics were greater than 0.50 with only 0.8% of cases (3/384) with a discordance of more than one stage. the main factor significantly associated with variability was the expression of -glutamyl transpeptidase and alanine aminotransferase, as multiples of upper limit of reference values. the use of standardized method with pyridoxal phosphate reduced the variability of alanine aminotransferase expression, and standardized original szasz method reduced the variability of -glutamyl transpeptidase expression. conclusionsthe variability of fibrotest and actitest was acceptable without clinical consequences for the prediction of the stage of liver fibrosis and grade of activity. standardized methods and assay calibration should be used and expression of alanine aminotransferase and -glutamyl transpeptidase in multiples of the upper limit of reference values should not be employed.

PMC149429

pubmed-1173

the missouri department of health and senior services conducted this investigation in response to the hospital s identification of an increased number of tracheal aspirates that were positive for b. cereus collected from newborns who were on ventilators during march may, 2011. all tracheal aspirate culture results obtained in the neonatal intensive care unit (nicu) during january 2010june 2011 were reviewed. nicu data was also searched for positive b. cereus culture from other specimens, such as blood, body fluids, or tissues. investigators thoroughly evaluated respiratory management practices in the unit by direct observation, respiratory records review, and an interview with the respiratory therapist. several environmental cultures were obtained from the flow sensors of the unit s ventilators over the 1-month period. b. cereus isolates were forwarded to the centers for disease control and prevention to be molecularly characterized by using multilocus sequence typing (mlst) (10). the dna was used as a template in pcrs with the primers described on the bacillus cereus mlst web site (www.pubmlst.org/bcereus) for the 7 loci which define the mlst scheme. the sequences for the loci glpf, gmk, ilvd, pta, pur, pyca, and tpi were then assigned allele designations. a greater number of alleles that match between strains indicates a higher level of relatedness (10). prevalence of b. cereus positive specimens was compared by using the mann-whitney u test. retrospective analysis of tracheal aspirate culture results showed significant increase (p=0.039) in b. cereus isolation between march and may, 2011 (figure 1). no bacillus spp. were isolated from blood, other body fluids, or tissues during the study period. the chart review of the case-patients comprising the cluster of b. cereus colonization revealed that none received a diagnosis of clinical b. cereus infection. all patients were treated with vancomycin or tobramycin, or both, for indications not related to b. cereus in tracheal aspirate. one case-patient died 108 days later without evidence that b. cereus contributed to the outcome. epidemiologic curve of bacillus spp.positive tracheal aspirates from newborns on ventilators, january 2010january 2012. investigation of the ventilation procedures in the nicu revealed that most equipment used for respiratory care was disposable, designated for single-patient use. telford, pa, usa; www.draeger.us/sites/enus_us/pages/hospital/evita-xl.aspx) was used for mechanical ventilation of infants who were intubated to treat severe respiratory compromise. the draeger evita v500 is a microprocessor controlled ventilator offering both mandatory and spontaneous ventilation modes for adult, pediatric, and neonatal patients. heated and humidified gas flows from the ventilator unit, through the inspiratory circuit and neoflow air flow sensor to the patient through an endotracheal tube. upon exhalation, gas flows back through the air flow sensor into the expiratory circuit and returns to the ventilator through the expiratory flow sensor and exhalation valve. in addition to the ventilator, reusable respiratory equipment comprised a proximal air flow sensor, expiratory flow sensor, exhalation valve, and circuit temperature probe. the sensor closest to the newborn s mouth was an air flow sensor located inside the disposable ventilation circuit (figure 2). from 9 environmental cultures obtained from 9 air flow sensors, 1 was positive for bacillus spp., and was later confirmed as b. cereus by the state public health laboratory. mlst was performed for 8 b. cereus isolates from case-patients and for 1 environmental isolate from the air flow sensor. one locus for the remaining 5 strains did not yield an amplicon for sequencing after repeated attempts and, thus, could not be assigned a sequence type. the isolates that included sequence type (st) 73 and st94 were closely related to each other because they differed by merely 1 locus, gmk. the strains that were not fully typed because of the inability to obtain sequences for locus pta were also closely related to st73 or st94 because the other loci matched. there was 1 match between strains isolated from 1 case-patient and the air flow sensor, which was st73. the contaminated air flow sensor was then sterilized by using a steam autoclave. a repeat culture of this sensor after sterilization was negative. we found that air flow sensors were routinely disinfected by placing them in a container with 70% alcohol solution for 60 minutes. after discovery of the air flow sensor contaminated with b. cereus, the disinfection policy was changed. all air flow sensors were first soaked in enzol enzymatic detergent (asp, irvine, ca, usa; www.aspjj.com/us/products/enzol) solution and then sent for steam autoclave sterilization at 134c (273.2f). after implementation of new disinfection and sterilization procedures, no new cases of b. cereus tracheal colonization were identified in the nursery. in this cluster, contaminated proximal air flow sensors were the likely source of tracheal colonization with b. cereus in newborn infants, supported by a genetic match by mlst between a strain isolated from 1 case-patient and the contaminated air flow sensor. b. cereus transmission from contaminated respiratory equipment has been reported in other geographic areas. in the netherlands, an outbreak of b. cereus infections in a pediatric intensive care unit caused by contaminated reusable ventilator air flow sensors switching to disposable air flow sensors stopped colonization with b. cereus in that unit. in canada, an outbreak of b. cereus infections among patients in an adult icu was linked to colonized ventilator circuitry (8). in the united kingdom, reusable ventilator circuits were also identified as the cause of a b. cereus outbreak among intubated nicu patients (9). our investigation underscores the necessity of close monitoring of occurrences of bacillus spp. in tracheal aspirates since clustering of such cases, b. cereus isolates were either st73, st94, or closely related to those sequence types. st73 and st94 are associated with strains previously described as having caused illness in elderly persons. strains with st73 were implicated in cases of septicemia (12), and of sepsis and pneumonia (13). strains with st 94 were recovered from patients with pneumonia (14). b. cereus strains harboring b. anthracis plasmids such as pxo1, have also been associated with severe and fatal respiratory infections (15). all case-patients in our investigation were considered to be colonized with b. cereus without clinical implications. since all of them received intravenous antimicrobial drugs effective against b. cereus, it is conceivable that the clinical course of those patients could have been different without such treatment. should not be routinely viewed as clinically insignificant and further testing to determine exact strain should be considered under appropriate clinical and epidemiologic circumstances. proper disinfection of the entire ventilator circuit as recommended by the equipment manufacturer is crucial in avoiding potentially lethal b. cereus infections.

we investigated bacillus cereus positive tracheal aspirates from infants on ventilators in a neonatal intensive care unit. multilocus sequence typing determined a genetic match between strains isolated from samples from a case-patient and from the air flow sensor in the ventilator. changing the sterilization method for sensors to steam autoclaving stopped transmission.

PMC3647488

pubmed-1174

lung cancer is the second most common cancer in both men and women with an estimated 224,210 cases expected to be diagnosed in 2014 in the united states (us). it is also the leading cause of cancer related deaths in the us accounting for 27% of all cancer related deaths. the majority of lung cancer cases fall under the category of non-small-cell lung cancer (nsclc). figure 1 shows the selection of the non-small-cell lung cancer cases included in the study. racial/ethnic disparities have been shown to influence survival outcomes in nsclc [24]. disparities in survival outcomes among racial/ethnic groups may be attributed to a complex interaction between genetic and lifestyle factors [4, 5]. compared to non-hispanic whites (nhw), blacks have a higher incidence of lung cancer and more advanced disease at diagnosis with worse survival outcomes [68]. despite a lower incidence, hispanics are more likely to be diagnosed with advanced disease with poor outcomes compared to nhw [2, 9]. asian/pacific islanders (api) have a lower incidence of nsclc compared to nhw. interestingly, previous literature has shown that cancer related mortality is favorable in api compared to other racial/ethnic groups for early stage (stages ia and ib) nsclc [11, 12]. however, survival outcomes in api and other racial/ethnic groups based on the recently published american joint committee on cancer (ajcc) 7th edition have not been evaluated in detail. in this study, our primary objective was to utilize an established large nationwide cancer registry to ascertain racial/ethnic disparities in nsclc clinicopathologic features and survival outcomes. we used the national cancer institute (nci) surveillance, epidemiology, and end result (seer) cancer registry that collects large observational data across 18 cancer registry sites. the database was accessed using the seerstat 8.1.5, http://seer.cancer.gov/seerstat, assessed may 01, 2014. to be eligible, we identified patients diagnosed between 01/01/2004 to 31/12/2010 with nsclc (icd-o-3 site c34.0c34.9) based on the selected histology codes: squamous and transitional cell: 8051-8052, 80708084, and 81208131, adenocarcinoma in situ [ais]: 82508255, nonadenocarcinoma in situ [non-ais]: 8050, 81408149, 81608162, 81908221, 82568263, 82708280, 82908337, 83508390, 84008560, 85708576, and 8940-8941, large cell: 80118015, and others: 8010, 80208022, 80308040, 8046, 80908110, 81508156, 81708175, 8180, 8230-8231, 82408249, 83408347, 8561-8562, and 85808671. we utilized the time period stated, due to the ability to restage the tumors to the latest ajcc 7th edition using data from the collaborative stage variables. to investigate any existing treatment or tumor racial/ethnic disparities and disease-specific survival (dss), racial/ethnic groups were categorized as nhw, hispanics, blacks, and api. clinicopathologic characteristics included age at diagnosis, gender, birth country, marital status, tumor grade, tumor size, ajcc stage, and histology. decade long time intervals <30 years, 3039, 4049, 5059, 6069, 7079, others, a term that is inclusive of divorced, widowed, or separated individuals. birth within the us or outside was used to monitor the immigration effect. the variable tumor size reflected the size of the tumor mass and was classified categorically to <30 mm, 3050 mm, 5070 mm, >70 mm or in cases with no recorded tumor mass to no mass was found. all forms of radiation were collectively grouped as radiation received, while all forms of cancer directed surgeries were coded collectively as cases after 2010 were excluded to allow a minimum of 12 months of follow-up period. the kruskall-wallis nonparametric test was employed to examine the differences that may exist among various racial/ethnic groups and tumor characteristics. the difference between the racial/ethnic groups and the reasons for no surgery was measured using fisher's exact test. the end point was dss which was measured in months from the date of diagnosis to death due to lung cancer or censoring, which included either being alive, lost to follow-up, or died due to other causes. multivariate cox proportional hazard models were used to establish the weight of different characteristics (grade, age at diagnoses, tumor size, histology, marital status, race/ethnicity, gender, radiation, surgery, and radiation/surgery sequence) on prognostic significance contributing to the survival in each respective ajcc stage. the z test was employed to examine the proportional differences that may exist between the referent nhw and other race/ethnic groups. the models were constructed using ibm spss statistical software, version 21.0 (ibm corp. released 2012, ibm spss statistics for windows, version 21.0, armonk, ny: ibm corp.). our database yielded 190,046 patients with nsclc: 145646 (76.6%) nhw, 10350 (5.4%) hispanics, 22525 (11.9%) blacks, and 11525 (6.1%) api (table 1). compared to nhw stage i diagnosis (17.8%), blacks had the least proportion (12.4%) preceded by hispanics (13.5%) and api (14.3%) (p<0.05). nhw had the most stage ii diagnosis (13.1%), followed by blacks (12.7%), api (11.7%), and hispanics (11.4%) (p<0.05). blacks had the highest stage iii diagnoses (20.5%), followed by the referent nhw (18.5%), hispanics (17.7%), and api (17.2%) (p<0.05). api had the highest stage iv diagnoses (49.3%), followed by hispanics (47.7%), blacks (47.4%), and the referent nhw (42.6%), respectively. compared to the referent nhw's grades 1 (5.0%) and 2 (16.5%) statuses, blacks had the least amount of grade 1 (3.3%) and grade 2 (14.8%) tumors, while hispanics (5.4%) and api (5.7%) both had relatively greater grade 1 representations, respectively (p<0.05). regarding high grade tumors, api had significantly the lowest proportions of both grade 3 (25.7%) and grade 4 (1.8%) cases, compared to nhw. hispanics also had lower grade 3 (26.8%) diagnoses, compared to nhw, while blacks had greater proportions (28.2%). squamous and transitional cell diagnoses were significantly less common in api (15.8%) and hispanics (19.2%) compared to nhw (23.6%) (p<0.05). although blacks had greater shares (24.1%), this was nonsignificant. compared to nhws ' ais (4.1%) and non-ais (38.3%) histological diagnoses, hispanics had greater proportions (5.0% and 41.9%), with api having the greatest representation (6.3% and 49.6%). alternatively, blacks yielded the fewest ais (2.8%) cases in our study (p<0.05). for large cell carcinoma in the referent group (3.4%), both api (2.5%) and hispanics (3.0%) ranked lower, while a greater share was found among blacks (4.1%) (p<0.05). compared to nhw's later mean age at diagnosis of 68.86 years 11.239, an earlier onset was observed among api (68.05 12.315 years), hispanics (67.40 12.395 years), and blacks (64.65 11.467 years) (p<0.05). greater than 50% of cases among blacks were seen in the 5th (25.4%) and 6th (31.3%) decades, respectively, compared to the majority of the cases that presented later in the 6th and 7th decades among other ethnicities (p<0.05). in our study, blacks (29.2%) had the highest status, followed by hispanics (15.4%), and nhw (10.5%), with lowest observations noted among api (9.5%). blacks (32.9%) and nhw (33.0%) had higher others status, with relative lower proportions observed amongst hispanics (29.3%) and api (22.5%) (p<0.05). finally, married individuals were significantly more common among aip (64.9%) and less common among blacks (33.6%) compared to nhw (33.0%). significant majority of the api (58.2%) were born outside the united states (us). a greater proportion of hispanics (34.9%), compared to nhw (4.1%), and blacks (1.5%) are born outside (p<0.05). no tumor was found in 0.3% of the black population, compared to (0.4%) nhw (p<0.05). both nhw (31.0%) and api (27.8%) had the greater proportion of tumor 30 mm, compared to blacks (25.1%) and hispanics (26.7), respectively. a similar trend of proportionality was observed in tumors greater than 30 mm but not more than 50 mm, with api (23.7%) and nhw (22.6%) being higher, compared to blacks (22.0%) and hispanics (21.0%) (p<0.05). alternatively, blacks had relatively greater proportion of tumors greater than 50 mm, followed by hispanics, nhw, and api, respectively. with regard to stage i nsclc cases, radiation was less frequently utilized in both api (11.0%) and hispanics (12.2%) compared to nhw (16.3%) whereas greater proportions of blacks (18.9%) were treated with radiation (p<0.01). this trend was also observed in stage ii cases, with relatively more nhw (33.9%) and blacks (36.9%) than api (26.5%) and hispanics (28.6%) receiving radiation as part of their treatment (p<0.01). higher rates of blacks (57.3%) had radiation as part of the treatment in stage iii followed by nhw (55.3%), api (50.5%), and hispanics (48.2%) (p<0.01). similarly, blacks (44.9%) had the highest proportions of radiation utilization compared to nhw (44.1%), api (41.0%), and hispanics (39.1%) in the stage iv cohort (p<0.01). for ajcc stage i cases, a greater proportion of api (80.4%) were treated with cancer directed surgery compared to hispanics (75.4%), nhw (75.6%), and blacks (65.7%) (p<0.01). blacks (35.1%) had the lowest rate of surgical treatment in stage ii while nhw (47.3%) had the highest rate followed by api (44.7%) and hispanics (44.7%) (p<0.01). compared to nhw (17.0%), lower rates of surgical treatment in blacks (12.0%) were observed while api (20.4%) and hispanics (19.4%) had greater proportions that underwent surgery (p<0.01). nhw (4.5%) had the highest proportion of cancer directed surgery compared to hispanics (3.8%), api (3.6%), and blacks (3.5%) in stage iv nsclc (p<0.01). the most common reason for no surgery for all ethnicities was because it was not recommended. this reason was proportionally more common among api and least among blacks (p<0.05) for all ajcc stages except stage i (p<0.05). in contrast, api had the highest proportion of refusal for surgical treatment in early stage nsclc patients (p<0.05). multivariate cox proportional models were utilized to analyze the variables contributing to the dss among different ajcc stage. demographic variables that had improved survival at each ajcc stage were; female gender, and being married, (p<0.05). immigrants born outside the us had significant improved survival outcome in comparison to us born patients. patients with stage ii diagnosed at age 7079 (hazard ratio [hr]: 4.077, p<0.05) and>80 (hr: 5.14, p<0.05) had poor outcomes; patients>80 years had worsened survival among stage iv (hr: 1.626, p<0.05). api had a significantly improved survival in stage i (hr: 0.775, p<0.05), stage ii (hr: 0.791, p<0.05), and stage iv (hr: 0.858, p<0.05). this improvement was not observed in stage iii (hr: 0.966, p>0.1). unlike api, both hispanics and blacks did not have impact on the survival favorably compared to nhw (table 3). higher grade was uniformly associated with poor prognosis across all the stages (p<0.05). however both ais and non-ais diagnoses (with the exception of stage ii, hr: 0.966, p>0.05) were both associated with improved survival compared to the referent squamous and transitional diagnosis, with ais being the more favorable diagnosis (table 2). iii hr: 0.60, and stage iv: 0.917, p<0.01). surgical treatment favorably impacted stage i (hr: 0.231), and stage ii (hr: 0.282) survival respectively, (p<0.01). this study utilized the seer database to examine racial/ethnic disparities in nsclc clinicopathologic features and stage-based survival outcomes. api were more likely to be diagnosed with ais histology but yet presented with late stage disease. our analysis showed that cancer directed surgery and radiation therapy were significantly less likely to be offered to api compared to nhw. despite this, compared to nhw, api had increased disease-specific survival for early stage (i and ii) and stage iv nsclc. this analysis determined that survival disparities are also seen in api based on the recent ajcc 7th edition staging system. previous retrospective analyses have shown api to have decreased mortality compared to nhw for stage i disease, with an overall survival advantage regardless of smoking status which is consistent with our results [79]. our analysis also found increased survival in api with stage ii disease compared to nhw. stage iv disease was seen more frequently in api than in nhw with lower rates of cancer directed surgery and radiation therapy. despite this, there was a survival advantage for api compared to nhw in stage iv nsclc which is consistent with prior studies. improved outcomes in api may be attributed to favorable demographic and clinicopathologic features demonstrated in our analysis including being married, birth outside of the us, ais histology, and earlier age at diagnosis. regarding treatment modalities in stage iv, despite improved survival, the api cohort was less likely to receive cancer directed surgery compared to nhw. pertinently, there was greater proportion of surgery which was not part of the treatment plan. according to chang et al., api as a group had better overall survival after nsclc diagnosis compared to nhw, and single marital status was associated with decreased survival in the api population, which is consistent with our results. nsclc is a heterogeneous disease that is influenced by genetic, lifestyle, and socioeconomic elements. these elements are likely major factors in the disparate presentations and outcomes among different racial/ethnic groups. smoking status is an important prognostic indicator, with an improvement in overall and disease-specific survival in never smokers compared to patients with a smoking history [9, 11]. response to therapy including surgery, chemotherapy, and radiation is also improved in never smokers even in advanced disease. unlike nhw and black patients diagnosed with nsclc, a relatively high percentage of never smokers are seen in the api us population. however, besides smoking status, additional factors may account for improved outcomes because asian ethnicity independently is a favorable prognostic indicator for overall survival in both smokers and never smokers. in addition to a higher prevalence of smoking in lower ses groups, they are unlikely to receive adequate health care. in prior observational studies, blacks were less likely to receive surgery, chemotherapy, or radiation for stage iii disease and were less likely to receive chemotherapy for stage iv disease in comparison to nhw [1618]. in our study, cancer directed surgery was less likely to be offered to blacks compared to nhw. however, our study is unique in that it demonstrates that radiation is more significantly likely to be administered to blacks diagnosed with nsclc. poor access to quality health care is a major factor in racial/ethnic disparities, which have shown that when equivalent health care access is provided, survival outcomes become comparable [3, 13, 19, 20]. further research is necessary to determine whether lung cancer treatment is suboptimal in api residing in the us. overexpression of the epidermal growth factor receptor (egfr) leading to aberrant tyrosine kinase mediated signaling is implicated in approximately 70% of nsclc cases and is associated with a poor prognosis; egfr tyrosine kinase inhibitors (tki) were developed as a potential therapeutic option to improve outcomes. a greater understanding of the activity of tki has led to the discovery that the efficacy of these inhibitors is dependent on the presence of egfr activating mutations instead of the degree of egfr overexpression. egfr activating mutations are seen more commonly in females, ais histology, never or light smokers, and east asians [22, 23]. the prevalence of egfr activating mutations in other racial/ethnic groups such as blacks and nhw appears to be highly variable [2426]. improved survival in api potentially could be due to the presence of these mutations; however, randomized controlled trials have not shown an overall survival benefit with tki therapy in the adjuvant, stage iii maintenance, first-line metastatic, and second-line treatment settings [2731]. this could have led to incorrect classification of race/ethnicity and tumor classification. in our analysis however, we found the number of missing cases to be proportional among different racial/ethnic groups. in addition, we were not able to account for both genetic and lifestyle factors linked to nsclc including testing for egfr, kras, and alk mutations, familial history, smoking history, and occupational exposure to carcinogens. this is the first seer analysis to utilize the recent ajcc 7th edition to determine survival outcomes in api compared to nhw. interestingly, in all stages, except for stage iii, there was a significant survival benefit. this may be due to an insufficient sample size but also may be due to disparities in tumor biology and lifestyle factors specific for this stage. further research is necessary to gain a better understanding of the nsclc outcomes in the api population residing in the us.

background. the objective of our study was to ascertain racial/ethnic disparities in asian/pacific islanders (api) for non-small-cell lung cancer (nsclc) clinicopathologic features and survival outcomes based on various tumor characteristics and treatment modalities. method. seer database identified invasive nsclc cases from 2004 to 2010. variables included american joint committee on cancer (ajcc) stage 7, tumor grade, tumor size, histology, age, marital status, radiation, surgery, and reason for no surgery. the kruskall-wallis test and the z test were used to examine differences between races/ethnicities and the referent, non-hispanic white (nhw). multivariate cox proportional analyses were used to establish the weight of the prognostic significance contributing to disease-specific survival (dss) in each ajcc stage. result. improved dss was seen in api across stage i (hr: 0.78), stage ii (hr: 0.79), and stage iv (hr: 0.86), respectively, compared to the referent nhw (p<0.01). prognosis was improved by being married, being female gender, ais histology, and birth outside the us (p<0.01). conclusion. we have demonstrated improved survival among api in early stage and stage iv nsclc. further research is necessary to clarify the role of lifestyle and tumor biology for these differences.

PMC4312650

pubmed-1175

diabetes is a metabolic disease that leads to high blood sugar due to either insulin insufficiency, insulin resistance or both. according to the world health organization at least 171 million people (2.8% of the world population) suffered from diabetes in year 2000. it is expected that more than 70% of total diabetic patients in the world will be from developing countries by year 2030. the prevalence of type 2 diabetes in iran ranges from 1.3% to 14.5% which will increase as the population ages in both males (10.6%) and females (11.3%). vascular diseases are one of the most common causes of morbidity and mortality in diabetic patients. although, there is positive relation between insulin resistance and vascular disease, the exact mechanisms by which diabetes leads to arthrosclerosis is not well- understood. c-reactive protein (crp) and interleukin 6 (il-6) the two most sensitive markers of inflammation have been elevated in patients with type 2 diabetes. in addition, high crp level is shown to be a risk factor for developing type 2 diabetes, which may be atherogenic. oxidative stress is a component of cellular damage and has an important role in the pathogenesis of a number of human diseases including atherosclerosis. mechanisms that contribute to increased oxidative stress in diabetes may include not only increased non-enzymatic glycosylation and auto-oxidative glycosylation but also to decreasing antioxidant defence potential. fao/who, define probiotics as live microorganisms which when administered in adequate amounts confer a health benefit on the host. lactic acid bacteria (lab) and bifidobacteria are the most common types of microbes used as probiotics. animal studies showed that lactobacillus gg treatment not only reduces glucose intolerance but also significantly decrease hyperglycemia in streptozotocin induced diabetes rats. among other beneficial effects of probiotics and prebiotics, lactobacilli and bifidobacteria are the primary probiotic bacteria which are associated with cholesterol reduction, although comparable effect may be produced by other lactic acid bacteria, such as enterococci. it has also been reported that oral administration of heat killed lactobacillus casei to non-obese diabetic (nod) mice reduces the incidence of diabetes, but the mechanism underlying this effect has not been clarified. this study was designed to determine the effect of probiotics on lipid profile, glycemic control, insulin level, oxidative stress and inflammatory markers in patients with type 2 diabetes. this single-blinded clinical trial comprised 40 patients with type 2 diabetes recruited from medical clinic affiliated with shiraz university of medical sciences (sums) shiraz iran. diabetic patients with fasting blood glucose 126 mg/dl, aged from 25 to 65 years, and diagnosed as having diabetes for less than 15 years were eligible for the study. exclusion criteria were current smokers, subjects on non-steroidal anti-inflammatory drugs and multivitamin, as well as patients undergoing hormone replacement therapy, and those with any chronic diseases involving kidney, liver, and lung. the research was approved by the ethics committee of sums, and written informed consent was obtained from all patients prior to commencement of the study. subjects were initially studied during a screening visit after an overnight fast starting from 8 pm in previous evening baseline plasma samples were collected and analyzed for triglyceride, total cholesterol, ldl-c, hdl-c, glucose, insulin, malondialdehyde, hs-crp and il-6. using balanced block random sampling, subjects were then divided into two groups of intervention (probiotics) and placebo. patients in the intervention or treatment group received 1500 mg probiotic capsules twice daily, after lunch and evening meal for 6 weeks. the lactobacillus probiotics contained l. acidophilus, l. bulgaricus, l. bifidum, and l. casei. patients in placebo group received 1500 mg capsules containing 1000 mg magnesium stearate twice daily for six weeks. magnesium stearate is generally considered safe for human consumption at levels below 2500 mg/kg per day. according to the fda s subcommittee report on gras (generally recognized as safe) substances (scogs), adding magnesium stearate directly to human food after six weeks of experiment, fasting blood samples were collected and analyzed for all aforementioned parameters. methods of data gathering demographic data including age, sex, weight, height, body mass index (bmi), and waist to hip ratio (whr) were measured before and after the intervention. auto-analyzer bio-systems a-25 was used to determine the lipid profile and blood glucose concentration. elisa method was employed to determine insulin levels, high sensitive crp (hscrp) and il-6. comparison between different groups was performed through two independent samples t-test. in the absence of normal distribution, comparison between groups was made using non-parametric wilcoxon on signed ranks and mann-whitney tests. the study was conducted on 34 patients, of which 26 were females and 8 males. there were no significant differences in bmi and whr between placebo and treatment groups (table 1). the mean anthropometric data in the placebo and treatment groups*standard deviation;** waist to hip ratio;***body mass index table 2 shows changes in biochemical markers after probiotic treatment. the fasting blood sugar did not change significantly after probiotic treatment (table2). serum triglyceride concentration was reduced in probiotic treated group but the change was not significant (table2). there were no significant differences in total serum cholesterol, ldl-c, and hdl-c levels, between probiotic and placebo groups (table2). fasting plasma insulin level did not change in probiotic group compared to placebo group (table2). the mean parameters in placebo and treatment groups*non-parametric wilcoxon on signed ranks test; insulin-sensitivity measure: quicki (quantitative insulin sensitivity check index): 1/log (glucose0 (mg/dl))+log (insulin0 (mu/ml)); insulin-resistance measures: homa ir (homeostasis model for insulin resistance): insulin0(mu/ml)glucose0 (mmol/l)/22.5, firi (fasting insulin-resistance index): insulin0 (mu/ml)glucose0 (mmol/l)/25, bennetts index: 1/log (glucose0 (mmol/l))log (insulin0 (mu/ml)), insulin/glucose: insulin0 (mu/ml)-to-glucose0 (mmol/l) ratio although mda and il-6 levels were reduced in treatment group, but the changes were not statistically significant (table 2). there were an increase in crp levels in treatment group compared to placebo, but the change was not significant (table2). insulin-sensitivity was determined through quantitative insulin sensitivity check index (quicki) and insulin-resistance by homa ir, firi, bennett s index and ins/gluc ratio but there were no significant changes in these indices (table 2). diabetic complication, such as cardiovascular disease on the one hand and the dramatic growth of diabetic incidence on the other, demands a natural and safe solution to control and delay these complications. a strong association has been found between the level of oxidative stress and risk of cardiovascular disease. oxidative stress not only causes much pathopysiological complication but is also linked to insulin resistance which in turn causes diminished glucose uptake and disposal in peripheral tissues, and increasing glucose production in the liver. it has also been reported that postprandial hyperlipidemia and hyperglycemia are associated with increasing ldl-c oxidation and higher risk for cardiovascular disease. studies showed that probiotic containing foods may reduce the concentration of serum lipid and decreases both fasting and postprandial blood sugars in human. mann and spoerry reported that lactic acid bacteria are associated with a marked reduction in the total serum cholesterol. yun si et al, reported a significant reduction in fasting and postprandial glucose and decreasing hba1c in probiotic (bnr17) treated rats. in the present study, we were not able to demonstrate any significant effect on fasting blood glucose after treating with probiotics. serum triglyceride concentration was decreased but the change was not statistically significant. the reasons for these unexpected results can be related to either the small sample size or short duration of the study. observed some strains of lactobacillus acidophilus may decrease cholesterol absorption by enhancing the binding of cholesterol to the intestinal lumen. other possible cholesterol lowering properties of probiotics are deconjugation of bile by bile salt hydrolyses, binding of cholesterol to cellular surface and coprecipitation of cholesterol with deconjugated bile. this study showed no significant improvement in serum total cholesterol, ldl-cholesterol and or hdl-cholesterol after treating diabetic patients with probiotics. yadav et al. in their study on diabetic rats reported a marked reduction in pancreatic tissue oxidative damage due to a significant decrease in lipid peroxidation. in another study the same investigators showed that probiotic dahi not only decreases oxidative damage but also increases the antioxidant content and activities of catalase, glutathione peroxidase and superoxide dismutase in diabetic rats. the mechanism by which oxidative stress results in diabetic complications and tissue damage is the overproduction of the reactive oxygen species and reduction of the antioxidant defense function of the body. lipid peroxidation is one of the main biological targets of oxidative stress, which leads to formation of secondary products such as malondialdehyde that exacerbates oxidative damage. mda has been found to significantly increase in pathological conditions, which is considered as a common oxidative stress biomarker in recent years. the present study, showed a reduction in mda levels in probiotic-treated group; however, the reduction was not statistically significant.. showed a significant reduction in blood glucose and mda level in type 2 diabetic patients after consuming probiotic yogurt. evaluated the functional efficacy of antioxidative properties of probiotic in healthy subjects and found a significant improvement in blood total antioxidant activity (taa) and total antioxidant status (tas) after receiving probiotics. harisa et al. also reported a significant decrease in mda concentration after treating diabetic rats with l. acidophilus. divergent evidence is available on the anti-inflammatory properties of probiotics. while some studies reported beneficial effect, others showed no effect at all. in this study, interleukin-6 (il-6) examined the effect of probiotic bacteria on in vivo cytokine, antibody, and inflammatory responses in allergy-prone infants and showed that infants receiving probiotic had higher plasma levels of crp, and il-10 compared with those in the placebo group. studied the effect of lactobacillus rhamnosus gg (lgg) on rheumatoid arthritis (ra) patients and reported an increase in serum il-1 beta after lgg treatment with no significant change in il-6, tnf-alpha, myeloperoxidase (mpo), and il-10. a reduction in oxidative stress and cardiovascular risk factor seems to be an ideal treatment strategy in type 2 diabetic patients. the result of this study demonstrated that a 6 weeks oral treatment with probiotics decreased the concentration of tg, mda, and il-6 level in type 2 diabetic patients; however the change were not statistically significant. these finding could warrant future studies to determine the therapeutic effects of probiotic on diabetic patients.

background: the dramatic increase in the incidence of diabetes and its associated complications require a natural and safe solution to control and delay such complications. the present study tested the hypothesis that probiotics may affect biochemical indices of diabetic patients methods: thirty four types 2 diabetic patients aged between 25 to 65 years, and diagnosed with diabetes for less than 15 years were selected for this single- blinded clinical trial. using balanced block random sampling, the patients were divided into two groups of intervention (probiotics) and placebo. blood samples tested for baseline glucose, insulin, tg, total cholesterol, ldl-c, hdl-c, malondialdehyde, high sensitive crp (hs-crp) and il-6. after six weeks of experiment, fasting blood samples were re-tested and the data obtained were analyzed using spss software. results: there were no significant differences between anthropometric data including body mass index and waist to hip ratio in placebo and treatment groups. there was no significant difference in fbs, serum tg concentration total cholesterol and ldl-c levels between placebo and treatment groups. hdl-c levels were slightly elevated after probiotic treatment, which were not statistically significant. insulin, mda and il-6 levels were reduced and high sensitive crp hs.crp levels were elevated, although, not statistically significant. conclusion: the result of this study indicates a non- significant declining trend in the level of tg, mda and il-6 and insulin resistance after consumption of probiotics.

PMC3642943

pubmed-1176

the u.s. food and drug administration (fda) has approved around 30 antidepressant medications for the treatment of major depression. among them are selective serotonin reuptake inhibitors (ssris). these drugs change the balance of serotonin in the brain, such as fluoxetine (prozac), paroxetine (paxil), sertraline (zoloft), escitalopram (lexapro), and citalopram (celexa). another family of medications, selective serotonin and norepinephrine reuptake inhibitors (snris), help increase serotonin and norepinephrine levels in the brain, such as venlafaxine (effexor), duloxetine (cymbalta), and levomilnacipran (fetzima). still others in this family include bupropion (wellbutrin), vortioxetine (brintellix), mirtazapine (remeron) vilazodone (viibryd), nefazodone (serzone), and trazodone (desyrel). in addition, tricyclics and monoamine oxidase inhibitors, which are two classes of older antidepressants that work by inhibiting the brain s reuptake of serotonin and norepinephrine, are also approved but tend to cause more side effects than the other classes of antidepressants. but pharmacotherapy is nt the only option; two other major classes of treatment are also available psychotherapy and somatic nonpharmacological treatments. in randomized, controlled trials, cognitive-behavioral therapy (cbt) and interpersonal psychotherapy (ipt) repeatedly have been demonstrated to be effective in the treatment of major depressive disorder (mdd). whether other forms of psychotherapy, such as insight-oriented, psychodynamically based therapy, are effective in major depression remains controversial. brain stimulation therapies involve activating or touching the brain directly with electricity, magnets, or implants, and the fda has approved three somatic nonpharmacological treatments for depression: electroconvulsive therapy (ect), vagus nerve stimulation (vns), and repetitive transcranial magnetic stimulation (rtms). ect is generally considered the most effective of all depression treatments, although no head-to-head, randomized, controlled trial has compared it with other interventions. it generally requires inpatient hospitalization, at least initially, and general anesthesia with nine to twelve treatments over a three- to four-week period. vns and rtms are both fda-approved for treatment-resistant depression; the former requires an invasive surgical procedure. researchers have conducted relatively few controlled studies of these devices compared with the vast number of pharmacotherapy and psychotherapy treatment trials. with a plethora of drugs and psychotherapy approaches available, let us consider the problem psychiatrists encounter on a daily basis. a 50-year-old academic physician suffers from a classic major depressive episode associated with severe work stress. he has difficulty falling asleep, awakens several times during the night, and rises early with severe anxiety. he has reduced appetite, difficulty concentrating, and trouble enjoying any leisure activities, and he feels pessimistic about the future. he admits to passive contemplations about suicide, with recurring thoughts that if a car jumped the median and landed on his car, it would be an end to his suffering. he has no underlying medical disorder that might be contributing to depression, such as hypothyroidism or drug or alcohol abuse i want to recommend the treatment most likely to be successful in producing a complete remission of his depressive syndrome and relieving him of his considerable misery. what are the known and best-validated predictors of response? our group has previously reviewed the scientific findings in this area.36 the most reliable predictor is past response, but in this case the patient has never been treated for depression. a positive response in first-degree family relatives is also predictive of a beneficial response to antidepressants, but again, this is not applicable to this patient. some evidence suggests that certain subtypes of depression respond best to certain treatments monoamine oxidase inhibitors (the first type of antidepressants developed) are believed to be the most effective for patients with so-called atypical depression characterized by hypersomnia, overeating, extreme rejection sensitivity, and feeling better in the morning than later in the day. combinations of antidepressants and antipsychotics or ect are best for patients with major depression with psychotic features. surely patient choice is an important consideration, but it will likely be guided by my discussion with the patient. in 2013, mayberg, holtzheimer, dunlop, and craighead) were colleagues of mine for many years, and we continue to collaborate on various projects. mayberg s study sought to identify a biomarker that could predict which type of treatment would benefit a patient based on the individual s brain activity. using regional brain glucose metabolism as measured by positron emission tomography (pet) as a proxy for neural activity, her group sought to determine whether baseline resting state activity predicted remission after twelve weeks of treatment with either the selective serotonin reuptake inhibitor escitalopram (10 to 20 mg per day) or sixteen sessions of cognitive-behavioral therapy. the study sample initially comprised eighty-two men and women who were randomized between the two treatments. of these, sixty-five patients completed the study and thirty-eight had clear outcomes and acceptable pet data. the thirty-eight patients who comprise the analyzable data set were distributed as follows: eleven who went into remission with escitalopram (six non-responders) and twelve who did so with cbt (nine nonresponders). the major finding were that hypometabolism of glucose in the insula, likely reflecting reduced activity of neurons in this brain region, was associated with remission using cbt, and with poor response to escitalopram. contrariwise, insula hypermetabolism, reflecting increased activity of neurons in this brain region, was associated with remission using escitalopram and with poor response to cbt. the authors conclude that baseline insula metabolism is the first objective marker to guide initial treatment selection in depression first they eliminated from their primary analysis the responders to cbt or to escitalopram who did not go into remission. more specifically, partial responders to escitalopram or cbt were excluded from the analysis. they did so in order to accentuate the differences between the extremes in the depressed population; the results revealed clear differences in glucose metabolism in six regions: the right anterior insula, right motor cortex, left premotor cortex, right inferior temporal cortex, left amygdala, and precuneus. mean regional activity values for remitters and nonresponders segregated by treatment arm are plotted for the six regions showing a significant treatment outcome analysis of variance interaction effect. regional metabolic activity values are displayed as region/whole-brain metabolism converted to z scores. cbt indicates cognitive-behavioral therapy.7 when all six regions were compared, the right insula exhibited the greatest effect as a discriminator of treatment response, followed by the precuneus. when the whole sample was studied, right insular activity was positively correlated with the depression symptom severity scale, and with the hamilton depression rating scale (hrsd) score in the cbt treatment group while right insular activity was negatively correlated with the hrsd in the escitalopram treatment group. if additional research can replicates these results, it suggests that a simple brain imaging test could reliably predict whether a given patient should be treated with psychotherapy or antidepressant medication. it also raises a plethora of additional questions: a wealth of data, now summarized in a research meta-analysis, indicate that mdd patients with a history of child abuse and neglect exhibit a poorer response to pharmacotherapy and psychotherapy and exhibit unique brain imaging differences.8 mayberg s research does not address this critical clinical characteristic in this population.it is somewhat unclear how the six brain regions of interest were identified and why several regions repeatedly identified to be implicated in the pathophysiology of depression either were not selected or exhibited no significant effect, including the hippocampus, subgenual cingulate, and others.it is hard to know what to make of the findings that only the right anterior insula, right motor cortex, left premotor cortex, left amygdala, left precuneus, and right inferior temporal region show dramatic differences in the cbt versus escitalopram induced remission versus nonresponder groups whereas their counterparts, namely the left anterior insula, left motor cortex, right premotor cortex, right amygdala, right precuneus, and left inferior cortex did not. was a composite of the left and right sides of these structures informative?as the authors themselves point out, the study comprises a relatively small number of patients and our field is replete with pilot study findings that, unfortunately, have not been replicated in larger trials.this study utilized pet instead of the more often used functional magnetic resonance imaging (fmri) technology. as mayberg and her colleagues appropriately point out in their paper, fmri studies have examined regional brain activity and, more recently, resting state connectivity to identify mdd or mdd subtypes, but neither type of imaging has been used to discriminate response either among antidepressants or between antidepressants and psychotherapy.9 a wealth of data, now summarized in a research meta-analysis, indicate that mdd patients with a history of child abuse and neglect exhibit a poorer response to pharmacotherapy and psychotherapy and exhibit unique brain imaging differences.8 mayberg s research does not address this critical clinical characteristic in this population. it is somewhat unclear how the six brain regions of interest were identified and why several regions repeatedly identified to be implicated in the pathophysiology of depression either were not selected or exhibited no significant effect, including the hippocampus, subgenual cingulate, and others. it is hard to know what to make of the findings that only the right anterior insula, right motor cortex, left premotor cortex, left amygdala, left precuneus, and right inferior temporal region show dramatic differences in the cbt versus escitalopram induced remission versus nonresponder groups whereas their counterparts, namely the left anterior insula, left motor cortex, right premotor cortex, right amygdala, right precuneus, and left inferior cortex did not. was a composite of the left and right sides of these structures informative? as the authors themselves point out, the study comprises a relatively small number of patients and our field is replete with pilot study findings that, unfortunately, have not been replicated in larger trials. this study utilized pet instead of the more often used functional magnetic resonance imaging (fmri) technology. as mayberg and her colleagues appropriately point out in their paper, fmri studies have examined regional brain activity and, more recently, resting state connectivity to identify mdd or mdd subtypes, but neither type of imaging has been used to discriminate response either among antidepressants or between antidepressants and psychotherapy.9 the expanding area of genetics in general, and pharmacogenetics in particular, is also of vital importance. a burgeoning database documents the role of certain genetic variations in vulnerability to mood disorders, and more recently how variations may affect treatment response to different antidepressants. whether genetic material was collected in mayberg s study is unclear, but this focus is crucial, particularly in view of recent findings in imaging genomics. the lack of random assignment of the mdd patients as regards, for example, the vulnerability gene variants of the serotonin transporter or others, now shown to be associated with clear alterations in regional brain activity, could have confounded the results. this research group has always been willing to take great leaps forward, and they should be applauded for it. subsequent studies will reveal if the insula is truly the region that predicts response to cbt versus a selective serotonin reuptake inhibitor such as escitalopram or whether other regions or biomarkers also need to be a component of the ultimate formula. this is part of the ongoing and exciting scientific process that is emblematic of the marriage of neuroscience and psychiatry. ultimately, i believe this work will be judged as crucial in eventually attaining the goal all of us seek: a valid predictor of individual treatment response in depression, still the holy grail in psychiatry research.

editor s note:holy grail is a well-known metaphor for the eternal spiritual pursuit for truth and wisdom. it suggests that in order for us to find what no one has found, we must search where few have looked. in 2013, a group led by helen mayberg published a groundbreaking paper that sought an answer to one of the most discussed conundrums in psychiatry and neuroscience: can specific patterns of brain activity indicate how a depressed person will respond to treatment with medication or psychotherapy? our author examines the findings and discusses their potential impact on treatment for a public health problem that affects millions of people worldwide.

PMC4919944

pubmed-1177

cardiovascular disease (cvd) burden is substantially higher in chronic kidney disease (ckd) compared to non-ckd patients. in the end-stage renal disease (esrd) population, cardiovascular mortality is the leading cause of death, and despite the recently reported improvement in survival rates, cvd in this group remains unacceptably high. the increase in cardiovascular risk starts early on in ckd, with a lower estimated glomerular filtration rate (egfr) shown to be independently associated with increased cardiovascular risk even at the stage of microalbuminuria. ckd patients are therefore justifiably considered in the highest-risk group classification for cvd and, in fact, their risk of dying from a cardiac cause actually exceeds the risk of reaching esrd. they are attributed to a rather complex interplay of uremia-associated risk factors that are superimposed, as the disease progresses, on the already high burden of cvd traditional factors that characterizes the ckd population. subclinical atherosclerosis, as measured by noninvasive methods such as ultrasonically determined carotid intima-media thickness (cimt), is a valid predictor of coronary heart disease and vascular events in asymptomatic individuals. this is particularly important in the ckd group where the classic cardiovascular risk score approach underestimates the atherosclerotic burden. additionally, novel early atherosclerosis biomarkers, as well as possible therapeutic targets, are greatly needed in ckd patients. matrix metalloproteinases (mmps) may fall into this category of both useful markers and targets in ckd disease. mmps are a large family of endopeptidases that function under tight control, remodeling the extracellular matrix (ecm) and regulating the activity of many important non-ecm molecules including adhesion molecules, cytokines, and growth factors. they are classified according to their substrate specificity, sequence similarity, and domain organization into six groups: collagenases (mmp-1, mmp-8, mmp-13, and mmp-18), gelatinases (mmp-2, mmp-9), stromelysins (mmp-3, mmp-10), matrilysins (mmp-7, mmp-26), membrane-type mmps (mmp-14, mmp-15, mmp-16, mmp-24, mmp-17, and mmp-25), and other mmps (mmp-12, mmp-19, mmp-20, mmp-21, mmp-23, mmp-27, and mmp-28). their proteolytic activity is regulated at transcriptional and posttranslational levels but also at the tissue level by endogenous inhibitors, known as tissue inhibitors of metalloproteinases (timps 14). in vascular physiology and pathophysiology, they hold a prominent role by remodeling the ecm scaffold of the vessel wall and as regulators of the biological activity of nonmatrix molecules, including angiotensin-i, endothelin, tnf-, and others [1315]. based on the emerging role of mmps in vascular remodeling and their increased expression and activation under inflammatory and oxidative stress conditions, many studies have shown mmps imbalance to be a key event in atherosclerosis, arterial aneurysmal formation, and plaque instability. circulating levels of various mmps have been associated with both clinical manifestations of cvd [16, 17] and subclinical atherosclerosis [1820] or even as predictors of outcomes following revascularization [21, 22]. additionally, increased expression of mmps was observed at tissue level, in human carotid, coronary, and aortic atherosclerotic lesions [2325]. currently, the focus is on clarifying their exact role in the disease state and exploiting them in innovative diagnostic and research methodologies, as well as using them for prevention and therapy of vascular disease [2830]. in ckd, a plethora of underlying factors, with preeminent toxic uremic milieu and the increased levels of proinflammatory cytokines, oxidative stress, and acidosis, maintain a state of persistent low-grade inflammation, especially in esrd, with the addition of dialysis-related factors [31, 32]. although this state of chronic inflammation in ckd renders mmps attractive candidates for studies in this population and despite the mounting evidence of their role in cvd, the association between mmps and subclinical atherosclerosis in ckd patients has not been systematically studied. to this effect, we performed a systematic literature review and evaluation of the evidence associating circulating levels of mmps with subclinical atherosclerosis outcomes in ckd patients. the electronic databases scopus, pubmed, and google scholar were searched from inception until may 2015 using the keywords: atherosclerosis, metalloproteinases, kidney diseases, and hemodialysis either in the title or the abstract or using medical subject headings (mesh) terms. inclusion criteria were ckd cohort or case-control studies involving ckd patients, reporting as one of the outcomes of interest, the relationship of circulating measurement of mmps or their tissue inhibitors (timps), and markers of atherosclerosis (i.e., imt, plaque number, or similar atherosclerotic outcomes). the included studies were identified after two reviewers (andreas kousios, panayiotis kouis) independently screened the title and abstract of the obtained electronic search results and final selection was based on full text evaluation. two reviewers (andreas kousios, panayiotis kouis) independently extracted data regarding the studies ' design, characteristics of the included ckd population, methodology for circulating mmps levels determination, and assessment of atherosclerosis outcomes. the direction and magnitude of the association were recorded, as well as additional information such as method of statistical analysis and adjustment for potential confounders. the newcastle-ottawa scale for observational studies, which evaluates the selection of participants, the comparability of different groups, and ascertainment of exposure and outcome of interest, was utilized for the quality assessment of the included studies. in addition, a more detailed quality assessment was carried out regarding the methodology of atherosclerosis outcome evaluation based on the mannheim consensus criteria for carotid intima-media thickness and plaque assessment. 6218 items were excluded from further analysis based on title and abstract, while the remaining 106 were retrieved for full text assessment. studies with overlapping populations were cross-checked and final selection was based on the number of ckd participants. among the reports assessed in full text, 32 were literature reviews, 6 were commentaries or editorials, and another 4 were animal studies. additionally, 12 studies did not provide data on serum concentrations of mmps or their tissue inhibitors, 31 studies did not provide evidence on atherosclerosis related outcomes while 4 studies did not comprise a ckd population, and another one involved an overlapping population with another study. in summary, out of the total 106 reports retrieved, 16 reports were included in the qualitative synthesis and, among these, a total of 9 studies provided enough data to be included in the quantitative synthesis (figure 1, prisma diagram). the studies that were excluded at the last step prior to quantitative synthesis and the reason for their exclusion are presented in supplementary table 1 (in supplementary material available online at http://dx.doi.org/10.1155/2016/9498013). four studies were carried out in europe while the remaining studies were performed in the usa (two), africa (two), and asia (one). all the studies were observational and the majority of them included a ckd subgroup of participants along with age-matched healthy controls. weber et al. evaluated the association of mmps with atherosclerosis outcomes only in ckd stages iii and iv while snchez-escuredo et al. overall, the nine studies reviewed here involved a total of 1061 participants, of whom 858 were ckd patients and 203 were healthy controls. of the ckd patients, the association between mmp-2 and timp-1 with atherosclerosis was the most frequently assessed (four studies) with mmp-9 also assessed in three. seven studies used cimt as the atherosclerosis outcome and two of them also used an atherosclerosis score and carotid plaque number [37, 38]. the two studies included that did not measure cimt provided data on the relationship between mmps or their tissue inhibitors and aortic and coronary artery calcification and carotid plaque presence. characteristics of studies, including atherosclerotic outcome assessed, are shown in table 1. mmp-2 was found to have a positive association with cimt even after adjustment for multiple confounders in three studies [3941] and a positive association with abdominal aortic calcification but not with coronary artery and thoracic aortic calcification. the relationship of timp-1 with cimt was less consistent as only one of the three studies evaluating this relationship reported a statistically significant positive association; however, it did not account for different confounders. similarly, weber et al., who evaluated the relationship between timp-1 and calcification at coronary and aortic sites and included adjustment for multiple confounders, reported no statistically significant association either. mmp-9 was found to be positively and strongly associated with cimt, atherosclerosis score, and number of carotid plaques in a ckd population by addabbo et al. but this relationship was not confirmed in two additional studies evaluating mmp-9 and cimt [39, 40]. mmp-10 was only assessed in two studies and both of them reported a positive association with cimt in hd subgroups [38, 42] but only one of them reported a similar association in a non-hd, ckd subgroup. evaluated the relationship of papp-a with plaque presence and reported a significant positive association in a population of hd patients awaiting kidney transplant (or: 4.45; ci: 1.2216.2; p value: 0.023). papp-a was not found to be associated with cimt in a more recent study also involving hd patients. among the tissue inhibitors of mmps evaluated in this review (i.e., timp-1 and timp-2), only timp-2 showed some evidence of a negative association with atherosclerosis as pawlak et al. reported a negative association after adjusting for confounders between timp-2 and cimt, although in a more recent study by the same group this finding was not repeated. the quality assessment of the included studies was performed according to the newcastle-ottawa scale and the results are presented in table 2. overall, the included studies were characterized by good methodology and this offers some reassurance that the results presented have not been substantially influenced by bias. however, due to the substantial variability in the methodology and equipment used for the evaluation of atherosclerosis outcome, an additional table was constructed with particular emphasis on the modalities and the measurement and reporting methods used by each study (table 3). in concordance with the mannheim consensus, most studies assessed atherosclerosis in longitudinal view on the far wall and common carotid artery (cca) was the most commonly used anatomical site followed by carotid bulb (cb) and the internal carotid artery (ica). however, few studies reported whether measurements were obtained at the end of diastole or whether measurement was obtained in a blinded fashion. this systematic review evaluated the published evidence on the association between circulating levels of mmps and subclinical atherosclerosis in ckd patients. furthermore, the vast majority of studies were also characterized by a small sample size as most of them included less than 100 ckd patients. cimt was the main measure of subclinical atherosclerosis reported and mmp-2 and timp-1 were the most commonly assessed metalloproteinases. although the number of studies providing the same data on mmp-2 was too small for a formal meta-analysis, the overall consistent direction and magnitude of the association of mmp-2 with cimt reported in the different studies suggest that this is positively associated with subclinical atherosclerosis in ckd patients. it is however important to note that two out of the four studies reporting on mmp-2 were in hemodialysis patients only. on the contrary, most of the studies that evaluated timp-1 and subclinical atherosclerosis did not find any significant relationship, while for the remaining mmps, the low number of studies identified does not allow for any inferences regarding their association with subclinical atherosclerosis. studies involving ckd patients that did not use atherosclerosis measures as an outcome were excluded at the last step, prior to quantitative synthesis, in order to limit the results of this study to objective atherosclerosis measures as opposed to clinical or self-reported measures such as history of cvd. notably, in these studies, circulating levels of mmp-2 were associated with previous history of cvd in a non-hd ckd population and in a peritoneal dialysis (pd) population, providing further supporting evidence for mmp-2 association with cvd in ckd (supplementary table 1). for consistency, we also excluded studies that had measured mmp expression in vessel tissue instead of circulating concentrations. although tissue expression level is a direct evidence of mmp implication in the pathophysiology of atherosclerosis, it is not easily transferrable in the clinical setting as a biomarker. interestingly, only one study was found to report an association between serum measurements of mmps and atherosclerosis markers in pediatric ckd patients, making a separate review of these findings not possible. overall, although this approach limits the number of informative studies reviewed here, it allowed us to answer the more precise question on the association between circulating mmps and subclinical atherosclerosis in adult ckd patients. regulation of mmps expression and activity in physiological or pathological vascular remodeling is induced by hemodynamics, injury, inflammation, and oxidative stress [15, 47, 48]. in ckd, a condition where these processes are enhanced, it is expected that mmp dysregulation is intensified, particularly in late ckd stages and hd. persistent, low-grade inflammation in ckd is attributed to the production of proinflammatory cytokines combined with their decreased renal clearance, the ckd-associated metabolic acidosis, the uremic milieu induced oxidative and carbonyl stress, the chronic or frequent recurrent infections, and thrombotic events. in addition, dialysis-related factors, such as membrane biocompatibility, water and dialysate purity, and microbiological quality, further contribute and sustain inflammation in esrd. this uremia-inflammation interplay in ckd underlies the accelerated atherosclerosis and increased imt, the arterial stiffening, and increased vascular calcification of both intima and media and impairs the vascular repair process with the detrimental consequences of neointimal hyperplasia. moreover, plaque morphology, composition, and vulnerability differ in ckd, as coronary and carotid plaques of ckd patients were shown to be more calcified, more unstable, and frequently ruptured and containing less fibrous tissue [5052]. central to the pathogenesis of these processes and plaque formation are the endothelial cell (ec) dysfunction and vascular smooth muscle cell (vsmc) migration and their phenotypic shift to a more proliferative and secretory state [49, 53]. their cleaving of ecm and non-ecm molecules induces the pathogenic phenotypic shift of ecs and vsmcs and facilitates increased endothelial inflammation and permeability, intimal-medial thickening, fibrosis, calcification, and stiffening [26, 54]. mmps 1, 2, 8, 9, and 12 are mostly implicated in these processes with mmp-2 and mmp-9 having a prominent role. in later stages of atherosclerosis, mmps contribute to reducing the atherosclerotic plaques ' fibrous cap, thus rendering plaques more unstable and prone to rupture. in ckd patients, only few studies have examined the levels of circulating mmps compared to controls demonstrating increased circulating mmp levels in ckd, particularly those of mmp-2, mmp-9, and mmp-10 [57, 58]. additionally, mmp-2 and mmp-9 were shown to be upregulated focally in uremic vessels in two studies by chung et al. [59, 60]. mmp-2 was upregulated in arteries of esrd patients and activated mmp-2 was strongly correlated with arterial stiffness in dialyzed patients (supplementary table 1). mmp-2 and mmp-9 were upregulated in diabetic ckd arteries and correlated with stiffening and endothelial dysfunction (supplementary table 1). as research is ongoing on the development of cardiovascular risk markers in ckd patients, mmps stand to serve as potential biomarkers for atherosclerosis and cardiovascular risk assessment in this high risk group. in order for a potential biomarker to be approved for clinical use, it needs to be confirmed through rigorous testing of multiple subjects and testing should be characterized by reproducibility, good sensitivity, and specificity. the limited number of studies identified in this review reflects the fact that the level of evidence is still quite low for use of mmps as biomarkers for atherosclerosis in ckd patients, although the accessibility and relatively low cost of circulating mmps measurements along with knowledge of the disease mechanisms argue about the benefit of additional and larger studies involving ckd patients. moreover, such studies would provide further insight into their contribution to the higher cvd burden in ckd and, more importantly, would pave the way for their use in therapeutic interventions or even their targeted and specific inhibition. although the majority of the studies reviewed here are characterized by good overall methodology according to the newcastle-ottawa scale criteria, we have identified additional parameters relating to the performance of atherosclerosis assessment that vary between studies and may introduce additional variability in the estimated relationship between circulating mmps and subclinical atherosclerosis. as most of the studies used cimt and plaque measurements as surrogates for subclinical atherosclerosis, it is important to highlight the necessity of a homogenized approach for image acquisition, data analysis, and reporting methods, as well as the use of unified criteria to distinguish early atherosclerotic plaques from increased imt. with regards to imt measurement, the manheim carotid intima-media thickness and plaque consensus report proposes the site of measurement to be the far wall of the cca. mean imt values across the cca may be less susceptible to errors compared to maximum values and composite measures of imt and plaque should be avoided. plaque assessment should include the location, thickness and area, and plaque number and should be scanned in longitudinal and cross sections. in most of the reviewed studies, although imt was measured in the far wall of cca, there was considerable variability in methodology and poor plaque assessment. furthermore, circulating levels of mmps are influenced by environmental, genetic, disease, and drug related factors and although evaluating each of these factors individually is beyond the scope of this review; they need to be carefully examined in future study designs involving ckd populations. additionally, variations in sample collection methodology and preanalytical care have been found to significantly affect mmps levels with serum samples reported to have higher mean values compared to plasma samples [64, 65]. the majority of the included studies in this review had measured mmps levels in serum [36, 3843], with only two studies using plasma [35, 37]. although we can not exclude the possibility of such discrepancies in explaining part of the heterogeneity in the results, it seems unlikely that they would explain all of it as similar heterogeneity exists in the results obtained from studies that used serum. also, variations in mmps levels could arise from the status of recruited patients as it is suggested that hemodialysis may affect mmp levels, especially mmp-2, mmp-9, and their inhibitors [66, 67]. additionally, all studies included patients with a history of cvd. however, only six out of the nine studies reported the prevalence of cvd history in their patients groups which ranged between ~8% and 80%, while the cross-sectional design of the studies further limits the causal inferences that could be made. finally, none of the studies performed a priori power analysis in order to estimate the appropriate sample size and the possibility of publication bias can not be excluded as almost no study included in this review reported only a negative association between mmps levels and subclinical atherosclerosis. despite the extensive study of mmps and their role in the atherosclerotic process in both animal models and human studies, there are disproportionately fewer published studies of the atherogenic effects of mmps in patients with ckd. this is in keeping with a well described phenomenon of underrepresentation of ckd patients in cardiovascular disease studies despite the growing global burden of kidney disease and the high prevalence of ckd among cvd patients. nonetheless, based on their central role in arterial wall remodeling, mmps demonstrate great potential for further studies in ckd, a condition where the main drivers for mmp dysregulation, such as inflammation and oxidative stress, are intensified. their linkage to early atherosclerotic change, reflected in established but often not easily accessible subclinical atherosclerosis markers, provides the basis for mmps use as biomarkers or even as pharmacological targets of cardiovascular disease in ckd patients. to this effect, we have systematically reviewed the literature and critically appraised all studies addressing the association of various mmps with subclinical atherosclerosis in ckd patients. we aimed to help structure the knowledge derived from human studies in the field and identify potential candidate mmps for further research. future research initiatives in this field are thus urgently needed and would benefit by addressing the methodological issues identified in this review, during the study design process. overall, these findings are highly relevant in view of the undiminished interest in mmps and the need for novel approaches to address the significant problem of cvd in chronic kidney disease. in summary, the published evidence reviewed here demonstrates that circulating mmps levels could potentially be of use as biomarkers of subclinical atherosclerosis in adult ckd populations. mmp-2 shows the greatest promise although most of the other mmps or their tissue inhibitors are mostly understudied in the ckd population and no inferences about their potential can be made. studies characterized by larger and well defined ckd populations and involving several mmps and a consistent and homogenized assessment of different measures of subclinical atherosclerosis such as imt and plaque burden are urgently needed.

background. cardiovascular disease (cvd) remains a significant problem in chronic kidney disease (ckd). subclinical atherosclerosis identified by noninvasive methods could improve cvd risk prediction in ckd but these methods are often unavailable. we therefore systematically reviewed whether circulating levels of matrix metalloproteinases (mmps) and tissue inhibitors (timps) are associated with subclinical atherosclerosis in ckd, as this would support their use as biomarkers or pharmacologic targets. methods. all major electronic databases were systematically searched from inception until may 2015 using appropriate terms. studies involving ckd patients with data on circulating mmps levels and atherosclerosis were considered and subjected to quality assessment. results. overall, 16 studies were identified for qualitative synthesis and 9 studies were included in quantitative synthesis. mmp-2 and timp-1 were most frequently studied while most studies assessed carotid intima-media thickness (cimt) as a measure of subclinical atherosclerosis. only mmp-2 demonstrated a consistent positive association with cimt. considerable variability in cimt measurement methodology and poor plaque assessment was found. conclusions. although mmps demonstrate great potential as biomarkers of subclinical atherosclerosis, they are understudied in ckd and not enough data existed for meta-analysis. larger studies involving several mmps, with more homogenized approaches in determining the atherosclerotic burden in ckd, are needed.

PMC4793143

pubmed-1178

obesity epidemic continues its worrying global progression although significant advances have been achieved in the knowledge of its causes and consequences. this condition, in concert with glucose intolerance/type 2 diabetes, dyslipidemia, and metabolic syndrome, widely contributes to what has been recently defined as prosperity's plague. a complex system of social, psychological, physiological, and biological factors has to be considered in order to successfully control this plague and prevent from its further spread [2, 3]. from a physiological point of view, it is fundamental to understand the specific relative importance of long-term and short-term mechanisms involved in the regulation of energy balance. food intake and daily overconsumption may have a predominant impact on body weight regulation, and this led large interest to focus on appetite/satiety balance as one of the key potential therapeutic targets. multiple sites in the gastrointestinal (gi) tract, including the stomach, proximal and distal small intestine, colon, and pancreas, are involved in the short-term regulation of energy homeostasis, which basically controls what, when, and how much we eat within a single day or a single meal. in addition to mechanoreceptors and chemoreceptors, which are activated during a meal and signal to the brainstem through the vagal nerve, several gut-derived peptides and lipid mediators have a role in the regulation of food intake and energy homeostasis. the only recognized hunger gut peptide this peptide is mainly produced by the stomach and directly influences the number of meals consumed per day though it has probably no direct effect on meal size. however, the stomach plays an essential mechanical role in the regulation of satiety perception and meal termination. it is, in fact, the first organ to receive the bolus of food. here, the food ingested is rapidly homogenized, partially digested, and finally delivered to the small intestine. importantly, gastric distension and gastric emptying via the pylorus are finely regulated in order to match food delivery to the actual gut digestive and absorptive capacity. as a consequence, gastric competence can be considered as the first limiting step of gi ingestive and digestive capacity and thus represents a relevant target for obesity prevention and treatment. motility and physical mechanisms involved in gastric-mediated satiety have been extensively studied and successfully targeted in recent years [10, 11]. however, it is still unknown whether the gastric mucosa also releases any biochemical signal that may influence satiety in the very short term of meal consumption. in an attempt to explore this possibility, the serial analysis of gene expression (sage) method was used to identify the early transcriptional changes induced by a low-fat (lf) or high-fat (hf) meal in the gastric mucosa. the discovery potential of sage was determinant for choosing this technology instead of other comparable transcriptomic methods. sage, indeed, is a powerful and reliable sequencing-based technique which allows to detect the regulation of novel transcripts as well as characterized genes, as we have already shown in a number of previous studies [13, 14]. a total of 140 male c57bl6 mice (12-week-old) were purchased from charles river canada inc. and 12450b: 10% calories from fat, 70% from carbohydrate, and 20% from protein; 3.85 kcal/g) and tap water were served ad libitum. in the last day of the acclimatization, the body weight paired mice were randomly distributed into seven groups and fasted for 12 hours during darkness of the light cycle. on the experimental day, the other mice were fed ad libitum with high-fat (hf, research diet no. 12492: 60% calories from fat, 20% from carbohydrate, and 20% from protein; 5.24 kcal/g) or lf meal and sacrificed 30 min, 1 h, and 3 h after the beginning of the meal. the amount of macronutrients and energy ingested was recorded. in total, seven groups of mice under isoflurane anesthesia (fasting, hf 30 min/1 h/3 h, and lf 30 min/1 h/3 h) were alternatively exsanguinated by cardiac puncture after cervical dislocation. stomach was opened vertically and flushed clean with saline, and the mucosa was removed by scrapping with a glass microscope slide. the samples were rapidly frozen in liquid nitrogen and stored at 80c until rna extraction. all animal experimentation was conducted in accordance with the requirements of the canadian council on animal care and approved by the animal protection committee of laval university. the seven serial analyses of gene expression (sage) libraries were constructed as previously described. total rna was isolated from pooled stomach mucosa for each group (n=20) by trizol (invitrogen canada inc., burlington, on). the quality of total rna was monitored by microcapillary electrophoresis (bioanalizer 2100, agilent technologies, mississauga, on). polyadenylated rna was extracted (oligotex mrna mini kit, qiagen inc., mississauga, on), annealed with the biotin-5-t18-3 primer, and converted to cdna (cdna synthesis kit, invitrogen canada inc.)., pickering, on), and the 3 restriction fragments were isolated with streptavidin-coated magnetic beads (dynal biotech llc, brown deer, wi) and separated into two populations. each population was ligated to one of two annealed linkers and extensively washed to remove unligated linkers. the tag beside the most 3nlaiii restriction site (catg) of each transcript was released by digestion with bsmfi (new england biolabs ltd.). the blunting kit from takara bio inc. (otsu, japan) was used for the blunting and ligation of the two tag populations. the resulting ligation products containing the ditags were amplified by pcr and digested with nlaiii. the purified ditags were self-ligated to form concatemers using t4 ligase (invitrogen canada inc.). the isolated 500 bp to 1800 bp concatemers were isolated by agarose gel, and the resulting dna fragments were ligated into the sphi site of puc19 and cloned into omnimax 2t1 competent cells (invitrogen canada inc.). white colonies were picked up, and the concatemer inserts were finally sequenced by the applied biosystems 3730 (foster city, ca). identification of the transcripts was obtained by matching the 15 bp (sequence at the last catg+11 bp tags) with sagemap, unigene, and genbank databases. classification of the transcripts was based upon the updated information of the genome directory found at the tigr website (http://www.tigr.org/), the source (http://genome-www5.stanford.edu/cgi-bin/source/sourcesearch), and the omim (http://www.ncbi.nlm.nih.gov/) as well as previously published literatures. we have previously shown that the sage method is very reproducible with r=0.96 between two sage libraries constructed from the same total rna pool. first strand cdna was synthesized using 5 g of pooled rna of each experimental group in a reaction containing 200 u of superscript iii rnase h-rt (invitrogen canada inc.), 50 ng of random hexamers, 300 ng of oligo-dt18, 50 mm tris-hcl ph 8.3, 75 mm kcl, 3 mm mgcl2, 5 mm dithiothreitol, 0.5 mm deoxynucleotides triphosphate, and 40 u human rnase inhibitor (roche) in a final volume of 50 l. the resulting products were then treated with 1 g of rnase a for 30 minutes at 37c and purified thereafter with qiaquick pcr purification kits (qiagen). the cdna corresponding to 20 ng of total rna was used to perform fluorescent-based real-time pcr quantification using the lightcycler real-time pcr apparatus (roche inc., nutley, nj) and the faststart dna master sybr green kit (roche diagnostics). reading of the fluorescence signal was taken at the end of the heating to avoid nonspecific signal. oligoprimer pairs that allow the amplification of approximately 250 bp were designed by genetools software (biotools inc., gene name, genbank accession numbers, and regions used for the primer pairs were the following: chymotrypsin-like elastase family member 3b (elastase 3, cela3b), nm_026419, 189385; amylase 2a1, pancreatic (amy2a1), nm_001042712, 8481039; pancreatic lipase (pnlip), nm_026925, 8401067; major urinary protein 1 (mup1), nm_031188, 127405; protein disulfide isomerase associated 3 (pdia3), bc033439, 9941222; zymogen granule membrane protein 16 (zg16), nm_026918, 348522. the mrna levels were calculated using a standard curve of crossing point (cp) versus logarithm of the quantity and expressed as the number of copies per microgram of total rna. the lightcycler 3.5 program provided by the manufacturer (roche inc.) was used to calculate the cp according to the second derivative and double-correction method previously described by luu-the et al.. the standard curve with efficiency coefficient e=2 was established using known cdna amounts of 0, 10, 10, 10, 10, and 10 copies of atp synthase o subunit. when the anova revealed a significant interaction between diet and time, the contrast analysis was performed to identify the significant difference between the hf and lf groups from the same time points (p<.05). for the sage data, the comparative count display (ccd) test was used to identify the transcripts which were significantly differentially expressed (p .05) between the groups with more than a two-fold change, as previously described by lash et al.. q_rt-pcr data were analyzed by the two-tailed student's t-test (p<.01) for the time points formerly determined by the sage method. food and energy intakes are presented in figure 1 as cumulative and 30 minutes average consumption. as expected, cumulative energy as well as protein and fat intakes were higher, whereas carbohydrate intake was lower in the hf groups compared to lf (figure 2(a)). interestingly, a distinct pattern of feeding behavior between lf- and hf-fed mice can be observed by comparing the average 30 minutes consumption of the two groups (figure 1(c)). mice assigned to lf meal ate a moderate amount of food during one hour, after which their consumption decreased to a minimum intake. in contrast, the hf group consumed a large amount of meal in the first 30 minutes although the intake dropped in the following 30 minutes, reaching the minimum level at 1 h. however, the hf-group mice ingestion increased again in the last two hours. seven sage libraries were generated to identify the transcripts differentially modulated in mouse gastric mucosa by the following experimental conditions: fasting; lf or hf meal at 30 min, 1 h and 3 h since the beginning of consumption (lf 30 m/1 h/3 h and hf 30 m/1 h/3 h, resp.). among the 56382 sage tag species detected, a total of 35 transcripts were significantly regulated by lf and hf feeding compared to fasting, whereas 19 were specifically modulated by hf compared to lf. the most represented group includes transcripts coding for digestive enzymes and secretory pathway components (table 1). among the modulated mrnas were amylase 2a1, pancreatic lipase, carboxyl ester lipase, elastase 1 and 3, and carboxypeptidase a1 and b1. globally, three of them have lipolytic functions, nine code for proteolytic enzymes and one gene is involved in carbohydrate digestion. in addition, two genes involved in zymogen granule secretion were regulated, namely syncollin and zymogen granule membrane protein 16. interestingly, most of these genes showed a common pattern of regulation since their expression was downregulated at lf 30 m and 1 h, as well as at hf 1 h and 3 h, compared to fasting. moreover, the expression of these transcripts tended to increase at lf 3 h though the up-regulation was statistically significant only for six of them, such as amylase 2a1, chymotrypsinogen b1, and pancreatic lipase related protein 1. remarkably, for 13 out of the 15 tags considered, the specific differential regulation between lf 3 h and hf 3 h achieved statistical significance. there is, therefore, a common downregulation of these transcripts following both lf and hf feeding although a temporal delay between the two groups can be observed. in addition, 3 hours after the beginning of the lf meal, their transcription tended to increase at higher levels than those observed at the fasting state., the mrnas coding for the heat shock protein 70 (hsp70) 1a and expressed sequence tag (est) hsp70 1b were both upregulated by the lf meal, and the latter also by the hf meal, at 1 h following the beginning of ingestion. gene expressions of cysteine-rich protein 1, metallothionein 2, and est wd repeat domain 92 were reduced at lf 3 h compared to fasting, whereas onzin mrna levels significantly decreased at hf 3 h. moreover, hf specifically modulated the transcription of protein disulfide isomerase associated 3 and est elastase 2a/neutrophil elastase, respectively, up- and downregulated at 3 h. the results also showed the differential regulation of two transcripts coding for proprotein convertase proteins (furin and kallikrein) and an interesting new candidate as potential regulator of energy metabolism, namely mup 1 (table 2). in addition, lf and hf feeding significantly regulated 12 novel transcripts with no match in public databases (table 3). in particular, the tags ggagaacagcg and ctgactcaaat were specifically modulated by hf feeding compared to lf and could represent potential targets for further characterization studies. to validate the sage results, the q_rt-pcr analysis was also performed for some of the genes differentially regulated by feeding. the chosen genes are representative of the functional groups discussed. as presented in figure 3, the q_rt-pcr results globally confirmed the changes in expression level as well as the significant modulation highlighted by the sage method. the main regulated functional group is represented by digestive enzyme-coding genes, many of which are mostly expressed by the pancreas. in addition, two transcripts involved in the secretory pathway, syncollin, and zymogen granule membrane protein 16 were also modulated. many of the physiological changes induced by food intake should arise within minutes. therefore, the digestive enzymes and regulatory factors are normally synthesized and packed in secretory granules at rest, ready to be released when food ingestion and appropriate neurohumoral stimuli occur. following the meal, another cycle of synthesis and packaging prepares the zymogenic cells to the next secretory events. concordantly, the present results showed a decreased transcription of digestive enzyme-coding and secretory genes following the start of ingestion, when the cells are more likely to invest energy in secretion. moreover, in the lf-fed mice, the reinduction of these genes that occurred 3 hours after the beginning of intake seems a reasonable event, particularly if referred to their feeding pattern (figure 2). conversely, the digestion of a high-calorie and high-energy density meal, including its rate of emptying from the stomach, normally takes a longer time to be accomplished [20, 21]. the latter point may explain the delayed and prolonged downregulation of digestive transcripts in the hf group, which also suggests that the reinduction of transcription observed at lf 3 h may have started later in the hf-fed mice. interestingly, though all the mice had ad libitum access to food, feeding behavior and total ingestion were dissimilar between lf and hf groups (figures 1 and 2), possibly explaining the differences in the transcriptional regulation of digestive enzymes. however, the levels of digestive enzymes and secretory proteins might as well influence the intake. a physiological redundant excess of digestive capacity characterizes the gi system and guarantees the effectiveness of nutrition. moreover, the excess capacity for nutrient uptake, including the excess of surface, specialized cells, digestive enzymes, and other secretory products, is proportionally related to body weight. hence, this may also contribute to compromise the efficient control of appetite/satiety balance in overweight and obese subjects. the stomach may represent a primary target for the control of meal size and satiation. eventually, surgical options which physically affect gastric capacity and emptying mechanisms successfully modify the eating behavior and metabolic profile of obese patients though they still are invasive and lifestyle-affecting methods. likewise, mechanisms other than mechanical may also affect gastric volume and emptying rates to regulate satiation during meal consumption. presently, there still is a paucity of literature addressing the specific effects of hf intake on the neurohormonal control of gastric capacity and motility mechanisms. therefore, the search for these pathways was the principal aim of the current study. in particular, it would be useful to explain the specific role of these genes in the stomach and, most interestingly, their differential regulation in response to fasting and feeding. considering the high level of transcription, such as for amylase 2a1 at fasting and lf 3 h in contrast, it is hard to explain how the digestive enzymes, normally active at a neutral ph, could conceivably work in such an acidic milieu. however, it should also be considered that these proteins are often released as precursors and eventually activated by specific signals or the appropriate ph. this was not the first time that the expression and activity of pancreas-related genes were detected in the stomach and other nonpancreatic components of the gi system. terada and colleagues had already showed the expression of alpha-amylase, trypsin, chymotrypsin, and pancreatic lipase in normal and pathologic epithelial cells of gastric mucosa by immunohistochemistry and western blotting. they had also proved their enzymatic activity in stomach specimens, although to a far lesser extent than in pancreas. in that report, the authors explained the presence of pancreatic enzymes in nonpancreatic tissues as a result of the common embryonic origin (foregut) shared by the gastroenteric tissues. in addition, the mrna expression levels of representative genes have been further confirmed by q_rt-pcr in the present study. it can be hypothesized that the digestive enzymes expressed by the gastric mucosa would combine with the bolus of homogenized and partially digested food that finally reaches the small intestine. in normal conditions, the digestive enzymes would be in excess, but enough to guarantee the effectiveness of digestion in case of insufficient pancreatic secretion. the redundant production of these proteins along the digestive tract was also suggested by our previous study of the duodenum transcriptome, where analogue experimental conditions had been applied. in the intestine, the same pancreas-related transcripts were modulated (n=9) but showed the opposite trend, being upregulated at lf 1 h and hf 3 h. interestingly, in both the duodenal and gastric mucosa, the regulation of digestive gene expression presented a temporal delay between the lf and hf groups. the mucosal epithelium is a primary barrier, which defends the whole organism from external dangerous agents eventually ingested. moreover, uncontrolled acid secretion, inflammation, oxidative stress, and the epithelial damages consequently engendered can compromise the physical and functional integrity of the mucosal barrier. among the transcripts differentially regulated in the gastric mucosa, seven metallothionein 2 [24, 25], hsp70 (1a and 1b) [26, 27], and protein disulfide isomerase associated 3 genes [28, 29] code for multiple-task proteins, which can show chaperone activity and/or be involved in cell redox homeostasis control and apoptosis regulation. the latter is a very important role, since gastric epithelium is subject to constant renewal. the epithelial cells, in fact, rapidly turnover (13 days in humans), undergoing a cycle of division and differentiation before succumbing to apoptosis [9, 30]. in this study, est hsp70 1b was upregulated by both lf and hf at 1 h, and the same trend was observed for hsp70 1a. however, for the latter, the hf 1 h increase did not reach a statistical significance. interestingly, a polymorphism of hsp70 1b gene has been recently associated with obesity-related traits, thus stimulating further questions about its acute modulation by food intake. in the present study, the gene coding for mup1 was specifically downregulated at hf 30 m compared to lf. in previous transcriptomic studies conducted with the sage method, mup1 gene was also significantly regulated by feeding in the duodenum mucosa and hypothalamus of mice [13, 14]. however, recent studies in mice have surprisingly revealed that mup1 is also involved in glucose and lipid metabolism, and that it might play an important role in the regulation of energy expenditure. these findings raise the interest about the specific role of this molecule at the tissue level but also as a potential modulator of energy balance. globally, the most regulated class of genes was the one coding for proteolytic enzymes, particularly the serine-protease type. this group of proteases is highly represented in nature and shows numerous and functionally diverse functions, ranging from digestion and coagulation to apoptosis and immunity. in addition to the digestion-related genes described above, feeding regulated two other transcripts coding for highly important serine proteases, namely kallikrein and furin. est kallikrein 1 was specifically regulated by hf 3 h compared to lf, whereas furin was downregulated at lf 1 h. these two molecules act as proprotein convertases in distinct regulatory pathways. the first cleaves kininogen to produce kinin peptide, whereas furin processes the precursors of a large variety of proteins, including growth factors and receptors. interestingly, the specific pathways involving kallikrein-kinin [37, 38] and other proteins of furin family [39, 40] are presently being studied for their potential contribution to obesity and cardiovascular disorders. the present study was the first to analyze the global transcriptional changes acutely induced in mouse stomach mucosa by feeding and, in particular, by different nutritional stimuli. the principal aim was to identify new signals specifically induced by hf intake in the short term of meal consumption. given the weakest satiation power of hf compared to lf foods, these signals may represent potential pharmacological targets for the early modulation of appetite/satiety balance. in this study, both lf and hf regulated gene expression in gastric mucosa, and 17 known genes in addition, a number of novel tags were significantly regulated, some of which may be good objects for future characterization studies. however, a lower number of genes was regulated in the stomach compared to duodenum, when the same experimental conditions have been applied. this may suggest that gastric mucosa has a restricted role in the acute regulation of food intake and mainly centered on meal initiation than meal size/termination control. another plausible hypothesis is that satiation signals eventually raising from the mucosa could be induced earlier than 30 min after the beginning of the meal, at least at the transcriptional level. although it is still uncertain whether gastric mucosa releases an early molecular signal specifically involved in satiation control, the present study contributed to highlight some potential mediators of this process. in addition, the characterization of novel regulated genes could stimulate future investigations. since signals secreted by gastric mucosa may be the optimal targets for appetite control and obesity therapeutic strategies, further research efforts are deserved. the paper has been approved by all listed authors and there is no conflict of interest that would prejudice its impartiality. m. r. de giorgio analyzed and interpreted the sage data, and drafted the paper. m. yoshioka and j. st-amand conceived the study, designed it and critically revised the paper. j.

the ineffective short-term control of feeding behavior compromises energy homeostasis and can lead to obesity. the gastrointestinal tract secretes several regulatory peptides. however, little is known about the stomach peptide contribution to the acute regulation of intake. in an attempt to identify new gastric signals, the serial analysis of gene expression (sage) method was used for the transcription profiling of stomach mucosa in 7 groups of mice: fasting and sacrificed 30 minutes, 1 hour, 3 hours after a low-fat (lf) or high-fat (hf) ad libitum meal. in total, 35 genes were differentially modulated by lf and hf meals compared to fasting, including 15 mrnas coding for digestive enzymes/secretory proteins, and 10 novel transcripts. although the basic expression profile did not undergo substantial variations, both lf and hf meals influenced the transcription. this study represents the first global analysis of stomach transcriptome as induced by different nutritional stimuli. further studies including the characterization of novel genes may help to identify new targets for the therapy and prevention of obesity.

PMC3017904

pubmed-1179

in 2014, it is estimated that there are 608,620 bladder cancer survivors living in the united states, and an additional 74,690 cases will be diagnosed. neoadjuvant chemotherapy (nc) followed by radical cystectomy (rc) is now considered the standard of care for muscle-invasive bladder cancer after numerous trials demonstrated a survival benefit, most notably in patients with advanced pathologic stage disease [24]. for highly selected patients, bladder-sparing surgery such as transurethral resection of bladder tumor (turbt) [5, 6] or partial cystectomy (pc) [710] may provide similar oncologic outcomes to rc while maintaining bladder and sexual functions. of the two bladder-sparing options, pc has advantages over turbt as a third of patients are understaged with turbt and pc allows for full thickness examination of the bladder wall and concurrent lymphadenectomy resulting in more accurate staging and prognosis. our institution previously reported on 111 patients who received neoadjuvant methotrexate-vinblastine-doxorubicin-cisplatinum (m-vac) chemotherapy followed by turbt. of the 60 patients achieving ct0, 15 subsequently underwent pc and 17 underwent rc. ten-year metastasis-free survival for the 15 patients who underwent pc was 73% with 53% of patients having their bladders intact, compared to the 65% 10-year metastasis-free survival for patients undergoing rc. similarly in a prospective trial conducted by sternberg et al., 104 patients with muscle-invasive bladder cancer underwent turbt after 3 cycles of m-vac chemotherapy and 49% of the cohort achieved ct0 after nc. of these 104 patients, 13 patients with a solitary lesion underwent pc, while 39 patients underwent rc. for patients undergoing pc, 5-year survival was 69% with 4 patients alive after a median follow-up of 88 months (range 16158) compared to 5-year survival of 46% with 15 patients alive after a median follow-up of 45 months (range 4172) for patients undergoing rc. we herein report our contemporary experience with a highly select cohort of patients who received neoadjuvant chemotherapy followed by pc performed for curative intent at a single tertiary institution. in this institutional review board-approved retrospective study, we identified patients who underwent pc at memorial sloan kettering cancer center from 1995 to 2013 (n=331). only patients who underwent nc for urothelial cell carcinoma of the bladder followed by pc with curative intent were included in our study (n=36). these were not consecutive cases and all patients underwent restaging turbt at our institution prior to and after nc with cystoscopic mapping of bladder tumor/scar. all patients were followed up postoperatively with imaging and cystoscopy every 3 months for 2 years with widening of surveillance interval after. we recorded data for clinical and pathologic variables including age, gender, race, tumor size and focality, histology, presence of carcinoma in situ (cis), cross-sectional imaging, type and duration of nc, clinical and pathologic stages according to american joint committee on cancer 2010 tnm staging 7th edition, surgical margin (sm), disease status, and cause of death. survival outcomes included recurrence-free survival (rfs) which was defined as freedom from recurrence after pc, advanced recurrence-free survival (arfs) which was defined as freedom from recurrence after pc beyond salvage with intravesical therapy or rc, and overall survival (os). kaplan-meier survival estimates were generated with time measured from the date of pc to the date of event (recurrence, advanced recurrence, and death) or last follow-up. using univariate cox regression for continuous and log-rank text for categorical variables, we analyzed variables for association with rfs, arfs, and os. all probabilities were two-sided, and a p value<0.05 was considered significant for all analyses. all data were analyzed using stata version 12.0 (statacorp, college station, tx, usa). median age for the cohort was 70 years old (interquartile range (iqr) 58.876.8). all tumors were solitary, less than 5 cm in diameter, and 22 (61%) had a variant histology. six tumors were located in the anterior wall, 19 in the lateral wall, 5 in the posterior wall, 3 in the base/trigone, and 3 in a diverticulum. chemotherapy characteristics are described in table 1; most patients received platinum-based chemotherapy with 20 patients (56%) having received gemcitabine and cisplatin combination. unilateral ureteral reimplantation was performed in 7 patients at the time of pc to achieve sm in all cases. margin status was evaluated by intraoperative frozen sections at pc in all patients. as shown in table 1, prior to nc, 22 (61%) patients had ct2 disease, 21 (58%) all patients were clinically restaged after nc (tables 1 and 2) with 21 (58%) patients achieving ct0, 3 (8%) having ctis, and 4 (11%) having cn+. of the 4 patients with cn+ after nc, 3 had cn+ before nc, and information prior to nc was unavailable for 1 patient. as shown in tables 1 and 3, pc pathologic findings were pt0 in 18 (50%) patients, ptis in 6 (17%), pn+ in 4 (11%), and sm+ in 3 (8%). the sm+ was perivesical in 1 patient with pt3 disease and ptis at margin in 2 patients with pt3 disease and pt2 disease. all 3 patients with sm+ experienced recurrence and died of disease (dod) at 5, 10, and 43 months. of the 21 patients who were ct0 after nc, 7 (33%) had residual bladder disease in the pc specimen (table 3). at last follow-up, 19 (53%) patients had recurrence, 15 (42%) had advanced recurrences, 10 (28%) died of disease, and 1 died of another cause. twenty (56%) patients were with no evidence of disease (ned) after median follow-up of 17 months (iqr 9.438.2), with 15 having had no recurrences. two of these 4 patients underwent intravesical bacillus calmette-guerin (bcg) treatment at 8 and 23 months after pc and the other 2 patients underwent rc at 23 and 43 months after pc. four were alive with disease (awd): 2 patients having disease in the pelvis and 2 patients having disease in retroperitoneum. of the 19 (53%) patients who experienced recurrence (table 4) 9 had recurrence in the bladder with 6 in the bladder only. of the 9 patients with bladder cancer recurrences, 5 were at the resection site and 2 had sm+ at pc. of the 6 patients with bladder-only recurrences, 2 patients had ctis, received bcg therapy, and have been ned to date; 2 patients had ct2 and ct1/ctis tumors, underwent rc, and remained disease free; 1 patient had ctis and received bcg but developed distant metastases (lung and adrenal) without further bladder recurrences 7 years after pc and eventually died of disease. another patient developed persistent ct1/ctis disease that was managed with repeating turbt and bcg before a failed attempt at rc and later died of disease. as shown in table 5, median time to recurrence was 23 months (iqr 5.966.2), median time to advanced recurrences was 66 months (7.2not reached), and median time to death was 79 months (20.6not reached). kaplan-meier survival estimates for 2- and 5-year rfs, arfs, and os were 37% and 28%, 58% and 51%, and 71% and 63%, respectively (figure 1). clinical stage>ct2 was associated with both worse rfs (p=0.03) and arfs (p<0.01). after nc, the presence of cis was associated with worse os (p=0.04) and cn+ was associated with worse rfs (p<0.01), arfs (p<0.01), and os (p<0.01). following pc, presence of pt2 disease was associated with worse rfs (p=0.02) and arfs (p=0.01), pn+ was associated with worse rfs (p=0.04), and sm+ on final pathology was associated with worse rfs (p=0.01), arfs (p=0.04), and os (p<0.01). our findings have been consistent with those of the literature with regard to oncologic outcomes in patients undergoing pc after nc. in our series, 74% of patients were downstaged after nc with 58% having a complete clinical response. of the patients who achieved ct0 after nc, 7 (33%) had evidence of residual disease within the resected specimen at pc, which is close to 30% of understaging with turbt alone reported by our institution's herr and scher study. two- and 5-year overall survival were 71% and 63%, respectively, which were comparable to oncologic outcomes of other studies involving pc after nc [5, 11, 12] and rc. in our study, at last follow-up 19 patients (53%) had experienced recurrence and 24 (67%) were alive with 22 patients (61%) having retained an intact bladder. nine patients had recurrence in the bladder with 5 at the suture line. in rc series by stein et al., local pelvic recurrence only occurred in 6%13% of cases depending on radical cystectomy pathology and in our series 5 (14%) patients had recurrence in the pelvis with only 2 having isolated pelvic recurrences. both of these patients with pelvic-only recurrences had negative surgical margins at pc with only 1 patient having recurrence on the ipsilateral side of the previous tumor. for our study, advanced recurrence was defined as presence of disease that can not be treated with salvage intravesical therapy or rc, which differs from previous reports of disease recurring in the bladder muscle and beyond [7, 8]. we believe that, with the improved quality of surveillance cross-sectional imaging and follow-up cystoscopies, disease control can still be achieved despite recurrences. this was evident in the 6 patients with isolated bladder recurrence as only 1 patient experienced disease progression and died of disease. we also noted that 53% of patients who experienced recurrence had no disease in bladder and hence it is unclear whether a rc would have altered their disease course. in our previous report by holzbeierlein et al., the authors noted that presence of cis preoperatively was associated with local recurrence and sm+ and pn+ were associated with advanced recurrence, as defined by muscle invasion and beyond. though this series differs for lack of association of cis with recurrence, we noted similar findings with sm+ and pn+. all 3 patients with sm+ on final pathology experienced recurrence and died of diseasewith sm+ being associated with worse rfs, arfs, and os on univariable analysis. similarly, 4 patients had cn+ after nc with 2 eventually having pn+ at pc. of those 2 patients with pn+, one was awd at 7.3 months of follow-up and the other died of disease at 16.8 months of follow-up. cn+ after nc was associated with worse rfs, arfs, and os on univariable analysis. unlike in kassouf anderson cancer center series, the need for ureteral reimplantation is not an exclusion criterion for pc at our institution. in this series, we performed 7 unilateral ureteral cases of reimplantation and we were able to achieve sm in 4 patients and the rest had pt0 disease. in terms of the concerning voiding dysfunction after pc, none of the patients in this series underwent any additional procedures for diminished bladder capacity. our study is limited by its small size, retrospective nature, surgical selection bias, and relatively short follow-up. additionally, patients did not receive a uniform nc regimen; 4 (11%) patients had evidence of clinical nodal involvement after nc, and 22 patients (61%) had a variant histology including some with recognized aggressive nature such as small cell (25%) and micropapillary (14%). also though none of our patients underwent any additional procedures for voiding dysfunction, we do not have long-term quality of life or medication usage data. in this contemporary institutional series, pc after nc in highly selected patients with muscle-invasive bladder cancer provides acceptable oncologic outcomes comparable to those in previously published reports.

objective. to report our contemporary experience with partial cystectomy after neoadjuvant chemotherapy. patients and methods. retrospective review of patients who underwent neoadjuvant chemotherapy and partial cystectomy for urothelial cell carcinoma of the bladder at memorial sloan kettering cancer center from 1995 to 2013. log-rank test and cox regression models were used to analyze variables possibly associated with recurrence-free, advanced recurrence-free (free from recurrence beyond salvage with intravesical therapy or radical cystectomy), and overall survival. results. all 36 patients had a solitary tumor<5 cm in size. twenty-one patients (58%) achieved ct0 following neoadjuvant chemotherapy with 7 (33%) having residual disease at pc. at last follow-up, 19 (53%) patients had recurrence, 15 (42%) had advanced recurrence, 10 (28%) died of disease, and 22 (61%) maintained an intact bladder. median follow-up of those who were with no evidence of disease was 17 months. on univariable analysis, after neoadjuvant chemotherapy positive nodes on imaging and positive surgical margin at partial cystectomy were both associated with worse recurrence-free, advanced recurrence-free, and overall survival. five-year recurrence-free, advanced recurrence-free, and overall survival were 28%, 51%, and 63%, respectively. conclusion. partial cystectomy following neoadjuvant chemotherapy provides acceptable oncologic outcomes in highly selected patients with muscle-invasive bladder cancer.

PMC4897255

pubmed-1180

diabetes is a major public health concern in the united states because of its prevalence, considerable morbidity and mortality, and economic burden with total medical costs of 245 billion dollars in 2012 alone [1, 2]. in 2010, the prevalence rate of diabetes in the us was 9.3%, affecting older population (65 years or older) even more dramatically with the rate of 25.9%. diabetes is associated with serious complications, including coronary heart disease, stroke, kidney failure, neuropathy, blindness, and amputation, and was the seventh leading cause of death in 2010 [1, 2]. obesity is a major risk factor for t2d [2, 3], and the risk of diabetes increases directly with bmi [2, 4, 5]. according to national center for health statistics (nchs) more than one-third of us adults (34.9 percent) were obese in 2011-2012. the medical care costs of obesity in the united states are staggering, totaling about $147 billion dollars in 2008 alone. weight loss is important therapeutic goal in obese patients with t2d, because even moderate weight loss (5%) improves insulin sensitivity [2, 8]. bariatric surgery is the most effective weight-loss therapy and has considerable beneficial effects on diabetes and other obesity-related comorbidities [2, 911]. weight-loss surgery by laparoscopic sleeve gastrectomy (sg) leads to a 4065% reduction in excess weight and, amazingly, 56% of patients achieve resolution in their type 2 diabetes and 37% see improvement in their t2d symptoms. laparoscopic gastric bypass (gb) is a more intense surgery that typically results in a 6070% loss of excess weight and is also characterized by improvement or resolution of diabetes [9, 12, 13]. the objective of this study was to provide insight into the mechanism by which gut/stomach rerouting leads to weight loss and the improvement or resolution of diabetes. in metabolomics, an individual's metabolic state is profiled by multiplexed measurement of many low-molecular-weight metabolites. discrete groups of chemically related metabolites (e.g., amino acids) are quantified in a biological sample. in contrast, nontargeted analysis is a more qualitative approach that surveys as many different metabolites as possible. using primarily targeted approaches, multiple studies have identified higher levels of branched-chain and aromatic amino acids in insulin-resistant, obese, and t2d individuals. more recent studies demonstrated that higher levels of these amino acids are predictive of progression to t2d as well as future insulin resistance and hyperglycemia [14, 1822]. recently, gall and colleagues used nontargeted approach to identify plasma metabolites associated with development of insulin resistance and/or glucose intolerance. two top-ranked metabolites were an organic acid, -hydroxybutyrate (-hb), and a lipid, 1-linoleoyl-glycerophosphocholine (l-gpc). proposed fasting -hb and l-gpc levels as new biomarkers to help predict dysglycemia and t2d [14, 24]. this nontargeted global metabolomic profiling represents new tool that allows the comprehensive survey of metabolism and metabolic networks to gain insight into phenotype and identify biomarker candidates. so far this approach was used to find a way to predict the progression to t2d as well as future insulin resistance and impaired glucose tolerance by serum analysis of insulin-resistant, obese individuals who progressed to t2d. we took an opposite approach utilizing bariatric surgery tool as the most promising way to affect weight loss and to rectify t2d symptoms in morbidly obese patients. it is not known whether metabolic response is the same for all bariatric procedures, nor is it known whether there are any differences between nondiabetic and t2d patients. 15 patients represented three disease-surgery groups: nondiabetic (non-t2d) receiving sg and t2d receiving either sg or gb surgery (table 1). blood samples were collected over the course of treatment for each patient at the following times: at baseline (bl) prior to dieting/surgery, 14 days after baseline with adherence to strict preoperation weight-loss liquid diet (preop diet), and 28 days after surgery recovery after bariatric surgery (postop). blood samples were collected in serum separator tubes, allowed to stand at room temperature for 1520 minutes, centrifuged at 2500 rpm for 10 minutes at 4c, aliquoted, snap frozen in liquid nitrogen, and stored at 80c until analysis. (durham, nc), using two independent platforms: ultrahigh performance liquid chromatography/tandem mass spectrometry (uhplc-ms/ms) optimized for basic species or acidic species, and gas chromatography/mass spectrometry (gc/ms). general platform methods are described in details in online supplemental data section (see supplementary methods and materials available online at http://dx.doi.org/10.1155/2016/3467403). following log transformation and imputation with minimum observed values for each compound, repeated measures 2-way anova with posttest contrasts was used to identify biochemicals that differed significantly between experimental groups and across study time points with statistical cut-offs for p value (p<0.05). multiple comparisons were accounted for by estimating the false discovery rate using q-values of less than 5% (q<0.05). genome-wide association studies have identified many t2d susceptibility genes [14, 26] but generally failed to improve risk prediction over that provided by routine clinical measures [14, 27]. global nontargeted analysis performed in this study is the first study to provide the insight into mechanism by which bariatric surgery leads to weight loss and resolution or improvement of t2d. this approach might also be used to identify t2d biomarker candidates and find new, cost effective treatments that can replace surgery itself. since metabolomic profiling generates a wealth of data that must be parsed to extract information, we chose statistical cut-offs at both the level of individual metabolites p values and the level of multiple testing across the 476 metabolites detected in the serum samples q-values. by narrowing in on metabolites meeting the conservative criteria of p<0.05 and an estimated false discovery rate of less than 5% (q<0.05), we were able to reduce the complexity of the dataset and observed a number of statistically significant changes that occurred in common in nondiabetic and t2d patients with sg or gb. furthermore, we were able to identify concerted changes of related metabolites that pointed to areas of metabolism that were affected by standard preop diet as well as by bariatric surgery itself. a list of all 476 metabolites detected and heat map of the statistical comparisons across time and patient groups are presented in online supplemental tables a1 and a2. comparison of serum profiles at baseline, following a preop weight reduction diet, and after weight-loss surgery revealed several key metabolic differences as highlighted below. fat mobilization and oxidation were the key signatures associated with preop diet. prior to surgery, patients were subjected to 2-week clear liquid diet that promoted weight loss on the order of 35% of body weight. the preoperative liquid diet is a 14-day high protein, very low calorie diet (vlcd) designed to deplete glycogen and fat stores in the liver or shrink the liver which is lifted to access the stomach during surgery. this vlcd includes 800 kcal with 80 g protein and typically produces a 1020-pound weight loss. high protein drinks with less than 200 calories and at least 20 g protein are consumed 3-4x daily; no solid food is allowed on this diet. in addition, at least 64 ounces of sugar-free decaffeinated clear liquids a day are recommended along with a multivitamin and a calcium+vitamin d supplement. medications, such as antihyperglycemics, are adjusted during this preoperative weight-loss phase to account for decreased calorie and carbohydrate intake. the study found that patients who follow a preoperative liquid diet effectively reduced visceral fat and achieve greater weight loss. examination of preop metabolic profiles, serum samples taken immediately before surgery, showed a profound mobilization of fat as attested by statistically significant elevations of ketones, monoacylglycerols, oleate, and an acyl-carnitine (online supplemental table a3, figure 1). these are compounds associated with lipolysis and fatty acid oxidation which suggested that a major metabolic effect of the preop diet was to stimulate fat tissue triglyceride hydrolysis, transport of fatty acids to the liver, and subsequent liver fatty acid oxidation and ketogenesis to supply energy substrates for peripheral tissues. the elevation of the markers associated with lipolysis and ketone production was transient and, in most cases, returned to near baseline levels by day 28 postsurgery time point. these results suggest that 35% weight loss experienced by patients during preop diet is largely due to the consumption of adipose reserves for energy production. another interesting observation is that preop diet led to a transient elevation of alpha-hydroxybutyrate (-hb) and its precursor alpha-ketobutyrate (online supplemental table a3, figure 1). -hb is a sensitive biomarker of insulin resistance [23, 24] which suggests that both nondiabetic and t2d patients experienced a temporary relative increase in insulin resistance during preop diet. compounds that changed in a statistically significant manner after 28 days of recovery from bariatric surgery, relative to baseline, were more numerous and diverse than observed in response to the preoperation diet. 62 compounds in the postsurgery to baseline comparison represented p<0.05 and showed q<0.05 in at least one of the disease-surgery groups (online supplemental table a4). 28 compounds showed p and q-value cut-offs across all three disease-surgery groups at the 28-day postsurgery sample collection time point relative to baseline. 13 of the compounds that changed across all three groups had fold-change increases including 100-fold+increases for trans-urocanate, cis-urocanate, pyroglutamylvaline, and heme in most or all of the groups. the remaining fifteen compounds that changed across all three groups were reduced at the postsurgery time point compared to baseline. levels of ascorbate and various tocopherols were substantially reduced with ascorbate showing a 12.5-fold or greater decrease in each of the groups (online supplemental table a4, figure 2). difficulty in absorbing micronutrients, such as vitamin c, following bariatric surgery has been reported previously [29, 30] and appeared to be confirmed at a shorter follow-up time point in this study. weight-loss surgery led to concerted changes in compounds related to sulfur-containing amino acid metabolism that were largely shared across the groups. glutathione (gsh) is a tripeptide comprised of glutamate, cysteine, and glycine. these amino acids along with the recycling intermediates cys-gly and 5-oxoproline were increased in all groups following surgery (online supplemental table a4), suggesting a greater potential availability of substrates for gsh production. oxidized forms of glutathione and cysteine, such as the mixed heterodimer cysteine-glutathione and glutathione homodimer gssg, were elevated following surgery (online supplemental table a4, figure 2) and could be a sign of increased oxidative stress following surgery. however, an alternate interpretation is that a greater availability of glutathione and sulfur-containing amino acids following weight-loss surgery led to the greater formation of these oxidized compounds. pyruvate the terminal product of glucose metabolism via the glycolysis pathway dropped sharply after bariatric surgery (online supplemental table a4, figure 3), likely indicating its more efficient mitochondrial utilization. the reduction of pyruvate was matched by increases in fumarate, in all t2d patients, and malate perhaps indicating an inadequate supply of acetyl-coa, which is derived from pyruvate, relative to the level of tca cycle components. however, levels of the glycolytic intermediate 3-phosphoglycerate (3-pg) increased after surgery as did nonglycolytic products glycerol and serine potentially derived from 3-pg. in addition to changes in pyruvate production, glucose usage via the pentose phosphate pathway (ppp) was also shifted following bariatric surgery. the ppp is a key source of pentose sugars used for nucleotide synthesis as well as nadph which is used for reductive synthesis reactions and regeneration of reduced glutathione. ppp intermediates and derivative pentose sugars, including ribulose-5-phosphate and xylulose-5-phosphate that are isobars that can not be differentiated by our platform, and their nonphosphorylated products, such as xylulose, were significantly increased in all groups following surgery (online supplemental table a4, figure 3). glucose carbons, via glucose-6-phosphate, may have been directed toward the pentose phosphate pathway in the face of the proposed decrease in glycolysis pathway activity. for example, at baseline, metformin was detected in 100% of the t2d sg patient samples, 60% of the t2d gb samples, and none of the nondiabetic sg samples. after bariatric surgery, metformin was only detected in 20% of the t2d sg and gb serum samples. postsurgery serum glucose levels decreased relative to baseline but this change only reached statistical significance (p<0.05) in the t2d sg group (online supplemental table a4, figure 3). in total, the results suggest that bariatric surgery affected glucose metabolism through glycolytic and nonglycolytic pathways similarly for all three of the disease-surgery groups. each of the patient groups experienced an increase in serum heme levels around 100-fold compared to their respective baseline levels following surgery (online supplemental table a4). a couple of interesting possibilities, such as a reduced level of heme breakdown by heme oxygenase (ho) or an increased level of synthesis by 5-aminolevulinate synthase (ala synthase), could explain these changes. the understanding of ho-1 function has evolved beyond a simple disposal of heme to include cytoprotective, anti-inflammatory, and antioxidant functions. for instance, endogenous carbon monoxide produced by ho-1 engages multiple signal transduction pathways to confer antiapoptotic and anti-inflammatory effects and biliverdin and bilirubin are potent antioxidants. ho activation has been shown to have insulin sensitizing and anti-inflammation effects in t2d. so the increase in heme and biliverdin following surgery could represent an increase in heme oxidation by ho leading to greater antioxidant protection and insulin sensitivity. on the other hand, the greater availability of glycine, which shows a relative deficiency in t2d [23, 32], could also serve as the basis for greater heme production by ala synthase the rate-limiting enzyme of heme formation whose expression is repressed by glucose. on the other hand, biliverdin catabolism which can reflect red blood cell turnover and heme disposal was less evident following surgery as indicated by reductions in bilirubin zz and its ee photoisomer (online supplemental table a4). together, these exciting results suggest that bariatric surgery may promote antioxidant defense and insulin sensitivity through both increased heme synthesis and ho activity or expression. diabetes and obesity are chronic conditions associated with elevated oxidative/inflammatory activities with a continuum of tissue insults leading to more severe cardiometabolic and renal complications including myocardial infarction and end-stage-renal damage. a common denominator of these chronic conditions is the enhanced levels of cytokines like tumour necrosis factor-alpha (tnf-), interleukin (il-6), il-1beta, and resistin, which in turn activates the c-jun-n-terminal kinase (jnk) and nf-b, pathways, creating a vicious cycle that exacerbates insulin resistance, type-2 diabetes, and related complications. emerging evidence indicates that heme oxygenase (ho) inducers are endowed with potent antidiabetic and insulin sensitizing effects besides their ability to suppress immune/inflammatory response. importantly, the ho system abates inflammation through several mechanisms including the suppression of macrophage-infiltration and abrogation of oxidative/inflammatory transcription factors like nf-b, jnk, and activating protein-1. thus, ho system could be explored in the search for novel remedies against t2d and its complications. proposed using fasting -hb and l-gpc levels as new biomarkers to help predict dysglycemia and t2d [14, 24]. both were detected in this study but postsurgery results do not bear out an improvement in insulin resistance based on these markers. -hb is positively but l-gpc is negatively correlated with insulin resistance, so a postsurgery signature of improved insulin sensitivity would be expected to show a decrease of -hb and an increase of l-gpc. our findings showed an opposite pattern: -hb was increased during the liquid weight-loss diet and then returned to near baseline levels after the surgery, while l-gpc levels showed significant postsurgery decrease across all three disease-surgery groups (online supplemental table a4, figure 1). there could be several reasons for this to occur, including the assumption that -hb will drop after bariatric surgery is incorrect, or the 28-day time point is too soon to register a change. for the t2d subjects, there is the potential that metformin therapy also altered the baseline levels of -hb and l-gpc. large increases in histidine derivatives were possibly due to altered gut microbiome composition or increased liver histidine-ammonia lyase activity. histidine and several catabolites, such as imidazole propionate and urocanate isomers, both trans- and cis-urocanate, were significantly elevated (p<0.05, q<0.00001, including 100-fold+increases for trans-urocanate and cis-urocanate) in all three groups (online supplemental table a4, figure 4). histidine is classified as an essential amino acid but gut bacteria can synthesize it, perhaps using precursors supplied by the human host. these markers may be an indication of changes in gut microbiome as the direct participation of the rat intestinal flora in the degradation of urocanate to imidazole propionate has been demonstrated previously. although the sample size was very small, these results suggested that histidine metabolites could also be important marker candidates to monitor metabolic changes associated with weight-loss surgery. recently, ryan and colleagues found that vertical sleeve gastrectomy that led to weight loss and improvement of diabetes also resulted in changes in the gut bacteria. the researchers observed changes in several key bacterial groups that have been previously linked to the risk of t2d, and these changes were related to increase in circulating of bile acids that are known to bind to the nuclear receptor fxr. interesting is the researches proposal that manipulating the gut bacteria might be another way to mimic the surgery. on the other hand, urocanate is also formed in the liver by histidine-ammonia lyase (hal) which converts histidine into urocanate and ammonia. interestingly, hal gene expression in hepatocytes can be stimulated by glucagon, so it is also possible that the increase of urocanate following surgery reflects a change in circulating glucagon levels. cis-urocanate has interesting immunosuppressive properties that are believed to help protect the skin during sun exposure and perhaps sites distal from the skin. little is known about imidazole propionate but it is a reported constituent of urine and has been proposed as a marker of intestinal dysfunction. it may be useful to validate the ability of trans-urocanate, cis-urocanate, and imidazole propionate to serve as markers to monitor bariatric surgery in a larger independent cohort of patients and targeted quantitative assay. it will also be interesting to determine what, if any, utility such markers have for predicting long-term patient outcomes following surgery. comparing the postsurgery to the preoperation diet time point revealed 18 compounds that met the p and q-value cut-off criteria across all three disease-surgery groups (online supplemental table a5). thirteen were increased postsurgery samples relative to the samples collected at the preoperation diet time point and trans-urocanate, cis-urocanate, and pyroglutamylvaline displayed 100-fold or greater increases in nearly all of the groups. ascorbate and 1-linolenoylglycerol showed the greatest reductions among the 5 compounds that decreased in postsurgery samples relative to preoperation diet samples following surgery, but these reductions could also reflect altered gut absorption of these vitamins in addition to their consumption via the quenching of reactive oxygen species. there were 29 additional compounds that represented p<0.05 in all groups but did not reach q<0.05 for all of the disease-surgery combinations. histidine and several catabolites, such as imidazole propionate and urocanate isomers, were increased in t2d patients and the urocanate isomers were also likewise increased in nondiabetic patients after surgery (online supplemental tables a4 and a5). again, these results suggest that histidine metabolites could be important markers to monitor metabolic changes associated with weight-loss surgery. global metabolomic analysis was used to evaluate the changes occurring in nondiabetic and t2d patients experiencing either less extreme sleeve gastrectomy or a full gastric bypass. this study allowed gaining insights into the metabolic changes during both the preoperation weight-loss diet and early postsurgery recovery that accompany bariatric surgery. to identify metabolic changes that were conserved across nondiabetic and t2d patients and different bariatric surgery procedures sleeve gastrectomy (sg) versus gastric bypass (gb)the metabolomic data collected for each disease-surgery combination were filtered according to statistical cut-offs for p value (p<0.05) and to establish an estimated false discovery rate of less than 5% (q<0.05). it is important to point out that, despite age and sex difference, t2d status or bariatric surgery procedure, and coexistence of other associated diseases, all patients demonstrated striking similarity in major metabolome changes associated with preoperation weight-loss diet and bariatric surgery itself. the preoperation weight-loss diet was associated with a strong lipid metabolism signature related to triglyceride hydrolysis, fatty acid oxidation, and ketone formation. glucose metabolism via glycolytic and nonglycolytic pathways appeared to share a similar response across all patients regardless of baseline t2d status or the bariatric surgery procedure. glycolysis pathway appeared to be suppressed and perhaps led to an accumulation of the tca cycle components: malate and fumarate. such increases might indicate a greater demand for pentose sugars and nadph and the redirection of glucose-6-phosphate away from glycolysis. increased heme levels were a likely sign of improved antioxidant defense via the action of heme oxygenase and liver function through increased heme biosynthesis in the liver. the simultaneous postsurgery disappearance of vitamin c and surge in oxidative stress markers such as allantoin and cysteine-glutathione disulfide suggest that micronutrient status should be monitored and supported by nutritional supplementation. this initial study provided a broad understanding of how metabolism changed globally in morbidly obese subjects following weight-loss surgery. future serum metabolomic profiling studies focusing on baseline and 28 days (or other) after surgery with a greater number of patients in each group might help to further resolve differences between diabetic and nondiabetic patients. additionally, profiling of baseline and postsurgery fecal samples might provide a more focused manner to interrogate changes associated with gut and microbiome function. finally, the significance of this study lays in the exploration of future treatments for obesity and t2d that can mimic bariatric surgery weight loss and improvement and resolution of t2d.

the goal of this study was to provide insight into the mechanism by which bariatric surgical procedures led to weight loss and improvement or resolution of diabetes. global biochemical profiling was used to evaluate changes occurring in nondiabetic and type 2 diabetic (t2d) patients experiencing either less extreme sleeve gastrectomy or a full gastric bypass. we were able to identify changes in metabolism that were affected by standard preoperation liquid weight loss diet as well as by bariatric surgery itself. preoperation weight-loss diet was associated with a strong lipid metabolism signature largely related to the consumption of adipose reserves for energy production. glucose usage shift away from glycolytic pyruvate production toward pentose phosphate pathway, via glucose-6-phosphate, appeared to be shared across all patients regardless of t2d status or bariatric surgery procedure. our results suggested that bariatric surgery might promote antioxidant defense and insulin sensitivity through both increased heme synthesis and ho activity or expression. changes in histidine and its metabolites following surgery might be an indication of altered gut microbiome ecology or liver function. this initial study provided broad understanding of how metabolism changed globally in morbidly obese nondiabetic and t2d patients following weight-loss surgery.

PMC4736952

pubmed-1181

pelvic inflammatory disease (pid) is a polymicrobial infection of the upper genital tract (ugt). the diagnosis is made clinically; no single test or study is sensitive or specific enough for a definitive diagnosis. pid should be suspected in at-risk patients who present with pelvic or lower abdominal pain with no identified etiology and who have cervical motion, uterine, or adnexal tenderness. chlamydia trachomatis is one of the commonly implicated bacterial microorganisms; however, other microorganisms may be involved. most women can be treated successfully as outpatients with a single dose of a parenteral cephalosporin plus oral doxycycline, with or without oral metronidazole. delay in treatment may lead to major sequelae, including chronic pelvic pain, ectopic pregnancy, and infertility. hospitalization and parenteral treatment are recommended if the patient is a pregnant woman [1, 2]. the microorganisms that are implicated in pid are thought to spread in the following three ways: intra-abdominally, traveling from the cervix to the endometrium, through the salpinx, and into the peritoneal cavity (causing endometritis, salpingitis, tuboovarian abscess, or pelvic peritonitis);through the lymphatic systems, for example, infection of the parametrium from an intrauterine device (iud); through hematogenous routes, for example, with tuberculosis, although this is rare.the diagnosis of pid is based primarily on clinical evaluation. because of the potential for significant consequences if treatment is delayed, physicians should treat patients on the basis of clinical judgment without waiting for confirmation from laboratory or imaging tests. intra-abdominally, traveling from the cervix to the endometrium, through the salpinx, and into the peritoneal cavity (causing endometritis, salpingitis, tuboovarian abscess, or pelvic peritonitis); through the lymphatic systems, for example, infection of the parametrium from an intrauterine device (iud); through hematogenous routes, for example, with tuberculosis, although this is rare. the objective of this study is to analyze molecular factors that may help to make the diagnosis and prognosis of pid in the different stages of the disease. a systematic review was conducted using pubmed of the national center for biotechnology information (ncbi). the article search focused on covering all scientific publications of pid and related molecular factors published between 1996 and 2010. reference lists of pid publications were utilized to identify relevant literature and reviewed for completeness of already found publications. the study selection was done in two stages: during the first phase, all publications involving a component of pid and molecular factors were included. the study selection at this point was done using abstracts or full publications if the abstract did not give sufficient information. at the second phase, complete publications were reviewed and their suitability with respect to the research objective was assessed. the cellular paradigm of chlamydia pathogenesis states that the host response to chlamydiae is initiated and sustained by epithelial cells, which are the primary targets of chlamydial infections. they secrete chemokines that recruit inflammatory leukocytes to the site of infection and cytokines that induce and augment the cellular inflammatory response, and these mediators induce direct damage to the tissues. at the time of reinfection, host cell release of chemokines leads to recruitment of chlamydia-specific immune cells that rapidly amplify the response. the release of proteases, clotting factors, and tissue growth factors from infected host cells and infiltrating inflammatory cells leads to tissue damage and eventual scarring the cellular paradigm makes no distinction between damage induced by professional innate immune cells (neutrophils and monocytes) and adaptive lymphocyte populations but assumes that both cell populations contribute to the pathogenesis. chronic chlamydial infections are common and would lead to ongoing release of mediators that promote continued influx of inflammatory cells, damage to host epithelium, scarring, and, ultimately, fibrosis and scarring. because reinfection with chlamydiae occurs frequently, repeated inflammatory responses may lead to repeated insults to the tissues and may promote tissue scarring. among the molecular factors reviewed is the chlamydia heat shock protein 60 (chsp60), which has been investigated as a potential antigen responsible for the induction of delayed type hypersensitivity-induced disease. later studies conducted in a guinea pig model of trachoma revealed a protective role for vaccination with chsp60. although human studies have revealed elevated antibody counts to chsp60 in those with more severe disease [10, 11], this may simply reflect increased exposure to chlamydia through chronic or repeated infection. a recent large prospective study of women with pid did not reveal a correlation of increased antibody counts to chsp60 with worse outcome. in a prospective cohort study involving women at high risk of c. trachomatis infection, cohen et al. found that at baseline and after adjustment for age and other potential confounding variables, production of interferon (ifn)- by peripheral-blood mononuclear cells (pbmcs) stimulated with chsp60 strongly correlated with protection against incident c. trachomatis infection.. found that low pbmc ifn- and high interleukin (il)-10 responses to chsp60 were markers for increased risk of chlamydial infection and pid. in human immunodeficiency virus-seropositive women, a cd4 lymphocyte count of<400 cells/mm was determined to be an independent risk factor for c. trachomatis pid. chlamydia-specific cd4 t1 helper cell (th1)-ifn--producing cells are key mediators of host defense; a goal for vaccine development should be to determine chlamydia antigens and adjuvants that induce a strong cd4 th1 memory response. a persistent chsp60 antibody response was correlated with having culture- or ligase chain reaction-positive oviduct samples after treatment, which suggests that antibody positivity is a useful marker of chronic infection. these data indicate that prolonged or repeated exposure to chlamydiae leads to increased risk for disease and increased detection of anti-chlamydial antibodies, rather than directly implicating antibody formation in the pathogenesis. although high antibody responses to chsp60 have been correlated with increased susceptibility to chlamydial pid [10, 15], ifn- responses to this highly conserved protein have been correlated with protection among the same group of women. researchers have begun to determine the cellular receptors involved in c. trachomatis-induced stimulation of cytokine release. toll-like receptors (tlrs) act as pathogen-recognition receptors that enable cells to recognize conserved bacterial, viral, and fungal structural elements. in vitro, c. trachomatis infection of hek cells transfected with the adaptor molecule myd88 and the pathogen molecular pattern receptors tlr2 and tlr4/md-2 revealed that tlr2 was required for il-8 secretion and that the role of tlr4/md-2 was minimal. this was reproduced with chlamydial infection of immortalized human ectocervical epithelial cells. confocal microscopy experiments revealed that both tlr2 and myd88 colocalize with the intracellular chlamydial inclusion, suggesting that tlr2 is actively engaged in signaling from this intracellular location. there is a protective role for tlr2 deficiency in genital tract infection sequelae due to c. trachomatis. examination of human tissue samples for the various tlrs has revealed that the mrna for tlr2 is highly expressed in fallopian tubes and the cervix. thus, tlr2 may be a primary pathogen-recognition receptor available in the lower genital tract and oviducts to drive the pathology-inducing inflammatory response to chlamydial infection. whilst nucleic acid amplification tests can effectively diagnose uncomplicated lower genital tract (lgt) infections, they are not suitable for diagnosing ugt pathological sequelae. several studies have demonstrated a correlation between antibody responses to chsp60 and pathologic sequelae in women [1921], including a significant association between the presence of antibodies to chsp60 and pid [10, 21, 22]. these data have led to the development of a commercial enzyme-linked immunosorbent assay (elisa) screening test based on chsp60 (medac, hamburg, germany). studies evaluating the diagnostic potential of the medac chsp60 elisa test have demonstrated conflicting results, and thus the ability of the chsp60-based assay to distinguish various c. trachomatis disease stages may be limited [23, 24]. have identified several chlamydial antigens that could be used to discriminate between uncomplicated lgt infection and ugt pathology due to c. trachomatis. four amino acid bands allow physicians to distinguish between lgt infection and ugt pathology in affected women. two possible candidates were identified for each of band a (ct147 and ct314), b (ct727 and ct396), and c (ct157 and ct423). band a, reactive in 38% of c. trachomatis-infected samples, was identified as two possible candidate proteins: ct147 (conserved hypothetical protein: 162.1 kda) and ct314 (dna-directed rna polymerase beta chain: 154.9 kda). only ct147 has previously been shown to elicit a humoral response as expected from the protein's localization to the inclusion membrane of the elementary body (eb). ct314 functions as a transcriptional regulator and would not be expected to be presented to the host immune system at any stage during the chlamydial developmental cycle or infection process. the two candidate proteins for band b are ct727 (p-type atpase) and ct396 (hsp70). p-type atpases constitute a superfamily of cation transport enzymes that mediate transmembrane exchange of all biologically significant cations. in contrast, hsp70 is associated with outer membrane complexes of ebs and was originally thought to play a role in either attachment or entry of the eb into host cells [28, 29]. one of the candidate proteins for band c, ct157, contains two phospholipase d (pld) domains and is a member of the pld superfamily, which includes enzymes that have high catalytic activity and are involved in phospholipid metabolism. plds, which are known to hydrolyze phospholipids to phosphatidic acid, may be essential for the formation of particular types of transport vesicles or be strongly involved in signal transduction. ct423, the second protein candidate for band c, contains three functional domains (two cbs domains and one transporter-associated domain) that are implicated in intracellular targeting and trafficking as well as protein-protein interactions. sensitivity and specificity of the identified antigens in various combinations showed the a or b or c format to be the most efficacious for diagnosing uncomplicated lgt infection. the addition of antigen d to the panel (a or b or c or d) was shown to increase the sensitivity to 79%. however, given the overall prevalence of antigen d in samples from c. trachomatis-infected patients, the diagnostic potential of antigen d for specifically identifying lgt infections is limited due to the high c. pneumoniae cross-reactivity demonstrated within ugt patients. moreover, this suggests that antigen d could possibly be more useful as a marker of general chlamydial infections rather than of a particular stage of infection. a small study conducted by kuo et al. showed that the chemokine receptor deletion mutation ccr5-32 correlated significantly with protection from tubal damage. endocervical epithelial cells released il-1 after infection, and the induced proinflammatory cytokine cascade could be inhibited by specific anti-il-1 antibodies. the addition of an il-1 receptor antagonist to the cultures completely eliminated tissue destruction induced by infection, indicating a direct role for this cytokine in the pathogenesis. other potentially important factors are matrix metalloproteinases (mmps), which are expressed by neutrophils and monocytes and are involved in proteolysis and resynthesis of extracellular matrix. studies in humans also indicate a role for mmps and neutrophils in the pathogenesis of tissue damage. fallopian tube epithelial cells infected in vitro with c. trachomatis produce mmp-2, and infected oviduct stromal cells produce mmp-9. an interrelated protease mechanism involves two interesting markers, cathepsin b and cystatin c. cathepsin b belongs to the family of lysosomal cysteine proteases and is active in acidic environments. it has also been found to be secreted as an extracellular contributor to degrade extracellular matrix (ecm) molecules or as a regulator involved in cell death modulation [37, 38]. it has been shown that cathepsin b mediates hepatic inflammation and injury caused both by apoptosis and the production of proinflammatory chemokines. previous studies have shown that cathepsin b plays a critical role in the tumor necrosis factor (tnf)--triggered apoptotic cascade and promotes cell death through participation in the extrinsic pathway in which caspase-8 causes the release of active cathepsin b from lysosomes; consequently, cathepsin b increases the cytosol-induced release of cytochrome c from mitochondria [40, 41]. in contrast, nagai and his colleagues found that cathepsin b could inhibit neuronal cell death that was induced by cystatin c. however, foghsgaard et al. found that proteolytic enzyme families, for example, cathepsin b and cysteine proteases, regulate apoptosis and play opposite roles in malignancies by reducing tumor cells by means of their proapoptotic features and by enhancing tumor cells through their known facilitation of invasion. cystatin c, an endogenous cysteine protease inhibitor, is a nonglycosylated low molecular weight (13 kda) secretory protein produced by nucleated cells. it has been found in a variety of human tissues but is mainly found in extracellular body fluid and serum [4345]. clinically, a patient's altered cystatin c level in bodily fluid or serum is monitored or used to predict the progression of diseases [4750]. a high concentration of cystatin c has been reported in patients with hepatic disease, and it has therefore been suggested that cystatin c could be used as a marker for monitoring liver functions and the progression of liver fibrosis. cystatin c is also used as a predictor for the reduction in kidney function, which may be associated with increased inflammation or adverse pathophysiological consequences [51, 52]. tsai et al. have found a significantly increased expression of cathepsin b but a decreased expression of cystatin c as well as an imbalance in the equilibrium between cathepsin b and cystatin c in patients with pid. thus, significantly low levels of cystatin c and significantly high levels of cathepsin b in the serum of patients with pid before they received treatment were found. in addition, the ratio of the cathepsin b level to the cystatin c level in the serum of patients with pid increased significantly before the patients received treatment compared with after they had received treatment according to the protocol suggested by the centers for disease control and when compared with healthy controls. although this regulatory mechanism needs further investigation, it has been suggested that the detection of serum levels of cathepsin b and cystatin c, as well as the serum ratio of cathepsin b to cystatin c, can provide useful clinical information for pid. from the bacterial point of view, nine surface-exposed c. trachomatis polymorphic membrane proteins (pmps) are encoded via a multigene family yielding pmpa to pmpi. pmps represent 13.6% of the coding capacity of the c. trachomatis genome, suggesting that they have a critical role in biology and virulence [55, 56]. these findings imply either a role for these specific pmps in inflammation or simply that women with pid have sustained and increased exposure due to repeated or chronic infection. have suggested that pmpa plays a role in the pathology of ugt, although these data were nonsignificant. in addition, pmpd may stimulate host cell inflammatory responses, and it is possible that an increased antibody titer to pmpd reflects increased exposure to these potentially pathogenic ligands. in the study by taylor et al., increased inflammation and reproductive sequelae were found among women with high antibody titers to pmpd. overall, expression of the pmpd antibody appeared to have minimal effects on inflammation and reproductive sequelae in this study. in addition, the authors found that women with antibody reactivity to pmpi were more likely to have ugt infection (ugti). endometritis was also more frequent in this group, although these results were nonsignificant (table 1). several molecular factors have been investigated in the past years for their application in the early detection and identification of chronic pid caused by c. trachomatis infection. although there is already a diagnostic method (medac chsp60 elisa test), its utility is limited, and there is no other commercial method known to date. the other discussed host molecular factors are thought to be of interest as new potential markers in the diagnosis at different stages of the disease; however, further investigation and clinical trials will have to be carried out. membrane proteins in c. trachomatis, which are known to be related to inflammation and chronic pid, may be candidates for commercial antibody development for avoiding harmful infections.

background. untreated chlamydia trachomatis infections in women can result in disease sequelae such as pelvic inflammatory disease (pid), ultimately culminating in tubal occlusion and infertility. while nucleic acid amplification tests can effectively diagnose uncomplicated lower genital tract infections, they are not suitable for diagnosing upper genital tract pathological sequelae. objective. the purpose of this paper was to provide a comprehensive review of new molecular factors associated with the diagnosis and prognosis of pid. material and methods. the literature was searched using the key words chlamydia trachomatis infections, pelvic inflammatory disease, and molecular factors in the pubmed database. relevant articles published between 1996 and 2012 were evaluated. conclusions. the use of new molecular factors could potentially facilitate earlier diagnosis and prognosis in women with pid due to c. trachomatis infection.

PMC3477744

pubmed-1182

it is the most common endemic mycosis in the united states.1 it is most prevalent around the valleys of the mississippi and ohio rivers.2 in endemic areas, 50%80% of people have evidence of previous exposure to histoplasma.3 the fungus grows as a mold in the soil and when its microconidia are inhaled, causes infection and grows as a yeast in the host tissues. most infected people remain asymptomatic or complain of a self-limiting flu-like illness. up to 25% of people infected with human immunodeficiency virus will develop disseminated histoplasmosis, with considerable morbidity and mortality.3 infection outside endemic areas and atypical presentations represent a diagnostic challenge. we present a case of progressive disseminated histoplasmosis manifesting as a wasting syndrome with hypercalcemia, mimicking a metastatic cancer. a 65-year-old, type 2 diabetic man presented with a 2-month history of constipation, polyuria, and unexplained weight loss of 54 lb. he had lived in west pennsylvania until 13 years earlier, when he had moved to the texas panhandle area where he presented with the above complaints. on physical examination, laboratory test results revealed a hemoglobin of 10.6 (normal range 1216) g/dl and a white blood cell count of 3.5 10 cells/l (normal range 4.010.6 10 cells/l). biochemistry tests showed a creatinine of 3.2 (normal range 0.51.4) mg/dl, serum calcium of 12.4 (normal range 8.410.3) mg/dl, and albumin of 3.5 (normal range 3.75.1) g/dl. the patient s parathyroid hormone level was low at 6 (normal range 11.054.0) pg/ml and serum protein electrophoresis showed a normal pattern. body computed tomography showed bilateral adrenal enlargement and a mass lesion at the base of the tongue (figure 1). magnetic resonance imaging of the brain showed three left-sided brain lesions (figure 2). biopsies of the tongue lesion and the left adrenal gland showed necrotizing granulomas containing budding yeast forms, consistent with histoplasmosis (figures 35). histoplasmosis is rarely diagnosed in the texas panhandle area and we were unable to tell whether his presentation represented a reactivation of an old infection or progression of a newly acquired infection. after adequate intravenous hydration, the patient s kidney function tests and serum calcium level reverted to normal. the patient received a 4-week course of liposomal amphotericin b and was subsequently started on itraconazole. dissemination of h. capsulatum is common in the early stages of this fungal infection.1 symptomatic acute dissemination develops in immunocompromised patients.2 they present with a febrile illness that can be complicated by severe sepsis, acute respiratory distress syndrome, and disseminated intravascular coagulopathy. on the other hand, chronic progressive disseminated histoplasmosis is typically reported in middle-aged and elderly men who are not immunosuppressed.3 they present with a wasting syndrome, long-standing fever, and night sweats. the infection may involve multiple organ systems, including the gastrointestinal tract (with resulting ulceration), adrenal glands (precipitating adrenal insufficiency), the reticuloendothelial system (causing hepatosplenomegaly), bone marrow (leading to pancytopenia), the central nervous system, and the lungs. on rare occasions, progressive disseminated histoplasmosis has been associated with hypercalcemia, and this is attributed to increased 1, 25 dihydroxyvitamin d production from the fungal granulomas.410 a medline search (january, 1946 to november, 2012) identified seven reported cases of disseminated histoplasmosis presenting with hypercalcemia. the clinical presentation, risk factors that predisposed to histoplasmosis, and patient outcomes are reported (table 1). upon reviewing the cases and in comparison with the case at hand, the following features were noted. like our patient, most patients were middle-aged and elderly men with a limited degree of immunosuppression. presenting symptoms varied, with pulmonary complaints in two cases, gastrointestinal symptoms in two, wasting syndrome in three, including ours, and musculoskeletal complaints in another. hypercalcemia was symptomatic in some cases and an asymptomatic laboratory abnormality in others. in all cases, the diagnosis was difficult to make, and in three cases was established post mortem. two of the three patients who died, ie, the first and second cases, did not receive antifungal therapy, and treatment was delayed in the third patient who died, ie, the fourth case. diagnosis of histoplasmosis relies on a multifaceted approach.11 histopathological examination, cultures, antigen and antibody detection, and molecular methods are commonly used in different combinations to establish the diagnosis. a recent multicenter study evaluated the above-mentioned tests in the diagnosis of disseminated histoplasmosis and reported their corresponding sensitivities, ie, 74% for cultures, 76% for histopathology, 92% for antigen detection in urine and/or serum using a third-generation enzyme immunoassay, and 75% for antibody detection combining immunodiffusion and complement fixation assays.11 use of molecular methods in the diagnosis of histoplasmosis has been reported, but remains uncertain and is awaiting further study.12 the high sensitivity of antigen detection is plagued by significant cross-reactivity with other fungal antigens. cross-reaction occurs in 90% of patients with blastomycosis and in 60% of patients with coccidioidomycosis.13 testing both urine and serum yields better sensitivity. furthermore, testing cerebrospinal fluid and bronchoalveolar lavage fluid might improve sensitivity in diagnosing central nervous system and pulmonary infections.14 it is worth mentioning that failure to detect histoplasma antigens does not rule out the diagnosis, and repeating the test in patients with progressive illness should be considered.3 severity of illness dictates antifungal treatment options and duration of therapy. for moderate to severe infection, liposomal amphotericin b for 12 weeks followed by a 12-month course of itraconazole is recommended.15 for milder cases, itraconazole for one year is indicated. for histoplasmosis of the central nervous system, liposomal amphotericin b for 46 weeks followed by itraconazole for at least one year and until cerebrospinal fluid abnormalities and antigenemia or antigenuria resolve is recommended.15 antigen levels in serum or urine should be measured during therapy for progressive disseminated histoplasmosis and central nervous system infection, and for 12 months afterwards. ten percent to 15% of patients experience a relapse.16 diagnosis and treatment in this group of patients follows the above outlined principles, but also includes long-term itraconazole maintenance therapy. our work has some limitations, not the least of which is the fact that it is a single case report. furthermore, the diagnosis was based on a compatible clinical presentation and histopathological examination that could not be confirmed by culture, serology, or antigen detection. further research is needed to develop readily available tests, probably molecular diagnostic methods, with higher sensitivity and specificity to diagnosis histoplasmosis as well as other mycosis. acute disseminated infection presents with a sepsis syndrome, whereas chronic dissemination presents as a wasting syndrome. we reported here a case of chronic disseminated histoplasmosis presenting with multiple mass lesions, weight loss, and hypercalcemia, mimicking metastatic cancer. in addition to malignancy, granulomatous disease, including fungal infection, should be considered in patients with similar presentation.

histoplasmosis is a common endemic mycosis. the majority of infections involving this dimorphic fungus are asymptomatic. manifestations in symptomatic patients are diverse, ranging from flu-like illness to a more serious disseminated disease. we present here a case of chronic disseminated histoplasmosis mimicking a metastatic cancer. we reviewed the literature for cases of disseminated histoplasmosis presenting with hypercalcemia, focusing particularly on clinical presentation, risk factors predisposing for fungal infection, and outcome. we report a case of a 65-year-old diabetic male who presented with unexplained weight loss and hypercalcemia. multiple brain space-occupying lesions and bilateral adrenal enlargement were evident on imaging studies. biopsies showed caseating granulomas with budding yeast, consistent with histoplasmosis. the patient s symptoms resolved after liposomal amphotericin b and itraconazole therapy. granulomatous diseases, including fungal infections, should be considered alongside malignancies, in patients with similar presentation.

PMC3588607

pubmed-1183

epidemiological investigation indicates that parkinson disease (pd) patients experience more falls than either age-matched healthy controls or individuals with other neuropathologies, including spinal disorders, epilepsy, multiple sclerosis, stroke, and motor neuron disease. for patients with pd, fall occurrences and increased fear of falling are frequent in situations with complex or threatening context, with contact with an obstacle presenting a major cause of falls among pd [1, 3]. task demands, such as the inherent characteristics of the obstacle to be crossed as well as constraints imposed by the general environment surrounding the obstacle and task, contribute to context and exacerbate motor disturbances amongst pd patients. previous studies have shown that neurotypical adults adopt conservative strategies for standing [6, 7], walking, and obstacle crossing when behaving in a context that threatens increased physical consequences as a result of a fall. in contrast, pd patients have exhibited increased postural instability and gait disturbance when concurrently challenged with a cognitive or motor demand. it is probable that threatening context may exacerbate any obstacle negotiation deficits that exist for pd patients. while pd pharmacotherapy reduces classical parkinsonian symptoms, some functional movement parameters remain insensitive to dopamine replacement [13, 14]. furthermore, improvements enabled by pd medication can be compromised by challenging context [15, 16]. this compromise can lead to instability during standing and walking in activities of daily living, increasing fall risk. the purpose of this study was to investigate changes in obstacle crossing behaviour amongst the meds on and meds off pd patients in response to task context. we had patients step over a walking-surface obstacle in two contexts: at floor level and on a raised walking platform, previously identified as sufficient to threaten participants ' sensorimotor system, and elicit changes in motor strategy [6, 9]. we hypothesized that threatening context would have stronger influence on obstacle crossing than dopamine replacement, resulting in obstacle negotiation deficits amongst both meds on and meds off pd patients. ten participants with idiopathic pd (pd; age: 69.7 10.3 years) and ten age-matched controls (ctrl; age: 68.8 8.4 years) served as subjects. the human research ethics committee of the university of lethbridge had previously approved all procedures. all pd patients were receiving dopaminergic and associated medication as pd management (table 1), and each pd subject was tested meds off (> 12 h removed from last dose) and meds on (between 1 h and 2 h following regular dose) in the same laboratory visit (same day). all patients were tested in the off then on order for patient's practicality and comfort. quality of on condition was confirmed by patient's self-report and clinical assessment. the unified parkinson disease rating scale motor scores (updrs-iii) assessed at time of testing are provided in table 1. participants started in a standing posture at the beginning of a 4.7 m long, 0.6 m wide walkway, with each foot positioned such that the lateral malleolus was aligned with the centre line of a separate force plate (kistler products). threatening context was imposed by increasing the potential negative result of a fall, as empirically established in previous human movement studies [69]. in the high condition, the test walkway was solidly supported 0.7 m above the ground, and the force plates were raised to an equal height on a hydraulic lift. in the low condition, the walkway was outlined on the laboratory floor with continuous tape borders (figure 1). a ramp (0.9 m length, 5 angle of declination) was positioned at the start of the walkway, flush with the anterior edge of the lowered force plates, to allow for gradual vertical displacement from low force platform height (0.09 m) to low walkway height (0.00 m). the obstacle was a rigid foam block (0.15 m high, 0.60 m wide (perpendicular to gait path), and 0.15 m long), approximately equal in height and length to a north american concrete parking curb. all participants wore a safety harness for all trials, and that harness was tethered to an overhead rolling coupling to prevent falls to the ground. participants also wore vision-occluding goggles (plato, translucent technologies, toronto, on) that initially concealed the presence or absence of the gait obstacle, to control for the preplanning of obstacle negotiation strategy. during practice trials, participants were familiarised with the preparatory stimulus (opening of the goggles) and the imperative stimulus (audio signal). in experimental trials, once the investigator had positioned the obstacle (for obstructed trials) or feigned placing the obstacle (nonobstructed trials), a second experimental investigator informed the participant that a new trial was set to begin. at a random interval following this instruction, the imperative stimulus sounded 0 ms, 500 ms, or 1000 ms after goggles opening, with all subjects receiving the same number of trials at each latency (n=3) in the same random order. subjects walked at a self-selected speed along the walkway in each of the high and low conditions, performing a block of 18 trials in each condition (36 trials total). obstacle trials were further randomized in each threat condition, such that 9 of 18 trials in each threat condition involved obstacle negotiation and nine were nonobstructed trials. obstacle position was chosen at a point on the walkway equal to or greater than three stride lengths from the point of gait initiation for each subject, as determined during practice trials. this positioning allowed participants to transition from gait initiation to a stable gait pattern and provided adequate time for obstacle negotiation behaviour to reach a stable level. a fixed posture with arms loosely crossed in front of the body was used to limit obstruction of markers. participants were outfitted with passive infrared-reflective markers at the following anatomical locations: bilaterally at the anterior end of the shoe, the lateral malleolus, the posterior end of the shoe, the lateral epicondyle of the femur, the greater trochanter, the ulnar styloid, the lateral epicondyle of the humerus, and the acromion process and unilaterally at the sternal notch and the forehead. a single marker was also placed in the top center of one sagittal face of the obstacle. positional data were collected using a 6-camera infrared motion analysis data collection system (peak motus 2000, peak performance technologies, englewood, co), with a collection frequency of 120 hz. synchronized digital video recordings of each trial were made in the sagittal and frontal planes for qualitative scoring of obstacle negotiation. kinetic data for gait initiation were also captured from the force plates at a collection frequency of 600 hz, in synchrony with an analog signal split from the audio imperative stimulus. behavioural coding of obstacle contact was completed from video by three individual judges and corroborated with kinematic analysis of the obstacle marker displacement. trials where a participant contacted the obstacle were removed from further kinematic analysis as were any trials that could not be successfully postdigitized. given these reductions, the total number of trials included in kinematic analyses was pd off74, 69; pd on76, 65; ctrl79, 75 for low and high conditions, respectively. kinetic and kinematic data were processed using custom algorithms (matlab, the mathworks, natick, ma, usa). raw displacement data were visually inspected and interpolated as required then filtered using a fourth-order butterworth low pass digital filter with a cutoff frequency of 10 hz. pertinent kinematic measures assessing obstacle approach and obstacle negotiation in both the lead limb (first limb across obstacle) and the trail limb (second limb across obstacle) are illustrated in figure 2. they include the precrossing measure of horizontal distance from rear edge of obstacle to trail toe off (dpre), the crossing measure of vertical distance between top of obstacle and lead toe (dvert), and the postcrossing measure of horizontal distance from front edge of obstacle to lead heel strike (dpost), along with determinations of crossing step length (sl) from trail toe off to lead heel strike and horizontal velocity (cvcom) of whole body centre of mass at crossing. gait initiation rate was expressed as a time (unload time), being the difference in time between the imperative stimulus signal and a zero vertical force reading from one of the force plate pair. separate analyses were used to examine group and threat effects in the obstacle contact frequency counts. a mixed model manova comparison was conducted on the kinematic measures, with the followup between group (pd off versus ctrl; pd on versus ctrl) threat (low versus high) univariate anovas and within group (pd off, and pd on) threat (low versus high) repeated measure anovas performed, with a corrected level of significance of =.017 for multiple comparisons. unobstructed walking trials in low and high threat conditions were considered as a baseline in the current study. group mean values for horizontal velocity at the centre of mass are shown in figure 3. pd off subjects had a slower com horizontal velocity than ctrl subjects (f(1, 18)=80.76, p<.001; ctrl=1.01 m/s; pd off=0.58 m/s). univariate follow-up tests revealed that these measures were supported by group threat interactions (( f(1, 18)=4.90, p<.05). pd on walked slower (f(1, 18)=25.75, p=.00; ctrl=1.01 m/s; pd on=0.72 m/s) than ctrl subjects. a group threat interaction indicated that the manipulation of postural threat affected gait velocity amongst pd on subjects differently than ctrl subjects (f(1, 18)=5.25, p<.05). pd on demonstrated significantly slower walking speed in the high condition. a significant main effect for threat on com velocity (f(1, 18)=12.11, p<.05) was revealed through the multivariate analysis. group and group threat effects did not exist (f(1, 18)=2.48, p>.05 and f(1, 18)=.92, p>.05, resp.). there were no group or threat-based differences for gait initiation rate during obstructed trails (figure 4(a)). pd off did produce significantly lower com velocities during obstacle approach compared to ctrl (f(1, 18)=11.350, p=0.003). all three groups decreased com approach velocity in the high condition (figure 4(b); pd on/ctrl: f(1, 18)=15.632, p=.001; pd off/pd on: f(1, 18)=17.944, p=.002). larger decreases in com approach velocity amongst pd patients in the high condition led to a threat group interaction in the pd on/ctrl comparison (f(1, 18)=11.408, p=.003). pd off had a high frequency of obstacle contacts in the high condition; in total, 21.3% of trials compared to 9.9% observed in low ((1)=4.05, p<.05). pd on also made more frequent obstacle contact in high (observed in 18.3% of trials) than in low (5.9% of trials) ((1)=5.49, p<.05). conversely, ctrl had few obstacle contacts in both the high (8.5% observed) and low (6.3% observed) conditions, and these differences did not reach significance ((1)=0.32, p>.05). kinematic parameters for low and high condition obstacle crossing are presented in table 2. pd off was significantly slowed in obstacle crossing velocity compared to ctrl (f(1, 18)=11.317, p=.003), regardless of threat condition. both pd off and ctrl reduced cvcom (f(1, 18)=14.481, p=.001) while negotiating the obstacle in the high condition. compared to ctrl participants, pd off used a smaller precrossing margin (dpre; f(1, 18)=10.941, p=.004) with a smaller crossing step (sl; f(1, 18)=10.993, p=.004) in both conditions. pd off and ctrl both tended to reduce dpre in the high condition (f(1, 18)=3.897, p=.064). in contrast, ctrl increased postobstacle horizontal clearance of the lead heel in the high condition (dpost; 33 8 cm, as compared to 23 5 cm in low), where pd off produced horizontal heel clearance values of similar small magnitudes in either condition (15 2 cm in low, 14 2 cm in high). pd on and ctrl both decreased the crossing velocity in the high threat condition (f(1, 18)=25.988, p<.001). pd on used smaller crossing steps than ctrl (sl; f(1, 18)=45.247, p<.001), but both groups decreased crossing step length in the high condition (f(1, 18)=12.671, p=.002). in contrast, pd on used a smaller preobstacle margin than ctrl in both threat conditions (dpre; f(1, 18)=9.510, p=.006). postobstacle lead heel horizontal clearance approached a group threat interaction (f(1, 18)=5.130, p=.036), with pd on leaving smaller lead heel clearance in the high condition (11 2 cm, compared to 16 2 cm in low), while ctrl increased lead heel clearance in high obstacle crossing (33 8 cm, compared to 23 5 cm in low). pd off and pd on used significantly slower whole body com obstacle crossing velocity (cvcom; f(1, 9)=10.252, p=.010) in the high condition. pd patients also used a smaller crossing step in the high condition (sl; f(1, 9)=17.663, p=.002), with pd on using smaller crossing steps than pd off in both conditions (f(1, 9)=30.111, p<.001). both groups exhibited non-significant decreases in precrossing toe clearance, vertical clearance, and postcrossing heel clearance in the high condition. the results of this study agreed with our hypotheses, indicating that threatening context challenged locomotion amongst people living with the parkinson disease and that obstacle crossing errors were increased, while obstacle crossing kinematics, specifically obstacle clearance distances and velocity, was decreased during threatened context trials. in addition, motor improvements potentiated amongst pd patients through conventional pharmacotherapy were not uniformly maintained in the threatening context. pd on used small preobstacle clearance margins and small crossing steps to negotiate the obstacle. previous studies have established that pd motor deficits are manifest in multiple aspects of gait, including initiation, steady state, and termination. we suggest that the changes in obstacle avoidance behaviour observed among pd patients in the threatening context may be the result of constraints induced when some attention is directed toward a threatening environment. previous studies have used dual task paradigms to elicit similar obstacle negotiation deficits among neurotypical populations [23, 24]. the main finding of this study is that threatening context appears to be detrimental for pd patients. in healthy adults, perception and classification of threat the diversion of attentional resources to threatening context may lead to an attentional resource conflict, as previous studies have suggested that patients have adapted to use directed attention to initiate and control movements [10, 11, 26]. subdividing attention may exceed available capacity, especially amongst moderate to severe pd patients, who have been shown to have decreased executive function. it is possible that the increased errors in the high condition are the result of arousal and anxiety induced by threatening context. increased anxiety may also be a partial product of the safety precautions that surround the high condition, namely, the need for the overhead tether. previous studies from our laboratory [79] and others have shown that anxiety-provoking contexts can lead to kinematic changes in behaviour. one limitation of the current study is the lack of state or trait anxiety measures, including fear of falling, amongst participant groups. previous research has shown that the pd patients exhibit higher levels of anxiety and a heightened fear of falling in threatening contexts. while it is possible that the errors observed amongst pd patients completing threatened trials in this study are a partial result of raised anxiety, we did not observe changes in success rates between the low and high conditions for healthy normal adults. this finding contradicts previous research and suggests that the threat manipulation imposed in this study was not sufficient to invoke performance-inhibiting anxiety amongst the non-parkinson participants. it is possible that both attentional interference and increased anxiety contribute to the deficits observed amongst pd patients in the threatening context and that some portion of the diverted attention is consumed by perception and interpretation of threatening context. our results show that current pharmacological treatment of pd allowed patients to achieve fewer obstacle contact errors and improve gait kinematics, though these improvements failed to reach levels equal to control participants. furthermore, threatening context appeared to have the capacity to limit medication benefits, reducing obstacle crossing success rates and crossing kinematics for meds on pd patients to similar levels as meds off pd patients. previous work has indicated that temporal aspects of gait (e.g., stride cadence and stride event durations) are less sensitive to dopamine replacement [13, 30]. given the critical importance of gait cadence and response timing in obstacle negotiation, it follows that this activity may still be deficit for meds on pd patients if cadence and timing are only moderately improved with medication. one limitation of the current study is incomplete information on levodopa dosage levels, eliminating the possibility to fully consider dose-response relationships or possible confounders for persistent meds on deficits. despite this limitation, it is possible that the increased deficits observed for medicated pd in the threatening environment reflect a situational dysfunction in the nondopaminergic neural processes at work in this environmental context. we believe that executive attentional resources are the nondopaminergic assets that are being overloaded by concurrent attentional demands from perceived environmental threat and directed focus on task control. our findings show that obstacle negotiation amongst pd patients is compromised in a threatening context. pd patients exhibited more obstacle contacts, decreased obstacle crossing clearance margins, and decreased approach and crossing velocities when walking in a threatening condition. conventional pd pharmacotherapy failed to reduce obstacle contacts or increase obstacle clearance in the threatening context. interference resulting from the attention diverted to threatening context plus the directed attention used by pd patients to initiate and control movement may be the cause of obstacle negotiation deficits .

we examined whether people with parkinson disease (pd) have difficulty negotiating a gait obstruction in threatening (gait path and obstacle raised above floor) and nonthreatening (gait path and obstacle at floor level) contexts. ten pd patients were tested in both meds off and meds on states, along with 10 age-matched controls. participants completed 18 gait trials, walking 4.7 m at a self-selected speed while attempting to cross an obstacle 0.15 m in height placed near the centre point of the walkway. kinematic and kinetic parameters were measured, and obstacle contact errors were tallied. results indicated that pd patients made more obstacle contacts than control participants in the threatening context. successful crossings by pd patients in the threatening condition also exhibited kinematic differences, with meds off pd patients making shorter crossing steps, with decreased initiation and crossing velocities. the findings from this study lend support to the theory that pd patients rely on directed attention to initiate and control movement, while providing indication that the motor improvements provided by current pd pharmacotherapy may be limited by contextual interference. these movement patterns may be placing pd patients at risk of obstacle contact and falling.

PMC4437341

pubmed-1184

neonatal diabetes mellitus (ndm) is a rare monogenic form of diabetes starting within the first 6 months of life 13. the disease has an incidence of about 1:100,000260,000 live births and can be permanent (pndm), requiring lifelong treatment, or may be transient (tndm), in which case the diabetes may spontaneously remit (or be so mild as not to require treatment), but will often relapse, usually during adolescence 35. a genetic diagnosis has been made in up to 90% of these patients 7. in the majority of them (around 70%), it was found that a genetic or epigenetic alteration in the tndm locus on chromosome 6q24 causing the overexpression of two imprinted genes 7. less frequently, activating mutations of the genes kcnj11 and abcc (accounting for 10% and 13% of the cases, respectively) may result in tndm 7. mutations in these genes lead to a gain-in-function of the pancreatic atp-sensitive potassium (katp) channel, which is critical in the regulation of insulin secretion by the beta cell 3,6,8,9. the beta cell katp channel is an octameric complex composed of four pore-forming subunits: channel-building inwardly rectifying potassium-channel subunits (kir6.2) encoded by the kcnj11 gene, and four regulatory sulfonylurea-receptor subunits (sur1) and encoded by the abcc8 gene 10,11. these subunits regulate the metabolic activity of the channel, which is shut down in response to an increase in intracellular atp, leading to insulin secretion. gain-in-function mutations of either of these genes keep the channel in open conformation and impair insulin secretion 1012. most patients with kcnj11 mutations treated with insulin can be transferred to sulfonylurea (su) with a remarkable improvement in metabolic control and patient's quality of life 13. sulfonylureas close katp channels, through an atp- independent route, improving insulin secretion and representing a suitable therapeutic alternative for patients with kcnj11 mutations 10. for these reasons, identification of katp channel mutation can have a major impact on the treatment's choice. this is an example about how molecular diagnosis can influence the clinical management of the patients. herein, we report on a case of ndm in a caucasian boy, who presented severe diabetic ketoacidosis (dka) at 17 days of life. the genetic screening showed a heterozygous missense mutation (c.679 g>a) in the kcnj11 gene which leads to the replacement of lysine with glutamic acid at position 227 (e227k) of the atp sensitive potassium channel. an 11-day-old caucasian boy was admitted to the neonatal care unit with complaints of poor weight progression, suppurative conjunctivitis, and mucoral candidiasis. he was the second child of a 21-year-old woman (gravida 2, para 1) without history of diabetes, and was born through cesarean section at 38 weeks of pregnancy due to preeclampsia. apgar score was 5/9/10; birth weight was 2890 g (p15), length 47 cm (p15) and head circumference 34.5 cm (p50) 14. on physical examination, the infant exhibited axial hypotonia and weak suction reflex, demanding a nasogastric tube in order to be feed. at 17 days the child became irritable, drowsy, dehydrated, tachypneic, tachycardic with poor peripheral perfusion; rectal temperature was 37.8c. he was started on intravenous vancomycin after isolation of a methicillin-resistant staphylococcus from the axillary suppurative adenitis. blood tests revealed a glycemia of 1412 mg/dl with high levels of ketonemia; serum sodium was 172 mmol/l; potassium 3.9 mmol/l, and the ph was 7.0. after initial treatment with intravenous 0.9% saline serum, he was started on intravenous insulin perfusion (0.01 u/kg/h) in a 0.45% saline serum supplemented with 15 meq/l of potassium chloride. three days later, the insulin perfusion was stopped and the child was transferred to a subcutaneous protocol of intensive insulin therapy, consisting in a once daily administration of insulin glargine (1 u/day), and insulin lyspro every 6 h. further investigations revealed that there was no evidence of pancreatic exocrine failure. transfontanelar and abdominal ultrasounds; electroencephalography and brain magnetic resonance imaging showed no relevant findings. an interatrial communication ostium secundum, associated with enlargement of right cavities was found in the echocardiogram. c-peptide was 0.37 ng/ml (0.804.20); auto antibodies against islet cell (ica), decarboxylase of glutamic acid (gad), and insulin were all negative. the infant was referred to a tertiary hospital due to instability of his metabolic control, alternating episodes of hypoglycemia with hyperglycemia. two months later, insulin administration was stopped, given that glycemia was always within normal levels with minimal amounts of insulin. at this stage, the c-peptide was already normal. at the age of 9 months, his growth had declined from p10 to p<1. the e227k mutation found in our patient is a gain-function mutation that results in both impaired atp sensitivity and higher intrinsic the e227k mutation has been reported in several other patients with tndm but also in a few with pndm reflecting the phenotypic variability of kcnj11 mutations (table1). the reason why the same mutation causes a relapsing/remitting form of diabetes in some patients whereas in others it produces a permanent diabetes is unclear 15. it was not demonstrated a clear relationship between the clinical phenotype and the magnitude of the impairment of the atp-sensitive potassium (katp) channels. tndm may result from a reduction in insulin requirements at the time of remission due to changes in beta cell turnover or to compensatory alterations (at the level of the beta cell, pancreas, or whole body), overcoming the lower effectiveness of the atp sensitive potassium channel. therefore, the genetic background of the patient as well as other still unrecognized environmental factors may play an important role in the phenotypic expression of the mutation. on the other hand, the apparent clinical variability may result from confounding factors: patients diagnosed during puberty or early adulthood may have had a period of hyperglycemia that was missed during the neonatal period. clinical data of patients with heterozygous e227k mutation wks, weeks; mth, months; yrs, years; dka, diabetic ketoacidosis; mody, maturity-onset diabetes of the young. the e227k may be inherited from affected parents, or occurs as de novo mutation. in our study, the mutation is present in the affected child but also in his asymptomatic mother, suggesting that there was not a complete co-segregation of the mutation with diabetes. this situation has also been described previously (table1). in the majority of tndm and pndm cases caused by kcnj11 mutations 3,13, including e227k mutations 11, metabolic control was achieved by replacing insulin therapy with sulfonylureas, which are well-known katp channel inhibitors (table1). this finding supports the idea that if our patient has a relapse of diabetes, he may achieve optimal glycemic control with oral sulfonylurea treatment, strengthening the importance of the molecular diagnosis even if neonatal diabetes remits. the expression of kcnj11 in the central nervous system and skeletal muscle explain the neurological features associated with syndromic forms of pndm, such as developmental delay, muscle weakness, and epilepsy 16,17. however, neurological features were also identified in patients with nonsyndromic forms of pndm and tndm who carried kcnj11 mutations as speech delay, autistic spectrum disorder, and learning disability. until now it is difficult to assure whether these complications are a consequence of the mutation or whether environmental and/or other genetic factors are involved 6. in the case herein reported, the infant exhibited axial hypotonia and weak suction reflex, that may be caused by the mutation or/and may be due to exposure to hyperglycemia and ketosis during the first days of the child's life 1,3,18. further studies are necessary to clarify the etiology of neurological impairment in tndm patients who carried kcnj11 mutations and to access the effectiveness of su in improving the neurological development. in conclusion molecular diagnosis should be performed in order to identify those patients who may benefit from su therapy. further investigation is required to understand clinical heterogeneity and the incomplete co-segregation of the kcnj11 mutation with diabetes, and also the molecular mechanisms underlying the biphasic course of tndm.

key clinical messageneonatal diabetes is a monogenic form of diabetes. herein, we report on a newborn presenting diabetic ketoacidosis at 17 days of life. a kcnj11 mutation was identified. in such cases, insulin can be replaced by sulfonylurea with a successful metabolic control, as an example of how molecular diagnosis may influence the clinical management of the disorder.

PMC4614638

pubmed-1185

voluntary exercise has been found to mitigate harmful consequences of stress on the brain and to prevent the expression of depression and anxiety-like behavior .increased activity of brain-derived neurotrophic factor (bdnf) signaling is suggested to be an important factor mediating the benefits seen after running.in agreement, stress and depression have been found to decrease bdnf expression [2, 3]. corticotrophin-releasing factor (crf) is the major hypothalamic mediator of stress and is also involved in the etiology of depression and anxiety-like behavior [4, 5] and has been found to be downregulated in the mouse hypothalamus following exercise [6, 7]. crf acts through the seven transmembrane, g-protein-coupled receptor crf receptor 1 (crfr1), initiating the release of cortisol in humans and corticosterone in rodents from the adrenal gland. the cloning of a second crf receptor (crfr2) [911], existing as two primary splice variants (crfr2 and crfr2), was followed by the discovery of three additional crf family members, the urocortin 1 (ucn1), urocortin 2 (ucn 2) [13, 14], and urocortin 3 (ucn 3). in general, there is a limited overlap in the distribution of crf and the crf receptor subtypes and of the urocortins, suggesting separate but complementary functional roles. the physiological roles of crfr2 in the brain are still somewhat elusive, but most reports in the literature suggest involvement in dampening the body's response to stress. thus, mice deficient in crfr2 (crfr2 /) exposed to restraint stress show rapid and elevated acth levels compared to control animals, and behavioral studies show an increase in anxiety-like behaviors, possibly due to increased crf mrna levels in the central nucleus of the amygdala. however, studies using agonists and antagonists against crfr2 indicate that the attenuation of depression and anxiety-like behavior in relation to activated crfr2 is complex. thus, the effects has been found to be diverse, site specific, and depending on the stress level and experimental model as well as being different between genders. the lateral septum (ls), a brain area important in the shaping of coping responses to stress and found to modulate the activity in the amygdala, exhibits the highest density of crf2 in the brain. here, we have studied crfr2 and bdnf in the female mouse ls using quantitative real-time reverse transcriptase polymerase chain reaction (qrt-pcr) in an exercise paradigm. brain punch biopsies from young female mice exposed to voluntary exercise and nonexercised age- and sex-matched controls were analyzed for expression levels of transcript for bdnf and crfr2 in ls. in addition, crf mrna was studied in the central nucleus of amygdala (cea), as this is a key site for the integration of central stress circuits. finally, we monitored the exercise-induced effects on morning corticosterone and leptin levels in plasma as well as the weight of abdominal fat mass. the experiment was performed in 20 nave, 5-week-old c57/bl6 female mice (scanbur, sollentuna, sweden). all experimental procedures in animals were approved by the animal care and use committee at linkping university and in accordance with the european communities council directive guidelines. the mice were housed individually under standard conditions with free access to water and food under a 12-h light and 12-h dark cycle (lights on at 07:00 am). the experimental groups (n=10) had access to a wheel (: 13 cm) for three weeks, and the housing of the control group (n=10) remained unchanged. vaginal smears were used to assess the stage in the estrous cycle and all females were in the estrous phase at the end point of the experiment. the amount of running was on average 8,000 revolutions per day with peaks during the proestrus phase. for analysis of gene expression by qrt-pcr, the mice were euthanized after three weeks at 9.00 am by means of decapitation. blood was immediately withdrawn from the right ventricle by heart puncture, collected in edta containers (sarstedt ab, landskrona, sweden) and centrifuged at 7,000 g (4c; 10 min). the brains were dissected out, sliced, and put on ice, and punch biopsies were collected under a microscope using an air-powered punching machine following a microdissection protocol. total rna was extracted using rneasy lipid tissue mini kit (qiagen, sollentuna, sweden)including dnase treatment and rna was reversely transcribed to cdna (applied biosystems, foster city, calif, usa). quality control of rna extraction was performed on each brain area using the agilent rna 6000 nano assay protocol (http://www.agilent.com/chem/labonachip/) according to their protocol. real-time rt-pcr was performed on an applied biosystems 7900 fast real-time pcr system using taqman fast universal pcr master mix according to the manufacturer's instructions (applied biosystems, stockholm, sweden). the taqman gene expression assays used were: bdnf=mm 01334042-m1; crfr2=mm 00438303-m1; b-actin=mm 00607939-s1 and gapdh=mm 99999915-s1 as endogenous controls. each gene was normalized with the corresponding average of b-actin and gapdh expression in the same animal and expressed as the fold difference in relation to the control group. morning corticosterone was measured by means of an enzyme immunoassay (oc-teia), according to the manufacturer's instruction (ids nordic, herlev, denmark). assay sensitivity was 0.55 ng/ml. leptin concentration was measured by means of bead-based xmap luminex technology (austin, tex, usa), using a commercially available kit (electrabox, tyres, sweden) according to the manufactures protocol. data were acquired as mean fluorescence intensity, collected by the star station software program (applied cytometry systems, dinnington, sheffield, uk). data were analyzed with anova followed by student's t-test to ascertain which group differed significantly from controls. here, we report a 3-fold increase in bdnf gene-expression levels in the ls following three weeks of voluntary running (p<0.05) (figure 1). to our knowledge, this is the first demonstration that bdnf mrna levels in the female ls are markedly increased following long-term exercise. bdnf has a multitude of actions on neurons, and dysfunction of this neurotrophin may modulate mood. exercise has been found to induce bdnf-mediated increase of neurogenesis, and increased bdnf gene-expression and protein following acute or long-term exercise results in mood benefits and enhanced memory [3, 21]. however, studies of exercise-induced effects on bdnf in other brain areas and circuits other than hippocampus are limited. in addition, we studied the effect after voluntary exercise on crfr2, since the ls harbors substantial levels of crfr2 and since this receptor has been reported to mediate coping responses during the recovery phase after stress [4, 22]. in the present study, crfr2 gene-expression was, however, not altered after three weeks exercise nor was cea expression of crf mrna although we found a trend towards an increase in crfr2 (figure 1). plasma concentrations of morning corticosterone were decreased by approximately 18% compared to the control group (15,3 1,6 ng/ml; 12,6 2,4 ng/ml, p<0.01) (figure 2), which may suggests that it is possible that a part of the hpa-axis is inhibited by voluntary long-term exercise. however we used female mice, since anxiety and depression are twice as common in females, and there is accumulating evidence that the crf system also outside hypothalamus is differently regulated when comparing female and male rodents. the amount of voluntary running in females is closely correlated to the levels of sex hormones. we observed what others also have found that the average frequency of running where higher during the proestrus phase when there is a peak in estrogen levels. we chose to collect the brains the day at estrus when estrogen levels are low, since it is known that bdnf is regulated by this sex hormone itself at least in the hippocampus. thus, bdnf-synthesizing neurons express estrogen receptors, and the bdnf gene contains an estrogen responsive element, suggesting possible interactions between estrogen and bdnf regulation [25, 26]. our working hypothesis was that since acute exercise initiates the activation of the hpa-axis, crfr2 might be activated to counteract the crf/crfr1 system in the amygdala through the ls. thus, the activation of the crf system in the amygdala is tightly correlated to stress and anxiety-like behavior. however, neither crfr2 nor crf mrna were changed after three weeks running. taken together, if crfr2 and ls are involved in the strategies of stress coping, it seems that long-term voluntary exercise is a situation when ls crfr2 and cea crf are not activated. <0.05) (figure 2), in parallel with a 30% reduction in fat mass (p<0.001). food intake and water consumption was not measured in the present study, but previous studies of mice using the same experimental model showed no difference in food intake in exercised animals versus controls, and no difference between groups in total body weight, similar to what we observed. leptin is a 16 kda protein hormone and a product of the obese gene that has been found to be correlated with the lipid content of the cells and plays an important role in regulating food intake and energy expenditure. it has been shown in both humans and mice that weight loss is associated with a decrease in plasma leptin. as already mentioned, we did not observe any changes in total body weight but a decrease in perigonadal fat pads. a decrease in abdominal fat in combination with no weight loss is probably due to an increase in muscle weight after long-term exercise. it is possible that the decrease of plasma leptin in the present study is correlated to the decrease in perigonadal fat. however, further studies are needed, since the mechanisms responsible for regulating leptin expression and protein are complex and not fully understood at least not in females. in summary, these data show for the first time that long-term voluntary exercise increases bdnf gene expression but not crfr2 in the ls or crf in the cea in young healthy female mice. although our data show that the bdnf gene is activated by exercise in the ls, the limitation is that we did not measure bdnf protein levels. however, it is possible that exercise may promote ls neuronal survival through increased bdnf, but this needs to be further elucidated. in addition, to what extent this is related to an effect on depressive and anxiety-like behavior remains to be analyzed and would be an intriguing future perspective.

voluntary physical activities are known to modulate anxiety and depressive/like behaviors in both animals and humans. brain derived neurotrophic factor (bdnf), has been reported to be elevated following exercise. bdnf, as well as type 2 corticotrophin releasing factor receptor (crfr) 2, has been shown to mediate anxiety-like behavior. in the present study we examined the effects of long-term voluntary exercise on the transcripts for bdnf and crfr2 in the lateral septum (ls) and for crf in the central amygdala (cea) in female mice. thus, increased activity of crf in the cea is associated with anxiety-like behavior. quantitative rt-pcr was employed to measure levels of mrna in punch biopsies from ls and cea. in addition, measurements of the concentration of corticosterone and leptin in plasma were employed. in the ls, we found a three-fold increase of bdnf mrna (p<0.05) but no significant change in crfr2 mrna. no changes in crf in the amygdala were observed but we found a decrease in the levels of plasma corticosterone. plasma leptin and the weight of perigonadal fat pads were decreased following exercise. in conclusion, these data show that bdnf gene expression in the ls is influenced by long-term exercise in females but not crfr2.

PMC3184426

pubmed-1186

regulation of body weight and adiposity relies on a homeostatic system balancing energy intake with energy expenditure. well-documented evidence gathered during the past 35 years has established that induction of thermogenesis in brown adipocytes of mice and rats can reduce obesity (rothwell and stock, 1979). the maintenance of body temperature by brown adipose tissue (bat) thermoregulation utilizes energy stores in proportion to ambient temperature (kozak, 2010). importantly, bat-based non-shivering thermogenesis may be important in humans as well (yoneshiro and saito, 2015). therefore, adiposity may be regulated by the capacity of the individual to manipulate brown adipocyte phenotypes at reduced temperature, thereby constituting a strategy to reduce metabolic efficiency (jaroslawska et al., 2015). during the past decade, accumulating data have demonstrated that the gut microbiota impacts body weight and energy homeostasis (tremaroli and bckhed, 2012). microbial diversity as well as the relative proportions between the members of main phyla firmicutes and bacteroidetes have been associated with regulation of obesity in both mice and humans (ley et al., 2005, the gut microbiota is important for energy harvest on a polysaccharide-rich diet (bckhed et al., 2004) and also contributes to diet-induced obesity (dio) by modulating different pathways involving triglyceride storage and fatty acid oxidation (bckhed et al., 2007). interestingly, microbiota from lean twins can protect against obesity induced by microbiota from obese twins, when transferred to mice (ridaura et al. bile acids (bas) produced by hepatocytes, stored in the gall bladder and released into the gut after a meal, are metabolized by the gut microbiota to generate an array of ba species such as secondary bas, e.g., lithocholic and deoxycholic acid (sayin et al., 2013). these can activate nuclear receptor farnesoid x receptor (fxr) and g-coupled receptor tgr5, located on ibat, to regulate thermogenesis (prawitt et al. recent studies have linked changes in the gut microbiota in a cold environment to the thermogenic potential of brite cells through enhanced type 2 cytokine signaling by the innate immune system (lee et al., 2015, chevalier et al., 2015). here we show, in contrast to the role of brite cells in determining resistance to dio in c57bl/6j mice at reduced temperature (surez-zamorano et al., 2015), that acute changes in energy balance in mice fed a high-fat diet at 12c is associated with changes in the gut microbiota, increased ba metabolism, and induction of ibat thermogenesis. we fed mice with high-fat diet (hfd) and chow diet (chd) at thermoneutrality and at reduced ambient temperatures to assess the effects of reduced temperature on cold-induced energy expenditure and development of dio. at 12c and 17c, the reduced fat mass and adiposity (figures 1a, 1b, s1a, and s1b) together with increased food intake in mice fed either hfd or chd resulted in increased energy expenditure (figures 1c and 1d), demonstrating that reduced temperature blocks dio. reduction of ambient temperature from 29c to 17c and 12c induced ibat and inguinal fat (ing) uncoupling protein 1 (ucp1) mrna and protein expression in mice fed either chd or hfd (figures 1e1h and s1c). however, ucp1 expression in ing was only 6% of that observed in ibat. in addition, pgc1a (peroxisome proliferator-activated receptor coactivator 1-alpha) and adrb1 (beta3-adrenergic receptor) expression, which are associated with improved metabolism, was significantly induced in ibat and ing by cold (figures s1d and s1e). reduced cellular energy levels lead to increased phosphorylation of ampk and was associated with increased phosphorylation of acc and increased expression of cpt1a, indicating increased hepatic fatty acid oxidation (figures 1i1k). at 12c mice had decreased expression of biomarkers of hepatic lipogenesis (figure s1f), a phenotype associated with reduced plasma cholesteryl esters (ces) and triacylglycerols (tags) in mice fed hfd at 12c compared to 29c (ces, 12c 6,102.5 446 versus 29c 8,421.1 490.7, p <0.05; tags, 12c 155.1 50.4 versus 29c 409.4 43.4, p <0.05). consistent with reduced adiposity, glucose tolerance was improved in mice fed hfd at 12c compared to 17c or 29c and was similar in both hfd- and chd-fed mice at 12c (figure 1l). reduced ambient temperature also improved insulin tolerance of mice on either hfd or chd (figures s1 g and s1h). the improved glucose tolerance was associated with increased glut4 (glucose transporter type 4) mrna and protein levels in ibat and skeletal muscle (figures s1i s1k). induction of irs1 (insulin receptor substrate 1) mrna at 17c reflected the improved insulin tolerance at reduced ambient temperature (figure s1l). furthermore, expression of pepck (phosphoenolpyruvate carboxykinase) and g6pc (glucose-6-phosphatase catalytic subunit) mrna levels was increased in liver of mice housed at 17c and 12c (figures s1 m and s1n), indicating increased hepatic gluconeogenesis, which provides energy for thermogenesis in the cold (himms-hagen, 1995). to directly investigate the impact of diet and ambient temperature on mouse gut microbiota, the variable region 4 (v4) of bacterial 16s rrna genes was amplified by pcr and sequenced using the illumina miseq platform. we observed 4,090 distinct otus (from 9,442,775 reads; ranging from 75,344 to 159,323 reads per sample). to investigate how diet and ambient temperature affected the microbiota phylogenetic richness in each caecum sample, we analyzed the -diversity, as assessed by rarefication and phylogenetic diversity (figure 2a). similar to previous reports, we found that diet is a key factor in shaping phylogenetic diversity (hildebrandt et al., 2009, turnbaugh et al., 2009) and observed that the caecal microbiota of mice on chd had higher phylogenetic diversity compared with mice on hfd. we next performed principal coordinate analysis (pcoa) of unweighted unifrac distances between the caecum samples from the different groups to determine the effects of diet and ambient temperature on the microbiota. a clear separation between the communities, driven by diet, was observed at the first principal coordinate (x axis), which explained 27% of the variance (figure 2b). the second principal coordinate (y axis) accounted for 13% of the variance and separated the communities by ambient temperature within the diets (figure 2b). moreover, the communities of mice maintained at 12c separated from those at 17c and 29c independently of the diets with the strongest effect in the hfd groups (figure 2b). analysis at the phylum level indicated that the caecal microbiota was dominated by five major phyla: actinobacteria, bacteroidetes, firmicutes, proteobacteria, and verrucomicrobia (figure 2c). mice fed hfd at 12c and 17c were associated with a bloom of proteobacteria and a reduction in bacteroidetes and an increase in firmicutes (figure 2c). shifts in bacteroidaceae, rikenellaceae, and s24-7 (all bacteroidetes), particularly in s24-7 on chd and bacteroidaceae on hfd, were observed (figure 2d). the increase in firmicutes under all conditions was due to increases in clostridiaceae, lachnospiraceae, and ruminococcaceae (figure 2d). interestingly, a bloom in erysipelotrichaceae was observed in both diets, but only at 29c (figure 2d). the bloom in proteobacteria at reduced temperature was largely accounted for by desulfovibrionaceae (figure 2d), which has been previously associated with metabolic health (caesar et al., 2015). to identify taxonomic differences in the microbiota composition of mice fed hfd or chd and challenged by differences in the ambient temperature and to identify specific bacterial taxa or species-level phylotypes that contribute to the adiposity phenotype, we applied linear discriminant analysis (lda) effect size (lefse) with lda score>2 (segata et al., 2011). this analysis revealed 46 discriminative features in the chd-fed mice (figure s2a) and 34 in the microbiota of hfd-fed mice (figure s2b). similar otus belonging to class bacilli in particular orders turicibacterales and lactobacillales, the genus allobaculum in the family erysipelotrichaceae, as well as the genus rc4-4 in the family peptococcaceae (figures s2a and s2b) were increased in mice maintained at 29c independent of diet. the microbiota of mice fed hfd maintained at 12c was enriched in a corriobacteria such as adlercreutzia, number of clostridia from the mogibacteriaceae and ruminococcaceae families, and desulfovibrionales such as desulfovibrio (figure s2b). similar changes were observed in mice fed chd maintained at 17c (figure s2a), all of which were lean and glucose tolerant. reduced ambient temperature caused a robust induction of hepatic enzymes engaged in the conversion of cholesterol to primary bas, including cyp7a1 (cholesterol 7alpha-hydroxylase), cyp8b1 (sterol 12alpha-hydroxylase), and cyp27a1 (sterol 27-hydroxylase), as well as in taurine production and taurine conjugation to bas (figures 2e, s2c, and s2d). accordingly, the ba profile was drastically altered and dominated by unconjugated ba (ca, and -, mca) at 29c in mice fed a hfd, whereas primary taurine-conjugated bas, i.e., tca, tmca, and tmca, were elevated in plasma of mice maintained at 12c on both diets (figures 2f2h). fgf21 was 7- and 2.5-fold upregulated in ibat at 12c on a hfd and chd, respectively (figure s2e). furthermore, type 2 iodothyronine deiodinase expression, which is associated with increased thermogenesis, was induced at reduced temperature (figure s2e), as previously observed (de jesus et al., 2001). the tgr5 receptor, which binds to microbially produced secondary bas (kawamata et al., 2003), was induced at 12c while thyroid hormone receptor beta was not (figures s2e s2 g). to investigate whether the gut microbiota and bas were altered in response to reduced temperature or reduction in obesity, we performed a kinetic experiment and analyzed the microbiota in mice that were fed hfd for 4 weeks at 29c and then transferred to 12c for 6 days. increased fat mass and adiposity after 4 weeks of a hfd at 29c was not affected by reduced ambient temperature (figures 3a and 3b), and the increased demand for fuel was satisfied by a 20% increase in food intake within 2 days of cold exposure (figure 3c). cold exposure induced ucp1 expression 5-fold in ibat after 1 day at 12c (figure 3d), similar to the increase observed after 4 weeks at 12c (compare with figure 1e). the induction of ucp1 in ing was very low and therefore not associated with the initial response required for survival in the cold (figure 3d). the gut microbiota and ba composition were shifted to the cold-adapted state within 1 day, demonstrating that these changes were independent of reduced adiposity (figures 3e3h). the bas profile, already modified 1 day after cold exposure, was dominated by conjugated bas (tca, tmca, tmca, and tmca), whereas the levels of unconjugated bas (mca, mca, and mca) were reduced compared to 29c (figure 3e). analysis on caecal microbiota composition showed a significant decrease in the phylogenetic diversity already 2 days after cold exposure compared to 29c (figure 3f). at the phylum level, deferribacteres increased and verrucomicrobia decreased within 1 day of cold (figure 3 g). bacteroidetes increased and firmicutes decreased, but not until after 6 days at 12c (figure 3 g), to increase the bacteroidetes/firmicutes ratio (figure 3h). at the family level, the most abundant phylotypes affected by cold exposure were bacteroidaceae, rikenellaceae, porphyromonadaceae, deferribacteraceae, lactobacillaceae, clostridiaceae, and peptostreptococcaceae (figure s3a). the fraction of others, such as s24-7, clostridiales, lachnospiraceae, ruminococcaceae, erysipelotrichaceae, and desulfovibrionaceae (figure s3a) did not change when mice were transferred to cold for 6 days, suggesting that these microbial phylotypes are associated with hfd feeding. similar to the initial cold-exposure experiment for 4 weeks, we observed that adlercreutzia and bacteroides were increased after 6 days of cold exposure (figure s3b). the firmicutes, lactobacillus, clostridiaceae, genus smb53, dehalobacterium, peptostreptococcaceae, and mogibacteriaceae decreased at 12c (figure s3b). long-term cold exposure induced a bloom in proteobacteria, particularly in desulfovibrionaceae (figure s2b), but it did not change during the short-term exposure at 12c (figure s3a). these data suggest that in parallel with ucp1 induction, changes in microbiota and bas occur when ambient temperature is reduced, but independent of changes in adiposity. to assess the capacity of the gut microbiota from mice maintained at reduced ambient temperature to modulate the development of dio mice colonized with microbiota from donors kept at 12c had reduced fat mass and adiposity as well as significantly higher expression of ucp1 and dio2 mrna and protein in ibat compared with mice colonized with microbiota from 29c (figures 4a4e). expression of adrb3, pgc1a, and fgf21was not altered in ibat (figure 4c); no changes in gene expression were detected in ing of recipient mice (figure 4f). the glucose response was improved in the recipient mice colonized with microbiota from donor kept at 12c, but no differences occurred in glut4 protein levels in muscle and ibat (figures 4 g, s4a, and s4b). recipient mice, colonized with microbiota from donors kept at 12c, had increased hepatic expression of cyp8b1 and cyp7b1 (25-hydroxycholesterol 7alpha-hydroxylase) and csd (cysteine sulfinic acid decarboxylase), leading to an altered ba profile (figures s4c and 4h). these mice had an increased proportion of conjugated, and a reduced proportion of primary unconjugated, bas (ca, cdca, and mca) and secondary bas (dca and udca) in the plasma (figure 4h). gut microbiota transferred from donors housed at 12c influenced hepatic lipid metabolism, inducing ampk phosphorylation augmenting lipid -oxidation in liver compared with microbiota from 29c (figures 4i4k and s4d). nonetheless, lipid analysis showed a modest increase in total tag in plasma in mice colonized with microbiota from donor kept at 12c (figure s4e). these results suggest that functional differences between microbiota of mice kept at 12c and 29c can be transferred to recipient mice kept at 23c. a primary and essential task of all endothermic animals is to maintain a normal body temperature by inducing thermogenesis in response to cold. here, we demonstrate that reducing ambient temperature from 29c to 12c or even 17c also protects the host from dio, an effect that is associated with increased ucp1 expression in ibat. however, recent studies have shown that the pathway for activating thermogenesis may be more complex than the traditional model based on ibat thermogenesis. thermogenesis occurs not only in ibat, but also by the induction of brite cells in wat at 29c by administration of interleukin 4 (qiu et al., similarly, the thermogenic program in ibat may be activated by bas at 29c (zietak and kozak, 2016). recently, it was shown that the depletion of the microbiota by antibiotic treatment or gf conditions stimulates the induction of brite cells by enhanced type 2 cytokine signaling from eosinophil infiltration (surez-zamorano et al., 2015). here, we show that both the acute and chronic exposure to reduced ambient temperature leads to induction of ucp1 in ibat and rapid changes in the composition of the gut microbiota and ba metabolism. the results suggest that the induction of cold-mediated thermogenesis involves the activation of ibat thermogenesis by a mechanism involving modulation of ba metabolism and ampk phosphorylation by the gut microbiota. a key question is whether the improved obesity/diabetic phenotype of mice with dio reared in the cold is dependent on the effects of the gut microbiota. we observed that cold exposure is linked to altered caecal microbiota and that mice on both diets shared microbial phylotypes associated with changes in ambient temperature. bacteria belonging to bacilli and erysipelotrichaceae, usually associated with obesity (turnbaugh et al., 2009), were enriched in mice at 29c, whereas adlercreutzia and desulfovibrio, associated with leanness (caesar et al., 2015, goodrich et al., 2014), were increased at 12c. changes in the composition of gut microbiota occurring within 1 day of exposure at 12c and in the absence of changes in adiposity suggest that the changes in microbiota are driven by changes in temperature rather than merely reflecting obesity. the major microbiota changes occurring in parallel with induction of ucp1 were reduced firmicutes apparent after 1 day and an increase in bacteroidetes after 6 days, changes previously linked with protection against obesity (ley et al., 2005, turnbaugh et al., 2008). (2015), we identified a decreased abundance of verrucomicrobia and an increased abundance of deferribacteres when mice were exposed to cold, suggesting that altered abundance of members in these phyla contribute to the cold-induced phenotype. changes in other bacteria after longer cold exposure may be in response to altered adiposity of the host. the mechanism by which the gut microbiota influences adiposity may include modulation of ba metabolism (sayin et al., 2013). bas are microbial-derived metabolic regulators, which can suppress dio through increased energy expenditure (watanabe et al., 2012). here we show that lower ambient temperature increased production of bas and expression of genes related to ba synthesis. the increased levels of conjugated bas may be attributed to reduced levels of lactobacillus, which has high deconjugation capacity upon cold exposure. these observations were confirmed in the kinetics study where conjugated bas were increased and lactobacillus was decreased after 1 day at 12c. the increased prevalence of taurine species in the cold might antagonize fxr receptor (sayin et al., 2013) and protect against dio as fxr-deficient mice are resistant to dio (prawitt et al., 2011a). in agreement with inhibition of fxr signaling in the cold-exposed animals, we observed increased expression of enzymes involved in ba synthesis and increased ba pool size. the cold-exposed mice had a ba profile that resembled that of gf mice, which also are resistant to dio and have increased expression of phosphorylated ampk in the liver (bckhed et al., 2007). ampk activation inhibits fxr activity (lien et al., 2014) and also promotes energy expenditure. accordingly, we observed increased expression of phosphorylated acc as well as downstream cpt1a expression, which is associated with increased fatty acid oxidation and energy expenditure. importantly, we observed this phenotype both following cold-exposure as well as after microbiota transfer, suggesting that the phenotype is linked to the altered microbiota. in the current study, cold exposure at 12c causes a strong and rapid induction of the brown adipose phenotype in ibat, but not in ing, an increased whole-animal energy expenditure, and a complete suppression of dio. we demonstrated that transplantation of caecal material from mice reared at 12c to gf recipients improved their metabolic phenotype. (2015) demonstrated that transplantation of caecal material from cold-exposed mice reduced obesity and improved insulin sensitivity. however, the brown adipocyte phenotype in ing wat in our study is minor (1%5%) compared to the robust ibat thermogenic phenotype. our investigations suggest that changes in the gut microbiota in response to the cold exposure mediate ba metabolism, possibly through changes in ampk and fxr signaling, to complement sympathetic signaling in the regulation of thermogenesis in ibat and resistance to dio. protocol i. breeding pairs of c57bl6/j (b6) mice were obtained from the jackson laboratory. adult b6 mice at 1220 weeks of age were divided into 6 groups (n =810 mice/group). three groups were ad libitum fed hfd (58% energy in kcal from fat, ain-76a 9g03 research diets); another three groups received chd (11% energy in kcal from fat, 5053, rodent diet 20, labdiet). mice were single-housed with a 12 hr light/12 hr dark cycle at environmental temperatures of 12c, 17c, and 29c for 4 weeks. b6 mice at 8 weeks of age were individually housed at 29c and ad libitum fed a hfd for 4 weeks (n =6 mice). thereafter, mice were transferred to 12c for 1, 2, 4, and 6 days and received ad libitum a hfd (n =6 mice/time point). for both protocols, mice were anaesthetized with an overdose of cocktail composed of ketamine/xylazine/chlorpromazine administered subcutaneously to collect blood samples by cardiac puncture. blood samples were centrifuged for 10 min at 2,400 rpm and stored at 20c. mice were sacrificed by cervical dislocation, and tissues and caecal content were quickly removed and stored at 80c for further analysis. animal experiments performed at different temperatures were approved by the local committee for the ethical treatment of experimental animals of warmia-mazury university (nr 38/2011), olsztyn, poland. fat mass and lean mass were measured by nuclear magnetic resonance (nmr, bruker). food intake was calculated on a weekly basis and expressed as the amount of energy in kj. at the end of the experiment bacterial gdna was extracted using the genematrix stool dna purification kit (eurx) from the caecum of mice fed hfd and maintained at 17c or 29c. genomic dna from caecum of mice fed hfd at 12c and chd at 12c, 17c, and 29c was isolated using the repeated bead beating (rbb) method (salonen et al., 2010). details about 16s rrna amplification, sequencing, microbiota data analysis, and ba analyses are provided in supplemental experimental procedures. the data are expressed as mean sem and analyzed using graphpad prism 6.0. statistical differences for single variables were analyzed by mann-whitney test or one-way anova and tukey s multiple comparison post hoc test for three groups (29c, 17c, and 12c) the level of significance was set at p <0.05; p <0.05; p <0.01; p <0.001; p <0.0001. m.z. was involved in design of the experiment and performed physiological and molecular phenotypes and participated in writing the manuscript; p.k .- d. was involved in design and performed experiments concerning microbial profiling and transplant experiments and participated in writing the manuscript; l.h.m. and m.s. designed the initial hypothesis and participated in the design and the writing of the manuscript; f.b. was involved in design and interpretation of experiments concerning microbial profiling and transplant experiments and participated in the design and the writing of the manuscript .

summarymaintenance of body temperature in cold-exposed animals requires induction of thermogenesis and management of fuel. here, we demonstrated that reducing ambient temperature attenuated diet-induced obesity (dio), which was associated with increased ibat thermogenesis and a plasma bile acid profile similar to that of germ-free mice. we observed a marked shift in the microbiome composition at the phylum and family levels within 1 day of acute cold exposure and after 4 weeks at 12c. gut microbiota was characterized by increased levels of adlercreutzia, mogibacteriaceae, ruminococcaceae, and desulfovibrio and reduced levels of bacilli, erysipelotrichaceae, and the genus rc4-4. these genera have been associated with leanness and obesity, respectively. germ-free mice fed a high-fat diet at room temperature gained less adiposity and improved glucose tolerance when transplanted with caecal microbiota of mice housed at 12c compared to mice transplanted with microbiota from 29c. thus, a microbiota-liver-bat axis may mediate protection against obesity at reduced temperature.

PMC4911343

pubmed-1187

the peptide sequence of anastomosis photocaged 1 (apc1) contains seven lysine residues that are protonated at neutral ph, keeping the peptide soluble and in its monomeric unfolded state. as will be shown, a sol-gel phase transition can be initiated by triggering the folding of the peptide into an amphiphilic -hairpin. once folded, apc1 is designed to rapidly self-assemble into a fibrillar hydrogel network, where each fibril is composed of a bilayer of -hairpins that are intermolecularly hydrogen-bonded along the long-axis of a given fibril, figure 1b (transition i) and 2b. earlier studies in our lab support this proposed mechanism where the formation of the hydrophobic interface that defines the fibril bilayer provides most of the thermodynamic driving force for self-assembly. we, and the pochan laboratory, have shown that hydrogels formed from hairpin peptides display shear-thin/recovery rheological behavior. when these gels experience a shear stress, such as that delivered by a syringe plunger, some of the interactions that stabilize their fibril network can be disrupted allowing the material to flow. when the application of shear stress ceases, the network heals and the gel recovers (figure 1b, transition ii). as will be shown, apc1 exhibits similar behavior, allowing its syringe-based delivery. to induce the final gel-sol transition that allows the material within the sutured vessel to dissolve, we sought to disrupt the hydrogel network by destabilizing the hydrophobic interior of its fibrils, figure 2b. apc1 incorporates a photocaged glutamic acid, namely 4-methoxy-7-nitroindolinyl glutamic acid [e(mni)] on its valine-rich face, which would reside in the hydrophobic bilayer of the peptide fibril. when the gel is irradiated with 365 nm light, or alternatively through 2-photon irradiation at 720 nm, the cage is released introducing a negatively charged glutamate side chain into the hydrophobic bilayer, which is energetically unfavorable. this locally disruptive interaction is additive and should result in the global destabilization of the fibril network defining the gel state, thus initiating the final gel-sol transition (figure 1b, transition iii and figure 2a). the mni cage, chosen for its efficient aqueous photolysis and cytocompatibility, is incorporated at position 14 of apc1 's primary sequence. this is a central position on the hairpin's hydrophobic face that corresponds to a fully buried site within the fibril bilayer. incorporating the cage at this position necessitates the placement of a glycine residue on the opposing strand of the hairpin at position 7. in the self-assembled state, the small glycine provides a hole on the hydrophobic face of one folded hairpin into which the caged side chain from a neighboring hairpin can reside. this lock and key side chain packing arrangement accommodates the large photocage within the tight steric constraints of the bilayer interior. for example, aryl residues can be found in sheet interiors with their aromatic side chains laying over a glycine residue in a neighboring strand. the formation of favorable-interactions between the aromatic side chain and the glyl-amide backbone drives this fold. although the extended length and flexibility of the caged side chain could allow for multiple modes of packing, molecular modeling shows that in the context of the apc1 hairpin, the proposed lock and key arrangement results in a well-packed hydrophobic face that is conducive to bilayer formation (figure 2b). figure 2c shows a cut-away view of one monolayer formed from three hairpins. here, the caged side chain from one hairpin lays over the glycine of a neighboring hairpin below it, with the indoline group making hydrophobic contacts with proximal valine side chains. the top-most hairpin in the assembly shown in panel c highlights the glycine hole into which a photocaged side chain could be placed if an additional hairpin were to join the fibril assembly. in addition to apc1, a second peptide was designed to study the positional effect of cage placement on gel performance. peptide apc2 contains the [e(mni)] residue at position 16, which is slightly closer to the hairpin's c-terminus. two control peptides were also prepared, namely capc1 and capc2, which contain uncaged glutamate residues at positions 14 and 16, respectively. the ability of apc1 and apc2 to fold and associate into -sheet rich assemblies was monitored using circular dichroism (cd) spectroscopy. in water at 5 c, the cd spectra of 1 wt% solutions of apc1 and apc2 indicate that the peptides are unfolded (figure 3a). however, figure 3b shows that folding and self-assembly can be triggered by adding ph 7.4 buffer that contains nacl to the aqueous peptide solution and increasing the temperature to 25 c for apc1 and to 37 c for apc2. the nacl screens the lysine point charges and increasing the temperature drives the hydrophobic effect, both of which favor folding and assembly. the exact temperatures needed to induce gelation was determined by monitoring the mean ellipticity at 216 nm as a function of temperature, figure s3. in these cd experiments, self-supporting hydrogels of both peptides (ph 7.4, 150 mm nacl) form directly in the cuvette. spectra of both peptides in the gelled state display distinct minima at 216 nm, which is indicative of sheet secondary structure. also evident in the spectra are absorptions due to the indoline cage, which occur in the near uv-cd (240-380 nm). this indicates that in the unfolded state of each peptide, the achiral aromatic indoline ring resides in an achiral environment, that is, it is solvent exposed. however, when the peptides fold and assemble, the ring is placed into a chiral environment, such as that provided by the fibril's hydrophobic interior. importantly, under the same solution conditions that support apc1 and apc2 assembly, the control peptides capc1 and capc2 remain unfolded, figure s4. this suggests that the control peptides ' negatively charged glutamate side chains are not accommodated within the hydrophobic interior of the fibril bilayer and thus, peptide folding and assembly are disfavored. importantly, it also supports the assertion that if the glutamate's negative point-charge were to be unmasked when the peptides are in the folded and assembled fibrillar state, that this event should be disruptive. oscillatory rheology was employed to study the rheological behavior of each gel under experimental conditions that mimic its use during the anastomosis procedure. here, the storage modulus (g), a measure of the gels ' mechanical rigidity, is monitored in the rheometer under environmental conditions that mimic: (1) the initial (sol-gel) formation of the hydrogel in the syringe; (2) shear thinning of the material during injection with subsequent hydrogel recovery in the vessel lumen; and (3) the disruption of the gel network (gel-sol) by uv photolysis after suturing. monitoring gel behavior in a rheometer, although not exactly capturing the gel's response during the actual anastomosis procedure, allows quantitative and reproducible measurement of gel mechanical properties under highly controlled conditions. i, the rate of hydrogel formation (sol-gel) is assessed by monitoring the evolution of g after peptide folding and assembly is triggered. apc1 forms a semi-rigid gel within the first few minutes that further rigidifies with time (g2,500 pa after 30 minutes). after completion of the initial time sweep, 1000% strain is applied to the material for 30 seconds in regime ii to mimic syringe delivery of the gel. this application of strain results in an immediate decrease in g indicative of shear thinning that results in a viscous gel capable of flow. after the 30 seconds, the applied strain is decreased allowing the apc1 gel network to recover to about 75% (1900 pa) of its original rigidity. lastly, using an optically clear parallel plate in the rheometer, the recovered hydrogel is subjected to irradiation by uv light (365 nm) for the first 10 minutes of regime iii. the data clearly show that the gel network is rapidly degraded with an almost immediate decrease of g to 180 pa. taken together, the rheological data suggests that apc1 is capable of triggered gelation, shear-thin delivery via syringe and rapid post-delivery recovery. importantly, irradiation by uv rapidly disrupts the gel network affording a viscous material, which should be capable of dissolution when exposed to the shear of blood flow. figure 3d shows the same experiment for the apc2 gel, where a significant lag phase before the onset of gelation is observed. however, with time, apc2 forms a gel that is significantly more stiff (20,000 pa) then that formed from apc1. in regime ii, the apc2 gel shear thins but is unable to self-heal effectively and recovers only about 5% of its original mechanical rigidity. irradiation in regime iii although apc2 initially forms a rigid gel, its inability to recover after being shear thinned precludes it use in the anastomosis procedure. overall, this rheological data indicates that the positional placement of the photocage within the peptides ' primary sequence is important. here, incorporation of the cage near the hairpin's terminus hampers the ability of its network to recover. the rheological data shows that irradiation of the recovered apc1 gel leads to a significant decrease in g presumably as a result of releasing the glutamate cage. this was confirmed by following the fate of caged apc1 during photolysis by uv spectroscopy and lcms, which showed nearly complete release of the mni cage and evolution of corresponding carboxylate-containing peptide within 90 seconds of irradiation, figure s8. in figure 4, transmission electron microscopy (tem) shows the morphology of fibrils isolated from a 1 wt% apc1 hydrogel before (a) and after (b) irradiation. before irradiation, the hydrogel network is composed of long fibrils whose lengths are distributed over a range of 150 nm to over 1000 nm, figure 4c. irradiation results in the formation of small fibril segments as shown in panels (b) and (d). the average length of these fibrils is on the order of 150 nm demonstrating that the majority of longer fibrils have been converted to smaller segments as a result of photolysis. further, cd spectroscopy of the irradiated gel shows an attenuation of -sheet signal at 216 nm, which is consistent with the disruption of the fibril network, figure s9. the fact that some small fibrils persist may be due to either incomplete release of the cage, or that a population of the uncaged peptide remains in the fibrillar state. at any rate, the rheological data demonstrates, and as will be confirmed in the in vivo studies, this level of fibril disruption is sufficient to ensure the necessary gel-sol phase transition. the ability of the apc1 hydrogel to serve as a temporary aid in the suturing process was assessed in a mouse femoral artery end-to-end anastomosis model. this challenging microsurgical setting tests the gel with regards to ease, safety, precision, and speed of arterial anastomosis. the mouse femoral artery is approximately 200 microns in diameter and, conventionally, is anastomosed via a technically challenging and time-consuming no-touch under-water suturing technique. in contrast, the apc1 hydrogel is designed for facile administration directly to the in situ vessel to distend the lumen and add stability to the vessel wall. this should enable more precise and quick placement of stitches, resulting in increased vessel patency. in this model, an incision is made in the groin crease of mice to expose the femoral artery, which is dissected and subsequently clamped, figure 5a. optical coherence tomography (oct) of the vessel cross-section shows that the lumen is collapsed, figure 5b. without the aid of a stent or luminal filler an intraluminal injection of a 2 wt% apc1 hydrogel was administered by syringe to both severed ends of the vessel, distending the lumen (figure 5c) and mechanically supporting the vessel wall after injection, figure 5d. a longitudinal cross-section oct image of the proximal (left) and distal (right) ends of the vessels after injection with the apc1 hydrogel is shown in figure 5e. vascular distention caused by the gel helped maintain a cylindrical vessel shape, facilitating identification of a single vessel wall leading to more uniform suture spacing and closure. further, hydrogel can be applied between the vessels, aiding their approximation (see video s1). vessel ends can be inserted into the gel, where local thinning occurs proximal to the vessels during their movement within the gel. the needle can be passed directly through the optically clear gel to place the sutures. upon placement of the final suture, the external gel is washed away, and the vessel is irradiated at the suture site for 2 minutes using a hand-held 365 nm led uv light to remove the interior gel. resumption of blood flow after removing the clamps clears the disrupted gel as evidenced by volume doppler oct (figure 5f) and blood flow speed measurements, figure s10. the efficacy of the final gel-sol phase transition is critical since remaining solid material could lead to thrombus formation, diminished perfusion and tissue ischemia. thus, vessel patency was assessed in a series of experiments that monitor vascular perfusion. first, high-resolution micro-ct was used to follow the perfusion of a polymeric contrast agent (microfil) one hour after gel-based end-to-end anastomosis of the femoral artery and resumption of blood flow. figure 6a-c and video s2 show that polymer completely fills the distal tibial and fibular vessels as well as the plantar arch on the footpad and the digital branches to the toes. separate experiments in which animals were dissected to directly observe polymer distribution support the ct data (figure 6d-f), confirming occlusion free vascular patency throughout the entire extremity that is similar to the contralateral control limb. lastly, perfusion of a near-infrared dye was followed throughout an explanted hind limb after irradiating a gel that had been implanted into the femoral artery, figure 6g-i. the leading edge of the dye (green arrow) immediately penetrates the limb from its initial injection site (yellow arrow), quickly penetrating another major vessel (white arrow, h) and distant vascular regions and surrounding tissue (i). taken together, these experiments indicate that the peripheral vascular and capillary bed is well perfused without any evidence of luminal narrowing or occlusion due to gel remnants. we also investigated gel biocompatibility, where histology shows a similar peri-vascular inflammatory response in vessels anastomosed with or without gel, a result of surgical tissue traumatization and post-operative healing, figure s11. further, subcutaneously injected gel produced no gross local inflammation and a typical foreign-body response that resolved, figure s12. designing soft materials from self-assembling peptides allows their bulk properties to be engineered at the molecular level for specific applications. physical attributes endeared to the peptide monomer are translated to the properties of the self-assembled gel network. the multiple phase transitions of apc1, which enable its use in facilitating the anastomosis of ultra-small vessels, are due to the exact placement of natural and non-natural amino acids within its sequence that render the peptide, and its corresponding gel, responsive to environmental change. thus, de novo peptide design can afford a self-assembled material that represents a promising alternative to currently available non-injectable stents. general methods describing the synthesis and analytical characterization of the photocaged glutamic acid and all peptides, as well as detailed procedures for all of the experiments employed in this study (including the number of animals used and replicates) can be found in the supplementary information in the online version of the paper. the supplementary information also contains afm, additional rheological studies, histological analysis, and videos showing the gel-aided anastomosis and three-dimensional reconstruction of hind-limb vasculature.

many surgeries are complicated by the need to anastomose, or reconnect, micron-scale vessels. although suturing remains the gold standard for anastomosing vessels, it is difficult to place sutures correctly through collapsed lumen, making the procedure prone to failure. here, we report a multi-phase transitioning peptide hydrogel that can be injected into the lumen of vessels to facilitate suturing. the peptide, which contains a photocaged glutamic acid, forms a solid-like gel in a syringe and can be shear-thin delivered to the lumen of collapsed vessels (where it distends the vessel), and the space between two vessels (where it is used to approximate the vessel ends). suturing is performed directly through the gel. light is used to initiate the final gel-sol phase transition that disrupts the hydrogel network, allowing the gel to be removed and blood flow to resume. this gel adds a new tool to the armamentarium for micro- and supermicrosurgical procedures.

PMC4706483

pubmed-1188

cognition is defined as information processing in one s brain and ability to judge and make decisions, and it covers various concepts such as attention, memory, executive planning, insight, and problem solving1, 2. for normal cognitive function, the integration of sensory information, visual perception, and language ability is required first, and loss of attention and of memory impair cognitive function, such as problem solving and reasoning ability3. in rehabilitation training program, the adaptive approach, which focuses on recovery of damaged cognitive function in the brain, is one of the common approaches in cognitive rehabilitation. it is based on the theory that neuroplasticity reorganizes the damaged cerebral cortex, and it focuses on recovery of the damaged cognitive function and minimizing the effects of the damage4. as a method of functional brain imaging for brain wave testing, many different innovative methods of radiological examination including the electroencephalogram, positron emission tomography, magnetic resonance imaging, functional magnetic resonance imaging, and single-photon emission computerized tomography have been used, and these methods can be used to confirm the brain s functional changes by comparison with normal brains5. compared with other experimental brain imaging methods, brain wave measurement is a commonly used as a noninvasive method for analyzing the changes in brain functions directly within a short period of time, and providing a variety of useful information with data from a short examination6. it is also an electronic neurophysiological experiment method that can be used to investigate the brain s functional status in real-time while focusing on a specific assignment. this is applicable to various patients suffering from brain damage, alcoholism, and/or depression, and it can be used to analyze brain functions objectively. it makes it especially easy to observe the process of spatiotemporal changes, and therefore, it is very useful for measuring cognitive load in real time7. neurofeedback (nfb) brain wave training based on the principle of brain plasticity is a relatively novel method for cognitive rehabilitation. this method involves training to adjust brain waves within a specific range, and the optimum brain wave adjustment improves the level of awakening and affects various functional elements of the patient. therefore, understanding brain waves should be among the highest research priorities8, 9. the beta wave improves concentration and reaction time when activated with a brain wave between 1235 hz. through beta wave activation, nfb training aims to improve cerebral function by enabling patients to activate this brain wave by reinforcing or suppressing certain frequencies based on visual and auditory feedback7, 10. previous research has shown that nfb is effective in improving cognitive functions including visual perception, memory, and concentration in patients with brain injuries, such as traumatic brain injury or stroke11, 12. however, research on cognitive rehabilitation through nfb on existing stroke patients has been limited to single case studies, and sufficient studies on its effectiveness and clinical usability have not been conducted. this study investigated the changes of a brain wave and visual perception following nfb and the manner in which these changes affect daily life in stoke patients. also, we aimed to indicate the effective therapeutic method to clinicians engaged in the cognitive rehabilitation of patients with stroke. the participants were recruited from among 28 stroke patients who received occupational and physical therapy and were hospitalized at a general hospital in kyeongki province, republic of korea, from june to july 2013. participant selection criteria included that the patient should be hemiparalytic from a stroke within the previous 3 months to 1 year, be able to follow verbal instructions, and be able to communicate at a certain level. in addition, participants were chosen from among patients who were able to perform all the tests and had experienced light cognitive function failure that was scored between 18 and 23 on the mini-mental state examination (mmse). a subject was eliminated if he/she had diplegia, never attended a school, was biased, or had experienced nfb within the past year. furthermore, all subjects who participated in this trial provided a signed written consent form after having the expected result and the side effects fully explained. a total of 27 subjects eventually completed the intervention and testing: 13 from the nfb group and 14 from the control group. nfb training was conducted over a period of 6 weeks, considering the hospitalization period. as the participants were recruited successively, the training was conducted over a 9-week period. the control group received occupational and physical therapy for half an hour 5 times a week for 6 weeks. the nfb group received the same number of traditional rehabilitation sessions as the control group with extra nfb training, respectively, for half an hour 5 times a week for 6 weeks. all of the protocols used in this study were approved by sahmyook university. before participation, the procedures, risks, and benefits were explained to all of the participants, who gave their informed consent. the participants rights were protected according to the guidelines of sahmyook university. to perform the nfb training, a neurocomp system (neurocybernetics inc., encino, ca, usa), composed of a repeater, a monitor for the clinician and the patient, computer, electroencephalography (eeg) sensor, cables, and poles, was used for nfb. the poles used in nfb training were attached to the scalp, and data were recorded on an oscillograph. the location of the poles followed the international 1020 electrode system, and the distance between each pole was 1020% of the whole circumference5, 13. the nfb training method used in this research was a beta-smr training method and was conducted with the patient s eyes open. the reward brain wave was set with either an smr wave (1215 hz) or mid-beta wave (1518 hz) depending on the location of the cerebral cortex. the inhibitory brain wave was set with both a delta wave (0.54 hz) and high-beta wave (2236 hz)7, 8, 12. the training time for a single trial was set at 30 minutes, during which a 3-minute training module was conducted 10 times. for monopolar type training, a pole or nfb sensor was attached to a certain part of the scalp (c5 or c6) within the lesion area, and the remaining 2 poles were attached to both ears with the participant seated on a comfortable chair. we used 4 games that had a low level of difficulty and were intriguing including space race, mazes, island, and boxlight. participants played the games by watching the monitor with the poles attached, and his/her awakening level was controlled. for the space race game, the spaceship was set to move forward and backward depending on his/her level of brain wave activation. a quantitative analysis of the brain wave data was performed using the complexity 2.0 software (laxtha inc., checked for any artifact inflow, and data for 180 seconds obtained from pattern observation with the nfb system from the raw data of the measured brain excluding the first 10 seconds-were used for the analysis. since delta waves between the 0.54 hz are likely to be contaminated with noise such as eye blinking (24 hz) and head movement due to an unstable body position (0.51 hz), the range of 450 hz from the entire brain wave domain was also extracted for the analysis. the fast fourier transform (fft) filtering method was conducted to convert the raw data into frequencies. the x axis represents the frequency and y axis represents the power value, which shows spectral analysis of evoked potentials in brain. the output value is the absolute band power, which is the square of the signal amplitude. the relative band power is the absolute power ratio of a particular frequency band on values of absolute band power between 0 and 1, and could be in percentage (0100%). this relative band power analysis was used to adjust for the difference in skull thickness between test subjects and individual brain waves due to the degree of tension during measurement. the motor-free visual perception test (mvpt) was used for visual perception evaluation. it contains a total of 36 items with four multiple-choice response options worth 1 point each, adding up to a maximum score of 36. the mvpt is a standardized evaluation tool for individuals 1880 years of age and measures six different parts of visual perception functions. there are 5 items for visual discrimination (vd), 5 items for form constancy (fc), 8 items for visual memory (vm), 11 items for visual closure (vc), and 4 items for spatial relation (sr). moreover, the processing time to complete each item is measured for all items (35 items) except for item 4. the mvpt can be used on patients with damaged physical function who have difficulty with writing, and the confidence level of test-retest reliability for the mvpt r=0.770.8315. the differences in the brain wave and visual perception within a group before and after the treatments were tested using the paired t-test, whereas differences between groups were tested using the independent t-test. for all data, the general characteristics of participants are shown in table 1table 1.general characteristics of the subjectsnfbcongender (male/female)8/511/3age (years)62.97.263.69.3lesion side (right/left)9/48/5duration (months)10.63.212.52.7mmse (score)19.82.520.53.7all variables are presented as the meansd. nfb: neurofeedback training group; con: control group; mmse: mini-mental state examination. the brain wave values and visual perception changes before and after nfb training are shown in table 2table 2.comparison of brain waves and mvpt in each groupitemsubtestnfbconprepostprepostbrain waverelative beta wave*11.324.5215.455.51*8.583.8011.327.37(%)relative mid-beta wave2.171.022.811.32**1.530.612.171.61relative high beta wave*4.221.716.082.03*3.371.904.433.60acq*(hz)0.20850.07770.34170.25230.19170.04510.29220.2976mvptraw score***20.764.3423.464.48**24.005.4325.215.17**(score)vd5.691.647.150.89**5.851.796.001.70fc2.530.963.150.80*3.211.053.640.84*vm4.301.794.691.93**5.351.445.501.45vc6.001.776.691.75**6.571.606.921.89sr2.231.012.690.85**3.001.173.140.86time (second)*7.761.316.991.38***7.222.066.872.07**all variables are presented as meansd.*nfb: neurofeedback training group; con: control group; acq: attention concentration quotient; mvpt: motor-free visual perception test; vd: visual discrimination; fc: form constancy; vm: visual memory; vc: visual closure; sr: spatial relation; time: visual perceptual processing time. brain wave measurement before and after nfb training revealed a statistically significant difference for the nfb group s relative beta wave value and attention concentration quotient (acq) (p<0.05). comparison of the difference before and after the interventions between the two groups revealed that the nfb group s relative wave values and acqs were significantly different (p<0.05). for the nfb group, there were differences in vd, fc, vm, vc, and sr before and after the experiment. comparison of the differences before and after the interventions between the two groups revealed significant differences in mvpt raw score and processing time (p<0.05). nfb: neurofeedback training group; con: control group; mmse: mini-mental state examination all variables are presented as meansd.*p<0.05;** p<0.01;***p<0.001. nfb: neurofeedback training group; con: control group; acq: attention concentration quotient; mvpt: motor-free visual perception test; vd: visual discrimination; fc: form constancy; vm: visual memory; vc: visual closure; sr: spatial relation; time: visual perceptual processing time nfb is developing along with technical development of quantitative eeg, computer devices, and individual medical protocols. while performing assignments that require more attention than in a steady state, alpha waves are controlled and beta waves are increased; vitalization of beta wave reflects cognitive function improvement14, 16. the smr waves in beta waves were found to be in an appropriately steady state and to maintain attention and wakefulness. promotion of smr wave activity is also used in a treatment to relieve impulsivity and involuntary movements17. smr-beta wave training is an effective interventional approach for treatment of attention and cognitive impairment, whereas nfb training supports and improves the neurophysiological function level. performance of eeg before and after nfb training revealed statistically significant differences in the nfb group s relative beta wave value and acq (p<0.05). comparison of the differences before and after the interventions between the two groups revealed significant differences in the nfb group s relative beta wave values and acqs compared with the control group (p<0.05). relative beta wave value went up when attention increased, and acq reflects improvements in attention. the results of this study indicate that the increased relative beta wave value and aco resulted in significant improvement compared with the control group. lopez-larraz et al.18 reported that nfb increased cognitive ability and concentration for various diseases, and gevensleben et al.19 claimed that nfb using the beta wave is effective for improvement of concentration, although their research was performed with adhd patients. in this study, we observed that nfb led to notable differences in attention and concentration after the intervention. this difference may have been due to the neurobiological reaction to nfb, which affects the beta wave and the concentration brain waves. thus, nfb would be a prevailing choice for patients who require attention and concentration training. visual perception is a process in which the central nervous system integrates visual information to adapt to the environment and converts the information to cognitive concepts for decision-making. this process has a hierarchical structure consisting of oculomotor control, visual fields, visual acuity, visual attention, visual scanning, pattern recognition, and visual memory, and the highest visual percptual process in the hierarchy is visual cognition2. through training of visual scanning, visuospatial orientation, and visual judgment, the damaged visual perception functions of stroke patients can be improved to enhance recognition ability and activities of daily living. regarding visual perception before and after nfb, both the nfb group and control group showed statistically significant differences in mvpt raw score and processing time. for the nfb group, there were differences in vd, fc, vm, vc, and sr before and after the intervention. comparison of the differences between the two groups revealed significant differences in the mvpt raw score and processing time (p<0.05). nfb training was found to be more effective in changing visual perception change compared with traditional rehabilitation training (p<0.05). the nfb program is considered to have been more effective in improving visual perception ability because the training was on watching and focusing with the eyes. more research into the development of an attention and concentration training program that fits the rehabilitation purpose of not only stroke patients but also patients with other illnesses is necessary. in addition, post-test check-ups should be performed to determine how long the changes last. standardized and more elaborate eeg measurement and analysis are required to provide sufficient evidence for neurofeedback brain wave training.

[ purpose] this study investigated a brain wave and visual perception changes in stroke subjects using neurofeedback (nfb) training. [subjects] twenty-seven stroke subjects were randomly allocated to the nfb (n=13) group and the control group (n=14). [methods] two expert therapists provided the nfb and con groups with traditional rehabilitation therapy in 30 thirst-minute sessions over the course of 6 weeks. nfb training was provided only to the nfb group. the con group received traditional rehabilitation therapy only. before and after the 6-week intervention, a brain wave test and motor free visual perception test (mvpt) were performed. [results] both groups showed significant differences in their relative beta wave values and attention concentration quotients. moreover, the nfb group showed a significant difference in mvpt visual discrimination, form constancy, visual memory, visual closure, spatial relation, raw score, and processing time. [conclusion] this study demonstrated that nfb training is more effective for increasing concentration and visual perception changes than traditional rehabilitation. in further studies, detailed and diverse investigations should be performed considering the number and characteristics of subjects, and the nfb training period.

PMC4395689

pubmed-1189

prolactinomas are pituitary adenomas that secrete prolactin. these represent the most common hormone-secreting adenomas occurring in the pituitary gland, accounting for around 40% of all clinically recognized pituitary adenomas. they are diagnosed more frequently in women than in men, especially between the ages of 20 and 40 years, because premenopausal women are sensitive to hypogonadism, which manifests as infertility and menstrual disorders, whereas postmenopausal women are already hypogonadal and men may ignore or not recognize symptoms of hypogonadism manifesting as decreased libido, impotence, or erectile dysfunction. moreover, galactorrhea is rare for both postmenopausal women and men (and is also relatively rarer than hypogonadism in premenopausal women), so symptoms due to tumor growth such as headache or visual field loss can represent chances for diagnosis in postmenopausal women or men. herein, we present the case of a 44-year-old nulliparous woman who had experienced irregular menstruation cycles for about 10 years and developed both pituitary prolactinoma and endometrioid endometrial carcinoma. in premenopausal women, hyperprolactinemia causes hypogonadism by inhibiting the secretion of gonadotropin-releasing hormone, which in turn suppresses luteinizing hormone levels and can cause menstrual disorders ranging from amenorrhea, oligomenorrhea and chronic anovulatory cycle to short luteal phases of the menstrual cycle [35]. chronic anovulatory menstrual cycle is the most common cause of long-term exposure of the endometrium to endogenous estrogen without adequate opposition from progestins, which can lead to endometrioid endometrial carcinoma [6, 7]. thus, in this case, pituitary prolactinoma may have caused the chronic anovulatory cycle and indirectly led to the development of endometrioid endometrial carcinoma. a nulliparous 44-year-old woman with a 10-year history of irregular menstrual cycles presented with massive abnormal uterine bleeding, shortness of breath, and exhaustion. she had experienced abnormal uterine bleeding for about 1 year, and it had increased over the previous 10 days. she had no past illnesses of note, including no history of hypertension or glucose intolerance, and no special history of taking pharmacotherapies. on presentation, she was obese with a height of 152 cm and weighing 73.0 kg. vital signs were stable, with: blood pressure, 152/96 mm hg; heart rate, 88 beats/min; axillary temperature, 100.2f; and oxygen saturation by pulse oximetry, 99% (room air). general physical examination revealed hirsutism without any other signs of androgen excess such as acne, male pattern baldness, or lowering of the voice, and there was no evidence of galactorrhea. gynecological examination revealed an almost normal-sized uterus, impalpable bilateral adnexa, and unremarkable vagina and vulva. ultrasonographic examination and magnetic resonance imaging (mri) showed thickening of the endometrium and collapse of the junctional zone. both ovaries appeared normal and no fluid was evident in the pelvic cavity (fig. surgical resection was planned for the endometrial carcinoma. while waiting for the operation, correction of anemia by iron supplementation and exploration of the reasons for irregular menstruation endocrinological survey yielded the following results: serum prolactin, 243.8 ng/ml (institutional normal range, 4.128.6); luteinizing hormone, 2.0 miu/ml (follicular phase, 1.713.3); follicle-stimulating hormone, 7.2 miu/ml (follicular phase, 4.511.0); estradiol,<25.0 pg/ml (follicular phase, 40.7224.0); testosterone, 23 ng/dl (normal, 956); growth hormone, 0.05 ng/ml (normal, 0.281.64); adrenocorticotrophic hormone, 16.2 pg/ml (normal, 7.263.3); thyroid-stimulating hormone, 2.95 iu/ml (normal, 0.384.31). marked hyperprolactinemia led us to suspect pituitary prolactinoma, and mri of the hypophysis was therefore performed. t1-weighted mri showed an 8.4 7.8-mm tumor in the right anterior lobe of the hypophysis (fig. no evidence of headache or visual field loss was present, so surgery did not seem to be indicated for the pituitary prolactinoma. a few days later, total abdominal hysterectomy was performed with bilateral salpingo-oophorectomy and pelvic and para-aortic lymphadenectomy. histological examination confirmed grade 2, well- to moderately differentiated endometrioid endometrial carcinoma tumors with less than half myometrial invasion and without involvement of any other organs, including regional lymph nodes. during the 10 months of follow-up, serum prolactin levels have been stable at around 160 ng/ml, and no signs of recurrence of endometrial carcinoma have been present. the prognosis of advanced-stage endometrial carcinoma is still poor relative to early-stage carcinoma, although many improvements have been made in treatment modalities such as surgery, chemotherapy, radiotherapy and others in recent years. remembering risk factors for endometrial carcinoma, detecting patients in high-risk groups, and dealing properly with them, are thus important for catching early-stage patients and decreasing the morbidity and mortality rates of this life-threatening disease. in particular, in endometrioid endometrial carcinoma, which comprises about 80% of endometrial carcinomas, long-term exposure to excess estrogen unopposed by progestin is well known as the most important risk factor [7, 8]. chronic anovulatory menstrual cycle remains the most common cause of long-term, unopposed exposure of the endometrium to endogenous estrogen [6, 7]. many endocrinological disorders cause ovulatory disorders, with polycystic ovary syndrome (pcos) as the most representative. because the patient was obese with hirsutism, the ovulatory disorder was initially attributed to pcos. although the causes of hyperprolactinemia vary widely, marked hyperprolactinemia over 200250 ng/ml is usually due to pituitary prolactinoma or pregnancy, and this was also evident in the present patient. in premenopausal women, hyperprolactinemia causes hypogonadism by inhibiting secretion of gonadotropin-releasing hormone followed by suppression of luteinizing hormone levels and can cause menstrual disorders ranging from amenorrhea, oligomenorrhea and chronic anovulatory cycle to short luteal phases of the menstrual cycle. as mentioned above, chronic anovulatory cycle can be a risk factor for endometrioid endometrial carcinoma, and this patient had a 10-year history of irregular menstruation. pituitary prolactinoma could thus have indirectly resulted in endometrioid endometrial carcinoma through chronic anovulatory cycle in this case. indeed, some anecdotal evidence from similar cases suggests a relationship between hyperprolactinemia and endometrioid carcinoma [1012]. in this case, obesity could also have been a cause of ovulatory disorder, in addition to pituitary prolactinoma. obesity is thought to have various carcinogenic effects other than ovulatory disorder for endometrial carcinoma. however, cases of endometrial carcinoma correlating with hyperprolactinemia have involved younger patients compared to the more common obese cases without hyperprolactinemia [10, 12]. pituitary prolactinoma could thus have been more important than obesity as a cause of carcinoma in this case. one apparent inconsistency is that plasma estrogen concentrations on presentation were subnormal, while estrogen exposure is theoretically needed for carcinogenesis. actually, we do not have any information about her hormone levels (including prolactin) prior to her presentation to our hospital, after irregular menstruation had been ongoing for a long period. however, some studies have proposed that increased plasma estrogen concentration is not important for carcinogenesis; rather, long-term exposure to low concentrations of estrogen unopposed by progesterone (that is, under conditions of progesterone deficiency) plays an essential role [6, 7, 11]. another area of uncertainty involves the direct effect of prolactin on the endometrium, rather than the indirect effect mentioned above. although some studies have reported that serum concentrations of prolactin are significantly elevated in patients with endometrial carcinoma compared to healthy individuals [13, 14] and that prolactin receptors are expressed in both normal endometrial and carcinoma tissue [14, 15], the direct effects of prolactin on the endometrium, in terms of proliferative or differentiative effects, remain unclear. the utility of correcting hyperprolactinemia using dopamine agonists for the purpose of preventing the development of endometrial carcinoma has yet to be determined. in the present case, levels of serum prolactin have remained stable and no evidence of recurrent endometrial carcinoma has been identified during follow-up. in conclusion, hyperprolactinemia indirectly induces endometrioid endometrial carcinoma after causing chronic anovulation. in patients with irregular menstruation and chronic anovulation that may be attributable to hyperprolactinemia, exploration of both the hypophysis and endometrium

we present the case of a 44-year-old nulliparous woman who experienced irregular menstrual cycles for about 10 years and developed both pituitary prolactinoma and endometrioid endometrial carcinoma. in premenopausal women, hyperprolactinemia causes hypogonadism by inhibiting secretion of gonadotropin-releasing hormone and thus suppressing luteinizing hormone levels, which can cause menstrual disorders ranging from amenorrhea, oligomenorrhea and chronic anovulatory cycle to short luteal phase of the menstrual cycle. a chronic anovulatory menstrual cycle is the most common cause of long-term exposure of the endometrium to endogenous estrogen without adequate opposition from progestins, which can lead to endometrioid endometrial carcinoma. in this case, pituitary prolactinoma may have caused the chronic anovulatory cycle and indirectly led to the endometrioid endometrial carcinoma. in patients for whom the cause of irregular menstruation and chronic anovulatory cycle is suspected to be hyperprolactinemia, explorations of both the hypophysis and endometrium are essential.

PMC3573812

pubmed-1190

disrupted in schizophrenia 1 (disc1) was initially discovered at the breakpoint in a balanced chromosomal translocation t (1; 11) segregating with major mental conditions, such as schizophrenia, bipolar disorder, and major depression in a scottish pedigree (millar et al., 2000). since then, accumulating evidence from genetic studies indicated that disc1 is not only associated with schizophrenia and mood disorders, but also other psychiatric disorders of neurodevelopmental origin, such as autism, asperger syndrome, and agenesis of the corpus callosum (hennah et al., 2003; hodgkinson et al., 2004; callicott et al., 2005; kilpinen et al., 2008; song et al., 2008, 2010; although recent genome wide association studies (gwas) have not found disc1 as a key genetic risk factor for patients met the current diagnostic criteria for schizophrenia (purcell et al., 2009; stefansson et al., 2009; mathieson et al., 2011), it is noted that variations of disc1 influence anatomical and functional endophenotypes even in control subjects (thomson et al., 2005; di giorgio et al., 2008; prata et al collectively, genetic variation of disc1 may confer vulnerabilities to a wide range of neurodevelopmental psychiatric conditions by affecting brain maturation, thereby modifying brain function. consistently, extensive biological studies indicate that disc1 plays a role in multiple cellular processes during and after brain development (chubb et al., 2008; brandon and sawa, 2011). in fact, many protein binding partners of disc1 are associated with various molecular pathways that regulate fundamental cellular processes for brain development and function (table 1). nonetheless, it is still unknown which functional aspects of disc1 directly affect molecular mechanisms underlying disease susceptibility. how can we utilize accumulating biological data of disc1 to discover novel therapeutic targets and biological markers for major mental conditions? here, we will review disc1-associated molecular pathways which have the potential to be novel therapeutic targets, with particular focus on well documented disc1 pathways involved in cerebral cortex development and function (figure 1). we will also discuss the potential link of disc1 pathways and environmental factors, such as immune/inflammatory responses, to explore therapeutic interventions based on understanding disease mechanisms of genetic and environmental interaction. disc1 may function as an anchoring molecule to regulate various molecular pathways via interaction with said protein interactors in a context dependent manner. various disc1-mediated pathways with many binding partners and environmental factors synergistically affect proper cerebral cortex development and function. for reviews of the other disc1 interactors, disrupted in schizophrenia 1 plays a critical role for the regulation of cell proliferation in the developing cerebral cortex via the canonical wnt signaling pathway (mao et al., 2009). the data suggested that disc1 inhibits the activity of glycogen synthase kinase 3 beta (gsk3) via protein interaction, thereby stabilizing -catenin which is required for proper progenitor proliferation through wnt pathway. the same group later reported that dix domain containing-1 (dixdc1), a homolog of the wnt signaling genes disheveled axin, interacts with disc1 to co-modulate gsk3/-catenin signaling for proper cell proliferation (singh et al., 2010). accumulating evidences have shown that gsk3 signaling may be involved in various neuropsychiatric disorders, such as schizophrenia, autism, and alzheimer s disease, suggesting that gsk3 appears as a prominent therapeutic target for mental disorders (bachmann et al. in fact, lithium, the mood stabilizer which is commonly used for the treatment of bipolar disorder, is known to inhibit gsk3 activity (stambolic et al., 1996). the other psychoactive drugs, such as clozapine, risperidone, and valproic acid, have also been reported to affect gsk3 activity (stambolic et al., 1996; kang et al., 2004; li et al., 2007; rowe et al., 2007). nonetheless, since gsk3 regulates various downstream effectors, which are not only implicated in the wnt pathway, but also other signaling required for cellular development, such as sonic hedgehog and notch signaling pathways (hur and zhou, 2010), it is important to examine specific gsk3-mediated pathways relevant to disease mechanisms to find novel therapeutic strategies. in this regard, it may be ideal to focus on disc1-mediated gsk3 pathways, especially those in association with other genetic risk factors, to explore disease-associated molecular mechanisms. for instance, collapsin response mediator protein-2 (crmp-2)/dihydropyrimidinase-like-2 (dpysl2), a susceptibility gene for schizophrenia (nakata et al., 2003), is reported to be a potential protein interactor of disc1 by yeast-two-hybrid screening (camargo et al., 2007). interestingly, crmp-2/dpysl2 is known to be phosphorylated by gsk3 for the regulation of axon outgrowth (yoshimura et al., 2005). many groups have consistently reported that knockdown of disc1 using rna interference (rnai) impaired radial neuronal migration in the developing cerebral cortex (kamiya et al., 2005, 2008 ;, 2010; singh et al., 2010; young-pearse et al., 2010; ishizuka et al., findings from these studies suggest that disc1, along with many protein binding partners, regulate neuronal migration via centrosome and microtubule-dependent mechanisms. of note, some of these binding partners are known as risk or causative genes for various neuropsychiatric disorders. these include nuclear distribution element-like (ndel1) and pericentriolar material 1 (pcm1), risk genes for schizophrenia, and bbs4, a causative gene for bardet biedl syndrome that frequently accompanies impaired cognition, mental retardation, and psychosis (burdick et al., 2008; kamiya et al., 2008; amyloid precursor protein (app) also interacts with disc1 to recruit disc1 to the centrosome for regulation of neuronal migration (young-pearse et al., 2010). furthermore, disc1 is a component of the lis1/dynein motor complex (kamiya et al., 2005). mutations in human lis1 gene cause classical lissencephaly resulting in mental retardation (pilz et al., 1998). consistently, lis1 heterozygous knockout mice in which lis1 expression is reduced, display disorganization of proper cortical layer formation and behavioral abnormalities, such as impaired spatial learning and motor function, indicating that this is a good animal model for human lissencephaly caused by lis1 haploinsufficiency (hirotsune et al., 1998). interestingly, the prenatal administration of alln, a calpain inhibitor which prevents the degradation of lis1, is effective to ameliorate neuronal migration defect and improve motor coordination in this animal model (yamada et al., 2009). although mental disorders undoubtedly have genetic complexities and could not be explained by the simple haploinsufficiency model as the case of lissencephaly, elucidation of risk genes, and/or molecules in their interactome, specifically ones with enzymatic activity, may offer hope for novel treatment interventions for neuropsychiatric disorders. in this regard, endo-oligopeptidase activity of ndel1 is quite interesting from a drug discovery viewpoint (hayashi et al., 2005). as a matter of fact, inhibitors of angiotensin-converting enzyme (ace), an exopeptidase, are currently being used to treat hypertension and renal disease (izzo and weir, 2011), making peptidase activity an attractive drug target. although endogenous substrates for ndel1-oligopeptidase in brain development remain unknown, in vitro experiments identified several oligopeptides, such as neurotensin and bradykinin, as potential targets for ndel1 (camargo et al., 1983). interestingly, neurotensin has a modulatory effect on neurotransmitter systems, including dopaminergic neurons, which may be involved in the pathophysiologies of schizophrenia (boules et al., 2007). posttranslational modifications, which affect the functional diversity of target proteins, could also have potential as novel drug targets and biological markers in the disc1 pathways. we have recently reported that phosphorylation of disc1 at serine 710 is a molecular switch signaling from cell proliferation to neuronal migration in the developing cerebral cortex (ishizuka et al., 2011). by utilizing in utero electroporation, this study has shown that a phosphor-dead mutant disc1 can rescue only the proliferation defect elicited by disc1 knockdown, whereas a phosphor-mimic mutant of disc1 can exclusively recover impaired migration. the question arises whether the phosphorylation of disc1 at serine 710 may be involved in the pathophysiologies of major mental disorders, such as schizophrenia. it is obviously impractical to investigate the phosphorylation status of disc1 in the developing human brain from subjects at risk of developing schizophrenia. nonetheless, recent progress in induced pluripotent stem (ips) cell technology will open new avenues to characterize such findings from preclinical studies using patient-derived neuronal cells, which might in turn identify biological markers for major mental disorders. disrupted in schizophrenia 1 impacts upon brain development may be a challenge for treatment intervention. however, synaptic deficits revealed by the disc1 pathway offer some potential for development of targeted pharmacologic intervention. subsequent findings underline roles for disc1 in regulating dendritic spines of the glutamate synapse (hayashi-takagi et al., 2010). rac1 is activated by karilin-7, leading to increased spine size following nmda glutamate receptor activation. however, disc1 appears to interact with karilin-7, preventing access to and activation of rac1 until nmda receptor activation promotes release of kal-7 and spine enlargement. pharmacologic tools to modulate the karilin-7/disc1 interaction might be a means to regulate spine maintenance. traf2- and nck-interacting kinase (tnik) represents another potential pharmacological target in the disc1 protein interaction network. tnik is found in postsynaptic densities and regulates c-jun kinase, the actin cytoskeleton and a number of wnt pathway effectors (fu et al., 1999; genetic association studies have found single-nucleotide polymorphisms of tnik associated with schizophrenia (potkin et al., 2009; shi et al., 2009). tnik mrna expression was increased in the dorsolateral prefrontal cortex of schizophrenia subjects (glatt et al., 2005) and in lymphoblasts of monozygotic twins discordant for bipolar disorder (matigian et al., 2007). a yeast-two-hybrid screen using disc1 as bait identified tnik as an interactor (camargo et al., 2007). subsequently, tnik and disc1 were shown to interact in mouse brain (wang et al., 2011). disc1 was found to inhibit the kinase activity of tnik, an action that could be reproduced by a small peptide derived from the disc1 interaction site. this disc1 peptide led to increased actin polymerization and decreased expression of a number of postsynaptic density proteins, including psd95, stargazin, ampa receptor subunit glur1 and tnik, itself (wang et al., 2011). microbial infections have been recognized as environmental factors responsible for the increased incidence of schizophrenia and associated disorders (brown and derkits, 2010; sham et al., 1992; torrey and yolken, 2003). these reports have been supported by the epidemiological findings of an association between elevated cytokines in maternal serum and schizophrenia in the offspring (delisi and wyatt, 1982; patterson, 2007; miller et al., 2009). subsequently, it has been demonstrated that it is the maternal immune response to a microbe that may contribute to the increased risk of schizophrenia. the role of cytokines in innate immune response makes them promising candidates for studying their functions in disruption of fetal brain development in vulnerable individuals (dantzer et al., 2008). most studies with prenatal immune activation have thus far used wild-type mice and rats. however, recently, there have been several reports on developing and characterizing animal models based on combining prenatal immune activation with genetic mutations relevant to schizophrenia (ibi et al., 2010; ehninger et al., we have been studying possible roles for disc1 in modulation of poly i: c-induced immune activation in pregnant mice to mimic prenatal in utero exposure to viruses as a model of gene environment interactions relevant to schizophrenia (abazyan et al., our findings have suggested that disc1 may be involved in mediating neuroimmune interplay in this mouse model. given the extended interactome of disc1, it is not surprising that this protein is at the crossroads of the signaling transduction pathways activated by immune factors. one can envision multiple interactions between the pathways impacted by mutant disc1 and activated by cytokines and/or bacterial lipopolysaccharide (lps) and poly i: c itself via cytokine receptors or toll-like receptors (tlr) expressed by neurons or glia cells, respectively. one of the major common pathways is the phosphoinositide-3 kinase/akt-signaling network (pi3k/akt) that is activated by cytokines and poly ic and has been demonstrated to interact with disc1 partners (camargo et al., 2007). another example is interactions with gsk3, a key regulator of the host inflammatory response and the production of pro- and anti-inflammatory cytokines (hayden et al., 2006). as described above, disc1 inhibits gsk3 activity through a direct interaction (mao et al., 2009). we also found altered poly i: c-induced phosphorylation of gsk3 in mutant disc1 newborn mice that might at least in part explain altered basal and poly i: c-induced production of cytokines in fetal brains and resultant affective behaviors in adult offspring (abazyan et al., 2010). these observations are consistent with an emerging role for gsk3 in inflammation-associated depression and anxiety (jope, 2011). many immune effects of gsk3 are related to its regulation of critical transcription factors, including nuclear factor kappa-light-chain-enhancer of activated b cells (nf-b; hayden et al., 2006). a family of tlrs acts as primary sensors that detect a wide variety of microbial components and elicit innate immune responses. all tlr signaling pathways culminate in activation of nf-b, which controls the expression of an array of inflammatory cytokine genes. stimulation with tlr ligands triggers the rapid phosphorylation of specific serine residues of inhibitor of b (ib) proteins by the ib kinase (ikk) complex. phosphorylated ib proteins are subsequently polyubiquitinated and degraded, allowing nf-b to move into the nucleus. this so-called canonical pathway is involved in tlr-mediated induction of inflammatory cytokines such as tumor necrosis factor- (tnf-) and interleukin-6 (il-6; hayden et al., prior studies with disc1 have demonstrated that disc1, particularly a nuclear isoform of the protein, can play an important role in regulation of transcription activity in the nucleus (sawamura et al., 2008). we found that expression of mutant disc1 in n2 a neuronal cells led to delaying a recovery of ib after tnf--induced phosphorylation and ubiquitination of ib. this prolonged degradation due to expression of mutant disc1 seems to suggest that perturbation in functions of disc1 could also affect (e.g., stimulate) pro-inflammatory signaling transduction cascades in neurons. in addition to immune signaling pathways, disc1 and perhaps other candidate genes can play a significant role in the cellular processes utilized by microbes during their life cycles (carter, 2009). it has been proposed that the involvement of disc1 in the control of the microtubule network might be important both in viral traffic and in the rerouting of microtubules to the vacuoles formed by t. gondii (carter, 2009). recent clinical trials of anti-inflammatory add-on therapy in schizophrenia have demonstrated superior beneficial treatment effects when antipsychotics were co-administered with anti-inflammatory compounds, as compared with treatment outcomes using antipsychotics alone (meyer et al., 2011). however, a broad non-specific anti-inflammatory or immunosuppressive treatments that may have several unwanted effects such as increased sensitivity to infections (meyer et al., 2011). ultimately, future therapeutic approaches will result from deciphering intracellular pathways that underlie convergence of environmental influences and genetic predisposition and their influence on neurodevelopmental processes. disrupted in schizophrenia 1-mediated pathways play multiple roles for critical cellular processes through many protein binding partners in a context dependent manner. nonetheless, it is still unknown which functional aspect of disc1 directly affects molecular mechanisms underlying disease susceptibility. are all disc1 functions in such cellular events implicated in disease processes or are only some specific functional aspects critical? this is a tremendously difficult question, because the molecular disposition of disc1 is complex as reflected by multiple isoforms at both mrna and protein levels (ishizuka et al., 2006 nonetheless, biological functions of disc1 are currently being explored without waiting for the complete identification of disc1 isoforms, resulting in the identification of multiple roles of disc1 in various functional contexts. in fact, in addition to the roles in cerebral cortex we reviewed here, disc1 also contributes to brain development and function in other brain regions, such as hippocampal regions (enomoto et al., 2009; kim et al., 2009; meyer and morris, 2009). further investigations with advanced genetic engineering techniques, which allow us to dissect region and cell type-specific disc1 functions in a temporal manner, might contribute to more clearly elucidate disc1 functions relevant to psychiatric disorders. as complete functional recovery is unlikely for neurodevelopmental disorders, such as schizophrenia, developing preventive strategies is particularly important. indeed, if the findings on microbial etiologies and resultant immune dysfunction are replicated, simple public health measures may prove beneficial in diminishing the incidence of infections during pregnancy to prevent an appreciable proportion of schizophrenia cases. for example, influenza vaccination, improved hygiene to prevent t. gondii infection, and antibiotics to treat genital/reproductive infections are feasible strategies already employed (brown and derkits, 2010). the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

genetic risk factors for major psychiatric disorders play key roles in neurodevelopment. thus, exploring the molecular pathways of risk genes is important not only for understanding the molecular mechanisms underlying brain development, but also to decipher how genetic disturbances affect brain maturation and functioning relevant to major mental illnesses. during the last decade, there has been significant progress in determining the mechanisms whereby risk genes impact brain development. nonetheless, given that the majority of psychiatric disorders have etiological complexities encompassing multiple risk genes and environmental factors, the biological mechanisms of these diseases remain poorly understood. how can we move forward to our research for discovery of the biological markers and novel therapeutic targets for major mental disorders? here we review recent progress in the neurobiology of disrupted in schizophrenia 1 (disc1), a major risk gene for major mental disorders, with a particular focus on its roles in cerebral cortex development. convergent findings implicate disc1 as part of a large, multi-step pathway implicated in various cellular processes and signal transduction. we discuss links between the disc1 pathway and environmental factors, such as immune/inflammatory responses, which may suggest novel therapeutic targets. existing treatments for major mental disorders are hampered by a limited number of pharmacological targets. consequently, elucidation of the disc1 pathway, and its association with neuropsychiatric disorders, may offer hope for novel treatment interventions.

PMC3310233

pubmed-1191

multicystic dysplastic kidney (mcdk) is a relatively common developmental anomaly in infants and children, and its overall prognosis is good in older children. although mcdk is grossly " cystic " in appearance, it is not one of the inherited renal cystic diseases, but a kind of renal dysplasia, in which cystic elements are found along with immature, undifferentiated, primitive tissue (1). in contrast, a malignant rhabdoid tumor of the kidney (mrtk) is one of the most lethal neoplasms of early life, and the mortality rate exceeds 80% (2). mrtk usually arises from perihilar renal parenchyma and infiltrates into the medulla, renal sinus, and collecting system. the recurrence rate is high, and the tumor tends to metastasize to the lung, liver, and brain (2, 3). there have been some reports concerning mrtk and mcdk presenting individually and mcdk presenting with wilms tumor (4). however, a combined case of these two diseases has not been reported to date. therefore, the authors present a case of mrtk combined with mcdk in a 5-yr-old girl with a literature review. a 5-yr-old girl who was previously diagnosed with mcdk at birth by abdominal sonography presented with a huge palpable mass on the right side of her abdomen. no symptoms were noted until a huge mass was palpated two weeks prior to presentation. abdominal sonography and computed tomography (ct) were performed, and they revealed an increased cystic lesion extensively replacing the right kidney and a newly-developed amorphous portion in the cystic lesion, compared to the previous radiologic findings at birth (fig. the cut surface showed numerous cystic and semisolid masses in the cortex and medulla (fig. some of the neoplastic cells had eccentric nuclei and large, round, eosinophilic cytoplasmic inclusions. in the remaining parenchyma the tumor cells were non-cohesive, large, round-to-polygonal cells with vesicular nuclei and prominent nucleoli (fig. the immunohistochemical stains of the rhabdoid tumor cells were positive for cytokeratin, vimentin, ini1, and epithelial membrane antigen and negative for desmin and smooth muscle actin (fig. ultrastructurally, the tumor cells had poorly formed intercellular junctions, a fair amount of mitochondria, and were filled with lipid droplets (not shown). generally, kidney abnormalities are classified by quantity, location, morphology, differentiation, and genetic disorder. among them one in 4,300 live births is estimated to have unilateral mcdk (6), and few occur in syndromes of multiple malformations. in contrast, mrtk is a rare malignant tumor of the kidney, and it accounts for about 2-3% of kidney tumors (3). mrtk also tends to occur in young infants and is one of the most lethal neoplasms in early life (7). before 1981, investigators thought mrtk was a kind of wilms tumor; however, haas et al. they reviewed 111 cases of rhabdoid tumors of the kidney by analyzing microscopic findings, immunohistochemical stains, and electron microscopic findings of the cases. unlike with a wilms tumor, they found that some of the tumor cells originated from primitive cells. some investigators suggested that mrtk might originate from widely-distributed precursor cells or neuroepithelial cells (7). there has not been a report about a case of mcdk presenting concurrently with mrtk with an examination of the cause of their coexistence and their pathophysiology to date. embryologically, dysplastic kidney disease, which is induced by a metanephron abnormality, is irreversible, and the severity of disease and affected areas are varied (5). mcdk is a common disease in infants, yet the pathophysiology of mcdk is not well understood. one hypothesis is that mcdk results from an abnormal induction of the metanephric blastema by the ureteric bud (5). embryologically, mcdk may result from abnormal renal morphogenesis, likely due to abnormalities of developmentally expressed genes (1). until now, pax2, bcl2, and galectin-3 genes were thought to be related with the occurrence of mcdk, and chromosome t(6:19)(p21:q13.1) abnormality-induced cytogenetic change (8). those genes are associated with oncogenesis and their high level of expression can accelerate the proliferation of dysplastic cysts, which causes some patients ' multicystic dysplastic kidney to continue to propagate (8, 9). on the other hand, about 15% of mrtks they arise embryologically from the stromal cell, mesenchymal cell, neuroectodermal cell, or germ cell. it is reported that genetically 90% of rhabdoid tumors have a 22q11.2 chromosomal translocation, and a mutation or deletion of smarcb1, hsnf5/iml, and ddt1 genes (10). according the theory of pathogenesis, the two kinds of disease are probably related to stem cell mutation. distinctions should be made among mcdk, wilms tumor, mrtk with a cystic pattern, and other diseases affecting the kidney. the pathologic findings in this case revealed a typical mcdk that coincided with embryonic tubules, glomeruloid structures, and immature cartilage. in addition, immunohistochemical stains were positive for cytokeratin, epithelial membrane antigen, and vimentin, but negative for smooth muscle actin. therefore, it was diagnosed as mcdk coexistent with mrtk (11). by electron microscopy, tumor cells of usual cases of mrtk form sheetlike patterns, have poorly formed intercellular junctions, abundant mitochondria, and lipid droplets in the cytoplasm, especially prominent aggregates of filaments. however, in this case, the cytoplasm did not have prominent aggregates of filaments. therefore, the diagnosis of mrtk should be given only after thorough investigations by light microscopy, immunohistochemical stains, and electron microscopy. age is a highly significant prognostic factor, and the younger the patient, the better the prognosis. subjects older than five years are less responsive to chemotherapy, suggesting a poor prognosis (12). however, when the disease is combined with hypertension or a malignant tumor, the patient is more likely to have a poor prognosis (13). after being diagnosed with mcdk, the patient needs regular follow-up to ensure that the cystic tumor is regressing or to uncover any evidence that a new neoplasm is developing. until now, there have already been reports of mcdk simultaneously occurring with renal cell carcinoma, mesothelioma, and wilms tumor (14). the prognosis of mrtk is related to the stage, lymph node metastasis, sex, nuclear diameter, and other factors. in this case, because the patient was 5 yr old, the tumor was stage i, and the cells had a medium nuclear size (2-4 m), according to the mrtk prognosis markers, the patient might have belonged to the favorable prognostic group. it is difficult to evaluate the patient's prognosis when there are two different diseases present at the same time. hence, a prognosis should be related to the more serious disease, if two diseases occur simultaneously. in conclusion, the authors believe that this case, mcdk combined with mrtk found in an infant, is the first of its kind to be reported, and we consider that this occurrence can become a new disease entity in infantile renal disease in the future. according to the literature, finally, early development of one could have affected the course of the other. by reviewing more cases and studies, pathogenetic and prognostic evidence of mcdk combined with mrtk

multicystic dysplastic kidney (mcdk) is a relatively common developmental anomaly in infants and children and has a good prognosis. in contrast, a malignant rhabdoid tumor of the kidney (mrtk) is one of the most lethal neoplasms of early life. however, the presentation of such a lethal tumor combined with multicystic dysplasia has not been reported to date. in this report, we describe a case of mrtk in a 5-yr-old girl who also had multicystic dysplasia. she was previously diagnosed with mcdk at birth due to a huge palpable mass on the right side of the abdomen. the right kidney was extensively replaced by numerous grossly dilated, variable-sized cysts. microscopically, the tumor cells show a diffusely infiltrative growth pattern, which revealed large non-cohesive, round-to-polygonal tumor cells with vesicular nuclei. some tumor cells had eccentric nuclei and large, round, eosinophilic cytoplasmic inclusions. there were metanephrons present, with the central ureteric bud and peripheral branches surrounded by condensing mesenchyma, immature glomeruli, and metaplastic cartilage in the adjacent parenchyma. to our knowledge, this is the first combined case of the two aforementioned diseases and this case may, in fact, suggest a new disease entity.

PMC2858842

pubmed-1192

systemic lupus erythematosus (sle) is a chronic systemic inflammatory disease affecting mainly women during childbearing age. although life expectancy has improved significantly, no changes in morbidity and mortality related to cardiovascular disease (cvd) have been observed in sle patients in the past decades [2, 3]. in addition to traditional risk factors, many lupus-specific factors are linked to the increased risk of cvd observed in sle [46]. obesity-associated systemic inflammation is characterized by increased circulating proinflammatory cytokines and activation of several kinases that regulate inflammation [79]. recent evidence supports that obesity-induced inflammation is mediated primarily by immune cells such as the macrophages and t lymphocytes present in metabolic tissues. adipose tissue derived cells can produce inflammatory cytokines, such as tumor necrosis factor alpha (tnf-), interleukin (il) 6, and il-10 [10, 11]. tnf- and il-6 are proinflammatory cytokines associated with an increased insulin resistance, inhibition of insulin receptor autophosphorylation, and signal transduction. upregulation of il-10 locally or systemically reduces atherosclerosis development in mouse models [1315]. the aim of this study was to evaluate the association between obesity, measures of body fat content, and serum tnf-, il-6, and il-10 in csle. fifty-two consecutive csle patients, recruited from the pediatric rheumatology outpatient clinic of the state university of campinas were included in this study. patients were included in the present study if they (i) fulfilled at least four criteria of the american college of rheumatology (acr); (ii) were below 18 years of age at disease onset; and (iii) had a follow-up duration of at least 6 months (time necessary to evaluate damage index). fifty-two healthy volunteers (caregivers or students) matched by age, gender, and sociodemographic characteristics were included as a control group. this study was approved by the ethics committee at our institution, and the informed written consent was obtained from each participant and/or legal guardian. all patients had their medical histories and clinical, and serological characteristics entered at the time of csle diagnosis into special computer database programs. features included in this protocol were age at the onset of disease (defined as the age at which the first symptoms clearly attributable to sle occurred), age at diagnosis (defined as the age when patients fulfilled four or more of the 1987 revised criteria for the classification of sle), and follow-up time (defined as the time from disease onset until december 2012). total doses and length of use the of corticosteroids since the onset of disease were calculated by careful review of the medical charts. the cumulative dose of corticosteroids used was calculated by the sum of the daily dosages versus the time (days) of treatment. we also calculated the cumulative corticosteroid dose adjusted by weight by summing up the daily corticosteroid dose per weight at each routine visit. disease activity was measured by the systemic lupus erythematosus disease activity index (sledai). sledai scores range between 0 and 105, and the scores of 3 were considered as active disease. adjusted sledai scores over time were calculated by careful review of the medical charts and preview exams. cumulative sle-related damage in all patients was determined by using the systemic lupus international collaborating clinics (slicc)/acr damage index (sdi). body mass index (bmi) was calculated as weight (kg) divided by height (m) squared (kg/m). criteria used to define nutritional status were based on the world health organization (who) criteria. bmi cutoff points for brazilian children and adolescents were used for individuals between 2 and 18 years. percentual body fat (pbf), fat mass, and lean mass were obtained by dxa scan (hologic discovery wii), through whole body auto fan beam. this scan determines total fat mass and total lean mass in kilograms in addition to total fat mass and total lean mass as a percentage of total body mass. blood samples were collected from peripheral veins of all individuals in dry tubes and left to clot at room temperature for 30 minutes. blood samples were then centrifuged for 15 minutes at 3000 rpm, and the serum was then stored in aliquots at 80c for future use. we did not collect blood samples from individuals during an episode of acute or chronic infection. commercially available kits from r&d systems (london, uk) were used for the measurement of serum tnf-, il-6, and il-10 levels by enzyme-linked immunosorbent assay (elisa), carried out in accordance with the manufacturer's instructions. the minimum detectable dose (mdd) was 0.106 pg/ml for tnf-, 0.039 pg/ml for il-6, and 3.9 pg/ml for il-10. all the data were tested for their normal distribution (kolmogorov-smirnov test). mann-whitney u test was used to compare anthropometric measure and laboratory studies between patients and controls. spearman's correlation was used to correlate continuous variables (e.g., tnf- levels, sledai, and sdi scores). for all analyses, statistical analysis was carried out using ibm spss statistics 16.0 software (spss/ibm, chicago, il, usa). forty-seven (90.3%) were women with mean age of 17.6 years (standard deviation (sd) 3.7 years). the control group consisted of 52 controls (47 women) with mean age of 18.2 years (sd 6.4). patients and healthy controls were statistically comparable in terms of age and sex (table 1). bmi was similar between patients (median 21.74 kg/m; range: 16.131.12 kg/m) and controls (median 21.43 kg/m; range: 14.3628.54 kg/m) (p=0.101). sixteen (31%) csle patients were overweight compared to 6 (11.5%) controls (p=0.018). we did not observe an association between bmi and sledai, sdi, and cumulative corticosteroid dose. on whole body analysis, we observed a median fat mass of 22.38 kg (range: 7.67 kg36.62 kg), a median lean mass of 35.49 kg (range: 25.31 kg52.14 kg), and a median pbf of 34.1% (range: 12.154.4%) in csle. in the trunk region we observed a median fat mass of 8.62 kg (range 2.98 kg17.59 kg), median lean mass of 16.80 kg (range: 11.24 kg26.19 kg) and a pbf of 42.3% (range: 12.154.4%). serum tnf- (p=0.004), il-6 (p=0.002), and il-10 (p<0.001) levels were significantly increased in csle patients when compared to healthy controls (table 2). we observed higher serum tnf- levels in obese csle patients when compared with nonobese csle patients (p=0.036), obese controls (p=0.039) and non-obese controls (p<0.0001) (table 3). no difference in serum tnf- levels was observed between obese and non-obese healthy controls (p>0.05). we observed an association between tnf- and pbf (p=0.046) and total fat mass on trunk region (p=0.035) analyzed by dxa scans. no association between serum il-6 and il-10 levels and sledai or sdi scores was observed. in addition, no difference in these cytokine levels in csle patients and controls with and without obesity was observed. adipose tissue is known to be capable of secreting cytokines such as tnf-, il-6, and il-10. therefore, the purpose of this study was to assess whether the levels of these cytokines were increased in obese csle when compared to nonobese csle and healthy controls. the observation that obese csle patients had higher serum tnf- levels when compared to nonobese csle and healthy controls is the major finding of our study. in addition, we observed that serum tnf- levels correlated with pbf and total fat mass in trunk region in csle. recent studies have demonstrated that increased adipose tissue mass contributes towards an increase in chronic inflammation [26, 27]. chronic inflammation is further enhanced by inflammatory markers produced in the liver and in other organs. recently, it has been demonstrated that obesity is associated with a low-grade inflammatory process, characterized by increased circulating levels of proinflammatory cytokines such as tnf-, il-6, and acute-phase proteins (crp) [2932]. the mechanism underlying increased inflammation in the setting of obesity remains unclear, but it is known that mononuclear cells are activated and proinflammatory cytokines are upregulated in obese individuals [33, 34]. we observed an association between serum tnf- levels and pbf and total fat mass in trunk region. studies analyzing the association between serum tnf- and dxa scans have not been reported in csle so far, but studies on healthy women and type-2 diabetes patients showed an association between plasma levels of tnf- and visceral adipose tissue volume measured by ct-scan [3538]. previous studies have shown that visceral fat accumulation is associated with increased risk of cv risk. in addition, with an increase in tnf-, a reduction in lipoprotein lipase activity in adipose tissue is observed. there is also evidence that tnf- has a local effect, regulating adipocyte size in the face of increasing energy consumption [40, 41]. cytokines, such as tnf- and il-6, are primarily involved in the early stages of the inflammatory response culminating in atherosclerosis [39, 42]. increased tnf- levels in the endothelium promote initial atheroma plaque [39, 42]. however, so far, studies were not able to conclude whether tnf- is a causative factor of atherosclerosis. both il-6 and tnf- are expressed and secreted by human adipose tissue. in obesity, increased secretion of il-6 may contribute to metabolic dysfunction [44, 45]. in addition, one previous study has shown that il-6 correlated positively with bmi and with measures of insulin resistance in abdominal obese male subjects. as previously described in adults sle patients, we observed higher il-6 and il-10 levels in csle patients when compared to healthy controls [4649]. il-10 downregulates inflammatory activation of monocytes and macrophages by transcriptional and posttranscriptional inhibition of the entire range of proinflammatory cytokines. il-10 has been shown to reduce atherosclerosis and it can be found in atheromatous plaque due to local macrophages production. however, il-10 is involved in sle pathogenesis and it is increased in sle patients with cvd compared to sle patients without cvd [51, 52]. in our study, we did not observe an association between sera il-10 levels and obesity. we also did not observe an association between sera il-6 levels and obesity. in the literature, it has been described that plasma il-6 levels are associated with increased cv risk and observed in sle patients with metabolic syndrome and in patients with type 2 diabetes [44, 54]. in a large healthy family population study where children were included, il-6 levels were closely associated with traditional and nontraditional risk factors for atherosclerosis. although csle is rare, it is important to consider that one limitation of our study is the small number of patients and controls included. corticosteroids also cause a redistribution of fat deposition, occurring predominantly in the trunk and face [5659]. however, we did not observe an association between serum tnf-, il-6, and il-10 levels and corticosteroid dose. to the best of our knowledge, this is the first study to evaluate the association of bmi, body composition and serum tnf-, il-6, and il-10 levels in csle patients. although these cytokines have been shown to be associated with cvd in other populations, we only observed an association between serum tnf- levels and obesity, and pbf and total fat mass in trunk region. our findings suggest that total fat mass may contribute to increased levels of serum tnf- levels in csle.

background. in systemic lupus erythematosus (sle), atherosclerosis is attributed to traditional and lupus related risk factors, including metabolic syndrome (mets), obesity, and inflammation. objective. to evaluate the association between obesity, measures of body fat content, serum tumor necrosis factor alpha (tnf-), and interleukin (il)-6 and -10 levels in childhood-onset sle (csle). methods. we screened consecutive csle patients followed up in the pediatric rheumatology outpatient clinic of the state university of campinas. csle patients were assessed for disease and damage. obesity was definite as body mass index (bmi) 30 kg/m2. serum tnf-, il-6, and il-10 levels were measured by elisa. dual-energy x-ray absorptiometry was used to determine total fat mass, lean mass, and percent of body fat. results. we included 52 csle patients and 52 controls. csle patients had higher serum tnf- (p=0.004), il-6 (p=0.002), and il-10 (p<0.001) levels compared to controls. we observed higher serum tnf- (p=0.036) levels in csle patients with obesity. an association between serum tnf- levels and body fat percent (p=0.046) and total fat mass on trunk region (p=0.035) was observed. conclusion. serum tnf- levels were associated with obesity and body fat content in csle. our finding suggests that obesity may contribute to the increase of serum tnf- levels in csle.

PMC3987792

pubmed-1193

movement disorders are neurological conditions that affect the speed, fluency, quality, and ease of movement. there may be either an excess of movement or a paucity of voluntary and automatic movements, unrelated to weakness or spasticity. movement is produced and coordinated by several interacting brain structures, such as the motor cortex, the cerebellum, and the basal ganglia (bg). the motor system is part of the central nervous system that is involved with voluntary and involuntary movements. the extrapyramidal system is part of the motor system that causes involuntary reflexes and movement, and modulation of movement (i.e., coordination). the bg comprises a group of interconnected deep brain nuclei, namely, the caudate and putamen, the globus pallidus internus (gp), the substantia nigra (sn), and the subthalamic nucleus (stn). these nuclei (via their connections with the thalamus and the cortex) influence the involuntary components of movement and muscle tone. disruption of such complex circuitry within the bg causes movement disorders, such as parkinson's disease (pd), essential tremor (et), and dystonia. intimate structural and functional connections between cerebellum and basal ganglia appear to be involved in patients with dystonia. in certain types of dystonia, cerebellar dysfunction (such as compensatory activity) clinical, biochemical, pathological, and imaging studies suggest an abnormal functioning of the cerebellum in et. movement disorders can be classified as hyperkinesias (excess of movements), dyskinesias (unnatural movements), and abnormal involuntary movements. there is also decreased amplitude of movement (or hypokinesia), but the terms bradykinesia (slowness of movement) and akinesia (loss of movement) are used as well. for example, acute morbidities encountered in movement disorders include those related to parkinson's disease, acute drug reactions (acute dystonia, neuroleptic malignant syndrome, serotonergic syndrome, and malignant hyperthermia), acute exacerbation of chronic movement disorders (status dystonicus), hemiballism, and stiff-person syndrome. the year 2012 marks the 25th anniversary of the birth of modern dbs. it was initially created to treat tremor of the ventral intermediate nucleus (vim) of the thalamus. since then, dbs has become a highly effective and safe surgical treatment for severe et, advanced parkinson's disease, and dystonia. dbs is widely administered with voltage-controlled devices, in which current is variable [9, 10]. high frequency dbs leads to a kind of functional deafferentation of the stimulated structure and to the modulation of cortical activity. up to date, tens of thousands patients have undergone implantation of dbs electrodes, mainly for the treatment of parkinson's disease, severe et, and for primary (idiopathic) dystonia. new uses of dbs include epilepsy and psychiatric disorders such as depression, obsessive compulsive disorder, and tourette's syndrome. motor cortex stimulation is used for intractable neuropathic pain (including central poststroke pain). the role of dbs for parkinson's disease, et, and dystonia is a well-established treatment option that is currently approved for use in north america, europe, and in countries such as australia and new zealand. the aims of this narrative paper are to explore the use of dbs in the treatment of movement disorders to review indications for its use and its mechanisms of action. the implantation technique for dbs and its possible adverse effects future technological advances clarifying pathophysiology of movement disorders and the need for improved research designs are discussed as well. the paper is based on an extensive search of the literature (pubmed, embase) in relation to the topics covered without strict inclusion or exclusion criteria in the search strategy. indications for the use of dbs include the need to improve function, reduce medication dependency, and avoid ablative neurosurgery. dbs has arisen to the forefront as a highly effective, safe, and reversible treatment of parkinson's disease, et, and dystonia. the possible target sites for dbs include the ventral intermediate (vim) nucleus of the thalamus, the gpi, and the stn. parkinson's disease is a chronic progressive neurodegenerative movement disorder affecting the extrapyramidal motor system. the loss of sn pars compacta dopaminergic neurones projecting to the caudate and putamen is considered its neuropathological hallmark. class one evidence exists for the usefulness of dbs for parkinson's disease [11, 13, 14]. it is estimated that more than 10% of parkinson's disease patients could benefit from dbs treatment. dbs should be reserved for patients with levodopa-responsive parkinson's disease who have levodopa-related complications that can not be adequately controlled with medications. the three currently accepted primary targets used for dbs in the treatment of idiopathic advanced parkinson's disease refractory to medical therapy are the vim thalamus, the gpi, and the stn. the overall clinical outcome of stn and gpi dbs for control of dyskinesia and motor fluctuations is similar. reduction of dopaminergic therapy after stn dbs may help in reducing visual hallucinations and impulse control abnormalities. the use of constant-current bilateral dbs of the stn for parkinson's disease results in significant improvements in motor function and daily fluctuations of response to levodopa. the evidence to date shows that dbs is generally safe from the cognitive standpoint in well-selected pd patients. however, there is a clear risk of postsurgical cognitive decline that seems greater whenever the stn dbs is used. significant improvements occur in patients with advanced parkinson's disease (particularly those with severe motor fluctuations) when treated with gpi dbs. these include improvements in gait and posture, reduction of dyskinesias, and the reduction of both the amount and severity of on/off fluctuations. however, both primary and various types of secondary dystonia can be treated very effectively with gpi dbs. such tremors include parkinsonian tremors, ets, cerebellar tremors, tremors of multiple sclerosis, and orthostatic tremors. dbs of the vim thalamus remains an effective target for treatment of certain patients with tremor dominant parkinson's disease refractory to medical therapy. the frequency of stimulation is a key factor in determining clinical efficacy [21, 22]. stimulation starts to reduce tremor at a frequency of approximately 50 hz and reaches a plateau at 200 hz. for more than five years after implantation, thalamic dbs has been shown to benefit tremor control [20, 23]. in severe parkinsonian tremor, promising results have recently been obtained from the use of dbs in the posterior subthalamic area (including the caudal zona incerta). et is the most common movement disorder affecting up to 5.5% of individuals aged 65 years or older. the main exclusion criteria of dbs treatment for et include altered cognition and the presence of an untreated or disabling psychiatric illness. the usefulness of thalamic stimulation in the treatment of essential head and voice tremor remains unproven. dbs has been an emerging therapy for disabling cerebellar tremors of different aetiologies (multiple sclerosis, stroke, trauma, cavernous haemangiomas, tumours, and degenerative disease). better control in posttraumatic tremor occurred when dual deep brain stimulator leads were placed over a larger region of the ventral thalamus [8, 28]. bilateral thalamic stimulation has demonstrated beneficial effects in case reports in treatment-resistant orthostatic tremor [29, 30].. it might be primary (idiopathic) or secondary to a known structural lesion of the brain (e.g., cerebral palsy from perinatal hypoxia, infections, stroke, trauma, drugs, and wilson's disease) or associated with a complex regional pain syndrome. the interaction between the bg and cerebellar circuits plays a major role in its pathophysiology. it presents with sustained, uncontrolled, and often painful muscle contractions causing repetitive movements and abnormal postures. dystonia is divided into focal (affecting a single body region), segmental (two or more adjacent areas), or generalized (involving the legs, or one leg and the trunk, plus at least one other area of the body). focal dystonias include cervical dystonia (spasmodic torticollis), blepharospasm, oculogyric crisis, oromandibular dystonia, spasmodic dysphonia or laryngeal dystonia, and focal hand dystonia. the gpi shows abnormal firing activity in dystonia and is therefore the usual target of dbs (e.g., for primary dystonia and for cervical dystonia orspasmodic torticollis). the optimal frequency and amplitude stimulation settings needed for dbs in dystonia are higher than for gpi dbs and stn dbs in parkinson's disease patients. positive effects of dbs on dystonia scales, quality of life, and pain reduction have been confirmed in many studies [2, 32, 33]. in primary generalised dystonia long-term sustainability of these benefits has been demonstrated. in tardive dystonia (from neuroleptics, metoclopramide, and prochlorperazine), there is significant improvement in dystonic symptoms from dbs. whereas the maximum beneficial effect on tremor and rigidity is reached within minutes, the delay for maximal improvement in akinesia is minutes to hours, and the improvement in dystonia gradually develops over several weeks [22, 3740]. the third is that high-frequency stimulation induces long-term synaptic changes (plasticity). recent evidence suggests that dbs has more complex mechanisms of action than the pure functional inactivation of the target region. the ultimate effect of modulating the network activity within the bg can be viewed as the takeover on hyperactive elements or structures of the cortico-bg-thalamocortical complex circuit [8, 4143]. for example, reducing the abnormally enhanced synchronisation of basal ganglia output is an essential mechanism in the therapeutic effect of dbs in parkinson's disease. other possible mechanisms of action for high-frequency dbs include local neuronal inhibition with concomitant activation of surrounding fibres, thus resulting in increased synaptic output and activation of afferent axon terminals (e.g., the cortical inputs in the case of high-frequency stimulation of the stn or nucleus accumbens) [22, 44, 45]. this could be of benefit for the treatment of obsessive-compulsive disorders and depression [22, 46]. dbs may modulate specific neurones that release specific neurotransmitters, thereby affecting these systems in the brain. the use of volume of tissue-activated studies, other functional imaging, microelectrode multisite recordings, local field potentials, eegs, and magnetoencephalographic studies will promote understanding of the stimulation effects on local and long-range neuronal networks. for example, patient selection criteria for dbs in parkinson's disease are as follows: (1) a diagnosis of medically refractory intractable parkinson's disease, primary generalised dystonia, or et, with symptoms that substantially interfere with the patient's quality of life and functionality, (2) intact cognition, (3) the absence of an untreated or disabling psychiatric illness, (4) realistic expectations, (5) the ability and willingness to participate in regular followup visits, and (6) the absence of comorbidities that are contraindications to dbs [18, 47]. the dbs technique uses continuous high-frequency stimulation of specific brain regions (figure 1). it involves the implantation of a microelectrode into a deep target within the brain that is connected to a stimulator; the stimulator is programmed to emit electrical impulses at varying strengths and frequencies. impulses travel to the implanted electrodes from a pulse generator (similar to a cardiac pacemaker) that is telemetrically programmable. medtronic dbs device (minneapolis inc.) is currently the most widely utilised system in functional surgery across the world. the device used has three separate components including the electrode, the extension wires connecting the intracranial electrodes with impulse programming generator (ipg), and the ipg (figure 2). although details regarding surgical techniques may vary, all combine a stereotactic technique with detailed image guidance. stereotaxis is a minimally invasive surgical procedure that makes use of a three-dimensional coordinate system to accurately locate a target in a deep-seated area of the brain. electrodes are implanted into the target brain area by means of this stereotactic surgical procedure with electrophysiological recordings at the cellular or pathway level. a stereotactic head frame is placed on the patient under local anaesthesia in the operating room. a computed tomography (ct) scan or, more commonly, a magnetic resonance imaging (mri) scan is obtained; this identifies the anterior commissure, posterior commissure, and the midcommissural point. based on the location of these structures, well-established x, y, and z target coordinates are used to plan electrode placement. planning software determines the target coordinates; an entry point is found that will allow passage of the electrode through the brain without traversing the ventricle or damaging vascular structures. surgery is usually performed while the patient is awake, off drug therapy, and under local anaesthesia, as this enables reliable microelectrode recording (mer) to be obtained; it allows evaluation of the intraoperative stimulation and possible adverse effects caused by the current diffusion to adjacent structures. general anaesthesia is generally contraindicated during mer, as it depresses neural activity, suppresses clinical symptoms (tremors and rigidity), and interferes with the evaluation of clinical benefits. in patients unable to tolerate an awake procedure, ketamine is a safe and effective alternative to other drugs used to induce general anaesthesia, as the feasibility of microelectrode recording is preserved. a scalp incision and burr hole are placed in the skull at the predetermined entry point. electrodes of 1.3 mm in diameter integrating four contacts of 1.5 mm length each, connected to a pulse generator, are used. verbal feedback is received from the awake patient regarding unwanted adverse effects (such as paraesthesias or visual phenomena). proper placement is confirmed by intraoperative fluoroscopy and postoperative mri or ct scanning. once trial stimulation has been deemed successful, a permanent pulse generator (similar to a pacemaker) is placed in the subclavicular space. stimulation parameters (frequency, amplitude, and pulse widths) may vary. programming these parameters several time-consuming visits may be required before the best therapeutic effect is reached. bilateral lead implantations can be performed either during a single surgery or in a staged procedure separated by 24 weeks. pulse generators can be placed in a subclavicular position either on the same day or as part of a staged procedure after lead implantation. successful outcomes are correlated with patient selection, accurate placement of the electrodes in their surgical target, and optimal programming of patients. at what stage however, an eight-year followup study in parkinson's disease showed that stn dbs can be considered safe from a cognitive standpoint but did not seem to modify the cognitive evolution along the course of the disease. on the basis of these observations, it may be appropriate to perform surgery earlier than currently indicated. adverse effects noted include those related to the surgery, the hardware, and the stimulation per se. surgical complications include primarily intracerebral haemorrhage (less than 2% in most centres) and infection (in about 4% of the cases) [2, 51]. intraoperative or postoperative haemorrhage is the most dreaded complication of dbs. haemorrhages may occur due to laceration of intracerebral vessels during microelectrode recording or lead implantation. surgery on the gpi carries a greater haemorrhagic risk than does that on the stn. hardware complications (device-related problems occur in 4.5% of the patients) include the following: erosion over the connector; electrode ruptures or malfunction; electrode migration; lead fractures; infections; skin erosion; battery failure; device malfunction; mri safety concerns. erosion of the subcutaneous portions of the hardware occurs in patients with a very low body mass index. electrode impedance should be checked and recorded at each clinical visit [15, 55]. stimulation signals with amplitudes greater than those required to achieve symptom control can affect neighbouring structures causing adverse effects; these are reversible with amplitude adjustments. to avoid this dyskinesia, worsening of axial symptoms (freezing, balance, and gait disturbance), speech disturbance, involuntary muscle contractions, paraesthesia, and diplopia are among the common stimulation-related and transient side effects. stn dbs can worsen speech and gait in some patients, requiring stimulation parameters to be adjusted. other adverse effects observed after stn dbs include neuropsychiatric problems, cognitive deterioration, eyelid opening apraxia, weight gain, stimulation-induced dyskinesias, and worsening akinesia [56, 57]. the neuropsychiatric symptoms following stn dbs in parkinson's disease patients are generally transient and mild if managed appropriately. with gpi dbs, adverse effects include paresthesias, muscle contractions, visual flashes, worsening akinesia, dysarthria, weight gain, eyelid opening apraxia, confusion, and cognitive decline. a recent study reported that depression worsened with stn dbs but improved with gpi dbs. years later, patients can develop disabling levodopa-resistant symptoms, such as gait disturbances and cognitive impairment. stimulation-induced dyskinesia is frequently managed with a reduction in the dosage of dopaminergic medications. to control symptoms with fewer medication adverse effects, programming of dbs can be performed concurrently with changes in levodopa doses. in dbs for et, the most frequent stimulation-induced adverse effects are paresthesias, followed by dysarthria and pain; these are reversible once the stimulation is turned off. gait or balance may worsen following dbs for medication refractory et. adverse effects of dbs may include modulation of affect, cognition, and behaviour, or possible changes of personality. some data suggest that the implantation per se and not the stimulation is the main cause of the decline in executive function. dbs is generally safe from the cognitive standpoint in well-selected pd patients when looking at measures of global cognition. nevertheless, there is a clear risk of postsurgical cognitive decline that seems greater whenever the stn dbs is used, although data with other targets is limited. only one large randomized, double-blind trial has focused mainly on motor efficacy issues of stn dbs versus gpi dbs. postsurgical decline in verbal fluency has been the most consistently reported cognitive adverse effect in patients undergoing subthalamic dbs [18, 59]. the demonstration of long-term cognitive effects from the surgical procedure or stimulation is difficult. it remains challenging to differentiate these from the natural progression of the disease and other confounding variables (such as drug therapy, brain vascular lesions, pd progression, and concurrent degenerative pathology). short-term clear cut changes are most probably due to the surgical procedure itself and the electrical stimulation. the factors (such as age, pd duration, disease phenotype, and levodopa responsiveness) that predict postsurgical cognitive decline remain unsatisfactory. a wireless instantaneous neurotransmitter concentration system (wincs) has been developed to promote understanding of the neurocircuitry involved [61, 62]. the wincs system provides real-time neurotransmitter monitoring to reveal underlying neuromodulatory mechanisms of dbs action. this device is capable of monitoring the release of a variety of neurochemicals (dopamine, serotonin, histamine, and adenosine) during dbs using the electroanalytical techniques of fast-scan cyclic voltammetry at a carbon fibre microelectrode, and fixed potential amperometry at enzyme-linked biosensors. dbs systems; these would provide feedback from brain electrical activity to direct the stimulation and neuroimaging modalities. computational analysis or electrophysiological modelling dbs would then depend on the use of multiple electrodes with these closed-loop it might even allow the performance of effective and safe programming through remote access, such as via the telephone or the internet. by disentangling the neuronal network codes, closed-loop devices could provide stimulation on demand. on-going clinical trials with dbs are investigating its use in tremor in multiple sclerosis, in mood disorders, in pain and cluster headache, in hypertension, in obesity, in memory impairment, in aggressiveness, in drug addiction, and in other central nervous system disorders; this will enhance indications for its use in future. advances in functional imaging are providing new offer preoperative modelling for dbs surgery, including nerve fibre tracts (diffusion tensor imaging), and imaging of volume of tissue activated by a specific electrode. computational analysis techniques for dbs include mathematical models of the abnormally synchronized electrical activity that underlies epilepsy, movement disorders, and many mood disorders as well. new programming options such as interleaving and constant current devices are now on the market. constant-current stimulation provides more accurate control of the spread of the electrical field than do voltage-controlled devices, as adjustments can be for heterogeneity in tissue impedance [10, 68]. the development of new electrodes with improved variability of stimulation direction should aid progress as well. finding the right anatomical areas to stimulate to gain the best outcomes remains a challenge. a more recent experimental target is the pedunculopontine nucleus (ppn) that may be appropriate for patients with gait freezing or postural instability gait difficulty [6971]. the centremedian/parafascicular thalamic complex has been proposed as a successful target for control of tremor as well. fibre tracts rather than nuclei might be the correct target of choice (not only in parkinson's disease, but also in thalamic stimulation for et). optogenetic studies suggest that stn stimulation and stimulation of afferents from cortical areas might form the main mechanism of action of dbs [11, 41]. movement disorders encompass acute and chronic diseases characterised by involuntary movements or loss of control or efficiency in voluntary movements. in movement disorders, dbs is a highly effective, safe, and reversible surgical treatment for advanced parkinson's disease, tremor, and dystonia. its use has promoted interdisciplinary clinical team work and provided an improved understanding of the complex neurocircuitry associated with these disorders. for improvement of outcomes after dbs, a refinement of patient selection criteria is needed. dbs is a useful therapeutic option in carefully selected patients that significantly improves motor symptoms, functional status, and quality of life. dbs remains an expensive resource, and its future clinical use will continue to raise many regulatory and ethical issues. further evidence, particularly in the form of prospective studies and randomised controlled trials, is required to better establish the pathophysiology of movement disorders and its role therein.

movement disorders are neurological conditions affecting speed, fluency, quality, and ease of movement. deep brain stimulation (dbs) is used to treat advanced parkinson's disease, essential tremor, and dystonia. possible target sites for dbs include the ventral intermediate nucleus of the thalamus, the globus pallidus internus, and the subthalamic nucleus. high-frequency dbs leads to a kind of functional deafferentation of the stimulated structure and to the modulation of cortical activity. this has a profound effect on the efficiency of movement. indications for the use of dbs include the need to improve function, reduce medication dependency, and avoid ablative neurosurgery. appropriate patient selection is critical for success. the implantation technique is briefly described. programming stimulation parameters are performed via telemetry. the adverse effects of dbs are discussed. the future should see the development of closed-loop systems. its use has promoted interdisciplinary team work and provided an improved understanding of the complex neurocircuitry associated with these disorders. dbs is a highly effective, safe, and reversible surgical treatment for advanced parkinson's disease, tremor, and dystonia. it is a useful therapeutic option in carefully selected patients that significantly improves motor symptoms, functional status, and quality of life.

PMC3459225

pubmed-1194

root canal isthmus, a narrow ribbon-shaped communication between two root canals is an important anatomical feature because of the fact that it may contain pulp remnants, necrotic tissues, and micro-organisms and their byproducts. an isthmus is also called a corridor, a lateral interconnection, and a transverse anastomosis. the prevalence of isthmus varies according to the tooth type, root levels, and age. an isthmus might be found in roots with c-shaped canals or in two adjacent canals such as mesial roots of mandibular molars, premolars, and so on. the mesial root of the mandibular first molar exhibits the most number of isthmuses. the majority of isthmuses have been reported in the apical 5 mm of root canals. a study in a chinese population reported that the prevalence of isthmuses decreases with age in molars due to the deposition of secondary dentin. irregularities in root canal system, including isthmuses, are inaccessible spaces for instruments, irrigation solutions, and medicaments, and serve as reservoirs for bacteria, which finally leads to the failure of conventional root canal treatment. in addition, isthmuses overlooked during periapical surgeries might lead to the failure of surgical treatment. ideally, with the present practice of advanced preparation and filling of isthmuses during root-end resection, the success rate of endodontic treatments is expected to increase in most cases. therefore, a thorough knowledge of this anatomic feature in the apical third of root canals in posterior teeth has a great value in increasing the success rate of surgical and nonsurgical endodontic treatments. a large number of studies have been carried out in different parts of the world to determine the prevalence of isthmus in mandibular molars, ranging from 54 to 89% [table 1]. considering ethnical variations and inadequate published data on this anatomical feature, the aim of the present study was to evaluate the prevalence and location of isthmus in the mesial roots of extracted mandibular molars in an iranian population. in this cross-sectional descriptive study, 60 extracted mandibular first and second molars were randomly selected from dental clinics of tehran (from the north, south, east, and west regions). the teeth were rinsed under tap water immediately after extraction and immersed in 10% neutral buffered formalin solution and prepared for two-angle radiographic examination (straight and 20 mesially). the inclusion criteria consisted of mature roots, the presence of two canals in the mesial root, absence of any calcification, internal or external root resorption, and visible cracks. the age, gender, and race of the patients were not considered. all teeth were decoronated and two #15 k-flexofiles (dentsply/maillefer, ballaigues, switzerland) were used to verify the two canals in the mesial roots of the teeth and a periapical x-ray was taken. a low-speed handpiece with a thin metallic disk (d and z, germany; length: 0.17 mm, breadth: 2.0 mm) was used to cut each root at 2, 4, and 6 mm distances from the apex perpendicular to the root long axis. each separated root segment, which was 2 mm in thickness, was placed in 5.25% sodium hypochlorite solution for 24 hours to remove any debris or organic material remnants. subsequently, the root samples were immersed in 17% ethylenediaminetetraacetic acid (edta; ariadent, asia chemie teb, tehran, iran) for 30 seconds, then rinsed with distilled water, and dried. finally, the sectioned surfaces of the samples were stained with indian ink and evaluated under a stereomicroscope (nikon ufx-dx, tokyo, japan) at a magnification of 30. photographs were taken using a camera (nikon fx-35 xx, tokyo, japan), and recorded and evaluated by two endodontists. the absence or presence of isthmuses and their types were evaluated and recorded based on the classifications of kim and teixeira at various distances from the apex. the kim classification consists of five types [figure 1]: schematic representation of isthmus classifications described by hsu and kim type i: presence of two canals without a noticeable communication type ii: presence of two canals without a definite communication type iii: similar to type ii but with three canals instead of two canals type iv: extension of the main canal into the isthmus type v: presence of a complete communication or corridor between the two canals the teixeira classification consists of no isthmus, incomplete isthmus, and complete isthmus. a chi-squared test was used to determine the relationship between the prevalence and types of isthmuses with canal location after prevalence and confidence intervals were determined. the results are presented in [tables 2 and 3] and based on the classifications of kim and teixeria. in the 60 mandibular first and second molars evaluated in the present study, isthmus was found in an average of 83% of the mesial roots at 2, 4, and 6 mm distances from the apex. the highest prevalence of isthmus was found at a distance of 6 mm from the apex with 92% [confidence interval (ci): 89.8-93.6]; the lowest prevalence was found at a distance of 2 mm from the apex with 70% (ci: 64.7-75.3). the prevalence of isthmus was 88% (ci: 85.7-90.92) at a distance of 4 mm from the apex. prevalence of isthmuses, based on the kim classification, at 2, 4, and 6 mm distances from the apex in an iranian population prevalence of isthmuses, based on the teixeira classification, at 2, 4, and 6 mm distances from the apex in an iranian population based on the kim classification [figure 2], there was no significant relationship between isthmus type and canal location. the most prevalent isthmus at 2 and 4 mm from the apex was type v but at 6 mm, it was type ii. however, in terms of the teixeira classification [figure 3], there was a significant relationship between sections at 2 and 6 mm from the apex (p=0.039). moreover, the incomplete type was most common in 6 mm (67%) and least in 2 mm (18.3%). lack of isthmus was most common in 2 mm (18%) and least in 6 mm (5%). the complete type was most common in 2 mm (52%) and least in 6 mm (25%). isthmus classifications described by hsu and kim: type i (a), type ii (b), type iii (c), type iv (d), type v (e) teixeira classification: no isthmus (a), incomplete isthmus (b), and complete isthmus (c) the management of root canal isthmus has been shown to be very essential in nonsurgical and surgical endodontic treatment. complete cleaning, shaping, and obturation of the apical third of root canals are considered as among the most important factors in achieving an excellent prognosis of root canal therapy. an unprepared isthmus in the root canal system, especially in the mandibular and maxillary molars, might contain necrotic debris and tissue remnants, which might serve as a reservoir for bacteria, leading to endodontic failure. therefore, initial anatomical knowledge, recognition, and proper management of an isthmus may be of great value to increase the success rate of surgical and nonsurgical endodontic treatments in posterior teeth. in the present study, isthmuses were found in 83% of the mesial roots of the mandibular first and second molars, which is consistent with the results of the studies by fan et al. in which prevalence rates of 85, 81, and 88.5% were reported, respectively [table 1]. teixeira et al. found an incidence of 59% two canals in the mesial root of mandibular molars. the prevalence of isthmus was greatest 3-5 mm from the apex. in these cases, 22% were complete and 37% partial in mandibular molars. bidar et al. reported an isthmus incidence of 16% in distal roots with two canals of mandibular molars in a sample of iranian population. this lower rate of isthmus could be explained by different roots (distal versus mesial). however, the authors emphasized that even this percentage would be taken into account during the cleaning and shaping of root canals. furthermore, the highest and lowest prevalence rates of isthmuses in the present study were found at 6 mm and 2 mm distances from the root apex, respectively. therefore, the number of isthmuses increases from 2 to 6 mm distance beyond the apex. previous studies, similar to our study, have shown the highest prevalence of isthmuses at 4-6 mm distances from the apex in the mesial roots of mandibular molars. in addition, we found the highest and lowest prevalence rates of complete isthmuses at 2 and 6 mm distances, respectively, indicating a progressive decrease in the number of complete isthmuses from 2 to 6 mm beyond the apex. the prevalence of complete isthmus at 2 mm from the apex, in our study, was higher than that of the findings of gu et al. management of complete isthmus is easier with the use of microsurgical techniques, such as the usage of a dental operating microscope and microsurgical instruments; however, preparation of incomplete isthmuses is more difficult and requires the accurate use of fine ultrasonic tips. in the present study, a higher rate of incomplete isthmus was found in the 6 mm apical root, indicating a challenging situation during nonsurgical preparation of mandibular molars. additionally, following 3 mm root end resection during periapical surgery, retropreparation and retrofilling to a depth of 3 mm are suggested to clean and fill the 6 mm apically located segment of an isthmus., the teeth were sectioned and evaluated under a stereomicroscope, similar to the technique used by teixeria et al. and bidar et al. the sectioning, staining, and clearing is a commonly used technique due to its greater accuracy in the detection of isthmus than other techniques. however, microcomputed tomography is a modern technique, which is used at present for the evaluation of the morphology, location, and configuration of isthmus. the technique was first used by mannocci et al. to determine the prevalence of isthmuses in the mesial roots of mandibular first molars. one of the advantages of this technique is a thorough reconstruction of the root canal system without destroying the specimens. if the isthmuses are not cleared of bacteria, there is potential for the treatment to fail, and the presence of unsuspected isthmuses may also affect the quality of the root canal filling. therefore, complete removal of debris and micro-organisms from the apical third of the root canal is an important predicting factor for improving the long-term prognosis of endodontic treatment. a recent study found that the residual bacteria which frequently are entrapped in ramifications, isthmuses, and dentinal tubules makes it necessary to use an antibacterial irrigant and inter appointment medicament to maximize bacterial reduction before filling of the infected teeth. however, the complete eradication of bacteria could not be achieved in apical isthmus after two sessions of endodontic therapy. despite various studies on the evaluation and management of isthmuses and recent advances in nonsurgical endodontic treatment modalities such as modern sonic and ultrasonic irrigation devices, side-vented needle irrigation (sni), and vpro endosafe (vpro), cleaning and shaping of isthmus areas showed that the application of negative pressure techniques for the removal of debris from the isthmus in the mesial root of a mandibular first molar does not lead to the removal of more debris compared to the manual dynamic irrigation technique and none of the techniques completely removes debris from an isthmus. some in vitro studies have shown that none of the isthmuses in the root canals can be completely obturated with root-filling materials during conventional endodontic treatment. it was shown that production of dentinal debris during canal instrumentation and its penetration into the isthmuses of mesial root canals of mandibular molars prevent penetration of sealers and filling materials into the isthmuses despite continuous irrigation during and after instrumentation. therefore, proper management of isthmuses including bacterial reduction and complete filling requires future application of newer technologies and then further studies to verify their efficacies. a recent study by de groot et al. on the cleaning efficacy of laser-activated irrigation of root canals showed that the use of this technique is more efficient in removing debris from the apical third of the root canal compared to passive ultrasonic irrigation and hand irrigation techniques. in addition, the application of er, cr: ysgg laser (er, cr: ysgg: erbium, chromium-doped: yttrium, scandium, gallium, and garnet) for the obturation of root canal system resulted in an increased rate of better obturated root canals and isthmuses. therefore, it is postulated that the use of modern technologies such as lasers, modern irrigation devices, and surgical microscopes might result in a more thorough cleaning and obturation of isthmuses during surgical and nonsurgical endodontic treatments. isthmuses are very common in the mesial roots of mandibular permanent molars in the iranian population, with the highest prevalence in those at 6 mm distance from the root apex. therefore, endodontic microscopes and newer technologies should be used for cleaning and obturation of isthmuses to achieve higher success rates in endodontic treatment.

background: management of canal isthmus is considered as an important factor for successful endodontic treatment. accordingly, this study was designed to determine the prevalence, location, and types of isthmus in mesial root canals of extracted mandibular molars in a sample of iranian population. materials and methods: in this cross-sectional descriptive study, 60 extracted molars with two mesial canals were included. the samples were initially decoronated and then, roots were sectioned horizontally at 2, 4, and 6 mm levels from the apex via a low-speed handpiece with a thin metallic disk and finally prepared and stained with indian ink. all sections were examined using a stereomicroscope at a magnification of 30. prevalence, location, and types of isthmus were evaluated based on the classifications by kim and teixeira and all data were statistically analyzed by the chi-squared test. the statistical significance level was established at 0.05. results:eighty-three percent of extracted mandibular molars had an isthmus at the mesial root. this prevalence increased with distance from the apex, that is, 92% at 6 mm from the apex and 70% at 2 mm from the apex. a statistically significant difference was found between the sections at 2 and 6 mm from the apex (p<0.05), but no other significant differences between other levels (p>0.05). conclusion: isthmus is very common in the mesial roots of the mandibular permanent molars in the iranian population, with the highest prevalence in the 6 mm distance from the root apex. therefore, detection, cleaning, and filling of these apical 6 mm isthmuses are of great benefit in modern endodontics.

PMC4052653

pubmed-1195

most hemiplegic patients who suffer from stroke experience restrictions on mobility at home and in the community, and they especially have difficulty with independent walking1. turnbull et al.2 suggested that the recovery of gait ability is an important goal of physical therapy for a stroke patient, because gait is an important element of functional independence. with regard to this, mumman3 suggest that the biggest loss after stroke is gait ability, and hemiplegic patients show disorders in the selective ability of regulated and coordinated movements, which results in a slow gait velocity and compensatory movements by the lower extremity of the unaffected side. perry4 also suggested that hemiplegic patients show a short stride length and slow gait velocity for result of damage to the joint and to the regulatory function of the muscles that are necessary for normal gait. furthermore, gait is closely connected with the environment, since gait adapts and is modified to overcome obstacles and the varied geography that are faced during walking5. due to central nervous system damage, stroke patients show muscle weakness, abnormal muscle tone, and disorders of balance and posture control, which result in difficulty in the control of movement6. for these reasons, problems occur with the quality and adaptation of the gait pattern, resulting from imbalance in the low extremity stance phase of the affected side and of the low extremity stance phase of the unaffected side, a decline in cadence and gait velocity, asymmetrical weight distribution, and a difference between step length and stride length7, 8. in particular, gait disorder after stroke reduces the functional independence level and results in a negative prognosis, which is a reason why regaining gait ability is a critical element directly connected with patients independence and is one of the goals of rehabilitation9. neurotherapy methods, which include bobath therapy and proprioceptive neuromuscular facilitation, mainly focus on the control of abnormal muscle tone and of the asymmetrical movement which leads to gait disorder10. these methods require many therapists and time, because they mainly consist of muscle strengthening movements in a static position through manual handling by a therapist. however, studies on the effects of neurophysiotherapy performed by therapist handling are inconclusive. therefore, we hypothesized that gait function would improve with pelvic control following a hip extensor strengthening exercise (hese) program for the paretic lower extremity. we examined whether the hese program promotes functional improvement of the paretic lower extremity of stroke patients. the participants in this study were fifteen hemiplegic patients who had been diagnosed with stroke (table 1table 1.clinical characteristics of the hemiplegic stroke patientsage (yr)gender (%) height (cm)weight (kg)cause of disease (%) as (%) k-mmse (score)time post- stroke (mo)44.2 3.9 m 10 (66.7)f 5 (33.3)168.5 2.168.5 3.5 in 12 (80.0)he 3 (20.0)rt 7 (46.7)lt 8 (53.3)26.5 2.520.5 m: male; f: female; in: infarction; he: hemorrhage; as: affected side; rt and lt: right and left side; k-mmse: korean version of mini mental status examination) who were receiving inpatient or outpatient treatment at hospital p rehabilitation center. all the subjects participated in a four-week six-method hip extensor strengthening exercise (hese) program. this program was performed by a therapist manipulating the subjects for about half an hour a day in the supine position, side-lying position, and prone position on a treatment table. the hese program comprised six steps: data are presented as means se. m: male; f: female; in: infarction; he: hemorrhage; as: affected side; rt and lt: right and left side; k-mmse: korean version of mini mental status examination 1. hip extension and posterior tilt movement; 2. hip joint and pelvis movement using a therapeutic ball; 4. hip joint and pelvis movement hip joint extension muscle strengthening movement in the side-lying position; and 6. each session consisted of three sets of 15 performances of the 6-step program lasting about half an hour, with 30 seconds of relaxation time between the sets11. each participant was assessed by a physical therapist before and after the intervention in order to examine its effects on gait performance and stability. the 10-m walking velocity test and the berg balance scale (bbs) were used to evaluate the changes in gait performance and stability. bbs is a widely used clinical test which was developed to evaluate both the static and kinetic balance abilities of stroke patients. it consists of 14 assessment items: sitting to standing, standing without support, sitting without support, standing to sitting, transfers, standing with eyes closed, performing the romberg test with eyes open, reaching, turning and looking over the shoulder, making 360 turn to the right and left, and standing on one leg. it has been shown that subjects with bbs scores>41 have a low risk of fall, medium risk of fall for bbs scores of 2140, and high risk of fall for bbs scores of less than 20. bbs can be used to evaluate the balance ability of patients with hemiplegia caused either by senile disorder or stroke12. a gaitrite (gait trainer 2 analysis system, usa) was used to measure the spatiotemporal variables of gait (walking speed, walking cycle, affected side stance phase, stride length) and the symmetry index (stance phase, stride length). subjects performed three trials for both pre- and post-test measurements. when gaitrite was used in the study, it helped the participants observe in real time their feet touching the ground on a monitor. gaitrite can compare gait velocity (meter/sec), gait cycle (cycle/sec), and the symmetry index (%) of the stance phase and the swing phase, with normal category values on a histogram13. statistical analyses were performed using spss version 20.0. the shapiro-wilks test was used to verify the general and medical characteristics and the measured variables displayed a normal distribution. the chi-square was used to compare the general and medical characteristics of the participants and the paired t-test was conducted to compare the results of before and after the treatment. the formulas for the symmetry indexes of the stance phase and stride length used in the study were: symmetric index of length (%) =non-affected side low extremity length (cm)/affected side low extremity length (cm) 100%; and symmetric index of the stance phase (%)=affected side low extremity stance phase (sec)/non-affected side low extremity stance phase (sec) 100%. the protocol of this study was approved by the committee of ethics in research of the university of yongin, in accordance with the terms of resolution 5-1-20, december 2006. furthermore, all subjects provided their informed consent to participation in the present study. table 1 summarizes the clinical characteristics of the subjects. walking speed, stance phase and stride length of the affected side, and the symmetry index of the stance phase significantly improved after the hese program (p<0.05) (table 2table 2.effects of hip extensor strengthening exercise program on the hemiplegic stroke patientsvariableshemiplegic stroke patientspre-hesepost-hesewalking speed (m/sec)0.5 0.00.6 0.0walking cycle (c/sec)0.6 0.00.6 0.0as stance phase (sec/%)47.0 1.248.5 1.1as stride length (cm)38.1 3.041.8 2.8si of stance phase (%) 90.0 4.294.0 4.0si of stride length (%) 90.6 6.493.1 5.710wvt (m/sec)29.8 11.829.2 11.6bbs (score)37.1 2.537.3 2.8data are presented as means se. hese: hip extensor strengthening exercise; as: affected side; si: symmetry index; 10wvt: 10 m walking velocity test; bbs: berg balance scale. *: significantly different from pre-hese, p<0.05). hese: hip extensor strengthening exercise; as: affected side; si: symmetry index; 10wvt: 10 m walking velocity test; bbs: berg balance scale. *: significantly different from pre-hese, p<0.05 the distinctive gait patterns of hemiplegic patients include a slow gait cycle and velocity, differences between the affected side and unaffected side step length, a short stance phase, and a relatively long swing phase on the affected side14, 15. restoration of the ability to gait is a very important goal for stroke patients, and therefore, evaluating gait patterns of hemiplegic patients and analyzing the related elements is meaningful16, 17. to contribute to the treatment of problems with gait, this study aimed to discover the effects of hip extension muscle strengthening on gait ability and stable gait. in the study, the experimental group showed significant improvements in walking speed, the affected side stance phase, stride length, and the stance phase symmetry index after the training. the hese program conducted for the hemiplegic patients contributed to improvements in walking speed, stance phase, stride length, and the stance phase symmetry index. the treatment with respect to movement after the acute phase improved hemiplegic patients gait and function, similar to the results of a previous study18. in addition, in order to discover effective movement methods for hemiplegic patients besides general movement treatment, a muscle strengthening movement program using manipulations by a therapist was performed11. in that study of the effects of leg muscle improvement movement and an aerobic movement program on muscle weakness and stiffness, thirteen stroke patients at least nine months after stroke onset were the subjects of a ten-week program11. for about half an hour, the experimental group carried out resistance movements using a sand pocket, and therabands of eight different elasticities, and also received a therapist s handling for the hip flexor and extensor, knee flexor and extensor, and ankle flexor and extensor muscles. there was an increase in strength of about 42.3% in the leg muscles, and gait velocity also increased11. moreover, in a study of the effects of gradual resistance movement on the leg muscle, involving twenty chronic stroke patients, gradual resistance movement by centripetal and centrifugal movement was conducted for eight weeks19. as measured by computed tomography, there was a decline in hypoderm and the amount of body fat and an increase in midthigh muscle area of the femoral region19. there was also an increase of the femoral muscles of about 9.04.5%, and of gait velocity of about 48%19. considering the results of previous studies of movement programs using gradual muscle movement and therapist handling, it seems that a treatment program using hip joint muscle strengthening movements and therapist handling provides an appropriate environment for improvement of gait ability and for motivation of patients. wade et al.20 reported that the 10-m walking velocity test for hemiplegic patients is a simple, objective measurement for evaluating functional recovery. however, sharp and brouwer21 reported that after a six-week intervention of knee joint isokinetic resistance movement involving fifteen chronic stroke patients, muscle power and gait velocity improved, whereas walking up and down stairs and tug times showed no significant differences with respect to functional performance ability. page22 reported that the effect of movement treatment on stroke patients depends on the treatment time, the movement form, and the patient s positive participation. hendricks et al.23 suggested that the degree of recovery from stroke weakens as time passes and that the recovery of movement regulation ability occurs no later than three months after a stroke. a limitation of their study was that the disease period of the participants ranged from 6 months to 91 months, and no improvement of movement regulation function resulted. the reason why there was no significant improvement in all test items after four weeks of movement therapy was the order of movement and other factors during the intervention. to elicit an improvement in hemiplegic patients stable gait, a much longer treatment period is required, and the stage and duration of stroke and a variety of forms of movement also need to be considered. from this it can be understood that for hip joint muscle power strengthening movements to influence hemiplegic patients stable gait, several things are required at the same time: a long enough treatment period, a variety of movements and muscle power strengthening movements of the hip joint, knee joint, and ankle joint. despite positive changes, the ability to generalize the present study s results to every hemiplegic patient is limited. further study of more methods for improving stable gait through hip flexor muscle power strengthening movements is required, with larger numbers of participants, a longer treatment period, and a follow-up after the treatment. furthermore, scientific multi-dimensional investigations on the effects of neurophysiotherapy related to gait and muscle function should be conducted for stroke patients24,25,26,27,28,29,30.

[ purpose] the purpose of this study was to investigate the effects of strengthening exercises for the hip extensors on the gait performance and stability of patients with hemiplegia. [subjects and methods] the subjects were fifteen stroke patients (ten males, five females). the experimental subjects performed a hip extensor strengthening exercise (hese) program for a total of four weeks. [results] the experimental subjects showed significant improvements after the hese program. especially, walking speed and the affected side stance phase time significantly increased after the hese program. furthermore, the affected side stride length and symmetry index in the stance phase significantly increased after hese program. [conclusion] these results suggest that the hese program may, in part, help to improve gait performance ability and stabilize physical disability after stroke.

PMC4395682

pubmed-1196

attention deficit hyperactivity disorder (adhd) is a common disorder that affects 5.3% to 20% of the children worldwide. us studies have shown a prevalence of 8.7% in 815 years old (froehlich et al. 2007). specifically in india, studies in hospital or outpatient clinics, with referral bias, suggest prevalence of 5.2% to 29.5% [36]. the condition generally leads to poor academic performance and problems with behavior at home and school. children with this disorder often have other problems such as anxiety, depression, and learning disabilities. as they reach adolescence, these children are also at greater risk of drug and alcohol abuse and other issues such as increased rate of motor vehicle accidents. children with adhd also suffer from higher levels of temper-tantrums, tics, and problems with family and peer relationships. if the condition remains untreated, it can continue into adulthood and prevent the person from achieving their maximum potential. with proper medical attention and care, children can generally learn to cope with their disorder. both medication and behavioral therapy may help. drugs, which usually consist of stimulants such as methylphenidate and amphetamine-dextroamphetamine, are either expensive or not available in india. furthermore, these medications require close medical attention, which is also a scarce and expensive resource. indeed, while medication combined with behavioral therapy has been shown to be the most effective therapy after 1 year and 2 years in the multimodal treatment study of children with attention deficit hyperactivity disorder conducted by nimh, longer term followup suggests medications appear to have little additional benefit. unfortunately, there is a lack of similar studies in india regarding the use of stimulant medication, or multimodal therapy. clearly, the use of a low-cost, effective method for identifying children with adhd and providing them with some form of behavioral therapy would go a long way to improve the quality of life for a significant portion of the school age population. some approaches, such as the use of play therapy and physical exercise, would be easy to adapt. ideally, strategies that are culturally familiar would be more acceptable and easier to incorporate. there is strong belief but limited evidence to show that yoga and meditation help focus and attention. pilot studies using this as family-based therapy for adhd in 8 boys have been reported to show promise. additional theoretical basis may be the increase in dopamine release in the cns from yoga. in children with adhd, reduced dopamine levels are seen in the cns, and strategies to regulate these levels are suggested as possible therapies. to make this affordable, a peer-mediated approach utilizing normal high school volunteers was planned. indeed, limited studies in small settings have shown peer tutoring does help children with adhd [12, 13]. furthermore, to allow maximum adherence, immersion in the regular school day was planned. we report efficacy of a six-week multimodal peer-mediated behavioral program that includes yoga in improving performance and behavioral scores as measured by the vanderbilt. additionally, the ability of peers to instruct and children with adhd to learn yoga was evaluated. finally, whether this embedded program could remain functional based solely on local resources a program was designed to assess prevalence of adhd in india and perform a needs assessment in the town of najibabad 250 kilometers north of delhi. the boys and girls schools in this town of 150,000 in north up accounted for more than 40% of the town's children, from all socioeconomic backgrounds. the majority of children came from urban or semiurban areas (87.2%), and 56% were hindus while 42% muslim. all 910 children ageing from 6 to 11 were screened for adhd using the initial teacher vanderbilt assessment [6, 7]. the vanderbilt questionnaires were translated into hindi by trained teachers. while it was designed in the english language and is used prevalently in western countries, this score has been used in other non-english speaking countries. furthermore, studies analyzing diagnosis of adhd in children in india using the vanderbilt have been performed. found that the vanderbilt could be used to identify children with adhd, though some minor discrepancies between parents and teachers reporting information about the child were noted. the performance impairment scores on the questionnaire are based on 8 areas: reading, mathematics, written expression, relationship with peers, following directions, disrupting class, assignment completion, and organizational skills. each category is scored from a 1 to 5 with a 4 or 5 indicating impairment, and hence abnormal scores. those with impairment had the parent vanderbilt questionnaire completed. from this initial screen, 156 with poor school performance were identified, and the combined parent and teacher scores as well as a neurodevelopmental assessment by neurodevelopmental pediatrician identified 80 children (8.8%) diagnosed with adhd and further categorized into either combined, predominantly inattentive, or predominantly hyperactive/impulsive types. the study was approved by the school board of mdkv and registered under clinicaltrials.gov (nct01012778). these children were evaluated in a medical camp for comorbidities, and additional programs to educate families and teachers on the problems of adhd were conducted. furthermore, all yoga postures were designed by designated yoga teachers to ensure that they have no real physical strain beyond normal physical activities. this was a multimodal program that incorporated yoga postures, meditation program, and behavioral play therapy in 1-hour sessions during the school day. postures and simple breathing techniques that would be appropriate for children between 6 and 11 years were used. the next 30 minutes were devoted to behavioral therapy and then 5 minutes for discussion about the past sessions or any questions the children might have. the children were organized into manageable groups of 8 to 12 children and also divided by gender to keep with school custom. teachers played no direct role in the actual therapy of the children but supervised the classroom, and logged children's behavior using a simple scale. high school volunteers were selected after being recommended by their teachers for excelling in academics and leadership qualities. a further criterion was that they could take on this extra responsibility without adversely affecting their academic performance. the volunteers were trained and assessed over 3 weeks until they became proficient in yoga, meditation, and peer mentoring during the behavioral therapy. from the fifth week, the high school student volunteers managed the program alone. in the sixth week of the program, children's yoga performance was measured using a yoga posture score (table 1). in this system in each of the 5 aspects of the yoga posture, a child could score from 0 to 2. a score of 0 indicated that the specific aspect of the posture was not recognized and the child did not even make an attempt. a score of 1 indicated that the child attempted that aspect of the posture but performed it inadequately. finally, a score of 2 indicated that the child recognized that aspect of the posture and performed it at an adequate level. each child was scored independently by the 2 observers and the mean of the scores used. in order to measure the child's ability to perform breathing portion of meditation, the duration for which they could maintain the humming sound on exhalation was recorded. this was based on the principle that improvement from breathing techniques used in meditation leads to prolonged but controlled exhalation. all children were evaluated in the same week and were measured in three trials using a simple stopwatch. our measurements in yoga and meditation were compared against a control group of 3 healthy children aged 711 who participated in the 6-week program alongside the children with adhd. in addition, the children were assessed with a follow-up teacher and parent vanderbilt. this included performance impairment score by the teachers, allowing comparison from baseline for both the total number of categories still impaired and average performance impairment score, as well as behavioral scores. using the change in the average performance impairment score, percent improvement was calculated per child. completed teacher and parent vanderbilt follow-up questionnaires were collected for 70 of the 76 children who joined the program. the collected data contained 26 females and 44 males, a gender ratio similar to that seen in the us. the average age for females was 8.27 sd 1.8, while the average age for males was 8.47 sd 1.3. furthermore, the parent and teacher vanderbilt scores were used to subcategorize 70 of the children into combined, hyperactive/impulsive, and inattentive. of these, 47 of the children (67.1%) were combined, 8 of the children (11.4%) were predominantly hyperactive/impulsive, and finally 15 of the children (21.4%) were predominantly inattentive. improvement of performance impairment scores was noted in a large number of children, specifically in the poor academic and social performance categories. the average performance impairment score showed a significant decrease from an average baseline score of 5.72 sd 1.78 to 1.41 sd 2.13 on followup (p<0.001 paired t-test). more importantly, 57 of the 63 (90.5%) children had some form of improvement in their performance impairment from this therapy, and more than half the students, 35 of the 63 (55.5%) students, improved to the normal range with no performance impairment reported by teachers. the performance impairment score change did not vary by gender, age, or initial adhd subtype (figure 1). also, final teacher and parent behavioral scores demonstrated an alternative measure of improvement to the performance impairment scores. 25 of the 64 children (39.1%) had behavioral scores shift from the abnormal to normal range as rated by parents and teachers. yoga posture scores (ypss) and meditation values were also collected for the 63 children. children were measured on their improvement of yoga posture scores from a baseline score of 40. all the children improved by an average of 29.5 points or an improvement of 73.9% sd 15.5. this was similar to the control group of 3 children also taught yoga and meditation. there was weaker interobserver correlation at r 0.81 than during training of observers (r 0.97) but may partly be explained by day to day variance as measurements were not performed concurrently. the improvement in yoga posture scores from baseline did not vary by gender, adhd subtype, religion, or most importantly their performance impairment level (r=0) (figure 2). children could maintain the humming sound/exhaling of breath for an average time of 7.85s sd 3.16 by 6 weeks. because this had not been performed before, we had no exact expectation for the normal range of child after being taught meditation. we did find, however, that their performance was similar to the control group of 3 children. again, this trend did not have statistical significance (p=0.4, anova, r=0.1). gender and adhd subtype had no correlation with the children's meditation scores except for a subgroup of girls who were diagnosed with the adhd combined subtype who had a higher than average meditation score (p=0.06, chi square). again, there was no significant correlation between the children's ability to learn meditation and their initial performance impairment score (r=0.14) (figure 3). the results of this pilot study demonstrate that a six-week peer-mediated multimodal behavioral program that included yoga and meditation can lead to measurable benefits in children with adhd. improvement did not really vary by age, gender, or type of diagnosed adhd. the ability to incorporate yoga and meditation as well as play therapy using school aged peers as volunteers was shown. the improvements seen from the program would need to be sustained in the long term, and further prospective studies are needed to dissect out factors that may be relevant to improvement. furthermore, the fact that the vanderbilt questionnaire had to be translated into hindi for all the parents and the majority of the teachers may have led to some misunderstanding and affected some of the results. this questionnaire has been used by others in india but still needs to be formally validated in hindi. this potential problem may lead to an error in diagnosis in a few cases but does not affect the main outcomes of the study because the change in performance of each child was analyzed. the difference between parent and teacher would remain consistent and not affect the measured change in performance of the child. through the course of the program, it was evident that the children could and did learn the yoga to a standard level setup by a control group of 3 children. the children learned yoga over the six-week period and improved to an average yoga posture score of 69.5 with an sd 6.25, a score of 86.9%. while this novel score warrants validation and interobserver variation in practice was higher (r=0.81), one promising finding was that the yoga score along with the meditation score fell within a normal distribution curve. the scoring system demonstrated that a majority of the children learned yoga to a similar level. more importantly, yoga improvement did not vary by gender, age, type of adhd diagnosed, or performance impairment score at diagnosis. if confirmed, this would suggest therapy would be applicable no matter the variation of age or the severity of the child's adhd. the length of controlled exhalation in the majority of the children fell within the average score of 7.85 seconds, similar to a control group of 3 children. again children could learn to control their breath irrespective of their performance impairment score at diagnosis indicating that their impairment due to adhd did not inhibit them from learning meditation. the ability to train peers in a few sessions is an important low-cost strategy. the results of the six-week period show promise of such an approach as an effective and low-cost way to address needs of children with adhd. long-term followup of the peer-mediated intervention is ongoing to see if these early gains are sustained.

a low-cost resource approach to adhd therapy would be a practical approach to treating children in developing countries. research has shown that adhd is prevalent in all areas of the world, and yet treatment for children in more impoverished countries is still lacking. the approach taken was to combine yoga and meditation combined with multimodal behavioral therapy program for children ageing 6 to 11. the program was kept low cost by using trained high school volunteers and integrating the program within the public school. after 6 weeks of the program, 90.5% of children showed improvement as measured by their performance impairment score, a measurement of academic performance. parent and teacher evaluations of behavior also found improvement as 25 of the 64 children (39.1%) improved into the normal range as measured by the vanderbilt questionnaire. moreover, children could successfully learn both yoga and meditation from high school students irrespective of their age, adhd type, or initial performance impairment. the results demonstrate efficacy of a multimodal behavioral program incorporating yoga and meditation. the use of high school volunteers from schools in the area demonstrates an effective low-cost and universally applicable approach.

PMC3263567

pubmed-1197

since minimally invasive surgery (mis) is performed using an endoscope and several thin instruments through small incisions made in patients, it provides patients with some advantages like shorter recovery time, less postoperative pain, earlier resumption of normal activity, and cost savings. however, it is more ergonomically challenging to performing surgeons due to its inherent complexity such as limited work volume and degree of freedom. specifically, such complexity induces abnormal movements of arm and shoulder while holding certain body postures, for example, head and torso, for prolonged time [13]. importantly, this complexity often exposes performing surgeons to increased ergonomic risks including muscle fatigue that can result in critical errors during surgical procedures [46]. the vulnerability to ergonomic risk is well confirmed in a literature stating that performing laparoscopic surgery is significantly more stressful for the surgeon than open surgery. in addition, it has been reported that mis carries more complications than open surgery [8, 9]. therefore, it is important to quantitatively measure ergonomic risks on performing surgeons, particularly muscle fatigue during mis procedures. note that timely intervention with information about muscle fatigue can ensure improved quality of mis procedures. some existing study for fatigue analysis has focused on quantitative measures and their applications for isometric or isotonic contractions during relatively short bouts of high-force activities. among these studies, frequency banding analysis predicted muscle fatigue when lower frequency bands increase and higher frequency bands decrease. standard discomfort analysis was also used to detect the level of muscle fatigue on subjects, which may lack objective analysis. in addition, heart rate and tissue oxygen saturation were used as indicators of fatigue development. importantly, power spectral density (psd) of transformed emg data through fast fourier transform approach was widely used to detect muscle fatigue [1416]. in this approach, frequency and amplitude changes are considered as a result of a reduction in conduction velocity in the muscle fibers and larger motor unit synchronization. as mis operations can be considered as prolonged light muscle activation, psd based measure, which is mainly for static activities, may not be efficiently used to predict muscle fatigue during mis operations. specifically, when psd based measures are used for light muscle activations, conflicting results and complicated relationship between subjective and objective fatigue have been reported [17, 18]. such conflicts result from stationary data requirement for psd based measures to be successfully used. in fact, emg data collected from light muscle activations are nonstationary due to changing distance between muscle and emg sensor, as well as changing muscle length. from the literature, it is noted that fatigue mechanism during these activities is not well understood in comparison to high-force (or intense) muscle activities. although there are no significant reductions in muscle force level during mis operations, there are some physiological changes in muscles that can lead to muscle fatigue affecting the capacity of muscles and the performance of subjects [20, 21]. uhrich et al. assessed the muscle fatigue during a relatively short time during simulated laparoscopic surgery. in their study, the effects of fatigue, monitor placement, and surgical experience have been compared. after obtaining the emg activity and muscular discomfort scores before and after a fatigue session, it was found that the emg data and discomfort scores demonstrated a fatigue response in several muscle groups. they found minimal differences between the two monitor positions and less muscle activity and discomfort in the attending surgeons. in another study, slack et al. the length of the operations varied within 110 hr, but only one minute period before and after operations were analyzed using frequency analysis. in addition, the muscle fatigue increases proportional to time. on the other hand, recurrence quantification analysis (rqa) has been tested on biceps brachii and shown to be more sensitive to muscle fatigue than fft variable spectral center frequency (fc). in another study, filligoi and felici showed that determinism%, which is one of the rqa variables, is more effective than median frequency to detect emg signal changes in biceps brachii muscle. for the first time, this novel data analysis method is used in our study to quantify any possible muscle fatigue in real laparoscopic surgery operations which is known as prolonged and low-force muscle activity compared to some intense tasks which involve isometric muscle contraction throughout the whole task. the main goal of this study is to answer the following questions: can objective manifestations of muscle fatigue be detected from emg data during a laparoscopic surgery as prolonged light muscle activation?what is time-to-fatigue for the muscles experiencing fatigue during laparoscopic surgery?which muscle has the highest possibility level of fatigue in laparoscopic surgery among the tested muscle groups? can objective manifestations of muscle fatigue be detected from emg data during a laparoscopic surgery as prolonged light muscle activation? what is time-to-fatigue for the muscles experiencing fatigue during laparoscopic surgery? which muscle has the highest possibility level of fatigue in laparoscopic surgery among the tested muscle groups? as the first step, emg data for fatigue analysis was collected. specifically, surface emg electrodes were attached to upper arm muscles of participants to collect muscle activations while performing various mis procedures. next, emg data was converted into higher dimensional data using time shift and represented by recurrence plots that facilitate recurrence quantification analysis (rqa), particularly computation of determinism values. then, moving average technique was applied for trajectories of determinism values to detect any changes as the indicator of muscle fatigue. under an irb-approved protocol, five right-hand-dominant expert laparoscopic surgeons, who have performed more than 100 laparoscopic surgeries, performed fifteen mis procedures in a local hospital., a total of eight surface emg (semg) electrodes were attached to the following four bilateral muscles including bicep, triceps, deltoid, and trapezius. note that since lower arms are scrubbed from the fingertips to the elbow, electrodes were not placed on these sterilized muscle compartments. tricep and bicep were selected due to their high activity level during arm flexion and extension. since the shoulder and neck are the common area of muscle fatigue, trapezius and deltoid were also included in our study. all semg data were collected using an 8-channel bioradio 150 physiologic data acquisition system (great lakes neurotechnologies, incorporated, cleveland, oh). after wiping skin surfaces overlying target muscle groups with rubbing alcohol and allowing the alcohol to dry, two 1 1 mvap-ii electrodes (mvap medical supplies, incorporated, newbury park, ca) were placed over the muscle bellies of each muscle group and connected to the positive and negative input poles for each channel. an electrode was also attached to the right elbow and connected to the ground input on the bioradio 150 to complete the input circuit. the biocapture data acquisition software package (great lakes neurotechnologies, incorporated, cleveland, oh) more specifically, semg data was sampled at frequency of 256 hz from each channel. digital signal processing filters were then applied to exclude the noise that are at low (< 10 hz) and high frequency (> 127 hz) signals. rqa is a time series analysis method and detects the deterministic structure of the dynamical systems. let x(i) be the ith point on the orbit describing a dynamical system in d-dimensional space, for i=1, n square, where a dot is placed at (i, j) whenever x(j) is sufficiently close to x(i). in order to obtain a recurrence plot from a time series {ui }, the following procedures are required. first, we choose an embedding dimension d and construct the d-dimensional orbit of x(i) by the method of time delays: if u and i are scalar, x(i)=(ui, ui+1,, ui+d1). next, we choose r(i) such that the ball of radius r(i) centered at x(i) in r contains a reasonable number of other points x(j) of the orbit. finally, we plot a dot at each point (i, j) for which x(j) is in the ball of radius r(i) centered at x(i). we call this picture a recurrence plot (rp) and an example of rps is shown in figure 2. note that i and j are, in fact, times; therefore, a recurrence plot describes natural time correlation information. recurrence plots tend to be fairly symmetric with respect to the diagonal i=j because if x(i) is close to x(j), then x(j) is close to x(i). there is, however, no complete symmetry because we do not require r(i)=r(j). when n is more than 2 dimensions in a phase space, projection is performed. starting from the time series s(t)={s1,, sn }, the attractor of the underlying dynamics is reconstructed in a phase space by applying the time-delay vector method by takens. the reconstructed trajectory x can be expressed as a matrix where each row is a phase space vector: (1)x=x1,x2, xmt, where xi=[s1, si+t, si+(de 1)t], m=n (de 1)t, de is the embedding dimension, and t is the delay time. the recurrence plot is a tool that can be used to investigate higher dimensional dynamics through a two-dimensional binary plot of its recurrences. any recurrence of state i with state j is pictured on a boolean matrix expressed by(2)ri, jde,=xixj, where xi, j r are the embedded vectors, i, j n, () is the heaviside step function, and is an arbitrary threshold. in the graphical representation, each nonzero entry of ri, j is marked by a black dot in the position i, j. since any state is recurrent with itself, the recurrent plot (rp) matrix fulfills ri, j=1 which hence contains the diagonal line of identity (loi). the percentage of determinism (% det) derived from diagonal lines and related to predictability of the system is an important parameter in rqa which quantifies the ratio of the recurrence points. the following formula is typically used to calculate% det from a recurrence plot: (3)%det=l=lminnlpll=1nlpl100%,where p(l) is histogram or frequency distribution of diagonal line lengths, n is the length of a data series, and lmin is predefined minimal length of a diagonal line. in this study, the above% det for emg data was used as a muscle fatigue indicator. cross recurrence plot (crp) toolbox available in matlab was used for rqa analysis. in order to ensure optimized results, rqa parameters including embedding dimension (de), time delay (t), and threshold () should be selected carefully. in the crp toolbox, one can set the parameters of optimal embedding dimension and time delay to the obtained values from false nearest neighbors (fnn) and average mutual information (ami) function which may lead to the optimal recurrence plots as shown in figure 3. using these functions, embedding dimension and time-delay parameters to facilitate optimal threshold value, it has been suggested to consider the threshold value only a few percent of the maximum phase space diameter. therefore, the threshold value was chosen according to the 10% of the minimum value of maximum phase space diameter of the data. in this study, the whole duration of mis operations summarized in table 1 was analyzed by applying rqa for each minute of the operation with a window length of 15,360 data points. then,% det value was derived from rqa analysis and the results were plotted against operation time. finally, a moving average analysis with the interval (or window size) of ten was applied to the% det values to determine time-to-fatigue. figure 4 shows% det values of all eight muscles for surgeon 1 performing case 3 for 132 minutes as an example. it was observed from figures 4(g) and 4(h) that moving average of% det of bilateral trapezius muscles increased after 4550 minutes of operation. in addition, moving average of% det of bilateral deltoid increased after 5560 minutes of operation as shown in figures 4(e) and 4(f). between deltoid and trapezius, bilateral trapezius became more deterministic with% det close to 75% at the end of operation while bilateral deltoid was less deterministic with% det value close to 50%. in this study, the increase in the moving average of% det values is considered as the development of muscle fatigue. thus, it is conjectured from these observations that trapezius became more fatigued than deltoid for surgeon 1 performing case 3. however, there were no changes in moving averages of% det of bilateral bicep and triceps throughout the entire operation as shown in figure 4. as the next step,% det was tested for all the mis operations and results are summarized in table 2. det results did not detect any changes in any of the muscles for surgeon 2 in case number 1 which had the least completion time of 55 minutes. also, surgeon 4 in case number 2 as well as surgeon 5 in case number 3 did not experience any fatigue in their deltoid muscle. specifically, no fatigue signs were detected on bilateral bicep and triceps in any of the subjects. figure 5 shows the mean of moving average values for det% of all the operations and subjects. table 2 also shows that fatigue signs are developed at least 45 minutes after operations begin and trapezius gets fatigue sign earlier than deltoid. the moving average of% det for bilateral trapezius deltoid increased after 4550 and 5560 minutes of operation, respectively. this might be caused due to the following nature of mis procedures: (i) during mis, surgeons should maintain their head positions at certain orientation to keep watching the monitor and this may impose significant stress on trapezius muscle, and (ii) as the surgeon operates thin and long instrument through a small incision, they often use excessive shoulder movements to overcome the limited degree of freedom and this may impose fatigue on deltoid muscle. in this study, higher% det value implies that the emg data are getting more deterministic and periodic. this deterministic and periodic pattern is the result of synchronization of motor units in fatiguing stage. in order to supply necessary force to continue certain tasks, if almost all motor units have already been involved, motor unit synchronization takes place to continue task operation and prevent the failure. the fact that more motor units are recruited and synchronized during the course of muscle fatigue has been shown in literature. for conventional occupational tasks, increase in synchronization of motor units has been successfully detected using% det values through a computer simulation model. on the other hand, shoulder disorder is considered as one of most important musculoskeletal disorders, especially in prolonged repetitive activations with high precision [3335]. an increase in interstitial potassium concentrations in trapezius muscle can be the cause of decreased conduction velocity. also, the intra- and extracellular sodium and potassium concentration changes can be the main reason for changes in emg data which are related to muscle fatigue. although the recovery of these metabolic changes is quick, in prolonged light muscle activation, muscles need longer recovery times in order to regain the primary force capacity [37, 38]. because of orderly recruitment of motor units, low threshold fibers are vulnerable in prolonged muscle activation, which necessitates the importance of recovery time to avoid myalgic disorders in trapezius [39, 40]. it can be summarized from the literature review that fatigue analysis is highly difficult for prolonged light muscle activation tasks such as mis procedures. this study shows that trapezius was the first muscle to show fatigue sign in prolonged light muscle activation during mis procedures. it is interesting to note that similar results were reported in a light assembly task in industrial operations. while the existing study also suggested recovery/break time for workers at 90 minutes after the task begins, the results in this study suggest recovery/break time after 4550 minutes after mis operations begin. more likely, this difference results from intensity and precision level of two tasks: industrial and surgical. this might be because of less muscle activation and less muscle contraction in laparoscopic surgery for these two muscles. as muscles are vulnerable to fatigue during mis operations which have prolonged and intense nature, detecting the muscle fatigue and estimation of time-to-fatigue are of great importance. to meet this need, this study proposed and tested a novel measure that can be efficiently used for detection of muscle fatigue and time-to-fatigue from emg data. in the future study, correlation between objective and subjective results would be important. here, objective results mean fatigue analysis using the proposed measure of this study and subjective results correspond to survey analysis to subjects asking whether they feel fatigue symptoms during mis procedures. also, it would be interesting to compare performance analysis with fatigue analysis in the future, since the final goal for muscle fatigue analysis is to detect any possible effect on surgeon's performance. this will emphasize the importance of quantitative muscle fatigue analysis, although it might be challenging to apply performance analysis to real surgical operations. however, performance analysis can be easily applied to dry lab experiments such as fundamentals of laparoscopic surgery (fls) tasks, since there are validated methods to analyze the performance of subjects. therefore, the combination of rqa, as a quantitative muscle fatigue analysis method, and standard performance analysis of fls tasks will open up new doors for future studies related to muscle fatigue and performance analysis of real mis operations which would be very beneficial for surgical community. also, future studies should include larger number of subjects and more surgical operations in order to confirm findings of this study. in this study, recurrence quantification analysis (rqa) was applied to emg data recorded from eight muscle groups of five surgeons while doing fifteen mis operations. the results showed that this novel measure could detect the sign of muscle fatigue on bilateral deltoid and trapezius at 4555 minutes after operations began, and no sign of fatigue was found on other muscles. it was found from this study that trapezius and deltoid were the most vulnerable muscles among all eight muscle groups tested. here, it is worthwhile to note the nature of mis procedures such that surgeons manipulate long and thin instruments for the frequent changes of their orientation and position mainly using bicep and triceps and maintain their arm posture using deltoid while gazing through monitor using trapezius muscle for prolonged time. considering this nature, deltoid and trapezius may show clear sign of fatigue while other muscles do not show any sign of fatigue as tested in this study. based on the results, it could be suggested that surgeons need to take break time at 4550 minutes after mis operations begin in order to minimize muscle fatigue and other possible muscle disorders. to have a better understanding about the effect of recovery time on surgeons doing such a complicated laparoscopic operation, future research might test different recovery times to find an optimum amount of time for muscle relaxation before muscles fatigue. in addition, ergonomic improvement of surgical equipment to reduce the intensity level might be efficient in reducing muscle fatigue or at least increasing time-to-fatigue.

due to its inherent complexity such as limited work volume and degree of freedom, minimally invasive surgery (mis) is ergonomically challenging to surgeons compared to traditional open surgery. specifically, mis can expose performing surgeons to excessive ergonomic risks including muscle fatigue that may lead to critical errors in surgical procedures. therefore, detecting the vulnerable muscles and time-to-fatigue during mis is of great importance in order to prevent these errors. the main goal of this study is to propose and test a novel measure that can be efficiently used to detect muscle fatigue. in this study, surface electromyography was used to record muscle activations of five subjects while they performed fifteen various laparoscopic operations. the muscle activation data was then reconstructed using recurrence quantification analysis (rqa) to detect possible signs of muscle fatigue on eight muscle groups (bicep, triceps, deltoid, and trapezius). the results showed that rqa detects the fatigue sign on bilateral trapezius at 47.5 minutes (average) and bilateral deltoid at 57.5 minutes after the start of operations. no sign of fatigue was detected for bicep and triceps muscles of any subject. according to the results, the proposed novel measure can be efficiently used to detect muscle fatigue and eventually improve the quality of mis procedures with reducing errors that may result from overlooked muscle fatigue.

PMC4895041

pubmed-1198

more recently, they have been used in autotransplantation procedures to replace non-restorable teeth. the transplantation of third molars may help to maintain alveolar bone and enable endosseous implantation without requiring bone regeneration, fulfilling functional and aesthetic demands. information regarding morphology and number of roots may be especially beneficial for careful extraction and subsequent endodontic procedures in autotransplantation. relatively few studies have been conducted on the root and canal morphology of mandibular third molars, and there is no available report that specifically examines the use of cone-beam computed tomography (cbct). cbct was introduced for head and neck applications and consists of a conical radiographic source and a high-performance digital panel detector. cbct has been used in various applications, including measurements for gingival and dentogingival units, as a preoperative tool in decision making for furcation involvement, evaluation of the facial bony wall, estimation of cancellous bone density, clinical assessment of bone grafting, assessment of root length, and resorption of the root. it has been suggested that cbct data may provide a better basis for treatment plans. the main purpose of this study was to investigate the root morphology of korean mandibular third molars, and to evaluate the prevalence of c-shaped (gutter-shaped), two-rooted, and three-rooted mandibular third molars with distolingual roots. evaluations were performed on 60 male and 77 female patients whose mean age was 35.3 15.3 [table 1]. descriptive statistics of study population according to the age and gender an i-cat scanner (imaging sciences international, hatfield, pa, usa) with a spatial resolution of 10 line pairs per centimeter and an isotropic 0.4-mm voxel size was used for this study. serial axial cbct images were evaluated continuously by moving the toolbar from the floor of pulp chamber to the apex to determine the number of roots and their morphology, using commercially available software (m-view, seoul, korea). the incidences of mandibular third molars with one-root, c-shaped roots, two roots, or three roots were evaluated by age group, gender, and topology [figures 14]. to evaluate the bilateral occurrence of one-rooted, c-shaped, and three-rooted mandibular third molars, evaluations were performed only on the patients who had bilateral mandibular third molars (patient n=77). cone-beam computed tomography images showing mandibular third molars with one root (arrow) mandibular third molars with one root with c-shaped canal (arrow) mandibular third molars with two roots (arrow) mandibular third molars with three roots having distolingual root (arrow) statistical analyses of the occurrences, according the contributing factors, were performed using the chi-square test. data analysis was done with commercially available software (pasw statistics 18, spss inc., the number and percentage of mandibular third molars evaluated in the study group are listed in table 1. one hundred and twenty-one teeth (56.5%) were detected to have two roots. only 3.7% of mandibular third molars had c-shaped roots, and 1.9% had three roots with distolingual roots. calculating the incidence of each type by using the total number of teeth in each age group as the denominator, the occurrence of three-rooted teeth in each affected age group (20-29, 30-39, 40-49) increased to a respective 1.0% (1/99), 4.2% (2/48), and 6.7% (1/15). the percentage of c-shaped roots for the age groups 20-29, 30-39, 50-59, 60-69 was a respective 4.0% (4/99), 2.1% (1/48), 5.6% (1/18), and 14.3% (2/14). the overall occurrence of the number of roots in each age group was reported to show significant difference [p<0.05, table 2], and the incidence of multi-rooted third molars tended to increase with patient age. analysis of incidence of mandibular third molars with one-root, c-shaped root, two roots, or three roots according to age groups the classification of mandibular third molars by root number and gender is seen in table 3. using the total number of mandibular molars in male and female patients as the denominator, the incidences of one root (31.5% (29/92) for male versus 42.6% (52/122) for female), c-shaped root (4.3% (4/92) for male versus 3.3% (4/122) for female), two roots (63.0% (58/92) for male versus 51.6% (63/122) for female), three roots (1.1% (1/192) for male versus 2.5% (2/112 for female) were similar between males and females (p=0.144). classification of mandibular third molars by root number and gender classification of mandibular third molars by number of roots and topology is done in table 4. the incidences of one root (37.3% (42/110) for right side versus 38.5% (40/104) for left side), c-shaped root (3.6% (4/110) for right side versus 3.8% (4/104) for left side), two roots (57.3% (63/110) for right side versus 55.8% (58/104) for left side), three roots (1.8% (2/110) for right side versus 1.9% (2/104) for left side) appeared to be very similar between the right and left sides (p=0.919). classification of permanent mandibular third molars by root number and topology (right and left side) an analysis of bilateral and unilateral distribution of mandibular third molars with c-shaped roots, two roots, or three roots having distolingual roots is listed in table 5. to evaluate the bilateral occurrence of one-rooted, c-shaped, two-rooted, and three-rooted mandibular third molars, only patients who had bilateral mandibular third molars the incidence rate of each of these types was calculated using the total number of mandibular molars in each group (the one-rooted, c-shaped, two-rooted, and three-rooted groups) as the denominator. bilateral occurrence was more evident for all groups except for the three-rooted group. calculated bilateral and unilateral distributions for each group are as follows: one-rooted group (79.4% (50/63) for bilateral distribution versus 20.6% (13/63) for unilateral distribution), c-shaped group (66.7% (4/6) for bilateral distribution versus 33.3% (2/6) for unilateral distribution), two-rooted group (85.4% (70/82) for bilateral distribution versus 14.6% (12/82) for unilateral distribution), and three-rooted group (0.0% (0/3) for bilateral distribution versus 100.0% (3/3) for unilateral distribution). analysis of bilateral and unilateral distribution of mandibular third molars with c-shaped root, two roots or three roots having distolingual root this study used cbct images to evaluate the number of roots and the morphology of 214 mandibular third molars in 137 korean individuals. the mandibular third molar, the last tooth in the molar series, is reported to be associated with greater variation in root pattern and canal systems. it is widely accepted that mandibular molars usually have two roots: one located mesially and one distally. this study showed that highest percentage of mandibular third molars (56.5%) had two roots, which is consistent with previous reports that showed respective results of 53.0% and 53.4%. the incidence of three roots found for this report was rare (1.9%), and the additional roots were found in the distolingual area. an additional root that is located distolingually is called radix entomolaris, and this is a morphological variant identified as an mongolian trait. an additional root located in the lingual area we found that the overall occurrence of the number of roots according to age groups was significantly different; specifically, the younger the group, the lower the incidence rate of multi-rooted teeth. further study with a larger number of patients may be needed to draw conclusions about this apparent trend. gender predilection for the presence of distolingual roots and c-shaped roots in mandibular third molars was also evaluated in this study. previous reports have already found no significant differences in third molar development between males and females, and no significant relationship between the gender of the patient and the presence or absence of third molars has been found either. topological predilection for the presence of either the distolingual root or c-shaped root in mandibular third molars is rarely reported in the literature. this study observed very similar occurrences between the right and left sides of the same patient's jaw. no significant side differences of mandibular third molar mineralization have been reported previously, and prior study found that left-right symmetry in the root development of the mandibular third molar was very high, with a correlation coefficient of 0.93 for males and 0.95 for females. analysis was performed to evaluate the unilateral or bilateral occurrence of one-rooted, c-shaped, two-rooted, and three-rooted teeth in the mandibular third molars. most patients (80.5%) exhibited similar morphology on both their right and left mandibular sides. a previous report indicated that 78.2% of the individuals studied possessed both mandibular third molars, while 11.3% had one and 10.5% had none. extraction of mandibular third molars is a common operation in oral and maxillofacial surgery, and many reports have been published related to this issue. various aspects such as the prevalence of caries experience, carious lesions, or restorations on the occlusal surface have been determined in asymptomatic third molars that have erupted to the occlusal plane. the prevalence of caries in third molars is considered to be high as well as associated with patients caries experiences in first and second molars. the morphology of mandibular third molars may be of interest to the operator for many procedures including surgical removal, autotransplantation for atraumatic procedures, and endodontic treatment. tooth autotransplantation using mandibular third molars is reported be a useful surgical method to replace non-restorable teeth, with a high long-term survival rate. recently, phase-contrast radiography was used to assess the root morphology of mandibular third molars, and it was suggested that phase-contrast radiography may be more useful than conventional radiography for this purpose. there was a high prevalence of two-rooted and one-rooted mandibular third molars from a korean population, and it was found that the incidence of multi-rooted third molars tended to increase with patient age. these data regarding the occurrence and morphology of teeth roots will provide useful information to dentists for various dental procedures.

objective: the purpose of this study was to investigate the morphology and number of roots of korean mandibular third molars, and to evaluate the prevalence of c-shaped, two-rooted, and three-rooted mandibular third molars using cone-beam computed tomography (cbct). materials and methods: serial axial cbct images of the mandibles were gathered from 137 korean patients. the total number of roots in the mandibular third molars of these patients was measured, and both the incidence and the correlations between left- and right-side occurrences, as well as between males and females, were analyzed. results:most of the mandibular third molars either had two roots (56.5%) or one root (37.9%). there was no significant difference regarding the incidence of the different types of roots according to gender (female versus male) or topology (right versus left side). a higher percentage (80.5%) of the patients had similar root morphology on both sides. conclusion:the morphology and number of 214 mandibular third molars were examined using cbct. there was a high prevalence of two-rooted mandibular and one-rooted mandibular third molars from this korean population. even though the anatomical variations in the mandibular third molars may not be high, these data regarding the occurrence and morphology of the roots will provide useful information to dentists performing these procedures.

PMC4053618

pubmed-1199

neoadjuvant chemotherapy (nac) has generally been used in treatment of locally advanced and inflammatory breast cancer, but its use is increasing for earlier stages of the disease [1-3]. the number of patients who are candidates for breast conserving treatment (bct) increases with the use of nac, which downsizes tumors, facilitating bct in patients who would otherwise require mastectomy. several clinical trials have reported equivalent impacts of neoadjuvant versus adjuvant chemotherapy on survival. the locoregional recurrence (lrr) rate was also acceptably low in patients treated with nac followed by breast conserving surgery (bcs) and radiotherapy (rt). dna microarray analysis of gene expression profiles has divided breast cancer into distinct molecular subtypes with different clinical outcomes and responses to treatment, including estrogen receptor (er)positive/luminal, basal-like, and her2-positive subtypes. however, dna microarray analysis has challenges for wide use in routine clinical care, determination of molecular subtypes based on clinically available immunohistochemical (ihc) markers such as hormone receptor (hr) and her2 status has been considered and validated as a more practical approach to identification of the corresponding subgroups based on gene expression profiling. it has been demonstrated that different molecular subtypes can predict lrr in addition to survival and distant metastasis (dm) in the adjuvant setting [10-12]. however, the impact of molecular subtypes on ipsilateral breast tumor recurrence (ibtr) and lrr in patients who undergo nac warrants further investigation. therefore, the current study was conducted to evaluate whether molecular subtypes can identify patients at high risk for ibtr and lrr following nac and bct. this was a single-institution retrospective review of an institutional review board approved prospective breast cancer database. a total of 335 consecutive patients with non-metastatic breast cancer who underwent nac followed by bcs and rt from 2002 to 2009 were identified. before initiation of nac, all patients had been clinically staged according to the sixth edition of the american joint committee on cancer (ajcc) guidelines. clinical stages were evaluated by physical examination, ultrasonography, fluorodeoxyglucose-positron emission tomography (pet)/computed tomography (ct), and chest ct. clinicopathological data were recorded, including age, menopause status, ct stage, cn stage, pathological tumor size, number of lymph nodes (lns) identified pathologically, histological type, histological grade, er, progesterone receptor (pr), her2, and ki-67 status. nac consisted of anthracycline-based (doxorubicin 60 mg/m and cyclophosphamide 600 mg/m every 3 weeks for four cycles, n=150), taxane-based (docetaxel 75 mg/m and capecitabine 1,000 mg/m orally twice daily on days 1-14 every 3 weeks for four cycles, n=85; paclitaxel 80 mg/m followed by gemcitabine 1,200 mg/m on days 1 and 8 every 3 weeks for four cycles, n=27), or combined anthracycline-taxane based therapy (doxorubicin 60 mg/m and cyclophosphamide 600 mg/m every 3 weeks for four cycles followed by docetaxel 100 mg/m every 3 weeks for four cycles, n=73). a total of 245 patients (73.1%) were treated in one of the two prospective institutional clinical trials. nac regimen for the remainder was chosen at physician s discretion. in the bcs procedure, residual primary tumors were excised, and clear margins to healthy tissues were determined from frozen biopsy specimens. however, five patients with persistent positive resection margins in the final pathology reports declined further surgical resection. no further revision surgery was attempted in 30 patients with close resection margins (< 2 mm). standard level i and ii axillary ln dissections were performed in all except 14 patients who underwent sentinel ln biopsy without axillary dissection. no residual tumor or only carcinoma in situ in both primary breast tumor and lns was considered pathologic complete response (pcr). following bcs, rt was performed with tangential fields at a median dose to the breast of 50.4 gy in 28 fractions over 5.5 weeks in all patients. all patients received an electron boost to the tumor bed with a median dose of 10 gy in five fractions. supraclavicular nodal rt was delivered in 318 patients (median dose, 45 gy in 25 fractions). internal mammary nodal rt was administered at a median dose of 55 gy to only seven patients with pre-nac initial pet-positive internal mammary lns. adjuvant hormone suppression therapy was offered to all patients with er-positive or pr-positive tumors. some patients showed changes in er and pr expression before and after nac, but hormonal suppression therapy was administered to all patients whose tumors were er- or pr-positive in one or more tests. following rt, an ihc assay was used to evaluate the expression of the er, pr, her2, and ki-67 markers in pretreatment core biopsies. er and pr positivity were defined using the allred score when strong nuclear staining was observed in at least 3/8 tumor cells examined. er and pr status were categorized as hr-positive when er or pr staining was positive, and as hr-negative when er and pr staining were negative. immunostaining for her2 was considered positive in the case of strong (3 +) membranous staining in at least 10% of tumor cells, or in the case of 2+with unequivocal amplification by fluorescence in situ hybridization. for evaluation of ki-67, areas with the highest ki-67 staining were examined; 15% was used as the cut-off value for ki-67 to dichotomize the patients. according to the ihc features on core biopsies before nac, patients were classified according to ihc-based molecular subgroups as follows: luminal a (hr+/her2/ki-67<15%), luminal b1 (hr+/her2/ki-67 15%), luminal b2 (hr+/her2 +), her2 (hr/her2 +), and triple negative (tn) (hr/her2). in this study, the her2 group, which is known as an unfavorable feature, was divided into two subtypes based on the use of trastuzumab. the final six groups were as follows: luminal a, luminal b1, luminal b2, her2 with trastuzumab (her2[t+]), her2 without trastuzumab (her2[t]), and tn. lrr was defined as recurrent disease in the ipsilateral breast, chest wall or axillary, supraclavicular, infraclavicular, or internal mammary lns. all ibtrs and lrrs were considered events, regardless of whether they were the first site of failure versus occurred with or after dm. patients who did not experience ibtr or lrr were censored at the last follow-up or at the time of death. distributions of the clinical factors among groups were compared using the kruskal-wallis test for continuous variables and the chi-square test for categorical variables. actuarial rates of ibtr and lrr were calculated using the kaplan-meier method, and differences between groups were compared using the two-sided log-rank test. logistic regression was used to evaluate the association between covariates of interest and the probability of ibtr or lrr. significant differences in the distribution of histological type, histological grade, resection margin status, and response to nac were observed among subtypes. in evaluation of the response to nac, we noted a difference (p<0.01) in pcr rates with a lower percentage of patients in the luminal a (10.6%) and b1 (6.1%) subgroups compared with patients in the her2(t) (35.5%), and tn (23.0%) subgroups. the median follow-up period was 7.2 years (range, 0.7 to 11.6 years). twenty-six ibtrs, 15 regional recurrences, 67 dms, and 56 deaths occurred during follow-up (table 2). the 5-year lrr-free survival rates in the subtypes were as follows: luminal a, 96.4%; b1, 93.9%; b2, 90.3%; her2(t+), 92.9%; her2(t), 78.3%; and tn, 79.6% (fig. compared with the luminal a subtype, significantly higher lrr rates were observed for the luminal b2, her2(t), and tn subtypes (p=0.02, p<0.01, and p<0.01, respectively). the 5-year ibtr-free survival rates in the subtypes were as follows: luminal a, 97.2%; b1, 93.9%; b2, 92.8%; her2(t+), 92.9%; her2(t), 89.1%; and tn, 84.6% (fig. the her2(t) and tn subtypes had significantly higher rates of ibtr compared with the luminal a subtype (p=0.04 and p<0.01, respectively). despite the same unfavorable molecular markers with her2(t), her2(t+) subtype showed no difference in ibtr and lrr rates compared with the luminal a subtype. the 5-year dm-free and disease-free survival (dfs) rates were as follows: luminal a, 90.2%; b1, 75.6%; b2, 83.0%; her2(t+), 85.7%; her2(t), 76.6%; and tn, 75.4% (fig. 1c) and luminal a, 88.4%; b1, 75.6%; b2, 81.9%; her2(t+), 85.7%; her2(t), 70.0%; and tn, 72.1% (fig. the clinicopathological variables associated with ibtr and lrr were analyzed by univariate and multivariate analyses (table 3). in univariate analysis, the factors affecting ibtr development included the tn subtype (p<0.01), poorly differentiated tumors (p=0.03), and clinical t3-4 stage (p<0.01). luminal b2 subtype (p=0.03), her2(t) subtype (p<0.01), tn subtype (p<0.01), poorly differentiated tumor (p=0.01), and clinical t3-4 stage (p<0.01) were also associated with lower lrr-free survival rates. in the multivariate model, the her2(t) subtype, tn subtype, and clinical t3-4 stage affected the development of both ibtr and lrr. compared with the luminal a subtype, the her2(t) and tn subtypes were potent factors affecting ibtr/lrr, with hazard ratios of 4.2 (p=0.04)/7.6 (p<0.01) and 6.9 (p=0.01)/8.1 (p<0.01), respectively (table 3). notably, a pcr after nac was not associated with the development of ibtr (p=0.39) or lrr (p=0.65). patients of the her2(t+) subtype had significantly lower hazard ratios for ibtr and lrr compared with her2(t) patients. in the analysis of ibtr and lrr according to pcr versus non-pcr after nac, patients of the tn subtype who failed to achieve pcr showed a significantly higher lrr (p=0.03) (fig. however, among patients of the non-tn subtypes, including her2(t), no significant effect of a pcr on either lrr (p=0.52) (fig. breast cancer is now regarded as a biologically heterogeneous disease comprising different molecular subtypes, each with a different prognosis and response to treatment [10-12]. these subtypes, including luminal, her2, and basal-like, can be defined by gene expression profiling or approximations to this classification using ihc. clinicians should consider these features for proper assessment of the relevant evidence and decide on an appropriate therapeutic course of action. in a series of women with clinical stage ii-iii breast cancer who underwent nac and bct, we found that molecular subtypes showed correlation with different rates of ibtr and lrr. the tn and her2(t) subtypes had worse outcomes with significantly higher ibtr and lrr rates than those of other subtypes despite excellent tumor responses to nac. several authors have examined the impact of molecular subtype on lrr in different patient populations. nguyen et al. evaluated 793 patients treated with bct as a first-line intervention. after a median follow-up period of 70 months, the 5-year lrr rate was 0.8% for luminal a, 8.4% for her2, and 7.1% for basal subtypes. also evaluated differences in lrr according to subtype in patients undergoing bct as initial treatment. these patients were classified based on receptor status as well as nuclear grade, with subgroups defined as luminal a (hr+/her2/grade 1-2), luminal b (hr+/her2/grade 3), luminal her2 (hr+/her2 +), her2 (hr/her2 +), and tn (hr/her2). the 5-year lrr rates were 0.8% for luminal a, 10.8% for her2, and 6.7% for tn subtypes. in contrast to our study, both of these studies were limited to patients undergoing initial surgery. after a median follow-up period of 43 months, 5-year lrr rates were 3.8%, 1.3%, and 4.2% for luminal a, her2, and basal subtypes, respectively. the molecular subtype and pcr predicted dm, dfs, and overall survival (os). only patients who received nac were included; however, patients underwent bct or mastectomy. after a median follow-up period of 55 months, a higher rate of lrr in patients with basal (14%) versus luminal (4%) or her2 (5%) tumors was reported. by evaluating only the 49 patients who underwent bct, no lrr events were observed in the luminal or her2 groups, while 8% of the basal group developed lrr. most recently, caudle et al. analyzed the clinicopathological data from 595 patients who received nac and bct. after a median follow-up period of 64 months, the 5-year lrr-free survival rates were found to vary by subtype: hr+/her2, 97.0%; hr+/her2 +, 95.9%; hr/her2 +, 86.5%; and hr/her2, 89.5% (p=0.001). first, our data encompassed a homogeneous group of patients with clinical stage ii-iii breast cancer who underwent nac followed by bct at a single institution, compared with the results from patients treated with nac followed by bct or mastectomy. to the best of our knowledge, the current study is unique in its analysis of the impact of molecular subtypes on ibtr and lrr in patients who underwent nac followed by only bct, which could be associated with the concerns regarding a higher lrr rate compared with mastectomy. most previous studies have focused on dfs, os, or lrr alone [23,26-28]. inclusion of patients from previous treatment eras may yield higher rates of lrr compared with those treated more recently due to several factors. the evolution of systemic therapy has resulted in better local control and better outcomes on systemic recurrence. the use of modern radiation techniques and the evolution of breast imaging may have an impact on the rates of ibtr and lrr. third, we included 36 patients treated with trastuzumab, of whom 14 her2(t+) patients had a better local outcome compared with her2(t) patients. five-year ibtr- and lrr-free survival rates were 92.9% versus 89.1% and 92.9% versus 78.3% in her2(t+) versus her2(t), respectively. this result suggests that the use of trastuzumab could alter the impact of the molecular subtype on local outcome in her2 subtype patients. last, we found that a pcr to nac had no impact on locoregional outcomes in any patients of non-tn groups. in tn patients, however, a pcr was associated with excellent ibtr and lrr control. the association between the extent of response to nac and prognosis has been examined [3,5,23,25-27]. the best relative dfs, as well as dm-free survival, and os was observed in those who achieved a pcr. reported that a pcr to nac did not affect lrr or ibtr regardless of subtype, while caudle et al. reported that patients achieving a pcr had similar lrr rates among subtypes a second limitation was the modest number of patients evaluated; categorization according to the six subtypes resulted in a small number of patients in some subtypes, including her2(t+), luminal b1, and her2(t) patients. therefore, these findings should be confirmed in a larger prospective study in the future. in conclusion, we demonstrated that the tn and her2 subtypes predicted higher rates of ibtr and lrr after nac followed by bct. among the non-tn subtype patients, pcr was not predictive of better ibtr or lrr. however, among the tn subtype patients, a pcr to nac was a predictor of better lrr control. taken together, a novel locoregional treatment strategy to decrease ibtr and lrr such as mastectomy instead of bct in tn subtype patients with non-pcr to nac deserves further investigation. improvements in systemic therapy, investigation of radiosensitizing agents, radiation dose escalation, and other new techniques may prove to be important.

purposethe purpose of this study is to determine whether breast cancer subtype can affect locoregional recurrence (lrr) and ipsilateral breast tumor recurrence (ibtr) after neoadjuvant chemotherapy (nac) and breast-conserving therapy (bct). materials and methodswe evaluated 335 consecutive patients with clinical stage ii-iii breast cancer who received nac plus bct from 2002 to 2009. patients were classified according to six molecular subtypes: luminal a (hormone receptor [hr]+/her2/ki-67<15%, n=113), luminal b1 (hr+/her2/ki-67 15%, n=33), luminal b2 (hr+/her2 +, n=83), her2 with trastuzumab (her2[t+ ]) (hr/her2+/use of trastuzumab, n=14), her2 without trastuzumab (her2[t ]) (hr/her2 +, n=31), and triple negative (tn) (hr/her2, n=61). resultsafter a median follow-up period of 7.2 years, 26 ibtrs and 37 lrrs occurred. the 5-year lrr-free survival rates were luminal a, 96.4%; b1, 93.9%; b2, 90.3%; her2(t+), 92.9%; her2(t), 78.3%; and tn, 79.6%. the 5-year ibtr-free survival rates were luminal a, 97.2%; b1, 93.9%; b2, 92.8%; her2(t+), 92.9%; her2(t), 89.1%; and tn, 84.6%. in multivariate analysis, her2(t) (ibtr: hazard ratio, 4.2; p=0.04 and lrr: hazard ratio, 7.6; p<0.01) and tn subtypes (ibtr: hazard ratio, 6.9; p=0.01 and lrr: hazard ratio, 8.1; p<0.01) were associated with higher ibtr and lrr rates. a pathologic complete response (pcr) was found to show correlation with better lrr and a tendency toward improved ibtr controls in tn patients (ibtr, p=0.07; lrr, p=0.03). conclusionthe tn and her2(t) subtypes predict higher rates of ibtr and lrr after nac and bct. a pcr is predictive of improved ibtr or lrr in tn subtype.

PMC5080807

pubmed-1200

the disease is characterized by progressive intracranial vascular stenosis of the circle of willis, resulting in successive ischemic events. diagnosis is established by the typical appearance on cerebral angiography i.e.; puff of smoke and refers to the appearance of multiple compensatorily dilated striate vessels seen on angiography. ct and mri play a major role in documenting the regions of infarction/hemorrhage. we performed this study to analyze the role of brain perfusion spect in diagnosis and management of moyamoya disease. a retrospective analysis of the records of 17 patients (10 male, 7 female) referred for brain perfusion scintigraphy between may 2005 and dec 2009 was conducted [table 1]. the aim of the study was to describe the spectrum of findings on brain spect in patients with moyamoya disease and to compare the findings with other investigations when available. of these 17 patients, 7 were children of age group 3 to 16 years and 10 adults between 23 to 50 years. all patients underwent a baseline technetium-99 m ethyl cysteinate dimer (tc99m-ecd) brain perfusion scintigraphy as per the established procedure guidelines. one patient had a follow up scan at six months after surgical procedure (myo-dural synangiosis). three patients underwent both a baseline and post diamox brain perfusion scintigraphy for evaluation of cerebrovascular reserve. showing the characteristics of perfusion defects in the brain on tc99m-ecd brain perfusion study for children, an intravenous line was secured and the child was placed in a quiet, dimly lit room along with one of the parents. child was instructed not to speak. once the child had calmed down, tc99m-ecd in a dose of about 10 mbq per kg body weight was injected via the intravenous cannula. five min after the tracer injection intravenous sedatives were administered under close monitoring, as per the institutional sedation protocol. they were allowed to stay in a dimly lit room and instructed not to speak. for preparation of ecd, tc99 m was obtained from a generator that had been eluted previously within 24 hrs. tablets of diamox up to 1,200 mg crushed to form powder were given orally at least 30 minutes before the tracer injection. applying manually drawn regions of interest the ratio of the counts in the region with perfusion defect to corresponding contralateral normal cerebral cortex was determined both in the baseline and post-diamox study. cerebrovascular reserve was calculated as the proportion of this ratio in the post diamox study to that in the baseline study. a ratio greater than one was considered as adequate reserve. tomographic images of the brain were acquired in 128 128 matrix, circular orbit and continuous 360 acquisition. the acquired data were processed using butterworth filter, order 0.45, cut off 10 and chang attenuation correction method was applied. visual interpretation of the perfusion state was made using a rating scale of 0 to -3, in which; 0 was baseline perfusion, -1 mild and -2 moderate reductions in perfusion. a score of -3 was given to a region of deficit which was defined as a clear disconnection in brain ecd uptake in more than 3 continuous slices. the presenting clinical features were noted and patients records were scrutinized for reports of ncct, mri, dsa, and ct angiography (cta). headache was the presenting symptom in 7, seizures in one, loss of vision in one. all the patients in pediatric age group presented with neurological defect as the presenting feature. while majority of the adult subjects had headache and vomiting as the presenting symptom but one patient had sub-arachnoid hemorrhage. following the initial presentation, features of moyamoya disease were detected on dsa in 11 patients, cta in 1, mr angiography in 1. four patients had evidence of parenchymal infarcts on mri and evidence of haemorrhage in two. in our study, unilateral perfusion defects were seen in 10 patients, normal perfusion in 2 and bilateral defects in 5 patients. however, unilateral features of moyamoya disease were found in angiography only in three of them (pts 4, 5 and 11). in one of these patients (pt 11) there was retrograde filling of the middle cerebral artery from the posterior circulation and hence no demonstrable perfusion defects. no perfusion defects despite bilateral vascular changes were noted in one patient (pt 14). cerebral infarcts were detected on mri unilaterally in three subjects while multiple infarcts were identified in one. tc99m-ecd brain spect showed bilateral perfusion defects in one patient with unilateral mri infarcts while in the rest of the patients the defects were more extensive compared to mri. follow up studies following surgical procedures (myo-dura synangiosis) was done in two patients and showed partial resolution of perfusion defects in the involved areas. perfusion defects of the individual patients in the respective cerebral areas are depicted in the table. moyamoya disease is characterised by steno-occlusive changes in the terminal internal carotid artery and involving the proximal portions of the anterior or the middle cerebral arteries with abnormal vascular networks seen in the vicinity of the steno-occlusive disease. extensive fibocellular intimal thickening and deposits of thrombi and lipids with proliferation of smooth muscle cells is the pathogenic feature of the disease. cerebral angiography is considered the gold standard investigation in moyamoya disease as the demonstration of the internal carotid stenosis with formation of collaterals is very effective. mri and ct scans also demonstrate the squeal of the pathology in the form of infarcts and intra-cerebral, subarachnoid and intra-ventricular haemorrhages. tissue level changes of the altered flow dynamics have not been well elucidated in moyamoya disease. in our study we have found that though vascular changes are seen bilaterally (5/14 i.e. 35.7%), in majority of the cases unilateral perfusion defects alone are noted. in their study, ogata et al, found that the rate of vascular events was lower in patients with unilateral spect perfusion defects middle cerebral artery territory, i.e. frontal lobe and parts of the parietal lobe and basal ganglia are most frequently involved [figure 1]. the presence of artero-venous malformation along with features of moyamoya disease in one patient can possibly explain such a phenomenon (pt 13). progression of posterior circulation defects after revascularisation has been described in a study by huang et al. tc99m-ecd brain perfusion spect images in transaxial, sagittal and coronal views showing extensive perfusion defects in the left frontal and parietal lobes tc99m-ecd brain perfusion spect images in transaxial, sagittal and coronal views showing moderate perfusion defects in the right occipital cortex (posterior circulation) along with the parietal, temporal and the thalamus good cerebrovascular reserve was found post acetazolamide in two patients [figure 3]. though the drawback in our study was the usage of oral acetazolamide preparation, obvious visual improvement was noted in the images suggesting adequate effect of the drug. presence of good cerebro-vascular reserve is a known good prognostic factor indicating lesser chances of future events or interventions. tc99m-ecd brain perfusion spect images in transaxial views showing perfusion defect in the right broca's area (a) which shows improvement (b) in the post acetazolamide study our study demonstrates that though the pathological process occurs in the arteries, tc99m-ecd brain spect reflects the result of these pathogenic changes on the cerebral tissue. the perfusion defects might involve both anterior and posterior circulations unilaterally or bilaterally and are better delineated in perfusion imaging compared to anatomical imaging modalities. demonstration of infarcts in posterior cerebral artery territory adds prognostic value, predicting occurrence of future infarcts. oral acetazolamide is also effective in demonstration of cerebrovascular reserve though not the ideal mode of administration. our study is lacking adequate follow-up of the patients to show the prognostic implications of the findings of perfusion scintigraphy. we conclude that brain perfusion scintigraphy is an indispensible adjunct in evaluation of patients with moyamoya disease yielding information about the direct end results of the pathology in the vessels and also prognostic information.

background: moyamoya disease is a rare, progressive cerebrovascular disorder caused by intracranial stenosis of the circle of willis, resulting in successive ischemic events. computed tomography (ct) and magnetic resonance imaging (mri) play a major role in diagnosis. objective:the aim of the study was to describe the spectrum of findings on brain spect in patients with moyamoya disease and to compare the findings with other investigations. materials and methods: tc99m-ecd spect scans of seventeen patients (7 children and 10 adults) were analysed to study the brain perfusion. results:features of moyamoya disease were detected on dsa in 11 patients, cta in one, mr angiography in one patient. brain perfusion spect analysis showed unilateral perfusion defects in 11 patients, normal perfusion in 2 and bilateral defects in 4 patients. no perfusion defects despite bilateral vascular changes were noted in one patient. cerebral infarcts were detected on mri unilaterally in three subjects while multiple infarcts were identified in one. tc99m-ecd brain spect showed perfusion defects that were more extensive compared to those detected on mri. post acetazolamide studies for assessment of cerebrovascular reserve were done in three patients. two of them showed good cerebrovascular reserve (> 1). follow-up studies post-surgical procedures (myo-dura synangiosis) done in two patients showed partial resolution of perfusion defects in the involved areas. conclusion:brain perfusion scintigraphy is an important adjunct in evaluation of patients with moyamoya disease yielding information about the direct end results of the pathology in the vessels and also prognostic information.

PMC3237223