texts
sequence
meta
dict
scores
sequence
avg_score
float64
0
0.25
num_sents
int64
5
5
tagged_pii_results
list
[ "LATEST JOB POSTINGS\n\nPerforms necessary activities to complete the \"HSE Self-Management\" • Support the HSE team in the management of information relative to the customer.• Provide support in HSE matter to the Products ...\n\nExecute the design, analysis, or evaluation of projects related to the mechanical design of API 6A Equipment (Wellhead or Flow) using the standards related with oil industry, procedures and product requirements.· ..." ]
{ "pile_set_name": "Pile-CC" }
[ 0.008771929824561403 ]
0.008772
5
[]
[ "Fake Blonde Bounces and Moans On Dildo\n\nFake Blonde Bounces and Moans On Dildo\n\nYou may also like:\n\nAmateur;Big Tits;Blonde;Masturbation;Toys;Teen;Solo Female;Female Orgasm" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.005813953488372093 ]
0.005814
5
[]
[ "Q:\n\nError on \"pod install --verbose\"\n\nI just installed pod with this command\nsudo gem install cocoapods\n\ngit cloned a project from git repository and run pod install --verbose and I get this error:\n\nResolving dependencies of `Podfile`\n[!] ", "Unable to integrate the following embedded targets with their respective host targets (a host target is a \"parent\" target which embeds a \"child\" target like a framework or extension):\n\n- MyApp (true) and OneSignalNotificationServiceExtension (false) do not both set use_frameworks!.", "\n\nI can't get this app tower inside Xcode because of this. ", "I get this error message:\n\nupdate\nthis is my (the only one) Podfile\n\nupdate 2\nafter putting up the use_frameworks! ", "line I get this:\n\nA:\n\nadd use_frameworks! ", "to solve this problem on OneSignalNotificationServiceExtension.", "\n\ntarget 'OneSignalNotificationServiceExtension' do\n use_frameworks!", "\n pod 'OneSignal', '>= 2.5.2', '< 3.0'\nend\n\nA:\n\nOkay! ", " \nLooks like the solution in your case was to move use_frameworks! ", "up and out of a specific target and make it global for the Podfile.", "\nThe issues you're now seeing (in your Update 2) is that you need to go into your Project Settings and fix the ALWAYS_EMBED_SWIFT_STANDARD_LIBRARIES setting. ", " I'd recommend simply removing the build setting.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0041841004184100415, 0, 0.01694915254237288, 0.008695652173913044, 0, 0, 0, 0, 0, 0.014925373134328358, 0, 0, 0 ]
0.003443
5
[ { "analysis_explanation": null, "end": 798, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 761 }, { "analysis_explanation": null, "end": 846, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 807 } ]
[ "\n103 F.Supp.2d 826 (2000)\nSTATE FARM MUTUAL AUTOMOBILE INSURANCE COMPANY, Plaintiff,\nv.\nRichard WALKO and Sharon Walko, Defendants.", "\nNo. ", "3:00 CV 0023.", "\nUnited States District Court, M.D. Pennsylvania.", "\nJuly 6, 2000.", "\n*827 Teresa Ficken Sachs, Britt, Hankins, Schaible & Moughan, Philadelphia, PA, for State Farm Mutual Automobile Insurance Company, plaintiff.", "\nBrian C. Corcoran, Kingston, PA, for Richard Walko, Sharon Walko, defendants.", "\n\nMEMORANDUM\nMUNLEY, District Judge.", "\nBefore the court for disposition is the report and recommendation of Magistrate Judge Raymond J. Durkin which recommends that the defendants' motion to dismiss be denied. ", "The defendants, Richard Walko and Sharon Walko, have filed objections to the report and recommendation. ", "The matter has been fully briefed and is thus ripe for disposition. ", "For the reasons that follow, the objections will be sustained, and the motion to dismiss will be granted.", "\n\nBackground\nDefendant Sharon Walko was involved in an automobile accident on June 17, 1997. ", "At the time of the accident, she was driving a motor vehicle owned by her husband, Defendant Richard Walko. ", "The vehicle was insured through Plaintiff State Farm Mutual Automobile Insurance Company. ", "Two other vehicles owned by Richard Walko were also insured with the Plaintiff. ", "Plaintiff alleges that each policy provided for stacking underinsured motorist coverage in the amount of $15,000.00 per person and $30,000 per occurrence. ", "Plaintiff has paid the Walkos $45,000 in underinsured motorist coverage, which it alleges is the total owed under the three policies (that is $15,000 for each of the three vehicles). ", "Defendants claim that they are actually entitled to a total of $150,000 and are thus still owed $105,000 from the plaintiff. ", "The defendants requested arbitration under their insurance policy to adjudicate the claim. ", "Plaintiff, however, filed the instant declaratory judgment action wherein it seeks to have the court declare that State Farm is not obligated to provide additional underinsured motorist coverage to the defendants for the June 17, 1997 accident. ", "In addition, the plaintiff filed a motion to stay arbitration which was granted by Magistrate Judge Durkin.", "\nDefendants subsequently filed a motion to dismiss pursuant to Federal Rule of Civil Procedure 12(b)(1) asserting that this court lacks subject matter jurisdiction.[1] The magistrate recommends that the defendants' motion to dismiss be denied. *", "828 The defendants have filed objections to the report and recommendation bringing the case to its present posture. ", "After a careful review of the matter, we find that the defendants' objections should be sustained.", "\n\nStandard of Review\nIn disposing of objections to a magistrate's report and recommendation, the district court must make a de novo determination of those portions of the report to which objections are made. ", "28 U.S.C. § 636(b)(1)(C); see also Henderson v. Carlson, 812 F.2d 874, 877 (3d Cir.1987). ", "The court may accept, reject, or modify, in whole or in part, the findings or recommendations made by the magistrate. ", "The judge may also receive further evidence or recommit the matter to the magistrate with instructions. ", "Id.\nIn the instant case, the parties are apparently in agreement that Pennsylvania state law governs the substantive liabilities of the parties. \"", "Under Pennsylvania law, the determination of whether an issue must be submitted to arbitration depends on two factors: (1) whether the parties entered into an agreement to arbitrate, and (2) whether the dispute falls within the scope of that agreement.\" ", "Id. at 46. ", "The question presented here is whether the dispute falls within the scope of the agreement as it is uncontested that the parties have in fact entered into an arbitration agreement. ", "Further, any ambiguities in the policy must be resolved against the insurance company. ", "Brennan v. General Accident Fire & Life Assurance, Corp., 524 Pa. 542, 574 A.2d 580 (1990).", "\nThe insurance policy at issue provides as follows:\nDeciding Fault and Amount — Coverages U, U3, W and W3 Two questions must be decided by agreement between the insured and us:\n1. ", "Is the insured legally entitled to collect compensatory damages from the owner or driver of an uninsured motor vehicle or underinsured motor vehicle; and\n2. ", "If so, in what amount?", "\nIf there is no agreement, these two questions shall be decided by arbitration at the request of the insured or us. ", "The arbitrators' decision shall be limited to these two questions. ", "The arbitrators shall not award damages under this policy which are in excess of the limits of liability of this coverage as shown on the declarations page. ", "The Pennsylvania Uniform Arbitration Act, as amended from time to time, shall apply.", "\nComplaint Exhibit A, Insurance Policy at page 19 (emphasis in original).", "\nTo decide whether the instant case should be in arbitration, we must determine what the issues are and the scope of the arbitration clause. ", "In its complaint, plaintiff claims that the underlying dispute is whether the policy forms used by State Farm and executed by Richard Walko, requesting limits of underinsured motorist coverage lower than the limits of liability coverage, are invalid and unenforceable as violative of the Pennsylvania Motor Vehicle Financial Responsibility Law. ", "Complaint ¶ 12. ", "Defendants frame the underlying issue as follows: \"The crux of the dispute between the Plaintiff and the Defendants involves whether or not the `sign down' and waiver forms prepared by the Plaintiff are valid under the Pennsylvania Motor Vehicle Financial Responsibility Law.\" ", "Motion To Dismiss, ¶ 4. ", "Defendants proceed to explain that \"[t]he policy does not specifically exclude, from the province of the arbitrators, consideration of coverage issues or stacking and waiver issues.\" ", "Id. at ¶ 5. ", "We must decide whether these matters fall within the scope of the arbitration provision.", "\nIn determining the scope of an arbitration provision, courts examine the language granting authority to the arbitrators and for any language limiting the arbitrator's jurisdiction. ", "Brennan v. General Accident Fire & Life Assurance Corp. 524 Pa. 542, 574 A.2d 580 (1990); Nationwide Ins. ", "Co. v. Patterson, 953 F.2d 44 (3d *829 Cir.1991). ", "The Patterson court noted that \"... the vast majority of district court decisions applying Pennsylvania law have held that questions concerning the extent of coverage under an insurance policy are within the scope of the arbitration clause unless there is language in the clause which explicitly excludes coverage issues from the scope of arbitration.\" ", "Id. at 47. ", "As set forth above, the instant controversy appears to fit into the arbitration clause as the parties are disputing coverage under the policy. ", "Consequently, we must examine the clause to determine if there is any language in policy which explicitly excludes the present issue.", "\nPlaintiff State Farm maintains that the arbitration clause is not applicable because the following limitation is imposed: \"The arbitrators shall not award damages under this policy which are in excess of the limits of liability of this coverage as shown on the declarations page.\" ", "Complaint Exhibit A, Insurance Policy at page 19. ", "Plaintiff's position is that the defendants have already been awarded the amount shown on the declarations page. ", "Accordingly, the arbitrators would not be able to award them any additional damages pursuant to the plain language of the arbitration clause, and the matter is not appropriate for arbitration.", "\nWe do not agree with the plaintiff. ", "The arbitration clause language that plaintiff cites merely limits the amount of damages that the arbitration panel can award — it does not limit the matters which are subject to arbitration. ", "It does not clearly exclude any topic from arbitrators including the coverage issues in the instant case. ", "Case law indicates that language excluding matters from arbitration can be very clear. ", "For example, the United States District Court for the Eastern District of Pennsylvania found that the following language excluded coverage issues from arbitration: \"Questions between the injured party and us regarding whether the injured party is an insured under this coverage, or the limits of such coverage are not subject to arbitration and shall be decided by a court of law.\" ", "Troebs v. Nationwide Ins. ", "Co., 1998 WL 546078 (E.D.Pa.). ", "In the instant case, the policy provides that coverage issues are proper for arbitration and then attempts to limit the amount that the arbitrators can award without limiting the topics that are subject to arbitration.", "\nInasmuch as the disputed language from the arbitration clause may be an attempt to remove some topics from arbitration, we find it to be ambiguous. ", "As such it is properly interpreted against the insurer. ", "Bateman v. Motorists Mutual Ins. ", "Co., 527 Pa. 241, 590 A.2d 281, 283 (1991) (\"Where the provision of the policy is ambiguous, the policy provision is construed in favor of the insured and against the insurer, the drafter of the instrument.\").", "\nMoreover, merely because the defendants seek to arbitrate an issue does not necessarily mean that more damages will be awarded. ", "The arbitrators may, in fact rule for the plaintiff and find no more damages are appropriate. ", "Otherwise, if the arbitrators find that more damages are necessary, above the amount currently listed on the policy, they can reasonably substitute the amount they find is proper as the amount listed on the declarations page and award it without violating the policy.", "\nIn addition to arguing that the matter does not fall within the arbitration provision, plaintiff also alleges that as a matter of law, the subject of the dispute is not proper for arbitration. ", "We disagree.", "\nUnder the law, when a claimant attacks a particular provision of a clause in an insurance contract as being contrary to a constitutional, legislative, or administrative mandate, jurisdiction may properly lie with a federal district court, Schultz v. Aetna Casualty and Surety Co., 443 Pa.Super. ", "659, 663 A.2d 166, 168 (1995). ", "Plaintiff claims that the court, rather than arbitrators, should decide issues of whether policy provisions themselves are valid and enforceable. ", "Apparently *830 their position is that such matters necessarily involve constitutional, legislative, or administrative mandate. ", "Contrary to the plaintiff's position, case law indicates that this case is proper for arbitration. ", "See Nealy v. State Farm Mutual Automobile Ins. ", "Co., 695 A.2d 790 (Pa.Super.1997).", "\nIn Nealy, a case dealing with jurisdiction in an automobile insurance setting, one of the issues was whether the waivers that the claimants signed pursuant to 75 Pa.C.S.A. § 1734 were invalid, thus entitling the claimants to a greater amount of stacked uninsured/underinsured motorist benefits. ", "Id. at 791. ", "The court found that jurisdiction over the matter rested with the arbitrators, and the courts were even without jurisdiction to hear an appeal of the matter. ", "Id. at 792. ", "See also Prudential Property and Casualty Ins. ", "Co. v. Goshgarian, 1995 WL 56604 (E.D.Pa.) (", "Issue of whether husband-defendant specifically waived any stacking of coverage when he signed a rejection of Stacked Underinsured Coverage Limits provision should be heard by arbitrators). ", "As set forth above, the issue in the instant case is similar to Nealy and accordingly it is also appropriate for arbitration. ", "Accordingly, plaintiff's argument is without merit, and the subject matter is not barred from arbitration.", "\nFor the foregoing reasons, the defendants' motion to dismiss will be granted, and the objections to the report and recommendation sustained.", "\nNOTES\n[1] Defendants style their motion as one under F.R.C.P. 12(b)1, lack of subject matter jurisdiction. ", "The Third Circuit, however, has held that in situations such as this the appropriate rule is 12(b)6. ", "Rule 12(b)1 deals with subject matter jurisdiction, which this court has as there is diversity of citizenship and an amount in controversy in excess of $75,000.00. ", "Compl. ¶ ", "3. ", "Rule 12(b)6 deals with not stating a cause of action upon which relief can be granted and is the correct rule to rely on in matters involving arbitration. ", "Nationwide Ins. ", "v. Patterson, 953 F.2d 44, 45 n. 1 (3d Cir.1991). ", "For purposes of judicial economy, we shall treat the motion as if it had been filed under Rule 12(b)6.", "\n" ]
{ "pile_set_name": "FreeLaw" }
[ 0.030534351145038167, 0, 0, 0.02040816326530612, 0, 0.02097902097902098, 0.038461538461538464, 0, 0.011627906976744186, 0.019230769230769232, 0, 0, 0.010752688172043012, 0.009259259259259259, 0.011111111111111112, 0.025, 0, 0, 0, 0, 0.004081632653061225, 0.018691588785046728, 0.004081632653061225, 0, 0, 0, 0.011111111111111112, 0, 0, 0, 0, 0, 0, 0, 0.02197802197802198, 0, 0, 0, 0, 0, 0, 0.011904761904761904, 0, 0, 0.008695652173913044, 0, 0.01444043321299639, 0, 0, 0, 0, 0, 0.018867924528301886, 0.02, 0.0028328611898017, 0, 0, 0, 0, 0.02, 0.008849557522123894, 0, 0, 0, 0, 0, 0.002617801047120419, 0, 0, 0, 0, 0, 0.030303030303030304, 0, 0, 0, 0, 0, 0, 0.013513513513513514, 0, 0, 0, 0, 0.02127659574468085, 0, 0, 0, 0, 0, 0.02127659574468085, 0.022727272727272728, 0.005263157894736842, 0, 0.009433962264150943, 0, 0, 0.009900990099009901, 0, 0, 0, 0, 0, 0.02, 0, 0 ]
0.004898
5
[ { "analysis_explanation": null, "end": 23, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19 }, { "analysis_explanation": null, "end": 100, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87 }, { "analysis_explanation": null, "end": 117, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 105 }, { "analysis_explanation": null, "end": 142, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 135 }, { "analysis_explanation": null, "end": 196, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 179 }, { "analysis_explanation": null, "end": 210, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 198 }, { "analysis_explanation": null, "end": 236, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 217 }, { "analysis_explanation": null, "end": 286, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 274 }, { "analysis_explanation": null, "end": 290, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 288 }, { "analysis_explanation": null, "end": 372, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 355 }, { "analysis_explanation": null, "end": 382, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 374 }, { "analysis_explanation": null, "end": 386, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 384 }, { "analysis_explanation": null, "end": 405, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 392 }, { "analysis_explanation": null, "end": 419, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 407 }, { "analysis_explanation": null, "end": 450, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 444 }, { "analysis_explanation": null, "end": 571, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 554 }, { "analysis_explanation": null, "end": 668, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 655 }, { "analysis_explanation": null, "end": 685, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 673 }, { "analysis_explanation": null, "end": 950, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 938 }, { "analysis_explanation": null, "end": 1006, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 993 }, { "analysis_explanation": null, "end": 1114, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1101 }, { "analysis_explanation": null, "end": 1247, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1234 }, { "analysis_explanation": null, "end": 1470, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1464 }, { "analysis_explanation": null, "end": 2074, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2057 }, { "analysis_explanation": null, "end": 2191, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2185 }, { "analysis_explanation": null, "end": 2903, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2894 }, { "analysis_explanation": null, "end": 3253, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3241 }, { "analysis_explanation": null, "end": 3336, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3324 }, { "analysis_explanation": null, "end": 3581, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3579 }, { "analysis_explanation": null, "end": 3858, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3851 }, { "analysis_explanation": null, "end": 3940, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3936 }, { "analysis_explanation": null, "end": 4037, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4035 }, { "analysis_explanation": null, "end": 4051, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4045 }, { "analysis_explanation": null, "end": 5078, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5065 }, { "analysis_explanation": null, "end": 6073, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6066 }, { "analysis_explanation": null, "end": 6153, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6149 }, { "analysis_explanation": null, "end": 6188, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6179 }, { "analysis_explanation": null, "end": 6235, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6226 }, { "analysis_explanation": null, "end": 6325, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6313 }, { "analysis_explanation": null, "end": 6584, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6582 }, { "analysis_explanation": null, "end": 7951, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7934 }, { "analysis_explanation": null, "end": 7991, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7971 }, { "analysis_explanation": null, "end": 8007, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7995 }, { "analysis_explanation": null, "end": 8338, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8334 }, { "analysis_explanation": null, "end": 8857, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8853 }, { "analysis_explanation": null, "end": 9968, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9961 }, { "analysis_explanation": null, "end": 10045, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10041 }, { "analysis_explanation": null, "end": 10430, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10425 }, { "analysis_explanation": null, "end": 10490, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10487 }, { "analysis_explanation": null, "end": 10681, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10677 }, { "analysis_explanation": null, "end": 11050, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11046 }, { "analysis_explanation": null, "end": 11331, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11326 }, { "analysis_explanation": null, "end": 12204, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12195 }, { "analysis_explanation": null, "end": 8, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4 }, { "analysis_explanation": null, "end": 8356, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 8350 }, { "analysis_explanation": null, "end": 10012, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 10007 }, { "analysis_explanation": null, "end": 10492, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 10487 }, { "analysis_explanation": null, "end": 11067, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 11061 }, { "analysis_explanation": null, "end": 4037, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 4035 }, { "analysis_explanation": null, "end": 4047, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 4045 }, { "analysis_explanation": null, "end": 8348, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8342 } ]
[ "Pure red cell aplasia characterized by erythropoietic maturation arrest. ", "Response to anti-thymocyte globulin.", "\nPure red cell aplasia is a syndrome characterized by markedly decreased erythropoiesis. ", "On bone marrow examination, there are typically less than 0.5 percent erythroblasts, but sometimes a picture of maturation arrest can be seen. ", "This report describes a patient with maturation arrest of erythropoiesis at the basophilic normoblast stage who had a response to an eight-day course of anti-thymocyte globulin with a return of normal erythropoiesis." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 483, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 474 } ]
[ "Bollards are typically set in place to obstruct passage of pedestrian and vehicle traffic. ", "As such, they are continuously subjected to various surface and structural damaging phenomena, including weathering, pollution, vandalism, physical contact, and others. ", "In many instances, these phenomena reduce the service lifetime of a bollard." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0, 0, 0 ]
0
5
[]
[ "// Copyright (c) 2018 Demerzel Solutions Limited\n// This file is part of the Nethermind library.", "\n// \n// The Nethermind library is free software: you can redistribute it and/or modify\n// it under the terms of the GNU Lesser General Public License as published by\n// the Free Software Foundation, either version 3 of the License, or\n// (at your option) any later version.", "\n// \n// The Nethermind library is distributed in the hope that it will be useful,\n// but WITHOUT ANY WARRANTY; without even the implied warranty of\n// MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", "See the\n// GNU Lesser General Public License for more details.", "\n// \n// You should have received a copy of the GNU Lesser General Public License\n// along with the Nethermind. ", "If not, see <http://www.gnu.org/licenses/>.", "\n// \n\nusing Nethermind.", "Core;\n\nnamespace Nethermind.", "Crypto\n{\n public class ProtectedPrivateKeyFactory : IProtectedPrivateKeyFactory\n {\n private readonly ICryptoRandom _random;\n private readonly ITimestamper _timestamper;\n\n public ProtectedPrivateKeyFactory(ICryptoRandom random, ITimestamper timestamper)\n {\n _random = random;\n _timestamper = timestamper;\n }\n\n public ProtectedPrivateKey Create(PrivateKey privateKey) => new ProtectedPrivateKey(privateKey, _random, _timestamper);\n }\n}\n" ]
{ "pile_set_name": "Github" }
[ 0.010101010101010102, 0.010830324909747292, 0, 0, 0.008849557522123894, 0.023255813953488372, 0.043478260869565216, 0, 0 ]
0.010724
5
[ { "analysis_explanation": null, "end": 23, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19 }, { "analysis_explanation": null, "end": 90, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80 }, { "analysis_explanation": null, "end": 122, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 112 }, { "analysis_explanation": null, "end": 399, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 389 }, { "analysis_explanation": null, "end": 757, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 747 }, { "analysis_explanation": null, "end": 824, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 814 }, { "analysis_explanation": null, "end": 853, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 843 }, { "analysis_explanation": null, "end": 1042, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1031 }, { "analysis_explanation": null, "end": 1328, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1298 }, { "analysis_explanation": null, "end": 1351, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1340 }, { "analysis_explanation": null, "end": 800, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 772 } ]
[ "---\nabstract: |\n We report measurements of the branching fractions for $B^0\\rightarrow\\pi^+\\pi^-$, $K^+\\pi^-$, $K^+K^-$ and $K^0\\pi^0$, and $B^+\\rightarrow\\pi^+\\pi^0$, $K^+\\pi^0$, $K^0\\pi^+$ and $K^+\\overline{K}{}^0$. The results are based on 10.4 fb$^{-1}$ of data collected on the $\\Upsilon$(4S) resonance at the KEKB $e^+e^-$ storage ring with the Belle detector, equipped with a high momentum particle identification system for clear separation of charged $\\pi$ and $K$ mesons. ", "We find ${\\cal B}(B^0\\rightarrow\\pi^+\\pi^-)\n =(0.56^{\\ +0.23}_{\\ -0.20}\\pm 0.04)\\times 10^{-5}$, ${\\cal B}(B^0\\rightarrow K^+\\pi^-)\n =(1.93^{\\ +0.34\\ +0.15}_{\\ -0.32\\ -0.06})\\times 10^{-5}$, ${\\cal B}(B^+\\rightarrow K^+\\pi^0)\n =(1.63^{\\ +0.35\\ +0.16}_{\\ -0.33\\ -0.18})\\times 10^{-5}$, ${\\cal B}(B^+\\rightarrow K^0\\pi^+)\n =(1.37^{\\ +0.57\\ +0.19}_{\\ -0.48\\ -0.18})\\times 10^{-5}$, and ${\\cal B}(B^0\\rightarrow K^0\\pi^0)\n =(1.60^{\\ +0.72\\ +0.25}_{\\ -0.59\\ -0.27})\\times 10^{-5}$, where the first and second errors are statistical and systematic. ", "We also set upper limits of ${\\cal B}(B^+\\rightarrow\\pi^+\\pi^0)<1.34\\times 10^{-5}$, ${\\cal B}(B^0\\rightarrow K^+K^-)<0.27\\times 10^{-5}$, and ${\\cal B}(B^+\\rightarrow K^+\\overline{K}{}^0)<0.50\\times 10^{-5}$ at the $90\\%$ confidence level.", "\n\n PACS numbers: 13.25.Hw, 14.40.Nd\\\n---\n\n-3cm KEK Preprint 2001-11\\\nBelle Preprint 2001-5\\\n\n[ **Measurement of Branching Fractions for\\\n$B\\rightarrow \\pi\\pi$, $K\\pi$ and $KK$ Decays [^1]** ]{}\n\n0.5cm\n\n(The Belle Collaboration)\\\n0.2cm\n\nK. Abe$^{10}$, K. Abe$^{37}$, I. Adachi$^{10}$, Byoung Sup Ahn$^{15}$, H. Aihara$^{38}$, M. Akatsu$^{20}$, G. Alimonti$^{9}$, Y. Asano$^{42}$, T. Aso$^{41}$, V. Aulchenko$^{2}$, T. Aushev$^{13}$, A. M. Bakich$^{34}$, W. Bartel$^{6,10}$, S. Behari$^{10}$, P. K. Behera$^{43}$, D. Beiline$^{2}$, A. Bondar$^{2}$, A. Bozek$^{16}$, T. E. Browder$^{9}$, B. C. K. Casey$^{9}$, P. Chang$^{24}$, Y. Chao$^{24}$, K. F. Chen$^{24}$, B. G. Cheon$^{33}$, S.-K. Choi$^{8}$, Y. Choi$^{33}$, S. Eidelman$^{2}$, Y. Enari$^{20}$, R. Enomoto$^{10,11}$, F. Fang$^{9}$, H. Fujii$^{10}$, M. Fukushima$^{11}$, A. Garmash$^{2,10}$, A. Gordon$^{18}$, K. Gotow$^{44}$, R. Guo$^{22}$, J. Haba$^{10}$, H. Hamasaki$^{10}$, K. Hanagaki$^{30}$, F. Handa$^{37}$, K. Hara$^{28}$, T. Hara$^{28}$, N. C. Hastings$^{18}$, H. Hayashii$^{21}$, M. Hazumi$^{28}$, E. M. Heenan$^{18}$, I. Higuchi$^{37}$, T. Higuchi$^{38}$, H. Hirano$^{40}$, T. Hojo$^{28}$, Y. Hoshi$^{36}$, W.-S. Hou$^{24}$, S.-C. Hsu$^{24}$, H.-C. Huang$^{24}$, Y. Igarashi$^{10}$, T. Iijima$^{10}$[^2], H. Ikeda$^{10}$, K. Inami$^{20}$, A. Ishikawa$^{20}$, H. Ishino$^{39}$, R. Itoh$^{10}$, G. Iwai$^{26}$, H. Iwasaki$^{10}$, Y. Iwasaki$^{10}$, D. J. Jackson$^{28}$, P. Jalocha$^{16}$, H. K. Jang$^{32}$, M. Jones$^{9}$, H. Kakuno$^{39}$, J. Kaneko$^{39}$, J. H. Kang$^{45}$, J. S. Kang$^{15}$, N. Katayama$^{10}$, H. Kawai$^{3}$, H. Kawai$^{38}$, T. Kawasaki$^{26}$, H. Kichimi$^{10}$, D. W. Kim$^{33}$, Heejong Kim$^{45}$, H. J. Kim$^{45}$, Hyunwoo Kim$^{15}$, S. K. Kim$^{32}$, K. Kinoshita$^{5}$, S. Kobayashi$^{31}$, P. Krokovny$^{2}$, R. Kulasiri$^{5}$, S. Kumar$^{29}$, A. Kuzmin$^{2}$, Y.-J. Kwon$^{45}$, J. S. Lange$^{7}$, M. H. Lee$^{10}$, S. H. Lee$^{32}$, D. Liventsev$^{13}$, R.-S. Lu$^{24}$, D. Marlow$^{30}$, T. Matsubara$^{38}$, S. Matsumoto$^{4}$, T. Matsumoto$^{20}$, Y. Mikami$^{37}$, K. Miyabayashi$^{21}$, H. Miyake$^{28}$, H. Miyata$^{26}$, G. R. Moloney$^{18}$, S. Mori$^{42}$, T. Mori$^{4}$, A. Murakami$^{31}$, T. Nagamine$^{37}$, Y. Nagasaka$^{19}$, T. Nakadaira$^{38}$, E. Nakano$^{27}$, M. Nakao$^{10}$, J. W. Nam$^{33}$, S. Narita$^{37}$, S. Nishida$^{17}$, O. Nitoh$^{40}$, S. Noguchi$^{21}$, T. Nozaki$^{10}$, S. Ogawa$^{35}$, T. Ohshima$^{20}$, T. Okabe$^{20}$, S. Okuno$^{14}$, S. L. Olsen$^{9}$, H. Ozaki$^{10}$, P. Pakhlov$^{13}$, H. Palka$^{16}$, C. S. Park$^{32}$, C. W. Park$^{15}$, H. Park$^{15}$, L. S. Peak$^{34}$, M. Peters$^{9}$, L. E. Piilonen$^{44}$, J. L. Rodriguez$^{9}$, N. Root$^{2}$, M. Rozanska$^{16}$, K. Rybicki$^{16}$, J. Ryuko$^{28}$, H. Sagawa$^{10}$, Y. Sakai$^{10}$, H. Sakamoto$^{17}$, M. Satapathy$^{43}$, A. Satpathy$^{10,5}$, S. Schrenk$^{5}$, S. Semenov$^{13}$, K. Senyo$^{20}$, M. E. Sevior$^{18}$, H. Shibuya$^{35}$, B. Shwartz$^{2}$, V. Sidorov$^{2}$, J.B. Singh$^{29}$, S. Stanič$^{42}$, A. Sugi$^{20}$, A. Sugiyama$^{20}$, K. Sumisawa$^{28}$, T. Sumiyoshi$^{10}$, J.-I. Suzuki$^{10}$, K. Suzuki$^{3}$[^3], S. Suzuki$^{20}$, S. Y. Suzuki$^{10}$, S. K. Swain$^{9}$, H. Tajima$^{38}$, T. Takahashi$^{27}$, F. Takasaki$^{10}$, M. Takita$^{28}$, K. Tamai$^{10}$, N. Tamura$^{26}$, J. Tanaka$^{38}$, M. Tanaka$^{10}$, G. N. Taylor$^{18}$, Y. Teramoto$^{27}$, M. Tomoto$^{20}$, T. Tomura$^{38}$, S. N. Tovey$^{18}$, K. Trabelsi$^{9}$, T. Tsuboyama$^{10}$, T. Tsukamoto$^{10}$, S. Uehara$^{10}$, K. Ueno$^{24}$, Y. Unno$^{3}$, S. Uno$^{10}$, Y. Ushiroda$^{17,10}$, Y. Usov$^{2}$, S. E. Vahsen$^{30}$, G. Varner$^{9}$, K. E. Varvell$^{34}$, C. C. Wang$^{24}$, C. H. Wang$^{23}$, J. G. Wang$^{44}$, M.-Z. Wang$^{24}$, Y. Watanabe$^{39}$, E. Won$^{32}$, B. D. Yabsley$^{10}$, Y. Yamada$^{10}$, M. Yamaga$^{37}$, A. Yamaguchi$^{37}$, H. Yamamoto$^{9}$, Y. Yamashita$^{25}$, M. Yamauchi$^{10}$, S. Yanaka$^{39}$, M. Yokoyama$^{38}$, Y. Yusa$^{37}$, H. Yuta$^{1}$, C.C. Zhang$^{12}$, J. Zhang$^{42}$, H. W. Zhao$^{10}$, Y. Zheng$^{9}$, V. Zhilich$^{2}$, and D. Žontar$^{42}$\n\n$^{1}$[Aomori University, Aomori]{}\\\n$^{2}$[Budker Institute of Nuclear Physics, Novosibirsk]{}\\\n$^{3}$[Chiba University, Chiba]{}\\\n$^{4}$[Chuo University, Tokyo]{}\\\n$^{5}$[University of Cincinnati, Cincinnati, OH]{}\\\n$^{6}$[Deutsches Elektronen–Synchrotron, Hamburg]{}\\\n$^{7}$[University of Frankfurt, Frankfurt]{}\\\n$^{8}$[Gyeongsang National University, Chinju]{}\\\n$^{9}$[University of Hawaii, Honolulu HI]{}\\\n$^{10}$[High Energy Accelerator Research Organization (KEK), Tsukuba]{}\\\n$^{11}$[Institute for Cosmic Ray Research, University of Tokyo, Tokyo]{}\\\n$^{12}$[Institute of High Energy Physics, Chinese Academy of Sciences, Beijing]{}\\\n$^{13}$[Institute for Theoretical and Experimental Physics, Moscow]{}\\\n$^{14}$[Kanagawa University, Yokohama]{}\\\n$^{15}$[Korea University, Seoul]{}\\\n$^{16}$[H. Niewodniczanski Institute of Nuclear Physics, Krakow]{}\\\n$^{17}$[Kyoto University, Kyoto]{}\\\n$^{18}$[University of Melbourne, Victoria]{}\\\n$^{19}$[Nagasaki Institute of Applied Science, Nagasaki]{}\\\n$^{20}$[Nagoya University, Nagoya]{}\\\n$^{21}$[Nara Women’s University, Nara]{}\\\n$^{22}$[National Kaohsiung Normal University, Kaohsiung]{}\\\n$^{23}$[National Lien-Ho Institute of Technology, Miao Li]{}\\\n$^{24}$[National Taiwan University, Taipei]{}\\\n$^{25}$[Nihon Dental College, Niigata]{}\\\n$^{26}$[Niigata University, Niigata]{}\\\n$^{27}$[Osaka City University, Osaka]{}\\\n$^{28}$[Osaka University, Osaka]{}\\\n$^{29}$[Panjab University, Chandigarh]{}\\\n$^{30}$[Princeton University, Princeton NJ]{}\\\n$^{31}$[Saga University, Saga]{}\\\n$^{32}$[Seoul National University, Seoul]{}\\\n$^{33}$[Sungkyunkwan University, Suwon]{}\\\n$^{34}$[University of Sydney, Sydney NSW]{}\\\n$^{35}$[Toho University, Funabashi]{}\\\n$^{36}$[Tohoku Gakuin University, Tagajo]{}\\\n$^{37}$[Tohoku University, Sendai]{}\\\n$^{38}$[University of Tokyo, Tokyo]{}\\\n$^{39}$[Tokyo Institute of Technology, Tokyo]{}\\\n$^{40}$[Tokyo University of Agriculture and Technology, Tokyo]{}\\\n$^{41}$[Toyama National College of Maritime Technology, Toyama]{}\\\n$^{42}$[University of Tsukuba, Tsukuba]{}\\\n$^{43}$[Utkal University, Bhubaneswer]{}\\\n$^{44}$[Virginia Polytechnic Institute and State University, Blacksburg VA]{}\\\n$^{45}$[Yonsei University, Seoul]{}\\\n\nAbstract\n\n-0.5cm\n\nThe charmless hadronic $B$ decays $B\\rightarrow\\pi\\pi$, $K\\pi$ and $KK$ provide a rich sample to test the standard model and to probe new physics [@phys]. ", "Of particular interest are indirect and direct $CP$ violation in the $\\pi\\pi$ and $K\\pi$ modes, which are related to the angles $\\phi_2$ and $\\phi_3$ of the unitarity triangle, respectively [@phys]. ", "Measurements of branching fractions of these decay modes are an important first step toward these $CP$ violation studies. ", "However, experimental information is rather limited, and the only published results come from one experiment [@cleo]. ", "One of the key experimental issues is the particle identification (PID) for separation of the high momentum charged $\\pi$ and $K$ mesons. ", "This is one of the primary reasons that the $B$ factory experiments [@ichep_belle; @ichep_babar] have been equipped with specialized high momentum PID devices.", "\n\nIn this paper, we report the first results of the Belle experiment on charmless hadronic two-body $B$ decays into $\\pi\\pi$, $K\\pi$ and $KK$ final states. ", "The decay modes studied are $\\pi^+\\pi^-$, $K^+\\pi^-$, $K^+K^-$ and $K^0\\pi^0$ for $B^0$ decays, and $\\pi^+\\pi^0$, $K^+\\pi^0$, $K^0\\pi^+$, $K^+\\overline{K}{}^0$, for $B^+$ decays. ", "For the modes with $K^0$ mesons, only $K^0_S\\rightarrow\\pi^+\\pi^-$ decays are used. ", "Throughout this paper, the inclusion of charge conjugate states is implied. ", "The results are based on data taken by the Belle detector [@belle] at the KEKB asymmetric $e^+e^-$ storage ring [@kekb]. ", "The Belle detector is equipped with aerogel Čerenkov counters (ACC) configured for high momentum PID. ", "The data set consists of 10.4 fb$^{-1}$ data taken at the $\\Upsilon$(4S) resonance, corresponding to 11.1 million $B\\overline{B}$ events, and 0.6 fb$^{-1}$ data taken at an energy $\\sim$60 MeV below the resonance, for systematic studies of the continuum $q\\overline{q}$ background.", "\n\nPrimary charged tracks are required to satisfy track quality cuts based on their impact parameters relative to the interaction point (IP). ", "$K^0_S$ mesons are reconstructed using pairs of charged tracks that have an invariant mass within $\\pm$30 MeV/$c^2$ of the known $K^0_S$ mass and a well reconstructed vertex that is displaced from the IP. ", "Candidate $\\pi^0$ mesons are reconstructed using $\\gamma$ pairs with an invariant mass within $\\pm$16 MeV/$c^2$ of the nominal $\\pi^0$ mass. ", "The $B$ meson candidates are reconstructed using the beam constrained mass, $m_{bc}=\\sqrt{E_{\\rm beam}^2-p_B^2}$, and the energy difference, $\\Delta E=E_B-E_{\\rm beam}$, where $E_{\\rm beam}\\equiv\\sqrt{s}/2\\simeq 5.290$ GeV, and $p_B$ and $E_B$ are the momentum and energy of the reconstructed $B$ in the $\\Upsilon$(4S) rest frame, respectively. ", "The signal region for each variable is defined as $\\pm 3\\sigma$ from its central value. ", "The resolution in $m_{bc}$ is dominated by the beam energy spread and is typically 2.7 MeV/$c^2$. The $\\Delta E$ resolution ranges from 20 to 25 MeV, depending on the momentum and energy resolutions for each particle. ", "Normally we compute $\\Delta E$ assuming a $\\pi$ mass for each charged particle. ", "This shifts $\\Delta E$ downward by 44 MeV for each charged $K$ meson, giving kinematic separation between the $h\\pi^+$ and $hK^+$ $(h=\\pi, K)$ final states. ", "In modes with $\\pi^0$ mesons, both the $m_{bc}$ and $\\Delta E$ distributions are asymmetric due to $\\gamma$ interactions in the material in front of the calorimeter and energy leakage out of the calorimeter. ", "We accept events in the region $m_{bc}>5.2$ GeV/$c^2$ and $|\\Delta E|<0.25$ GeV for the $h^+h^-$ and $K^0_Sh^+$ modes, and $-0.45<\\Delta\nE<0.15$ GeV for the $h^+\\pi^0$ and $K^0_S\\pi^0$ modes. ", "In this kinematic window, the area outside the signal region is defined as a sideband. ", "The signal reconstruction efficiencies after the kinematic window cut are 65% for $h^+h^-$, 33% for $K^0_Sh^+$, 50% for $h^+\\pi^0$, and 24% for $K^0_S\\pi^0$, according to a GEANT [@geant] based Monte Carlo (MC) simulation. ", "The MC tracking efficiency is verified by detailed studies using high momentum tracks from $D$, $\\eta$ and $K^*$ decays. ", "The reconstruction efficiencies for high momentum $K^0_S$ and $\\pi^0$ mesons are tested by comparing the ratio of the yield of $D^+\\rightarrow K^0_S\\pi^+$ to $D^+\\rightarrow K^-\\pi^+\\pi^+$ and $D^0\\rightarrow K^-\\pi^+\\pi^0$ to $D^0\\rightarrow K^-\\pi^+$, respectively, between data and MC simulation. ", "From these studies, we assign a relative systematic error in these efficiencies of 2.3% per charged track, 12% per $K^0_S$ and 8.5% per $\\pi^0$ meson.", "\n\nThe background from $b\\rightarrow c$ transitions is negligible. ", "The dominant background is from the continuum $q\\overline{q}$ process. ", "We suppress this background using the event topology, which is spherical for $B\\overline{B}$ events and jet-like for $q\\overline{q}$ events in the $\\Upsilon$(4S) rest frame. ", "This difference can be quantified by using several variables including the event sphericity, $S$, the angle between the $B$ candidate thrust axis and the thrust axis of the rest of the event, $\\theta_T$, and the Fox-Wolfram moments [@fw] $H_l=\\sum_{i,j}{|\\vec{p_i}||\\vec{p_j}|P_l(\\cos\\theta_{ij})}$, where the indices $i$ and $j$ run over all final state particles, $\\vec{p}_i$ and $\\vec{p}_j$ are the momentum vectors of particles $i$ and $j$, $P_l$ is the $l$-th Legendre polynomial, and $\\theta_{ij}$ is the angle between particles $i$ and $j$. We can also use the $B$ flight direction, $\\theta_B$, and the decay axis direction, $\\theta_{hh}$, which distinguish $B\\overline{B}$ from $q\\overline{q}$ processes based on initial state angular momentum.", "\n\nWe increase the suppression power of the normalized Fox-Wolfram moments, $R_l=H_l/H_0$, by decomposing them into three terms: $R_l=R_l^{ss}+R_l^{so}+R_l^{oo}=(H_l^{ss}+H_l^{so}+H_l^{oo})/H_0$, where the indices $ss$, $so$, and $oo$ indicate respectively that both, one, or neither of the particles comes from a $B$ candidate. ", "These are combined into a six term Fisher discriminant [@fisher] called the Super Fox-Wolfram [@sfw] defined as $SFW=\\sum^{4}_{l=1}{(\\alpha_lR_l^{so}+\\beta_lR_l^{oo})}$, where $\\alpha_l$ and $\\beta_l$ are Fisher coefficients and $l$=2,4 for $\\alpha_l$ and $R_l^{so}$. The terms $R_l^{ss}$ and $R_{l=1,3}^{so}$ are excluded because they are strongly correlated with $m_{bc}$ and $\\Delta E$. In the $h^+h^-$ modes, for example, $SFW$ gives a 20% increase in the expected significance compared to $R_2$.\n\nWe combine different $q\\overline{q}$ suppression variables into a single likelihood, ${\\cal L}_{s(q\\overline{q})}=\\prod_i{{\\cal L}_{s(q\\overline{q})}^i}$, where the ${\\cal L}_{s(q\\overline{q})}^i$ denotes the signal($q\\overline{q}$) likelihood of the suppression variable $i$, and select candidate events by cutting on the likelihood ratio ${\\cal R}_s={\\cal L}_s/({\\cal L}_s+{\\cal L}_{q\\overline{q}})$. For $h^+h^-$ and $K^0_Sh^+$, the likelihood contains $SFW$, $\\cos\\theta_B$, and $\\cos\\theta_{hh}$. In modes with $\\pi^0$ mesons, the $q\\overline{q}$ background is significantly larger. ", "In this case, we first make a loose cut on $\\cos\\theta_T$. Next, we extend $SFW$ to include $\\cos\\theta_T$ and $S$, and form the likelihood using this extended $SFW$ and $\\cos\\theta_B$. In each case, the signal probability density functions (PDFs) are determined using MC simulation and the $q\\overline{q}$ PDFs are taken from $m_{bc}$ sideband data. ", "The performance of ${\\cal R}_s$ varies among the modes with efficiencies ranging from $40$% to $51\\%$ while removing more than $95\\%$ of the $q\\overline{q}$ background. ", "The $\\pi^+\\pi^0$ mode calls for a tighter cut with an efficiency of $26\\%$. The error in these efficiencies is determined by applying the same procedure to the $B^+\\rightarrow\\overline{D}{}^0\\pi^+$, $\\overline{D}{}^0\\rightarrow K^-\\pi^+$ event sample and comparing the cut efficiencies between data and MC. ", "The relative systematic error is determined to be $4\\%$.\n\nThe high momentum charged $\\pi$ and $K$ mesons ($1.5<p_{h^{\\pm}}<4.5$ GeV/$c$ in the laboratory frame) are distinguished by cutting on the $\\pi (K)$ likelihood ratio ${\\cal R}_{\\pi(K)}\\equiv{\\cal L}_{\\pi (K)}/({\\cal L}_{\\pi}+{\\cal L}_K)$, where ${\\cal L}_{\\pi (K)}$ denotes the product of each $\\pi (K)$ likelihood of their energy loss ($dE/dx$) in the central drift chamber and their Čerenkov light yield in the ACC. ", "Each likelihood is calculated from a PDF determined using MC simulation. ", "The PID efficiency and fake rate are measured using $\\pi$ and $K$ tracks in the same kinematic range as signal, with kinematically selected $D^{*+}\\rightarrow D^0\\pi^+$, $D^0\\rightarrow K^-\\pi^+$ decays. ", "The efficiency and fake rate for $\\pi$ mesons are measured to be 92% and 4% (true $\\pi$ fakes $K$), whereas those for $K$ mesons are 85% and 10% (true $K$ fakes $\\pi$), respectively. ", "The relative systematic error in the PID efficiency is 2.5% per charged $\\pi$ or $K$ meson.", "\n\nFigure \\[fig:fig1\\] shows the $m_{bc}$ and $\\Delta E$ distributions in the signal region of the other variable, for the $\\pi^+\\pi^-$, $K^+\\pi^-$ and $K^0_S\\pi^+$ modes. ", "Each $m_{bc}$ and $\\Delta E$ distribution is fitted to a Gaussian signal plus a background function. ", "The $m_{bc}$ and $\\Delta E$ peak positions and $m_{bc}$ width are calibrated using the $B^+\\rightarrow\\overline{D}{}^0\\pi^+$, $\\overline{D}{}^0\\rightarrow K^+\\pi^-$ data sample. ", "The $\\Delta E$ Gaussian width is calibrated using high momentum $D^0\\rightarrow K^-\\pi^+$ and $D^+\\rightarrow K^0_S\\pi^+$ decays. ", "The $m_{bc}$ background shape is modeled by the ARGUS background function [@argus] with parameters determined using positive $\\Delta E$ sideband data. ", "A linear function is used to model the shape of the $\\Delta E$ background; the slope is fixed at the value determined from the $m_{bc}$ sideband. ", "The signal yields are determined from the $\\Delta E$ fits where there is kinematic separation between the $h\\pi^+$ and $hK^+$ decays. ", "The $\\pi^+\\pi^-$ and $K^+\\pi^-$ fits include a component to account for misidentified backgrounds. ", "The normalizations of these components are free parameters. ", "The extracted yields are listed in Table \\[tab:table1\\]. ", "The cross-talk among different signal modes is consistent with expectations based on PID fake rates. ", "No excess is observed in the $K^+K^-$ and $K^+K^0_S$ modes.", "\n\nFigure \\[fig:fig2\\] shows the $m_{bc}$ and $\\Delta E$ projections for the $\\pi^+\\pi^0$, $K^+\\pi^0$ and $K^0_S\\pi^0$ modes. ", "For these modes, since the $\\Delta E$ distribution has a long tail, a two-dimensional fit is applied to the $m_{bc}$ and $\\Delta E$ distributions. ", "The signal distribution is modeled by a smoothed two-dimensional MC histogram, while the background distribution is taken to be the product of the $m_{bc}$ and $\\Delta E$ background functions discussed above. ", "The signal and background shapes are determined following the same procedure as for the $h^+h^-$ and $K^0_Sh^+$ modes. ", "The $\\Delta E$ resolution is calibrated using $D^0\\rightarrow K^-\\pi^+\\pi^0$ decays where the $\\pi^0$ is reconstructed in the same kinematic range as the signal. ", "For the $\\pi^+\\pi^0$ mode, since the cross-talk from $K^+\\pi^0$ is expected to be large and the $\\Delta E$ separation is less than 1$\\sigma$, the $K^+\\pi^0$ component is fixed at its expected level. ", "The obtained yields are listed in Table \\[tab:table1\\].", "\n\nThe systematic error in the signal yield is determined by varying the parameters of the fitting functions within $\\pm 1\\sigma$ of their nominal values. ", "The changes in the signal yield from each variation are added in quadrature. ", "These errors range from 1% to 6%. ", "In the $K^+\\pi^-$ mode, the $\\Delta E$ background normalization is influenced by an excess around $-175$ MeV. In this region, we expect to observe a few background events from $B$ decays such as $B\\rightarrow\\rho\\pi$, $K^*\\pi$, and $K^*\\gamma$ (for modes with $\\pi^0$ mesons), based on a MC simulation [@pdg; @ichep_cleo] in all signal modes. ", "To estimate their effect, we either exclude the negative $\\Delta E$ sideband from the fit or add these components to the fit based on MC histograms. ", "The resulting change in the signal yield, ranging from 4% to 10%, is added in quadrature to the above systematic error.", "\n\nTable \\[tab:table1\\] summarizes all results. ", "The statistical significance ($\\Sigma$) is defined as $\\sqrt{-2\\ln ({\\cal L}(0)/{\\cal L}_{\\rm max})}$, where ${\\cal L}_{\\rm max}$ and ${\\cal L}(0)$ denote the maximum likelihood with the nominal signal yield and with the signal yield fixed at zero, respectively [@pdg]. ", "The final systematic error is the quadratic sum of the relative error in the signal yield ($N_s$), the reconstruction, PID, and continuum suppression efficiencies, and the number of $B\\overline{B}$ pairs (1%). ", "If $\\Sigma <3$, we set a $90\\%$ confidence level upper limit on the signal yield ($N_s^{\\rm U.L.}$) from the relation $\\int^{N_s^{\\rm U.L.}}_0{{\\cal L}(N_s)dN_s}/\n\\int^{\\infty}_0{{\\cal L}(N_s)dN_s}=0.9$, where ${\\cal L}(N_s)$ denotes the maximum likelihood with the signal yield fixed at $N_s$. The branching fraction upper limit (U.L.) is then calculated by increasing $N_s^{\\rm U.L.}$ and reducing the efficiency by their systematic errors.", "\n\nIn summary, using 11.1 million $B\\overline{B}$ events recorded in the Belle detector, the charge averaged branching fractions for $B\\rightarrow \\pi^+\\pi^-$, $K^+\\pi^-$, $K^+\\pi^0$, $K^0\\pi^+$, and $K^0\\pi^0$ are measured with statistically significant signals. ", "For the $\\pi^+\\pi^0$ mode, an excess is seen with marginal significance. ", "No excess is observed for the $K^+K^-$ and $K^+\\overline{K}{}^0$ modes. ", "For these modes, 90% confidence level upper limits are set. ", "The results are listed in Table \\[tab:table1\\]. ", "In Table \\[tab:table2\\], we list some ratios of branching fractions based on these measurements. ", "Recent theoretical work [@phys] suggests that the ratio ${\\cal B}(B^+\\rightarrow \\pi^+\\pi^0)/{\\cal B}(B^0\\rightarrow \\pi^+\\pi^-)$ is relevant for extracting $\\phi_2$, the ratio ${\\cal B}(B^+\\rightarrow K^+\\pi^0)/{\\cal B}(B^0\\rightarrow K^+\\pi^-)$ is relevant for determining the contribution from electro-weak penguins, and the remaining four ratios are useful to constrain $\\phi_3$. All the branching fraction and ratio results are consistent with other measurements [@cleo; @ichep_babar]. ", "Our results confirm that ${\\cal B}(B^0\\rightarrow K^+\\pi^-)$ is larger than ${\\cal B}(B^0\\rightarrow\\pi^+\\pi^-)$, and indicate that ${\\cal B}(B^+\\rightarrow h^+\\pi^0)$ and ${\\cal B}(B^0\\rightarrow K^0\\pi^0)$ seem to be larger than expected in relation to the $B^0\\rightarrow h^+\\pi^-$ and $B^+\\rightarrow K^0\\pi^+$ modes based on isospin or penguin dominance arguments [@phys].", "\n\nWe wish to thank the KEKB accelerator group for the excellent operation of the KEKB accelerator. ", "We acknowledge support from the Ministry of Education, Culture, Sports, Science, and Technology of Japan and the Japan Society for the Promotion of Science; the Australian Research Council and the Australian Department of Industry, Science and Resources; the Department of Science and Technology of India; the BK21 program of the Ministry of Education of Korea and the CHEP SRC program of the Korea Science and Engineering Foundation; the Polish State Committee for Scientific Research under contract No.2P03B 17017; the Ministry of Science and Technology of Russian Federation; the National Science Council and the Ministry of Education of Taiwan; the Japan-Taiwan Cooperative Program of the Interchange Association; and the U.S. Department of Energy.", "\n\n[99]{}\n\n**References**\n\n8.5cm\n\n8.5cm\n\n Mode $N_s$ $\\Sigma$ $\\epsilon$ \\[%\\] ${\\cal B}$ \\[$\\times 10^{-5}$\\] U.L. \\[$\\times 10^{-5}$\\]\n -------------------------------------- --------------------------------------- ---------- ------------------ ------------------------------------------ ---------------------------\n $B^0\\rightarrow\\pi^+\\pi^-$ $17.7^{\\ +7.1\\ +0.3}_{\\ -6.4\\ -1.1}$ 3.1 28.1 $0.56^{\\ +0.23}_{\\ -0.20}\\pm 0.04$ –\n $B^+\\rightarrow\\pi^+\\pi^0$ $10.4^{\\ +5.1\\ +1.2}_{\\ -4.3\\ -1.6}$ 2.7 12.0 $0.78^{\\ +0.38\\ +0.08}_{\\ -0.32\\ -0.12}$ $1.34$\n $B^0\\rightarrow K^+\\pi^-$ $60.3^{\\ +10.6\\ +2.7}_{\\ -9.9\\ -1.1}$ 7.8 28.0 $1.93^{\\ +0.34\\ +0.15}_{\\ -0.32\\ -0.06}$ –\n $B^+\\rightarrow K^+\\pi^0$ $34.9^{\\ +7.6\\ +0.6}_{\\ -7.0\\ -2.0}$ 7.2 19.2 $1.63^{\\ +0.35\\ +0.16}_{\\ -0.33\\ -0.18}$ –\n $B^+\\rightarrow K^0\\pi^+$ $10.3^{\\ +4.3\\ +0.4}_{\\ -3.6\\ -0.1}$ 3.5 13.5 $1.37^{\\ +0.57\\ +0.19}_{\\ -0.48\\ -0.18}$ –\n $B^0\\rightarrow K^0\\pi^0$ $8.4^{\\ +3.8\\ +0.4}_{\\ -3.1\\ -0.6}$ 3.9 9.4 $1.60^{\\ +0.72\\ +0.25}_{\\ -0.59\\ -0.27}$ –\n $B^0\\rightarrow K^+K^-$ $0.2^{\\ +3.8}_{\\ -0.2}$ – 24.0 – 0.27\n $B^+\\rightarrow K^+\\overline{K}{}^0$ $0.0^{\\ +0.9}_{\\ -0.0}$ – 12.1 – 0.50\n\n : Summary of the results. ", "The obtained signal yield ($N_s$), statistical significance ($\\Sigma$), efficiency ($\\epsilon$), charge averaged branching fraction ($\\cal B$) and its 90% confidence level upper limit (U.L.) are shown. ", "In the calculation of ${\\cal B}$, the production rates of $B^+B^-$ and $B^0\\overline{B}{}^0$ pairs are assumed to be equal. ", "In the modes with $K^0$ mesons, $N_s$ and $\\epsilon$ are quoted for $K^0_S$, while ${\\cal B}$ and U.L. are for $K^0$. Submode branching fractions for $K^0_S\\rightarrow\\pi^+\\pi^-$ and $\\pi^0\\rightarrow\\gamma\\gamma$ are included in $\\epsilon$. The first and second errors in $N_s$ and ${\\cal B}$ are statistical and systematic errors, respectively. []{", "data-label=\"tab:table1\"}\n\n --------------------------------------------------------------------------------------\n Modes Ratio\n ----------------------------------------- --------------------------------------------\n ${\\cal B}(B^+\\rightarrow \\pi^+\\pi^0) / $ < 2.67 $\n {\\cal B}(B^0\\rightarrow \\pi^+\\pi^-)$ \n\n $2\\,{\\cal B}(B^+\\rightarrow K^+\\pi^0) / $ 1.69^{\\ +0.46\\ +0.17}_{\\ -0.45\\ -0.19} $\n {\\cal B}(B^0\\rightarrow K^+\\pi^-)$ \n\n ${\\cal B}(B^0\\rightarrow\\pi^+\\pi^-) / $ 0.29^{\\ +0.13\\ +0.01}_{\\ -0.12\\ -0.02} $\n {\\cal B}(B^0\\rightarrow K^+\\pi^-)$ \n\n ${\\cal B}(B^0\\rightarrow K^+\\pi^-) / $ 0.60^{\\ +0.25\\ +0.11}_{\\ -0.29\\ -0.16} $\n 2\\,{\\cal B}(B^0\\rightarrow K^0\\pi^0)$ \n\n $2\\,{\\cal B}(B^+\\rightarrow K^+\\pi^0) / $ 2.38^{\\ +0.98\\ +0.39}_{\\ -1.10\\ -0.26} $\n {\\cal B}(B^+\\rightarrow K^0\\pi^+)$ \n\n ${\\cal B}(B^0\\rightarrow K^+\\pi^-) / $ 1.41^{\\ +0.55\\ +0.22}_{\\ -0.63\\ -0.20}$\n {\\cal B}(B^+\\rightarrow K^0\\pi^+)$ \n --------------------------------------------------------------------------------------\n\n : Ratio of charge averaged branching fractions (${\\cal B}$) for $B\\rightarrow\\pi\\pi$, and $ K\\pi$ decays. ", "The first error is statistical and the second is systematic. ", "The correlation and cancellation of systematic errors are taken into account. ", "A 90% confidence level upper limit in the first ratio, is calculated using a similar method as the upper limit of ${\\cal B}$ described in text. []{", "data-label=\"tab:table2\"}\n\n[^1]: submitted to PRL\n\n[^2]: e-mail: toru.iijima@kek.jp\n\n[^3]: e-mail: kazuhito@bmail.kek.jp\n" ]
{ "pile_set_name": "ArXiv" }
[ 0, 0.008960573476702509, 0.004166666666666667, 0.019129898179574206, 0.010050251256281407, 0, 0.00847457627118644, 0.007246376811594203, 0.018867924528301886, 0.00641025641025641, 0.00558659217877095, 0, 0, 0.024793388429752067, 0.0196078431372549, 0.0035587188612099642, 0.0070921985815602835, 0.004878048780487805, 0, 0, 0, 0.0045871559633027525, 0, 0, 0, 0, 0, 0.008968609865470852, 0.01652892561983471, 0.0033333333333333335, 0, 0, 0, 0, 0.003989361702127659, 0.003048780487804878, 0.005504587155963303, 0, 0.005917159763313609, 0, 0.008403361344537815, 0.0136986301369863, 0.00980392156862745, 0, 0.01098901098901099, 0.005847953216374269, 0, 0, 0.007692307692307693, 0.013245033112582781, 0, 0, 0.010101010101010102, 0, 0.017543859649122806, 0.009900990099009901, 0, 0, 0, 0, 0, 0, 0, 0.01818181818181818, 0, 0, 0, 0.0058309037900874635, 0, 0, 0, 0.007407407407407408, 0.004761904761904762, 0.004524886877828055, 0, 0, 0, 0, 0.020833333333333332, 0, 0.006109979633401222, 0.007957559681697613, 0.020202020202020204, 0.02127659574468085, 0.0016769144773616546, 0, 0.008064516129032258, 0.005714285714285714, 0.011503697617091208, 0, 0, 0.006802721088435374, 0.025 ]
0.005202
5
[ { "analysis_explanation": null, "end": 27107, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_140094861343664", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 27089 }, { "analysis_explanation": null, "end": 27144, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_140094861343664", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 27123 }, { "analysis_explanation": null, "end": 322, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 318 }, { "analysis_explanation": null, "end": 359, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 354 }, { "analysis_explanation": null, "end": 583, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 563 }, { "analysis_explanation": null, "end": 1251, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1243 }, { "analysis_explanation": null, "end": 1463, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1453 }, { "analysis_explanation": null, "end": 1604, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1588 }, { "analysis_explanation": null, "end": 1622, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1606 }, { "analysis_explanation": null, "end": 1641, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1624 }, { "analysis_explanation": null, "end": 1711, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1695 }, { "analysis_explanation": null, "end": 1732, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1713 }, { "analysis_explanation": null, "end": 1752, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1734 }, { "analysis_explanation": null, "end": 1791, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1772 }, { "analysis_explanation": null, "end": 1795, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1793 }, { "analysis_explanation": null, "end": 1843, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1828 }, { "analysis_explanation": null, "end": 1850, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1845 }, { "analysis_explanation": null, "end": 1886, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1866 }, { "analysis_explanation": null, "end": 1938, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1924 }, { "analysis_explanation": null, "end": 1958, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1940 }, { "analysis_explanation": null, "end": 1992, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1978 }, { "analysis_explanation": null, "end": 2050, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2030 }, { "analysis_explanation": null, "end": 2082, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2052 }, { "analysis_explanation": null, "end": 2103, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2084 }, { "analysis_explanation": null, "end": 2124, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2105 }, { "analysis_explanation": null, "end": 2142, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2126 }, { "analysis_explanation": null, "end": 2190, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2176 }, { "analysis_explanation": null, "end": 2247, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2232 }, { "analysis_explanation": null, "end": 2302, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2281 }, { "analysis_explanation": null, "end": 2322, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2304 }, { "analysis_explanation": null, "end": 2340, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2324 }, { "analysis_explanation": null, "end": 2361, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2342 }, { "analysis_explanation": null, "end": 2399, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2382 }, { "analysis_explanation": null, "end": 2565, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2550 }, { "analysis_explanation": null, "end": 2587, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2584 }, { "analysis_explanation": null, "end": 2620, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2604 }, { "analysis_explanation": null, "end": 2636, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2622 }, { "analysis_explanation": null, "end": 2652, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2638 }, { "analysis_explanation": null, "end": 2671, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2654 }, { "analysis_explanation": null, "end": 2694, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2692 }, { "analysis_explanation": null, "end": 2731, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2714 }, { "analysis_explanation": null, "end": 2750, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2733 }, { "analysis_explanation": null, "end": 2784, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2768 }, { "analysis_explanation": null, "end": 2802, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2786 }, { "analysis_explanation": null, "end": 2821, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2804 }, { "analysis_explanation": null, "end": 2876, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2862 }, { "analysis_explanation": null, "end": 2893, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2878 }, { "analysis_explanation": null, "end": 2932, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2915 }, { "analysis_explanation": null, "end": 2939, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2934 }, { "analysis_explanation": null, "end": 2959, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2952 }, { "analysis_explanation": null, "end": 2977, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2972 }, { "analysis_explanation": null, "end": 3026, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3010 }, { "analysis_explanation": null, "end": 3067, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3048 }, { "analysis_explanation": null, "end": 3184, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3179 }, { "analysis_explanation": null, "end": 3202, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3197 }, { "analysis_explanation": null, "end": 3234, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3215 }, { "analysis_explanation": null, "end": 3255, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3253 }, { "analysis_explanation": null, "end": 3372, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3351 }, { "analysis_explanation": null, "end": 3390, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3374 }, { "analysis_explanation": null, "end": 3408, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3392 }, { "analysis_explanation": null, "end": 3446, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3410 }, { "analysis_explanation": null, "end": 3481, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3463 }, { "analysis_explanation": null, "end": 3542, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3523 }, { "analysis_explanation": null, "end": 3595, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3579 }, { "analysis_explanation": null, "end": 3649, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3634 }, { "analysis_explanation": null, "end": 3668, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3651 }, { "analysis_explanation": null, "end": 3691, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3688 }, { "analysis_explanation": null, "end": 3775, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3758 }, { "analysis_explanation": null, "end": 3780, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3777 }, { "analysis_explanation": null, "end": 3811, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3794 }, { "analysis_explanation": null, "end": 3828, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3813 }, { "analysis_explanation": null, "end": 3866, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3830 }, { "analysis_explanation": null, "end": 3882, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3868 }, { "analysis_explanation": null, "end": 3901, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3884 }, { "analysis_explanation": null, "end": 3918, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3903 }, { "analysis_explanation": null, "end": 3925, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3920 }, { "analysis_explanation": null, "end": 3964, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3943 }, { "analysis_explanation": null, "end": 3999, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3981 }, { "analysis_explanation": null, "end": 4018, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4001 }, { "analysis_explanation": null, "end": 4070, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4055 }, { "analysis_explanation": null, "end": 4112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4092 }, { "analysis_explanation": null, "end": 4170, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4153 }, { "analysis_explanation": null, "end": 4187, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4172 }, { "analysis_explanation": null, "end": 4227, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4189 }, { "analysis_explanation": null, "end": 4245, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4229 }, { "analysis_explanation": null, "end": 4301, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4284 }, { "analysis_explanation": null, "end": 4316, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4302 }, { "analysis_explanation": null, "end": 4356, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4338 }, { "analysis_explanation": null, "end": 4377, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4358 }, { "analysis_explanation": null, "end": 4419, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4400 }, { "analysis_explanation": null, "end": 4444, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4439 }, { "analysis_explanation": null, "end": 4465, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4460 }, { "analysis_explanation": null, "end": 4495, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4479 }, { "analysis_explanation": null, "end": 4521, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4518 }, { "analysis_explanation": null, "end": 4554, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4538 }, { "analysis_explanation": null, "end": 4589, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4573 }, { "analysis_explanation": null, "end": 4607, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4591 }, { "analysis_explanation": null, "end": 4612, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4609 }, { "analysis_explanation": null, "end": 4646, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4627 }, { "analysis_explanation": null, "end": 4684, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4668 }, { "analysis_explanation": null, "end": 4722, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4704 }, { "analysis_explanation": null, "end": 4788, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4785 }, { "analysis_explanation": null, "end": 4817, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4803 }, { "analysis_explanation": null, "end": 4833, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4819 }, { "analysis_explanation": null, "end": 4906, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4887 }, { "analysis_explanation": null, "end": 4923, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4908 }, { "analysis_explanation": null, "end": 4930, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4925 }, { "analysis_explanation": null, "end": 4964, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4947 }, { "analysis_explanation": null, "end": 4983, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4966 }, { "analysis_explanation": null, "end": 5002, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4985 }, { "analysis_explanation": null, "end": 5101, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5098 }, { "analysis_explanation": null, "end": 5135, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5116 }, { "analysis_explanation": null, "end": 5175, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5159 }, { "analysis_explanation": null, "end": 5180, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5177 }, { "analysis_explanation": null, "end": 5249, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5215 }, { "analysis_explanation": null, "end": 5271, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5266 }, { "analysis_explanation": null, "end": 5300, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5285 }, { "analysis_explanation": null, "end": 5319, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5302 }, { "analysis_explanation": null, "end": 5335, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5321 }, { "analysis_explanation": null, "end": 5574, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5564 }, { "analysis_explanation": null, "end": 5586, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5576 }, { "analysis_explanation": null, "end": 5678, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5669 }, { "analysis_explanation": null, "end": 5771, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5765 }, { "analysis_explanation": null, "end": 5781, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5773 }, { "analysis_explanation": null, "end": 6303, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6294 }, { "analysis_explanation": null, "end": 6580, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6568 }, { "analysis_explanation": null, "end": 7025, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7019 }, { "analysis_explanation": null, "end": 7033, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7027 }, { "analysis_explanation": null, "end": 7191, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7186 }, { "analysis_explanation": null, "end": 7414, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7407 }, { "analysis_explanation": null, "end": 7541, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7531 }, { "analysis_explanation": null, "end": 8432, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8420 }, { "analysis_explanation": null, "end": 8552, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8547 }, { "analysis_explanation": null, "end": 9038, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9033 }, { "analysis_explanation": null, "end": 9068, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9064 }, { "analysis_explanation": null, "end": 9120, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9115 }, { "analysis_explanation": null, "end": 9405, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9394 }, { "analysis_explanation": null, "end": 10779, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10774 }, { "analysis_explanation": null, "end": 10853, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10850 }, { "analysis_explanation": null, "end": 11560, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11549 }, { "analysis_explanation": null, "end": 11690, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11686 }, { "analysis_explanation": null, "end": 12661, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12652 }, { "analysis_explanation": null, "end": 12674, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12671 }, { "analysis_explanation": null, "end": 12932, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12918 }, { "analysis_explanation": null, "end": 13275, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13264 }, { "analysis_explanation": null, "end": 13579, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13573 }, { "analysis_explanation": null, "end": 13749, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13743 }, { "analysis_explanation": null, "end": 13847, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13832 }, { "analysis_explanation": null, "end": 16431, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16428 }, { "analysis_explanation": null, "end": 16481, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16476 }, { "analysis_explanation": null, "end": 16644, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16633 }, { "analysis_explanation": null, "end": 16717, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16709 }, { "analysis_explanation": null, "end": 20802, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20797 }, { "analysis_explanation": null, "end": 21454, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21437 }, { "analysis_explanation": null, "end": 21555, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21540 }, { "analysis_explanation": null, "end": 21826, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21814 }, { "analysis_explanation": null, "end": 22618, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22614 }, { "analysis_explanation": null, "end": 22962, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22957 }, { "analysis_explanation": null, "end": 25272, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25268 }, { "analysis_explanation": null, "end": 25448, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25444 }, { "analysis_explanation": null, "end": 25946, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25937 }, { "analysis_explanation": null, "end": 26531, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26521 }, { "analysis_explanation": null, "end": 27047, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27041 }, { "analysis_explanation": null, "end": 27107, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 27101 }, { "analysis_explanation": null, "end": 27144, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 27132 } ]
[ "Q:\n\nHow many (unordered) bases does $\\Bbb F_q^n$ have as a vector space over $\\Bbb F_q$?", "\n\nFollowing the recommendation here to get this question out of the unanswered queue, I've changed this from a proof-verification question into an answer-your-own.", "\nHere's the question again in case someone has their own proof (which may be better than my own below):\n\nHow many (unordered) bases does $\\Bbb F_q^n$ have as a vector space over $\\Bbb F_q$?", "\n\nA:\n\nWe shall first consider how many different ordered bases $\\Bbb F_q^n$ has.", "\nRecall that $|GL_n(\\Bbb F_q)|=(q^n-1)(q^n-q)\\cdots(q^n-q^{n-1})$. Each element of $GL_n(\\Bbb F_q)$ represents a linear map that carries the standard (ordered) basis $\\{e_1, e_2, \\ldots, e_n\\}$ to another ordered basis. ", "We can establish a bijection between the ordered bases of $\\Bbb F_q^n$ with the elements of $GL_n(\\Bbb F_q)$ by the rule \n$$\\{v_1, \\ldots, v_n\\}\\mapsto\\text{the linear extension of the map that carries the standard basis to } \\{v_1, \\ldots, v_n\\}$$\nThus we know how many ordered bases $\\Bbb F_q^n$ has. ", "Now we define an equivalence relation on the set of all ordered bases of $\\Bbb F_q^n$. We call two ordered bases equivalent if they are permutations of one another. ", "The quotient set under this equivalence relation is clearly in bijection with the set of all unordered bases of $\\Bbb F_q^n$. Overmore, each equivalence class has the same number of elements, namely $n!$ since there are $n!$ permutations of any ordered basis. ", "Since the set of unordered bases is in bijection with the quotient set we have that the total number of unordered bases of $\\Bbb F_q^n$ is:\n$$\\frac{(q^n-1)(q^n-q)\\cdots(q^n-q^{n-1})}{n!}$$\nThis approach can be mirrored to conclude that the number of linearly independent subsets of order $k$ is:\n$$\\frac{(q^n-1)(q^n-q)\\cdots(q^n-q^{k-1})}{k!}$$\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0, 0, 0.004545454545454545, 0, 0, 0.0038461538461538464, 0 ]
0.000932
5
[ { "analysis_explanation": null, "end": 1127, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1120 }, { "analysis_explanation": null, "end": 1340, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1324 } ]
[ "Antiarrhythmic drugs and the modulation of autonomic control of heart rate in rabbits.", "\nA model of the components of autonomic control of heart rate was developed and used for the evaluation of quantitative contribution of sympathetic and vagal tone to cardiac function. ", "In conscious rabbits, sequential inhibition of muscarinic and beta receptors was produced and the relative contributions of vagal and sympathetic tone were characterized. ", "Based on the model, the magnitude of presynaptic interaction between the vagal and sympathetic nerve endings was evaluated. ", "From data in the literature, similar analysis of the control of heart rate was performed for the rat, dog, and human subject and compared with that of the rabbit. ", "The results show that the resting rabbit heart is under less vagal tone than sympathetic tone as compared with other species. ", "The effects of acute administration of amiodarone on the sympathetic and parasympathetic control of heart rate as well as intrinsic heart rate were investigated. ", "Amiodarone decreased the heart rate, which resulted from a direct effect on the sinoatrial (SA) node. ", "In addition, it attenuated the vagal as well as the sympathetic effects on the SA node. ", "The effect on vagal component was greater. ", "Further, the effects of other antiarrhythmic drugs on the electrocardiographic PP and PR intervals were studied. ", "The usefulness of this model for the analysis of the effects of antiarrhythmic drugs is presented." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0, 0, 0, 0.00980392156862745, 0.011363636363636364, 0, 0, 0 ]
0.001764
5
[]
[ "Introduction {#s1}\n============\n\nMost arthropod sense organs are embedded in cuticular compartments and are relatively inaccessible. ", "It is possible to record from bristle organ sensory cells after clipping off the bristle tip and applying an electrode to the cut end (Corfas and Dudai, [@B4]). *", "Drosophila\\'s* Johnston\\'s organ (JO), which constitutes the fly\\'s ear is enclosed in a cuticular chamber, the second antennal segment (A2) and although it has been possible to record extracellularly from its afferent nerve process (Eberl et al., [", "@B8]), it has not as yet been possible to record intracellularly from the constituent cells of the chordotonal organ, as it has in larger insects (Hill, [@B18]; Field and Matheson, [@B10]).", "\n\nAlthough, it is now possible to patch-clamp *Drosophila* CNS in semi-intact preparations (Wilson et al., [", "@B34]), the exoskeleton has for the most part thwarted access to neurons and sensory structures buried within small cuticular compartments. ", "Pioneering work by Dubin and Harris ([@B7]) showed that it was possible to obtain patch clamp recordings from olfactory sensory neurons in *Drosophila\\'s* third antennal segment (A3), cut open with iridectomy scissors. ", "However, there is a need for a procedure that makes access simpler, more accurate and applicable to even smaller compartments. ", "Providing open access to these compartments is essential if one is to be able to voltage clamp the cells, do single channel recordings or apply pharmacological agents.", "\n\nIn this communication we describe a method for opening the exoskeleton of arthropods that can be used to access small compartments not amenable to conventional microscopic dissection and expose, in a live state, the enclosed cells. ", "There is a long history of using sliced arthropod eye preparations in neuroscience (Hartline et al., [", "@B17]; Hadjilazaro and Baumann, [@B15]; Wu and Pak, [@B35]). ", "Our method modifies and extends this approach, by using a viscous photo-polymerizable resin that can be rapidly light cured, to support and anchor the cuticle. ", "We believe that the method could be of value in a variety of physiological and pharmacological experiments on *Drosophila\\'s* JO and many other arthropod organs, appendages and brains.", "\n\nMaterials and methods {#s2}\n=====================\n\n*Drosophila* strains\n--------------------\n\nFor initial tests to develop the protocol, we used a Canton S wild type strain. ", "To visualize membranes of all neurons in the fly, including those in the antenna, we used a *w elav*^*C155*^*-Gal4 UAS-mCD8-GFP* strain (Bloomington *Drosophila* Stock Center stock \\#5146). ", "The *elav*^*C155*^*-Gal4* driver expresses in all neurons (Lin and Goodman, [@B22]). ", "For Ca^2+^ imaging, we crossed *w elav*^*C155*^*-Gal4* females (Bloomington *Drosophila* Stock Center stock \\#458) with homozygous *w; UAS-GCaMP6m* males (Bloomington *Drosophila* Stock Center stock \\#42748). ", "To record voltage-dependent fluorescence changes, we crossed homozygous *w; JO15-2-Gal4* females to *w; UAS-ArcLight*^*attP40*^ homozygous males (Bloomington *Drosophila* Stock Center stock \\#51057) (Cao et al., [", "@B2]). ", "The *JO15-2* line, which expresses in the JO-A and JO-B subgroups of JO neurons, was derived from the original third chromosome *JO15* insertion (Sharma et al., [", "@B31]; Kamikouchi et al., [", "@B20]) by P-element remobilization to the second chromosome.", "\n\n*Drosophila* saline\n-------------------\n\nOur saline was based on the formulations of Wilson and Laurent ([@B33]) and Hardie et al. ([", "@B16]). ", "To optimize the recording we used a goggatomized *Drosophila* eye preparation where extracellular potentials in the retina were recorded with a glass electrode. ", "Oxygenation of the saline proved unnecessary for sustaining the vitality of the preparations.", "\n\nDrosophila saline (DS) in mM: 120 NaCl, 3 mM KCl, 1 CaCl~2~, 4 MgCl~2~, 4 NaHCO3, 1 NaH~2~PO~4~, 8 D-trehalose, 5 D-glucose, 2.5 L-alanine, 2.5 L-proline, 5 L-glutamine, and 5 TES (pH 7.15).", "\n\nImaging and electrophysiology\n-----------------------------\n\nPreparations were inserted into \\~ 1 mm ball of soft dental wax (white square ropes, Heraeus Kulzer, South Bend, IN) melted onto a 12 mm diameter cover glass that was placed in a perfusion chamber (Siskiyou Corp., Grants Pass, OR) and imaged on an Olympus BX50WI upright microscope equipped with a Hamamatsu ORCA-Flash 4.0 CMOS camera, with illumination provided by an X-Cite 120 LED (Excelitas Technologies Corp., Waltham, MA) through a Semrock (Rochester, NY) BrightLine filter set (472/30 Bandpass, 495 Dichroic and a 520/35 Bandpass) and controlled by MetaMorph software (Molecular Devices, Sunnyvale, CA).", "\n\nThe images in **Figure 8** were acquired on a Zeiss Axio Examiner upright microscope using a Plan Apochromat 40 × N.A. 1.0 water immersion objective (Zeiss, Germany), using a Colibri LED system (Zeiss, Germany) with excitation at 470 nm. ", "The objective C-mount image was projected onto the 80 × 80 pixel chip of a NeuroCCD-SM camera controlled by NeuroPlex software (RedShirtImaging, Decatur, GA). ", "For image demagnification we used an Optem C-to-C mount 25-70-54 0.38 × (Qioptiq LINOS, Fairport, NY).", "\n\nFor scanning electron microscopy, goggatomized preparations were fixed overnight in 2.5% paraformaldehyde and 2% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4) at 4°C, then rinsed with phosphate buffer, dehydrated, subjected to critical point drying, mounted on stubs and coated with gold. ", "The samples were examined with a Hitachi S-4800 scanning electron microscope.", "\n\nCells were stimulated with a glass microelectrode (\\~5 MΩ) filled with DS which was controlled by pClamp software (version 9) through a Digidata 1322A (Molecular Devices, Sunnyvale, CA) coupled to an AMPI Iso-Flex stimulus isolator.", "\n\nLight cured resin (LCR)\n-----------------------\n\nThe LCR composition: 70% BisGMA (bisphenol A diglycidyl methacrylate), 28.75% HEMA (2-hydroxy methacrylate), 1% EDMAB (2-ethyl dimethyl-4-aminobenzoate) and 0.25% CQ (camphorquinone).", "\n\nLCR was cured with a SDI Radii Plus LED curing light with a light intensity of 1.5 W cm^−2^ and a peak at 460 nm.", "\n\nA tungsten needle or electrode (\\~28 gauge and \\~2″ long) can be used for picking up a larger bead of LCR that can be used for the conventional goggatomy. ", "For the free-arista-goggatomy smaller quantities of LCR are needed. ", "In this case a tungsten needle can be coated with a thin layer of hard dental wax that the LCR wets (regular stick wax, Whip Mix Corp., Louisville, KY). ", "The cured LCR is cut with a carbon steel Feather blade (Ted Pella Inc.).", "\n\nAnalysis of the LCR\n-------------------\n\nReal Time Fourier Transform Infrared spectroscopy (FTIR) studies were performed using Nicolet Fisher Nexus 670. ", "Samples of the LCR were placed between two sodium chloride plates using 25 μm spacer beads. ", "Conversion was evaluated using the absorption band at 1636 cm^−1^.\n\nDifferential Scanning Calorimetry (DSC) studies were performed using a Perkin Elmer Diamond Differential Scanning Calorimeter modified to allow illumination of polymer samples. ", "Heat evolved from the polymerization reaction was used to evaluate reaction behavior using a plain aluminum pan as a reference.", "\n\nFor both Real Time FTIR and DSC reactions were monitored for 3 min to evaluate reaction duration. ", "All experiments were performed using a Rembrandt Allegro™ lamp. ", "A light intensity of 1.5 W cm^−2^ with peak irradiance at 450 nm.", "\n\nAll chemicals were from Sigma-Aldrich. ", "All data are expressed as mean ± SEM, with all the data measured from different preparations. ", "All mean responses, unless otherwise noted, were significantly different from the baseline noise as judged by a two-tailed Student *t*-test with *p* \\< 0.001.", "\n\nResults {#s3}\n=======\n\nThe method described here is simple; the body part is coated with a custom formulated light cured resin (LCR), which is applied as a viscous liquid and then cured to a solid by exposure to light. ", "The sample embedded in the cured compound is then sliced with a fine razor blade while covered with a physiological saline (Figure [1](#F1){ref-type=\"fig\"}). ", "The cured resin supports and reinforces the exoskeleton as the blade moves through it preventing its collapse and provides a handle for manipulating and positioning the sectioned material.", "\n\n![**", "Schematic of the goggatomy procedure. (", "A)** Sequence of steps illustrated for a *Drosophila* head (read left to right). ", "The gray rectangle represents the surface of a plastic petri dish. **(", "B)** Approximate level of section to produce intact JOs. **(", "C)** Goggatomized head in chip of LCR inserted into wax. **(", "D)** Higher powered view of a different sectioned head. ", "Scale bar 100μm.](fphys-07-00398-g0001){#F1}\n\nWe have called the procedure a \"goggatomy,\" from the South African word for insect, gogga (/\\'xɒxə/ <http://www.oxforddictionaries.com/definition/learner/gogga>) which derives from the Khoisan language; the original inhabitants of South Africa who have a unique click based language (Haacke and Eiseb, [@B14]).", "\n\nThe LCR used for this procedure is clear and becomes hard after a few seconds of irradiance with a blue light (460 nm). ", "We will also show how it can be used to affix insects to a substrate and how it can be used to aid the viewing of neurons in intact animals.", "\n\nWe illustrate the method using the A2 of *Drosophila melanogaster*. ", "The head of a cold-anesthetized fly is cut off with a blade and placed posterior side down on the cover of a 35 mm plastic petri dish. ", "Details of the procedure are given in the Appendix and an online [video](#SM1){ref-type=\"supplementary-material\"} is available at <http://www.youtube.com/watch?v=rH5aOc7ZKjY> and in Supplementary Material. ", "A small drop of LCR is applied to the anterior side of the head and allowed to flow over it. ", "The droplet should be a little larger than the head (\\~2 μl) and is applied with a thin needle. ", "Once the resin has covered the head a small drop of water (\\~10 μl) is placed over the LCR. ", "The resin is then cured with a dental curing light held within a few millimeters of the LCR drop for 1 min. ", "The water serves two purposes: (1) It reduces the amount of oxygen, which inhibits curing of the outer layer of resin. (", "2) It helps dissipate heat (*vide infra*). ", "The water is wiped off the cured drop with a tissue and a drop of *Drosophila* saline (DS---see Methods) is placed over the cured LCR. ", "A new blade is cleaned with ethanol, broken into quarters and used to slice through the embedded head. ", "Under a dissecting microscope, the blade is carefully oriented in the plane that one desires to cut. ", "The blade is then firmly and quickly drawn through the encapsulated head, cleaving it into two pieces. ", "As soon as the cuticle is breached, DS flows into the cut. ", "The cuticle is securely embedded in the cured LCR and the separated LCR chips can be handled with forceps and placed in a dish with DS. ", "The cured LCR is denser than water and sinks the sample to the bottom of the dish. ", "To hold and position the sample we use a small piece of soft dental wax melted onto a 12 mm circular coverslip. ", "An edge of the LCR chip containing the sample is simply pressed into the wax at the appropriate orientation.", "\n\nWe use the top of a 35 mm tissue culture dish as a work surface, since it forms an ideal platform that can be held and orientated with one hand while the other cuts through the embedded insect. ", "Moreover, the LCR bonds tightly to the surface of the dish so that the preparation remains fixed as the blade is drawn through it.", "\n\nLCR composition and properties\n------------------------------\n\nLCRs are widely used in dentistry to create permanent durable implants. ", "The chemical components from which they are formulated have a long history of use in the human oral cavity and extensive tests have established their safety (Pereira et al., [", "@B26]). ", "We screened five published formulations (Pashley et al., [", "@B25]). ", "Of these, their resin \\#3 (see *Methods and Materials* for composition) proved best in terms of its ability to support the exoskeleton, retain the tissue after cutting and bond to the dish. ", "The latter is important since the LCR should adhere to the dish as the blade moves through the sample. ", "The cured resin fractures along the line of the cut rather than shattering. ", "Moreover, this formulation is optically clear with a refractive index of 1.57 that facilitates index-matching improving optical resolution. ", "It is worth noting that light cured adhesives have been used to mount *Drosophila* for *in vivo* recordings (Budick et al., [", "@B1]; Seelig et al., [", "@B30]).", "\n\nPolymerization of the LCR was followed by real time FTIR. ", "The average conversion of the resin was 68% (*n* = 3) after 90 s of illumination. ", "At this point the polymer matrix has vitrified so that the diffusion of residual monomer would be slow. ", "Similar experiments performed with DSC found that most of the reaction occurred within the first 20 s of illumination.", "\n\nWhen the LCR polymerizes, its density increases and hence it shrinks. ", "Under the conditions employed here, where an unconstrained thin layer is applied to the insect the shrinkage is likely to be non-uniform. ", "The fact that it is cured under water might have an influence on this too. ", "The surface of the cured LCR appears reticulated, which further supports a non-uniform curing process. ", "Moreover, after cutting through the A2, its profile does not appear to be deformed, as might occur if the shrinkage of the LCR squeezed the antenna appreciably.", "\n\nTwo important aspects of the LCR are its viscosity and its ability to wet arthropod cuticles. ", "The high viscosity of the LCR (\\~1200 cP) allows one to suspend a droplet about the size of a fly\\'s head without it dropping off the applicator. ", "The viscosity of the LCR slows its spread along the cuticle, which allows one to cover only part of the head or body, if so desired (*vide infra*). ", "The wetting characteristics of the LCR induce it to penetrate between the setae and into even the finest crevices in the insect cuticle. ", "This ensures that LCR holds the fly part, as the resin does not actually bond to the insect cuticle.", "\n\nThe LCR formulation used here does not generate much heat during the curing process. ", "We tested the heat generated during curing by applying a drop of LCR to a piece of aluminum foil overlying a thermistor probe. ", "Illuminating the LCR for 1 min led to an increase in temperature of only 2.6 ± 0.5°C (*n* = 4, starting temperature 24.3 ± 0.7°C). ", "For most physiological applications this is a negligible increase.", "\n\nMorphology of sensory cells post-goggatomy\n------------------------------------------\n\nTo expose JOs, a fly head embedded in LCR was cut horizontally dorsal to the A2-A3 joint (Figure [1B](#F1){ref-type=\"fig\"}). ", "At this level of section it was possible to observe intact scolopidia in the dorsal parts of both divided A2s. ", "The form of the JO could be clearly resolved under bright field optics in goggatomized preparations, with the scolopidia attached to the remnants of the stalk (Figure [2](#F2){ref-type=\"fig\"}). ", "The outer surface of the scolopale cells was bright and lustrous, suggesting that the scolopidia are preserved. ", "Many scolopidia remain attached to the joint cuticle via their dendritic caps. ", "Pushing against the scolopidium at right angles to its long axis with a patch electrode allows one to assess the integrity of this link. ", "If the link is broken the scolopidium swings free.", "\n\n![**", "Light microscopic images of JOs within a goggatomized A2. (", "A)** Bright field image of JO **(B)** fluorescent image of JO expressing GCaMP6. ", "Both specimens have approximately the same orientation. ", "Scale bars 20μm.](fphys-07-00398-g0002){#F2}\n\nThe goggatomy procedure allows preparations to be made that can be fixed, dehydrated, gold sputtered and viewed on a scanning electron microscope (Figure [3](#F3){ref-type=\"fig\"}). ", "SEM images show that much of the scolopidial structure is preserved during goggatomy, even the dendritic caps connecting the scolopale cells to the stalk. ", "The scolopidial cells are plump suggesting that the space is still filled. ", "In some cases where the scolopidia have been cut, dendrites can be seen protruding.", "\n\n![**", "Scanning electron micrograph of a JO within a goggatomized A2**. ", "R---putative scolopale rods protruding from broken scolopidia. ", "Scale bar 5 um.](fphys-07-00398-g0003){#F3}\n\nThe appearance of the scolopidia under SEM was not as good as that under bright field. ", "We suspect that cells become fragile after dehydration and may fragment. ", "Under saline in bright field microscopy, the full fan-like arrays of scolopidia can be seen (Figure [2](#F2){ref-type=\"fig\"}), whereas, under SEM this was less common.", "\n\nPhysiology\n----------\n\nIn many cases when the head capsule is cut in the horizontal plane, the brain appears to pulse at a rate of \\~ 1 Hz. ", "This is due to the contraction of muscle 16, the frontal pulsatile organ (Demerec, [@B5]; Murthy and Turner, [@B23]), whose pulsations can persist in DS for up to 5 h *in vitro*. ", "Moreover, we have used fly lines that express GFP in neurons and in most cases the expression persists after many hours, again suggesting that the exposed cells are viable.", "\n\nWe have also assessed the toxicity of the procedure on whole flies. ", "The dorsal surface of whole flies was attached to a plastic dish with LCR and the survival of the flies was monitored. ", "Flies survived for more than 6 h and remained fully motile to the extent that the tethering would allow. ", "This survival resembles that when flies are held in pipette tips for extracellular electrophysiology (Eberl et al., [", "@B9]). ", "This suggests that if any resin crosses the cuticle it has little toxic effect on the organism.", "\n\nTo assess the electrophysiological vitality of cells in the goggatomized preparations we used the fluorescent voltage sensor ArcLight developed by Pieribone and colleagues (Jin et al., [", "@B19]). ", "ArcLight is maximally fluorescent at hyperpolarized potentials, its fluorescence declining roughly linearly as the cell depolarizes. ", "Moreover, its temporal response is sufficiently rapid to follow action potentials with reasonable fidelity. ", "To determine if the sensory cells of JO had a hyperpolarized resting potential, characteristic of live cells, goggatomized A2s were perfused with a saline where all the Na^+^ was substituted by K^+^ (HiK), which should depolarize the cells to \\~ 0 mV. Application of the saline led to a rapid decrease in fluorescence, consistent with depolarization (mean % ΔF/F = −28.5 ± 3.2, *n* = 16) (Figure [4A](#F4){ref-type=\"fig\"}). ", "If the cells had no resting potential, application of HiK should lead to no or little change in the fluorescence of ArcLight. ", "HiK stimulation induced similar changes in mushroom body neurons expressing ArcLight (mean % ΔF/F = −30.7 ± 5.1, *n* = 12). ", "Subjecting sensory neurons expressing GFP to HiK led to no significant change in fluorescence (mean % ΔF/F −0.02 ± 1.4, *n* = 9), indicating that the changes in the ArcLight flies are not the result of the cells shrinking or swelling.", "\n\n![**", "Assessing the vitality of exposed JOs. (", "A)** Response of sensory cells in JO expressing ArcLight to the perfusion of HiK (red arrow) and restoration of normal saline (green arrow). ", "Inset, pseudo-color image of difference between the image prior to stimulation and at its peak. ", "Scale bar 20 μm. ", "The green circles are the regions-of-interest used to produce the time traces. **(", "B)** Local electrical stimulation (arrow, 200 μs, 0.1 mA) of sensory cells in JO expressing ArcLight. ", "Scale bar 10 μm. **(", "C)** Response of JO expressing GCaMP6 to application of pymetrozine (arrow, 3.4 μM). ", "Top inset fluorescence, bottom inset pseudo-color difference image. ", "Scale bar 20μm.](fphys-07-00398-g0004){#F4}\n\nTo activate sensory neurons directly, a glass microelectrode was placed close to the cell bodies in goggatomized A2s. ", "When a pulse of current was delivered to the electrode, the fluorescence of the cell body declined and then increased back to baseline, consistent with depolarization and then repolarization of the cell (Figure [4B](#F4){ref-type=\"fig\"}, mean % ΔF/F = −1.5 ± 0.1, *n* = 7).", "\n\nWe also used the insecticide pymetrozine to determine if the scolopidia survive the goggatomy procedure with their transduction mechanism intact. ", "Pymetrozine interacts with the TRPV ion channel complex (with subunits Nan and Iav) resulting in a large influx of calcium (Nesterov et al., [", "@B24]). ", "Application of 15 μM of pymetrozine to goggatomized A2s from flies expressing GCaMP6 resulted in the consistent and rapid elevation of calcium in the sensory cells (Figure [4C](#F4){ref-type=\"fig\"} mean % ΔF/F = 56.3 ± 3.2% ΔF/F, *n* = 17). ", "Consistent with the reported pymetrozine effect, the response in our preparation was irreversible and could not be restored after washing off the pymetrozine. ", "The sensory neurons do not respond to a second application of pymetrozine even after washing off the drug for 10 min. ", "The decline of fluorescence is not the result of photobleaching, since little occurs with a slow sampling rate (0.2 Hz) and short exposures (50 ms).", "\n\nWe have not systematically assessed how long goggatomized preparations can be sustained in a physiologically responsive state *in vitro*. ", "Our experiments were typically performed within 2 h after the goggatomy, but recordings of physiological responses were observed even in preparations held for as long as 3 h in DS.", "\n\nFree-arista goggatomy\n---------------------\n\nWe modified the goggatomy procedure so as to expose the JO while preserving motion about the A2--A3 joint. ", "The procedure is detailed in Figure [5A](#F5){ref-type=\"fig\"} and is termed the Free-Arista (FA) goggatomy. ", "Directing a small short air pressure pulse toward the surface of the saline moved the arista. ", "Movement of the arista was detected by making a high-speed video and activation of the JO by increases in calcium detected by GCaMP6 (Figure [5B](#F5){ref-type=\"fig\"}).", "\n\n![**", "Free-Arista Goggatomy. (", "A)** Schematic of the procedure (1) Place the cut head on a small droplet of LCR (blue) and allowed it to sink so that its edges, but not the antennae or arista, are covered. ", "Cure for 20 s. (2) Place a small strip of colored Cellophane (gray rectangle) over the A3, to prevent LCR from pulling the antennae up when it is applied to A2. (", "3) Apply a very small droplet of LCR so that it covers the dorsal margins of the A2 (green). ", "Begin light curing, then remove the plastic strip and apply a droplet of water to the preparation. ", "Cure for 1 min. ", "Wick off the water with a tissue. (", "4) Apply DS and cut through the head as indicated by the dotted line. **(", "B)** Response of JO cells expressing GCaMP6 in a FA-goggatomized preparation to an air pulse (120 ms, \\~ 1 psi) directed at the solution (red arrow). ", "Inset top, fluorescence, bottom pseudo-color difference image. ", "Scale bar 20μm.](fphys-07-00398-g0005){#F5}\n\nOlfactory receptors\n-------------------\n\nWe further modified the goggatomy procedure to section the A3 while preserving the olfactory receptor neurons (ORNs) (Figure [6B](#F6){ref-type=\"fig\"}). ", "The approach is detailed in Figure [6A](#F6){ref-type=\"fig\"} and shows how one can cut the antenna without embedding the sensory sensilla. ", "Bath application of isoamyl-acetate led to a robust response in some of the sensory neurons, showing that their responsiveness is preserved (Figure [6C](#F6){ref-type=\"fig\"}).", "\n\n![**", "Sectioning A3 and response of ORNs to odorant. (", "A)** Schematic of the procedure. ", "Place the cut head on a droplet of LCR (blue) and allow sinking so that the margins of the head, but not the arista, become covered. ", "Light cure for 20 s. Apply small droplets of LCR over the arista and margins of the antennae (green). ", "Note, the frontal surface of A3 should not be covered so that the sensory sensilla are free. ", "Add droplet of water over preparation and cure for 1 min. ", "Wick off water with tissue. ", "Add droplet of DS and cut through the A3s (red line). **(", "B)** Image of goggatomize A3 expressing GCaMP6. **(", "C)** Increase in intracellular calcium in ORNs expressing GCaMP6 to the application of iso-amyl acetate (arrow, a 5 μl drop of a 0.67 mM solution was added to the \\~2 ml bath). ", "Upper inset, fluorescence prior to odorant application. ", "Lower inset pseudo-color difference image. ", "Scale bar 20μm.](fphys-07-00398-g0006){#F6}\n\nOther preparations\n------------------\n\nThe goggatomy procedure is versatile enough that it can also be useful for a number of other exoskeletal compartments besides the antennae. ", "As examples we show sensory cells in the labellum (Figure [7A](#F7){ref-type=\"fig\"}) and chordotonal organs in the legs (Figures [7B,C](#F7){ref-type=\"fig\"}). ", "Goggatomy also provides a convenient way of accessing the musculature and cells of the head, proboscis, halteres and sex organs.", "\n\n![**", "Goggatomy of *Drosophila* and other arthropods**. **(", "A)** *Drosophila* labellum, GFP, scale bar 50 μm. **(", "B,C)** *Drosophila* leg chordotonal organ, GFP, scale bar 25 μm. **(", "B)** Fluorescence and **(C)** bright field. **(", "D)** Mosquito head, *Culex pipiens*, scale bar 50μm. **(", "E)** Anterior end of Mimolette cheese mite, *Acarus siro*, scale bar 50 μm. ", "Head is top left. ", "The mite was cut in spider saline (Schmitz et al., [", "@B29]).](fphys-07-00398-g0007){#F7}\n\nIn addition, we have found that the goggatomy procedure is applicable to other small arthropods and have tried them on the following: mosquitoes (Figure [7D](#F7){ref-type=\"fig\"}), mites (in Figure [7E](#F7){ref-type=\"fig\"}), *Daphnia*, ants and wasps (data not shown).", "\n\nUsing the LCR to view neurons in intact insects\n-----------------------------------------------\n\nWe have found that we can use the LCR to mount whole live flies under a coverslip to view the antenna with a water immersion objective. ", "The refractive index of cured LCR is 1.57; this makes it possible to preserve the high numerical aperture of the water immersion objectives. ", "The procedure, which we term a \"gogga cap,\" is illustrated in (Figure [8](#F8){ref-type=\"fig\"}). ", "To image fluorescently labeled scolopidia in A2, while not immobilizing the A2-A3 joint, the following procedure can be followed. ", "A cold-anesthetized fly is affixed to a small piece of fishing line (0.25 mm diameter, \\~4 mm length) that is held vertical on a small piece of poster tack under a dissection microscope. ", "To do this, a drop of LCR is placed on the top of the fishing line and the ventral surface of the thorax is placed on the drop of resin. ", "The fly is secured to the line by curing the LCR. ", "A small drop of LCR is applied to a coverslip, which is attached to a coarse micromanipulator via a small rod. ", "Under a stereomicroscope the cover slip is maneuvered over the head and lowered until the resin starts flowing over the head. ", "When the desired coverage is achieved the resin is cured.", "\n\n![**", "Mounting live flies with LCR. (", "A)** Schematic of the mounting procedure. **(", "B)** Movement of arista (inset right) induced by a single sound pulse (red). **(", "C)** Response of JO expressing ArcLight in the same fly as **(B)**. ", "Scale bar 20μm.](fphys-07-00398-g0008){#F8}\n\nIn this configuration it is possible to image JO through the cuticle while stimulating the antenna with near field sound and detect changes in potential with ArcLight. ", "An example of such a recording is shown in (Figure [8](#F8){ref-type=\"fig\"}).", "\n\nIf one wants to image the brain in an intact fly it can simply be attached to a cover slip by holding it head down into a small droplet of LCR on a coverslip while light curing for 1 min.", "\n\nDiscussion {#s4}\n==========\n\nWe have developed a simple procedure for opening up the exoskeleton of arthropods, which exposes the live tissue and neuronal components. ", "The goggatomy procedure opens up previously inaccessible cells for direct physiological and pharmacological manipulation.", "\n\nWe have used the fluorescent voltage sensor ArcLight to show that sensory neurons in JO have a substantial negative potential and auditory sensory neurons respond to current injection. ", "The sensory transduction apparatus of the both JO and ORNs remains intact as judged by chemical stimulation. ", "Moreover, in a preparation where the A2-A3 joint is preserved, sensory neurons respond to joint displacement. ", "In addition, we have found that in *Drosophila* brain exposed by goggatomy, spontaneous and rhythmic activity persists *in vitro* (data not shown) (Rosay et al., [", "@B28]).", "\n\nThe method does not rely on the LCR adhering to the cuticle. ", "Arthropod cuticles have a thin wax layer and the resin in the uncured form wets it, but when cured does not bond to it. ", "The specimen is held in place because the resin forms a replica of the exoskeleton surrounding hairs and filling tiny gaps. ", "The method is not suitable for soft-bodied animals, like *C elegans* or *Drosophila* larvae, since once sliced the specimen falls out of the resin. ", "It is worth noting that the goggatomy procedure can facilitate the immunocytochemical staining of small arthropods since it makes the sections dense and provides a handle for manipulating the tissue. ", "It could also prove useful for opening a range of arthropods to powerful analytical chemistry techniques like laser desorption ionization mass spectroscopy (Phan et al., [", "@B27]) and cyclic voltammetry (Denno et al., [", "@B6]).", "\n\nIn some cases it might be desirable to produce a preparation where some part is not immersed in saline and exposed to the atmosphere. ", "In the case of an antenna a goggatomized head prepared as in the last section is removed from the holding saline and placed on a piece of clear tape over a hole (\\~ 1 cm diameter) cut into a petri dish lid (Figure [9](#F9){ref-type=\"fig\"}). ", "Vacuum grease is used to hold the section to the tape, exercising caution to avoid covering the antenna. ", "The seal does not have to be complete as water tension prevents the saline from leaking out. ", "The lid is inverted and a drop of saline is applied over the specimen. ", "An opening is then cut in the tape overlying the nervous system with a blade tip allowing saline to flow in. ", "We should note that we have not as yet tested whether, for example the A3 remains responsive to odorants.", "\n\n![**", "Schematic of an air-gogga preparation**. ", "Upper panel, side view. ", "Lower panel, top down view. ", "The dashed red line represents a hole cut into the tape to allow saline to enter the preparation.](fphys-07-00398-g0009){#F9}\n\nSinha et al. ([", "@B32]) have published a method for cutting holes in insect cuticles with a UV excimer laser, which they used to expose the brain in live *Drosophila*. ", "They have not used the method to expose cells in small cuticular compartments like the antennae. ", "Our goggatomy procedure is considerably more cost effective and easier to implement. ", "It is worth mentioning that Grover et al. ([", "@B13]) have developed a method for installing a transparent window in the fly head, which allows the activity of neurons expressing fluorescent probes to be imaged in untethered walking flies.", "\n\nFor arthropods where it is not feasible to use genetically encoded indicators, the goggatomy procedure makes it possible to use the acetoxylmethyl ester (AM) loading of synthetic ion-indicators like fluo-4 into cells (Grienberger and Konnerth, [@B12]) as has been done in the honeybee (Galizia et al., [", "@B11]). *", "Drosophila* neurons can load with calcein-AM (Li and Meinertzhagen, [@B21]), however some synthetic calcium probes may not load very efficiently (Jing Wang, personal communication).", "\n\nGoggatomization of *Drosophila* heads exposes the beating frontal pulsatile organ (muscle 16) that can be sustained *in vitro* for a few hours. ", "We suggest that this preparation could be a useful one for studying the rhythmicity of muscle. ", "Moreover, the preparation is simple enough to be used in classroom demonstrations and student labs.", "\n\nMore than 10 years ago Wilson et al. ([", "@B34]) showed how it was possible to perform patch clamp recordings on adult *Drosophila* brains. ", "Their method has been widely used opening up this important model organism to physiological investigation. ", "Alan Kay spent 2 years trying to get intracellular recordings from scolopidia without success. ", "The sensory neuron cell bodies are covered by a tough extracellular matrix, which hinders both patch and sharp recordings. ", "The scolopale cells are more rigid than other cells, thwarting attempts to patch and penetrate the cells. ", "Although, we were unable to make direct intracellular recordings from scolopidia, we believe that it would be imprudent to suggest that it is impossible. ", "It might be possible to make intracellular recording from the component cells of scolopidia with an appropriate sharp electrode, perhaps quartz or by digesting the extracellular matrix with proteases. ", "Our confidence that intracellular recordings can be made from *Drosophila* JO is bolstered by reports of whole-cell and perforated patch recordings from ORNs in A3s that have been cut open (Dubin and Harris, [@B7]; Cao et al., [", "@B3]).", "\n\nIsolated neuronal preparations have played an important role in the progress of neuroscience. ", "These include among others, the squid giant axon and synapse, the limulus eye, and isolated gastropod ganglia. ", "We believe that the goggatomy procedure will be of great value in helping to reveal the secrets of sensory organs and other cells trapped within the confines of very small cuticular compartments.", "\n\nAuthor contributions {#s5}\n====================\n\nAK and DE initiated the project. ", "AK performed the experiments. ", "AK, DR, and DE analyzed the data. ", "DE, DR, and MN produced the fly lines. ", "ES performed the SEM. ", "JS, CG and SA made and analyzed the LCR. ", "MN, CB, JS, CG, and SA provided reagents. ", "AK wrote the paper with contributions from all other authors.", "\n\nConflict of interest statement\n------------------------------\n\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.", "\n\nWe thank Mark Reagan and Matthew Wortel for measuring the refractive index of the LCR, Lyric Bartholomay for mosquitoes, Andrew Forbes for wasps and the New Pioneer Coop for the mimolette cheese, Baruch Minke for helpful advice, and Roger Hardie, Toshihiro Kitamoto and Jing Wang for comments on an earlier version of the manuscript. ", "The work was in part supported by an award from the Office of the Vice President for Research, University of Iowa (AK) and by the Iowa Center for Molecular Auditory Neuroscience, supported by NIH P30 grant DC010362 to Steven Green.", "\n\nSupplementary material {#s6}\n======================\n\nThe Supplementary Material for this article can be found online at: <http://journal.frontiersin.org/article/10.3389/fphys.2016.00398>\n\n###### \n\nClick here for additional data file.", "\n\nGoggatomy-step by step\n======================\n\nClean blade with alcohol and snap into quarters.", "Melt a small piece of soft dental wax onto a 12 mm circular coverslip, place in a 35mm petri dish filled with DS (Figure [A1A](#FA1){ref-type=\"fig\"}).Cold anesthetize flies for \\< 30 *s*.Pick up a drop of LCR (volume just a little larger than the head) with a tungsten tip.", "Lie fly on its side on the lid of the 35 mm petri dish. ", "Cut off head with blade. ", "Place head on its posterior surface.", "Apply a droplet of LCR on the head to completely cover it (Figure [A1B](#FA1){ref-type=\"fig\"}).Place a drop of water on the LCR and apply the curing light for 1 min, protecting eyes with goggles (Figure [A1C](#FA1){ref-type=\"fig\"}).Wipe off the saline with a tissue and apply a drop of DS.Under higher magnification orient the fixed fly head. ", "Hold the blade at an angle of \\~ 30° to petri dish surface (Figure [A1D](#FA1){ref-type=\"fig\"}). ", "Cut through the embedded head just above the A2--A3 (Figure [A1B](#FA1){ref-type=\"fig\"}) joint with a swift and firm motion.", "Trim the cured LCR chip (Figure [A1E](#FA1){ref-type=\"fig\"}) and transfer to the holding dish.", "Insert the chip into the dental wax under saline, with the cut surface appropriately oriented (Figure [A1F](#FA1){ref-type=\"fig\"}).", "\n\n![**", "Illustration of the goggatomy procedure on a *Drosophila* head. (", "A)** Melting a small piece of soft dental wax onto a circular cover slip. **(", "B)** Applying LCR to *Drosophila* head. **(", "C)** Curing light is place close to specimen. **(", "D)** Cutting through cured LCR. **(", "E)** Trimming embedded sections. **(", "F)** Placing chip in wax.](fphys-07-00398-a0001){#FA1}\n\n[^1]: Edited by: Paivi H. Torkkeli, Dalhousie University, Canada\n\n[^2]: Reviewed by: Andrew Mason, University of Toronto Scarborough, Canada; Andrew Dacks, West Virginia University, USA\n\n[^3]: This article was submitted to Invertebrate Physiology, a section of the journal Frontiers in Physiology\n" ]
{ "pile_set_name": "PubMed Central" }
[ 0, 0.018518518518518517, 0, 0.026455026455026454, 0.018518518518518517, 0.007142857142857143, 0.0091324200913242, 0, 0, 0, 0.00980392156862745, 0.11475409836065574, 0, 0, 0, 0.005263157894736842, 0.03529411764705882, 0.004784688995215311, 0.004694835680751174, 0.14285714285714285, 0.006172839506172839, 0.037037037037037035, 0.016666666666666666, 0.022222222222222223, 0.125, 0, 0, 0.005208333333333333, 0.014858841010401188, 0.004166666666666667, 0.012578616352201259, 0.029411764705882353, 0, 0.012987012987012988, 0.008547008547008548, 0.004273504273504274, 0, 0, 0, 0.013071895424836602, 0.013888888888888888, 0.0064516129032258064, 0, 0, 0, 0.01, 0.015625, 0, 0.024390243902439025, 0, 0.006329113924050633, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011235955056179775, 0, 0, 0, 0, 0.0048543689320388345, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007352941176470588, 0, 0, 0, 0, 0, 0, 0, 0.125, 0, 0.125, 0, 0, 0, 0, 0, 0.045454545454545456, 0.14285714285714285, 0, 0, 0, 0.00847457627118644, 0, 0, 0, 0, 0, 0, 0.00684931506849315, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005154639175257732, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015384615384615385, 0, 0, 0, 0, 0, 0.027932960893854747, 0, 0, 0, 0, 0, 0.14285714285714285, 0, 0.015957446808510637, 0.125, 0.007518796992481203, 0, 0.0047169811320754715, 0.007936507936507936, 0.008064516129032258, 0.008547008547008548, 0, 0, 0.0070921985815602835, 0, 0, 0, 0.0196078431372549, 0, 0, 0, 0, 0, 0, 0.02112676056338028, 0.125, 0.004149377593360996, 0, 0, 0, 0, 0.005555555555555556, 0.006493506493506494, 0.009259259259259259, 0, 0.005952380952380952, 0, 0, 0, 0, 0, 0, 0, 0.02857142857142857, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010752688172043012, 0, 0, 0.017543859649122806, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.018867924528301886, 0.014705882352941176, 0, 0.017857142857142856, 0.013157894736842105, 0, 0.019230769230769232, 0.006535947712418301, 0, 0, 0, 0, 0.0053475935828877, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014705882352941176, 0.009389671361502348, 0, 0, 0, 0, 0.0106951871657754, 0.009174311926605505, 0, 0.006134969325153374, 0.14285714285714285, 0, 0, 0, 0, 0, 0, 0.043478260869565216, 0.16666666666666666, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006622516556291391, 0, 0, 0, 0.005208333333333333, 0.009836065573770493, 0.1111111111111111, 0.022099447513812154, 0, 0, 0, 0.024390243902439025, 0.01020408163265306, 0, 0.010526315789473684, 0, 0, 0, 0, 0.008771929824561403, 0.16666666666666666, 0, 0, 0, 0.011904761904761904, 0, 0.029411764705882353, 0.02564102564102564, 0.045454545454545456, 0.04878048780487805, 0.07142857142857142, 0, 0, 0.023809523809523808, 0.030303030303030304, 0.00425531914893617, 0, 0.007326007326007326, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0226628895184136 ]
0.009774
5
[ { "analysis_explanation": null, "end": 712, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 707 }, { "analysis_explanation": null, "end": 725, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 717 }, { "analysis_explanation": null, "end": 1007, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1002 }, { "analysis_explanation": null, "end": 1018, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1012 }, { "analysis_explanation": null, "end": 1828, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1813 }, { "analysis_explanation": null, "end": 1874, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1872 }, { "analysis_explanation": null, "end": 1882, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1879 }, { "analysis_explanation": null, "end": 2181, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2179 }, { "analysis_explanation": null, "end": 2393, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2385 }, { "analysis_explanation": null, "end": 2560, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2549 }, { "analysis_explanation": null, "end": 2664, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2661 }, { "analysis_explanation": null, "end": 2676, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2669 }, { "analysis_explanation": null, "end": 2697, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2691 }, { "analysis_explanation": null, "end": 3106, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3096 }, { "analysis_explanation": null, "end": 3188, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3186 }, { "analysis_explanation": null, "end": 3297, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3287 }, { "analysis_explanation": null, "end": 3472, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3465 }, { "analysis_explanation": null, "end": 3492, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3486 }, { "analysis_explanation": null, "end": 4052, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4050 }, { "analysis_explanation": null, "end": 4117, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4103 }, { "analysis_explanation": null, "end": 4129, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4119 }, { "analysis_explanation": null, "end": 4440, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4433 }, { "analysis_explanation": null, "end": 4444, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4442 }, { "analysis_explanation": null, "end": 4463, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4456 }, { "analysis_explanation": null, "end": 4474, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4465 }, { "analysis_explanation": null, "end": 4478, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4476 }, { "analysis_explanation": null, "end": 4518, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4503 }, { "analysis_explanation": null, "end": 4622, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4613 }, { "analysis_explanation": null, "end": 4626, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4624 }, { "analysis_explanation": null, "end": 4784, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4779 }, { "analysis_explanation": null, "end": 4793, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4786 }, { "analysis_explanation": null, "end": 4829, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4824 }, { "analysis_explanation": null, "end": 4838, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4831 }, { "analysis_explanation": null, "end": 5019, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5012 }, { "analysis_explanation": null, "end": 5023, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5021 }, { "analysis_explanation": null, "end": 5112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5099 }, { "analysis_explanation": null, "end": 5122, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5114 }, { "analysis_explanation": null, "end": 5126, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5124 }, { "analysis_explanation": null, "end": 5624, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5623 }, { "analysis_explanation": null, "end": 5680, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5671 }, { "analysis_explanation": null, "end": 5684, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5682 }, { "analysis_explanation": null, "end": 5813, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5807 }, { "analysis_explanation": null, "end": 5947, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5945 }, { "analysis_explanation": null, "end": 6449, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6439 }, { "analysis_explanation": null, "end": 6453, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6451 }, { "analysis_explanation": null, "end": 7213, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7208 }, { "analysis_explanation": null, "end": 8720, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8707 }, { "analysis_explanation": null, "end": 8743, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8738 }, { "analysis_explanation": null, "end": 8846, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8839 }, { "analysis_explanation": null, "end": 8897, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8885 }, { "analysis_explanation": null, "end": 8944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8938 }, { "analysis_explanation": null, "end": 8954, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8949 }, { "analysis_explanation": null, "end": 9042, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9029 }, { "analysis_explanation": null, "end": 9479, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9471 }, { "analysis_explanation": null, "end": 10022, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10017 }, { "analysis_explanation": null, "end": 11761, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11747 }, { "analysis_explanation": null, "end": 11821, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11814 }, { "analysis_explanation": null, "end": 12471, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12458 }, { "analysis_explanation": null, "end": 12494, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12481 }, { "analysis_explanation": null, "end": 13547, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13541 }, { "analysis_explanation": null, "end": 14284, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14279 }, { "analysis_explanation": null, "end": 14793, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14791 }, { "analysis_explanation": null, "end": 15442, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15440 }, { "analysis_explanation": null, "end": 15474, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15472 }, { "analysis_explanation": null, "end": 16132, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16130 }, { "analysis_explanation": null, "end": 16735, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16728 }, { "analysis_explanation": null, "end": 16818, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16811 }, { "analysis_explanation": null, "end": 16833, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16827 }, { "analysis_explanation": null, "end": 16844, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16838 }, { "analysis_explanation": null, "end": 17035, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17025 }, { "analysis_explanation": null, "end": 17758, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17749 }, { "analysis_explanation": null, "end": 17785, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17775 }, { "analysis_explanation": null, "end": 18077, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18075 }, { "analysis_explanation": null, "end": 18989, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18986 }, { "analysis_explanation": null, "end": 19029, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19027 }, { "analysis_explanation": null, "end": 19410, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19408 }, { "analysis_explanation": null, "end": 19472, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19470 }, { "analysis_explanation": null, "end": 20263, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20260 }, { "analysis_explanation": null, "end": 20328, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20313 }, { "analysis_explanation": null, "end": 20856, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20850 }, { "analysis_explanation": null, "end": 21196, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21193 }, { "analysis_explanation": null, "end": 21318, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21315 }, { "analysis_explanation": null, "end": 21429, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21427 }, { "analysis_explanation": null, "end": 21769, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21767 }, { "analysis_explanation": null, "end": 22423, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22418 }, { "analysis_explanation": null, "end": 22554, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22552 }, { "analysis_explanation": null, "end": 22645, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22637 }, { "analysis_explanation": null, "end": 23320, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23307 }, { "analysis_explanation": null, "end": 23773, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23768 }, { "analysis_explanation": null, "end": 24581, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24572 }, { "analysis_explanation": null, "end": 24944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24936 }, { "analysis_explanation": null, "end": 24982, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24978 }, { "analysis_explanation": null, "end": 25044, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25033 }, { "analysis_explanation": null, "end": 25131, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25117 }, { "analysis_explanation": null, "end": 26895, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26893 }, { "analysis_explanation": null, "end": 27037, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27035 }, { "analysis_explanation": null, "end": 27421, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27416 }, { "analysis_explanation": null, "end": 27799, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27797 }, { "analysis_explanation": null, "end": 27946, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27944 }, { "analysis_explanation": null, "end": 28276, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28264 }, { "analysis_explanation": null, "end": 29109, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29098 }, { "analysis_explanation": null, "end": 29156, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29144 }, { "analysis_explanation": null, "end": 30262, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30251 }, { "analysis_explanation": null, "end": 30271, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30267 }, { "analysis_explanation": null, "end": 30640, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30628 }, { "analysis_explanation": null, "end": 31067, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31056 }, { "analysis_explanation": null, "end": 31080, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31072 }, { "analysis_explanation": null, "end": 31138, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31124 }, { "analysis_explanation": null, "end": 31200, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31198 }, { "analysis_explanation": null, "end": 31218, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31205 }, { "analysis_explanation": null, "end": 31307, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31298 }, { "analysis_explanation": null, "end": 31476, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31465 }, { "analysis_explanation": null, "end": 31695, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31673 }, { "analysis_explanation": null, "end": 31708, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31696 }, { "analysis_explanation": null, "end": 31926, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31918 }, { "analysis_explanation": null, "end": 31940, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31933 }, { "analysis_explanation": null, "end": 32674, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32672 }, { "analysis_explanation": null, "end": 32792, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32787 }, { "analysis_explanation": null, "end": 32803, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32797 }, { "analysis_explanation": null, "end": 32822, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32812 }, { "analysis_explanation": null, "end": 33352, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33350 }, { "analysis_explanation": null, "end": 33386, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33384 }, { "analysis_explanation": null, "end": 33394, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33392 }, { "analysis_explanation": null, "end": 33484, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33482 }, { "analysis_explanation": null, "end": 33492, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33490 }, { "analysis_explanation": null, "end": 33842, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33831 }, { "analysis_explanation": null, "end": 33861, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33847 }, { "analysis_explanation": null, "end": 33926, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33909 }, { "analysis_explanation": null, "end": 33956, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33943 }, { "analysis_explanation": null, "end": 34030, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34018 }, { "analysis_explanation": null, "end": 34067, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34055 }, { "analysis_explanation": null, "end": 34087, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34069 }, { "analysis_explanation": null, "end": 34101, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34092 }, { "analysis_explanation": null, "end": 34386, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34374 }, { "analysis_explanation": null, "end": 34716, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34708 }, { "analysis_explanation": null, "end": 35274, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35269 }, { "analysis_explanation": null, "end": 36308, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36297 }, { "analysis_explanation": null, "end": 36338, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36332 }, { "analysis_explanation": null, "end": 36371, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36359 }, { "analysis_explanation": null, "end": 36414, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36408 }, { "analysis_explanation": null, "end": 36428, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36416 }, { "analysis_explanation": null, "end": 2683, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.6499999999999999, "start": 2680 }, { "analysis_explanation": null, "end": 8961, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.6499999999999999, "start": 8958 }, { "analysis_explanation": null, "end": 29163, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.6499999999999999, "start": 29161 }, { "analysis_explanation": null, "end": 8813, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 8755 }, { "analysis_explanation": null, "end": 9602, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 9560 }, { "analysis_explanation": null, "end": 34573, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 34510 }, { "analysis_explanation": null, "end": 290, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 288 }, { "analysis_explanation": null, "end": 435, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 433 }, { "analysis_explanation": null, "end": 549, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 547 }, { "analysis_explanation": null, "end": 704, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 701 }, { "analysis_explanation": null, "end": 732, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 729 }, { "analysis_explanation": null, "end": 847, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 844 }, { "analysis_explanation": null, "end": 1024, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1022 }, { "analysis_explanation": null, "end": 1164, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1162 }, { "analysis_explanation": null, "end": 1836, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1833 }, { "analysis_explanation": null, "end": 1869, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1866 }, { "analysis_explanation": null, "end": 1889, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1886 }, { "analysis_explanation": null, "end": 2518, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 2514 }, { "analysis_explanation": null, "end": 2618, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 2614 }, { "analysis_explanation": null, "end": 2732, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 2728 }, { "analysis_explanation": null, "end": 3113, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3111 }, { "analysis_explanation": null, "end": 3284, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3281 }, { "analysis_explanation": null, "end": 3312, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3309 }, { "analysis_explanation": null, "end": 3479, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3476 }, { "analysis_explanation": null, "end": 3507, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3504 }, { "analysis_explanation": null, "end": 8024, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8022 }, { "analysis_explanation": null, "end": 8651, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8649 }, { "analysis_explanation": null, "end": 9263, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 9261 }, { "analysis_explanation": null, "end": 11769, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11766 }, { "analysis_explanation": null, "end": 11836, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11833 }, { "analysis_explanation": null, "end": 12478, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12476 }, { "analysis_explanation": null, "end": 12502, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12499 }, { "analysis_explanation": null, "end": 13293, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13291 }, { "analysis_explanation": null, "end": 14618, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 14616 }, { "analysis_explanation": null, "end": 14621, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 14619 }, { "analysis_explanation": null, "end": 14644, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 14642 }, { "analysis_explanation": null, "end": 14949, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 14947 }, { "analysis_explanation": null, "end": 15409, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15407 }, { "analysis_explanation": null, "end": 15593, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15591 }, { "analysis_explanation": null, "end": 15757, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15755 }, { "analysis_explanation": null, "end": 16157, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16155 }, { "analysis_explanation": null, "end": 16266, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16264 }, { "analysis_explanation": null, "end": 16536, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16534 }, { "analysis_explanation": null, "end": 16824, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16822 }, { "analysis_explanation": null, "end": 16851, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16848 }, { "analysis_explanation": null, "end": 17502, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 17500 }, { "analysis_explanation": null, "end": 17793, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 17790 }, { "analysis_explanation": null, "end": 18442, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 18440 }, { "analysis_explanation": null, "end": 19648, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 19646 }, { "analysis_explanation": null, "end": 19988, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 19986 }, { "analysis_explanation": null, "end": 20336, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 20333 }, { "analysis_explanation": null, "end": 20520, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 20518 }, { "analysis_explanation": null, "end": 21466, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 21464 }, { "analysis_explanation": null, "end": 21470, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 21468 }, { "analysis_explanation": null, "end": 21522, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 21520 }, { "analysis_explanation": null, "end": 21829, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 21827 }, { "analysis_explanation": null, "end": 22143, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 22141 }, { "analysis_explanation": null, "end": 22213, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 22211 }, { "analysis_explanation": null, "end": 22300, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 22298 }, { "analysis_explanation": null, "end": 22790, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 22788 }, { "analysis_explanation": null, "end": 22895, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 22893 }, { "analysis_explanation": null, "end": 22967, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 22965 }, { "analysis_explanation": null, "end": 23030, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 23028 }, { "analysis_explanation": null, "end": 23282, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 23280 }, { "analysis_explanation": null, "end": 23320, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 23318 }, { "analysis_explanation": null, "end": 23655, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 23653 }, { "analysis_explanation": null, "end": 23889, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 23887 }, { "analysis_explanation": null, "end": 24231, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 24229 }, { "analysis_explanation": null, "end": 24479, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 24477 }, { "analysis_explanation": null, "end": 24552, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 24550 }, { "analysis_explanation": null, "end": 25139, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 25136 }, { "analysis_explanation": null, "end": 25169, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 25167 }, { "analysis_explanation": null, "end": 25333, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 25331 }, { "analysis_explanation": null, "end": 25378, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 25376 }, { "analysis_explanation": null, "end": 25893, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 25891 }, { "analysis_explanation": null, "end": 25960, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 25958 }, { "analysis_explanation": null, "end": 25991, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 25989 }, { "analysis_explanation": null, "end": 25994, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 25992 }, { "analysis_explanation": null, "end": 26986, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 26984 }, { "analysis_explanation": null, "end": 27215, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 27213 }, { "analysis_explanation": null, "end": 28045, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 28043 }, { "analysis_explanation": null, "end": 28048, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 28046 }, { "analysis_explanation": null, "end": 28284, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 28281 }, { "analysis_explanation": null, "end": 29117, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 29114 }, { "analysis_explanation": null, "end": 29522, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 29520 }, { "analysis_explanation": null, "end": 29993, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 29991 }, { "analysis_explanation": null, "end": 30248, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 30246 }, { "analysis_explanation": null, "end": 30271, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 30268 }, { "analysis_explanation": null, "end": 30649, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 30646 }, { "analysis_explanation": null, "end": 31087, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 31084 }, { "analysis_explanation": null, "end": 31146, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 31143 }, { "analysis_explanation": null, "end": 31225, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 31222 }, { "analysis_explanation": null, "end": 31717, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 31714 }, { "analysis_explanation": null, "end": 32809, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 32807 }, { "analysis_explanation": null, "end": 32829, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 32827 }, { "analysis_explanation": null, "end": 34355, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 34352 }, { "analysis_explanation": null, "end": 34370, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 34362 }, { "analysis_explanation": null, "end": 35597, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 35595 }, { "analysis_explanation": null, "end": 35601, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 35599 } ]
[ "147)*2*6)**2*6).", "\n-127009\nSimplify (1 + ((sqrt(171) - (sqrt(171) - (sqrt(171) + 1)*4)) + (sqrt(171) + 2)*-1 - -6*(-1*sqrt(171) + -1)))**2.", "\n54*sqrt(19) + 1548\nSimplify 2 + 2 + (-2*(5 + -4 + sqrt(432)))**2 + -5.", "\n96*sqrt(3) + 1731\nSimplify (4*-6*(-1 + sqrt(108)) + (sqrt(108) + sqrt(108)*-2 - sqrt(216)/sqrt(2)))*1.", "\n-156*sqrt(3) + 24\nSimplify (4*((sqrt(243) + -3)*3 - 3*sqrt(243)*-4 - (2 + -4 + (-2*sqrt(243) + sqrt(243))*-4)))**2.", "\n-22176*sqrt(3) + 471232\nSimplify ((5 + (2 + sqrt(98) - sqrt(98)) + sqrt(98) + 4 - (sqrt(14)/(sqrt(28)/sqrt(4)) + sqrt(12)/sqrt(6) + -1))*2)**2.", "\n480*sqrt(2) + 776\nSimplify -6*((sqrt(45)/sqrt(3)*6)/sqrt(3) - (4 + sqrt(20) + 3)).", "\n-24*sqrt(5) + 42\nSimplify ((-1 + (sqrt(891)*-1*-5 + sqrt(891)*-2 + 3)*3*6)*3)**2.", "\n463644*sqrt(11) + 23408685\nSimplify -4*((sqrt(22) + (1*sqrt(242))/sqrt(11))/((sqrt(2) - sqrt(12)/sqrt(6))*2 - sqrt(2)) - ((sqrt(396) + -2)*-1 + 2)**2).", "\n-184*sqrt(11) + 1648\nSimplify ((-2*sqrt(180))**2*4 - 3*(sqrt(180) + 2*sqrt(180))) + -4 + -2*(0 + sqrt(180)) + (sqrt(180) + 3 + sqrt(180))*1.", "\n-54*sqrt(5) + 2879\nSimplify (-2*((sqrt(1100) - (sqrt(1100)*2*-2 - sqrt(1100)) - (sqrt(1100) + 3 + 2 + sqrt(1100))) + 0 + (1 + sqrt(1100) - sqrt(1100))*-1))**2.", "\n-1920*sqrt(11) + 70544\nSimplify (-4*(sqrt(38)/(4*sqrt(2)))**2 + 0 - 5*(sqrt(2299) - (-3 + sqrt(2299) + 2 - sqrt(2299))))*4.", "\n-220*sqrt(19) - 39\nSimplify (6*(-1 + sqrt(343) + sqrt(343) + ((sqrt(343) - -2*sqrt(343)) + sqrt(343) - sqrt(343))) - (-1*(5 + sqrt(7) + sqrt(175)) + -1))**2.", "\n326592\nSimplify (((-1*sqrt(330))/sqrt(6))/(sqrt(15)/sqrt(3)*-1))**2 + ((sqrt(99) + -1 - sqrt(99) - sqrt(99)) + sqrt(275) + 2)**2.", "\n4*sqrt(11) + 56\nSimplify 1*(0 + -5 + -5*(sqrt(304)*1 + sqrt(19)) + sqrt(152)/(sqrt(80)/(sqrt(250) + sqrt(10))))**2 + 0.", "\n190*sqrt(19) + 6884\nSimplify 3 + (sqrt(640)*-1*4)/((sqrt(80) - ((sqrt(80) + 1*sqrt(80) - sqrt(80))*5 + sqrt(80))) + sqrt(80)).", "\n2*sqrt(2) + 3\nSimplify (((sqrt(660)*-1*-5 - sqrt(660) - sqrt(660)) + sqrt(660))/(sqrt(1100) - 2*sqrt(1100)))/(-5*(sqrt(768) + (2*sqrt(768)*-3 + sqrt(768) - sqrt(768)))).", "\n-sqrt(5)/500\nSimplify ((sqrt(5040) - -1*sqrt(5040) - (1*sqrt(245))/sqrt(7))/(sqrt(252)*1 - 5*sqrt(7)*1)*5 + 0)**2.", "\n66125\nSimplify (2*-3*-5*(2*(-2*sqrt(3564) + sqrt(3564)) + 1 + -1 + sqrt(3564) + sqrt(3564))*2)**2.", "\n0\nSimplify (3*(sqrt(150) + -4*sqrt(150)))/(sqrt(108) - (sqrt(108) + (sqrt(108) - -4*(sqrt(108) - -4*sqrt(108))))).", "\n5*sqrt(2)/14\nSimplify 4 + ((-2 + (1*(sqrt(162) + 2 + 5) + -1)*2)*4)**2.", "\n5760*sqrt(2) + 11972\nSimplify 2 + (5*(sqrt(78)*-1 + sqrt(78) + sqrt(78))*-4*2)/(sqrt(42)/(-2*sqrt(7)) + (2*sqrt(18))/sqrt(3)).", "\n-80*sqrt(13)/3 + 2\nSimplify (-6*(sqrt(1331) - (sqrt(1331)*-2 + -2) - (-1 + sqrt(1331))*-2) + (sqrt(1331) - (-3 + sqrt(1331)*1) - (sqrt(1331) - (sqrt(1331)*-1 + -2))))**2.", "\n-704*sqrt(11) + 1362945\nSimplify (-1*(3 + (sqrt(1539) + 2*sqrt(1539) - sqrt(1539)) + -2)*-2*2 + -4)**2.", "\n98496\nSimplify (4 + 1 + sqrt(208)*-1 - (2*(sqrt(208)*-3 + sqrt(208)) + 4))**2*4.", "\n96*sqrt(13) + 7492\nSimplify (sqrt(192) + (-2*sqrt(192))**2 + -4 - (-5 + 1 + sqrt(192))**2) + 3 + 5 + (2*1*sqrt(363) + sqrt(363) + 6*(1 + sqrt(363)))**2.", "\n1260*sqrt(3) + 30003\nSimplify ((sqrt(4)*-2*-2 + -2*sqrt(576))*3)/(6*(sqrt(128) + -2*sqrt(128) - sqrt(128)) + (sqrt(128) - (sqrt(128) - 2*sqrt(128))*5) + sqrt(128)).", "\n3*sqrt(2)/2\nSimplify (0 + (5*((sqrt(252) + 1)*1 + -1 + sqrt(252) + 4))**2*4 + -2)*-2.", "\n-204796 - 19200*sqrt(7)\nSimplify (4 + 0 + (sqrt(76) + 0 + sqrt(76) + -1)*6 + 4)**2.", "\n96*sqrt(19) + 10948\nSimplify ((0 + (sqrt(175) - (-1 + sqrt(175) + -5)) + 4 + -5 + -5)*-2)**2.", "\n0\nSimplify (-2 + sqrt(180) + 2 + -2*sqrt(180) + 2 + 3*sqrt(180)*1 + sqrt(180)*1 + -3)**2.", "\n-36*sqrt(5) + 1621\nSimplify (-1*6*(sqrt(2112) + 1*sqrt(2112)))/(2*sqrt(539)*2 + sqrt(539) - sqrt(539) - -5*((2*sqrt(539) - sqrt(539)) + sqrt(539))).", "\n-48*sqrt(3)/49\nSimplify ((4*sqrt(275)*-2)/(sqrt(35)/(sqrt(28)/sqrt(4))))/((-4*sqrt(480))/(sqrt(144)/sqrt(6) + sqrt(6) - sqrt(6))).", "\nsqrt(11)\nSimplify 3*(((-3*(3*(sqrt(19) + sqrt(57)/sqrt(3)) - sqrt(19))*-1*5)**2 + 1)*3 + -2).", "\n961878\nSimplify ((-5*2*sqrt(112))/(-2*sqrt(200) - sqrt(200)))/(sqrt(7) + sqrt(84)/(sqrt(60)/sqrt(5) + sqrt(12)) - sqrt(567)/sqrt(9)).", "\n-4*sqrt(2)/9\nSimplify (sqrt(119)/sqrt(7) + -5 + -3 + -1 - (-2 + (sqrt(272) + 2 - sqrt(272)) + sqrt(272) - (2 + -2*sqrt(272))))**2.", "\n154*sqrt(17) + 2106\nSimplify ((5 + (sqrt(1300) + sqrt(1300) + 1*sqrt(1300) + sqrt(1300))*2 - ((sqrt(832) - (0 + sqrt(832))) + sqrt(65)/(sqrt(5)*-1) + 4))*-5)**2.", "\n4050*sqrt(13) + 2132350\nSimplify (-6*-2*-6*(5*(sqrt(468) - (1 + sqrt(468))) + 2 + -2))**2.", "\n129600\nSimplify (sqrt(45) + 2 + sqrt(1125) + sqrt(320) + (sqrt(320) - (sqrt(320) - (sqrt(320) - (sqrt(320) + -1*sqrt(320)*-4)))) + sqrt(320))*-4.", "\n-8*sqrt(5) - 8\nSimplify (sqrt(1200) + 3)**2*-6 + -4 + (-3*((sqrt(1200) - (sqrt(1200) + 4 + 1) - sqrt(1200)) + sqrt(1200)))**2.", "\n-7033 - 720*sqrt(3)\nSimplify (sqrt(38) - (sqrt(190)/sqrt(80) + sqrt(38)) - sqrt(190)/(sqrt(5)*-2))/((sqrt(200) + 2*(-2*sqrt(200) + sqrt(200) - sqrt(200)))*-4).", "\nsqrt(19)/480\nSimplify ((-5*(sqrt(1584)*-1 - sqrt(1584)) - (-5 + sqrt(1584)*1))*5)**2 + (1 + (0 + sqrt(1331) + (sqrt(1331) - -1*sqrt(1331) - sqrt(1331)))*-6)**2.", "\n26736*sqrt(11) + 3399890\nSimplify (((sqrt(192) + sqrt(192)*-2*-6 + sqrt(192))*6)**2 + sqrt(192) + (6*(sqrt(192)*-1 + sqrt(192)))**2 + -1 + sqrt(192) + 0)*5.", "\n80*sqrt(3) + 6773755\nSimplify (((-2*sqrt(5) - sqrt(5))*-3 + (sqrt(5) - ((sqrt(5) + -2)*2 + sqrt(5))))**2 + -4*(-2*sqrt(5) + sqrt(5) + -2))*-4.", "\n-1076 - 240*sqrt(5)\nSimplify (sqrt(56)/sqrt(32) + 3)*2 - ((sqrt(126)*2)/sqrt(2))/(sqrt(9) - (sqrt(9) - (sqrt(9) - (sqrt(9) - sqrt(27)/sqrt(3))*-6))).", "\n-sqrt(7) + 6\nSimplify (0 + 0 + -5 + ((sqrt(1216) + 1)*-6 - sqrt(1216)) + 5 + -1 + 5)**2.", "\n224*sqrt(19) + 59588\nSimplify ((sqrt(80)/(3*sqrt(4) - sqrt(4)) - sqrt(20)) + -3*sqrt(720))/(5*(sqrt(900) + 1*sqrt(900)) + sqrt(900) - sqrt(900)).", "\n-37*sqrt(5)/300\nSimplify 0 + 1*(-6*(-3 + sqrt(13)) + 4 + 4 + sqrt(832) + sqrt(832) + 3)**2.", "\n580*sqrt(13) + 2141\nSimplify -5 + -1*((3*sqrt(320)*6)**2 + (-3*5*sqrt(35)/sqrt(7))**2).", "\n-104810\nSimplify -2 + (((sqrt(468) + (sqrt(468) - (sqrt(468) + 0))*-6)*5)**2 - -4*5*2*sqrt(468)) + 5.", "\n240*sqrt(13) + 11703\nSimplify (-3 + sqrt(891) + (sqrt(891) - (sqrt(891)*1)**2) - (-1 + 1*sqrt(1331))) + (-5*(3*sqrt(704) + sqrt(704)) + sqrt(704) + 1*sqrt(704)*-4)**2.", "\n7*sqrt(11) + 371523\nSimplify (sqrt(304) + 5 + sqrt(209)/(sqrt(66)/sqrt(6)) + (sqrt(1216) - (sqrt(1216) + 2*sqrt(1216)*1)) + 4)**2 + -5.", "\n-198*sqrt(19) + 2375\nSimplify -3*(5 + sqrt(605) + -2)**2 + (sqrt(5) + ((-4*sqrt(25)/sqrt(5))**2 - sqrt(5)) - ((sqrt(5) - sqrt(45)) + 3)**2).", "\n-1791 - 186*sqrt(5)\nSimplify (sqrt(200) + ((sqrt(200)*2 - sqrt(200)) + sqrt(200) - sqrt(200)) + -5 - -3*sqrt(200)*3 - -4*sqrt(200)*1*-4) + 3.", "\n-50*sqrt(2) - 2\nSimplify 1*-5*(-3 + 4*(sqrt(13) - sqrt(325)*-2 - (sqrt(91)*1)/sqrt(7))**2).", "\n-25985\nSimplify -5 + -2 + (sqrt(208) - (-5*sqrt(208))**2) - ((sqrt(208) - (-1*(sqrt(208) + 4))**2) + -3).", "\n-4980 + 32*sqrt(13)\nSimplify (3*((sqrt(320) + -1 + 3)*-3 + 5 + -1*sqrt(180)*3))**2.", "\n756*sqrt(5) + 79389\nSimplify (-1*sqrt(612) + -2*(3 + sqrt(17)) - ((sqrt(17) + 2)*-5 + -2*sqrt(612))) + 3.", "\n7 + 9*sqrt(17)\nSimplify (2 + 3*(sqrt(2) + sqrt(2) + -1 + (1 + sqrt(2) - sqrt(2))) + 5*-1*sqrt(242))**2*5.", "\n-980*sqrt(2) + 24030\nSimplify (4 + -4 + (((sqrt(99) + sqrt(99) + -2)*2 - sqrt(99)) + -1*sqrt(99)*2 - -2*3*sqrt(99)*-3))**2.", "\n408*sqrt(11) + 28627\nSimplify 3 + 0 + -2 + (sqrt(264)/(2*sqrt(6)) - sqrt(44))**2 + sqrt(220)/sqrt(5) + -2.", "\n2*sqrt(11) + 10\nSimplify (4*sqrt(171)*-1)/(sqrt(45)/sqrt(5)*2) - (((-3 + sqrt(1216) - sqrt(1216)) + -4)**2 - (sqrt(1216) + -1 + -1 - sqrt(1216))**2).", "\n-45 - 2*sqrt(19)\nSimplify -5*(-4 + sqrt(50) + 5 + (1*sqrt(4)/sqrt(2) - (sqrt(10)/sqrt(5) + 0)))**2.", "\n-255 - 50*sqrt(2)\nSimplify 3*(((2*(sqrt(1792)*-1 - sqrt(1792)))**2 - sqrt(1792))*-1 + (-1*sqrt(1792) + 5)**2 + (-2*sqrt(1792) + sqrt(1792) + -1)**2 + sqrt(1792)) + -4.", "\n-75190 - 288*sqrt(7)\nSimplify ((sqrt(252)*2*-3)/sqrt(6))/((sqrt(96) - (-2*2*sqrt(96) - sqrt(96))) + sqrt(96)).", "\n-3*sqrt(7)/14\nSimplify (((sqrt(468) - sqrt(468)*1) + -1 + sqrt(468) + sqrt(468) + (2 + sqrt(468) + -5 - sqrt(468)))*4)**2 - ((sqrt(468) + 0)*4 + sqrt(468) + 0 + -5).", "\n-1566*sqrt(13) + 30213\nSimplify (-4 + (2*sqrt(80) + -4)*-2 + (1 + -2*sqrt(80) + sqrt(80) - (-4 + (-1 + sqrt(80) - sqrt(80)))))**2*-1.", "\n-2100 + 400*sqrt(5)\nSimpl" ]
{ "pile_set_name": "DM Mathematics" }
[ 0, 0, 0, 0, 0, 0, 0, 0.012195121951219513, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008695652173913044, 0, 0, 0.005847953216374269, 0, 0, 0, 0, 0, 0, 0.010638297872340425, 0, 0.006711409395973154, 0, 0, 0, 0, 0.006172839506172839, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0196078431372549, 0.011904761904761904, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.009345794392523364, 0, 0, 0, 0, 0, 0.014925373134328358, 0 ]
0.001559
5
[ { "analysis_explanation": null, "end": 390, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 382 }, { "analysis_explanation": null, "end": 479, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 468 }, { "analysis_explanation": null, "end": 2013, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2005 }, { "analysis_explanation": null, "end": 2519, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2496 }, { "analysis_explanation": null, "end": 2888, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2862 }, { "analysis_explanation": null, "end": 3663, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3623 }, { "analysis_explanation": null, "end": 5598, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5593 }, { "analysis_explanation": null, "end": 5611, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5600 }, { "analysis_explanation": null, "end": 7148, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7140 }, { "analysis_explanation": null, "end": 7727, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7718 }, { "analysis_explanation": null, "end": 7801, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7790 }, { "analysis_explanation": null, "end": 7964, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7952 }, { "analysis_explanation": null, "end": 8100, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8097 }, { "analysis_explanation": null, "end": 909, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 905 }, { "analysis_explanation": null, "end": 763, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 755 }, { "analysis_explanation": null, "end": 24, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 18 }, { "analysis_explanation": null, "end": 451, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 445 }, { "analysis_explanation": null, "end": 743, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 737 }, { "analysis_explanation": null, "end": 763, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 755 }, { "analysis_explanation": null, "end": 1478, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1472 }, { "analysis_explanation": null, "end": 2741, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2734 }, { "analysis_explanation": null, "end": 3314, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3308 }, { "analysis_explanation": null, "end": 3955, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3949 }, { "analysis_explanation": null, "end": 4399, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4392 }, { "analysis_explanation": null, "end": 4473, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4467 }, { "analysis_explanation": null, "end": 5085, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5078 }, { "analysis_explanation": null, "end": 5238, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5231 }, { "analysis_explanation": null, "end": 5933, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5927 }, { "analysis_explanation": null, "end": 6215, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6209 } ]
[ "Declcan Hayes & Andrew from AppierCom Ltd who created this amazing App free of charge for Limerick Suicide Watch.", "\n\nThe Emergency Service, All the Mental Health Services, Drug and Alcohol awareness Groups, Homeless and Family Support Groups, College and Secondary School representatives, Tom Morrisey from the Limerick All Ireland Hurling Champions 2018 and the talented musician Conor Ward who performed his song “Hope”.", "\n\nLucy O’Hara the groups PRO states, “Launching the “Limerick Suicide Watch APP” is an easy way for members of the public to access the various mental health services that are available to them, it’s is a one-stop shop where the many mental health providers in Limerick City and County can promote their services while making it easier for families and persons in distress to access the services required”.", "\n\nThe App is user friendly and will provide a brief description of the many services for people to avail of, making it simpler for people to make direct contact by a touch of a button providing a phone number, email and website. ", "It is also connected to Google Maps allowing people to find the service at ease.", "\n\nMetropolitan mayor Daniel Butler said, “The APP will be an incredible resource to the people in crisis or struggling”.", "\n\nAccording to Patrick Fitzgerald, this APP will make “a difference to people’s lives”.", "\n\nLimerick Suicide Watch is hopeful the APP will be beneficial to those in distress, suicidal or for somebody who maybe concerned about a person’s well-being, and hopefully save people’s lives.", "\n\nLimerick Suicide Watch would like to thank everybody who attended our launch, to fundraisers, the public, organisations and businesses for helping to support Limerick Suicide Watch and a special thank you to all Limerick Suicide Watch Volunteers for being there for people whom are distressed and contemplating suicide and for giving them hope." ]
{ "pile_set_name": "Pile-CC" }
[ 0.035398230088495575, 0.016286644951140065, 0, 0.004366812227074236, 0.0125, 0.016666666666666666, 0.022988505747126436, 0.0051813471502590676, 0.002890173410404624 ]
0.01292
5
[ { "analysis_explanation": null, "end": 298, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 286 }, { "analysis_explanation": null, "end": 316, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 308 }, { "analysis_explanation": null, "end": 351, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 347 }, { "analysis_explanation": null, "end": 388, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 378 }, { "analysis_explanation": null, "end": 431, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 420 }, { "analysis_explanation": null, "end": 692, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 679 }, { "analysis_explanation": null, "end": 1165, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1152 }, { "analysis_explanation": null, "end": 1283, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1265 } ]
[ "Comparison of outcomes in ST-elevation myocardial infarction according to age.", "\nMyocardial infarction constitutes a significant cause of morbidity and mortality. ", "Its pathophysiology varies according to age; atherosclerosis is the most common cause in older patients while thrombosis or plaque rupture is behind premature MI. ", "To compare the outcome differences between young (age ≤ 45 years) and older adults (age > 45 years) presenting with STEMI. ", "This was a retrospective cohort study of patients presenting with STEMI to the Emergency Department of a tertiary care center, between 2008 and 2018.Cases were patients age ≤ 45 and controls were the older population. ", "Descriptive and bivariate analyses were conducted followed by Logistic regression to identify the outcomes. ", "107 cases were matched with 214 controls. ", "Majority of patients were males (93% of cases and controls). ", "Younger patients were more likely to be smokers (80% vs. 57%, p < 0.001) and with a family history of MI (56% vs. 37%, p = 0.002). ", "Diabetes, hypertension, dyslipidemia and a previous history of MI were more common among controls, 37%, 60%, 43% and 42% respectively versus 10%, 24%, 36% and 25% in the younger population. ", "Younger patients had a higher prevalence of single-vessel disease compared to older patients (73% vs. 50%, p = 0.001). ", "LAD was the most commonly blocked vessel in both groups (71% vs. 64% respectively). ", "Ejection fraction was within normal range in the majority of controls and cases (63% vs. 56% respectively and 57% vs. 60% respectively). ", "Premature MI predominantly affects males and the associated risk factors are smoking and family history of MI. ", "It's characterized by single-vessel disease as compared to older patients." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0.0045871559633027525, 0.009259259259259259, 0, 0, 0.007633587786259542, 0, 0, 0, 0.0072992700729927005, 0, 0 ]
0.001919
5
[ { "analysis_explanation": null, "end": 322, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 320 }, { "analysis_explanation": null, "end": 388, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 380 }, { "analysis_explanation": null, "end": 422, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 414 }, { "analysis_explanation": null, "end": 586, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 574 }, { "analysis_explanation": null, "end": 624, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 622 }, { "analysis_explanation": null, "end": 1072, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1070 }, { "analysis_explanation": null, "end": 1319, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1316 }, { "analysis_explanation": null, "end": 1646, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1644 }, { "analysis_explanation": null, "end": 598, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 591 } ]
[ "Newt in 1996: Let’s build a real Jurassic Park, have sex in space\n\nWill Rahn\n\nNewt Gingrichsaid Wednesday that there would be a permanent American base on the moon by the end of his second term. ", "This should not come as a surprise.", "\n\nThe former House speaker has long been known for his boyish enthusiasm for subjects like dinosaurs, zoos and outer space. ", "And in his 1996 book “To Renew America” he even devoted a short chapter to proposals that are, in some cases, directly inspired by popular science fiction. (", "RELATED: Full coverage of Newt Gingrich)\n\n“Why not aspire to build a real Jurassic Park?” ", "Gingrich asked on page 190 of the book, adding in parenthesis that such an achievement “may not be at all impossible.”", "\n\n“Wouldn’t that be one of the spectacular accomplishments of human history?” ", "he continued. “", "What if we could bring back extinct species?”", "\n\nIn fact, Gingrich argued in the book that we have quite a lot to learn from the works of authors like Arthur C. Clarke and Jules Verne, and despaired those contemporary storytellers like Michael Crichton didn’t have the imaginations necessary to inspire Americans.", "\n\n“Somehow we must reintegrate the scientific with the popular and reconnect the future to the present,” he wrote. “", "This is less a job for scientists, engineers, bureaucrats, and administrators and more a job for novelists, moviemakers, popularizers, and politicians.”", "\n\nGingrich says that as a boy he was taught by science fiction to believe there was “a whole universe waiting to be learned and explored” and that, having grown older, he still believes “this positive vision of my childhood was the right one.”", "\n\nHowever, by 1996 Gingrich thought that the space program had lost its “spirit of adventure” because of the pernicious influence of government bureaucrats. ", "If they were to get out of the way and allow private space exploration, he wrote, private entrepreneurs could be given free reign to explore the heavens at a fraction of the cost.", "\n\nWe could also have sex in space.", "\n\n“I believe that space tourism will be a common fact of life during the adulthood of children born this year, that honeymoons in space will be the vogue by 2020,” Gingrich wrote toward the end of the chapter. “", "Imagine weightlessness and its effects and you will understand some of the attractions.”", "\n\nWhile proposing items like a permanent moon base make it clear that Gingrich is still intent on blurring the line between science fiction and government policy, there are some differences between the Newt of today and the one who wrote “To Renew America.” ", "The book is dedicated to his ex-wife and current antagonist “Marianne, who made it all worthwhile.”" ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0.008064516129032258, 0, 0.011111111111111112, 0, 0, 0, 0, 0.015037593984962405, 0, 0, 0, 0, 0, 0, 0, 0, 0.003875968992248062, 0.010101010101010102 ]
0.00241
5
[ { "analysis_explanation": null, "end": 4, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 12, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8 }, { "analysis_explanation": null, "end": 46, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33 }, { "analysis_explanation": null, "end": 95, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67 }, { "analysis_explanation": null, "end": 105, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96 }, { "analysis_explanation": null, "end": 146, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 138 }, { "analysis_explanation": null, "end": 368, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 364 }, { "analysis_explanation": null, "end": 550, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 537 }, { "analysis_explanation": null, "end": 598, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 585 }, { "analysis_explanation": null, "end": 609, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 601 }, { "analysis_explanation": null, "end": 875, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 867 }, { "analysis_explanation": null, "end": 976, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 960 }, { "analysis_explanation": null, "end": 992, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 981 }, { "analysis_explanation": null, "end": 1061, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1045 }, { "analysis_explanation": null, "end": 1121, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1112 }, { "analysis_explanation": null, "end": 1399, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1391 }, { "analysis_explanation": null, "end": 1649, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1645 }, { "analysis_explanation": null, "end": 1658, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1650 }, { "analysis_explanation": null, "end": 2108, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2099 }, { "analysis_explanation": null, "end": 2160, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2156 }, { "analysis_explanation": null, "end": 2171, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2163 }, { "analysis_explanation": null, "end": 2376, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2368 }, { "analysis_explanation": null, "end": 2504, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2500 }, { "analysis_explanation": null, "end": 2513, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2508 } ]
[ "Continuing Education\n\nThis course provides an update of the clinical pharmacology of local anesthetic agents and formulations used presently in dentistry and will review nine factors that may aid the practitioner in achieving better success of the traditional IANB technique." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0036363636363636364 ]
0.003636
5
[]
[ "Reassessment of the environmental mechanisms controlling developmental polyphenism in spadefoot toad tadpoles.", "\nIdentifying the environmental mechanism(s) controlling developmental polyphenism is the first step in gaining a mechanistic and evolutionary understanding of the factors responsible for its expression and evolution. ", "Tadpoles of the spadefoot toad Spea multiplicata can display either a \"typical\" omnivorous or a carnivorous phenotype. ", "Exogenous thyroxine and feeding on conspecific tadpoles have been accepted as triggers for development of the carnivorous phenotype on the basis of a series of studies in the early 1990s. ", "I repeated the thyroxine and conspecific-feeding assays and demonstrated that neither exogenous thyroxine nor feeding on conspecifics induces the carnivorous phenotype. ", "Previous researchers used simple ratio statistics to argue that field-collected carnivores and thyroxine-treated tadpoles are similar, and my results supported these claims if I used the same simple ratio methodology. ", "However, investigation of trait developmental trajectories and allometries for field-collected carnivores and thyroxine-treated and conspecific-fed tadpoles show that these phenotypes are profoundly different." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0, 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 632, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 617 } ]
[ "SAF SEEKS SCOTUS REVIEW OF IMPORTANT ILLINOIS CARRY CASE\n\nBELLEVUE, WA – The Second Amendment Foundation has petitioned the Supreme Court of the United States to review a case challenging the State of Illinois’ ban on concealed carry by non-residents, asserting that without high court review, “virtually all Americans will be deprived of their full Second Amendment rights while in the State of Illinois, based on nothing more than their state of residence.”", "\n\nJoining SAF in this legal action are the Illinois State Rifle Association (ISRA), Illinois Carry and nine private citizens. ", "They are represented by attorney David Sigale of Glen Ellyn, Ill., a veteran of Second Amendment cases in Illinois and elsewhere.", "\n\n“This is a case that literally begs for Supreme Court attention,” said SAF founder and Executive Vice President Alan M. Gottlieb. “", "When the Court ruled in the 2008 Heller case that the Second Amendment protected a fundamental right, it was clear that this right belongs to everyone, not just the residents of an individual state. ", "The Seventh Circuit held in Moore v. Madigan that the carrying of firearms in public for self-defense is a fundamental right, but under existing Illinois restrictions, that right has been limited to Illinois residents and citizens from only four other states.", "\n\n“All the plaintiffs in this case are asking for is to be treated equally to Illinois residents,” he added. “", "They’re not asking for special treatment. ", "They will take the training required by state law and abide by all the other rules.”", "\n\nISRA Executive Director Richard Pearson added, “It is unfair that people from out of state cannot get an Illinois concealed carry license. ", "We intend to remedy that.”", "\n\nThis is not the first legal action SAF has taken against Illinois. ", "Its case in Moore v. Madigan paved the way for creation of a licensing system that allows concealed carry. ", "Before that, SAF and ISRA sued Chicago to nullify its decades-old handgun ban. ", "SAF and its partners in this case have been busy fighting to expand Second Amendment rights in the state since the landmark 2010 ruling in McDonald v. City of Chicago.", "\n\n“We’re determined to make sure that all law-abiding citizens are not forced to leave their Second Amendment rights at the state border when they travel into or through Illinois,” Gottlieb stated. “", "This is yet another example of trying to win back firearms freedom, one lawsuit at a time.”" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.006535947712418301, 0.023809523809523808, 0.007751937984496124, 0.03007518796992481, 0.005025125628140704, 0.007722007722007722, 0, 0, 0, 0.0070921985815602835, 0, 0.014492753623188406, 0.018691588785046728, 0.02531645569620253, 0.011976047904191617, 0.005025125628140704, 0 ]
0.009618
5
[ { "analysis_explanation": null, "end": 70, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68 }, { "analysis_explanation": null, "end": 158, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 141 }, { "analysis_explanation": null, "end": 318, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 309 }, { "analysis_explanation": null, "end": 404, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 383 }, { "analysis_explanation": null, "end": 629, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 617 }, { "analysis_explanation": null, "end": 643, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 633 }, { "analysis_explanation": null, "end": 649, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 645 }, { "analysis_explanation": null, "end": 698, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 690 }, { "analysis_explanation": null, "end": 842, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 826 }, { "analysis_explanation": null, "end": 878, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 874 }, { "analysis_explanation": null, "end": 885, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 879 }, { "analysis_explanation": null, "end": 1078, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1073 }, { "analysis_explanation": null, "end": 1198, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1190 }, { "analysis_explanation": null, "end": 1252, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1244 }, { "analysis_explanation": null, "end": 1389, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1381 }, { "analysis_explanation": null, "end": 1580, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1565 }, { "analysis_explanation": null, "end": 1654, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1646 }, { "analysis_explanation": null, "end": 1772, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1764 }, { "analysis_explanation": null, "end": 1791, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1786 }, { "analysis_explanation": null, "end": 1919, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1912 }, { "analysis_explanation": null, "end": 1946, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1935 }, { "analysis_explanation": null, "end": 2088, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2084 }, { "analysis_explanation": null, "end": 2126, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2099 }, { "analysis_explanation": null, "end": 2304, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2296 }, { "analysis_explanation": null, "end": 2315, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2307 } ]
[ "Q:\n\nHow to start day-trading? ", "Any advice about software for beginner?", "\n\nI want to start day trading, but I am beginner and I need help.", "\nIs there some online tutorial? ", "I want to start with just 1000 dollar.", "\nIs it enought? ", "I find ninja trader software. ", "Is it good? ", "Or do you\nknow any better software for beginner?", "\n\nA:\n\nMaybe learn a bit more before plunging in with your own money, buy some good books on the subject and on technical analysis. ", "Open up a virtual account and test your strategies first, develop a trading plan and include risk management in it, think about what the worst case scenario will be on each trade. ", "Learn about position sizing and where to place your stop losses. ", "A good book to start with is \"Trade your way to Financial Freedom\" by Van Tharp.", "\n$1000 is a bit small to start even if you use margin, because one bad trade can wipe you out, or even worse, you could lose even more than your $1000 if using margin whilst you don't know what you are doing. ", "Whilst you are learning about trading and technical analysis save up some more money. ", "I would use a minimum of $5000 and preferably over $10000 if using margin and at least $20000 without margin.", "\nAlso one other thing, day trading means you will need to spend most of your day in front of your screen, will this interfere with your day job and will you be getting enough sleep? ", "You need to be trading with a clear mind. ", "There are alternatives to day trading, position trading and swing trading to name 2. ", "You will be in a position from a couple of days to a couple of weeks in these type of trading and you won't have to be in front of your screen all day. ", "You can spend one or two hours per day after market close to place new orders and manage existing ones, that way it won't interfere with your day job or other daily activities you do.", "\n\nA:\n\n$1000 is certainly not enough cash to begin to day trade with. ", " Brokerage will eat your bankroll, even if you do manage to do well. ", " If you can get cheap brokerage (say $5, which is lower than any I've seen) you're still wasting 1% of your bankroll every time you trade in and out. ", " Given that on a good day you might make 2-3% on your day trades and on a bad day lose 2-3%, what you're really doing is paying the brokerage company to have some fun on the market.", "\nSuccessful day trading is mostly a myth peddled by people with books to sell. ", " You're actually much better off in the long run just sticking your money in an index fund. ", " \nOr betting it all on black.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.025, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
0.000862
5
[ { "analysis_explanation": null, "end": 89, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86 }, { "analysis_explanation": null, "end": 763, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 754 }, { "analysis_explanation": null, "end": 1421, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1418 }, { "analysis_explanation": null, "end": 1524, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1508 }, { "analysis_explanation": null, "end": 1545, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1528 }, { "analysis_explanation": null, "end": 1627, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1620 }, { "analysis_explanation": null, "end": 1659, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1650 }, { "analysis_explanation": null, "end": 2153, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2150 }, { "analysis_explanation": null, "end": 2177, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2168 }, { "analysis_explanation": null, "end": 2292, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2289 } ]
[ "Gent - Een naakte man en vrouw die verstrengeld in elkaar aan het vrijen zijn voor een groepje kinderen op het toneel. ", "Het is een opmerkelijke scène uit het controversiële toneelstuk ‘Lam Gods’, dat donderdag in avant-première ging bij het NTGent. “", "Het gaat om een erotische choreografie en niet om échte seks”, benadrukt het theatergezelschap.", "\n\nDe acteurs spelen Adam en Eva die op een gegeven moment met elkaar beginnen te vrijen. ", "Een groep meisjes, die eveneens meespelen in het stuk, kijken van dichtbij toe. “", "Het is niet wat het lijkt”, stelt NTGent. “", "Het gaat om een erotische choreografie en niet om échte seks.” ", "Er wordt dus niet gepenetreerd.", "\n\n“Twee blote mensen die elkaar graag zien”\n\nDe kinderen, een koortje, werden bovendien goed begeleid en de ouders waren op de hoogte van de pikante inhoud, klinkt het verder. “", "We hebben aan de kinderen uitgelegd dat het maar theater is. ", "Het zijn gewoon twee blote mensen die elkaar graag zien.”", "\n\nRegisseur Milo Rau ziet geen probleem, zegt hij tegen VTM Nieuws. “", "We hebben veel naakt, maar Adam en Eva waren ook naakt. ", "600 jaar geleden was het schilderij Lam Gods ook een schandaal. ", "Maar dat is zoals God ons geschapen heeft.”", "\n\nSyriëstrijders\n\nEerder ontstond er al controverse omtrent ‘Lam Gods’, nadat er via een zoekertje gezocht werd naar teruggekeerde Syriëstrijders om mee te spelen. ", "Volgens Rau zijn zij “een moderne versie van de kruisvaarders”, stelde hij destijds. ", "Enkele dagen later kwam NTGent daarop terug. ", "De theatergroep liet weten dat het “niet samenwerkt met, en geen podium geeft aan criminele terroristen”.", "\n\nDe moeder van een Syriëstrijder doet wel mee met het toneelstuk. ", "Haar zoon zou vorige week in Idlib zijn gesneuveld. ", "De vrouw speelt Moeder Maria." ]
{ "pile_set_name": "OpenWebText2" }
[ 0, 0, 0, 0.02247191011235955, 0.024691358024691357, 0, 0, 0.03225806451612903, 0.005649717514124294, 0, 0, 0.028985507246376812, 0.017857142857142856, 0.015625, 0.023255813953488372, 0.006097560975609756, 0.03529411764705882, 0.022222222222222223, 0, 0.014925373134328358, 0, 0.034482758620689655 ]
0.012901
5
[ { "analysis_explanation": null, "end": 47, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35 }, { "analysis_explanation": null, "end": 326, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 313 }, { "analysis_explanation": null, "end": 356, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 346 }, { "analysis_explanation": null, "end": 375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 364 }, { "analysis_explanation": null, "end": 421, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 406 }, { "analysis_explanation": null, "end": 450, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 437 }, { "analysis_explanation": null, "end": 464, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 456 }, { "analysis_explanation": null, "end": 486, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 478 }, { "analysis_explanation": null, "end": 540, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 522 }, { "analysis_explanation": null, "end": 652, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 625 }, { "analysis_explanation": null, "end": 672, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 655 }, { "analysis_explanation": null, "end": 708, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 677 }, { "analysis_explanation": null, "end": 721, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 710 }, { "analysis_explanation": null, "end": 807, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 723 }, { "analysis_explanation": null, "end": 815, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 809 }, { "analysis_explanation": null, "end": 839, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 833 }, { "analysis_explanation": null, "end": 873, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 856 }, { "analysis_explanation": null, "end": 878, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 874 }, { "analysis_explanation": null, "end": 906, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 895 }, { "analysis_explanation": null, "end": 924, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 912 }, { "analysis_explanation": null, "end": 946, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 929 }, { "analysis_explanation": null, "end": 967, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 949 }, { "analysis_explanation": null, "end": 977, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 973 }, { "analysis_explanation": null, "end": 996, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 988 }, { "analysis_explanation": null, "end": 1089, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1077 }, { "analysis_explanation": null, "end": 1097, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1094 }, { "analysis_explanation": null, "end": 1117, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1109 }, { "analysis_explanation": null, "end": 1141, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1137 }, { "analysis_explanation": null, "end": 1178, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1173 }, { "analysis_explanation": null, "end": 1238, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1216 }, { "analysis_explanation": null, "end": 1290, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1278 }, { "analysis_explanation": null, "end": 1324, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1296 }, { "analysis_explanation": null, "end": 1334, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1328 }, { "analysis_explanation": null, "end": 1363, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1343 }, { "analysis_explanation": null, "end": 1440, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1428 }, { "analysis_explanation": null, "end": 1471, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1459 }, { "analysis_explanation": null, "end": 1524, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1473 }, { "analysis_explanation": null, "end": 1550, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1545 }, { "analysis_explanation": null, "end": 1554, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1551 }, { "analysis_explanation": null, "end": 1564, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1555 }, { "analysis_explanation": null, "end": 1576, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1565 }, { "analysis_explanation": null, "end": 1596, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1579 }, { "analysis_explanation": null, "end": 1623, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1616 }, { "analysis_explanation": null, "end": 1642, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1628 }, { "analysis_explanation": null, "end": 1669, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1654 }, { "analysis_explanation": null, "end": 1678, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1673 }, { "analysis_explanation": null, "end": 1694, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1679 }, { "analysis_explanation": null, "end": 1704, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1696 }, { "analysis_explanation": null, "end": 1724, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1712 } ]
[ "DistroWatch Weekly, Issue 723, 31 July 2017\n\nFeature Story (by Jesse Smith)\n\nSet up web services quickly with UBOS 11 UBOS is a rolling release distribution based on Arch Linux. ", "The project produces an operating system for servers with the intent of making it a very quick and easy process to set up web-based services. ", "The project's website states: We created UBOS, a new Linux distro, in order to make it simple to set up and maintain a Linux server that runs common web applications and keeps data under control of the owner of the server. ", "Using a friendly command line utility called ubos-admin, it is possible for the user to install new web applications, create backups, install free security certificates from Let's Encrypt and keep the system up to date. ", "The UBOS website mentions a few other useful features: • [UBOS] pre-installs and pre-configures networking and other infrastructure, so it is ready to be used as soon as it has booted.", "\n\n\n\n• Systems that have two Ethernet interfaces can be turned into a home router/gateway with a single command. ", "In this gateway configuration, UBOS automatically sets up network masquerading, a firewall, a local DNS and DHCP server.", "\n\n\n\n• UBOS can backup or restore all, or any subset of installed applications on a device, including their entire configuration (like TLS) in a single command. ", "Each of these features can be accessed using a single, short command from the console. ", "I will come back to specific examples of UBOS's convenient functions later.", "\n\n\n\nInstalling\n\n\n\nUBOS is available in a variety of builds. ", "We can download disk images for Raspberry Pi, BeagleBone Black and Marvell EspressoBIN computers. ", "There are also installation images for 64-bit x86 personal computers and virtual machine disk images. ", "These downloads range in size from about 410MB to 530MB. ", "The downloads are compressed and, when decompressed, the disk images are approximately 3GB in size.", "\n\n\n\nWhen installing UBOS on a personal computer or server, we can boot the installation media to a text console and run a single command to launch an automated install process. ", "We need only to provide the name of the disk where UBOS is to be installed.", "\n\n\n\nFirst impressions\n\n\n\nThe installed copy of UBOS boots to a text console where we can sign into the root account without needing a password. ", "By default the UBOS environment is fairly minimal. ", "We are given just a command line environment without many utilities and no manual pages. ", "In the background, UBOS runs the OpenSSH secure shell service. ", "With the default settings, the root user cannot login to UBOS remotely and there are no other user accounts we can use to sign in. ", "Later, if we like, we can set up a regular user account and use it to access UBOS from another computer.", "\n\n\n\nThe operating system uses about 100MB of RAM and takes up 1GB of disk space. ", "Later, as we add more services, these resource requirements climb a bit. ", "I found running a few web applications used just over 1GB of disk space and about 200MB of RAM.", "\n\n\n\nUBOS, being based on Arch Linux, runs cutting edge software. ", "At the time of writing, this includes systemd 232 and version 4.11.3 of the Linux kernel. ", "I was surprised to discover UBOS uses the advanced Btr file system for its root partition. ", "Btrfs is not commonly used yet by many Linux distributions, but it offers a number of intriguing features such as file system snapshots.", "\n\n\n\nUsing UBOS\n\n\n\nMost of UBOS's features are accessed through a command line utility called ubos-admin. ", "This tool assists us in installing software updates, setting up new services, checking the status of running services, performing backups and restoring the system from a backup archive. ", "Tutorials on how to use each of the ubos-admin features can be found in the UBOS documentation. ", "Most of these functions are summarized in the UBOS Quick-Start guide.", "\n\n\n\nThe ubos-admin utility can help us set up eight different web-based services, which we can see listed on the project's website or by running the \"pacman -Sl hl\" command. ", "When we want to install and configure a new service we can run the command \"ubos-admin createsite\". ", "This launches a command line wizard where we are asked to provide the name of a service we wish to install. ", "The wizard asks us to provide a username and password we will use to access the new web-app service. ", "We are then asked to provide a URL where we will be able to access the new service. ", "The wizard downloads the packages we need and performs the necessary configuration steps. ", "The ubos-admin tool then offers to set up another service.", "\n\n\n\nWhen the tool is finished running, we have the requested chat client, Wordpress installation, Nextcloud and/or wiki running on our computer. ", "The entire process for each set up generally takes less than a minute. ", "This makes setting up new web services much faster than it would be to configure these services and their web server entries by hand. ", "Visiting our computer's URL in a web browser lists the available applications we are running and we can alternately link directly to each service using the URL we selected when running \"ubos-admin createsite\".", "\n\n\n\n\n\nUBOS 11 -- Listing installed services\n\n(full image size: 59kB, resolution: 1055x798 pixels)\n\n\n\nI tried setting up a couple of services and had mixed results. ", "For example, the Wordpress blogging software worked perfectly and the wiki software seems to work well. ", "However, when I installed the NextCloud file synchronization application the software installed, but produced errors whenever I tried to access the NextCloud front page.", "\n\n\n\nThe ubos-admin utility can perform a number of other useful tasks, including listing installed web applications and showing us the status of each service. ", "Perhaps one of the more impressive features is the ability to backup all of our web services and data with a single command.", "\n\n\n\nRunning \"ubos-admin backup --out my-archive\" creates an archive file with all of our web applications and data. ", "The my-archive file can be transferred to another server or disk for safe keeping. ", "We can then restore our web services from the backup by running \"ubos-admin restore --in my-archive\". ", "I was pleased to find that the restore feature works on clean installations of UBOS. ", "This means if our server completely fails, we can install UBOS on another computer and restore all of our web services to working order by running the restore command on an existing archive.", "\n\n\n\nOther observations\n\n\n\nFor the most part UBOS and its utilities worked well for me. ", "The ubos-admin tool works as advertised and I found the speed and ease of use impressive. ", "I did, however, run into a couple of problems during my time with UBOS.", "\n\n\n\nOne of the bigger issues I ran into was that, once I had set up a couple of services with \"ubos-admin createsite\", I was unable to add new services later. ", "For example, at one point I set up an installation of UBOS running Wordpress and NextCloud. ", "This initial configuration went smoothly. ", "Later, I tried to run \"ubos-admin createsite\" again in order to add the Mattermost application and the ubos-admin tool informed me I could not add new services as the server had already been set up. ", "It appears that appending new services to an existing installation of UBOS will not work. ", "This seems to me to be a severe limitation as it means we cannot extend an existing server's functionality the way we would with other common server distributions.", "\n\n\n\nAnother problem I ran into was with getting UBOS to shut down. ", "When no web applications were installed, I was able to power down or reboot the computer without any problem. ", "However, as soon as I installed a web service, the shutdown and reboot commands no longer worked. ", "The system would start to shut down and then freeze. ", "I was able to use the poweroff command to shut down the system, but could not find a way to reboot. ", "This meant that remotely upgrading and restarting the server was not possible; maintenance requiring a reboot would need to be performed while physically sitting at the computer. ", "For UBOS users at home this would not be much of an issue, but it would be a notable limitation for people working remotely.", "\n\n\n\nConclusions\n\n\n\nSome people might think that UBOS is targeting less experienced users with its talk of quickly and easily setting up popular web services at home. ", "At least that was my initial impression of the project's mission. ", "However, I came to realize that UBOS makes certain admin tasks very fast and convenient, but not necessarily beginner friendly. ", "Running UBOS means using the command line and being comfortable with the Linux command line tools. ", "The UBOS project does provide us with documentation for using the ubos-admin software which is very useful, but we are not given manual pages or guides for other commands. ", "This means UBOS users should already be comfortable working from a terminal, but do not necessarily need to know anything about setting up an Apache web server or web applications.", "\n\n\n\nFor the most part, UBOS does a good job of making it quick and easy to set up a handful of web services. ", "What would usually take me twenty minutes to install, configure and test takes less than five minutes with UBOS and I appreciate this time saving technology. ", "The ability to backup multiple websites and their databases in seconds with one command is also a very welcome feature.", "\n\n\n\nThere were downsides to using UBOS I ran into. ", "One was the distribution refusing to reboot after services were installed. ", "The second was the issue I ran into where I could not install new services once web applications had already been installed. ", "This seems like a restriction which would get in the way in any situation where we want to experiment with new applications.", "\n\n\n\nA final issue I ran into was UBOS currently does not offer many pre-packaged services. ", "There are, at the time of writing, eight available web services we can install and configure with a single command. ", "This is a good start, but I hope more services are added later, perhaps for other blogging software, development tools and other common web services. ", "The basics many home users are likely to want are already in UBOS's inventory and I hope the selection is expanded to appeal to a wider audience in the future. * * * * * ", "Visitor supplied rating\n\n\n\nUBOS has a visitor supplied average rating of: 4/10 from 1 review(s).", "\n\nHave you used UBOS? ", "You can leave your own review of the project on our ratings page.", "\n\n\n\n\n\nMiscellaneous News (by Jesse Smith)\n\nKorora provides list of popular applications, Ubuntu MATE seeks user feedback and unveils HUD, GNUstep releases first update in seven years, OpenBSD to use Clang by default When new users first try a Linux distribution one major challenge is discovering which applications they should use to perform tasks. ", "To save their users from digging through a long list of applications in search of the right one the Korora team has put together a quick guide that matches popular applications to specific tasks. \" ", "One of the core aims of the Korora Project is to provide an out-of-box Linux experience that can take care of the average user's daily needs with entirely free software. ", "To save you the trouble of digging through every pre-installed application, we have compiled a list of the prepackaged applications within each version of Korora that fulfill a specific purpose. ", "This will hopefully save you some trouble from immediately downloading more software when the right tool may already be installed. \" ", "The guide is divided into five separate sections, one for each desktop edition Korora offers. * * * * * ", "The Ubuntu MATE team is seeking feedback from the community as to which media player people would like to see installed by default. ", "The project has set up a poll and invited people to vote on whether they think VLC, MPV or Totem would be the best default video player for the distribution. ", "The winner of the poll will likely become the default player in the upcoming release of Ubuntu MATE 17.10.", "\n\n\n\nOne of the new features Ubuntu MATE is experimenting with for the upcoming 17.10 release is a global menu with HUD support. ", "The HUD, which was a popular feature of the Unity 7 desktop, allows users to search quickly through an application's menu without taking their hands off the keyboard. ", "The user can tap a short-cut key and type the name of the function they wish to use. ", "A demonstration of the HUD at work can be found in the release announcement for Ubuntu MATE 17.10 Alpha 2. \" ", "This is something we started during Ubuntu MATE 16.10 and never perfected, but is now ready for prime time. ", "A favourite of Unity 7 users is the Heads-Up Display (HUD) which provides a way to search for and run menu-bar commands without your fingers ever leaving the keyboard. ", "So if you're trying to find that single filter in GIMP but can't remember which filter category it fits into or if you can't recall if Preferences sits under File, Edit or Tools on your favourite browser, you can just search for it rather than hunting through the menus. \" * * * * * ", "GNUstep Live CD is a Debian-based live disc which features the GNUstep software. ", "The GNUstep Live CD distribution had been dormant for approximately seven years, but has since been updated with a new release. ", "The new version runs on 64-bit x86 computers and brings many major version bumps to installed packages. ", "More information can be found on the project's website. * * * * * ", "The OpenBSD project has traditionally shipped with the GNU Compiler Collection (GCC) as the operating system's default compiler. ", "While the GNU compiler will continue to be available to developers, the OpenBSD project is switching to using the Clang compiler as the default compiler on the x86 and x86_64 architectures. ", "Clang has been gaining adoption, particularly in the BSD community, due to its clear error messages and liberal license. * * * * * ", "These and other news stories can be found on our Headlines page.", "\n\n\n\n\n\nQuestions and Answers (by Jesse Smith)\n\nTransferring a list of installed packages\n\n\n\nTaking-my-packages-with-me asks: Is there a way to transfer the list of installed packages from one computer to another? ", "Like if I am setting up a new computer with Ubuntu 17.04 can I transfer the list of installed packages from my old Ubuntu 16.04 system?", "\n\n\n\nDistroWatch answers: Yes, there are a few ways to transfer a list of installed packages from one computer to another and optionally install the same packages on the new system. ", "However, when switching between two separate distributions (or different versions of the same distribution) it is possible to run into incompatibilities. ", "Distributions sometimes name their packages differently and packages may disappear from one version of an operating system to the next.", "\n\n\n\nWith Ubuntu, and other members of the Debian family, it is possible to get a list of installed (also referred to as selected) packages on the first computer by running the command dpkg --get-selections The above command will display a list of software components and their status. ", "To save this information to a file we can redirect the output to a text file: dpkg --get-selections > package-list The package-list file can be transferred to another computer and then used to select/install the same software on the second computer. ", "This is done by first transferring the list to the new computer and then using a utility called dselect to help install the software on your new computer.", "\n\n\n\nFirst we need to make sure the dselect utility is present on the new computer: sudo apt-get update\n\nsudo apt-get install dselect Then we import the list of packages we saved from the old computer and install them. ", "sudo dselect update\n\nsudo dpkg --set-selections < package-list\n\nsudo apt-get dselect-upgrade I also recommend making sure any non-standard repositories you have enabled on your old computer you also enable on your new computer. ", "If you have set up a third-party repository for installing Chrome, for example, then that repository should be enabled prior to performing the above steps to install your software on the new computer. ", "You can usually find a list of enabled repositories in the /etc/apt/sources.list.d directory.", "\n\n\n\nWhen setting up repositories on the new computer, I do not recommend simply copying the repository files from your old computer's /etc/apt/sources.list directory as they may contain version-specific information. ", "In other words, we do not want the new version of your operating system to try to install software from repositories containing packages for older versions of your distribution. ", "It is better to set up your repositories fresh, following instructions from the upstream website to avoid version conflicts.", "\n\n\n\nDifferent distributions use different package managers and the above steps will only work on the Debian family of distributions. ", "If you are using a distribution in the Fedora family then it will be necessary to perform similar steps using the RPM and DNF software utilities. ", "On the older computer you could use RPM to get a list of installed packages: rpm -qa --qf \"%{NAME}\n\n\" > package-list Then, transfer the package-list file to the newer computer and run the DNF command to import the list of packages: sudo dnf install $(cat package-list | tr '\n\n' ' ') Each package manager has its own methods for providing a list of installed packages and for importing a list of software to install. ", "For distributions not in the Fedora or Debian families, I recommend reading your operating system's documentation on exporting and importing lists of installed packages. * * * * * ", "More answers can be found in our Questions and Answers archive.", "\n\n\n\n\n\nReleased Last Week\n\nTorrent Corner\n\nUpcoming Releases and Announcements\n\nOpinion Poll\n\nInstalling applications on a new computer\n\n\n\nWhen installing a new operating system or moving to another computer, it is convenient to be able to transfer the applications we usually use from our old operating system to the new one. ", "In this week's Questions and Answers article we discussed ways to get a list of installed packages to move to another operating system. ", "We would like to find out how our readers transfer their software between systems. ", "Feel free to provide your own tips for taking applications with you between computers in the comments.", "\n\n\n\nYou can see the results of our previous poll on monitoring system logs in last week's edition. ", "All previous poll results can be found in our poll archives.", "\n\n\n\nInstalling applications on a new computer\n\n\n\nI export/import package lists: 89 (6%) I use a sync service: 9 (1%) I manually track software and install it myself: 598 (37%) I only install new applications as I need them on the new OS: 858 (53%) Other: 57 (4%)\n\nDistroWatch.com News" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.02247191011235955, 0, 0.004484304932735426, 0, 0.005434782608695652, 0, 0.025, 0.00625, 0, 0.013333333333333334, 0, 0.02040816326530612, 0, 0.017543859649122806, 0, 0.005649717514124294, 0.013333333333333334, 0, 0, 0, 0, 0, 0, 0.012345679012345678, 0, 0.010526315789473684, 0.03076923076923077, 0, 0.01098901098901099, 0.007352941176470588, 0.009523809523809525, 0, 0, 0, 0, 0, 0, 0.009900990099009901, 0, 0, 0, 0.013793103448275862, 0, 0, 0, 0, 0.009615384615384616, 0.011834319526627219, 0, 0, 0, 0, 0, 0.011764705882352941, 0, 0, 0, 0.014084507042253521, 0, 0.03260869565217391, 0, 0, 0, 0, 0.014925373134328358, 0, 0, 0, 0, 0, 0.008064516129032258, 0.012048192771084338, 0, 0.0078125, 0, 0.005813953488372093, 0, 0.009174311926605505, 0.006329113924050633, 0, 0.0196078431372549, 0, 0, 0, 0, 0, 0, 0.0058823529411764705, 0.010416666666666666, 0.045454545454545456, 0, 0.008571428571428572, 0.005050505050505051, 0, 0.005128205128205128, 0, 0.009615384615384616, 0, 0.0189873417721519, 0, 0.0078125, 0.005988023952095809, 0, 0.009174311926605505, 0, 0.005952380952380952, 0, 0, 0, 0, 0, 0.007751937984496124, 0.005263157894736842, 0.007633587786259542, 0.015625, 0.0047169811320754715, 0, 0, 0, 0, 0.0035087719298245615, 0, 0, 0, 0, 0.004975124378109453, 0, 0, 0, 0, 0.007518796992481203, 0.02054794520547945, 0.002403846153846154, 0, 0, 0.006134969325153374, 0, 0, 0, 0, 0, 0.0035211267605633804 ]
0.00444
5
[ { "analysis_explanation": null, "end": 43, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31 }, { "analysis_explanation": null, "end": 74, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63 }, { "analysis_explanation": null, "end": 176, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 166 }, { "analysis_explanation": null, "end": 444, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 439 }, { "analysis_explanation": null, "end": 1465, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1461 }, { "analysis_explanation": null, "end": 1596, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1584 }, { "analysis_explanation": null, "end": 1929, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1925 }, { "analysis_explanation": null, "end": 2137, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2133 }, { "analysis_explanation": null, "end": 2461, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2457 }, { "analysis_explanation": null, "end": 2562, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2558 }, { "analysis_explanation": null, "end": 2713, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2709 }, { "analysis_explanation": null, "end": 3014, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3004 }, { "analysis_explanation": null, "end": 3125, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3120 }, { "analysis_explanation": null, "end": 3166, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3162 }, { "analysis_explanation": null, "end": 3230, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3225 }, { "analysis_explanation": null, "end": 3269, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3264 }, { "analysis_explanation": null, "end": 3388, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3384 }, { "analysis_explanation": null, "end": 4737, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4719 }, { "analysis_explanation": null, "end": 6412, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6408 }, { "analysis_explanation": null, "end": 6826, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6822 }, { "analysis_explanation": null, "end": 7175, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7171 }, { "analysis_explanation": null, "end": 7403, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7399 }, { "analysis_explanation": null, "end": 8131, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8127 }, { "analysis_explanation": null, "end": 8347, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8343 }, { "analysis_explanation": null, "end": 8517, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8512 }, { "analysis_explanation": null, "end": 8914, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8910 }, { "analysis_explanation": null, "end": 9037, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9023 }, { "analysis_explanation": null, "end": 9097, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9075 }, { "analysis_explanation": null, "end": 9107, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9103 }, { "analysis_explanation": null, "end": 9224, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9217 }, { "analysis_explanation": null, "end": 9679, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9675 }, { "analysis_explanation": null, "end": 10064, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10060 }, { "analysis_explanation": null, "end": 10386, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10375 }, { "analysis_explanation": null, "end": 10528, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10517 }, { "analysis_explanation": null, "end": 10550, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10545 }, { "analysis_explanation": null, "end": 10594, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10589 }, { "analysis_explanation": null, "end": 10970, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10965 }, { "analysis_explanation": null, "end": 11028, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11023 }, { "analysis_explanation": null, "end": 12708, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12704 }, { "analysis_explanation": null, "end": 13097, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13072 }, { "analysis_explanation": null, "end": 13564, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13559 }, { "analysis_explanation": null, "end": 13640, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13635 }, { "analysis_explanation": null, "end": 13868, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13857 }, { "analysis_explanation": null, "end": 14830, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14820 }, { "analysis_explanation": null, "end": 15570, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15540 }, { "analysis_explanation": null, "end": 16752, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16746 }, { "analysis_explanation": null, "end": 17304, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17298 }, { "analysis_explanation": null, "end": 17531, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17522 }, { "analysis_explanation": null, "end": 17845, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17841 }, { "analysis_explanation": null, "end": 18240, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18229 }, { "analysis_explanation": null, "end": 16047, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 16037 }, { "analysis_explanation": null, "end": 16212, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 16202 }, { "analysis_explanation": null, "end": 18586, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 18571 }, { "analysis_explanation": null, "end": 10247, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 10243 } ]
[ "Nacional | Podemos\n\nPodemos advierte que será responsabilidad del PSOE si tienen que repetirse las andaluzas\n\nPor E.B.\n\njueves 16 de abril de 2015 , 00:00h\n\nTeresa Rodríguez, secretaria general de Podemos Andalucía Teresa Rodríguez califica el hecho de que Pablo Iglesias regalara Juego de Tronos al Rey de un “gesto simpático sin más” Teresa Rodríguez califica el hecho de que Pablo Iglesias regalara Juego de Tronos al Rey de un “gesto simpático sin más”\n\nLa secretaria general de Podemos en Andalucía, Teresa Rodríguez, afirmó en RNE que hoy lo que se determina es la composición de la Mesa del Parlamento andaluz -en la que cree que si todo transcurre como debería tendrán un vicepresidente tercero- e insistió en que para facilitar la investidura de Susana Díaz ellos han planteado al PSOE tres propuestas de “coste cero” (dimisión de los expresidentes de la Junta de Andalucía Manuel Chaves y José Antonio Griñán, a que no se ejecuten desahucios sin alternativa y a que se reduzca el número de altos cargo) unas medidas de mínimos a las a que todavía no le han dado respuesta.", "\n\n\n\nEl día en que se constituye el Parlamento andaluz, tras las elecciones del 22 de marzo, y en una jornada en la que los diputados tomarán posesión de sus escaños y después los partidos votarán la composición de la Mesa de la Cámara autonómica, la representante de Podemos deja claro que no podían consentir conseguir la presidencia del Parlamento con el precio de apoyar del PP, lo que considera “inaceptable” dado que “nuestro compromiso con los votantes es plantear alternativas al PP y somos coherentes con nuestro compromiso y con nuestro diagnóstico”.", "\n\n\n\nEn relación a la petición de que Manuel Chaves y José Antonio Griñán renuncien a sus escaños explica que lo hacen “ya que entendemos que la lucha contra la corrupción pasa por acabar con la impunidad y no tenemos mucha costumbre en este país de que haya responsabilidades políticos y entendemos que Griñán y Chaves han perdido la confianza de los ciudadanos para que le representen y eso es independiente de la responsabilidad penal y judicial”. ", "E insiste en que si no se aceptan sus tres propuestas han tomado la decisión de votar que no en todas las rondas.", "\n\n\n\nAfirma Teresa Rodríguez que será el PSOE, que ha sido el partido más votado, al que habrá que pedir responsabilidades al respecto si hay que repetir las elecciones andaluzas por lo que dice que espera que Susana Díaz modifique su postura en pos de la estabilidad institucional y “de un gobierno que tenga el apoya de la pluralidad de la Cámara”. “", "Hay que pedirle que abra que dialogue y que debata”, recalcó la representante de Podemos.", "\n\n\n\nTambién le pidieron en RNE una valoración sobre el regalo que le hizo ayer el secretario general de su partido a Felipe VI y lo calificó de “gesto simpático sin más al jefe del Estado y todo el mundo sabe que a Pablo Iglesias le gusta mucho Juego de Tronos”.", "\n\n\n\nAunque a continuación asegura que considera necesario abrir un debate sobre quién debe ser el jefe del Estado: “Abrir los grilletes de la Transición”.", "\n\n\n\nPreguntada por el de que el presidente venezolano, Nicolás Maduro calificara de racista a Mariano Rajoy por la declaración sobre Venezuela en el Congreso de los DIputados, la dirigente de Podemos cree que el hecho de hablar de Venezuela es una “cortina de humo” para no hablar de los problemas de los españoles y cree que parece que conviene hablar de Venezuela para perjudicar a Podemos y recalcó que condena la represión política en cualquier país." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.014787430683918669, 0.016100178890876567, 0.0044444444444444444, 0, 0.011396011396011397, 0.011235955056179775, 0.030534351145038167, 0.01948051948051948, 0.013215859030837005 ]
0.013466
5
[ { "analysis_explanation": null, "end": 80, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74 }, { "analysis_explanation": null, "end": 118, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99 }, { "analysis_explanation": null, "end": 173, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 157 }, { "analysis_explanation": null, "end": 204, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 194 }, { "analysis_explanation": null, "end": 214, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 205 }, { "analysis_explanation": null, "end": 231, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 215 }, { "analysis_explanation": null, "end": 271, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 257 }, { "analysis_explanation": null, "end": 296, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 272 }, { "analysis_explanation": null, "end": 309, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 297 }, { "analysis_explanation": null, "end": 352, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 336 }, { "analysis_explanation": null, "end": 392, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 378 }, { "analysis_explanation": null, "end": 417, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 393 }, { "analysis_explanation": null, "end": 430, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 418 }, { "analysis_explanation": null, "end": 490, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 480 }, { "analysis_explanation": null, "end": 503, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 494 }, { "analysis_explanation": null, "end": 521, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 505 }, { "analysis_explanation": null, "end": 547, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 541 }, { "analysis_explanation": null, "end": 608, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 552 }, { "analysis_explanation": null, "end": 668, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 640 }, { "analysis_explanation": null, "end": 717, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 669 }, { "analysis_explanation": null, "end": 766, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 755 }, { "analysis_explanation": null, "end": 786, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 773 }, { "analysis_explanation": null, "end": 896, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 883 }, { "analysis_explanation": null, "end": 918, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 899 }, { "analysis_explanation": null, "end": 996, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 979 }, { "analysis_explanation": null, "end": 1042, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1039 }, { "analysis_explanation": null, "end": 1081, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1067 }, { "analysis_explanation": null, "end": 1169, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1154 }, { "analysis_explanation": null, "end": 1364, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1354 }, { "analysis_explanation": null, "end": 1496, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1492 }, { "analysis_explanation": null, "end": 1540, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1525 }, { "analysis_explanation": null, "end": 1568, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1563 }, { "analysis_explanation": null, "end": 1685, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1672 }, { "analysis_explanation": null, "end": 1717, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1688 }, { "analysis_explanation": null, "end": 1756, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1744 }, { "analysis_explanation": null, "end": 1771, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1761 }, { "analysis_explanation": null, "end": 1838, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1826 }, { "analysis_explanation": null, "end": 1851, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1844 }, { "analysis_explanation": null, "end": 1892, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1888 }, { "analysis_explanation": null, "end": 1933, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1911 }, { "analysis_explanation": null, "end": 1944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1938 }, { "analysis_explanation": null, "end": 1978, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1947 }, { "analysis_explanation": null, "end": 2127, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2111 }, { "analysis_explanation": null, "end": 2149, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2139 }, { "analysis_explanation": null, "end": 2274, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2264 }, { "analysis_explanation": null, "end": 2288, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2276 }, { "analysis_explanation": null, "end": 2328, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2317 }, { "analysis_explanation": null, "end": 2347, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2340 }, { "analysis_explanation": null, "end": 2379, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2352 }, { "analysis_explanation": null, "end": 2415, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2404 }, { "analysis_explanation": null, "end": 2529, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2504 }, { "analysis_explanation": null, "end": 2706, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2702 }, { "analysis_explanation": null, "end": 2725, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2712 }, { "analysis_explanation": null, "end": 2759, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2750 }, { "analysis_explanation": null, "end": 2783, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2762 }, { "analysis_explanation": null, "end": 2862, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2848 }, { "analysis_explanation": null, "end": 2902, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2896 }, { "analysis_explanation": null, "end": 2982, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2972 }, { "analysis_explanation": null, "end": 3005, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2987 }, { "analysis_explanation": null, "end": 3013, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3008 }, { "analysis_explanation": null, "end": 3074, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3062 }, { "analysis_explanation": null, "end": 3112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3098 }, { "analysis_explanation": null, "end": 3134, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3113 }, { "analysis_explanation": null, "end": 3150, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3137 }, { "analysis_explanation": null, "end": 3185, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3176 }, { "analysis_explanation": null, "end": 3408, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3380 }, { "analysis_explanation": null, "end": 3496, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3482 } ]
[ "You need to play a total of 50 battles to post in this section.", "\n\nThe dwindling amount of players of WOWS. ", "Time for statistics & graphs!" ]
{ "pile_set_name": "OpenWebText2" }
[ 0, 0.023255813953488372, 0.034482758620689655 ]
0.019246
5
[]
[ "Adriamycin and enhanced radiation reaction in normal esophagus and skin.", "\nClinical evaluation of 10 patients with small cell carcinoma of the lung treated with radiotherapy and periodic cycles of combination chemotherapy with cyclophosphamide, vincristine, and adriamycin showed frequent and occasionally severe esophageal and skin reactions. ", "Eight of the 10 patients had esophagitis, four required supportive intravenous fluids, and two subsequently developed esophageal narrowing and stricture formation. ", "Recurrent esophagitis with augmentation of injury in the recently irradiated esophagus was observed 11 times in eight of the 10 patients after cycles of chemotherapy, and contributed to the sustained toxicity seen in two patients. ", "Dermatitis in the form of moist desquamation was observed in five of the patients at very low doses of supervoltage radiation therapy. ", "Acute pulmonary reactions was notably absent. ", "This combination of chemotherapy, particularly adriamycin, potentiates the effect of radiotherapy on the normal esophagus and skin, and further implicates the radiosensitizing property of adriamycin." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.013888888888888888, 0.003703703703703704, 0, 0, 0, 0, 0 ]
0.002513
5
[]
[ "> I'm not sure exactly :) Django has jython/pypy/ironpython support for\n> example. ", "Twisted, pyglet, pywebsite, cherrypy and others support pypy.", "\n>> Should I make a bigger list?", "\nThat, or propose fewer categories. ", "I don't really want to introduce\ncategories that serve no actual purpose.", "\nThe question then really is: how to get package authors to actually use\nthese categories?", "\nRegards,\nMartin" ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0, 0, 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 32, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26 } ]
[ "// Copyright 2008 Google Inc.\n// All Rights Reserved.", "\n//\n// Redistribution and use in source and binary forms, with or without\n// modification, are permitted provided that the following conditions are\n// met:\n//\n// * Redistributions of source code must retain the above copyright\n// notice, this list of conditions and the following disclaimer.", "\n// * Redistributions in binary form must reproduce the above\n// copyright notice, this list of conditions and the following disclaimer\n// in the documentation and/or other materials provided with the\n// distribution.", "\n// * Neither the name of Google Inc. nor the names of its\n// contributors may be used to endorse or promote products derived from\n// this software without specific prior written permission.", "\n//\n// THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS\n// \"AS IS\" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT\n// LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR\n// A PARTICULAR PURPOSE ARE DISCLAIMED. ", "IN NO EVENT SHALL THE COPYRIGHT\n// OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,\n// SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT\n// LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE,\n// DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY\n// THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT\n// (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE\n// OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.", "\n\n\n// Type and function utilities for implementing parameterized tests.", "\n\n// GOOGLETEST_CM0001 DO NOT DELETE\n\n#ifndef GTEST_INCLUDE_GTEST_INTERNAL_GTEST_PARAM_UTIL_H_\n#define GTEST_INCLUDE_GTEST_INTERNAL_GTEST_PARAM_UTIL_H_\n\n#include <ctype.h>\n\n#include <cassert>\n#include <iterator>\n#include <memory>\n#include <set>\n#include <tuple>\n#include <utility>\n#include <vector>\n\n#include \"gtest/internal/gtest-internal.h\"\n#include \"gtest/internal/gtest-port.h\"\n#include \"gtest/gtest-printers.h\"\n\nnamespace testing {\n// Input to a parameterized test name generator, describing a test parameter.", "\n// Consists of the parameter value and the integer parameter index.", "\ntemplate <class ParamType>\nstruct TestParamInfo {\n TestParamInfo(const ParamType& a_param, size_t an_index) :\n param(a_param),\n index(an_index) {}\n ParamType param;\n size_t index;\n};\n\n// A builtin parameterized test name generator which returns the result of\n// testing::PrintToString.", "\nstruct PrintToStringParamName {\n template <class ParamType>\n std::string operator()(const TestParamInfo<ParamType>& info) const {\n return PrintToString(info.param);\n }\n};\n\nnamespace internal {\n\n// INTERNAL IMPLEMENTATION - DO NOT USE IN USER CODE.", "\n// Utility Functions\n\n// Outputs a message explaining invalid registration of different\n// fixture class for the same test suite. ", "This may happen when\n// TEST_P macro is used to define two tests with the same name\n// but in different namespaces.", "\nGTEST_API_ void ReportInvalidTestSuiteType(const char* test_suite_name,\n CodeLocation code_location);\n\ntemplate <typename> class ParamGeneratorInterface;\ntemplate <typename> class ParamGenerator;\n\n// Interface for iterating over elements provided by an implementation\n// of ParamGeneratorInterface<T>.", "\ntemplate <typename T>\nclass ParamIteratorInterface {\n public:\n virtual ~ParamIteratorInterface() {}\n // A pointer to the base generator instance.", "\n // Used only for the purposes of iterator comparison\n // to make sure that two iterators belong to the same generator.", "\n virtual const ParamGeneratorInterface<T>* BaseGenerator() const = 0;\n // Advances iterator to point to the next element\n // provided by the generator. ", "The caller is responsible\n // for not calling Advance() on an iterator equal to\n // BaseGenerator()->End().", "\n virtual void Advance() = 0;\n // Clones the iterator object. ", "Used for implementing copy semantics\n // of ParamIterator<T>.", "\n virtual ParamIteratorInterface* Clone() const = 0;\n // Dereferences the current iterator and provides (read-only) access\n // to the pointed value. ", "It is the caller's responsibility not to call\n // Current() on an iterator equal to BaseGenerator()->End().", "\n // Used for implementing ParamGenerator<T>::operator*().", "\n virtual const T* Current() const = 0;\n // Determines whether the given iterator and other point to the same\n // element in the sequence generated by the generator.", "\n // Used for implementing ParamGenerator<T>::operator==().", "\n virtual bool Equals(const ParamIteratorInterface& other) const = 0;\n};\n\n// Class iterating over elements provided by an implementation of\n// ParamGeneratorInterface<T>. ", "It wraps ParamIteratorInterface<T>\n// and implements the const forward iterator concept.", "\ntemplate <typename T>\nclass ParamIterator {\n public:\n typedef T value_type;\n typedef const T& reference;\n typedef ptrdiff_t difference_type;\n\n // ParamIterator assumes ownership of the impl_ pointer.", "\n ParamIterator(const ParamIterator& other) : impl_(other.impl_->Clone()) {}\n ParamIterator& operator=(const ParamIterator& other) {\n if (this !", "= &other)\n impl_.reset(other.impl_->Clone());\n return *this;\n }\n\n const T& operator*() const { return *impl_->Current(); }\n const T* operator->() const { return impl_->Current(); }\n // Prefix version of operator++.", "\n ParamIterator& operator++() {\n impl_->Advance();\n return *this;\n }\n // Postfix version of operator++.", "\n ParamIterator operator++(int /*unused*/) {\n ParamIteratorInterface<T>* clone = impl_->Clone();\n impl_->Advance();\n return ParamIterator(clone);\n }\n bool operator==(const ParamIterator& other) const {\n return impl_.get() == other.impl_.get() || impl_->Equals(*other.impl_);\n }\n bool operator!=(const ParamIterator& other) const {\n return !(*", "this == other);\n }\n\n private:\n friend class ParamGenerator<T>;\n explicit ParamIterator(ParamIteratorInterface<T>* impl) : impl_(impl) {}\n std::unique_ptr<ParamIteratorInterface<T> > impl_;\n};\n\n// ParamGeneratorInterface<T> is the binary interface to access generators\n// defined in other translation units.", "\ntemplate <typename T>\nclass ParamGeneratorInterface {\n public:\n typedef T ParamType;\n\n virtual ~ParamGeneratorInterface() {}\n\n // Generator interface definition\n virtual ParamIteratorInterface<T>* Begin() const = 0;\n virtual ParamIteratorInterface<T>* End() const = 0;\n};\n\n// Wraps ParamGeneratorInterface<T> and provides general generator syntax\n// compatible with the STL Container concept.", "\n// This class implements copy initialization semantics and the contained\n// ParamGeneratorInterface<T> instance is shared among all copies\n// of the original object. ", "This is possible because that instance is immutable.", "\ntemplate<typename T>\nclass ParamGenerator {\n public:\n typedef ParamIterator<T> iterator;\n\n explicit ParamGenerator(ParamGeneratorInterface<T>* impl) : impl_(impl) {}\n ParamGenerator(const ParamGenerator& other) : impl_(other.impl_) {}\n\n ParamGenerator& operator=(const ParamGenerator& other) {\n impl_ = other.impl_;\n return *this;\n }\n\n iterator begin() const { return iterator(impl_->Begin()); }\n iterator end() const { return iterator(impl_->End()); }\n\n private:\n std::shared_ptr<const ParamGeneratorInterface<T> > impl_;\n};\n\n// Generates values from a range of two comparable values. ", "Can be used to\n// generate sequences of user-defined types that implement operator+() and\n// operator<().", "\n// This class is used in the Range() function.", "\ntemplate <typename T, typename IncrementT>\nclass RangeGenerator : public ParamGeneratorInterface<T> {\n public:\n RangeGenerator(T begin, T end, IncrementT step)\n : begin_(begin), end_(end),\n step_(step), end_index_(CalculateEndIndex(begin, end, step)) {}\n ~RangeGenerator() override {}\n\n ParamIteratorInterface<T>* Begin() const override {\n return new Iterator(this, begin_, 0, step_);\n }\n ParamIteratorInterface<T>* End() const override {\n return new Iterator(this, end_, end_index_, step_);\n }\n\n private:\n class Iterator : public ParamIteratorInterface<T> {\n public:\n Iterator(const ParamGeneratorInterface<T>* base, T value, int index,\n IncrementT step)\n : base_(base), value_(value), index_(index), step_(step) {}\n ~Iterator() override {}\n\n const ParamGeneratorInterface<T>* BaseGenerator() const override {\n return base_;\n }\n void Advance() override {\n value_ = static_cast<T>(value_ + step_);\n index_++;\n }\n ParamIteratorInterface<T>* Clone() const override {\n return new Iterator(*this);\n }\n const T* Current() const override { return &value_; }\n bool Equals(const ParamIteratorInterface<T>& other) const override {\n // Having the same base generator guarantees that the other\n // iterator is of the same type and we can downcast.", "\n GTEST_CHECK_(BaseGenerator() == other.", "BaseGenerator())\n << \"The program attempted to compare iterators \"\n << \"from different generators.\" ", "<< std::endl;\n const int other_index =\n CheckedDowncastToActualType<const Iterator>(&other)->index_;\n return index_ == other_index;\n }\n\n private:\n Iterator(const Iterator& other)\n : ParamIteratorInterface<T>(),\n base_(other.base_), value_(other.value_), index_(other.index_),\n step_(other.step_) {}\n\n // No implementation - assignment is unsupported.", "\n void operator=(const Iterator& other);\n\n const ParamGeneratorInterface<T>* const base_;\n T value_;\n int index_;\n const IncrementT step_;\n }; // class RangeGenerator::Iterator\n\n static int CalculateEndIndex(const T& begin,\n const T& end,\n const IncrementT& step) {\n int end_index = 0;\n for (T i = begin; i < end; i = static_cast<T>(i + step))\n end_index++;\n return end_index;\n }\n\n // No implementation - assignment is unsupported.", "\n void operator=(const RangeGenerator& other);\n\n const T begin_;\n const T end_;\n const IncrementT step_;\n // The index for the end() iterator. ", "All the elements in the generated\n // sequence are indexed (0-based) to aid iterator comparison.", "\n const int end_index_;\n}; // class RangeGenerator\n\n\n// Generates values from a pair of STL-style iterators. ", "Used in the\n// ValuesIn() function. ", "The elements are copied from the source range\n// since the source can be located on the stack, and the generator\n// is likely to persist beyond that stack frame.", "\ntemplate <typename T>\nclass ValuesInIteratorRangeGenerator : public ParamGeneratorInterface<T> {\n public:\n template <typename ForwardIterator>\n ValuesInIteratorRangeGenerator(ForwardIterator begin, ForwardIterator end)\n : container_(begin, end) {}\n ~ValuesInIteratorRangeGenerator() override {}\n\n ParamIteratorInterface<T>* Begin() const override {\n return new Iterator(this, container_.begin());\n }\n ParamIteratorInterface<T>* End() const override {\n return new Iterator(this, container_.end());\n }\n\n private:\n typedef typename ::std::vector<T> ContainerType;\n\n class Iterator : public ParamIteratorInterface<T> {\n public:\n Iterator(const ParamGeneratorInterface<T>* base,\n typename ContainerType::const_iterator iterator)\n : base_(base), iterator_(iterator) {}\n ~Iterator() override {}\n\n const ParamGeneratorInterface<T>* BaseGenerator() const override {\n return base_;\n }\n void Advance() override {\n ++iterator_;\n value_.reset();\n }\n ParamIteratorInterface<T>* Clone() const override {\n return new Iterator(*this);\n }\n // We need to use cached value referenced by iterator_ because *iterator_\n // can return a temporary object (and of type other then T), so just\n // having \"return &*iterator_;\" doesn't work.", "\n // value_ is updated here and not in Advance() because Advance()\n // can advance iterator_ beyond the end of the range, and we cannot\n // detect that fact. ", "The client code, on the other hand, is\n // responsible for not calling Current() on an out-of-range iterator.", "\n const T* Current() const override {\n if (value_.get() == nullptr) value_.reset(new T(*iterator_));\n return value_.get();\n }\n bool Equals(const ParamIteratorInterface<T>& other) const override {\n // Having the same base generator guarantees that the other\n // iterator is of the same type and we can downcast.", "\n GTEST_CHECK_(BaseGenerator() == other.", "BaseGenerator())\n << \"The program attempted to compare iterators \"\n << \"from different generators.\" ", "<< std::endl;\n return iterator_ ==\n CheckedDowncastToActualType<const Iterator>(&other)->iterator_;\n }\n\n private:\n Iterator(const Iterator& other)\n // The explicit constructor call suppresses a false warning\n // emitted by gcc when supplied with the -Wextra option.", "\n : ParamIteratorInterface<T>(),\n base_(other.base_),\n iterator_(other.iterator_) {}\n\n const ParamGeneratorInterface<T>* const base_;\n typename ContainerType::const_iterator iterator_;\n // A cached value of *iterator_. ", "We keep it here to allow access by\n // pointer in the wrapping iterator's operator->().", "\n // value_ needs to be mutable to be accessed in Current().", "\n // Use of std::unique_ptr helps manage cached value's lifetime,\n // which is bound by the lifespan of the iterator itself.", "\n mutable std::unique_ptr<const T> value_;\n }; // class ValuesInIteratorRangeGenerator::Iterator\n\n // No implementation - assignment is unsupported.", "\n void operator=(const ValuesInIteratorRangeGenerator& other);\n\n const ContainerType container_;\n}; // class ValuesInIteratorRangeGenerator\n\n// INTERNAL IMPLEMENTATION - DO NOT USE IN USER CODE.", "\n//\n// Default parameterized test name generator, returns a string containing the\n// integer test parameter index.", "\ntemplate <class ParamType>\nstd::string DefaultParamName(const TestParamInfo<ParamType>& info) {\n Message name_stream;\n name_stream << info.index;\n return name_stream.", "GetString();\n}\n\ntemplate <typename T = int>\nvoid TestNotEmpty() {\n static_assert(sizeof(T) == 0, \"Empty arguments are not allowed.\");", "\n}\ntemplate <typename T = int>\nvoid TestNotEmpty(const T&) {}\n\n// INTERNAL IMPLEMENTATION - DO NOT USE IN USER CODE.", "\n//\n// Stores a parameter value and later creates tests parameterized with that\n// value.", "\ntemplate <class TestClass>\nclass ParameterizedTestFactory : public TestFactoryBase {\n public:\n typedef typename TestClass::ParamType ParamType;\n explicit ParameterizedTestFactory(ParamType parameter) :\n parameter_(parameter) {}\n Test* CreateTest() override {\n TestClass::SetParam(&parameter_);\n return new TestClass();\n }\n\n private:\n const ParamType parameter_;\n\n GTEST_DISALLOW_COPY_AND_ASSIGN_(ParameterizedTestFactory);\n};\n\n// INTERNAL IMPLEMENTATION - DO NOT USE IN USER CODE.", "\n//\n// TestMetaFactoryBase is a base class for meta-factories that create\n// test factories for passing into MakeAndRegisterTestInfo function.", "\ntemplate <class ParamType>\nclass TestMetaFactoryBase {\n public:\n virtual ~TestMetaFactoryBase() {}\n\n virtual TestFactoryBase* CreateTestFactory(ParamType parameter) = 0;\n};\n\n// INTERNAL IMPLEMENTATION - DO NOT USE IN USER CODE.", "\n//\n// TestMetaFactory creates test factories for passing into\n// MakeAndRegisterTestInfo function. ", "Since MakeAndRegisterTestInfo receives\n// ownership of test factory pointer, same factory object cannot be passed\n// into that method twice. ", "But ParameterizedTestSuiteInfo is going to call\n// it for each Test/Parameter value combination. ", "Thus it needs meta factory\n// creator class.", "\ntemplate <class TestSuite>\nclass TestMetaFactory\n : public TestMetaFactoryBase<typename TestSuite::ParamType> {\n public:\n using ParamType = typename TestSuite::ParamType;\n\n TestMetaFactory() {}\n\n TestFactoryBase* CreateTestFactory(ParamType parameter) override {\n return new ParameterizedTestFactory<TestSuite>(parameter);\n }\n\n private:\n GTEST_DISALLOW_COPY_AND_ASSIGN_(TestMetaFactory);\n};\n\n// INTERNAL IMPLEMENTATION - DO NOT USE IN USER CODE.", "\n//\n// ParameterizedTestSuiteInfoBase is a generic interface\n// to ParameterizedTestSuiteInfo classes. ", "ParameterizedTestSuiteInfoBase\n// accumulates test information provided by TEST_P macro invocations\n// and generators provided by INSTANTIATE_TEST_SUITE_P macro invocations\n// and uses that information to register all resulting test instances\n// in RegisterTests method. ", "The ParameterizeTestSuiteRegistry class holds\n// a collection of pointers to the ParameterizedTestSuiteInfo objects\n// and calls RegisterTests() on each of them when asked.", "\nclass ParameterizedTestSuiteInfoBase {\n public:\n virtual ~ParameterizedTestSuiteInfoBase() {}\n\n // Base part of test suite name for display purposes.", "\n virtual const std::string& GetTestSuiteName() const = 0;\n // Test case id to verify identity.", "\n virtual TypeId GetTestSuiteTypeId() const = 0;\n // UnitTest class invokes this method to register tests in this\n // test suite right before running them in RUN_ALL_TESTS macro.", "\n // This method should not be called more than once on any single\n // instance of a ParameterizedTestSuiteInfoBase derived class.", "\n virtual void RegisterTests() = 0;\n\n protected:\n ParameterizedTestSuiteInfoBase() {}\n\n private:\n GTEST_DISALLOW_COPY_AND_ASSIGN_(ParameterizedTestSuiteInfoBase);\n};\n\n// INTERNAL IMPLEMENTATION - DO NOT USE IN USER CODE.", "\n//\n// ParameterizedTestSuiteInfo accumulates tests obtained from TEST_P\n// macro invocations for a particular test suite and generators\n// obtained from INSTANTIATE_TEST_SUITE_P macro invocations for that\n// test suite. ", "It registers tests with all values generated by all\n// generators when asked.", "\ntemplate <class TestSuite>\nclass ParameterizedTestSuiteInfo : public ParameterizedTestSuiteInfoBase {\n public:\n // ParamType and GeneratorCreationFunc are private types but are required\n // for declarations of public methods AddTestPattern() and\n // AddTestSuiteInstantiation().", "\n using ParamType = typename TestSuite::ParamType;\n // A function that returns an instance of appropriate generator type.", "\n typedef ParamGenerator<ParamType>(GeneratorCreationFunc)();\n using ParamNameGeneratorFunc = std::string(const TestParamInfo<ParamType>&);\n\n explicit ParameterizedTestSuiteInfo(const char* name,\n CodeLocation code_location)\n : test_suite_name_(name), code_location_(code_location) {}\n\n // Test case base name for display purposes.", "\n const std::string& GetTestSuiteName() const override {\n return test_suite_name_;\n }\n // Test case id to verify identity.", "\n TypeId GetTestSuiteTypeId() const override { return GetTypeId<TestSuite>(); }\n // TEST_P macro uses AddTestPattern() to record information\n // about a single test in a LocalTestInfo structure.", "\n // test_suite_name is the base name of the test suite (without invocation\n // prefix). ", "test_base_name is the name of an individual test without\n // parameter index. ", "For the test SequenceA/FooTest.", "DoBar/1 FooTest is\n // test suite base name and DoBar is test base name.", "\n void AddTestPattern(const char* test_suite_name, const char* test_base_name,\n TestMetaFactoryBase<ParamType>* meta_factory) {\n tests_.push_back(std::shared_ptr<TestInfo>(\n new TestInfo(test_suite_name, test_base_name, meta_factory)));\n }\n // INSTANTIATE_TEST_SUITE_P macro uses AddGenerator() to record information\n // about a generator.", "\n int AddTestSuiteInstantiation(const std::string& instantiation_name,\n GeneratorCreationFunc* func,\n ParamNameGeneratorFunc* name_func,\n const char* file, int line) {\n instantiations_.push_back(\n InstantiationInfo(instantiation_name, func, name_func, file, line));\n return 0; // Return value used only to run this method in namespace scope.", "\n }\n // UnitTest class invokes this method to register tests in this test suite\n // test suites right before running tests in RUN_ALL_TESTS macro.", "\n // This method should not be called more than once on any single\n // instance of a ParameterizedTestSuiteInfoBase derived class.", "\n // UnitTest has a guard to prevent from calling this method more than once.", "\n void RegisterTests() override {\n for (typename TestInfoContainer::iterator test_it = tests_.begin();\n test_it !", "= tests_.end(); ++test_it) {\n std::shared_ptr<TestInfo> test_info = *test_it;\n for (typename InstantiationContainer::iterator gen_it =\n instantiations_.begin(); gen_it !", "= instantiations_.end();\n ++gen_it) {\n const std::string& instantiation_name = gen_it->name;\n ParamGenerator<ParamType> generator((*gen_it->generator)());\n ParamNameGeneratorFunc* name_func = gen_it->name_func;\n const char* file = gen_it->file;\n int line = gen_it->line;\n\n std::string test_suite_name;\n if ( !", "instantiation_name.empty() )\n test_suite_name = instantiation_name + \"/\";\n test_suite_name += test_info->test_suite_base_name;\n\n size_t i = 0;\n std::set<std::string> test_param_names;\n for (typename ParamGenerator<ParamType>::iterator param_it =\n generator.begin();\n param_it !", "= generator.end(); ++param_it, ++i) {\n Message test_name_stream;\n\n std::string param_name = name_func(\n TestParamInfo<ParamType>(*param_it, i));\n\n GTEST_CHECK_(IsValidParamName(param_name))\n << \"Parameterized test name '\" << param_name\n << \"' is invalid, in \" << file\n << \" line \" << line << std::endl;\n\n GTEST_CHECK_(test_param_names.count(param_name) == 0)\n << \"Duplicate parameterized test name '\" << param_name\n << \"', in \" << file << \" line \" << line << std::endl;\n\n test_param_names.insert(param_name);\n\n if (!", "test_info->test_base_name.empty()) {\n test_name_stream << test_info->test_base_name << \"/\";\n }\n test_name_stream << param_name;\n MakeAndRegisterTestInfo(\n test_suite_name.c_str(), test_name_stream.", "GetString().c_str(),\n nullptr, // No type parameter.", "\n PrintToString(*param_it).c_str(), code_location_,\n GetTestSuiteTypeId(),\n SuiteApiResolver<TestSuite>::GetSetUpCaseOrSuite(file, line),\n SuiteApiResolver<TestSuite>::GetTearDownCaseOrSuite(file, line),\n test_info->test_meta_factory->CreateTestFactory(*param_it));\n } // for param_it\n } // for gen_it\n } // for test_it\n } // RegisterTests\n\n private:\n // LocalTestInfo structure keeps information about a single test registered\n // with TEST_P macro.", "\n struct TestInfo {\n TestInfo(const char* a_test_suite_base_name, const char* a_test_base_name,\n TestMetaFactoryBase<ParamType>* a_test_meta_factory)\n : test_suite_base_name(a_test_suite_base_name),\n test_base_name(a_test_base_name),\n test_meta_factory(a_test_meta_factory) {}\n\n const std::string test_suite_base_name;\n const std::string test_base_name;\n const std::unique_ptr<TestMetaFactoryBase<ParamType> > test_meta_factory;\n };\n using TestInfoContainer = ::std::vector<std::shared_ptr<TestInfo> >;\n // Records data received from INSTANTIATE_TEST_SUITE_P macros:\n // <Instantiation name, Sequence generator creation function,\n // Name generator function, Source file, Source line>\n struct InstantiationInfo {\n InstantiationInfo(const std::string &name_in,\n GeneratorCreationFunc* generator_in,\n ParamNameGeneratorFunc* name_func_in,\n const char* file_in,\n int line_in)\n : name(name_in),\n generator(generator_in),\n name_func(name_func_in),\n file(file_in),\n line(line_in) {}\n\n std::string name;\n GeneratorCreationFunc* generator;\n ParamNameGeneratorFunc* name_func;\n const char* file;\n int line;\n };\n typedef ::std::vector<InstantiationInfo> InstantiationContainer;\n\n static bool IsValidParamName(const std::string& name) {\n // Check for empty string\n if (name.empty())\n return false;\n\n // Check for invalid characters\n for (std::string::size_type index = 0; index < name.size(); ++index) {\n if (!", "isalnum(name[index]) && name[index] !", "= '_')\n return false;\n }\n\n return true;\n }\n\n const std::string test_suite_name_;\n CodeLocation code_location_;\n TestInfoContainer tests_;\n InstantiationContainer instantiations_;\n\n GTEST_DISALLOW_COPY_AND_ASSIGN_(ParameterizedTestSuiteInfo);\n}; // class ParameterizedTestSuiteInfo\n\n// Legacy API is deprecated but still available\n#ifndef GTEST_REMOVE_LEGACY_TEST_CASEAPI_\ntemplate <class TestCase>\nusing ParameterizedTestCaseInfo = ParameterizedTestSuiteInfo<TestCase>;\n#endif // GTEST_REMOVE_LEGACY_TEST_CASEAPI_\n\n// INTERNAL IMPLEMENTATION - DO NOT USE IN USER CODE.", "\n//\n// ParameterizedTestSuiteRegistry contains a map of\n// ParameterizedTestSuiteInfoBase classes accessed by test suite names. ", "TEST_P\n// and INSTANTIATE_TEST_SUITE_P macros use it to locate their corresponding\n// ParameterizedTestSuiteInfo descriptors.", "\nclass ParameterizedTestSuiteRegistry {\n public:\n ParameterizedTestSuiteRegistry() {}\n ~ParameterizedTestSuiteRegistry() {\n for (auto& test_suite_info : test_suite_infos_) {\n delete test_suite_info;\n }\n }\n\n // Looks up or creates and returns a structure containing information about\n // tests and instantiations of a particular test suite.", "\n template <class TestSuite>\n ParameterizedTestSuiteInfo<TestSuite>* GetTestSuitePatternHolder(\n const char* test_suite_name, CodeLocation code_location) {\n ParameterizedTestSuiteInfo<TestSuite>* typed_test_info = nullptr;\n for (auto& test_suite_info : test_suite_infos_) {\n if (test_suite_info->GetTestSuiteName() == test_suite_name) {\n if (test_suite_info->GetTestSuiteTypeId() !", "= GetTypeId<TestSuite>()) {\n // Complain about incorrect usage of Google Test facilities\n // and terminate the program since we cannot guaranty correct\n // test suite setup and tear-down in this case.", "\n ReportInvalidTestSuiteType(test_suite_name, code_location);\n posix::Abort();\n } else {\n // At this point we are sure that the object we found is of the same\n // type we are looking for, so we downcast it to that type\n // without further checks.", "\n typed_test_info = CheckedDowncastToActualType<\n ParameterizedTestSuiteInfo<TestSuite> >(test_suite_info);\n }\n break;\n }\n }\n if (typed_test_info == nullptr) {\n typed_test_info = new ParameterizedTestSuiteInfo<TestSuite>(\n test_suite_name, code_location);\n test_suite_infos_.push_back(typed_test_info);\n }\n return typed_test_info;\n }\n void RegisterTests() {\n for (auto& test_suite_info : test_suite_infos_) {\n test_suite_info->RegisterTests();\n }\n }\n// Legacy API is deprecated but still available\n#ifndef GTEST_REMOVE_LEGACY_TEST_CASEAPI_\n template <class TestCase>\n ParameterizedTestCaseInfo<TestCase>* GetTestCasePatternHolder(\n const char* test_case_name, CodeLocation code_location) {\n return GetTestSuitePatternHolder<TestCase>(test_case_name, code_location);\n }\n\n#endif // GTEST_REMOVE_LEGACY_TEST_CASEAPI_\n\n private:\n using TestSuiteInfoContainer = ::std::vector<ParameterizedTestSuiteInfoBase*>;\n\n TestSuiteInfoContainer test_suite_infos_;\n\n GTEST_DISALLOW_COPY_AND_ASSIGN_(ParameterizedTestSuiteRegistry);\n};\n\n} // namespace internal\n\n// Forward declarations of ValuesIn(), which is implemented in\n// include/gtest/gtest-param-test.h.", "\ntemplate <class Container>\ninternal::ParamGenerator<typename Container::value_type> ValuesIn(\n const Container& container);\n\nnamespace internal {\n// Used in the Values() function to provide polymorphic capabilities.", "\n\ntemplate <typename... Ts>\nclass ValueArray {\n public:\n ValueArray(Ts... v) : v_{std::move(v)...} {}\n\n template <typename T>\n operator ParamGenerator<T>() const { // NOLINT\n return ValuesIn(MakeVector<T>(MakeIndexSequence<sizeof...(Ts)>()));\n }\n\n private:\n template <typename T, size_t... I>\n std::vector<T> MakeVector(IndexSequence<I...>) const {\n return std::vector<T>{static_cast<T>(v_.template Get<I>())...};\n }\n\n FlatTuple<Ts...> v_;\n};\n\ntemplate <typename... T>\nclass CartesianProductGenerator\n : public ParamGeneratorInterface<::std::tuple<T...>> {\n public:\n typedef ::std::tuple<T...> ParamType;\n\n CartesianProductGenerator(const std::tuple<ParamGenerator<T>...>& g)\n : generators_(g) {}\n ~CartesianProductGenerator() override {}\n\n ParamIteratorInterface<ParamType>* Begin() const override {\n return new Iterator(this, generators_, false);\n }\n ParamIteratorInterface<ParamType>* End() const override {\n return new Iterator(this, generators_, true);\n }\n\n private:\n template <class I>\n class IteratorImpl;\n template <size_t... I>\n class IteratorImpl<IndexSequence<I...>>\n : public ParamIteratorInterface<ParamType> {\n public:\n IteratorImpl(const ParamGeneratorInterface<ParamType>* base,\n const std::tuple<ParamGenerator<T>...>& generators, bool is_end)\n : base_(base),\n begin_(std::get<I>(generators).begin()...),\n end_(std::get<I>(generators).end()...),\n current_(is_end ? ", "end_ : begin_) {\n ComputeCurrentValue();\n }\n ~IteratorImpl() override {}\n\n const ParamGeneratorInterface<ParamType>* BaseGenerator() const override {\n return base_;\n }\n // Advance should not be called on beyond-of-range iterators\n // so no component iterators must be beyond end of range, either.", "\n void Advance() override {\n assert(!AtEnd());\n // Advance the last iterator.", "\n ++std::get<sizeof...(T) - 1>(current_);\n // if that reaches end, propagate that up.", "\n AdvanceIfEnd<sizeof...(T) - 1>();\n ComputeCurrentValue();\n }\n ParamIteratorInterface<ParamType>* Clone() const override {\n return new IteratorImpl(*this);\n }\n\n const ParamType* Current() const override { return current_value_.get(); }\n\n bool Equals(const ParamIteratorInterface<ParamType>& other) const override {\n // Having the same base generator guarantees that the other\n // iterator is of the same type and we can downcast.", "\n GTEST_CHECK_(BaseGenerator() == other.", "BaseGenerator())\n << \"The program attempted to compare iterators \"\n << \"from different generators.\" ", "<< std::endl;\n const IteratorImpl* typed_other =\n CheckedDowncastToActualType<const IteratorImpl>(&other);\n\n // We must report iterators equal if they both point beyond their\n // respective ranges. ", "That can happen in a variety of fashions,\n // so we have to consult AtEnd().", "\n if (AtEnd() && typed_other->AtEnd()) return true;\n\n bool same = true;\n bool dummy[] = {\n (same = same && std::get<I>(current_) ==\n std::get<I>(typed_other->current_))...};\n (void)dummy;\n return same;\n }\n\n private:\n template <size_t ThisI>\n void AdvanceIfEnd() {\n if (std::get<ThisI>(current_) !", "= std::get<ThisI>(end_)) return;\n\n bool last = ThisI == 0;\n if (last) {\n // We are done. ", "Nothing else to propagate.", "\n return;\n }\n\n constexpr size_t NextI = ThisI - (ThisI !", "= 0);\n std::get<ThisI>(current_) = std::get<ThisI>(begin_);\n ++std::get<NextI>(current_);\n AdvanceIfEnd<NextI>();\n }\n\n void ComputeCurrentValue() {\n if (!", "AtEnd())\n current_value_ = std::make_shared<ParamType>(*std::get<I>(current_)...);\n }\n bool AtEnd() const {\n bool at_end = false;\n bool dummy[] = {\n (at_end = at_end || std::get<I>(current_) == std::get<I>(end_))...};\n (void)dummy;\n return at_end;\n }\n\n const ParamGeneratorInterface<ParamType>* const base_;\n std::tuple<typename ParamGenerator<T>::iterator...> begin_;\n std::tuple<typename ParamGenerator<T>::iterator...> end_;\n std::tuple<typename ParamGenerator<T>::iterator...> current_;\n std::shared_ptr<ParamType> current_value_;\n };\n\n using Iterator = IteratorImpl<typename MakeIndexSequence<sizeof...(T)>::type>;\n\n std::tuple<ParamGenerator<T>...> generators_;\n};\n\ntemplate <class... Gen>\nclass CartesianProductHolder {\n public:\n CartesianProductHolder(const Gen&... g) : generators_(g...) {}\n template <typename... T>\n operator ParamGenerator<::std::tuple<T...>>() const {\n return ParamGenerator<::std::tuple<T...>>(\n new CartesianProductGenerator<T...>(generators_));\n }\n\n private:\n std::tuple<Gen...> generators_;\n};\n\n} // namespace internal\n} // namespace testing\n\n#endif // GTEST_INCLUDE_GTEST_INTERNAL_GTEST_PARAM_UTIL_H_\n" ]
{ "pile_set_name": "Github" }
[ 0, 0, 0, 0.005154639175257732, 0, 0.0056179775280898875, 0, 0.0019455252918287938, 0, 0.003389830508474576, 0.007874015748031496, 0, 0, 0.00872093023255814, 0, 0, 0, 0.009174311926605505, 0.015625, 0, 0.006578947368421052, 0, 0.01694915254237288, 0, 0.016666666666666666, 0.005813953488372093, 0, 0, 0.013422818791946308, 0, 0, 0.0055248618784530384, 0.0032258064516129032, 0.010050251256281407, 0, 0, 0.0066555740432612314, 0, 0, 0.0007446016381236039, 0, 0.00847457627118644, 0.0024691358024691358, 0.0019047619047619048, 0.006756756756756757, 0, 0.009009009009009009, 0.027777777777777776, 0, 0, 0.011976047904191617, 0, 0, 0, 0.00847457627118644, 0.006557377049180328, 0.003952569169960474, 0, 0, 0, 0, 0.01015228426395939, 0, 0.0058823529411764705, 0.007462686567164179, 0, 0, 0.008032128514056224, 0, 0.004347826086956522, 0, 0, 0, 0.022727272727272728, 0.00437636761487965, 0, 0, 0.005813953488372093, 0, 0, 0, 0, 0, 0, 0, 0.0035460992907801418, 0.008130081300813009, 0.005305039787798408, 0, 0, 0, 0, 0, 0.0273972602739726, 0.00267379679144385, 0, 0, 0, 0.01282051282051282, 0.008, 0, 0, 0.0029239766081871343, 0, 0, 0, 0, 0.006024096385542169, 0.02702702702702703, 0.005076142131979695, 0, 0, 0.0028169014084507044, 0.0049261083743842365, 0.004405286343612335, 0.003355704697986577, 0.004807692307692308, 0.0091324200913242, 0.0033829499323410014, 0.0030864197530864196, 0, 0, 0.002127659574468085, 0, 0.00847457627118644, 0, 0.012345679012345678, 0.0026666666666666666, 0, 0, 0, 0, 0.004111842105263158 ]
0.003563
5
[ { "analysis_explanation": null, "end": 17, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13 }, { "analysis_explanation": null, "end": 1146, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1137 }, { "analysis_explanation": null, "end": 1373, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1363 }, { "analysis_explanation": null, "end": 1400, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1384 }, { "analysis_explanation": null, "end": 2370, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2361 }, { "analysis_explanation": null, "end": 4587, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4538 }, { "analysis_explanation": null, "end": 6001, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5986 }, { "analysis_explanation": null, "end": 6912, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6874 }, { "analysis_explanation": null, "end": 7173, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7152 }, { "analysis_explanation": null, "end": 8714, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8674 }, { "analysis_explanation": null, "end": 12264, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12224 }, { "analysis_explanation": null, "end": 12841, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12838 }, { "analysis_explanation": null, "end": 13300, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13285 }, { "analysis_explanation": null, "end": 14807, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14751 }, { "analysis_explanation": null, "end": 14999, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14976 }, { "analysis_explanation": null, "end": 15328, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15305 }, { "analysis_explanation": null, "end": 15368, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15345 }, { "analysis_explanation": null, "end": 15510, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15484 }, { "analysis_explanation": null, "end": 16115, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16085 }, { "analysis_explanation": null, "end": 16559, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16533 }, { "analysis_explanation": null, "end": 16661, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16631 }, { "analysis_explanation": null, "end": 17165, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17135 }, { "analysis_explanation": null, "end": 17799, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17769 }, { "analysis_explanation": null, "end": 18629, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18604 }, { "analysis_explanation": null, "end": 18787, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18774 }, { "analysis_explanation": null, "end": 20152, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20122 }, { "analysis_explanation": null, "end": 20502, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20470 }, { "analysis_explanation": null, "end": 21249, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21234 }, { "analysis_explanation": null, "end": 21446, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21426 }, { "analysis_explanation": null, "end": 22272, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22242 }, { "analysis_explanation": null, "end": 24220, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24180 }, { "analysis_explanation": null, "end": 24913, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24888 }, { "analysis_explanation": null, "end": 25756, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25731 }, { "analysis_explanation": null, "end": 25891, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25884 }, { "analysis_explanation": null, "end": 26377, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26365 }, { "analysis_explanation": null, "end": 26764, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26749 }, { "analysis_explanation": null, "end": 26800, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26785 }, { "analysis_explanation": null, "end": 27392, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27367 }, { "analysis_explanation": null, "end": 30213, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30204 }, { "analysis_explanation": null, "end": 30318, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30278 }, { "analysis_explanation": null, "end": 31898, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31887 }, { "analysis_explanation": null, "end": 2485, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 2483 }, { "analysis_explanation": null, "end": 2568, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 2566 }, { "analysis_explanation": null, "end": 5991, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 5989 }, { "analysis_explanation": null, "end": 7256, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 7254 }, { "analysis_explanation": null, "end": 9033, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 9031 }, { "analysis_explanation": null, "end": 9611, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 9609 }, { "analysis_explanation": null, "end": 11056, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 11054 }, { "analysis_explanation": null, "end": 11237, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 11235 }, { "analysis_explanation": null, "end": 12583, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 12581 }, { "analysis_explanation": null, "end": 13062, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 13060 }, { "analysis_explanation": null, "end": 13290, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 13288 }, { "analysis_explanation": null, "end": 13414, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 13412 }, { "analysis_explanation": null, "end": 13489, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 13487 }, { "analysis_explanation": null, "end": 13892, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 13890 }, { "analysis_explanation": null, "end": 14494, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 14492 }, { "analysis_explanation": null, "end": 14652, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 14650 }, { "analysis_explanation": null, "end": 15724, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 15722 }, { "analysis_explanation": null, "end": 15786, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 15784 }, { "analysis_explanation": null, "end": 16796, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 16794 }, { "analysis_explanation": null, "end": 18020, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 18018 }, { "analysis_explanation": null, "end": 18201, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 18199 }, { "analysis_explanation": null, "end": 18489, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 18487 }, { "analysis_explanation": null, "end": 19245, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 19243 }, { "analysis_explanation": null, "end": 19485, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 19483 }, { "analysis_explanation": null, "end": 20313, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 20311 }, { "analysis_explanation": null, "end": 20407, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 20405 }, { "analysis_explanation": null, "end": 20494, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 20492 }, { "analysis_explanation": null, "end": 20632, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 20630 }, { "analysis_explanation": null, "end": 20895, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 20893 }, { "analysis_explanation": null, "end": 21113, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 21111 }, { "analysis_explanation": null, "end": 21122, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 21120 }, { "analysis_explanation": null, "end": 21367, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 21365 }, { "analysis_explanation": null, "end": 21653, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 21651 }, { "analysis_explanation": null, "end": 21855, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 21853 }, { "analysis_explanation": null, "end": 23098, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 23096 }, { "analysis_explanation": null, "end": 23142, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 23140 }, { "analysis_explanation": null, "end": 23180, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 23178 }, { "analysis_explanation": null, "end": 23283, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 23281 }, { "analysis_explanation": null, "end": 23295, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 23293 }, { "analysis_explanation": null, "end": 23573, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 23571 }, { "analysis_explanation": null, "end": 23964, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 23962 }, { "analysis_explanation": null, "end": 24120, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 24118 }, { "analysis_explanation": null, "end": 24213, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 24211 }, { "analysis_explanation": null, "end": 24352, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 24350 }, { "analysis_explanation": null, "end": 24360, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 24358 }, { "analysis_explanation": null, "end": 24534, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 24532 }, { "analysis_explanation": null, "end": 26372, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 26370 }, { "analysis_explanation": null, "end": 27537, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 27535 }, { "analysis_explanation": null, "end": 27858, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 27856 }, { "analysis_explanation": null, "end": 27893, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 27891 }, { "analysis_explanation": null, "end": 28126, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 28124 }, { "analysis_explanation": null, "end": 28347, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 28345 }, { "analysis_explanation": null, "end": 28413, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 28411 }, { "analysis_explanation": null, "end": 28598, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 28596 }, { "analysis_explanation": null, "end": 28639, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 28637 }, { "analysis_explanation": null, "end": 28702, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 28700 }, { "analysis_explanation": null, "end": 29307, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 29305 }, { "analysis_explanation": null, "end": 29406, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 29404 }, { "analysis_explanation": null, "end": 29458, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 29456 }, { "analysis_explanation": null, "end": 29934, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 29932 }, { "analysis_explanation": null, "end": 30645, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 30643 }, { "analysis_explanation": null, "end": 31070, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 31068 }, { "analysis_explanation": null, "end": 31125, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 31123 }, { "analysis_explanation": null, "end": 31287, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 31285 }, { "analysis_explanation": null, "end": 31317, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 31315 }, { "analysis_explanation": null, "end": 31525, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 31523 }, { "analysis_explanation": null, "end": 31553, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 31551 }, { "analysis_explanation": null, "end": 31586, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 31584 }, { "analysis_explanation": null, "end": 31728, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 31726 }, { "analysis_explanation": null, "end": 31757, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 31755 }, { "analysis_explanation": null, "end": 31895, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 31893 }, { "analysis_explanation": null, "end": 31920, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 31918 }, { "analysis_explanation": null, "end": 32054, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 32052 }, { "analysis_explanation": null, "end": 32118, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 32116 }, { "analysis_explanation": null, "end": 32180, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 32178 }, { "analysis_explanation": null, "end": 32246, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 32244 }, { "analysis_explanation": null, "end": 32379, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 32377 }, { "analysis_explanation": null, "end": 32613, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 32611 }, { "analysis_explanation": null, "end": 32669, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 32667 }, { "analysis_explanation": null, "end": 32764, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 32762 }, { "analysis_explanation": null, "end": 2664, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2657 }, { "analysis_explanation": null, "end": 5058, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5050 }, { "analysis_explanation": null, "end": 5183, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5175 }, { "analysis_explanation": null, "end": 5729, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5721 }, { "analysis_explanation": null, "end": 5765, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5757 }, { "analysis_explanation": null, "end": 7002, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6994 }, { "analysis_explanation": null, "end": 7090, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 7082 }, { "analysis_explanation": null, "end": 9294, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 9286 }, { "analysis_explanation": null, "end": 9315, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 9307 }, { "analysis_explanation": null, "end": 9337, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 9329 }, { "analysis_explanation": null, "end": 9368, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 9360 }, { "analysis_explanation": null, "end": 12936, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 12928 }, { "analysis_explanation": null, "end": 12970, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 12962 }, { "analysis_explanation": null, "end": 14003, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 13996 }, { "analysis_explanation": null, "end": 21246, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 21234 }, { "analysis_explanation": null, "end": 21702, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 21694 }, { "analysis_explanation": null, "end": 21891, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 21883 }, { "analysis_explanation": null, "end": 24396, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 24389 }, { "analysis_explanation": null, "end": 837, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 825 }, { "analysis_explanation": null, "end": 1076, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1064 }, { "analysis_explanation": null, "end": 1311, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1299 }, { "analysis_explanation": null, "end": 4301, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 4299 }, { "analysis_explanation": null, "end": 4524, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 4522 }, { "analysis_explanation": null, "end": 11051, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 11049 }, { "analysis_explanation": null, "end": 21197, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 21195 }, { "analysis_explanation": null, "end": 22371, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 22369 }, { "analysis_explanation": null, "end": 22447, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 22445 }, { "analysis_explanation": null, "end": 23278, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 23276 }, { "analysis_explanation": null, "end": 24115, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 24113 }, { "analysis_explanation": null, "end": 27532, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 27530 }, { "analysis_explanation": null, "end": 28593, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 28591 }, { "analysis_explanation": null, "end": 28634, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 28632 }, { "analysis_explanation": null, "end": 32088, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 32086 }, { "analysis_explanation": null, "end": 32152, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 32150 }, { "analysis_explanation": null, "end": 32214, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 32212 }, { "analysis_explanation": null, "end": 32364, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 32362 }, { "analysis_explanation": null, "end": 32608, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 32606 }, { "analysis_explanation": null, "end": 32664, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_140094861343856", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 32662 } ]
[ "Introduction {#s1}\n============\n\n*Campylobacter* is one of the major causative agents of foodborne gastrointestinal bacterial infections worldwide. ", "The human disease caused by *Campylobacter*, namely campylobacteriosis, is mostly due to the Gram-negative spiral-shaped *C. jejuni* [@pone.0046402-Moore1]. ", "This foodborne disease is characterized by reported symptoms including fever, abdominal cramps, bloody diarrhea, dizziness and myalgia [@pone.0046402-Acheson1]. ", "Although such infections tend to be self-limiting, syndromes such as Guillain-Barré and Miller Fisher can be late-onset complications [@pone.0046402-Nachamkin1]. ", "This enteric pathogen is also a suspected etiological factor in Crohn\\'s disease and ulcerative colitis [@pone.0046402-Moore1], [@pone.0046402-Boyanova1]. *", "C. jejuni* is one of the principal causes of hospitalization for foodborne illness in the USA [@pone.0046402-Scallan1]. ", "In a comparison of 168 pathogen-food combinations for 14 leading pathogens across 12 food categories representing over 95% of the annual illnesses and hospitalizations in the USA, the combination *Campylobacter*-poultry reached the first rank in terms of annual disease burden including illness, hospitalizations, deaths and costs [@pone.0046402-Batz1]. ", "A baseline survey conducted in 28 European countries also indicated that the prevalence of *Campylobacter*-colonized broiler batches and *Campylobacter*-contaminated broiler carcasses was 71.2% and 75.8%, respectively [@pone.0046402-Anon1] which constitutes the main reservoir for human campylobacteriosis. ", "Although this obligate microaerobic pathogen has fastidious growth requirements [@pone.0046402-Liu1], *C. jejuni* can survive, paradoxically, in food products challenging food processing, conservation and preparation conditions [@pone.0046402-Chan1]. ", "During these processes, *C. jejuni* is exposed to highly variable oxygen concentrations suggesting that it must develop protective mechanisms to resist oxidative stress [@pone.0046402-Skirrow1]. ", "Oxidative stress leads to the degradation and modulation of protein functions and results in lipid and DNA damage [@pone.0046402-Fisher1]--[@pone.0046402-Broman1]. ", "Kaakoush *et al.* (", "2007) [@pone.0046402-Kaakoush1] have shown that *C. jejuni* strains have different oxygen tolerances. ", "A cross-protection between low temperature and oxidative stress in *C. jejuni* strains from various origins has been reported by Garénaux *et al.* (", "2008) [@pone.0046402-Garnaux1]. *", "Campylobacter* is probably also inactivated by an oxidative burst when high pressure treatment is applied [@pone.0046402-Bieche1]. ", "Moreover, oxidative stress and redox-related proteins were found to be over-expressed in *C. jejuni* stressed with paraquat, a strong oxidizing agent [@pone.0046402-Garenaux1].", "\n\nIn *Campylobacter spp.*, ", "oxygen is required as a terminal electron acceptor for respiration [@pone.0046402-Sellars1] and the genes described in other Gram-negative bacteria for oxidative stress and general stress responses are lacking [@pone.0046402-Parkhill1], [@pone.0046402-Fouts1]. *", "C. jejuni* encodes only a few enzymes in oxidative defense, including a superoxide dismutase (SodB), an alkyl hydroperoxide reductase (AhpC) and a catalase (KatA) [@pone.0046402-Elvers1]--[@pone.0046402-Grant1] for which the molecular and gene regulation mechanisms are still poorly understood [@pone.0046402-Atack1]. *", "C. jejuni*, unlike other foodborne pathogens, lacks the key regulators of oxidative stress defense enzymes known in *E. coli* and *S. typhimurium* as SoxRS and OxyR regulons [@pone.0046402-Corcionivoschi1]. ", "However, it has been shown that alternative regulators, termed Fur and PerR, mediate at least part of the response to oxidative stress in *Campylobacter* by repressing both AhpC and KatA expression [@pone.0046402-Baillon1], [@pone.0046402-vanVliet1]. ", "More recently, two other regulators have been found to be involved in the oxidative stress response [@pone.0046402-Garnaux1], [@pone.0046402-Gundogdu1], [@pone.0046402-Hwang1]. *", "C. jejuni* also encodes other antioxidant enzymes, such as the thiolperoxidases (Tpx) and the bacterioferritin co-migratory protein (Bcp), which together play a role in the protection of *C. jejuni* against oxidative stress [@pone.0046402-vanVliet2], [@pone.0046402-Atack2]. ", "Hofreuter *et al.* [", "@pone.0046402-Hofreuter1] have also indicated that the strain *C. jejuni* 81--176 has an additional DMSO reductase system which may be important for respiration in oxygen-restricted conditions. ", "Respiration is a reactive oxygen species (ROS)-generating process initiated in the microbial membrane. ", "However, no overall approach has yet been used to identify *C. jejuni* membrane proteins involved in the response to oxidative conditions.", "\n\nAs the membrane is the first bacterial line of defense against environmental stresses, proteomic analyses at the membrane level of *C. jejuni* in oxygen-enriched conditions were explored. ", "In the present study, *C. jejuni* inner and outer membrane subproteomes were characterized using two-dimensional protein electrophoresis (2-DE) on oxygen-acclimated cells and oxygen non-acclimated cells and were related to the capability of *C. jejuni* to adhere to abiotic surfaces.", "\n\nResults {#s2}\n=======\n\n*C. jejuni* 81--176 and NCTC 11168 under oxygen acclimation conditions {#s2a}\n----------------------------------------------------------------------\n\nAs *C. jejuni* 81--176 and NCTC 11168 could not survive in atmospheric air, a specific gas mixture was used to explore its oxygen acclimation response. ", "Oxygen acclimation was performed using the same gas mixture for optimal growth (5% O~2~, 10% CO~2~ and 85% N~2~) but with a higher oxygen concentration (19% O~2~, 10% CO~2~ and 71% N~2~) on growing cells. ", "The presence of blood did not change the colony-forming capability of for both strains. ", "This is not surprising as red blood corpuscles contained in blood are able to capture dioxygen. ", "On blood-free plates, almost twice as much time was necessary for the development of *C. jejuni 81--176* colonies under oxygen-acclimation conditions compared to microaerobic conditions while the same number of colonies could not be reached by NCTC11168 in these conditions ([Table 1](#pone-0046402-t001){ref-type=\"table\"}). ", "Consequently, *C. jejuni* 81--176 strain was used for further experiments. ", "An identical number of colonies in both conditions was retrieved for subsequent proteomic analyses of each of the membranes of *C. jejuni*.", "\n\n10.1371/journal.pone.0046402.t001\n\n###### Time required to reach at least 250 colonies in microaerobic and oxygen enriched conditions for three strains of *C. jejuni* grown on Columbia blood agar plates (CBA) and Columbia blood-free agar (CA) plates from a 100 µL spread inoculum of a 10^5^ diluted culture.", "\n\n![](", "pone.0046402.t001){#pone-0046402-t001-1}\n\n *C. jejuni* NCTC 11168 *C. jejuni* 81--176\n --------- ------------------------------- ------------------------ ---------------------\n **CBA** 5% O~2~, 10% CO~2~, 85% N~2~ 15 h 15 h\n 19% O~2~, 10% CO~2~, 71% N~2~ 15 h 15 h\n **CA** 5% O~2~, 10% CO~2~, 85% N~2~ 24 h 24 h\n 19% O~2~, 10% CO~2~, 71% N~2~ \\>63 h 42 h\n\nSeparation of membrane proteins of *C. jejuni* 81--176 {#s2b}\n------------------------------------------------------\n\nAnalyzing membrane proteins using 2-DE is complex due to the difficulty in extracting and solubilizing the inherently hydrophobic proteins [@pone.0046402-Santoni1]. ", "The most efficient and reproducible membrane separation for *Campylobacter* was obtained using the method based on lauryl-sarcosinate detergent rather than sucrose density gradient ultracentrifugation or spheroplasting by lysozyme (data not shown) as already observed previously [@pone.0046402-Asakura1]--[@pone.0046402-Hobb1]. ", "The lauryl-sarcosinate activity enables two fractions to be obtained, a lauryl-sarcosinate-insoluble fraction enriched in outer membrane proteins (OMPs) and a lauryl-sarcosinate-soluble fraction enriched in inner membrane proteins (IMPs). ", "As different concentrations of lauryl sarcosinate were previously used on *C. jejuni* (0.2% in Asakura *et al.* [", "@pone.0046402-Asakura1], 1% in Hobb *et al.* [", "@pone.0046402-Hobb1] and 2% in Leon-Kempis *et al.* [", "@pone.0046402-LeonKempisMdel1]), the lowest efficient concentration was determined to prevent any interference during protein electrofocalization ([Fig. ", "1](#pone-0046402-g001){ref-type=\"fig\"}). ", "From a 0.5% detergent concentration, outer and inner membrane profiles were clearly distinguished and the identification of the main OMPs of *C. jejuni* in the lauryl-sarcosinate-insoluble fraction (FlaA, PorA-MOMP and CadF) confirmed the expected IMP-OMP separation. ", "The lowest concentration of lauryl sarcosinate required to obtain the optimal separation of IMPs and OMPs was thus selected for subsequent 2D-electrophoresis experiments to prevent interference during protein electrofocalisation.", "\n\n![", "Membrane protein fractions of *C. jejuni* 81--176 extracted with lauryl sarcosinate at 0.1, 0.5, 1 and 2% concentrations and separated using SDS-PAGE.\\\nInner membrane protein-enriched fraction (lauryl-sarcosinate-soluble fraction), outer membrane protein-enriched fraction (lauryl-sarcosinate-insoluble fraction) and cytosolic protein (cytosoluble) profiles are presented. ", "Molecular masses (MM) are indicated on the left (kDa). ", "Identified proteins in the sarcosinate-insoluble fraction are indicated on the right.](pone.0046402.g001){#pone-0046402-g001}\n\nMembrane subproteome variations in oxygen acclimation conditions {#s2c}\n----------------------------------------------------------------\n\nThe differences between the 2D-electrophoretic profiles obtained from oxygen-acclimated cells and microaerobically grown cells were validated by PCA (*cf.* [", "Fig. ", "S1](#pone.0046402.s001){ref-type=\"supplementary-material\"}). ", "Then, LC-MS/MS analyses successfully identified 42 and 25 spots which exhibited a significantly altered abundance in the IMP-enriched fraction and in the OMP-enriched fraction, respectively ([Fig. ", "2](#pone-0046402-g002){ref-type=\"fig\"}, [Table 2](#pone-0046402-t002){ref-type=\"table\"}). ", "Several of these spots contained the same protein (*e.g.* the FlaA protein with 12 p*I* variants or CadF with 3 p*I* variants). ", "The same observation was made previously on the whole envelope of *C. jejuni* JHH1 studied by Cordwell *et al.* [", "@pone.0046402-Cordwell1]. ", "Finally, a total of 23 higher-abundance proteins and 15 lower-abundance proteins in oxygen-acclimated cells as compared to the control were identified. ", "The localization of these proteins in their cellular compartment was predicted using the algorithm PSORTb v.3.0.2 ([Table 2](#pone-0046402-t002){ref-type=\"table\"}). ", "PSORTb returns a list of the five localization sites for Gram-negative bacteria (cytoplasm, inner membrane, periplasm, outer membrane and extracellular space) and the associated probability value for each. ", "Several proteins were predicted in the cytoplasmic compartment and could thus be regarded as contaminant proteins. ", "This was expected as methods used for membrane fractionation do not separate exclusively membrane proteins [@pone.0046402-Brown1], [@pone.0046402-Solis1]. ", "In fact, some of the predicted cytoplasmic proteins have already been described in membrane analysis such as the chaperone proteins GroEL, DnaJ, DnaK, [@pone.0046402-Siroy1] or the elongation factor EF-Tu [@pone.0046402-Siroy1]--[@pone.0046402-Kolberg1]. ", "Apart from the localization of intrinsic or secreted proteins being well predicted by the PSORTb algorithm due to their specific structure (signal peptide, transmembrane alpha helices, beta-barrel proteins, hydrophobicity, motif), the extrinsic proteins associated with the surface of the membranes could not be so easily predicted. ", "This could also explain why some of the proteins predicted in the cytoplasm were found in the enriched membrane protein fractions. ", "To avoid any experimental or prediction biases, only proteins isolated from membrane enriched fractions predicted as membrane, periplasmic or secreted proteins were discussed further. ", "The MOMP represents the major part of proteins in the OMP-enriched fraction, as already reported in previous studies [@pone.0046402-Cordwell1]. ", "The over-abundance of one protein could prevent the detection of less abundant proteins. ", "Analyzing the two membranes of *C. jejuni* separately reduced this bias in the IMP-enriched fraction while emphasizing it in the OMP-enriched fraction.", "\n\n![", "Two-dimensional electrophoresis (2-DE) profiles of the inner (A, B) and outer membrane proteins (C, D) of oxygen-acclimated cells (B, D) compared to non-acclimated cells (A, C) of *C. jejuni* 81--176.\\\nOn profiles A and C, arrows indicate the significant lower-abundance proteins (or protein forms) in oxygen-acclimated cells while on profiles B and D, arrows indicate the significant higher-abundance proteins (or protein forms) in oxygen-acclimated cells. ", "PorA was identified as the major protein on OMP profiles.](pone.0046402.g002){#pone-0046402-g002}\n\n10.1371/journal.pone.0046402.t002\n\n###### Identification and localization prediction (PSORTb v3.0.2) of proteins predominantly modulated by oxygen-acclimated conditions in the IMP and OMP enriched fractions of *C. jejuni*.", "\n\n![](", "pone.0046402.t002){#pone-0046402-t002-2}\n\n Accession number Protein ID Prot/Spot *P*-value[\\*](#nt101){ref-type=\"table-fn\"} n-Fold p*I/*MW Mascot score NMP/Pc Fraction localization Cell localization prediction\n ------------------ ------------------------------------------------------------------------------ ------------- -------------------------------------------- -------- ------------ -------------- -------- ----------------------- ------------------------------\n ***Transporters*** \n gi\\|121612178 CjaA protein CjaA-1 0.003 up2.0 5.69/30949 799 29/66% IM PP/IM\n putative amino acid CjaA-2 0.009 up2.2 5.69/30949 699 22/65% IM PP/IM\n transporter CjaA-3 0.002 up1.9 5.69/30949 339 14/55% OM PP/IM\n \\[surface antigen CjaA\\] CjaA-4 0.008 up2.4 5.69/30949 358 13/54% OM PP/IM\n CjaA-5 0.006 up1.6 5.69/30949 865 32/75% OM PP/IM\n CjaA-6 0.005 up2.0 5.69/30949 485 18/55% OM PPIM\n gi\\|121612379 histidine-binding protein HisJ (surface antigen CjaC) CjaC protein CjaC do2.4 6.48/27781 376 10/34% OM PP\n gi\\|121613528 high affinity branched-chain amino acid ABC transporter, ATP-binding protein LivF 0.002 do2.3 7.03/25739 510 16/58% IM CytP\n gi\\|121612467 outer membrane lipoprotein CmeC RND efflux system, CmeC-1 0.01 do1.7 5.14/55385 598 13/29% OM OM\n CmeC-2 0.003 do1.9 5.14/55385 526 12/27% OM OM\n ***Chaperones*** \n gi\\|121612249 chaperonin GroEL GroEL-1 0.0001 up3.3 5.02/57934 945 27/47% IM CytP\n GroEL-2 0.007 up1.6 5.02/57934 2350 68/44% IM CytP\n GroEL-3 0.005 up1.8 5.02/57934 1724 45/55% IM CytP\n gi\\|121612930 co-chaperonin GroES GroES 0.004 do2.2 5.38/9452 348 12/87% IM CytP\n gi\\|121613084 molecular chaperone DnaK DnaK 0.005 do2.5 4.98/67403 206 6/12% OM CytP\n gi\\|121612573 co-chaperone protein DnaJ DnaJ1 0.003 up9.0 8.86/33320 79 3/10% IM CytP\n gi\\|121613623 ATP-dependent chaperone protein ClpB ClpB-1 0.004 do3.5 5.47/95489 1802 56/56% IM CytP\n ClpB-2 0.003 do2.4 5.47/95489 1742 56/52% IM CytP\n ClpB-3 0.002 do2.0 5.47/95489 607 19/22% IM CytP\n ClpB-4 0.006 do2.4 5.47/95489 2692 88/68% IM CytP\n ***Fatty acid biosynthesis*** \n gi\\|121612451 biotin carboxylase AccC_2-1 0.00001 do1.8 6.01/49116 191 7/19% IM CytP\n AccC_2-2 0.001 do2.8 6.01/49116 165 5/17% IM CytP\n gi\\|121613559 putative lipoprotein CJJ_0430 0.01 up3.3 5.29/33188 254 9/29% OM unknown\n ***Adhesion/virulence*** \n gi\\|121612545 flagellin FlaA-1 0.00003 up2.1 5.61/59507 1518 41/43% IM EC\n FlaA-2 0.00006 up2.0 5.61/59507 1180 29/43% IM EC\n FlaA-3 0.0003 up2.0 5.61/59507 1694 45/48% IM EC\n FlaA-4 0.0007 up1.8 5.61/59507 1131 31/45% IM EC\n FlaA-5 0.00001 up2.1 5.61/59507 1426 34/40% IM EC\n FlaA-6 0.00013 up1.8 5.61/59507 1383 33/46% OM EC\n FlaA-7 0.0004 up2.7 5.61/59507 601 15/36% OM EC\n FlaA-8 0.0007 up1.9 5.61/59507 1884 53/57% OM EC\n FlaA-9 0.002 up2.3 5.61/59507 253 10/24% OM EC\n FlaA-10 0.003 up2.0 5.61/59507 402 19/33% OM EC\n FlaA-11 0.001 up2.4 5.61/59507 2379 67/60% OM EC\n FlaA-12 0.0003 up3.3 5.61/59507 1999 46/53% OM EC\n gi\\|121613214 flagellar hook protein FlgE FlgE-1 0.005 up1.7 5.14/89392 915 30/39% OM EC\n FlgE-2 0.0006 up1.6 5.14/89392 1320 36/37% OM EC\n gi\\|121613274 chemotaxis histidine kinase CheA CheA-1 0.005 up2.4 4.88/85168 889 20/28% IM CytP\n CheA-2 0.006 up2.2 4.88/85168 370 11/15% IM CytP\n CheA-3 0.0006 up2.7 4.88/85168 451 13/19% IM CytP\n gi\\|121612668 major outer membrane protein (MOMP) PorA-1 0.002 up2.9 4.72/45681 281 8/20% IM OM\n PorA-2 0.002 up1.7 4.72/45681 616 14/38% IM OM\n gi\\|121612905 cell-binding factor 2 major antigenic peptide Peb4 CBF2 Cbf2 (Peb4) 0.00003 up5.1 9.23/30411 479 19/51% IM PP\n gi\\|121612147 fibronectin-binding protein CadF-1 0.004 up1.7 5.89/35967 202 6/12% OM OM\n CadF-2 0.005 up1.6 5.89/35967 540 13/34% OM OM\n CadF-3 0.006 do1.8 5.89/35967 235 6/16% OM OM\n gi\\|121613534 fibronectin type III domain-containing protein CJJ_1295 0.0007 up1.6 5.91/46079 511 19/42% OM unknown\n ***Other*** \n gi\\|121612430 elongation factor Tu Tuf-1 0.005 up1.7 5.11/43566 918 28/48% IM CytP\n Tuf-2 0.009 up1.6 5.11/43566 2361 65/75% IM CytP\n Tuf-3 0.004 do2.2 5.11/43566 570 15/36% IM CytP\n Tuf-4 0.001 up1.7 5.11/43566 992 31/68% OM CytP\n gi\\|121613042 serine protease DO HtrA-1 0.006 up1.6 8.97/50985 1515 44/61% IM PP\n HtrA-2 0.009 up1.7 8.97/50985 1626 50/62% IM PP\n HtrA-3 0.00007 up4.3 8.97/50985 475 15/31% IM PP\n gi\\|121613659 malate dehydrogenase Mdh 0.002 up2.0 5.46/33379 212 5/19% IM CytP\n gi\\|121612371 succinyl-CoA synthase, beta subunit SucC 0.006 do1.7 5.61/41716 164 6/16% IM CytP\n gi\\|121612541 isocitrate dehydrogenase, NADP-dependent Icd-1 0.004 do2.9 6.85/86316 156 5/9% IM CytP\n Icd-2 0.007 do2.1 6.85/86316 954 27/36% IM CytP\n gi\\|121612912 pyruvate kinase Pyk 0.005 do1.8 5.89/53751 485 16/31% IM CytP\n gi\\|121612884 arylsulfate sulfotransferase, degenerate CJJ_0882 0.005 do1.8 7.57/69255 411 15/27% IM unknown\n gi\\|121613032 mur ligase family protein CJJ_0816 0.01 do2.3 9.22/55168 34 2/4% OM unknown\n gi\\|121613329 tyrosyl-tRNA synthetase TyrS 0.0005 do3.4 6.31/45347 31 5/16% OM CytP\n gi\\|121613150 hypothetical protein CJJ81176_1382 CJJ_1382 0.00005 up3.5 8.84/26552 143 4/23% IM OM/PP/EC\n gi\\|121613455 hypothetical protein CJJ81176_0729 CJJ_0729 0.006 up1.6 5.60/27722 795 23/67% IM CytP\n gi\\|121613526 7-alpha-hydroxysteroid dehydrogenase CJJ_0828 0.001 up1.8 6.77/28119 1025 35/88% IM CytP\n *gi\\|121612484* *hypothetical protein CJJ81176_0854* *CJJ_0854* 0.007 up7.3 5.70/36925 16 3/11% IM CytP\n *gi\\|121612647* *hypothetical protein CJJ81176_0275* *CJJ_0275* 0.002 up7.8 5.32/31916 16 3/13% IM unknown\n\nOnly spots with a *q*-value (False Discovery Rate) \\<0.05 and a P (Power)\\>0.8 were conserved.", "\n\nSpot refers to spots detected from 2-DE gel analysis ([Fig. ", "2A and B](#pone-0046402-g002){ref-type=\"fig\"}), N-fold: protein abundance difference between 5% O~2~ and 19% O~2~, up: higher abundance protein, do: lower abundance protein, p*I*: protein isoelectric point; MW: protein molecular weight (Da); NMP: number of matching peptides, Pc: % of protein coverage, OM: outer membrane, IM: inner membrane; PP: periplasm, EC: extracellular, CytP: cytosol. ", "The identification of the proteins indicated in italic was not statistically validated.", "\n\nAmong the 38 identified proteins whose abundance was modulated by oxidative conditions, four main functional classes were described : (i) transporters that could be involved in the setting up of new catabolic pathways (CjaA/CjaC, LivF, CmeC), (ii) chaperones in response to the oxidative stress (DnaK, GroEL/S, DnaJ1, ClpB), (iii) proteins involved in fatty acid biosynthesis (AccC) and (iv) proteins involved in the adhesion/virulence of *C. jejuni* 81--176 (FlaA, FlgE, CadF, Cjj_1295, Peb4, CheA, MOMP).", "\n\nqRT-PCR analysis of proteins identified in 2-DE {#s2d}\n-----------------------------------------------\n\nDifferently expressed proteins of interest in oxygen-acclimated cells were selected to further investigate their expression patterns at the transcription level ([Fig. ", "3](#pone-0046402-g003){ref-type=\"fig\"}). ", "The selection was based on the most over-expressed proteins *i.e.* above 5.0-fold: the major antigenic peptide Peb4 (5.1-fold), the co-chaperone DnaJ1 (9-fold), Cjj_0854 (7.3-fold) and Cjj_0275 (7.8-fold). ", "Although the identification of two hypothetical proteins could not be statistically validated, they were also selected to assess their expression profile in oxygen-acclimated cells. ", "The protein CadF was selected too as its abundance among cytosoluble proteins has previously been reported as being modulated under paraquat-mediated oxidative stress [@pone.0046402-Garnaux1]. ", "The qRT-PCR results indicated that gene expression patterns of the proteins were in accordance with the proteomic-level changes for all proteins. ", "All the genes tested were significantly more transcribed in oxygen-acclimated cells (*P*\\<0.05). ", "However, the relative mRNA expression level was not proportional to the level of protein abundance for all the genes. ", "For instance, Cjj_0854 displayed the lowest mRNA expression while the fold was one of the highest recorded (7.3-fold). ", "This may be attributed to the relative stability of the mRNA and proteins or to the differences in regulation mechanisms (such as degradation rates and protein synthesis) that act on both mRNA synthesis and protein synthesis, and ultimately affect the combined molecular amounts [@pone.0046402-Jianke1].", "\n\n![", "Relative mRNA levels of *peb4*, *cadF*, *dnaJ*, *cjj0275* and *cjj0854* as revealed by qRT-PCR in oxygen-acclimated *C. jejuni* 81--176 normalized to relative mRNA levels observed in non-acclimated cells (equivalent to 1).\\\nThe *rpo*A gene was used as the endogenous control. ", "Error bars represent the standard deviation of the mean of three independent RNA extractions. ", "Significant differences between oxygen-acclimated and non-acclimated cells were validated statistically (0.002\\<*P*\\<0.035).](pone.0046402.g003){#pone-0046402-g003}\n\nSwarming capability of oxygen-acclimated cells {#s2e}\n----------------------------------------------\n\nAs flagellum components (FlaA and FlgE) were over-expressed in oxygen-acclimated conditions, the swarming capability of *C. jejuni* 81--176 was assessed in optimal growth conditions and in oxygen-acclimated conditions ([Fig. ", "4](#pone-0046402-g004){ref-type=\"fig\"}). ", "After 48 h incubation on soft agar, the results revealed that swarming capability was significantly enhanced in oxygen-acclimated conditions as compared to microaerobic conditions.", "\n\n![", "Motility of *C. jejuni* 81--176 on BHI+0.6% agar in microaerobic (5% O~2~) and oxygen-enriched conditions (19% O~2~) after 48 h at 42°C.\\\nAssays were performed with 2 µL of pure culture or 10 times diluted culture. (", "A) Mean diameters of three independent experiments. (", "B) Example of motility plates obtained after 48 h at 42°C with a diluted culture.](pone.0046402.g004){#pone-0046402-g004}\n\nAdhesion of oxidative-stressed cells and oxygen-acclimated cells to abiotic surfaces {#s2f}\n------------------------------------------------------------------------------------\n\nThe capability of oxygen-acclimated cells as well as paraquat-stressed cells to adhere to an inert surface was estimated using the Biofilm Ring Test® ([Fig. ", "5](#pone-0046402-g005){ref-type=\"fig\"}). ", "This test was designed to assess both bacterial adhesion and biofilm formation in 96-well microtiter plates. ", "The test is based on the reduced detection of magnetic beads entrapped by the adherent bacterial cells. ", "It has been applied to various bacteria able to adhere to inert surfaces (e.g. [@pone.0046402-Chavant1]--[@pone.0046402-Cremet1]) and found especially appropriate for assessing *Campylobacter* adhesion [@pone.0046402-Sulaeman1]. ", "As *C. jejuni* 81--176 adhesion is close to the detection limit using the Biofilm Ring Test® after 2 h, any effect that would increase the number of adherent cells could not be correctly assessed. ", "For this reason, the adhesion experiments were performed after 0.5 h when fewer adherent cells in the control under microaerobic conditions were detected [@pone.0046402-Sulaeman1]. ", "Paraquat, a superoxide anion generator, was used to induce an oxidative stress as previously described [@pone.0046402-Garnaux1] on broth cultivated cells. ", "Cells stimulated by paraquat or acclimated to enriched oxygen conditions displayed a greater adhesion capability than those cultivated in microaerobic conditions, indicating that oxidizing agents have an impact on the very first step of biofilm development. ", "No significant difference was observed between oxygen-acclimated cells and paraquat-stressed cells.", "\n\n![", "Adhesion capability after 0.5 h to an inert surface of oxygen-acclimated cells and oxidative-stressed cells of *C. jejuni* 81--176.\\\n19% O~2~: oxygen-acclimated cells, (PQ) oxidative- stressed cells mediated by paraquat, (T) control without oxidizing agents (microaerobic conditions). ", "Bacterial initial concentration was 8.81±0.05 Log(CFU/mL) for oxygen-acclimated cells, 8.20±0.11 Log(CFU/mL) for PQ-stressed cells and 8.85±0.05 Log(CFU/mL) for the control. ", "Error bars represent the standard deviation of three independent assays. ", "Asterisks indicate significant differences (*P*\\<0.05) in comparison with the control.](pone.0046402.g005){#pone-0046402-g005}\n\nIdentification of CadF protein forms using immunoblotting {#s2g}\n---------------------------------------------------------\n\nThe absence of CadF protein in the OMP enriched fraction of the derivative 81--176 Δ*cadF* mutant as compared to the isogenic strain was verified using dotblotting ([Fig. ", "6A](#pone-0046402-g006){ref-type=\"fig\"}). ", "The immunoblot using anti-CadF antibodies performed from the 2-DE gel of the sarcosyl-insoluble fraction of oxygen-acclimated cells confirmed the identification of different forms of CadF. These included the two higher-abundance forms (CadF-1 and CadF-2) and the lower-abundance form (CadF-3) in oxygen-acclimated conditions ([Fig. ", "6B](#pone-0046402-g006){ref-type=\"fig\"}).", "\n\n![", "Influence of CadF on *C. jejuni* adhesion to inert surfaces.\\\n(A) Dot blotting using anti-CadF antibodies of 0.5, 1, 5 and 10 µg of OMP-enriched fraction of *C. jejuni* 81--176 (WT) and the derivative mutant *C. jejuni* 81--176 Δ*cadF*. ", "Ctl is the control without protein. (", "B) Silver-stain two-dimensional electrophoretic gel of the OMP-enriched fraction of oxygen-acclimated cells and the corresponding immunoblot using anti-CadF antibodies. (", "C) Adhesion capability after 2 h of oxygen-acclimated cells and paraquat-stressed cells of *C. jejuni* 81--176 mutant Δ*CadF* (CadF^−^) and its isogenic strain. ", "Initial bacterial concentration anged from 8.72 to 8.85 Log(CFU/mL). ", "Error bars represent the standard deviation of three independent assays. ", "Asterisks indicate significant differences in comparison with the isogenic strain (*P*\\<0.05).](pone.0046402.g006){#pone-0046402-g006}\n\nEffect of cadF mutation on adhesion to an inert surface of paraquat-stressed cells and oxygen-acclimated cells {#s2h}\n--------------------------------------------------------------------------------------------------------------\n\nThe *C. jejuni* 81--176 mutant Δ*cadF* was significantly less adherent than its isogenic strain ([Fig. ", "6C](#pone-0046402-g006){ref-type=\"fig\"}). ", "In addition, neither oxygen-acclimated cells nor paraquat-stressed cells from the mutant recovered their initial adhesion level, confirming that CadF is involved in the adhesion process of *C. jejuni* to inert surfaces.", "\n\nDiscussion {#s3}\n==========\n\nThe purpose of this study was to examine the response of microaerophilic *C. jejuni* 81--176 to oxygen-enriched conditions at the membrane protein level. ", "Oxygen was selected instead of using chemicals generating ROS molecules, such as hydrogen peroxide and paraquat, which are frequently applied to induce oxidative stress in *C. jejuni*. ", "This enabled efflux pump activation to be encompassed such as that reported in *Salmonella enterica* for paraquat efflux [@pone.0046402-Gil1], [@pone.0046402-Nikaido1] and, more recently, in *C. jejuni* with CmeG [@pone.0046402-Jeon1] for oxygen peroxide (H~2~O~2~) efflux. ", "In addition, a single method of growth was chosen to avoid any cellular changes due to the method [@pone.0046402-John1]. ", "To segregate the influence of oxygen from that of any other gas, controlled mixtures of gas essential for *C. jejuni* growth (O~2~, CO~2~) were used. ", "As a capnophilic bacterial species, *C. jejuni* is able to assimilate CO~2~, which could be explained by a reverse reaction producing pyruvate by a *f*lavodoxin *q*uinone *r*eductase FqrB (Cjj_0584) as demonstrated in the closely related species *Helicobacter pylori* [@pone.0046402-StMaurice1]. ", "Thus, O~2~ concentration could be varied while the CO~2~ concentration was maintained at a constant level. ", "However, oxygen is a less powerful oxidizing molecule and its solubility is very low in liquid at 42°C (Henry\\'s constant = 9.28×10^−4^ mol L^−1^ atm^−1^ in water at 42°C). ", "In our study, oxygen transfer was reduced by applying controlled gas mixtures to cells forming colonies. ", "The mixture of 19% O~2~, 10% CO~2~ and 71% N~2~ was used to obtain oxygen-acclimated cells while 5% O~2~, 10% CO~2~ and 85% N~2~, which is the modified atmosphere usually applied for optimal growth conditions, was used as a control.", "\n\nDifferential protein expression between these two conditions was analyzed on the IMP-enriched and the OMP-enriched fractions separated using lauryl-sarcosinate as previously applied to *C. jejuni* membrane fractionation [@pone.0046402-Asakura1], [@pone.0046402-LeonKempisMdel1]. ", "This is the first time that such 2-DE subproteomic analysis has been reported on separate membrane fractions of *Campylobacter*. ", "Our data demonstrated that the adaptation of *C. jejuni* 81--176 to oxygen-enriched growth conditions resulted in the differential abundance of some proteins in both membranes. ", "These could be grouped into four identified functional classes representing transporters, chaperones, adhesion/virulence and fatty acid synthesis. ", "As all the identified membrane-associated proteins related to adhesion/virulence were more abundant in oxygen-acclimated cells, downstream analyses were focused on this functional class.", "\n\nThe higher-abundance membrane proteins FlaA and FlgE in oxygen-acclimated cells are involved in cell motility and subsequently in the virulence of *C. jejuni* as non-motile or motile-restricted cells have been shown to be less virulent [@pone.0046402-Yao1], [@pone.0046402-Yao2]. ", "FlaA was found in both membranes and FlgE in the outer membrane and they are both predicted to be secreted. ", "The flagellum comprises a basal body (a conduit spanning the inner and outer membranes of the cell), a hook section of the flagellum composed primarily of the protein FlgE, and the flagellar filament, which consists of thousands of copies of the flagellin proteins FlaA and FlaB, with FlaA being the major component. ", "It was not surprising to detect FlaA in both membranes and for it to be predicted to be secreted as it is exported through the two membranes for filament elongation. *", "C. jejuni* possesses a flagellum that functions in both motility and protein secretion [@pone.0046402-Wassenaar1]--[@pone.0046402-Grant2]. ", "The higher expression of flagellum components is consistent with the increased swarming ability in oxygen enriched conditions. ", "Differences in the swarming motility of *C. jejuni* were also observed using various methods to obtain a microaerobic atmosphere with a concomitant enhanced swarming and a higher transcript level of *flaA* [@pone.0046402-John1]. ", "Over-expression of FlaA has previously been reported in *C. jejuni* NCTC 11168 stressed with paraquat [@pone.0046402-Garnaux1] and in a robust colonizer of the chicken gastrointestinal system [@pone.0046402-Seal1]. ", "Using aflagellate and non-motile mutants inactivated on *maf5* or *fliS* genes [@pone.0046402-Joshua1] or deleted on the *flaAB* gene [@pone.0046402-Reuter1], a severely reduced aggregate biofilm was observed. ", "As in many flagellated bacteria, flagella are involved in *C. jejuni* biofilm formation [@pone.0046402-Barken1]--[@pone.0046402-Watnick1].", "\n\nPeb4 was predicted in the periplasm and found in the inner membrane, which is in accordance with the localization previously described [@pone.0046402-Cordwell1]. ", "In our study, this protein was induced in oxygen-enriched conditions as revealed by its higher abundance and concomitant increase gene expression. ", "The highly conserved periplasmic Peb4 of *C. jejuni* 81--176 is similar to the peptidyl prolyl cis-trans isomerase (SurA) in *E. coli* and other orthologs in numerous bacteria. ", "It constitutes a major antigen of *C. jejuni* and may be involved in the energy-generation-free transformation of carbohydrates, as well as in the folding of outer membrane proteins [@pone.0046402-Asakura1], [@pone.0046402-Burucoa1]. ", "A *peb4* mutant of *C. jejuni* NCTC 11168 [@pone.0046402-Asakura1] and *C. jejuni* 81--176 [@pone.0046402-Rathbun1] was reported to impact biofilm formation. ", "In addition, the *peb4* mutant cells of NCTC 11168 impaired the increase in biofilm formation in an ambient air environment suggesting that Peb4 is involved in biofilm formation [@pone.0046402-Asakura1].", "\n\nNo biological function has yet been attributed to Cjj_1295; however, its DNA sequence possesses a fibronectin-type III domain which suggests a possible role in fibronectin recognition. ", "The OMP CadF (*C*ampylobacter *a*dhesin to *F*ibronectin) promotes the binding of *C. jejuni* to fibronectin (*F*n) on host cells [@pone.0046402-Konkel2] and is required for maximal adherence and invasion of INT407 cells and colonization of the chicken cecum [@pone.0046402-Monteville1], [@pone.0046402-Larson1]. ", "Furthermore, CadF was also found to be more abundant after a paraquat-mediated oxidative stress in the soluble protein fraction of *C. jejuni* NCTC 11168 [@pone.0046402-Garnaux1]. ", "The relatively higher gene transcription of *CadF* in oxidative conditions compared to microaerobic conditions indicates that this gene is induced in conditions favoring a net accumulation of ROS.", "\n\nAs some over-expressed proteins have previously been identified as signatures of biofilm formation in *C. jejuni*, adhesion to inert surfaces was compared for oxygen-acclimated cells and microaerobically grown cells. ", "Interestingly, cells acclimated to oxygen-enriched conditions enhanced *C. jejuni* adhesion to inert surfaces. ", "In addition, the comparable adhesion obtained with cells stressed with paraquat confirmed that ROS-generating conditions enhanced adhesion of *C. jejuni* to inert surfaces. ", "Furthermore, examining the effect of oxidative conditions prior to adhesion in our study rather than during biofilm formation indicated that these conditions enhanced the first step of biofilm formation by modifying the cell biology to achieve a better adhesion capability. ", "Subsequently, oxidative conditions confer a survival and dissemination advantage of *C. jejuni* through adhesion to abiotic surfaces in the food environment *sensu lato*.", "\n\nAlthough the higher abundance of CadF in the outer membrane in oxygen-enriched conditions was modest, it was statistically validated and corroborated with its higher transcription in these conditions and, as previously shown, its over-expression among cytosoluble proteins in *C. jejuni* NCTC 11168 [@pone.0046402-Garnaux1]. ", "Consequently, using an insertional inactivation of the *cadF* gene in *C. jejuni* 81--176, a *cadF* mutant was tested for its capability to adhere to an abiotic surface. ", "The lower adhesion capability of the *cadF* mutant compared to its isogenic strain indicates that CadF also plays a role in the inert surface adhesion process and may contribute to the enhanced adhesion in oxygen-enriched conditions. ", "Furthermore, the adhesion of *CadF* mutant cells submitted to oxidative conditions mediated by both paraquat and oxygen was not different from that of CadF mutant cells cultivated in microaerobic conditions, confirming that CadF is a key protein in the adhesion mechanism of *C. jejuni* to inert surfaces. ", "Taken together, these results suggest that adhesion to inert surfaces is also mediated by CadF whose expression is controlled by oxidative conditions. ", "The alignment of CadF sequences indicates that this protein is well-conserved among *C. jejuni* strains suggesting its functional importance (*cf.* [", "Fig. ", "S2](#pone.0046402.s002){ref-type=\"supplementary-material\"}). ", "Three forms of CadF (CadF-1, 24 kDa, CadF-2, 35 kDa, and CadF-3, 25 kDa), also detected by immunoblotting, were modulated under oxygen-enriched conditions. ", "Cordwell *et al.* [", "@pone.0046402-Cordwell1], [@pone.0046402-Scott1] have also previously observed a series of spots corresponding to CadF on 2-DE gels of the entire membrane of *C. jejuni* with variations in their immunogenic properties. ", "The authors also reported two cleavage sites between serine^195^ and leucine^196^, and glycine^201^ and phenylalanine^202^ (nucleotide counts without the 16 nt-peptide signal). ", "Among the three p*I* variants of CadF modulated by oxygen-enriched conditions in our study, CadF-2 displayed a higher molecular weight (35 kDa/p*I* 6.01) than that of CadF-1 and CadF-3 (24 kDa/p*I* 4.85 and 25 kDa/p*I* 5.07, respectively). ", "Noticeably, the protein coverage of CadF-2 included the cleavage site while peptides for CadF-1 and CadF-3 matched only in the N-terminal region suggesting a cleavage of these proteins (*cf.* [", "Fig. ", "S3](#pone.0046402.s003){ref-type=\"supplementary-material\"}). ", "This cleavage could be carried out by the carboxyl-terminal protease and the HtrA serine protease [@pone.0046402-Cordwell1]. ", "An increased abundance of HtrA has been associated with robust chicken colonization and may reflect a requirement for protease activity in colonization [@pone.0046402-Seal1]. ", "Interestingly, HtrA was also more abundant in oxygen-enriched conditions in our study.", "\n\nIn conclusion, these data demonstrate that oxygen-enriched conditions promote over-expression of the membrane proteins involved in the biofilm initiation and virulence of *C. jejuni*. ", "The adhesion of *C. jejuni* to inert surfaces results in a complex process which exacerbates and employs proteic virulence factors. ", "Finally, even though aerobic conditions are detrimental to *C. jejuni* growth, sub-lethal oxidative conditions could favor its survival throughout food processing because it develops a greater ability to adhere to inert surfaces, which could explain the re- and cross-contamination of food products by this pathogen.", "\n\nMaterials and Methods {#s4}\n=====================\n\nBacterial strains, media and growth conditions {#s4a}\n----------------------------------------------\n\nThe clinical *Campylobacter jejuni* strains NCTC 11168, 81--176 and its Δ*cadF* derivative generated via insertion of the kan^r^ cassette were used in this study. ", "A loopful of frozen culture conserved at −80°C in Brain-Heart Infusion (BHI) broth (Biokar, Beauvais, France) containing 20% sterile glycerol was spread on fresh Karmali agar plates (Oxoid, Dardilly, France) and incubated in microaerobic conditions of 5% O~2~, 10% CO~2~ and 85% N~2~ (Air Liquide, Paris, France) at 42°C for 48 h. Then, a subculture was performed in BHI in 24-well plates incubated for 18 h at 42°C under microaerobic conditions (5% O~2~, 10% CO~2~ and 85% N~2~, Air Liquide) or oxygen-acclimated conditions (19% O~2~, 10% CO~2~, and 71% N~2~, Air Liquide) with shaking. ", "Next, calibrated inocula (100 µL of a 10^5^ diluted culture) obtained from the subculture were spread on Columbia blood-free gelose plates (Merck KgaA, Darmstadt, Germany) or Columbia plates supplemented with 5% defibrinated horse blood and incubated at 42°C in stainless steel jars (Don Whitley Scientific Ltd, West Yorkshire, UK) under microaerobic conditions or oxygen-acclimated conditions from 15 to 68 h. Each jar was successively vacuum-emptied and refilled twice before incubation to ensure the correct gas concentration. ", "For *C. jejuni* 81--176, cells were harvested from plates flooded with 5 mL of sterile peptone water and the colonies were removed from the agar plates with a cell scraper after 24 h in optimal growth conditions (microaerobic conditions) and after 42 h in the oxygen-acclimated conditions in order to obtain an equivalent number and size of countable colonies.", "\n\nCells oxidatively stressed with paraquat, a molecule generating free radicals [@pone.0046402-Hassan1], were obtained as previously described by Garénaux *et al.* [", "@pone.0046402-Garnaux1] and used afterwards for adhesion assays. ", "Briefly, cells grown in the above-mentioned microaerobic conditions were centrifuged for 20 min at 3000×*g* at 20°C and resuspended up to an optical density (OD) of 1.00±0.05 at 600 nm in sterile peptone water broth (PWB) (Merck, Darmstadt, Germany) containing 500 µM paraquat (MP Biomedicals, Illkirch, France) and then incubated for 1 h at 42°C under microaerobic conditions. ", "A control of non-stressed cells was exposed to the same conditions without paraquat. ", "After incubation, cells were harvested by centrifugation for 20 min at 3000×*g* at 20°C and used for adhesion assays.", "\n\nBacterial adhesion to an abiotic surface {#s4b}\n----------------------------------------\n\nAdhesion was assessed for each strain in microaerobic static conditions using the BioFilm Ring Test® (BioFilm Control, Saint-Beauzire, France) according to the protocol described in detail by Sulaeman *et al.* [", "@pone.0046402-Sulaeman1]. ", "Briefly, cultures calibrated to OD~600\\ nm~ = 1±0.05 were added to 8-well polystyrene strips and incubated for 0.5 or 2 h under microaerobic conditions (5% O~2~, 10% CO~2~ and 85% N~2~) or oxygen enriched conditions (19% O~2~, 10% CO~2~ and 71% N~2~). ", "The adhesion capability of each strain was expressed as the mean of the BioFilm Index (BFI) of three wells calculated by the software. ", "Detection is based on attracted beads forming a black spot in the bottom of the wells detected by the Scan Plate Reader (BioFilm Control). ", "The initial concentration before adhesion was verified by plating the appropriate decimal dilution on Blood Gelose plates (Oxoid, Basingstoke, UK). ", "Colonies were enumerated after incubation in microaerobic conditions at 42°C for 48 h. The initial bacterial concentration was calculated from the mean of colonies enumerated on three plates of the appropriate dilution. ", "Three independent assays (from independent cultures) for each condition were performed.", "\n\nBacterial motility {#s4c}\n------------------\n\nThe swarming motility of *C. jejuni* 81--176 was assessed according to Scott *et al.* (", "2007) [@pone.0046402-Scott2] with the following modifications. ", "Swarm 0.6% soft agar BHI plates were briefly dried, inoculated with 2 µL of pure culture or 10 times diluted cultures and incubated at 42°C in microaerobic conditions or oxygen-acclimated conditions for 48 h. After incubation, strain motility was calculated by measuring the diameter of the growth area. ", "The experiments were carried out in triplicate from three independent cultures.", "\n\nMembrane protein extraction {#s4d}\n---------------------------\n\nAfter ultrasound treatment of bacterial cells, cytoplasmic proteins were separated from membrane fractions by ultracentrifugation at 188,000×*g* for 1 h at 4°C as described previously in Bièche *et al.* (", "2011). ", "Then, inner membrane proteins (IMPs) and outer membrane proteins (OMPs) contained in the pellet were separated by a sodium lauryl sarcosinate (Sigma-Aldrich, Steinheim, Germany) treatment [@pone.0046402-Filip1] carried out on ice for 20 min with shaking. ", "To determine the optimal separation conditions, 0.1, 0.5, 1 and 2% sodium lauryl sarcosinate concentrations were tested and only 0.5% was used subsequently. ", "After ultracentrifugation at 188,000×*g* for 1 h at 4°C, supernatant containing IMPs and pellet containing OMPs resuspended in 1 mM EDTA were aliquoted and stored at −80°C. ", "The protein concentration of OMPs and IMPs was determined using the Micro BCA™ Protein Assay Kit (Perbio Science, Brebieres, France) according to the manufacturer\\'s protocol.", "\n\nTo check the optimal separation of IMPs and OMPs using sodium lauryl sarcosinate, migration through 12.5% acrylamide/bisacrylamide SDS-PAGE (18×20×0.75 mm) was performed with a 4% acrylamide/bisacrylamide stacking gel using a Protean II cell (Bio-Rad, Hercules, CA, USA) SDS-PAGE. ", "Samples of 10 µg of proteins were mixed in a ratio of 3∶1 with the reducing agent sample buffer containing 2% SDS, 62.5 mM Tris-HCl, pH 6.8, 10% glycerol, 5% β-mercaptoethanol, and a trace of bromophenol blue, and heated for 5 min at 100°C. ", "Proteins in gels were silver stained and scanned with a GS-800 densitometer (Bio-Rad) operated with the QuantityOne® software (Bio-Rad) at a resolution of 42.3 microns.", "\n\nTwo-dimensional gel electrophoresis (2-DE) {#s4e}\n------------------------------------------\n\nA quantity of 100 µg of protein was concentrated using the Concentrator 5301 (Eppendorf, Le Pecq, France), at room temperature, until the solution volume was reduced to 40 µL. Then, each sample was solubilized in 400 µL of a solution containing 7 M urea, 2 M thiourea, 2 mM tributyl phosphine (TBP), 1% amidosulfobetaine-14 (ASB-14), 2% carrier ampholytes and 0.25% Coomassie Blue R-250 (Sigma-Aldrich) under rotation shaking for 1 h. Next, each protein sample was frozen/thawed for at least 30 min at −80°C. ", "Insoluble material was removed by centrifugation at 8000×g for 3 min at 4°C. ", "Iso-Electro Focusing (IEF) (Bio-Rad, Marnes la Coquette, France) was carried out with 18-cm NonLinear Immobiline Dry IPG strips (GE Healthcare, Uppsala, Sweden). ", "Gradients giving the best results in terms of spot quantity, quality and separation were used: a linear gradient pH 4--7 for OMPs and a non-linear gradient pH 3--10 for IMPs. ", "Strips were rehydrated under 50 V for 10 h and the voltage for protein focalization was as follows: 250 V for 15 min, a linear increase to 10,000 V for 3 h, then 10,000 V until 105 kVh was reached. ", "After focalization, IPG strips were first reduced for 10 min in 2% dithiothreitol (DTT) and subsequently alkylated for 10 min in 2% iodoacetamide, contained in a detergent exchange buffer composed of 7 M urea, 50 mM Tris-HCl (pH 6.8), 15% glycerol, 2% SDS and 1% Coomassie Blue R-250 as described previously by Vilain *et al.* [", "@pone.0046402-Vilain1].", "\n\nThe second-dimension electrophoresis was performed using 12.5% acrylamide/bisacrylamide SDS-PAGE. ", "Strips were laid over the separation gel and embedded with 0.3% migration buffer supplemented with 5% polyacrylamide alignment gel. ", "Migration was carried out at 4°C at 300 V maximum and 10 mA/gel for 45--60 min and then at 20 mA/gel. ", "For protein identification, gels were loaded with 250 µg of proteins and stained in 0.06% Colloidal Coomassie Blue G-250 (Bio-Rad). ", "All experiments were carried out in triplicate from three independent protein extractions.", "\n\nImage and statistical analyses of 2-DE gels {#s4f}\n-------------------------------------------\n\nAfter scanning by the ProXPRESS Proteomic Imaging System (Perkin Elmer) with a resolution of 100 microns, the 2D gels were analyzed using Progenesis Samespots® 4.0 software (NonLinear Dynamics, Newcastle upon Tyne, UK) for normalization of the gels and statistical analysis. ", "In Progenesis SameSpots, normalization is performed from a calculated gain factor including variations from sample quantity to scanning setting and gel staining which avoid any variations due to major proteins. ", "The quality of the gels was ensured using the Quality Control (QC) of Progenesis SameSpots software. ", "Statistical analysis of protein expression was performed on at least six gels for each condition (5% O~2~ and 19% O~2~), *i.e.* 3 independent experiments (independent cultures) and at least 2 technical replicates for each independent culture. ", "Differences between each condition were validated by Principal Component Analysis (PCA) to determine if samples had the groupings expected or if there were any outliers in the data. ", "In our study, only normalized spots exhibiting variations with a fold of at least 1.6 and with a *p-value* (ANOVA) ≤0.01, a *q-value* (False Discovery Rate, FDR) \\<0.05 and P (Power Analysis) \\>0.8 were selected as being differentially expressed. ", "P depends on the sample size and can calculate the effect of running a different number of replicates. ", "With a target power of 0.8, it is possible to select a fold of at least 1.6 without increasing the risk of including false positive spots.", "\n\nIn-gel trypsin digestion and protein identification {#s4g}\n---------------------------------------------------\n\nManually excised spots were washed several times with water and ammonium carbonate, dehydrated with acetonitrile (ACN) and dried. ", "Trypsin digestion was performed overnight with a dedicated automated system (MultiPROBE II, PerkinElmer). ", "The gel fragments were subsequently incubated twice in an H~2~O/ACN solution for 15 min, then in 1% (v/v) Formic Acid for 15 min and finally in 100% ACN for 15 min to enable the extraction of peptides from the gel pieces. ", "Supernatants were pooled and transferred into a clean 96-well plate. ", "Peptide extracts were then dried and solubilized in 10 µL starting buffer for chromatographic elution, consisting of 3% ACN and 0.1% HCOOH in water.", "\n\nPeptides were analyzed using a nano-LC1200 system coupled to a 6340 Ion Trap mass spectrometer equipped with an HPLC-chip cube interface (Agilent Technologies, Massy, France). ", "The tandem mass spectrometry peak lists were extracted using the DataAnalysis program (version 3.4, Bruker Daltonic) and compared to the *C. jejuni*, strain 81--176, amino acid sequence database (UniprotKB, 09.09.2010) using the Mascot Daemon (version 2.1.3) search engine. ", "The searches were performed with a maximum of one missed cleavage, with no fixed modification and with variable modifications for carbamidomethyl and oxidation of methionines. ", "Identification from the tandem mass spectrometry spectra was performed with a mass tolerance of 1.6 Da for precursor ions and 0.8 for MS/MS fragments. ", "The determination of at least two peptide sequences with a Mascot Score over 50 using splitting patterns allowed a satisfactory identification of the protein. ", "Cell localization was predicted using PSORTb v3.0.2 programs (<http://www.psort.org/psortb/>) [@pone.0046402-Yu1].", "\n\nDot and western blotting {#s4h}\n------------------------\n\nDot blotting was carried out by slowly spotting 5 µL of 0.5, 1, 5 and 10 µg of OMP-enriched fraction onto a nitrocellulose membrane. ", "Western blotting was performed on proteins separated on the unstained 2-DE gel of the OMP-enriched fraction. ", "Proteins were transferred (at 100 V for 2 h) to a nitrocellulose membrane using the Mini Trans-Blot Cell Assembly® SD Semi-dry Electrophoretic Transfer Cell (Bio-Rad).", "\n\nNon specific sites were blocked by soaking each nitrocellulose membrane for 2 h in 20 mM Tris-HCl, 150 mM NaCl-pH 7.5 supplemented with 4% skim milk. ", "Transferred proteins were probed with a 1/2000 dilution of rabbit anti-serum anti-CadF. Immunoreactive proteins were detected using a 1/2000 dilution goat-anti-rabbit alkaline phosphatase antibody, followed by incubation in 3,3′-diaminobenzidine tetrahydrochloride (DAB) (Sigma-Aldrich). ", "Gels were scanned using a GS-800 Imaging densitometer (Bio-Rad).", "\n\nRNA extraction and quantitative RT-PCR (qRT-PCR) {#s4i}\n------------------------------------------------\n\nCell cultures supplemented with 1 mL RNA Protect Reagent (Qiagen, Courtaboeuf, France) were pelleted (3300 *g*, 6 min) at 4°C and resuspended in 1 ml of EXTRACT-ALL® (Eurobio, Courtaboeuf, France) according to the manufacturer\\'s instructions. ", "Then, the RNA samples were treated and submitted to reverse transcription according to Ritz *et al.* (", "2009) [@pone.0046402-Ritz1]. ", "Quantitative real-time PCR (qRT-PCR) assays were performed using the 7300 Realtime PCR system (Applied Biosystems) as described previously by Bieche *et al.* [", "@pone.0046402-Bieche1] using the SYBR Green Master Mix (Applied Biosystems) as the amplification detector and the rpoA gene as the endogenous control. ", "The absence of DNA in the samples was confirmed by classical PCR with primers CPYFLA_1 5′-GGATTTCGTATTAACACAAATGGTGC-3′ and CPYFLA_2 5′ CTGTAGTAATCTTAAAACATTTTG-3′ amplifying 1700 bp of the gene flaA. Gene-specific primers used for qRT-PCR were designed according to the corresponding gene sequences of the identified proteins ([Table 3](#pone-0046402-t003){ref-type=\"table\"}). ", "Three independent RNA extractions with four replicates for each gene were performed for each condition.", "\n\n10.1371/journal.pone.0046402.t003\n\n###### Primers used in this study for gene expression quantification using qRT-PCR.", "\n\n![](", "pone.0046402.t003){#pone-0046402-t003-3}\n\n Primer name Sequence 5′-3′ Amplicon length (bp) (ref)\n ----------------- ------------------------------ ----------------------------\n **rpoAQ-fw** `CGAGCTTGCTTTGATGAGTG` 109 (Garénaux *et al.*)", "\n **rpoAQ-rev** `AGTTCCCACAGGAAAACCTA` \n **cadF-fw** `TGCTGATACTCGTGCAACTC` 112 (Garénaux *et al.*)", "\n **cadF-rev** `ACCAAAATGACCTTCCAAAG` \n **cjj0854-fw** `GGTAGCGTTTTAAGCGTGGA` 106\n **cjj0854-rev** `TTTTTACAGCTTGGGTAATTTCTTTT` \n **cjj0275-fw** `TCATGCTGCTCGTGAAGAAG` 106\n **cjj0275-rev** `TGCAGCTTTTGCGTTAAATG` \n **dnaj1-fw** `TATGTTCCCCGCCTTTAACA` 109\n **dnaj1-rev** `CCGCGGTTTTTAAATTCTTG` \n **cjj0093-fw** `TAGCCTTTGCCAAACCTGAT` 116\n **cjj0093-rev** `TATACCGCACATTCCACCAA` \n **peb4-fw** `ACAGATGCTGCTTTCGCACT` 108\n **peb4-rev** `TTGACCTTTAGCCTGCGAAT` \n\nfw: forward, rev: reverse, bp: base pair.", "\n\nStatistical analyses {#s4j}\n--------------------\n\nThe results from adhesion, motility and qRT-PCR, including assays and conditions, were analyzed using Statgraphics Plus 5.1 software (StatPoint Inc., Herndon, Virginia, USA). ", "With the confirmation of a normal distribution for each data set, significant differences were determined using two-sided Student\\'s t-test comparisons at a 5% significance level.", "\n\nSupporting Information {#s5}\n======================\n\n###### \n\nPrincipal Component Analysis performed on the complete data set of the 14 2-DE gels for IMPs-enriched fraction (A) and 13 2-DE gels for OMPs-enriched fraction (B). ", "Blue circles correspond to proteins of oxygen-acclimated cells and pink circles to proteins of microaerobically grown cells (control).", "\n\n(DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\n**Alignment of CadF protein sequences from different strains of** ***C. jejuni*** **using software ClutalX2.** ", "Frames highlight the suspected adhesion to fibronectin site **(FRLS)** and the two potential protease sites **(SL)** and **(GF)**.", "\n\n(DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\n**Protein coverage and matched peptides from the three protein forms of CadF (CadF-1, CadF-2 and CadF-3) which abundance was modulated under oxygen-acclimation conditions.** ", "Matched peptides are indicated in red.", "\n\n(DOC)\n\n###### \n\nClick here for additional data file.", "\n\nWe thank Florence JUGIAU and Florence RAMA for their technical help. ", "We are grateful to Carol Robins for English editing. ", "BioFilm Control (Saint-Beauzire, France) provided facilities for the BioFilm Ring Test®, the biomolecular platform (PFBM, Oniris, France) provided facilities for qRT-PCR and the Institut Fédératif Multidisciplinaire (IFRMP 23, University of Rouen, France) provided facilities for proteomic analyses. ", "Sheiam Sulaeman was the recipient of a Syrian fellowship.", "\n\n[^1]: **Competing Interests:**The authors have declared that no competing interests exist.", "\n\n[^2]: Conceived and designed the experiments: OT ED. ", "Performed the experiments: SS MH AS LC. ", "Contributed reagents/materials/analysis tools: JMB. ", "Wrote the paper: OT.", "\n" ]
{ "pile_set_name": "PubMed Central" }
[ 0, 0.006369426751592357, 0.006211180124223602, 0.018518518518518517, 0.01282051282051282, 0.008333333333333333, 0.002824858757062147, 0.003257328990228013, 0.00796812749003984, 0.005128205128205128, 0.012195121951219513, 0, 0.00980392156862745, 0, 0.030303030303030304, 0.007633587786259542, 0.005681818181818182, 0, 0.011450381679389313, 0.012539184952978056, 0.004830917874396135, 0.01195219123505976, 0.016853932584269662, 0.007272727272727273, 0, 0.005154639175257732, 0, 0, 0, 0, 0, 0.02926829268292683, 0, 0, 0, 0, 0, 0.012944983818770227, 0, 0.015568862275449102, 0.003048780487804878, 0, 0, 0.021739130434782608, 0.018867924528301886, 0.013071895424836602, 0, 0.014925373134328358, 0, 0, 0.005361930294906166, 0.03636363636363636, 0.004739336492890996, 0, 0, 0.02030456852791878, 0, 0.0078125, 0.008849557522123894, 0.038461538461538464, 0, 0, 0.0048543689320388345, 0, 0.012903225806451613, 0.0196078431372549, 0, 0, 0, 0.020833333333333332, 0, 0.013245033112582781, 0, 0, 0.009345794392523364, 0, 0.00299956369982548, 0.016129032258064516, 0.02295918367346939, 0, 0.015748031496062992, 0.003663003663003663, 0.024390243902439025, 0.0048543689320388345, 0, 0.0051813471502590676, 0, 0, 0, 0, 0.0033003300330033004, 0, 0, 0.010638297872340425, 0.004056795131845842, 0, 0, 0, 0.004629629629629629, 0, 0.002183406113537118, 0, 0, 0, 0.008733624454148471, 0, 0.0055248618784530384, 0.0064516129032258064, 0, 0, 0, 0, 0.017241379310344827, 0, 0.004728132387706856, 0, 0.0030120481927710845, 0, 0, 0.004219409282700422, 0.02702702702702703, 0.0058823529411764705, 0, 0, 0, 0.0021321961620469083, 0, 0.0045662100456621, 0, 0.010810810810810811, 0.014598540145985401, 0.008264462809917356, 0.013333333333333334, 0.006756756756756757, 0.018691588785046728, 0.005780346820809248, 0, 0.02586206896551724, 0.014234875444839857, 0, 0, 0, 0, 0.010638297872340425, 0, 0, 0, 0.007194244604316547, 0, 0.004366812227074236, 0.013953488372093023, 0.014285714285714285, 0.014492753623188406, 0.006097560975609756, 0, 0, 0.008547008547008548, 0.012658227848101266, 0.014778325123152709, 0, 0.012779552715654952, 0.011111111111111112, 0, 0, 0, 0.005780346820809248, 0, 0, 0.0061162079510703364, 0, 0.004273504273504274, 0.0032679738562091504, 0.006622516556291391, 0.006711409395973154, 0, 0, 0.00641025641025641, 0, 0.0091324200913242, 0, 0.0125, 0, 0, 0, 0.008, 0.005714285714285714, 0, 0, 0, 0, 0, 0.027210884353741496, 0.005660377358490566, 0, 0.006060606060606061, 0.015384615384615385, 0.007936507936507936, 0, 0, 0.006600660066006601, 0.038461538461538464, 0.023809523809523808, 0.007407407407407408, 0, 0.02027027027027027, 0.004545454545454545, 0, 0, 0.015873015873015872, 0.003289473684210526, 0, 0, 0, 0.00392156862745098, 0, 0, 0, 0.007067137809187279, 0.004149377593360996, 0.005952380952380952, 0.001652892561983471, 0, 0.024691358024691357, 0.005714285714285714, 0, 0.012195121951219513, 0.043478260869565216, 0.01, 0, 0.0196078431372549, 0, 0, 0.013404825737265416, 0, 0.009900990099009901, 0, 0.005494505494505495, 0.012145748987854251, 0, 0, 0, 0.009433962264150943, 0.0045045045045045045, 0, 0.006756756756756757, 0.011235955056179775, 0.0036496350364963502, 0, 0.006622516556291391, 0, 0.017543859649122806, 0.0051813471502590676, 0.009174311926605505, 0, 0.013157894736842105, 0.003472222222222222, 0, 0.017045454545454544, 0.0196078431372549, 0.034482758620689655, 0.018867924528301886, 0.006622516556291391, 0.0026455026455026454, 0.009708737864077669, 0.008333333333333333, 0, 0.010830324909747292, 0, 0.002898550724637681, 0.004405286343612335, 0, 0, 0, 0.018518518518518517, 0, 0, 0.018518518518518517, 0.005405405405405406, 0, 0.018518518518518517, 0.014084507042253521, 0.018867924528301886, 0.016666666666666666, 0.017543859649122806, 0, 0.01818181818181818, 0.025, 0.019230769230769232, 0.05, 0 ]
0.006558
5
[ { "analysis_explanation": null, "end": 15746, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 1, "start": 15737 }, { "analysis_explanation": null, "end": 18196, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 1, "start": 18187 }, { "analysis_explanation": null, "end": 19661, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 1, "start": 19652 }, { "analysis_explanation": null, "end": 23585, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 1, "start": 23576 }, { "analysis_explanation": null, "end": 24077, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 1, "start": 24068 }, { "analysis_explanation": null, "end": 25556, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 1, "start": 25547 }, { "analysis_explanation": null, "end": 30229, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 1, "start": 30220 }, { "analysis_explanation": null, "end": 280, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 270 }, { "analysis_explanation": null, "end": 463, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 441 }, { "analysis_explanation": null, "end": 549, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 535 }, { "analysis_explanation": null, "end": 567, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 554 }, { "analysis_explanation": null, "end": 698, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 692 }, { "analysis_explanation": null, "end": 795, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 785 }, { "analysis_explanation": null, "end": 878, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 875 }, { "analysis_explanation": null, "end": 1083, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1080 }, { "analysis_explanation": null, "end": 1301, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1293 }, { "analysis_explanation": null, "end": 1601, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1589 }, { "analysis_explanation": null, "end": 1679, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1669 }, { "analysis_explanation": null, "end": 1852, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1842 }, { "analysis_explanation": null, "end": 2184, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2176 }, { "analysis_explanation": null, "end": 2200, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2196 }, { "analysis_explanation": null, "end": 2255, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2245 }, { "analysis_explanation": null, "end": 2435, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2427 }, { "analysis_explanation": null, "end": 2451, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2447 }, { "analysis_explanation": null, "end": 2712, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2702 }, { "analysis_explanation": null, "end": 2786, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2763 }, { "analysis_explanation": null, "end": 3087, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3077 }, { "analysis_explanation": null, "end": 3216, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3212 }, { "analysis_explanation": null, "end": 3407, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3397 }, { "analysis_explanation": null, "end": 3781, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3777 }, { "analysis_explanation": null, "end": 3790, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3786 }, { "analysis_explanation": null, "end": 4044, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4034 }, { "analysis_explanation": null, "end": 4144, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4128 }, { "analysis_explanation": null, "end": 4232, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4222 }, { "analysis_explanation": null, "end": 4354, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4330 }, { "analysis_explanation": null, "end": 4908, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4898 }, { "analysis_explanation": null, "end": 4987, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4977 }, { "analysis_explanation": null, "end": 5206, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5196 }, { "analysis_explanation": null, "end": 6126, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6114 }, { "analysis_explanation": null, "end": 6171, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6163 }, { "analysis_explanation": null, "end": 6383, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6375 }, { "analysis_explanation": null, "end": 6490, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6480 }, { "analysis_explanation": null, "end": 6594, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6582 }, { "analysis_explanation": null, "end": 6658, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6648 }, { "analysis_explanation": null, "end": 6676, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6668 }, { "analysis_explanation": null, "end": 7327, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7312 }, { "analysis_explanation": null, "end": 7978, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7972 }, { "analysis_explanation": null, "end": 8244, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8238 }, { "analysis_explanation": null, "end": 8309, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8302 }, { "analysis_explanation": null, "end": 8768, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8758 }, { "analysis_explanation": null, "end": 8918, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8912 }, { "analysis_explanation": null, "end": 9188, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9182 }, { "analysis_explanation": null, "end": 9215, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9214 }, { "analysis_explanation": null, "end": 9283, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9269 }, { "analysis_explanation": null, "end": 9329, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9311 }, { "analysis_explanation": null, "end": 9409, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9391 }, { "analysis_explanation": null, "end": 10531, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10516 }, { "analysis_explanation": null, "end": 11531, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11527 }, { "analysis_explanation": null, "end": 12560, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12550 }, { "analysis_explanation": null, "end": 13451, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13441 }, { "analysis_explanation": null, "end": 14264, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14251 }, { "analysis_explanation": null, "end": 15788, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15784 }, { "analysis_explanation": null, "end": 15810, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15806 }, { "analysis_explanation": null, "end": 15816, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15812 }, { "analysis_explanation": null, "end": 15839, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15835 }, { "analysis_explanation": null, "end": 18072, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18002 }, { "analysis_explanation": null, "end": 18290, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18249 }, { "analysis_explanation": null, "end": 18784, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18597 }, { "analysis_explanation": null, "end": 21061, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21033 }, { "analysis_explanation": null, "end": 22530, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22509 }, { "analysis_explanation": null, "end": 26866, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26825 }, { "analysis_explanation": null, "end": 31757, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31751 }, { "analysis_explanation": null, "end": 33304, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33299 }, { "analysis_explanation": null, "end": 33558, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33554 }, { "analysis_explanation": null, "end": 35594, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35582 }, { "analysis_explanation": null, "end": 35674, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35662 }, { "analysis_explanation": null, "end": 35737, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35733 }, { "analysis_explanation": null, "end": 36924, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36921 }, { "analysis_explanation": null, "end": 37147, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37135 }, { "analysis_explanation": null, "end": 37505, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37493 }, { "analysis_explanation": null, "end": 37887, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37885 }, { "analysis_explanation": null, "end": 37987, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37975 }, { "analysis_explanation": null, "end": 38054, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38037 }, { "analysis_explanation": null, "end": 38105, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38098 }, { "analysis_explanation": null, "end": 38116, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38114 }, { "analysis_explanation": null, "end": 38153, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38136 }, { "analysis_explanation": null, "end": 38519, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38515 }, { "analysis_explanation": null, "end": 38698, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38671 }, { "analysis_explanation": null, "end": 39072, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39045 }, { "analysis_explanation": null, "end": 39107, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39103 }, { "analysis_explanation": null, "end": 39205, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39204 }, { "analysis_explanation": null, "end": 39330, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39327 }, { "analysis_explanation": null, "end": 39760, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39753 }, { "analysis_explanation": null, "end": 40335, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40308 }, { "analysis_explanation": null, "end": 40499, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40495 }, { "analysis_explanation": null, "end": 40550, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40540 }, { "analysis_explanation": null, "end": 40936, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40926 }, { "analysis_explanation": null, "end": 41140, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41130 }, { "analysis_explanation": null, "end": 41530, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41520 }, { "analysis_explanation": null, "end": 41653, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41629 }, { "analysis_explanation": null, "end": 41996, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41990 }, { "analysis_explanation": null, "end": 42593, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42583 }, { "analysis_explanation": null, "end": 43474, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43464 }, { "analysis_explanation": null, "end": 44199, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44189 }, { "analysis_explanation": null, "end": 44506, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44496 }, { "analysis_explanation": null, "end": 45178, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45168 }, { "analysis_explanation": null, "end": 45779, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45769 }, { "analysis_explanation": null, "end": 46608, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46598 }, { "analysis_explanation": null, "end": 46845, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46841 }, { "analysis_explanation": null, "end": 47107, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47095 }, { "analysis_explanation": null, "end": 47318, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47308 }, { "analysis_explanation": null, "end": 47686, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47676 }, { "analysis_explanation": null, "end": 48075, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48065 }, { "analysis_explanation": null, "end": 48188, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48184 }, { "analysis_explanation": null, "end": 48748, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48744 }, { "analysis_explanation": null, "end": 49035, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49031 }, { "analysis_explanation": null, "end": 49075, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49063 }, { "analysis_explanation": null, "end": 49108, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49104 }, { "analysis_explanation": null, "end": 49166, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49156 }, { "analysis_explanation": null, "end": 49280, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49276 }, { "analysis_explanation": null, "end": 49432, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49422 }, { "analysis_explanation": null, "end": 49572, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49568 }, { "analysis_explanation": null, "end": 49847, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49843 }, { "analysis_explanation": null, "end": 49898, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49888 }, { "analysis_explanation": null, "end": 50162, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50158 }, { "analysis_explanation": null, "end": 51194, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51184 }, { "analysis_explanation": null, "end": 51223, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51213 }, { "analysis_explanation": null, "end": 52051, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52045 }, { "analysis_explanation": null, "end": 52061, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52053 }, { "analysis_explanation": null, "end": 52069, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52063 }, { "analysis_explanation": null, "end": 52130, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52123 }, { "analysis_explanation": null, "end": 52159, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52151 }, { "analysis_explanation": null, "end": 52167, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52161 }, { "analysis_explanation": null, "end": 52198, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52186 }, { "analysis_explanation": null, "end": 52264, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52259 }, { "analysis_explanation": null, "end": 52272, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52266 }, { "analysis_explanation": null, "end": 52368, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52364 }, { "analysis_explanation": null, "end": 52710, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52701 }, { "analysis_explanation": null, "end": 52719, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52712 }, { "analysis_explanation": null, "end": 52875, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52861 }, { "analysis_explanation": null, "end": 52879, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52877 }, { "analysis_explanation": null, "end": 52899, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52887 }, { "analysis_explanation": null, "end": 53094, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53084 }, { "analysis_explanation": null, "end": 53304, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53292 }, { "analysis_explanation": null, "end": 53438, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53430 }, { "analysis_explanation": null, "end": 53592, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53584 }, { "analysis_explanation": null, "end": 53725, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53713 }, { "analysis_explanation": null, "end": 53764, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53758 }, { "analysis_explanation": null, "end": 53843, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53834 }, { "analysis_explanation": null, "end": 53908, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53899 }, { "analysis_explanation": null, "end": 53917, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53910 }, { "analysis_explanation": null, "end": 53961, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53950 }, { "analysis_explanation": null, "end": 53971, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53963 }, { "analysis_explanation": null, "end": 53979, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53973 }, { "analysis_explanation": null, "end": 54199, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54193 }, { "analysis_explanation": null, "end": 54393, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54381 }, { "analysis_explanation": null, "end": 54473, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54459 }, { "analysis_explanation": null, "end": 54481, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54475 }, { "analysis_explanation": null, "end": 54540, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54532 }, { "analysis_explanation": null, "end": 54699, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54696 }, { "analysis_explanation": null, "end": 54718, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54706 }, { "analysis_explanation": null, "end": 55218, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55206 }, { "analysis_explanation": null, "end": 55245, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55234 }, { "analysis_explanation": null, "end": 55249, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55247 }, { "analysis_explanation": null, "end": 55309, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55297 }, { "analysis_explanation": null, "end": 55689, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55677 }, { "analysis_explanation": null, "end": 55698, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55694 }, { "analysis_explanation": null, "end": 55767, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55757 }, { "analysis_explanation": null, "end": 55912, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55900 }, { "analysis_explanation": null, "end": 56357, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56354 }, { "analysis_explanation": null, "end": 56398, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56392 }, { "analysis_explanation": null, "end": 56414, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56410 }, { "analysis_explanation": null, "end": 56546, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56540 }, { "analysis_explanation": null, "end": 56584, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56575 }, { "analysis_explanation": null, "end": 56593, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56586 }, { "analysis_explanation": null, "end": 56657, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56651 }, { "analysis_explanation": null, "end": 56731, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56730 }, { "analysis_explanation": null, "end": 56752, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56746 }, { "analysis_explanation": null, "end": 56877, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56874 }, { "analysis_explanation": null, "end": 57125, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57116 }, { "analysis_explanation": null, "end": 57133, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57127 }, { "analysis_explanation": null, "end": 57258, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57240 }, { "analysis_explanation": null, "end": 57442, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57440 }, { "analysis_explanation": null, "end": 57447, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57444 }, { "analysis_explanation": null, "end": 57689, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57684 }, { "analysis_explanation": null, "end": 58050, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58041 }, { "analysis_explanation": null, "end": 58059, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58052 }, { "analysis_explanation": null, "end": 58067, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58061 }, { "analysis_explanation": null, "end": 58461, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58446 }, { "analysis_explanation": null, "end": 58540, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58535 }, { "analysis_explanation": null, "end": 58612, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58606 }, { "analysis_explanation": null, "end": 58700, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58693 }, { "analysis_explanation": null, "end": 58708, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58702 }, { "analysis_explanation": null, "end": 58919, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58915 }, { "analysis_explanation": null, "end": 59002, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58996 }, { "analysis_explanation": null, "end": 59041, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59038 }, { "analysis_explanation": null, "end": 59144, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59138 }, { "analysis_explanation": null, "end": 59209, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59203 }, { "analysis_explanation": null, "end": 59367, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59347 }, { "analysis_explanation": null, "end": 59408, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59395 }, { "analysis_explanation": null, "end": 59745, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59735 }, { "analysis_explanation": null, "end": 60291, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60282 }, { "analysis_explanation": null, "end": 60301, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60297 }, { "analysis_explanation": null, "end": 60305, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60303 }, { "analysis_explanation": null, "end": 61220, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61215 }, { "analysis_explanation": null, "end": 61260, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61257 }, { "analysis_explanation": null, "end": 61268, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61262 }, { "analysis_explanation": null, "end": 61872, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61863 }, { "analysis_explanation": null, "end": 62024, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62018 }, { "analysis_explanation": null, "end": 62065, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62059 }, { "analysis_explanation": null, "end": 62100, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62094 }, { "analysis_explanation": null, "end": 62171, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62159 }, { "analysis_explanation": null, "end": 62542, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62537 }, { "analysis_explanation": null, "end": 62550, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62544 }, { "analysis_explanation": null, "end": 62701, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62691 }, { "analysis_explanation": null, "end": 62795, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62778 }, { "analysis_explanation": null, "end": 63105, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63099 }, { "analysis_explanation": null, "end": 63548, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63547 }, { "analysis_explanation": null, "end": 63975, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63972 }, { "analysis_explanation": null, "end": 63993, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63985 }, { "analysis_explanation": null, "end": 64148, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64123 }, { "analysis_explanation": null, "end": 64590, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64584 }, { "analysis_explanation": null, "end": 64622, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64617 }, { "analysis_explanation": null, "end": 64700, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64694 }, { "analysis_explanation": null, "end": 64856, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64852 }, { "analysis_explanation": null, "end": 65311, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65279 }, { "analysis_explanation": null, "end": 66065, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66057 }, { "analysis_explanation": null, "end": 66192, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66184 }, { "analysis_explanation": null, "end": 66500, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66495 }, { "analysis_explanation": null, "end": 66567, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66562 }, { "analysis_explanation": null, "end": 67098, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67091 }, { "analysis_explanation": null, "end": 67108, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67100 }, { "analysis_explanation": null, "end": 67113, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67110 }, { "analysis_explanation": null, "end": 68099, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68095 }, { "analysis_explanation": null, "end": 68313, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68298 }, { "analysis_explanation": null, "end": 68331, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68318 }, { "analysis_explanation": null, "end": 68389, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68377 }, { "analysis_explanation": null, "end": 68442, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68428 }, { "analysis_explanation": null, "end": 68450, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68444 }, { "analysis_explanation": null, "end": 68547, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68541 }, { "analysis_explanation": null, "end": 68665, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68659 }, { "analysis_explanation": null, "end": 68726, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68711 }, { "analysis_explanation": null, "end": 68756, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68750 }, { "analysis_explanation": null, "end": 62770, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 62760 }, { "analysis_explanation": null, "end": 63404, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 63376 }, { "analysis_explanation": null, "end": 614, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 607 }, { "analysis_explanation": null, "end": 17125, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17117 }, { "analysis_explanation": null, "end": 17372, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17364 }, { "analysis_explanation": null, "end": 17619, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 17611 }, { "analysis_explanation": null, "end": 18113, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18103 }, { "analysis_explanation": null, "end": 21300, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 21296 }, { "analysis_explanation": null, "end": 41765, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 41758 }, { "analysis_explanation": null, "end": 62770, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 62760 }, { "analysis_explanation": null, "end": 65702, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 65695 }, { "analysis_explanation": null, "end": 9975, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 9973 }, { "analysis_explanation": null, "end": 49494, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 49492 }, { "analysis_explanation": null, "end": 50566, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 50564 }, { "analysis_explanation": null, "end": 62419, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 62413 }, { "analysis_explanation": null, "end": 64092, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.2, "start": 64086 }, { "analysis_explanation": null, "end": 64186, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.2, "start": 64180 }, { "analysis_explanation": null, "end": 15933, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 15928 }, { "analysis_explanation": null, "end": 16672, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 16667 }, { "analysis_explanation": null, "end": 17889, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 17884 }, { "analysis_explanation": null, "end": 18135, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 18131 }, { "analysis_explanation": null, "end": 18382, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 18378 }, { "analysis_explanation": null, "end": 19847, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 19843 }, { "analysis_explanation": null, "end": 20094, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 20090 }, { "analysis_explanation": null, "end": 20341, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 20337 }, { "analysis_explanation": null, "end": 22788, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 22783 }, { "analysis_explanation": null, "end": 24511, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 24506 }, { "analysis_explanation": null, "end": 25004, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 25000 }, { "analysis_explanation": null, "end": 25742, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 25738 }, { "analysis_explanation": null, "end": 26234, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 26230 }, { "analysis_explanation": null, "end": 28684, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 28680 }, { "analysis_explanation": null, "end": 28931, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 28927 }, { "analysis_explanation": null, "end": 30415, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 30411 }, { "analysis_explanation": null, "end": 30662, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 30658 }, { "analysis_explanation": null, "end": 31405, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 31401 }, { "analysis_explanation": null, "end": 31652, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 31648 }, { "analysis_explanation": null, "end": 14264, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 14255 }, { "analysis_explanation": null, "end": 14264, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 14255 }, { "analysis_explanation": null, "end": 14264, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 14255 }, { "analysis_explanation": null, "end": 15746, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 15737 }, { "analysis_explanation": null, "end": 15746, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 15737 }, { "analysis_explanation": null, "end": 15746, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 15737 }, { "analysis_explanation": null, "end": 15992, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 15983 }, { "analysis_explanation": null, "end": 15992, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 15983 }, { "analysis_explanation": null, "end": 15992, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 15983 }, { "analysis_explanation": null, "end": 16239, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 16230 }, { "analysis_explanation": null, "end": 16239, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 16230 }, { "analysis_explanation": null, "end": 16239, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 16230 }, { "analysis_explanation": null, "end": 16961, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 16952 }, { "analysis_explanation": null, "end": 16961, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 16952 }, { "analysis_explanation": null, "end": 16961, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 16952 }, { "analysis_explanation": null, "end": 17702, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 17693 }, { "analysis_explanation": null, "end": 17702, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 17693 }, { "analysis_explanation": null, "end": 17702, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 17693 }, { "analysis_explanation": null, "end": 17949, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 17940 }, { "analysis_explanation": null, "end": 17949, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 17940 }, { "analysis_explanation": null, "end": 17949, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 17940 }, { "analysis_explanation": null, "end": 18196, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 18187 }, { "analysis_explanation": null, "end": 18196, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 18187 }, { "analysis_explanation": null, "end": 18196, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 18187 }, { "analysis_explanation": null, "end": 18443, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 18434 }, { "analysis_explanation": null, "end": 18443, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 18434 }, { "analysis_explanation": null, "end": 18443, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 18434 }, { "analysis_explanation": null, "end": 19661, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 19652 }, { "analysis_explanation": null, "end": 19661, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 19652 }, { "analysis_explanation": null, "end": 19661, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 19652 }, { "analysis_explanation": null, "end": 20155, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 20146 }, { "analysis_explanation": null, "end": 20155, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 20146 }, { "analysis_explanation": null, "end": 20155, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 20146 }, { "analysis_explanation": null, "end": 20633, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 20624 }, { "analysis_explanation": null, "end": 20633, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 20624 }, { "analysis_explanation": null, "end": 20633, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 20624 }, { "analysis_explanation": null, "end": 23585, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 23576 }, { "analysis_explanation": null, "end": 23585, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 23576 }, { "analysis_explanation": null, "end": 23585, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 23576 }, { "analysis_explanation": null, "end": 24077, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 24068 }, { "analysis_explanation": null, "end": 24077, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 24068 }, { "analysis_explanation": null, "end": 24077, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 24068 }, { "analysis_explanation": null, "end": 24818, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 24809 }, { "analysis_explanation": null, "end": 24818, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 24809 }, { "analysis_explanation": null, "end": 24818, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 24809 }, { "analysis_explanation": null, "end": 25310, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 25301 }, { "analysis_explanation": null, "end": 25310, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 25301 }, { "analysis_explanation": null, "end": 25310, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 25301 }, { "analysis_explanation": null, "end": 25556, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 25547 }, { "analysis_explanation": null, "end": 25556, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 25547 }, { "analysis_explanation": null, "end": 25556, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 25547 }, { "analysis_explanation": null, "end": 26294, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 26285 }, { "analysis_explanation": null, "end": 26294, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 26285 }, { "analysis_explanation": null, "end": 26294, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 26285 }, { "analysis_explanation": null, "end": 26772, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 26763 }, { "analysis_explanation": null, "end": 26772, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 26763 }, { "analysis_explanation": null, "end": 26772, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 26763 }, { "analysis_explanation": null, "end": 27760, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 27751 }, { "analysis_explanation": null, "end": 27760, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 27751 }, { "analysis_explanation": null, "end": 27760, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 27751 }, { "analysis_explanation": null, "end": 28498, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 28489 }, { "analysis_explanation": null, "end": 28498, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 28489 }, { "analysis_explanation": null, "end": 28498, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 28489 }, { "analysis_explanation": null, "end": 28745, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 28736 }, { "analysis_explanation": null, "end": 28745, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 28736 }, { "analysis_explanation": null, "end": 28745, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 28736 }, { "analysis_explanation": null, "end": 28992, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 28983 }, { "analysis_explanation": null, "end": 28992, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 28983 }, { "analysis_explanation": null, "end": 28992, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 28983 }, { "analysis_explanation": null, "end": 29486, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 29477 }, { "analysis_explanation": null, "end": 29486, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 29477 }, { "analysis_explanation": null, "end": 29486, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 29477 }, { "analysis_explanation": null, "end": 29733, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 29724 }, { "analysis_explanation": null, "end": 29733, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 29724 }, { "analysis_explanation": null, "end": 29733, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 29724 }, { "analysis_explanation": null, "end": 29981, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 29972 }, { "analysis_explanation": null, "end": 29981, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 29972 }, { "analysis_explanation": null, "end": 29981, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 29972 }, { "analysis_explanation": null, "end": 30229, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 30220 }, { "analysis_explanation": null, "end": 30229, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 30220 }, { "analysis_explanation": null, "end": 30229, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 30220 }, { "analysis_explanation": null, "end": 30476, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 30467 }, { "analysis_explanation": null, "end": 30476, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 30467 }, { "analysis_explanation": null, "end": 30476, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 30467 }, { "analysis_explanation": null, "end": 30725, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 30716 }, { "analysis_explanation": null, "end": 30725, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 30716 }, { "analysis_explanation": null, "end": 30725, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 30716 }, { "analysis_explanation": null, "end": 30972, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 30963 }, { "analysis_explanation": null, "end": 30972, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 30963 }, { "analysis_explanation": null, "end": 30972, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 30963 }, { "analysis_explanation": null, "end": 31220, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 31211 }, { "analysis_explanation": null, "end": 31220, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 31211 }, { "analysis_explanation": null, "end": 31220, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 31211 }, { "analysis_explanation": null, "end": 31467, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 31458 }, { "analysis_explanation": null, "end": 31467, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 31458 }, { "analysis_explanation": null, "end": 31467, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 31458 }, { "analysis_explanation": null, "end": 295, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 288 }, { "analysis_explanation": null, "end": 454, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 447 }, { "analysis_explanation": null, "end": 746, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 739 }, { "analysis_explanation": null, "end": 770, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 763 }, { "analysis_explanation": null, "end": 893, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 886 }, { "analysis_explanation": null, "end": 1250, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1243 }, { "analysis_explanation": null, "end": 1491, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1484 }, { "analysis_explanation": null, "end": 1660, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1653 }, { "analysis_explanation": null, "end": 1808, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1801 }, { "analysis_explanation": null, "end": 2000, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1993 }, { "analysis_explanation": null, "end": 2140, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2133 }, { "analysis_explanation": null, "end": 2165, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2158 }, { "analysis_explanation": null, "end": 2216, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2209 }, { "analysis_explanation": null, "end": 2467, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2460 }, { "analysis_explanation": null, "end": 2601, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2594 }, { "analysis_explanation": null, "end": 2776, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2769 }, { "analysis_explanation": null, "end": 2895, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2888 }, { "analysis_explanation": null, "end": 3038, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3031 }, { "analysis_explanation": null, "end": 3065, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3058 }, { "analysis_explanation": null, "end": 3254, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3247 }, { "analysis_explanation": null, "end": 3279, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3272 }, { "analysis_explanation": null, "end": 3385, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3378 }, { "analysis_explanation": null, "end": 3585, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3578 }, { "analysis_explanation": null, "end": 3816, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3809 }, { "analysis_explanation": null, "end": 3842, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3835 }, { "analysis_explanation": null, "end": 3969, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3962 }, { "analysis_explanation": null, "end": 3995, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3988 }, { "analysis_explanation": null, "end": 4022, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4015 }, { "analysis_explanation": null, "end": 4272, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4265 }, { "analysis_explanation": null, "end": 4299, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4292 }, { "analysis_explanation": null, "end": 4343, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4336 }, { "analysis_explanation": null, "end": 6250, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6243 }, { "analysis_explanation": null, "end": 6520, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6513 }, { "analysis_explanation": null, "end": 6817, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6810 }, { "analysis_explanation": null, "end": 6837, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6830 }, { "analysis_explanation": null, "end": 7628, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7621 }, { "analysis_explanation": null, "end": 7933, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7926 }, { "analysis_explanation": null, "end": 7959, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 7952 }, { "analysis_explanation": null, "end": 8334, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8327 }, { "analysis_explanation": null, "end": 8381, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8374 }, { "analysis_explanation": null, "end": 8435, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8428 }, { "analysis_explanation": null, "end": 8591, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 8584 }, { "analysis_explanation": null, "end": 9644, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9637 }, { "analysis_explanation": null, "end": 9664, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9657 }, { "analysis_explanation": null, "end": 9990, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 9983 }, { "analysis_explanation": null, "end": 10247, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10240 }, { "analysis_explanation": null, "end": 10294, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10287 }, { "analysis_explanation": null, "end": 10576, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10569 }, { "analysis_explanation": null, "end": 10879, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 10872 }, { "analysis_explanation": null, "end": 11348, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 11341 }, { "analysis_explanation": null, "end": 11372, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 11365 }, { "analysis_explanation": null, "end": 11547, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 11540 }, { "analysis_explanation": null, "end": 11601, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 11594 }, { "analysis_explanation": null, "end": 11625, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 11618 }, { "analysis_explanation": null, "end": 12416, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 12409 }, { "analysis_explanation": null, "end": 13202, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13195 }, { "analysis_explanation": null, "end": 13222, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13215 }, { "analysis_explanation": null, "end": 13258, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13251 }, { "analysis_explanation": null, "end": 13470, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13463 }, { "analysis_explanation": null, "end": 13490, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13483 }, { "analysis_explanation": null, "end": 14264, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 14255 }, { "analysis_explanation": null, "end": 14264, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 14255 }, { "analysis_explanation": null, "end": 14264, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 14255 }, { "analysis_explanation": null, "end": 15746, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 15737 }, { "analysis_explanation": null, "end": 15746, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 15737 }, { "analysis_explanation": null, "end": 15992, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 15983 }, { "analysis_explanation": null, "end": 15992, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 15983 }, { "analysis_explanation": null, "end": 15992, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 15983 }, { "analysis_explanation": null, "end": 16239, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 16230 }, { "analysis_explanation": null, "end": 16239, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 16230 }, { "analysis_explanation": null, "end": 16239, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16230 }, { "analysis_explanation": null, "end": 16961, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 16952 }, { "analysis_explanation": null, "end": 16961, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 16952 }, { "analysis_explanation": null, "end": 16961, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16952 }, { "analysis_explanation": null, "end": 17702, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 17693 }, { "analysis_explanation": null, "end": 17702, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 17693 }, { "analysis_explanation": null, "end": 17702, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17693 }, { "analysis_explanation": null, "end": 17949, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 17940 }, { "analysis_explanation": null, "end": 17949, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 17940 }, { "analysis_explanation": null, "end": 17949, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17940 }, { "analysis_explanation": null, "end": 18196, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 18187 }, { "analysis_explanation": null, "end": 18196, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 18187 }, { "analysis_explanation": null, "end": 18443, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 18434 }, { "analysis_explanation": null, "end": 18443, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 18434 }, { "analysis_explanation": null, "end": 18443, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 18434 }, { "analysis_explanation": null, "end": 19661, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 19652 }, { "analysis_explanation": null, "end": 19661, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 19652 }, { "analysis_explanation": null, "end": 20155, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 20146 }, { "analysis_explanation": null, "end": 20155, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 20146 }, { "analysis_explanation": null, "end": 20155, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 20146 }, { "analysis_explanation": null, "end": 20633, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 20624 }, { "analysis_explanation": null, "end": 20633, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 20624 }, { "analysis_explanation": null, "end": 20633, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 20624 }, { "analysis_explanation": null, "end": 23585, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 23576 }, { "analysis_explanation": null, "end": 23585, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 23576 }, { "analysis_explanation": null, "end": 24077, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 24068 }, { "analysis_explanation": null, "end": 24077, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 24068 }, { "analysis_explanation": null, "end": 24818, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 24809 }, { "analysis_explanation": null, "end": 24818, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 24809 }, { "analysis_explanation": null, "end": 24818, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 24809 }, { "analysis_explanation": null, "end": 25310, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 25301 }, { "analysis_explanation": null, "end": 25310, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 25301 }, { "analysis_explanation": null, "end": 25310, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 25301 }, { "analysis_explanation": null, "end": 25556, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 25547 }, { "analysis_explanation": null, "end": 25556, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 25547 }, { "analysis_explanation": null, "end": 26294, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 26285 }, { "analysis_explanation": null, "end": 26294, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 26285 }, { "analysis_explanation": null, "end": 26294, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 26285 }, { "analysis_explanation": null, "end": 26772, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 26763 }, { "analysis_explanation": null, "end": 26772, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 26763 }, { "analysis_explanation": null, "end": 26772, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 26763 }, { "analysis_explanation": null, "end": 27760, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 27751 }, { "analysis_explanation": null, "end": 27760, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 27751 }, { "analysis_explanation": null, "end": 27760, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 27751 }, { "analysis_explanation": null, "end": 28498, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 28489 }, { "analysis_explanation": null, "end": 28498, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 28489 }, { "analysis_explanation": null, "end": 28498, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 28489 }, { "analysis_explanation": null, "end": 28745, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 28736 }, { "analysis_explanation": null, "end": 28745, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 28736 }, { "analysis_explanation": null, "end": 28745, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 28736 }, { "analysis_explanation": null, "end": 28992, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 28983 }, { "analysis_explanation": null, "end": 28992, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 28983 }, { "analysis_explanation": null, "end": 28992, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 28983 }, { "analysis_explanation": null, "end": 29486, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 29477 }, { "analysis_explanation": null, "end": 29486, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 29477 }, { "analysis_explanation": null, "end": 29486, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 29477 }, { "analysis_explanation": null, "end": 29733, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 29724 }, { "analysis_explanation": null, "end": 29733, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 29724 }, { "analysis_explanation": null, "end": 29733, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 29724 }, { "analysis_explanation": null, "end": 29981, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 29972 }, { "analysis_explanation": null, "end": 29981, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 29972 }, { "analysis_explanation": null, "end": 29981, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 29972 }, { "analysis_explanation": null, "end": 30229, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 30220 }, { "analysis_explanation": null, "end": 30229, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 30220 }, { "analysis_explanation": null, "end": 30476, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 30467 }, { "analysis_explanation": null, "end": 30476, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 30467 }, { "analysis_explanation": null, "end": 30476, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 30467 }, { "analysis_explanation": null, "end": 30725, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 30716 }, { "analysis_explanation": null, "end": 30725, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 30716 }, { "analysis_explanation": null, "end": 30725, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 30716 }, { "analysis_explanation": null, "end": 30972, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 30963 }, { "analysis_explanation": null, "end": 30972, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 30963 }, { "analysis_explanation": null, "end": 30972, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 30963 }, { "analysis_explanation": null, "end": 31220, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 31211 }, { "analysis_explanation": null, "end": 31220, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 31211 }, { "analysis_explanation": null, "end": 31220, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 31211 }, { "analysis_explanation": null, "end": 31467, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 31458 }, { "analysis_explanation": null, "end": 31467, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 31458 }, { "analysis_explanation": null, "end": 31467, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 31458 }, { "analysis_explanation": null, "end": 31878, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 31871 }, { "analysis_explanation": null, "end": 33129, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33122 }, { "analysis_explanation": null, "end": 33723, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 33716 }, { "analysis_explanation": null, "end": 34508, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 34501 }, { "analysis_explanation": null, "end": 35030, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35023 }, { "analysis_explanation": null, "end": 35050, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35043 }, { "analysis_explanation": null, "end": 35401, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35394 }, { "analysis_explanation": null, "end": 35976, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35969 }, { "analysis_explanation": null, "end": 35996, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 35989 }, { "analysis_explanation": null, "end": 36355, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 36348 }, { "analysis_explanation": null, "end": 36686, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 36679 }, { "analysis_explanation": null, "end": 36712, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 36705 }, { "analysis_explanation": null, "end": 36809, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 36802 }, { "analysis_explanation": null, "end": 37187, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 37180 }, { "analysis_explanation": null, "end": 37317, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 37310 }, { "analysis_explanation": null, "end": 38348, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 38341 }, { "analysis_explanation": null, "end": 38368, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 38361 }, { "analysis_explanation": null, "end": 38688, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 38681 }, { "analysis_explanation": null, "end": 39062, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 39055 }, { "analysis_explanation": null, "end": 39947, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 39940 }, { "analysis_explanation": null, "end": 39967, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 39960 }, { "analysis_explanation": null, "end": 40325, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 40318 }, { "analysis_explanation": null, "end": 41073, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 41066 }, { "analysis_explanation": null, "end": 41095, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 41088 }, { "analysis_explanation": null, "end": 41165, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 41158 }, { "analysis_explanation": null, "end": 41324, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 41317 }, { "analysis_explanation": null, "end": 42631, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 42624 }, { "analysis_explanation": null, "end": 42657, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 42650 }, { "analysis_explanation": null, "end": 43566, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 43559 }, { "analysis_explanation": null, "end": 43588, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 43581 }, { "analysis_explanation": null, "end": 44290, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 44283 }, { "analysis_explanation": null, "end": 44318, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 44311 }, { "analysis_explanation": null, "end": 44675, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 44668 }, { "analysis_explanation": null, "end": 44800, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 44793 }, { "analysis_explanation": null, "end": 44890, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 44883 }, { "analysis_explanation": null, "end": 44992, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 44985 }, { "analysis_explanation": null, "end": 45047, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 45040 }, { "analysis_explanation": null, "end": 45211, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 45204 }, { "analysis_explanation": null, "end": 45236, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 45229 }, { "analysis_explanation": null, "end": 45397, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 45390 }, { "analysis_explanation": null, "end": 45930, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 45923 }, { "analysis_explanation": null, "end": 45956, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 45949 }, { "analysis_explanation": null, "end": 46024, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 46017 }, { "analysis_explanation": null, "end": 46073, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 46066 }, { "analysis_explanation": null, "end": 46318, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 46311 }, { "analysis_explanation": null, "end": 46659, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 46652 }, { "analysis_explanation": null, "end": 46788, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 46781 }, { "analysis_explanation": null, "end": 46817, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 46810 }, { "analysis_explanation": null, "end": 46996, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 46989 }, { "analysis_explanation": null, "end": 48464, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 48457 }, { "analysis_explanation": null, "end": 49509, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 49502 }, { "analysis_explanation": null, "end": 49742, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 49735 }, { "analysis_explanation": null, "end": 49769, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 49762 }, { "analysis_explanation": null, "end": 50581, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 50574 }, { "analysis_explanation": null, "end": 50737, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 50730 }, { "analysis_explanation": null, "end": 50916, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 50909 }, { "analysis_explanation": null, "end": 53532, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 53525 }, { "analysis_explanation": null, "end": 53617, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 53610 }, { "analysis_explanation": null, "end": 54565, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 54558 }, { "analysis_explanation": null, "end": 55714, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 55707 }, { "analysis_explanation": null, "end": 56619, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 56612 }, { "analysis_explanation": null, "end": 59426, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 59419 }, { "analysis_explanation": null, "end": 63421, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 63414 }, { "analysis_explanation": null, "end": 64872, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 64865 }, { "analysis_explanation": null, "end": 65054, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 65047 }, { "analysis_explanation": null, "end": 65543, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 65536 }, { "analysis_explanation": null, "end": 65810, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 65803 }, { "analysis_explanation": null, "end": 65830, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 65823 } ]
[ "// Copyright 2014 The Go Authors. ", "All rights reserved.", "\n// Use of this source code is governed by a BSD-style\n// license that can be found in the LICENSE file.", "\n\n// +build go1.4\n\npackage sha3\n\nimport (\n\t\"crypto\"\n)\n\nfunc init() {\n\tcrypto.", "RegisterHash(crypto.", "SHA3_224, New224)\n\tcrypto.", "RegisterHash(crypto.", "SHA3_256, New256)\n\tcrypto.", "RegisterHash(crypto.", "SHA3_384, New384)\n\tcrypto.", "RegisterHash(crypto.", "SHA3_512, New512)\n}\n" ]
{ "pile_set_name": "Github" }
[ 0, 0, 0.019230769230769232, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0.05 ]
0.008974
5
[ { "analysis_explanation": null, "end": 17, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13 } ]
[ "The crew of a U.S. gunship have been awarded bravery medals at a ceremony in Florida after they rained fire down on Islamic State militants for hours, as allied soldiers on the ground were whisked to safety.", "\n\nForces on the ground came under heavy fire from ISIS militants in Nangarhar province, Afghanistan on April 3, 2019, in a ferocious fight which one Major on the ground likened to infamous WW2 battle Iwo Jima.", "\n\nThey called for backup from 'Spooky 41' - a AC-13OU gunship, and the Hercules-variant plane arrived within minutes to provide covering fire and ensure medical helicopters could safely evacuate the injured.", "\n\nThe crew were up in the air for nine hours and managed to suppress enemy fire during the evacuation of 15 wounded soldiers.", "\n\nThe ferocity of Spooky 41's firepower meant the enemy was unable to get a single shot off at the MedEvac helicopters, which were hovering in machine gun range of the dug-in militants for an hour.", "\n\nAt a ceremony on Monday, Spooky 41's Aircraft commander Capt. ", "Neils Aberhalden and navigator Capt. ", "John Crandall Jr. were awarded Distinguished Flying Crosses.", "\n\nThe airmen were with the 4th Special Operations Squadron based at Hurlburt Field, Florida.", "\n\nFourteen Air Commandos with the 4th Special Operations Squadron were presented two Distinguished Flying Crosses and 12 Air Medals by Lt. ", "Gen. Jim Slife, commander of Air Force Special Operations Command, at Hurlburt Field, Florida\n\nTwo Distinguished Flying Crosses and 12 Air Medals lay on a table before a presentation ceremony at Hurlburt Field\n\nAn air-to-air front view of a AC-130 Hercules aircraft in-flight near Hurlburt Field\n\nThe DFC is awarded to any officer or enlisted person of the U.S. Armed Forces who have distinguished themselves in actual combat in support of operations by heroism or extraordinary achievement while participating in an aerial flight.", "\n\nThe remaining 12 airmen were each presented with Single Event Air Medals during the ceremony.", "\n\nAir Medals are awarded to U.S. and civilian personnel for single acts of heroism or meritorious achievements while participating in aerial flight and foreign military personnel in actual combat in support of operations.", "\n\nAll of the medals awarded came with a 'C' device - which was established to distinguish an award earned for exceptionally meritorious service or achievement performed under combat conditions, according to DVIDS.", "\n\nThe AC-130 'Spooky' Gunship The AC-130's is a heavily armed ground-attack variant of the C-130 Hercules transport plane. ", "Its primary missions are close air support and armed reconnaissance. ", "They are often used to support troops in contact with enemy forces, convoy escort and point air defense. ", "The AC-130 is armed with a fearsome array of weaponry, including a 105 mm cannon and 25 or 40 mm gatling guns. ", "It has a combat history dating to Vietnam, where gunships destroyed more than 10,000 trucks and were credited with many life-saving close air support missions. ", "During Operation Desert Storm, AC-130s provided close air support and force protection (air base defense) for ground forces. ", "The AC-130 users a suite of sensors to protect itself, and is armed with a fearsome array of weaponry, including a 105 mm cannon and 25 or 40 mm gatling guns Advertisement\n\nU.S. Air Force Lt. ", "Gen. Jim Slife, commander of Air Force Special Operations Command, presents Distinguished Flying Crosses to Aircraft commander Capt. ", "Neils Aberhalden and navigator Capt. ", "John Crandall Jr., with the 4th Special Operations Squadron\n\nThe air medals were in recognition of actions taken near Nangarhar Province, Afghanistan, on April 3-4, 2019, with the AC-130U 'Spooky' Gunship\n\nThe Hurlburt Field Honor Guard presents the colors at a medal-presentation ceremony\n\n'The most lethal part of any gunship is not the 25 mm, the 40 mm or the 105 mm weapons sticking out of the side of this big beautiful airplane. ", "The most lethal part of the gunship is the crew,' said Air Force Lt. ", "Gen. Jim Slife, commander of Air Force Special Operations Command as he awarded the citations.", "\n\n'There is nothing more complicated than the dance that goes on in a gunship to bring the kind of capability our teammates have described this morning to bear on our nation's adversaries,' said Slife. '", "The orchestration that goes on is unlike anything you will see anyplace else in AFSOC or in the United States Air Force.'", "\n\nThe crew of the aircraft, an AC-13OU, known as a Spooky, is used by the Air Force for close air support and armed reconnaissance reports Stripes.com.", "\n\nOn the night of April 3rd, 2019, the crew of the aircraft were called upon to help assist with the evacuation of ground personnel, some of whom had been injured by an improvised explosive device (IED) on the ground.", "\n\nThe Lockheed AC-130 gunship is a heavily armed, long-endurance, ground-attack variant of the C-130 Hercules transport, fixed-wing aircraft. ", "It carries a wide array of ground attack weapons that are integrated with sophisticated sensors, navigation, and fire-control systems\n\nU.S. Air Force Lt. ", "Gen. Jim Slife, commander of Air Force Special Operations Command, presents a Single Event Air Medals during a ceremony at Hurlburt Field\n\nAmerican and coalition forces had come under fire by fighters from Islamic State during an attack on a mountainside near Nangarhar province.", "\n\n'In my 20-plus years of training and experience in the art of attacking and defending ground objectives, I have seen few more formidable defensive positions – or ones more daunting to attack,' Maj. ", "Jeffrey Wright, 24th Special Operations Wing, who led a seven-man special tactics team in the assault, said in an Air Force statement.", "\n\n'I would have to reach for examples like Normandy, Iwo Jima or Hamburger Hill to appropriately convey the degree to which the enemy were prepared and ready for our assault.'", "\n\nU.S. Air Force Maj. ", "Jeff Wright, Special Tactics officer with the 24th Special Operations Wing, speaks at the ceremony on Monday.", "Maj. ", "Wright was being supported on the ground by Spooky 41 the day of the mission\n\nU.S. Air Force Lt. ", "Gen. Jim Slife, commander of Air Force Special Operations Command, gives his official remarks during the medal-presentation ceremony\n\nThe ISIS fighters managed to stay hidden as the coalition assault force moved in.", "\n\nAnd coalition forces were left exposed as firepower rained down on them from all directions.", "\n\n'By using networks of subterranean passageways, the enemy would reappear behind our forces even after they'd cleared buildings,' Wright explained.", "\n\nAs the numbers of wounded increased, the ground force called for backup from the air.", "\n\n'In short order, I heard the bark of the AC-130U's guns,' Wright said. '", "I distinctly remember wondering whether they were shooting at the right target, given the speed of their reaction – in 10 years as a joint terminal attack controller, I'd never seen any kind of fire support as responsive. ", "Sure enough, the first rounds were right on target – a good thing, because the enemy was so close to the assault force.'", "\n\nThree helicopters then arrived on scene to assist with getting the wounded soldiers to safety.", "\n\nThe copters were unable to land so the injured were winched into the air.", "\n\n'This entailed coming to a hover within machine gun range of dozens, if not hundreds, of enemy fighters keen to press home their advantage,' Wright explained, 'yet the enemy did not get off a single shot as the patients were evacuated.'", "\n\n'The reason there will be no memorials for three separate medical evacuation aircrews is because Spooky 41's fires were so responsive and so precise that the enemy was effectively neutralized.'", "\n\nThe crew of the AC-130U \"Spooky\" Gunship, flew for nine hours. ", "The crew's exemplary performance and battlefield coordination enabled the recovery of 15 patients following a mass-casualty event\n\nDuring the ceremony on Monday, U.S. Army Capt. ", "Benjamin Carnell, a Special Operations Force team member and one of the casualties who was evacuated thanked the crew of the Spooky for 'rising to the occasion.'", "\n\n'From the regiment, from the assault force, and more specifically from my wife and my son and my daughter -- I want to thank you for your professionalism and for rising to the occasion' said Carnell.", "\n\n'Without any of that I would not have been hoisted out of there and I wouldn't be standing here in front of you today, so I am indebted to you in a way that I can't describe.'", "\n\nAnother member of the ground force, U.S. Army Maj. ", "Jared Tomberlin, of the Special Operations Forces also spoke: 'I have been nothing short of humbled by your commitment to your profession and your commitment to each other and though most will never hear your stories of service and sacrifice, I will always know what you did for my men and I will never forget it.'", "\n\n'When every second mattered and lives were on the line, everybody was on top of their game in that aircraft -- 100 percent and then some.'", "\n\nAirmen awarded the Air Medal were Capt. ", "Micah T. Uvegas, Capt. ", "Brian K. Yee, 1st Lt. ", "Nicholas J. Maiolo, Tech. ", "Sgt. ", "Ryan A. Estes, Tech. ", "Sgt. ", "Jacob B. Griffen, Tech. ", "Sgt. ", "Austin L. Parrent, Staff Sgt. ", "Samuel Mayfield, Staff Sgt. ", "Michael S. Martinez, Staff Sgt. ", "Omar J. Diaz, Staff Sgt. ", "Jonathon M. Friesz, Senior Airman Jacob C. Bateman, Senior Airman Zadok N. Dean III.", "\n\nThe Hercules gunship has a long history with the US Military, and was first used during the Vietnam War.", "\n\nThe AC-130U Spooky Gunship used in this particular mission will soon retire as a new model, the AC-130J 'Ghostrider' Gunship, takes over.", "\n\n'This is probably the last ceremony of this sort we will do for any AC-130U crew before the last aircraft departs Hurlburt Field later this year,' said Slife." ]
{ "pile_set_name": "OpenWebText2" }
[ 0, 0.009569377990430622, 0.004830917874396135, 0, 0.01015228426395939, 0.046875, 0.02702702702702703, 0.016666666666666666, 0.021739130434782608, 0.007194244604316547, 0.015065913370998116, 0.010526315789473684, 0, 0, 0.008130081300813009, 0, 0, 0, 0, 0, 0, 0.022556390977443608, 0.02702702702702703, 0.006896551724137931, 0.014492753623188406, 0.02127659574468085, 0, 0, 0.019867549668874173, 0, 0.014084507042253521, 0.006493506493506494, 0.017921146953405017, 0, 0.014925373134328358, 0.005714285714285714, 0.045454545454545456, 0.01834862385321101, 0, 0.030927835051546393, 0.013953488372093023, 0, 0.006756756756756757, 0, 0.013513513513513514, 0, 0, 0, 0, 0.004201680672268907, 0.005128205128205128, 0, 0.0056179775280898875, 0.018633540372670808, 0.004975124378109453, 0, 0.018867924528301886, 0.006369426751592357, 0, 0, 0.08695652173913043, 0.045454545454545456, 0.038461538461538464, 0, 0.09523809523809523, 0, 0.041666666666666664, 0, 0.03333333333333333, 0.03571428571428571, 0.03125, 0.04, 0.047619047619047616, 0.018867924528301886, 0, 0.00625 ]
0.013981
5
[ { "analysis_explanation": null, "end": 18, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14 }, { "analysis_explanation": null, "end": 84, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77 }, { "analysis_explanation": null, "end": 149, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 144 }, { "analysis_explanation": null, "end": 260, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 256 }, { "analysis_explanation": null, "end": 292, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 274 }, { "analysis_explanation": null, "end": 305, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 294 }, { "analysis_explanation": null, "end": 322, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 309 }, { "analysis_explanation": null, "end": 530, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 523 }, { "analysis_explanation": null, "end": 664, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 654 }, { "analysis_explanation": null, "end": 940, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 933 }, { "analysis_explanation": null, "end": 965, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 959 }, { "analysis_explanation": null, "end": 1020, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1004 }, { "analysis_explanation": null, "end": 1058, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1041 }, { "analysis_explanation": null, "end": 1182, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1168 }, { "analysis_explanation": null, "end": 1191, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1184 }, { "analysis_explanation": null, "end": 1344, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1335 }, { "analysis_explanation": null, "end": 1414, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1400 }, { "analysis_explanation": null, "end": 1423, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1416 }, { "analysis_explanation": null, "end": 1625, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1611 }, { "analysis_explanation": null, "end": 1986, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1982 }, { "analysis_explanation": null, "end": 2835, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2828 }, { "analysis_explanation": null, "end": 3285, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3276 }, { "analysis_explanation": null, "end": 3420, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3404 }, { "analysis_explanation": null, "end": 3458, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3441 }, { "analysis_explanation": null, "end": 3577, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3559 }, { "analysis_explanation": null, "end": 3590, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3579 }, { "analysis_explanation": null, "end": 3610, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3595 }, { "analysis_explanation": null, "end": 3959, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3950 }, { "analysis_explanation": null, "end": 4189, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4177 }, { "analysis_explanation": null, "end": 4361, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4334 }, { "analysis_explanation": null, "end": 4545, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4517 }, { "analysis_explanation": null, "end": 5038, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5029 }, { "analysis_explanation": null, "end": 5171, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5147 }, { "analysis_explanation": null, "end": 5324, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5311 }, { "analysis_explanation": null, "end": 5516, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5502 }, { "analysis_explanation": null, "end": 5714, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5700 }, { "analysis_explanation": null, "end": 5842, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5831 }, { "analysis_explanation": null, "end": 5939, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5933 }, { "analysis_explanation": null, "end": 5952, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5946 }, { "analysis_explanation": null, "end": 6007, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6000 }, { "analysis_explanation": null, "end": 6057, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6048 }, { "analysis_explanation": null, "end": 6487, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6481 }, { "analysis_explanation": null, "end": 6649, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6643 }, { "analysis_explanation": null, "end": 6785, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6777 }, { "analysis_explanation": null, "end": 7317, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7311 }, { "analysis_explanation": null, "end": 7662, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7652 }, { "analysis_explanation": null, "end": 7824, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7818 }, { "analysis_explanation": null, "end": 7858, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7842 }, { "analysis_explanation": null, "end": 8202, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8195 }, { "analysis_explanation": null, "end": 8321, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8316 }, { "analysis_explanation": null, "end": 8446, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8431 }, { "analysis_explanation": null, "end": 8940, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8925 }, { "analysis_explanation": null, "end": 8960, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8948 }, { "analysis_explanation": null, "end": 8988, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8970 }, { "analysis_explanation": null, "end": 9014, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9001 }, { "analysis_explanation": null, "end": 9043, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9027 }, { "analysis_explanation": null, "end": 9073, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9056 }, { "analysis_explanation": null, "end": 9084, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9081 }, { "analysis_explanation": null, "end": 9101, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9086 }, { "analysis_explanation": null, "end": 9112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9109 }, { "analysis_explanation": null, "end": 9133, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9114 }, { "analysis_explanation": null, "end": 9144, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9141 }, { "analysis_explanation": null, "end": 9158, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9146 }, { "analysis_explanation": null, "end": 9169, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9166 }, { "analysis_explanation": null, "end": 9189, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9171 }, { "analysis_explanation": null, "end": 9221, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9205 }, { "analysis_explanation": null, "end": 9254, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9237 }, { "analysis_explanation": null, "end": 9464, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9457 }, { "analysis_explanation": null, "end": 9643, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9628 }, { "analysis_explanation": null, "end": 4512, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4501 } ]
[ "Becky Lynch is arguably the biggest female star on WWE’s SmackDown Live roster at the moment. “", "The Irish Lass Kicker” defeated Charlotte Flair at Hell In A Cell to capture the SmackDown Live Women’s Title. ", "She and “The Queen’s” feud has been the hottest thing on WWE TV as of late. ", "Their rivalry is set to commence in a Last Woman Standing match at Evolution this weekend.", "\n\nLynch has been brilliant on WWE programming recently, both on the mic and inside the ring. ", "Speaking to TV Insider, Lynch actually revealed she was offered some advice by WWE Hall Of Famer Shawn Michaels, while the pair were on set together for “The Marine 6: Close Quarters,” which may have influenced her current hot streak. ", "Here’s what she had to say:\n\n“Things weren’t going as well as they are now before I left to shoot. ", "I remember him giving me advice saying, ‘When you go back, go in as a different person. ", "Hold your head a little bit higher. ", "Have that attitude that you’re a top star. ", "Go with it. ", "I think this is what I’ve been trying to do since I came back.”", "\n\nShawn Michaels isn’t the only Hall Of Famer that has been advising Lynch. ", "She also revealed that Stone Cold Steve Austin and Mick Foley also help her out as well. ", "Austin gives Lynch some matches to watch and study, while Foley has been a huge supporter of her professional wrestling career:\n\n“Steve has been very supportive and generous with his time. ", "He talks to me and gives me matches to watch. ", "That has been wonderful.", "\n\n“Then I was with Mick Foley recently and talking to him. ", "He is one of the reasons I’m here today. ", "He was someone who helped bring me back into wrestling. ", "I’ve been very lucky for the support I’ve gotten from people who have been here before and done wonderful things in the business.”", "\n\n\n\n\n\n\n\n\n\n\n\n" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.031578947368421054, 0.02702702702702703, 0.013157894736842105, 0, 0.021505376344086023, 0.01276595744680851, 0, 0, 0, 0, 0, 0, 0.013157894736842105, 0.02247191011235955, 0.021164021164021163, 0, 0, 0.01694915254237288, 0, 0, 0, 0 ]
0.008172
5
[ { "analysis_explanation": null, "end": 11, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 105, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100 }, { "analysis_explanation": null, "end": 143, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 128 }, { "analysis_explanation": null, "end": 372, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 360 }, { "analysis_explanation": null, "end": 1056, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1042 }, { "analysis_explanation": null, "end": 1162, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1150 }, { "analysis_explanation": null, "end": 1177, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1167 }, { "analysis_explanation": null, "end": 1211, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1205 }, { "analysis_explanation": null, "end": 1223, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1218 }, { "analysis_explanation": null, "end": 1268, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1263 }, { "analysis_explanation": null, "end": 1340, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1335 }, { "analysis_explanation": null, "end": 1492, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1482 }, { "analysis_explanation": null, "end": 1561, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1556 } ]
[ "Q:\n\naxios The \"url\" argument must be of type string. ", "Received type undefined error\n\nIm working on an electron app that is trying to download a photo from the unsplash API and set it as a wallpaper. ", "When I call the API I get 200 OK status and get the download URL, but when I try to download the photo with the axios stream method I get the following error: \n\nUnhandledPromiseRejectionWarning: TypeError [ERR_INVALID_ARG_TYPE]:\n The \"url\" argument must be of type string. ", "Received type undefined\n\nthis is the function code:\nipcMain.on(\"getRandomWallpaper\", async event => {\n const randomApi = `${apiGateway}/?client_id=${unsplashKey}`;\n const request = await axios({\n method: \"get\",\n url: randomApi\n });\n if (request.status === 200) {\n const downloadUrl = request.data.links.download;\n const imagePath = \"./images\";\n const download_image = async (downloadUrl, imagePath) => {\n await axios({\n downloadUrl,\n responseType: \"stream\"\n }).then(\n response =>\n new Promise((resolve, reject) => {\n response.data\n .pipe(fs.createWriteStream(imagePath))\n .on(\"finish\", () => resolve())\n .on(\"error\", e => reject(e));\n })\n );\n };\n download_image(downloadUrl, imagePath);\n } else {\n const status = request.status;\n console.error(`${status}: \\n Something went wrong...`);\n }\n});\n\nWhen I tried to console.log the downloadUrl parameter inside the function it printed a value. ", "Also I did\n console.log(typeoff(downloadUrl))\n\nand it printed string.", "\nI hope you can help me, \nthanks in advance.", "\n\nA:\n\nYou are using destructuring: \nawait axios({\n downloadUrl,\n responseType: \"stream\"\n})\n\nThis means, You are using downloadUrl as key, instead of url:\nawait axios({\n downloadUrl: downloadUrl,\n responseType: \"stream\"\n})\n\nYou need to change it to url:\nawait axios({\n url: downloadUrl,\n responseType: \"stream\"\n})\n\nA proper example of axios from the doc:\naxios({\n method: 'post',\n url: '/user/12345',\n data: {\n firstName: 'Fred',\n lastName: 'Flintstone'\n }\n});\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0.006896551724137931, 0, 0, 0, 0, 0 ]
0.000985
5
[ { "analysis_explanation": null, "end": 729, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 719 }, { "analysis_explanation": null, "end": 790, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 769 }, { "analysis_explanation": null, "end": 877, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 866 }, { "analysis_explanation": null, "end": 1376, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1364 }, { "analysis_explanation": null, "end": 1744, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1733 }, { "analysis_explanation": null, "end": 1798, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1787 }, { "analysis_explanation": null, "end": 1811, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1800 }, { "analysis_explanation": null, "end": 1908, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1897 }, { "analysis_explanation": null, "end": 2059, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2055 }, { "analysis_explanation": null, "end": 1098, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1093 }, { "analysis_explanation": null, "end": 1328, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1318 }, { "analysis_explanation": null, "end": 1348, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1338 } ]
[ "Hello friend, If you want to see that how to look like Indian actress in real life, so i post here some well-known beautiful actress pics..." ]
{ "pile_set_name": "OpenWebText2" }
[ 0 ]
0
5
[ { "analysis_explanation": null, "end": 61, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55 } ]
[ "Your Vote: Move: WSAD or Arrow Keys\n\nSpecial Attack: Space\n\nPause: P Fight your way through 30 action packed levels, across 7 distinct areas.", "\n\n\n\nBattle deadly bosses, dash through minefields and dodge giant lasers.", "\n\n\n\nA rogue scientist, Dr Crenson, has harnessed a new type of energy, Xenos, to create a mechanical city and a huge army of robots to terrorise the earth.", "\n\n\n\nYou have been selected to pilot Asterus, a battle-suit powered by Xenos energy, and humanity's last hope.", "\n\n\n\nUNLOCKABLES\n\n\n\n- Upon completing the game, Survival mode and Mission X are unlocked.", "\n\n\n\n- Endure against endless waves in Survival mode.", "\n\n\n\n- Face the ultimate challenge in Mission X." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.0070921985815602835, 0.0136986301369863, 0.012903225806451613, 0.01834862385321101, 0, 0, 0 ]
0.007435
5
[ { "analysis_explanation": null, "end": 241, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 234 }, { "analysis_explanation": null, "end": 284, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 279 }, { "analysis_explanation": null, "end": 435, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 430 } ]
[ "Andrew Anglin\n\nDaily Stormer\n\nDecember 14, 2013\n\nHere at the Daily Stormer, we try and keep constant tabs on the endless flow of brutal non-White criminality. ", "Though it would literally be impossible to report all of it, the Race War section of the site should serve to demonstrate to all the nature of the situation we are dealing with in White nations.", "\n\nSometimes, however, I worry that we are being desensitized to it.", "\n\nA story like this surely serves to resensitize us.", "\n\nFrom the Pittsburgh Post-Gazette:\n\nA teenager was arraigned Friday night on charges that he allegedly raped and beat a retired nun in the parking lot of St. Titus Church in Aliquippa Friday morning, according to court documents and Aliquippa police. ", "Andrew Bullock, 18, of Aliquippa has been charged with felony rape, aggravated assault and sexual assault, and misdemeanor charges of indecent exposure, simple assault and reckless endangerment, according to court documents. ", "Mr. Bullock remains in the Beaver County Prison on $50,000 bond. ", "The Pittsburgh Post-Gazette does not identify the victims of alleged sexual assaults. ", "Aliquippa’s assistant police Chief Dan Couch told KDKA-TV that the nun, 70, was walking in a parking lot behind the church on Franklin Avenue around 11:30 this morning when she was approached by a man who choked her, punched her, then threw her to the ground and raped her. ", "The nun is recovering from a broken jaw at Allegheny General Hospital, according to KDKA. ", "Investigators said Mr. Bullock’s boots matched a footprint in the snow from the scene.", "\n\nCan you imagine it? ", "Raping a nun in the parking lot of a church.", "\n\nThese people are monsters, and they must be expelled from our nation. ", "We do not deserve this." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.006289308176100629, 0, 0, 0, 0.011904761904761904, 0.0044444444444444444, 0.015384615384615385, 0.011627906976744186, 0.0072992700729927005, 0.022222222222222223, 0.011627906976744186, 0, 0, 0, 0 ]
0.006053
5
[ { "analysis_explanation": null, "end": 15, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 47, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30 }, { "analysis_explanation": null, "end": 537, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 531 }, { "analysis_explanation": null, "end": 543, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 538 }, { "analysis_explanation": null, "end": 653, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 644 }, { "analysis_explanation": null, "end": 660, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 654 }, { "analysis_explanation": null, "end": 668, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 661 }, { "analysis_explanation": null, "end": 712, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 703 }, { "analysis_explanation": null, "end": 735, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 721 }, { "analysis_explanation": null, "end": 739, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 737 }, { "analysis_explanation": null, "end": 753, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 744 }, { "analysis_explanation": null, "end": 957, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 950 }, { "analysis_explanation": null, "end": 1106, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1097 }, { "analysis_explanation": null, "end": 1141, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1132 }, { "analysis_explanation": null, "end": 1171, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1169 }, { "analysis_explanation": null, "end": 1264, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1239 }, { "analysis_explanation": null, "end": 1491, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1484 } ]
[ "Miami Open (golf)\n\nThe Miami Open was a golf tournament on the PGA Tour from 1924 to 1955. ", "It was played at what is now the Miami Springs Golf & Country Club in Miami, Florida. ", "The event was played in December from 1924 to 1926 and from 1937 to 1955. ", "It was played in early January from 1928 to 1937.", "\n\nWinners\n1955 Sam Snead\n1954 Bob Rosburg\n1953 Doug Ford\n1952 Jack Burke, Jr.\n1951 Sam Snead\n1950 Sam Snead\n1949 Fred Haas\n1948 Frank Stranahan (amateur)\n1947 Jimmy Demaret\n1946 Sam Snead\n1945 Henry Picard\n1944 Dutch Harrison\n1943 Steve Warga\n1942 Harold \"Jug\" McSpaden (unofficial win)\n1941 Byron Nelson\n1940 Byron Nelson\n1939 Sam Snead\n1938 Harold \"Jug\" McSpaden\n1937 (Dec.) Sam Snead\n1937 (Jan.) Ray Mangrum\n1936 Willie Klein\n1935 Tommy Armour\n1934 Ralph Stonehouse\n1933 Johnny Revolta\n1932 Tommy Armour\n1931 Joe Turnesa\n1930 Gene Sarazen\n1929 Gene Sarazen\n1928 Gene Sarazen\n1927 No tournament - switched from December to January\n1926 Gene Sarazen\n1925 Willie Klein\n1924 Abe Mitchell\n\nExternal links\nMiami Spring Golf and Country Club\nMiami Springs Golf Course history - Miami Open history on pages 6–9\n\nCategory:Former PGA Tour events\nCategory:Golf in Florida\nCategory:Sports competitions in Miami" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.01098901098901099, 0.011627906976744186, 0, 0, 0.03218645948945616 ]
0.010961
5
[ { "analysis_explanation": null, "end": 5, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 89, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77 }, { "analysis_explanation": null, "end": 166, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 161 }, { "analysis_explanation": null, "end": 175, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 168 }, { "analysis_explanation": null, "end": 209, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 201 }, { "analysis_explanation": null, "end": 249, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 232 }, { "analysis_explanation": null, "end": 299, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 268 }, { "analysis_explanation": null, "end": 313, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 309 }, { "analysis_explanation": null, "end": 323, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 314 }, { "analysis_explanation": null, "end": 328, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 324 }, { "analysis_explanation": null, "end": 340, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 329 }, { "analysis_explanation": null, "end": 345, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 341 }, { "analysis_explanation": null, "end": 355, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 346 }, { "analysis_explanation": null, "end": 360, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 356 }, { "analysis_explanation": null, "end": 371, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 361 }, { "analysis_explanation": null, "end": 376, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 373 }, { "analysis_explanation": null, "end": 381, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 377 }, { "analysis_explanation": null, "end": 391, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 382 }, { "analysis_explanation": null, "end": 396, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 392 }, { "analysis_explanation": null, "end": 406, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 397 }, { "analysis_explanation": null, "end": 411, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 407 }, { "analysis_explanation": null, "end": 421, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 412 }, { "analysis_explanation": null, "end": 426, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 422 }, { "analysis_explanation": null, "end": 442, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 427 }, { "analysis_explanation": null, "end": 457, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 453 }, { "analysis_explanation": null, "end": 471, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 458 }, { "analysis_explanation": null, "end": 476, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 472 }, { "analysis_explanation": null, "end": 486, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 477 }, { "analysis_explanation": null, "end": 491, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 487 }, { "analysis_explanation": null, "end": 504, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 492 }, { "analysis_explanation": null, "end": 509, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 505 }, { "analysis_explanation": null, "end": 524, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 510 }, { "analysis_explanation": null, "end": 529, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 525 }, { "analysis_explanation": null, "end": 541, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 530 }, { "analysis_explanation": null, "end": 546, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 542 }, { "analysis_explanation": null, "end": 590, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 586 }, { "analysis_explanation": null, "end": 603, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 591 }, { "analysis_explanation": null, "end": 608, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 604 }, { "analysis_explanation": null, "end": 621, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 609 }, { "analysis_explanation": null, "end": 626, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 622 }, { "analysis_explanation": null, "end": 636, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 627 }, { "analysis_explanation": null, "end": 641, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 637 }, { "analysis_explanation": null, "end": 674, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 670 }, { "analysis_explanation": null, "end": 685, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 676 }, { "analysis_explanation": null, "end": 690, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 686 }, { "analysis_explanation": null, "end": 696, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 692 }, { "analysis_explanation": null, "end": 709, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 698 }, { "analysis_explanation": null, "end": 714, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 710 }, { "analysis_explanation": null, "end": 727, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 715 }, { "analysis_explanation": null, "end": 732, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 728 }, { "analysis_explanation": null, "end": 745, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 733 }, { "analysis_explanation": null, "end": 750, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 746 }, { "analysis_explanation": null, "end": 767, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 751 }, { "analysis_explanation": null, "end": 772, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 768 }, { "analysis_explanation": null, "end": 792, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 788 }, { "analysis_explanation": null, "end": 805, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 793 }, { "analysis_explanation": null, "end": 810, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 806 }, { "analysis_explanation": null, "end": 822, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 811 }, { "analysis_explanation": null, "end": 827, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 823 }, { "analysis_explanation": null, "end": 845, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 828 }, { "analysis_explanation": null, "end": 863, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 846 }, { "analysis_explanation": null, "end": 881, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 864 }, { "analysis_explanation": null, "end": 936, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 912 }, { "analysis_explanation": null, "end": 950, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 937 }, { "analysis_explanation": null, "end": 954, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 950 }, { "analysis_explanation": null, "end": 967, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 955 }, { "analysis_explanation": null, "end": 972, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 968 }, { "analysis_explanation": null, "end": 995, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 973 }, { "analysis_explanation": null, "end": 1019, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1002 }, { "analysis_explanation": null, "end": 1162, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1155 }, { "analysis_explanation": null, "end": 1200, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1195 } ]
[ "The Trump administration issued a proposal Monday that would allow it to collect DNA from migrants detained by immigration authorities and keep that data in a massive FBI criminal justice database.", "\n\nThe Department of Justice released the draft of a proposed rule on Monday that allows the government to broadly expand DNA collection from asylum-seekers and other migrants in U.S. detention.", "\n\nThe administration wrote that the rule would allow the U.S. attorney general to “direct all relevant Federal agencies, including the Department of Homeland Security, to collect DNA samples from individuals who are arrested, facing charges, or convicted, and from non-United States persons who are detained under the authority of the United States.”", "\n\nThe biometric data would then be transferred to the FBI’s criminal justice DNA database, the Combined DNA Index System, known as CODIS, according to the rule.", "\n\nThe Justice Department wrote there would be exceptions in the proposed rule for immigrants legally entering the U.S. or being processed for lawful admission into the U.S.\n\nDepartment of Homeland Security officials detailed the proposed plan earlier this month.", "\n\n“The proposed rule change would help to save lives and bring criminals to justice by restoring the authority of the Attorney General to authorize and direct the collection of DNA from non-United States persons detained at the border and the interior by DHS, with the ultimate goal of reducing victimization of innocent citizens,” Deputy Attorney General Jeffrey Rosen said in a statement Monday announcing the proposed rule.", "\n\n“Today’s proposed rule change is a lawful exercise of the Attorney General’s authority, provided by Congress, to collect DNA samples from non-United States persons who are properly detained under the authority of the United States,” Rosen said.", "\n\nThe Justice Department said that in advance of the proposed rule change, it has been working with DHS to initiate a DNA collection pilot program.", "\n\nThe proposal has drawn criticism from civil rights groups who have raised concerns over privacy, surveillance and the storing of the information in a database used for serious criminal investigations.", "\n\n“Forced DNA collection raises serious privacy and civil liberties concerns and lacks justification, especially when DHS is already using less intrusive identification methods like fingerprinting,” Vera Eidelman, a staff attorney with the American Civil Liberties Union's speech, privacy, and technology project, said in a statement earlier this month.", "\n\n“This kind of mass collection alters the purpose of DNA collection from one of criminal investigation to population surveillance, which is contrary to our basic notions of freedom and autonomy,” Eidelman said.", "\n\nThe administration has said a statute known as the DNA Fingerprint Act of 2005 authorizes collection of DNA from people in custody. ", "Thus far, the agency has been working under certain exemptions to that statute. ", "In 2010, Homeland Security Secretary Janet Napolitano requested an exemption to that collection for migrants who were not facing criminal charges and others awaiting deportation proceedings.", "\n\nThe Trump administration’s proposed rule would strike a provision authorizing the Secretary of Homeland Security to exempt DNA collection for migrants “because of operational exigencies or resource limitations.”", "\n\nThe rule will officially publish on Tuesday and is open to public comment for 20 days after publication." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.01015228426395939, 0.0051813471502590676, 0.002857142857142857, 0.00625, 0.007633587786259542, 0.004694835680751174, 0.0040650406504065045, 0.013605442176870748, 0, 0.0084985835694051, 0.004739336492890996, 0, 0, 0.010526315789473684, 0.009389671361502348, 0 ]
0.005475
5
[ { "analysis_explanation": null, "end": 9, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4 }, { "analysis_explanation": null, "end": 49, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43 }, { "analysis_explanation": null, "end": 271, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 265 }, { "analysis_explanation": null, "end": 378, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 374 }, { "analysis_explanation": null, "end": 449, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 445 }, { "analysis_explanation": null, "end": 670, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 653 }, { "analysis_explanation": null, "end": 736, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 719 }, { "analysis_explanation": null, "end": 1014, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1010 }, { "analysis_explanation": null, "end": 1157, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1139 }, { "analysis_explanation": null, "end": 1360, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1343 }, { "analysis_explanation": null, "end": 1526, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1513 }, { "analysis_explanation": null, "end": 1553, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1547 }, { "analysis_explanation": null, "end": 1590, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1585 }, { "analysis_explanation": null, "end": 1739, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1722 }, { "analysis_explanation": null, "end": 1814, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1797 }, { "analysis_explanation": null, "end": 1822, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1817 }, { "analysis_explanation": null, "end": 2386, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2373 }, { "analysis_explanation": null, "end": 2526, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2508 }, { "analysis_explanation": null, "end": 2731, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2723 }, { "analysis_explanation": null, "end": 2816, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2812 }, { "analysis_explanation": null, "end": 2957, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2953 }, { "analysis_explanation": null, "end": 3003, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2987 }, { "analysis_explanation": null, "end": 3150, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3145 }, { "analysis_explanation": null, "end": 3396, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3389 }, { "analysis_explanation": null, "end": 3438, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3431 } ]
[ "Iscoms containing purified Quillaja saponins upregulate both Th1-like and Th2-like immune responses.", "\nThe immune stimulating complex (iscom) is built up by antigen, cholesterol, phospholipids, and adjuvant active Quillaja saponins. ", "Previous studies have shown that iscoms containing Quil A (a semipurified preparation of saponins) efficiently induce antibody and cell-mediated immune responses. ", "In this study, we demonstrate that iscoms containing a mixture of two purified low toxicity Quillaja saponin fractions (ISCOPREP 703) are able to upregulate both Th1-like and Th2-like immune responses. ", "Thus, ovalbumin (OVA) iscoms induced higher levels of antigen-specific IgG1 and IgG2a antibodies and increased the production of both IFN-gamma and IL-4 compared with OVA administered without adjuvant. ", "In contrast, OVA formulated in Al(OH)3 elicited IgG1 and IgE antibodies and primed spleen cells producing IL-4 and IL-10, suggesting the activation of primarily Th2-like cells. ", "These findings underline that adjuvants are able to alter the character of immune responses and may be used to generate responses with desired properties." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0.0049504950495049506, 0, 0 ]
0.000707
5
[ { "analysis_explanation": null, "end": 836, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 829 } ]
[ "Overview\n\nThe United States is in the midst of an unprecedented drug epidemic. ", "Since 2000, overdoses from opioids in the United States have tripled. ", "Last year alone there were over 64,000 opioid related drug overdoses. ", "In fact, opioids kill more people in the United States than breast cancer.[1] A small, but significant portion of those deaths were veterans under the care of the U.S. Department of Veterans Affairs (the VA). ", "After nearly eighteen years of war in Afghanistan, Iraq, and countless unnamed Overseas Contingency Operations, over 60% of veterans report suffering from chronic pain that requires some form of medication or treatment. ", "For much of that time, invariably, opioids were the prescribed drug of choice.[2] Unfortunately, veterans represent one of the most vulnerable communities in America, reporting higher rates of chronic pain, post-traumatic stress, depression, chronic homelessness, and suicide. ", "Since America’s veterans are at the nexus between the opioid epidemic and overdoses, any improvements or fixes implemented within the veterans health system have immediate wider applications for the rest of America.", "\n\nResearch\n\nUntil 2013–14, the VA policy on opioid prescriptions would be best described as liberal. ", "Hundreds of thousands of veterans were prescribed staggering amounts of opioid pain killers such as Vicodin and OxyContin.[3] Many veterans report prescription “plans” consisting of 20+ concurrent medicines.[4] Just as the opioid epidemic entered the national conscience at the end of 2014, the VA reviewed and ultimately revised its prescription policies, aiming for an across the board reduction in prescription rates. ", "In a complete reversal of its previous policy — and in a vain effort to combat what it perceived as systemic abuse — the VA took a top-down approach and implemented what can best be described as a “cold-turkey” policy on opioids; instantly cutting some 230,000 veterans off from their prescribed pain medications.[5] The VA touts this as a success, reporting its Opioid Safety Initiative has resulted in “99% of VA facilities [reducing] prescription rates since 2012.”[6] Not every veteran would agree with the VA assessment. ", "Robert Rose Jr., in an interview with Liz Lohuis at WSMV Channel 4 in Nashville, described the new VA policy as “a death sentence for people like me.", "”[7]\n\nAlthough the VA now recognizes the dangers of its former liberal practice of prescribing opioids, citing the publication of the “Clinical Practice Guideline for Management of Opioid Therapy for Chronic Pain” in 2010 as the tipping point towards epidemic, the VA failed to provide an effective road-map for veterans to wean themselves from opioids.[8] Furthermore, most veterans report the VA implemented the “cold-turkey” policy with little to no input or feedback from their primary care providers.[9] The current alternative offered by the VA consists of educational material and prescriptions for yoga, chiropractic treatment, and acupuncture.[10] It is not as if their somatic symptoms suddenly disappeared. ", "Unfortunately, especially in the face of the Justice Department’s intransigence regarding non-addictive pain-management alternatives, now many veterans are following the rest of America’s lead by turning to the black market to obtain drugs to self-medicate.[11]\n\nAmerica’s veterans are a microcosm of the nation’s addiction to opioids, while also suffering from higher rates of over-prescription, addiction, and suicide. ", "These issues are especially prevalent among veterans who served in the “Post-9/11” era. ", "In the State of the American Veteran: The Chicagoland Veterans Study conducted by the USC School of Social Work’s Center for Innovation and Research on Veterans & Military Families, surveys show that “Post-9/11” veterans not only struggle more with transitioning back to civilian life, they report “feeling disconnected from the world” around them at double the rate of “Pre-9/11” veterans. ", "Worse still, the aforementioned years of combat and Overseas Contingency Operations have contributed to higher rates of being “bothered a lot” by issues related to: pain or problems with arms, legs, and joints; trouble sleeping; chronic back pain; feeling overly tired; bowel problems; headaches; and for female veterans, menstrual cramps and difficulties. ", "The study cites a key factor among “Post-9/11” veterans as an overarching sense of “being [physically] and [emotionally] exhausted when they left the military…suggesting service members are leaving the military today with significant unmet physical health issues.", "”[12]\n\nAs a sixteen-year Air Force veteran with a tour in Iraq that has battled with Post-Traumatic Stress, I completely agree with this sentiment. ", "Personally, although I only had four more years to retirement eligibility, continued service did not seem physically or emotionally possible without major sacrifices in my personal well-being.[13] I loved my job. ", "I was great at it. ", "I could not do it anymore.", "\n\nPrescribers, The VA, and Pill Manufactures\n\nAt a time when between 20 and 30 veterans commit suicide every day, the veterans of this era return to civilian life at greater risk than their predecessors. ", "Seemingly, the VA is only capable of lurching from one reactive pain management policy to another. ", "The Department of Veterans Affairs operates over 1000 treatment facilities and hospitals in all fifty states. ", "Over 9 million of America’s 22 million veterans receive their primary medical treatment at a VA or DoD facility.[14] This makes the VA the 10th largest healthcare network in America. ", "This is both a blessing and a curse.", "\n\nOne contributing factor to the VA’s over-prescription of opioids was the pill manufacturers themselves. ", "These companies took advantage of a government agency constantly on the defensive — one desperate, especially after the Iraq invasion, to be seen as doing something, anything to help veterans — by pushing the use of manufactured opioids for pain management. ", "Furthermore, these manufacturers used the VA as a publicly funded propaganda arm to spread the lie that these opioids were non-addictive and safe for wide use in pain-management.[15]\n\nFrom Pain Management and Opioid Safety — VA Educational Guide (2014)\n\nThe manufacture of OxyContin, Purdue Pharma, contributed $200,000 in 2001 to the VA’s pain management policy team and directly participated in developing the VA’s initial guidelines on opioids, ensuring the drug was cited as “rarely addictive.", "”[16] Worse still, as the VA increased use of opioids for pain management, so followed the rest of America. ", "There is a direct correlation between America’s rate of OxyContin abuse and the tremendous profits of its producer Purdue Pharma. ", "In 1995, the company, noting the drugs addictive properties, cited the goal of selling the smallest effective dose to the smallest number of patients. ", "In a marked reversal of mindset, by 2002 Purdue Pharma sales reps received specific training to overcome any clinician objections and questions about addition in order to complete a sale.[17] Finally, and this despite the growing opioid epidemic and dropping prescription rates, the company was valued at $14 billion in 2015, up from $95 million in 1995.[18] In a quantitative study conducted for the National Bureau of Economic Research, Christopher J. Ruhm examined county-level drug mortality rates — specifically for opioids — from 1999–2015 finding the marked increase in deaths was unlikely due to any contributing economic or societal factor, but instead was directly tied to the availability and cost of the drugs.[19] In short, the fault of the opioid epidemic can be laid directly at the feet of the government, sanctioned prescribers, but also opioid manufacturers.", "\n\nFrom Pain Management and Opioid Safety — VA Educational Guide (2014)\n\nThe Trump Administration Response — The Return of Just Say No\n\nThe current administration response to the opioid epidemic does not inspire hope in veterans. ", "The former head of the VA, Secretary David Shulkin, spent an inordinate amount of time on Capitol Hill answering questions regarding inappropriate use of government funds during official travel to Europe, where the New York Times reported he spent most of his time playing tourist.[20] This was a needless distraction for an organization on the front lines of this deadly epidemic. ", "Fortunately, there are suggestions that the VA is changing its cultural mindset with its Opioid Initiative Toolkit; which contains documents geared towards safe opioid prescribing while “recognizing the clinical challenges to successfully managing pain and prescribing safely for our Veterans.", "”[21] Though, this is tempered by the VA’s history of mismanagement in times of crisis.", "\n\nFurthermore, outside of a well-received speech wherein President Trump declared America’s opioid addiction a public health emergency, the President did not immediately request additional funds to combat the crisis.[22] In fact, President Trump did not address funding the fight against opioids until he published his 2019 budget on 12 February 2018. ", "He requested an additional $30 billion in new federal funding to combat opioids, while reducing the Health and Human Services budget by $17.9 billion (21%). ", "In the intervening 109 days between declaring a state of emergency and proposing funding, almost 20,000 Americans overdosed on opioids and in upwards of 3000 veterans committed suicide.[23] The fear among veterans is that, much like past government initiatives, it will be too little, too late and will inevitably focus on the wrong priorities.", "\n\nThis fear was reflected in a speech given by then Attorney General of the United States, Jeff Sessions, who stated, “I am operating under the assumption that this country prescribes too many opioids,” which is true, but he continued, “people need to take an aspirin sometimes and tough it out a little.", "”[24] The Attorney General’s views on drugs, and crime for that matter, hearken back to the failed “Just Say No” D.A.R.E. campaign era under the Reagan administration.[25] In his view, there is no alternative but abstinence and empty quips when it comes to the opioid epidemic. ", "This much was clear after he announced the Justice Department was ending the Obama Era guidance that shielded states with medical and legal marijuana laws on the books.[26] This, despite studies showing marked drops in opioid overdoses in states that legalized marijuana.[27]\n\nConclusions\n\nThe Chicagoland Veterans study makes it clear that today’s veterans are facing greater transition challenges than any previous generation, with nearly 1/3 of Chicago’s cohort considered “at-risk” of suicide the day they take off the uniform. ", "Terribly, “Post-9/11” vets were twice as likely to be considered a suicide risk as compared to their “Pre-9/11” peers.[28] Despite the lack luster responses from the current administration, there are sizable resources devoted to addressing the acute and chronic needs of veterans at the local level. ", "Though, the Chicagoland report laments the “lack of attention given to preventing these conditions or proactive early intervention to prevent conditions from being chronic.", "”[29] The study further laments the absence collaborative synergy between veterans support organizations, not just in Chicagoland, but nationally as well. ", "There is no formal structural schema for these organizations to collaborate and work together. ", "As the report states, these various governmental and non-government organizations “tend to focus on one or two veteran needs. ", "Thus, the only means by which veterans will receive a holistic support network is through all veteran support organizations working together.", "”[30]\n\nVeterans today balk at the simple notion that “an aspirin” and “tough[ing] it out a little” is a viable policy solution for the opioid epidemic. ", "First, any veteran would point out while in the service most trips to the doctor resulted in a prescription for an absolute mountain of 800mg Ibuprofen. ", "We spent our whole careers on “aspirin.” ", "Not to mention, as the Chicagoland study rightly pointed out, further “bike rides, expeditions to the North Pole, and athletic competitions [that] might appeal to fundraisers and generate ‘feel-good’ reactions among participants and civilians…do very little to address many of the more serious issues impacting [veterans].”[31] Though a marked improvement over getting spit-on at the airport, these events are not policy solutions. ", "Finally, “Post-9/11” veterans spent the last 18 years at war. ", "We are a generation of tough. ", "If anything, we are its literal embodiment. ", "Tough is not the issue. ", "The issue of Americans on opioids, like its veterans on opioids, is complicated. ", "Instead of a one-off slogan, the issue will require a multifaceted, complex, coordinated, frankly veteran-led solution.", "\n\n[1] “Increases in Drug and Opioid Overdose Deaths — United States, 2000–2014,” accessed February 13, 2018, https://www.cdc.gov/mmwr/preview/mmwrhtml/mm6450a3.htm; Rose Rudd et al., “", "Increases in Drug and Opioid Overdose Deaths — United States, 2000–2014,” January 1, 2016, https://www.cdc.gov/mmwr/preview/mmwrhtml/mm6450a3.htm; “Drug Overdose Death Data | Drug Overdose | CDC Injury Center,” January 5, 2018, https://www.cdc.gov/drugoverdose/data/statedeaths.html; “Opioid Data Analysis | Drug Overdose | CDC Injury Center,” January 19, 2018, https://www.cdc.gov/drugoverdose/data/analysis.html.", "\n\n[2] Mark Brunswick, “Veterans Struggle to Live with VA’s New Painkiller Policy,” Star Tribune, accessed February 13, 2018, http://www.startribune.com/cut-off-veterans-struggle-to-live-with-va-s-new-painkiller-policy/311225761/.\n\n[3] “Department of Veterans Affairs Opioid Prescribing Data | Data.va.", "Gov,” accessed February 13, 2018, https://www.data.va.gov/story/department-veterans-affairs-opioid-prescribing-data.", "\n\n[4] One veteran described his daily “cocktail” consisted of over 100 pills. ", "Jim Axelrod, “VA’s Overmedication of Vets Widespread, Inspector General Finds,” CBS News, May 14, 2014, https://www.cbsnews.com/news/vas-overmedication-of-vets-widespread-inspector-general-finds/.\n\n[5] Brunswick, “Veterans Struggle to Live with VA’s New Painkiller Policy.”", "\n\n[6] “Department of Veterans Affairs Opioid Prescribing Data | Data.va.", "Gov.”\n\n[7] Liz Lohuis, “TN Veteran Sues VA for Cutting off Pain Med Prescription,” accessed February 13, 2018, http://www.wsmv.com/story/36916192/tn-veteran-sues-va-for-cutting-off-pain-med-prescription.", "\n\n[8] “Opioid Safety Initiative (OSI) — VHA Pain Management,” General Information, accessed February 15, 2018, https://www.va.gov/PAINMANAGEMENT/Opioid_Safety_Initiative_OSI.asp.", "\n\n[9] Brunswick, “Veterans Struggle to Live with VA’s New Painkiller Policy.”", "\n\n[10] Brunswick.", "\n\n[11] Joe Eaton, “Selling Prescription Medications, Opioids Illegally,” AARP, accessed February 15, 2018, http://www.aarp.org/health/drugs-supplements/info-2017/selling-prescription-medications-opioids.html; Axelrod, “VA’s Overmedication of Vets Widespread, Inspector General Finds.”", "\n\n[12] Sara Kintzle, Janice Rasheed, and Carl Castro, “The State of the American Veteran: The Chicagoland Veterans Study” (USC School of Social Work / Loyola University Chicago School of Social Work, April 2016), http://cir.usc.edu/wp-content/uploads/2016/04/CIR_ChicagoReport_double.pdf.", "\n\n[13] I spent 16 years and 24 days as a United States Air Force Arabic Cryptologic Language Analyst and Intelligence Analyst for the National Security Agency. ", "Nearly every moment was either spent training for or fighting in the Global War on Terror against Al Qaeda in Iraq and the Islamic State.", "\n\n[14] “Department of Veterans Affairs Opioid Prescribing Data | Data.va.", "Gov”; Art Levine, “How the VA Fueled the National Opioid Crisis and Is Killing Thousands of Veterans,” Newsweek, 12 Oct 17, http://www.newsweek.com/2017/10/20/va-fueled-opioid-crisis-killing-veterans-681552.html.", "\n\n[15] Levine, “How the VA Fueled the National Opioid Crisis and Is Killing Thousands of Veterans.”", "\n\n[16] Levine; Richard Florida, “Don’t Blame Economic Despair for the Opioid Epidemic,” CityLab, accessed February 15, 2018, https://www.citylab.com/life/2018/02/the-real-cause-of-the-opioid-crisis/553118/; Christopher J. Ruhm, “Deaths of Despair or Drug Problems?,” ", "Working Paper (National Bureau of Economic Research, January 2018), https://doi.org/10.3386/w24188.", "\n\n[17] Patrick Radden Keefe, “The Family That Built an Empire of Pain,” The New Yorker, October 23, 2017, https://www.newyorker.com/magazine/2017/10/30/the-family-that-built-an-empire-of-pain.", "\n\n[18] Chase Peterson-Withorn, “Fortune Of Family Behind OxyContin Drops Amid Declining Prescriptions,” Forbes, June 29, 2016, https://www.forbes.com/sites/chasewithorn/2016/06/29/fortune-of-family-behind-oxycontin-drops-amid-declining-prescriptions/#55463a506341.", "\n\n[19] Ruhm, “Deaths of Despair or Drug Problems?”", "\n\n[20] Dave Philipps, “Report Faults V.A. Secretary Shulkin Over Travel to Europe,” The New York Times, February 14, 2018, sec. ", "U.S., https://www.nytimes.com/2018/02/14/us/veterans-affairs-shulkin.html.", "\n\n[21] “Opioid Safety Initiative (OSI) — VHA Pain Management.”", "\n\n[22] Alessandra Potenza, “Trump Declares Opioid Crisis a Public Health Emergency, but It Falls Short of What He Promised,” The Verge, October 26, 2017, https://www.theverge.com/2017/10/26/16552440/opioid-crisis-public-health-emergency-donald-trump-heroin-epidemic.", "\n\n[23] 65,000 opioid deaths in 2016/356=178 per day*109. ", "30 veterans per day*109.", "\n\n[24] Attorney General Jeff Sessions Recommends Aspirin in Tampa Bay, accessed February 11, 2018, https://www.youtube.com/watch?v=kyR98CeYPkQ; Sky Palma, “Jeff Sessions: Chronic Pain Sufferers Should ‘Take an Aspirin and Tough It Out,’” accessed February 11, 2018, http://deadstate.org/jeff-sessions-chronic-pain-sufferers-should-take-an-aspirin-and-tough-it-out/; Attorney General Jeff Sessions Recommends Aspirin in Tampa Bay, YouTube (Office of United States Attorney — Middle Distric of Florida, 2018), https://www.youtube.com/watch?v=kyR98CeYPkQ.\n\n[25] “Common Sense for Drug Policy: Drug Abuse Resistance Education (DARE),” accessed February 16, 2018, http://www.csdp.org/news/news/darerevised.htm; review of Youth Illicit Drug Use Prevention: DARE Long-Term Evaluations and Federal Efforts to Identify Effective Programs, by Marjorie Kanof, U.S. Government Accounting Office, no. ", "GAO-03–172R (January 15, 2003), https://www.gao.gov/products/GAO-03-172R.\n\n[26] Corky Siemaszko, “Sessions to End Obama-Era Policy on Legalized Marijuana,” NBC News, January 4, 2018, https://www.nbcnews.com/storyline/legal-pot/sessions-end-obama-era-policy-legalized-marijuana-n834591.", "\n\n[27] Melvin D. Livingston et al., “", "Recreational Cannabis Legalization and Opioid-Related Deaths in Colorado, 2000–2015,” American Journal of Public Health 107, no. ", "11 (October 11, 2017): 1827–29, https://doi.org/10.2105/AJPH.2017.304059.", "\n\n[28] Kintzle, Rasheed, and Castro, “Chicagoland Veterans Study,” 38.", "\n\n[29] Kintzle, Rasheed, and Castro, 39.", "\n\n[30] Kintzle, Rasheed, and Castro, 39.", "\n\n[31] Kintzle, Rasheed, and Castro, 39.", "\n\nBibliography\n\nAttorney General Jeff Sessions Recommends Aspirin in Tampa Bay. ", "YouTube. ", "Office of United States Attorney — Middle Distric of Florida, 2018. ", "https://www.youtube.com/watch?v=kyR98CeYPkQ.\n\nAxelrod, Jim. “", "VA’s Overmedication of Vets Widespread, Inspector General Finds.” ", "CBS News, May 14, 2014. ", "https://www.cbsnews.com/news/vas-overmedication-of-vets-widespread-inspector-general-finds/.\n\nBrunswick, Mark. “", "Veterans Struggle to Live with VA’s New Painkiller Policy.” ", "Star Tribune. ", "Accessed February 13, 2018. ", "http://www.startribune.com/cut-off-veterans-struggle-to-live-with-va-s-new-painkiller-policy/311225761/.\n\n“Common Sense for Drug Policy: Drug Abuse Resistance Education (DARE).” ", "Accessed February 16, 2018. ", "http://www.csdp.org/news/news/darerevised.htm.", "\n\n“Department of Veterans Affairs Opioid Prescribing Data | Data.va.", "Gov.” Accessed February 13, 2018. ", "https://www.data.va.gov/story/department-veterans-affairs-opioid-prescribing-data.", "\n\n“Drug Overdose Death Data | Drug Overdose | CDC Injury Center,” January 5, 2018. ", "https://www.cdc.gov/drugoverdose/data/statedeaths.html.", "\n\nEaton, Joe. “", "Selling Prescription Medications, Opioids Illegally.” ", "AARP. ", "Accessed February 15, 2018. ", "http://www.aarp.org/health/drugs-supplements/info-2017/selling-prescription-medications-opioids.html.", "\n\nFlorida, Richard. “", "Don’t Blame Economic Despair for the Opioid Epidemic.” ", "CityLab. ", "Accessed February 15, 2018. ", "https://www.citylab.com/life/2018/02/the-real-cause-of-the-opioid-crisis/553118/.\n\n“Increases in Drug and Opioid Overdose Deaths — United States, 2000–2014.” ", "Accessed February 13, 2018. ", "https://www.cdc.gov/mmwr/preview/mmwrhtml/mm6450a3.htm.", "\n\nKeefe, Patrick Radden. “", "The Family That Built an Empire of Pain.” ", "The New Yorker, October 23, 2017. ", "https://www.newyorker.com/magazine/2017/10/30/the-family-that-built-an-empire-of-pain.", "\n\nKintzle, Sara, Janice Rasheed, and Carl Castro. “", "The State of the American Veteran: The Chicagoland Veterans Study.” ", "USC School of Social Work / Loyola University Chicago School of Social Work, April 2016. ", "http://cir.usc.edu/wp-content/uploads/2016/04/CIR_ChicagoReport_double.pdf.", "\n\nLevine, Art. “", "How the VA Fueled the National Opioid Crisis and Is Killing Thousands of Veterans.” ", "Newsweek, 12 Oct 17. ", "http://www.newsweek.com/2017/10/20/va-fueled-opioid-crisis-killing-veterans-681552.html.", "\n\nLivingston, Melvin D., Tracey E. Barnett, Chris Delcher, and Alexander C. Wagenaar. “", "Recreational Cannabis Legalization and Opioid-Related Deaths in Colorado, 2000–2015.” ", "American Journal of Public Health 107, no. ", "11 (October 11, 2017): 1827–29. ", "https://doi.org/10.2105/AJPH.2017.304059.", "\n\nLohuis, Liz. “", "TN Veteran Sues VA for Cutting off Pain Med Prescription.” ", "Accessed February 13, 2018. ", "http://www.wsmv.com/story/36916192/tn-veteran-sues-va-for-cutting-off-pain-med-prescription.", "\n\n“Opioid Data Analysis | Drug Overdose | CDC Injury Center,” January 19, 2018. ", "https://www.cdc.gov/drugoverdose/data/analysis.html.", "\n\n“Opioid Safety Initiative (OSI) — VHA Pain Management.” ", "General Information. ", "Accessed February 15, 2018. ", "https://www.va.gov/PAINMANAGEMENT/Opioid_Safety_Initiative_OSI.asp.", "\n\nPalma, Sky. “", "Jeff Sessions: Chronic Pain Sufferers Should ‘Take an Aspirin and Tough It Out.’” ", "Accessed February 11, 2018. ", "http://deadstate.org/jeff-sessions-chronic-pain-sufferers-should-take-an-aspirin-and-tough-it-out/.\n\nPeterson-Withorn, Chase. “", "Fortune Of Family Behind OxyContin Drops Amid Declining Prescriptions.” ", "Forbes, June 29, 2016. ", "https://www.forbes.com/sites/chasewithorn/2016/06/29/fortune-of-family-behind-oxycontin-drops-amid-declining-prescriptions/#55463a506341.", "\n\nPhilipps, Dave. “", "Report Faults V.A. Secretary Shulkin Over Travel to Europe.” ", "The New York Times, February 14, 2018, sec. ", "U.S. https://www.nytimes.com/2018/02/14/us/veterans-affairs-shulkin.html.", "\n\nPotenza, Alessandra. “", "Trump Declares Opioid Crisis a Public Health Emergency, but It Falls Short of What He Promised.” ", "The Verge, October 26, 2017. ", "https://www.theverge.com/2017/10/26/16552440/opioid-crisis-public-health-emergency-donald-trump-heroin-epidemic.", "\n\nReview of Youth Illicit Drug Use Prevention: DARE Long-Term Evaluations and Federal Efforts to Identify Effective Programs, by Marjorie Kanof. ", "U.S. Government Accounting Office, no. ", "GAO-03–172R (January 15, 2003). ", "https://www.gao.gov/products/GAO-03-172R.\n\nRudd, Rose, Noah Aleshire, John Zibbell, and R. Matthew Gladden. “", "Increases in Drug and Opioid Overdose Deaths — United States, 2000–2014,” January 1, 2016. ", "https://www.cdc.gov/mmwr/preview/mmwrhtml/mm6450a3.htm.", "\n\nRuhm, Christopher J. “Deaths of Despair or Drug Problems?” ", "Working Paper. ", "National Bureau of Economic Research, January 2018. ", "https://doi.org/10.3386/w24188.", "\n\nSiemaszko, Corky. “", "Sessions to End Obama-Era Policy on Legalized Marijuana.” ", "NBC News, January 4, 2018. ", "https://www.nbcnews.com/storyline/legal-pot/sessions-end-obama-era-policy-legalized-marijuana-n834591." ]
{ "pile_set_name": "OpenWebText2" }
[ 0, 0, 0, 0.004784688995215311, 0, 0, 0, 0, 0.0023752969121140144, 0.0019011406844106464, 0.013422818791946308, 0.001392757660167131, 0.0023752969121140144, 0, 0.0076726342710997444, 0, 0.0038022813688212928, 0.013513513513513514, 0, 0.05263157894736842, 0, 0.00980392156862745, 0, 0.00909090909090909, 0.01092896174863388, 0, 0.009433962264150943, 0, 0.008048289738430584, 0, 0.015384615384615385, 0, 0.0045662100456621, 0, 0.010471204188481676, 0.0034129692832764505, 0.011494252873563218, 0.005681818181818182, 0.006369426751592357, 0, 0.003289473684210526, 0.0035971223021582736, 0.0037593984962406013, 0.0033333333333333335, 0.005813953488372093, 0, 0, 0, 0, 0, 0.006535947712418301, 0, 0.0023148148148148147, 0.03225806451612903, 0, 0, 0, 0, 0, 0.010869565217391304, 0.012077294685990338, 0.009966777408637873, 0.008620689655172414, 0, 0.01098901098901099, 0, 0.009852216748768473, 0.02247191011235955, 0, 0, 0.014084507042253521, 0.013888888888888888, 0.01875, 0.0072992700729927005, 0, 0.018867924528301886, 0.020202020202020204, 0.0149812734082397, 0.030303030303030304, 0.015625, 0.011363636363636364, 0, 0.03125, 0.013513513513513514, 0.03225806451612903, 0.011278195488721804, 0, 0, 0.016891891891891893, 0.014035087719298246, 0, 0.015503875968992248, 0.0136986301369863, 0.014285714285714285, 0.025, 0.025, 0.025, 0.0125, 0.1111111111111111, 0.029411764705882353, 0.03278688524590164, 0, 0.041666666666666664, 0.026785714285714284, 0.03333333333333333, 0.07142857142857142, 0, 0.0056179775280898875, 0, 0.021739130434782608, 0.014705882352941176, 0, 0.012195121951219513, 0.012048192771084338, 0.01818181818181818, 0.06666666666666667, 0.018518518518518517, 0.16666666666666666, 0, 0.009900990099009901, 0.047619047619047616, 0, 0.1111111111111111, 0, 0.006329113924050633, 0, 0.01818181818181818, 0.038461538461538464, 0, 0.029411764705882353, 0.011627906976744186, 0.0392156862745098, 0.014705882352941176, 0.011235955056179775, 0.013333333333333334, 0, 0.023809523809523808, 0.047619047619047616, 0.011363636363636364, 0.04597701149425287, 0.011627906976744186, 0.023255813953488372, 0, 0.024390243902439025, 0.0625, 0.01694915254237288, 0, 0.010869565217391304, 0.025, 0.019230769230769232, 0.034482758620689655, 0.047619047619047616, 0, 0.014925373134328358, 0, 0.024390243902439025, 0, 0.023622047244094488, 0, 0.043478260869565216, 0.0072992700729927005, 0.05263157894736842, 0.01639344262295082, 0.045454545454545456, 0.0136986301369863, 0.041666666666666664, 0.010309278350515464, 0.034482758620689655, 0.008928571428571428, 0.020689655172413793, 0.02564102564102564, 0, 0.045871559633027525, 0, 0.01818181818181818, 0.01639344262295082, 0.06666666666666667, 0.019230769230769232, 0.03225806451612903, 0.047619047619047616, 0, 0.037037037037037035, 0.00980392156862745 ]
0.015766
5
[ { "analysis_explanation": null, "end": 27, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10 }, { "analysis_explanation": null, "end": 89, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85 }, { "analysis_explanation": null, "end": 134, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 117 }, { "analysis_explanation": null, "end": 158, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 149 }, { "analysis_explanation": null, "end": 273, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 256 }, { "analysis_explanation": null, "end": 455, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 434 }, { "analysis_explanation": null, "end": 477, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 466 }, { "analysis_explanation": null, "end": 483, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 479 }, { "analysis_explanation": null, "end": 813, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 806 }, { "analysis_explanation": null, "end": 938, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 931 }, { "analysis_explanation": null, "end": 1139, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1132 }, { "analysis_explanation": null, "end": 1164, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1157 }, { "analysis_explanation": null, "end": 1172, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1170 }, { "analysis_explanation": null, "end": 1449, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1437 }, { "analysis_explanation": null, "end": 1529, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1514 }, { "analysis_explanation": null, "end": 2202, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2187 }, { "analysis_explanation": null, "end": 2235, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2225 }, { "analysis_explanation": null, "end": 2266, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2257 }, { "analysis_explanation": null, "end": 2288, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2286 }, { "analysis_explanation": null, "end": 2558, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2554 }, { "analysis_explanation": null, "end": 3240, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3233 }, { "analysis_explanation": null, "end": 3325, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3318 }, { "analysis_explanation": null, "end": 3592, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3584 }, { "analysis_explanation": null, "end": 4528, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4523 }, { "analysis_explanation": null, "end": 4600, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4588 }, { "analysis_explanation": null, "end": 4638, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4634 }, { "analysis_explanation": null, "end": 4771, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4756 }, { "analysis_explanation": null, "end": 5093, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5084 }, { "analysis_explanation": null, "end": 5202, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5200 }, { "analysis_explanation": null, "end": 5419, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5412 }, { "analysis_explanation": null, "end": 5489, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5487 }, { "analysis_explanation": null, "end": 5528, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5526 }, { "analysis_explanation": null, "end": 5575, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5568 }, { "analysis_explanation": null, "end": 5842, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5838 }, { "analysis_explanation": null, "end": 6227, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6223 }, { "analysis_explanation": null, "end": 6303, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6299 }, { "analysis_explanation": null, "end": 6313, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6311 }, { "analysis_explanation": null, "end": 6580, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6573 }, { "analysis_explanation": null, "end": 6627, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6620 }, { "analysis_explanation": null, "end": 6719, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6715 }, { "analysis_explanation": null, "end": 6903, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6899 }, { "analysis_explanation": null, "end": 7187, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7183 }, { "analysis_explanation": null, "end": 7321, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7302 }, { "analysis_explanation": null, "end": 7408, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7399 }, { "analysis_explanation": null, "end": 7807, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7803 }, { "analysis_explanation": null, "end": 7992, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7990 }, { "analysis_explanation": null, "end": 8017, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8004 }, { "analysis_explanation": null, "end": 8069, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8057 }, { "analysis_explanation": null, "end": 8170, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8164 }, { "analysis_explanation": null, "end": 8801, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8796 }, { "analysis_explanation": null, "end": 8818, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8811 }, { "analysis_explanation": null, "end": 8974, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8969 }, { "analysis_explanation": null, "end": 9052, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9048 }, { "analysis_explanation": null, "end": 9079, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9063 }, { "analysis_explanation": null, "end": 9265, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9241 }, { "analysis_explanation": null, "end": 9351, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9342 }, { "analysis_explanation": null, "end": 9670, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9653 }, { "analysis_explanation": null, "end": 9685, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9672 }, { "analysis_explanation": null, "end": 10007, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9999 }, { "analysis_explanation": null, "end": 10037, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10031 }, { "analysis_explanation": null, "end": 10510, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10505 }, { "analysis_explanation": null, "end": 10619, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10612 }, { "analysis_explanation": null, "end": 10668, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10661 }, { "analysis_explanation": null, "end": 11019, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11008 }, { "analysis_explanation": null, "end": 11298, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11287 }, { "analysis_explanation": null, "end": 11708, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11703 }, { "analysis_explanation": null, "end": 12067, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12056 }, { "analysis_explanation": null, "end": 12145, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12131 }, { "analysis_explanation": null, "end": 12518, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12501 }, { "analysis_explanation": null, "end": 12647, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12638 }, { "analysis_explanation": null, "end": 12891, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12878 }, { "analysis_explanation": null, "end": 12902, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12893 }, { "analysis_explanation": null, "end": 12931, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12914 }, { "analysis_explanation": null, "end": 13005, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12989 }, { "analysis_explanation": null, "end": 13069, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13056 }, { "analysis_explanation": null, "end": 13080, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13071 }, { "analysis_explanation": null, "end": 13098, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13083 }, { "analysis_explanation": null, "end": 13235, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13220 }, { "analysis_explanation": null, "end": 13369, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13353 }, { "analysis_explanation": null, "end": 13442, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13428 }, { "analysis_explanation": null, "end": 13545, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13528 }, { "analysis_explanation": null, "end": 13756, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13739 }, { "analysis_explanation": null, "end": 13876, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13871 }, { "analysis_explanation": null, "end": 13928, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13917 }, { "analysis_explanation": null, "end": 14019, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14007 }, { "analysis_explanation": null, "end": 14283, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14273 }, { "analysis_explanation": null, "end": 14288, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14286 }, { "analysis_explanation": null, "end": 14371, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14354 }, { "analysis_explanation": null, "end": 14573, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14556 }, { "analysis_explanation": null, "end": 14749, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14740 }, { "analysis_explanation": null, "end": 14838, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14821 }, { "analysis_explanation": null, "end": 14949, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14942 }, { "analysis_explanation": null, "end": 15035, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15023 }, { "analysis_explanation": null, "end": 15051, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15037 }, { "analysis_explanation": null, "end": 15068, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15057 }, { "analysis_explanation": null, "end": 15226, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15216 }, { "analysis_explanation": null, "end": 15326, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15318 }, { "analysis_explanation": null, "end": 15338, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15331 }, { "analysis_explanation": null, "end": 15577, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15573 }, { "analysis_explanation": null, "end": 15599, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15582 }, { "analysis_explanation": null, "end": 15689, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15679 }, { "analysis_explanation": null, "end": 15795, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15786 }, { "analysis_explanation": null, "end": 15897, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15891 }, { "analysis_explanation": null, "end": 15995, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15989 }, { "analysis_explanation": null, "end": 16012, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15997 }, { "analysis_explanation": null, "end": 16105, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16088 }, { "analysis_explanation": null, "end": 16208, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16189 }, { "analysis_explanation": null, "end": 16314, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16302 }, { "analysis_explanation": null, "end": 16374, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16354 }, { "analysis_explanation": null, "end": 16451, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16435 }, { "analysis_explanation": null, "end": 16663, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16650 }, { "analysis_explanation": null, "end": 16870, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16857 }, { "analysis_explanation": null, "end": 16891, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16887 }, { "analysis_explanation": null, "end": 16921, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16902 }, { "analysis_explanation": null, "end": 16931, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16925 }, { "analysis_explanation": null, "end": 16971, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16954 }, { "analysis_explanation": null, "end": 16982, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16978 }, { "analysis_explanation": null, "end": 17051, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16984 }, { "analysis_explanation": null, "end": 17137, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17119 }, { "analysis_explanation": null, "end": 17265, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17248 }, { "analysis_explanation": null, "end": 17432, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17425 }, { "analysis_explanation": null, "end": 17494, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17481 }, { "analysis_explanation": null, "end": 17526, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17517 }, { "analysis_explanation": null, "end": 17554, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17537 }, { "analysis_explanation": null, "end": 17610, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17601 }, { "analysis_explanation": null, "end": 17721, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17704 }, { "analysis_explanation": null, "end": 17853, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17840 }, { "analysis_explanation": null, "end": 17885, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17876 }, { "analysis_explanation": null, "end": 17945, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17931 }, { "analysis_explanation": null, "end": 17956, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17949 }, { "analysis_explanation": null, "end": 17962, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17958 }, { "analysis_explanation": null, "end": 18114, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18097 }, { "analysis_explanation": null, "end": 18304, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18290 }, { "analysis_explanation": null, "end": 18374, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18358 }, { "analysis_explanation": null, "end": 18440, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18425 }, { "analysis_explanation": null, "end": 18526, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18511 }, { "analysis_explanation": null, "end": 18663, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18636 }, { "analysis_explanation": null, "end": 18739, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18731 }, { "analysis_explanation": null, "end": 18750, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18741 }, { "analysis_explanation": null, "end": 18816, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18800 }, { "analysis_explanation": null, "end": 18903, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18897 }, { "analysis_explanation": null, "end": 18972, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18966 }, { "analysis_explanation": null, "end": 18976, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18974 }, { "analysis_explanation": null, "end": 19011, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19005 }, { "analysis_explanation": null, "end": 19015, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19013 }, { "analysis_explanation": null, "end": 19050, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19044 }, { "analysis_explanation": null, "end": 19054, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19052 }, { "analysis_explanation": null, "end": 19100, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19087 }, { "analysis_explanation": null, "end": 19132, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19123 }, { "analysis_explanation": null, "end": 19192, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19178 }, { "analysis_explanation": null, "end": 19203, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19196 }, { "analysis_explanation": null, "end": 19209, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19205 }, { "analysis_explanation": null, "end": 19269, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19266 }, { "analysis_explanation": null, "end": 19275, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19273 }, { "analysis_explanation": null, "end": 19361, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19349 }, { "analysis_explanation": null, "end": 19472, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19468 }, { "analysis_explanation": null, "end": 19576, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19559 }, { "analysis_explanation": null, "end": 19782, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19765 }, { "analysis_explanation": null, "end": 19930, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19913 }, { "analysis_explanation": null, "end": 20094, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20079 }, { "analysis_explanation": null, "end": 20162, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20159 }, { "analysis_explanation": null, "end": 20252, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20235 }, { "analysis_explanation": null, "end": 20363, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20356 }, { "analysis_explanation": null, "end": 20372, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20365 }, { "analysis_explanation": null, "end": 20466, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20449 }, { "analysis_explanation": null, "end": 20612, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20599 }, { "analysis_explanation": null, "end": 20623, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20614 }, { "analysis_explanation": null, "end": 20652, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20635 }, { "analysis_explanation": null, "end": 20715, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20710 }, { "analysis_explanation": null, "end": 20731, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20717 }, { "analysis_explanation": null, "end": 20809, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20793 }, { "analysis_explanation": null, "end": 20911, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20907 }, { "analysis_explanation": null, "end": 20927, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20913 }, { "analysis_explanation": null, "end": 20944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20933 }, { "analysis_explanation": null, "end": 21103, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21093 }, { "analysis_explanation": null, "end": 21299, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21290 }, { "analysis_explanation": null, "end": 21400, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21390 }, { "analysis_explanation": null, "end": 21411, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21402 }, { "analysis_explanation": null, "end": 21430, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21413 }, { "analysis_explanation": null, "end": 21445, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21432 }, { "analysis_explanation": null, "end": 21472, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21451 }, { "analysis_explanation": null, "end": 21548, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21540 }, { "analysis_explanation": null, "end": 21559, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21550 }, { "analysis_explanation": null, "end": 21625, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21609 }, { "analysis_explanation": null, "end": 21677, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21637 }, { "analysis_explanation": null, "end": 21685, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21679 }, { "analysis_explanation": null, "end": 21690, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21687 }, { "analysis_explanation": null, "end": 21696, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21694 }, { "analysis_explanation": null, "end": 21779, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21762 }, { "analysis_explanation": null, "end": 21950, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21934 }, { "analysis_explanation": null, "end": 22108, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22091 }, { "analysis_explanation": null, "end": 22183, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22178 }, { "analysis_explanation": null, "end": 22300, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22283 }, { "analysis_explanation": null, "end": 22523, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22510 }, { "analysis_explanation": null, "end": 22671, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22663 }, { "analysis_explanation": null, "end": 22677, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22673 }, { "analysis_explanation": null, "end": 22699, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22695 }, { "analysis_explanation": null, "end": 22729, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22710 }, { "analysis_explanation": null, "end": 22739, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22733 }, { "analysis_explanation": null, "end": 22779, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22762 }, { "analysis_explanation": null, "end": 22790, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22786 }, { "analysis_explanation": null, "end": 22879, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22869 }, { "analysis_explanation": null, "end": 23007, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22991 }, { "analysis_explanation": null, "end": 23263, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23249 }, { "analysis_explanation": null, "end": 23333, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23317 }, { "analysis_explanation": null, "end": 23383, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23336 }, { "analysis_explanation": null, "end": 23389, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23385 }, { "analysis_explanation": null, "end": 23404, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23391 }, { "analysis_explanation": null, "end": 23418, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23406 }, { "analysis_explanation": null, "end": 23442, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23424 }, { "analysis_explanation": null, "end": 23506, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23493 }, { "analysis_explanation": null, "end": 23517, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23508 }, { "analysis_explanation": null, "end": 23535, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23520 }, { "analysis_explanation": null, "end": 23649, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23599 }, { "analysis_explanation": null, "end": 23717, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23705 }, { "analysis_explanation": null, "end": 23767, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23762 }, { "analysis_explanation": null, "end": 23854, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23839 }, { "analysis_explanation": null, "end": 12988, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 12933 }, { "analysis_explanation": null, "end": 13155, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 13100 }, { "analysis_explanation": null, "end": 13292, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 13237 }, { "analysis_explanation": null, "end": 13423, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 13371 }, { "analysis_explanation": null, "end": 13651, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 13547 }, { "analysis_explanation": null, "end": 13840, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 13758 }, { "analysis_explanation": null, "end": 14113, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 14021 }, { "analysis_explanation": null, "end": 14465, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 14373 }, { "analysis_explanation": null, "end": 14642, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 14575 }, { "analysis_explanation": null, "end": 14941, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 14840 }, { "analysis_explanation": null, "end": 15304, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 15229 }, { "analysis_explanation": null, "end": 15885, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 15797 }, { "analysis_explanation": null, "end": 15831, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 15821 }, { "analysis_explanation": null, "end": 16188, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 16107 }, { "analysis_explanation": null, "end": 16348, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 16317 }, { "analysis_explanation": null, "end": 16539, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 16453 }, { "analysis_explanation": null, "end": 16498, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 16488 }, { "analysis_explanation": null, "end": 16802, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 16665 }, { "analysis_explanation": null, "end": 16717, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 16707 }, { "analysis_explanation": null, "end": 17052, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 16984 }, { "analysis_explanation": null, "end": 17378, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 17266 }, { "analysis_explanation": null, "end": 17301, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 17291 }, { "analysis_explanation": null, "end": 17600, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 17556 }, { "analysis_explanation": null, "end": 17822, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 17723 }, { "analysis_explanation": null, "end": 18009, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 17965 }, { "analysis_explanation": null, "end": 18162, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 18116 }, { "analysis_explanation": null, "end": 18418, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 18377 }, { "analysis_explanation": null, "end": 18630, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 18528 }, { "analysis_explanation": null, "end": 18869, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 18828 }, { "analysis_explanation": null, "end": 19255, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 19211 }, { "analysis_explanation": null, "end": 19455, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 19363 }, { "analysis_explanation": null, "end": 19682, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 19578 }, { "analysis_explanation": null, "end": 19830, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 19784 }, { "analysis_explanation": null, "end": 20014, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 19932 }, { "analysis_explanation": null, "end": 20151, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 20096 }, { "analysis_explanation": null, "end": 20355, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 20254 }, { "analysis_explanation": null, "end": 20549, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 20468 }, { "analysis_explanation": null, "end": 20709, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 20654 }, { "analysis_explanation": null, "end": 20897, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 20811 }, { "analysis_explanation": null, "end": 20856, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 20846 }, { "analysis_explanation": null, "end": 21180, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 21105 }, { "analysis_explanation": null, "end": 21389, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 21301 }, { "analysis_explanation": null, "end": 21335, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 21325 }, { "analysis_explanation": null, "end": 21678, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 21637 }, { "analysis_explanation": null, "end": 21873, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 21781 }, { "analysis_explanation": null, "end": 22004, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 21952 }, { "analysis_explanation": null, "end": 22177, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 22110 }, { "analysis_explanation": null, "end": 22401, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 22302 }, { "analysis_explanation": null, "end": 22662, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 22525 }, { "analysis_explanation": null, "end": 22577, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 22567 }, { "analysis_explanation": null, "end": 22859, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 22791 }, { "analysis_explanation": null, "end": 22825, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 22815 }, { "analysis_explanation": null, "end": 23121, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 23009 }, { "analysis_explanation": null, "end": 23044, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 23034 }, { "analysis_explanation": null, "end": 23377, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 23336 }, { "analysis_explanation": null, "end": 23592, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 23537 }, { "analysis_explanation": null, "end": 23750, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 23719 }, { "analysis_explanation": null, "end": 23958, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 23856 }, { "analysis_explanation": null, "end": 13722, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 13715 }, { "analysis_explanation": null, "end": 14260, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 14253 }, { "analysis_explanation": null, "end": 15671, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 15664 }, { "analysis_explanation": null, "end": 19896, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 19889 }, { "analysis_explanation": null, "end": 18868, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18857 }, { "analysis_explanation": null, "end": 21677, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 21666 }, { "analysis_explanation": null, "end": 3557, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3553 }, { "analysis_explanation": null, "end": 3774, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3770 }, { "analysis_explanation": null, "end": 3943, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3939 }, { "analysis_explanation": null, "end": 4357, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4353 }, { "analysis_explanation": null, "end": 10716, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 10712 }, { "analysis_explanation": null, "end": 10806, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 10802 }, { "analysis_explanation": null, "end": 12484, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 12480 }, { "analysis_explanation": null, "end": 13649, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 13640 }, { "analysis_explanation": null, "end": 13649, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 13640 }, { "analysis_explanation": null, "end": 13649, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 13640 }, { "analysis_explanation": null, "end": 14407, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 14399 }, { "analysis_explanation": null, "end": 17310, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 17302 }, { "analysis_explanation": null, "end": 19680, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 19671 }, { "analysis_explanation": null, "end": 19680, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_140094861021536", "recognizer_name": "UsPassportRecognizer" }, "score": 0.05, "start": 19671 }, { "analysis_explanation": null, "end": 19680, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 19671 }, { "analysis_explanation": null, "end": 21815, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 21807 }, { "analysis_explanation": null, "end": 23053, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 23045 }, { "analysis_explanation": null, "end": 13649, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 13640 }, { "analysis_explanation": null, "end": 13649, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 13640 }, { "analysis_explanation": null, "end": 13649, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 13640 }, { "analysis_explanation": null, "end": 14407, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 14399 }, { "analysis_explanation": null, "end": 15879, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 15873 }, { "analysis_explanation": null, "end": 16186, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16180 }, { "analysis_explanation": null, "end": 17310, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17302 }, { "analysis_explanation": null, "end": 18868, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 18862 }, { "analysis_explanation": null, "end": 19680, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 19671 }, { "analysis_explanation": null, "end": 19680, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 0.01, "start": 19671 }, { "analysis_explanation": null, "end": 19680, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.01, "start": 19671 }, { "analysis_explanation": null, "end": 20547, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 20541 }, { "analysis_explanation": null, "end": 21383, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 21377 }, { "analysis_explanation": null, "end": 21677, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 21671 }, { "analysis_explanation": null, "end": 21815, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 21807 }, { "analysis_explanation": null, "end": 23053, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 23045 } ]
[ "Apple investment pledge sends US markets to new records\n\n05:00, 18 January 2018\n· By Michael Hewson\n\nShare\n\nWhile European markets had a disappointing day yesterday, the late evaporation of strong early gains in US markets on Tuesday turned out to be a temporary blip, as the Dow rallied over 300 points, with most of the gains helped by an afternoon announcement from Apple about its future investment plans in the US.", "\n\nThe company said that as a result of the recent changes in US tax laws that it would look to expand its operations in the US by creating around 20,000 new jobs, while also repatriating a significant amount of the US dollar it currently holds overseas over the next few years. ", "The estimated sums are expected to be in the hundreds of billions of US dollars, while the company also announced it would be paying a one-off tax bill of $38bn.", "\n\nNot surprisingly tech stocks also rallied sharply on an expectation that we could see similar moves by other US companies who have large overseas cash piles, with the S&P500 also making a record close above 2,800.", "\n\nFor all the criticism of President Trump, the nature of his presidency and his economic policies, he appears to have got what he wanted in prompting US companies to reinvest their profits back into the US economy.", "\n\nWe also saw the US dollar bounce strongly on the back of the same news, as well as a positive Beige Book survey, with yields also pushing higher as markets started to price in a faster face of prospective rate rises, with both Charles Evans of the Chicago Fed and Robert Kaplan of the Dallas Fed painting a positive outlook for the US economy, with the prospect of three rate rises this year as a base case scenario.", "\n\nThe euro slipped back after a number of ECB officials said they were uncomfortable with the current level of the single currency with ECB Vice President Constancio saying there was no justification for it to be at current levels. ", "With an ECB meeting next week it is quite likely that with inflation well below the target rate of 2%, any further gains are likely to result in further verbal interventions between now and then.", "\n\nThe strength of the euro does appear to be acting as a drag on European markets and the DAX in particular which has continued to struggle to get anywhere near to the record highs that we saw in November last year.", "\n\nThe pound continues to squeeze the pessimists until the pips squeak hitting a new post Brexit peak against the US dollar at 1.3943 yesterday before retreating. ", "It also had a good day against the euro hitting a four week high and its best level this year, after MPC member Michael Saunders gave a fairly balanced outlook for the UK economy for the coming months, saying that further rate rises would probably be needed over time.", "\n\nIn Asia markets there have continued to remain buoyant with the main focus this morning on the latest Chinese Q4 GDP numbers as well as December industrial production and retail sales.", "\n\nThe Chinese economy is expected to end 2017 on a strong note with retail sales in particular showing a particular resilience as the Chinese authorities attempt to rebalance the economy towards a more consumption based model. ", "A crackdown on pollution and a move away from the traditional smokestack industries towards a more technology and consumption based economy has seen a much stronger economic performance than expected this year.", "\n\nQ4 GDP is expected to come in at 6.7 % rounding off a much better than expected year than was expected to be the case at the beginning of 2017, given the target was 6.5%.", "\n\nRetail sales are expected to come in at 10.1%, while industrial production is expected to rise 6.1%, both slightly down from the November numbers.", "\n\nNot surprisingly given this positive backdrop markets in Europe look set to open higher this morning after last night’s gains on Wall Street, though investors will also be making a note of comments from Bundesbank chief Jens Weidmann, and in particular his views on the timing of when the ECB might look to stop their bond buying program, as well as the timing of potential rate rises.", "\n\nEURUSD – the failure to push above 1.2300 has seen the euro slide back towards support at the 1.2160/70 area. ", "A break here has the potential to target a retest of the 1.2080 area. ", "The bias remains for a move towards the 1.2600 area and 61.8% retracement level of the 1.3995/1.0340 down move.", "\n\nGBPUSD – yesterday’s move above the 1.3830 area saw the pound push up towards the 1.3980 area, pulling back from 1.3943. ", "The 1.3980 area is the 38.2% retracement of the 1.7190/1.1950 down move and a significant obstacle to a move through 1.4000. ", "Support comes in at the 1.3650 area and or 1.3500.", "\n\nEURGBP – the failure to overcome the 100 day MA at 0.8910 has seen the euro slip back to the 0.8805/10 area. ", "This needs to hold to prevent a move back to 0.8740. ", "Above 0.8910 targets the 0.9000 area.", "\n\nUSDJPY – rebounded from the support area at 110.10 but needs to move above the 111.50 area to retarget the 112.00 area.", "\n\nCMC Markets is an execution only service provider. ", "The material (whether or not it states any opinions) is for general information purposes only, and does not take into account your personal circumstances or objectives. ", "Nothing in this material is (or should be considered to be) financial, investment or other advice on which reliance should be placed. ", "No opinion given in the material constitutes a recommendation by CMC Markets or the author that any particular investment, security, transaction or investment strategy is suitable for any specific person.", "\n\nInvesting in CMC Markets derivative products carries significant risks and is not suitable for all investors. ", "You could lose more than your deposits. ", "You do not own, or have any interest in, the underlying assets. ", "We recommend that you seek independent advice and ensure you fully understand the risks involved before trading. ", "Spreads may widen depending on liquidity and market volatility. ", "The information on this website is prepared without considering your objectives, financial situation or needs. ", "Consequently, you should consider the information in light of your objectives, financial situation and needs.", "\n\nDigital 100s and Countdowns carry a level of risk to your capital as you could lose all of your investment. ", "These products may not be suitable for all clients therefore ensure you understand the risks and seek independent advice. ", "Invest only what you can afford to lose.", "\n\nCMC Markets UK plc (173730) and CMC Spreadbet plc (170627) are authorised and regulated by the Financial Conduct Authority in the United Kingdom.", "\n\nCMC Markets Asia Pacific Pty Ltd ABN 11 100 058 213, AFSL No. ", "238054 (the derivative product issuer), CMC Markets Stockbroking Limited, Participant of the ASX Group (Australian Securities Exchange) and APX (Asia Pacific Exchange), ABN 69 081 002 851, AFSL No. ", "246381 (the stockbroking services provider) provides the financial products and/or services. ", "It's important for you to consider the relevant Product Disclosure Statement ('PDS') and any other relevant CMC Markets Documents before you decide whether or not to acquire any of the financial products. ", "Our Financial Services Guide contains details of our fees and charges. ", "All of these documents are available at cmcmarkets.com.au or you can call us on 1300 303 888.", "\n\nInformation relating to the Marketmaker trading platform can be found on our Marketmaker website.", "\n\nThis website uses cookies to obtain information about your general internet usage. ", "Removal of cookies may affect the operation of certain parts of this website. ", "For more information about cookies and how to remove them, please read our cookie policy.", "\n\nTax treatment depends on the individual circumstances of each client. ", "Tax law can change or may differ depending on the jurisdiction in which you are resident." ]
{ "pile_set_name": "Pile-CC" }
[ 0.007159904534606206, 0, 0, 0.004651162790697674, 0.004651162790697674, 0.011961722488038277, 0.004310344827586207, 0, 0, 0.012345679012345678, 0.007462686567164179, 0, 0, 0, 0.005813953488372093, 0.006756756756756757, 0.00516795865633075, 0, 0, 0, 0, 0, 0, 0.009009009009009009, 0, 0, 0.008264462809917356, 0, 0, 0, 0.004901960784313725, 0, 0, 0, 0, 0, 0, 0, 0.00909090909090909, 0, 0, 0.013605442176870748, 0.015625, 0.03535353535353535, 0, 0, 0, 0.010752688172043012, 0.010101010101010102, 0, 0, 0, 0, 0 ]
0.003463
5
[ { "analysis_explanation": null, "end": 6645, "entity_type": "AU_ABN", "recognition_metadata": { "recognizer_identifier": "AuAbnRecognizer_140094861024272", "recognizer_name": "AuAbnRecognizer" }, "score": 1, "start": 6631 }, { "analysis_explanation": null, "end": 6645, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 1, "start": 6634 }, { "analysis_explanation": null, "end": 6843, "entity_type": "AU_ABN", "recognition_metadata": { "recognizer_identifier": "AuAbnRecognizer_140094861024272", "recognizer_name": "AuAbnRecognizer" }, "score": 1, "start": 6829 }, { "analysis_explanation": null, "end": 6843, "entity_type": "AU_ACN", "recognition_metadata": { "recognizer_identifier": "AuAcnRecognizer_140094861021344", "recognizer_name": "AuAcnRecognizer" }, "score": 1, "start": 6832 }, { "analysis_explanation": null, "end": 6843, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 1, "start": 6832 }, { "analysis_explanation": null, "end": 32, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30 }, { "analysis_explanation": null, "end": 79, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57 }, { "analysis_explanation": null, "end": 106, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85 }, { "analysis_explanation": null, "end": 122, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 114 }, { "analysis_explanation": null, "end": 164, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 155 }, { "analysis_explanation": null, "end": 214, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 212 }, { "analysis_explanation": null, "end": 233, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 226 }, { "analysis_explanation": null, "end": 350, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 341 }, { "analysis_explanation": null, "end": 418, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 416 }, { "analysis_explanation": null, "end": 481, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 479 }, { "analysis_explanation": null, "end": 544, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 542 }, { "analysis_explanation": null, "end": 635, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 633 }, { "analysis_explanation": null, "end": 694, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 676 }, { "analysis_explanation": null, "end": 969, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 967 }, { "analysis_explanation": null, "end": 1112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1107 }, { "analysis_explanation": null, "end": 1223, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1221 }, { "analysis_explanation": null, "end": 1276, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1274 }, { "analysis_explanation": null, "end": 1304, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1302 }, { "analysis_explanation": null, "end": 1526, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1513 }, { "analysis_explanation": null, "end": 1563, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1550 }, { "analysis_explanation": null, "end": 1620, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1618 }, { "analysis_explanation": null, "end": 1677, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1668 }, { "analysis_explanation": null, "end": 1866, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1856 }, { "analysis_explanation": null, "end": 1962, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1953 }, { "analysis_explanation": null, "end": 2200, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2192 }, { "analysis_explanation": null, "end": 2341, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2323 }, { "analysis_explanation": null, "end": 2456, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2454 }, { "analysis_explanation": null, "end": 2483, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2474 }, { "analysis_explanation": null, "end": 2525, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2515 }, { "analysis_explanation": null, "end": 2562, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2553 }, { "analysis_explanation": null, "end": 2596, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2587 }, { "analysis_explanation": null, "end": 2631, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2615 }, { "analysis_explanation": null, "end": 2673, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2671 }, { "analysis_explanation": null, "end": 2703, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2686 }, { "analysis_explanation": null, "end": 2779, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2775 }, { "analysis_explanation": null, "end": 2859, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2847 }, { "analysis_explanation": null, "end": 2881, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2874 }, { "analysis_explanation": null, "end": 2916, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2908 }, { "analysis_explanation": null, "end": 2968, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2961 }, { "analysis_explanation": null, "end": 3000, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2992 }, { "analysis_explanation": null, "end": 3096, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3089 }, { "analysis_explanation": null, "end": 3391, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3382 }, { "analysis_explanation": null, "end": 3535, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3514 }, { "analysis_explanation": null, "end": 3701, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3693 }, { "analysis_explanation": null, "end": 3774, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3768 }, { "analysis_explanation": null, "end": 3811, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3799 }, { "analysis_explanation": null, "end": 3828, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3818 }, { "analysis_explanation": null, "end": 3944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3931 }, { "analysis_explanation": null, "end": 4395, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4389 }, { "analysis_explanation": null, "end": 4407, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4398 }, { "analysis_explanation": null, "end": 4730, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4719 }, { "analysis_explanation": null, "end": 4743, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4737 }, { "analysis_explanation": null, "end": 4892, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4886 }, { "analysis_explanation": null, "end": 4936, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4930 }, { "analysis_explanation": null, "end": 6592, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6574 }, { "analysis_explanation": null, "end": 7280, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 7263 }, { "analysis_explanation": null, "end": 4377, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 4364 }, { "analysis_explanation": null, "end": 4788, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 4779 }, { "analysis_explanation": null, "end": 1031, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1027 }, { "analysis_explanation": null, "end": 2884, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 2882 }, { "analysis_explanation": null, "end": 3395, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3393 }, { "analysis_explanation": null, "end": 6645, "entity_type": "AU_TFN", "recognition_metadata": { "recognizer_identifier": "AuTfnRecognizer_140094861022688", "recognizer_name": "AuTfnRecognizer" }, "score": 0.1, "start": 6634 }, { "analysis_explanation": null, "end": 6474, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6468 }, { "analysis_explanation": null, "end": 6505, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6499 }, { "analysis_explanation": null, "end": 6662, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6656 }, { "analysis_explanation": null, "end": 6860, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6854 } ]
[ "Oracle Code One Reimagined\n\nPrioritizing the health and safety of our attendees, Oracle Code One will not take place in Las Vegas this fall. ", "The in-person conference will be replaced with a series of free virtual events. ", "We are excited to stay connected with you online and look forward to reuniting at physical events in 2021." ]
{ "pile_set_name": "OpenWebText2" }
[ 0, 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 129, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 120 }, { "analysis_explanation": null, "end": 139, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 130 }, { "analysis_explanation": null, "end": 326, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 322 } ]
[ "Friday, May 27, 2016\n\nAs the old saying goes-- close but no cigar! ", "Hoping Uncle Walter would be released today- but we are still here in the Gainesville VA Hospital. ", "He is on the mend and we should be on the way home sometime this weekend. ", "I had to bribe him with a cherry sprite from Steak-N-Shake to hang out here for just a little longer! ", "So-- the farmhouse will be closed again this weekend and we will be back to regular hours next weekend- hope to see you then!", "\n\nSunday, May 1, 2016\n\nHave you any wool? ", "We'll I've got tons of it, and I love anything with sheep on it! ", "This is one of our new bracket signs-it's made from heavy gauge metal with a wonderful rusty finish, it's double sided so you can see it coming or going! ", "This is a big sign and would look great on your porch or inside, the wool sign is offset and hangs from old fence pieces. ", "This is an original design and hand-made right here at the farmhouse- I love it when an idea comes out just like you picture it!" ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0.010101010101010102, 0, 0, 0, 0, 0, 0, 0, 0 ]
0.00101
5
[ { "analysis_explanation": null, "end": 20, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 238, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 226 }, { "analysis_explanation": null, "end": 394, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 382 }, { "analysis_explanation": null, "end": 445, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 432 }, { "analysis_explanation": null, "end": 487, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 468 } ]
[ "Q:\n\nSelf-reference object in chained method calls\n\nHow do you reference the chained method's object in that same method's arguments. ", "Let's say you have a number of chained method calls that trim/substring a string like so:\nstr.", "Substring(varLen1).Substring(varLen2).Substring(1,##self##.Length-2)\n\nThe problem is that because the length of the string is now unknown and different from the original string's length, how do I substring like in the last call (a substring where the index and length may depend on the string itself).", "\nThanks!", "\n\nA:\n\nIn short, no.", "\nThough with an extension method you could capture ##self## and use a lambda to continue the expression.", "\npublic static TResult WithSelf<TSource, TResult> (this TSource x, Func<TSource, TResult> f)\n{\n return f (x);\n}\n\nstr.", "Substring (STDIN_PFX_FN.Length)\n .Trim (new char[] {'\"', ' '})\n .WithSelf (x => x.Substring (1, x.Length - 2))\n\nI tend to think that ends up more complicated to read and uglier and simply prefer to create a separate function.", "\nstr = Clean(str);\n\nprivate string Clean (string str)\n{\n str = str.", "Substring (STDIN_PFX_FN.Length).Trim (new char[] {'\"', ' '});\n return str.", "Substring (1, str.", "Length - 2);\n}\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0.0033222591362126247, 0, 0, 0, 0.041666666666666664, 0.004329004329004329, 0, 0, 0, 0 ]
0.00411
5
[ { "analysis_explanation": null, "end": 1027, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1012 }, { "analysis_explanation": null, "end": 870, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 866 } ]
[ "Travel News & Stories\n\nIndia\n\nThu Nov. 20th 2014\n\nNicola has just returned from her FIFTH trip to India in as many years - a favourite destination without a doubt!", "\n\nSome excerpts from her blog as she travelled ...\n\nCars, Cows & Chaos - my thoughts have been racing, my senses have seen, smelt, felt and touched (well trying to do less of that!) ", "everything. ", "My taste buds have been soaring. ", "But most of all my heart has been massaged beyond belief; racing heart, tight heart, happy and heavy. ", "It has certainly become more expanded.", "This country is a true paradox; unbelievable beauty vs shameful rubbish dumped everywhere. ", "Smiling faces on the poorest of urchins. ", "Tooting, hooting driving around the slow moving cow.", "The easy head wobble of ‘sure – why not’ vs the scramble to sell you a memory card as you step out of the bus.", "And I now have 8 other enthusiasts for this mind blowing confusing and yet fabulous country. ", "We are all having a wonderful time together\n\nDelhi was a wonderful introduction – sights, getting used to the traffic and the food. ", "Bharat’s jokes started off easy. ", "The Murghal Emperors, and Hindu Gods. ", "The introduction of the masala dosa for breakfast.", "\n\nVaranasi was challenging. ", "Trying to understand the sacred river that they worship and yet can pollute it at the same time. ", "Bharat gave us some wonderful words to think about\n\nFlying to Khajuraho gave us our first chance to have a couple of hours of relaxation. ", "Then we went to the temples to see the incredibly intricate carvings and the beauty that they could create out of stone. ", "Starting in 950 AD many are still in perfect condition. ", "It is incredible (over used word in India but what do you do – it is !!)", "\n\nDriving to Orchha on Diwali day was amazing – everyone was out painting their front areas in bright colourful colours. ", "We stopped at a home to say happy Diwali and then we stopped at a village to see if we could help with the painting. ", "The few people standing by to observe our antics grew from 2 to 200 in about 5 minutes. ", "It was such fun. ", "I used my finger to help paint and that was deemed hilarious by the locals. ", "We were painting on very nicely dried cow dung – great platform – you might like to try it!", "\n\nThen to Orchha for some Diwali celebrations at the Temple – and some fireworks !", "\n\nThen to Agra by train and the Taj. ", "It may be my 6th visit but her beauty has never diminished. ", "Her proportions and colours are incomparable. ", "The road conditions were dreadful. ", "The cows, camels, jugards, Massey Fergusson tractors, people, big trucks, carts – what have I missed – they were all out that day !!", "\n\nAnyway we get to the calm, stunningly beautiful Sher Bagh Hotel and we are in sarfari mode. ", "We take off in 2 jeeps looking for tiger. ", "Our jeep saw something a little more rare than a tiger – a leopard. ", "Our naturalist said best sighting in 24 years. ", "He walked along beside us for about 10 minutes and the other group saw a tiger and her 3 cubs. ", "Huge success. ", "Buzzing was an understatement! ", "We sat round the camp fire with a vodka lime and soda and talked safari stories!", "\n\nAnother big drive to Jaipur . ", "Jaipur was fabulous – some great shopping, the beautiful Amber Fort and a sunrise visit to the Ganesh Temple after walking up 300 stairs that will stay with me forever.", "\n\nYesterday we drove into the countryside of Jaipur to a place called Savista Retreat. ", "Today has been our day of rest! ", "A camel ride for some, a walk for others and some have had a cooking class and cooked the dinner for tonight !", "\n\nIndia is wildly exciting but you do need to have a little time to download all those thoughts and emotions in a peaceful place. ", "And Savista is just that.", "So tomorrow we are off to Pushkar – no rest there – camels, people, dust, camels, Brahman Temple and did I mention camelsWe have so much more to experience it’s hard to imagine how my senses will cope – but I know they will!", "\n\nWell I am at Delhi airport. ", "What a trip, what a journey, what an experience.", "The last few days just kept getting better – which was hard to believe could be possible.", "Udaipur – with our wonderful hotel right on the lake (you could do your own washing out the bedroom window!)The fine detail of the paintings and the peacock room of the City PalaceThe city lights and the almost full moon lighting up the Lake at night.", "Devi Garh – this magical hotel that was a Palace nestled amongst the Aravali mountains was a true home for the Princesses.", "Sitting outside for dinner with our own musician was pretty special!The 9 hour drive to Jodhpur didn’t seem that bad !!!!!! ", "as we stopped at the unbelievable temples of Ranakpur, the Bishnoi Villages with a welcome drink of liquid opium, and the Most wonderful durrie rug maker!Phew – then Jodhpur – with the massive Mehrangarh Fort towering over us as we sit at the sunset bar at our hotel feeling like we could almost be part of the Royal Family life" ]
{ "pile_set_name": "Pile-CC" }
[ 0.018404907975460124, 0.005494505494505495, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007575757575757576, 0.030303030303030304, 0.02631578947368421, 0, 0.03571428571428571, 0, 0.007246376811594203, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02702702702702703, 0, 0, 0, 0.007575757575757576, 0.010638297872340425, 0, 0, 0, 0, 0, 0, 0, 0.03125, 0.011904761904761904, 0.022988505747126436, 0, 0, 0, 0.04, 0.004464285714285714, 0, 0, 0, 0.00796812749003984, 0.02459016393442623, 0, 0.009146341463414634 ]
0.005868
5
[ { "analysis_explanation": null, "end": 48, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30 }, { "analysis_explanation": null, "end": 103, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98 }, { "analysis_explanation": null, "end": 120, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107 }, { "analysis_explanation": null, "end": 969, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 964 }, { "analysis_explanation": null, "end": 1115, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1110 }, { "analysis_explanation": null, "end": 1181, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1173 }, { "analysis_explanation": null, "end": 1302, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1296 }, { "analysis_explanation": null, "end": 1418, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1401 }, { "analysis_explanation": null, "end": 1573, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1567 }, { "analysis_explanation": null, "end": 1652, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1647 }, { "analysis_explanation": null, "end": 1715, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1705 }, { "analysis_explanation": null, "end": 2006, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1991 }, { "analysis_explanation": null, "end": 2207, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2201 }, { "analysis_explanation": null, "end": 2286, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2282 }, { "analysis_explanation": null, "end": 2493, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2477 }, { "analysis_explanation": null, "end": 2830, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2822 }, { "analysis_explanation": null, "end": 2878, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2862 }, { "analysis_explanation": null, "end": 3080, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3074 }, { "analysis_explanation": null, "end": 3089, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3083 }, { "analysis_explanation": null, "end": 3261, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3252 }, { "analysis_explanation": null, "end": 3301, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3295 }, { "analysis_explanation": null, "end": 3342, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3337 }, { "analysis_explanation": null, "end": 3359, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3352 }, { "analysis_explanation": null, "end": 3477, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3470 }, { "analysis_explanation": null, "end": 3485, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3480 }, { "analysis_explanation": null, "end": 3645, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3637 }, { "analysis_explanation": null, "end": 3667, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3660 }, { "analysis_explanation": null, "end": 3953, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3936 }, { "analysis_explanation": null, "end": 4033, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4026 }, { "analysis_explanation": null, "end": 4209, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4195 }, { "analysis_explanation": null, "end": 4276, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4271 }, { "analysis_explanation": null, "end": 4287, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4278 }, { "analysis_explanation": null, "end": 4354, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4347 }, { "analysis_explanation": null, "end": 4479, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4473 }, { "analysis_explanation": null, "end": 4496, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4489 }, { "analysis_explanation": null, "end": 4578, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4570 }, { "analysis_explanation": null, "end": 4600, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4580 }, { "analysis_explanation": null, "end": 4668, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4662 }, { "analysis_explanation": null, "end": 4698, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4691 } ]
[ "Conventional ratchet wrenches have the following disadvantages in design and use:\n1. ", "To turn a nut which is just put on a screw or just loosened, a conventional ratchet wrench must be swung. ", "If there is no space for such swing, the wrench should be substituted by hand. ", "When turning a nut unaccessible to hand, such as the replacing of a spark plug, operation difficulties would take place. ", "PA1 2. ", "A conventional ratchet wrench with direction change knob is to tighten the nut when the knob is turned counterclockwise. ", "This would make the user confused in direction changing, especially when the nut is turned over a screw upside down.", "\nTo eliminate these disadvantages, the inventor developed a ratchet handle of which the ratchet head will turn in the same clockwise or counterclockwise direction as the handle does and which can turn a nut without need to swing the handle. ", "It can also be turned as a whole like a conventional ratchet wrench. ", "So the convenience for use in different places and conditions is greatly increased.", "\nAnother purpose of this invention is to provide a ratchet handle of which the handle turns in the same direction as the nut is turned. ", "Thus, the operator will not be confused in changing the clockwise/counterclockwise direction." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
0
5
[]
[ "Athletics\n\nNorth Central University Athletics is developing student athletes–in mind, body, and spirit.", "\n\nWhy you should be a Ram\n\nAt North Central University, the athletic program is an integral part of your educational journey, propelling you to grow in all aspects of your life.", "\n\nDuring your time on a Rams athletic team, you will be challenged to develop Christian character with sound, biblical habits that will help you to be successful in the athletic arena and also in your daily living." ]
{ "pile_set_name": "Pile-CC" }
[ 0.009708737864077669, 0.005649717514124294, 0 ]
0.005119
5
[ { "analysis_explanation": null, "end": 365, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 356 } ]
[ "Efficacy and safety of late-course hypofractionated radiation therapy for muscle-invasive bladder carcinoma after bladder-conserving surgery.", "\nTo evaluate the efficacy and safety of late-course hypofractionated radiation treatment of muscle-invasive bladder carcinoma after bladder-conserving surgery. ", "Seventy-six patients with transitional cell bladder carcinoma, stage II (T2-4N0M0), after transurethral resection, were enrolled. ", "Pirarubicin was given at 30 mg/m2 and 100 mL physiological saline once weekly (QW) for 12 weeks through and after intravesical instillation postoperatively. ", "Radiation schedule delivered 46 Gy in 20 fractions for planning target volume, with an additional 20 Gy in five fractions for gross tumor volume as late-course radiation. ", "Chemotherapy was stopped if Radiation Therapy Oncology Group grade 3 or higher bladder or bowel toxicity occurred. ", "The primary end points were acute toxicity, local control and patients' survival. ", "One-, three- and five-year overall survival rates were 98, 78 and 69.5%, respectively. ", "Mean survival time was 58.4 months (95% CI: 52.6, 64.2). ", "In addition, 1-, 3- and 5-year local control rates were 100, 80.5 and 76.1%, respectively. ", "Mean local control time was 60.7 months (95% CI: 55.1, 66.3). ", "The cumulative incidence of local/regional failure and distant failure was 28.9%. ", "The rate of single local/regional failure was 13.2%, but distant failure rate was 21.1%. ", "Concurrent pirarubicin-based late-course hypofractionated radiation therapy showed desirable local control rate and acceptable toxicity. ", "It could be used after bladder-conserving surgery to allow patients to preserve their bladder." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0.007692307692307693, 0.006369426751592357, 0, 0.008695652173913044, 0, 0, 0, 0, 0.016129032258064516, 0, 0, 0, 0 ]
0.002592
5
[ { "analysis_explanation": null, "end": 526, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 518 }, { "analysis_explanation": null, "end": 982, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 973 }, { "analysis_explanation": null, "end": 1017, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1015 }, { "analysis_explanation": null, "end": 1077, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1066 }, { "analysis_explanation": null, "end": 1130, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1124 }, { "analysis_explanation": null, "end": 1230, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1219 }, { "analysis_explanation": null, "end": 376, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 374 } ]
[ "Q:\n\nAVL Tree Left Rotation\n\nI'm righting an AVL Tree class and I'm having trouble with my \"rotateLeft\" method. ", "I'm getting a null pointer exception and I'm not sure what's causing it. ", "Here is the class: \npublic class AVLNode {\n\n// Fields\nint data;\nAVLNode left;\nAVLNode right;\nint height;\n\n// Constructors\nAVLNode (int data) {\n this(data, null, null);\n}\n\nAVLNode (int data, AVLNode left, AVLNode right) {\n this.data = data;\n this.left = left;\n this.right = right;\n this.height = 0;\n}\n\n// Returns: new root of this subtree\n public AVLNode insert (int value, AVLNode rt) {\n if (rt == null)\n return new AVLNode(value, null, null);\n if (value < rt.data)\n rt.left = insert(value, rt.left);\n else if (value > rt.data)\n rt.right = insert(value, rt.right);\n // else this is a duplicate, do nothing\n rt.height = Math.max(height(rt.left), height(rt.right)) + 1;\n return balance(rt);\n }\n\n // Returns : String representation of tree root at this node\n public String toString() {\n return toString(this);\n }\n\n // Returns : String representation of tree root at rt\n private String toString(AVLNode rt) {\n if (rt == null)\n return \"\";\n if (rt.left == null && rt.right == null)\n return rt.data + \" \";\n String result = rt.data + \" \";\n if (rt.left !", "= null)\n result += toString(rt.left);\n if (rt.right !", "= null)\n result += toString(rt.right);\n return result;\n\n}\n\n // Returns: height of largest subtree, -1 if n is null\n private int height (AVLNode n) {\n return n == null ? ", "-1 : n.height;\n }\n\n //calculates balance between the nodes\n private int getBalance(AVLNode rt) { \n if (rt == null) return 0; \n return height(rt.left) - height(rt.right); \n }\n\n // Returns: new root of this subtree after balancing\n private AVLNode balance (AVLNode rt) {\n int bal = getBalance(rt);\n if (rt == null) return rt;\n\n // Rotate L case\n if (bal > 1 && data < rt.left.data) {\n return rotateRight(rt); \n }\n\n // Rotate R case\n if (bal < -1 && data > rt.right.data) {\n return rotateLeft(rt); \n }\n\n // Double rotate LR\n if (bal > 1 && data > rt.left.data) {\n return doubleRotateLeftRight(rt);\n } \n\n // Double rotate RL\n if (bal < -1 && data < rt.right.data) {\n return doubleRotateRightLeft(rt); \n }\n\n return rt;\n }\n\n // Returns: new root after single rotation of this rt right\n private AVLNode rotateRight(AVLNode rt) {\n //creates new node with the left value of rt as the root\n AVLNode y = rt.left;\n //creates a new node with a null value\n AVLNode rt2 = y.right; \n\n // do rotation\n y.right = rt; \n rt.left = rt2;\n\n //update height of both nodes\n rt.height = Math.max(height(rt.left), height(rt.right)) + 1;\n y.height = Math.max(height(y.left), height(y.right)) + 1;\n\n // Return the new root \n return y; \n }\n\n // Param: AVLNode rt\n // Returns: new root after single rotation of this rt left\n private AVLNode rotateLeft(AVLNode rt) {\n //creates new node with the right values of rt as the root\n AVLNode x = rt.right;\n //creates a new node with a null value\n AVLNode rt2 = x.left; \n\n // do rotation\n x.left = rt; \n rt.right = rt2; \n\n //update height of both nodes\n rt.height = Math.max(height(rt.left), height(rt.right)) + 1;\n x.height = Math.max(height(x.left), height(x.right)) + 1;\n\n // Return the new root \n return x; \n }\n\n private AVLNode doubleRotateLeftRight(AVLNode rt) {\n rt.left = rotateLeft(rt.left);\n rotateRight(rt);\n return rt;\n }\n\n private AVLNode doubleRotateRightLeft(AVLNode rt) {\n rt.right = rotateRight(rt.right);\n rotateLeft(rt);\n return rt;\n }\n}\n\nThis is the error specifically:\nException in thread \"main\" java.lang.", "NullPointerException\n at AVLNode.rotateRight(AVLNode.java:118)\n at AVLNode.balance(AVLNode.java:96)\n at AVLNode.insert(AVLNode.java:42)\n at AVLNode.insert(AVLNode.java:37)\n at AVLTest.main(AVLTest.java:22)\n\nThis is the test case that I am using: 60,10,61,9,8. ", "It is when I'm adding 8 into the tree where I run into the error. ", "I believe the error lies in the method itself but i'm not entirely sure on what's causing the problem. ", "Any help would be greatly appreciated.", "\n\nA:\n\nI was able to figure out the problem, the method will go into one of the double rotation methods and try to rotate the sub tree twice when it doesn't have to. ", "Which explains the null pointer exception, the solution is to add a balance check for the tree in both of the double rotation methods. ", "\n private AVLNode doubleRotateLeftRight(AVLNode rt) {\n if (getBalance(rt.left) < 0) {\n rt.left= rotateLeft(rt.left);\n return rotateRight(rt);\n } else {\n return rotateRight(rt);\n }\n}\n\nprivate AVLNode doubleRotateRightLeft(AVLNode rt) {\n if (getBalance(rt.right) > 0) {\n rt.right = rotateRight(rt.right);\n return rotateLeft(rt);\n } else {\n return rotateLeft(rt);\n }\n}\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0.01048951048951049, 0, 0.010810810810810811, 0.005754758742806552, 0.0033783783783783786, 0, 0, 0, 0, 0, 0.004694835680751174 ]
0.002702
5
[ { "analysis_explanation": null, "end": 52, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41 }, { "analysis_explanation": null, "end": 224, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 217 }, { "analysis_explanation": null, "end": 255, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 248 }, { "analysis_explanation": null, "end": 269, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 262 }, { "analysis_explanation": null, "end": 313, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 306 }, { "analysis_explanation": null, "end": 365, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 358 }, { "analysis_explanation": null, "end": 384, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 377 }, { "analysis_explanation": null, "end": 398, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 391 }, { "analysis_explanation": null, "end": 552, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 545 }, { "analysis_explanation": null, "end": 579, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 572 }, { "analysis_explanation": null, "end": 1550, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1543 }, { "analysis_explanation": null, "end": 1833, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1826 }, { "analysis_explanation": null, "end": 1850, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1843 }, { "analysis_explanation": null, "end": 1885, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1862 }, { "analysis_explanation": null, "end": 2475, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2468 }, { "analysis_explanation": null, "end": 2576, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2569 }, { "analysis_explanation": null, "end": 2646, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2639 }, { "analysis_explanation": null, "end": 2965, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2951 }, { "analysis_explanation": null, "end": 3038, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3031 }, { "analysis_explanation": null, "end": 3140, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3133 }, { "analysis_explanation": null, "end": 3224, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3204 }, { "analysis_explanation": null, "end": 3286, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3283 }, { "analysis_explanation": null, "end": 3520, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3513 }, { "analysis_explanation": null, "end": 3651, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3644 }, { "analysis_explanation": null, "end": 4657, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4650 }, { "analysis_explanation": null, "end": 4868, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4861 }, { "analysis_explanation": null, "end": 869, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 862 }, { "analysis_explanation": null, "end": 2784, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2777 }, { "analysis_explanation": null, "end": 2850, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2843 }, { "analysis_explanation": null, "end": 3349, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3342 }, { "analysis_explanation": null, "end": 3414, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3407 }, { "analysis_explanation": null, "end": 3836, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3829 }, { "analysis_explanation": null, "end": 3882, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3872 }, { "analysis_explanation": null, "end": 3931, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3921 }, { "analysis_explanation": null, "end": 3975, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3965 }, { "analysis_explanation": null, "end": 4018, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4008 }, { "analysis_explanation": null, "end": 4062, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4052 } ]
[ "Q:\n\nUpdated to Xcode5 simulator through get SIGABRT Error\n\nAn app I recently started and working its keeps crashing with a SIGABRT message. ", "The general message at the top of the debugger says:\nTerminating app due to uncaught exception 'NSUnknownKeyException', reason: '[<UIView 0xb651580> setValue:forUndefinedKey:]: this class is not key value coding-compliant for the key parentEmail.'", "\n\n... At the the bottom it says:\nlibc++abi.dylib: terminating with uncaught exception of type NSException\n(lldb)\n\nLet me know if the \"first throw call stack\" info is necessary to solve this one.", "\n\nA:\n\nCheck and make sure that you didnt previously have a button/text field/label previously linked with an action, then deleted that item. ", "The link still exists. ", "Check and make sure that all your links match to existing items.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.014285714285714285, 0, 0.010309278350515464, 0, 0, 0, 0 ]
0.003514
5
[ { "analysis_explanation": null, "end": 258, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 235 } ]
[ "Q:\n\nHow to set many IRQ to lowest priorty\n\nI see in msinfo32.exe that I have a ACPI-compliant system.", "\nFor IRQs 54 to 511, I want to set them all to the lowest priority.", "\nby using registry\nHKEY_LOCAL_MACHINE\\SYSTEM\\CurrentControlSet\\Control\\PriorityControl\nit's hard to set it one by one \nI want to set all by easy way\nlike \"IRQ54-551Priority\" \nis it possible?", "\n\nA:\n\nCreate and run a .bat file containing the following commands:\n@echo off\necho Windows Registry Editor Version 5.00 >f.reg\necho. ", ">>f.reg\necho [HKEY_LOCAL_MACHINE\\SYSTEM\\CurrentControlSet\\Control\\PriorityControl] >>f.reg\nfor /l %%G IN (54,1,511) DO echo \"IRQ%%GPriority\"=dword:00000001 >>f.reg\n\nThis will create the file f.reg in the current folder that will contain:\nWindows Registry Editor Version 5.00 \n\n[HKEY_LOCAL_MACHINE\\SYSTEM\\CurrentControlSet\\Control\\PriorityControl] \n\"IRQ54Priority\"=dword:00000001 \n\"IRQ55Priority\"=dword:00000001 \n...\n\"IRQ511Priority\"=dword:00000001 \n\nDouble-click on the file f.reg to import all these registry entries.", "\nReplace in the script the 00000001 with the priority that you want\nto assign all these IRQs.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.009900990099009901, 0, 0, 0.022556390977443608, 0.0019305019305019305, 0, 0 ]
0.004913
5
[ { "analysis_explanation": null, "end": 110, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 106 }, { "analysis_explanation": null, "end": 113, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111 }, { "analysis_explanation": null, "end": 1043, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1035 }, { "analysis_explanation": null, "end": 1100, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1096 }, { "analysis_explanation": null, "end": 482, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 478 }, { "analysis_explanation": null, "end": 496, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 492 }, { "analysis_explanation": null, "end": 579, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 575 }, { "analysis_explanation": null, "end": 652, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 648 }, { "analysis_explanation": null, "end": 685, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 681 }, { "analysis_explanation": null, "end": 969, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 965 }, { "analysis_explanation": null, "end": 645, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 637 }, { "analysis_explanation": null, "end": 868, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 860 }, { "analysis_explanation": null, "end": 900, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 892 }, { "analysis_explanation": null, "end": 937, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 929 }, { "analysis_explanation": null, "end": 1043, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1035 }, { "analysis_explanation": null, "end": 645, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 637 }, { "analysis_explanation": null, "end": 868, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 860 }, { "analysis_explanation": null, "end": 900, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 892 }, { "analysis_explanation": null, "end": 937, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 929 }, { "analysis_explanation": null, "end": 1043, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1035 } ]
[ "Hypnosis is the main hallmark of the anesthesia for surgery and any other noxious procedure done in a hospital setting. ", "The level of hypnosis is determined by the extent of noxious stimulation and the availability of supplementation with local/regional anesthesia. ", "The level of anesthesia that prevents the patients from moving in response to the painful stimuli is universally achieved by general anesthesia.", "\n\nDuring induction of general anesthesia the patients go through 4 stages from loss of consciousness to cessation of breathing. ", "However, with introduction of rapidly acting intravenous hypnotic agents, transition of patients through these stages is hardly noticeable. ", "Therefore the stage of excitement and delirium is seldom detected during induction of general anesthesia. ", "This stage is almost exclusively seen in patients who are inadvertently overdosed during moderate sedation with propofol, nowadays.", "\n\nWith advances in safety of the anesthetic agents and evolved monitoring techniques, many more patients undergo invasive interventions who would have originally been denied of anesthesia because of their physiological limitation and severity of their illnesses. ", "As we provide anesthetic care to patients with compromised cardiovascular reserve, a delicate balance should be maintained to preserve the myocardial contractility and systemic vascular resistance as much as possible. ", "Most of the induction agents that are in clinical use, negatively affect cardiac inotropy and cause significant drops in the left ventricular preload and afterload.", "\n\nBarbiturates are the oldest class of hypnotic agents that have been used for intravenous induction of anesthesia. ", "They share the advantage of rapid onset of action and due to their shorter distribution half-life, they do not produce noticeable prolongation of recovery from anesthesia following a single dose administration. ", "However, repeated doses of barbiturates or continuous intravenous administration of these drugs significantly prolong the recovery due to their longer elimination and context sensitive half-lives. ", "Hyperalgesic effects and delayed recovery have limited the use of barbiturates in moderate sedation cases. ", "Additionally, barbiturates posses a significant negative inotropy and venodilatory effects which causes remarkable drops in arterial blood pressures in patients with hypovolemia and preexisting systolic heart failure. ", "Because of these pharmacologic characteristics, the use of barbiturates is not favored in cardiac anesthesia.", "\n\nKetamine differs from barbiturates in its ability to stimulate sympathetic activity and thereby increasing systemic vascular resistance and maintaining blood pressures during induction. ", "It is important to note that in patients with prolonged untreated congestive heart failure where there is a depletion of the sympathetic tone, administration of ketamine may inadvertently cause myocardial suppression and lead to clinical hypotension during the induction of anesthesia. ", "Additional lack of motivation in using ketamine in cardiac patients is due to the increases in myocardial oxygen consumption which is unmatched by limited supply in patients with ischemic heart diseases. ", "Postoperative delirium and hallucination are also frequently reported after clinical use of ketamine that have further limited the use of this anesthetic induction agent.", "\n\nPropofol is the most commonly used induction agent in clinical anesthesia practice among general population. ", "Both induction and recovery are pleasant and welcomed by the patients. ", "Due to shorter half-life, recovery from anesthesia even in patients who have received prolonged infusion of propofol is extremely brief. ", "Propofol infusion is also commonly used for moderate sedation in patients undergoing invasive interventions outside of the operating room settings. ", "The major disadvantage of propofol is its strong vasodilatory effects, which may cause significant drops of the left ventricular afterload and hypotension upon induction of anesthesia.", "\n\nEtomidate is most commonly reserved for patients with limited cardiac function because it preserves myocardial contractility and systemic vascular resistance and therefore provide a favorable hemodynamic profile. ", "In clinical cardiac anesthesia practice, etomidate is probably the most commonly used single induction agent. ", "Inhibition of the hypothalamic pituitary adrenal axis by etomidate and related role in inhibiting the body homeostasis in adrenal stress response is probably the biggest shortcoming of this drug in cardiac patients.", "\n\nIn this issue of *Journal of Cardiovascular and Thoracic Research*, Yagan et al have randomized 90 relatively healthy patients to receive etomidate (0.3 mg/kg), propofol (2.5 mg/kg) or a combination of etomidate and propofol (propofol dose of 1.25 mg/kg + etomidate dose of 0.15 mg/kg) for the induction of anesthesia.^[@R1]^ Mean arterial blood pressure (MAP), heart rate and rate pressure product (HR\\*MAP) were measured at 10 different time points prior an after tracheal intubation. ", "MAPs were better maintained in the combination formula compared to propofol at the same time the combination formula prevented the surges of MAP during intubation compared to etomidate. ", "One may conclude that combining propofol with etomidate while it prevented inadvertent hypotension during induction it blocked the hemodynamic response to the tracheal stimulation.", "\n\nClinical anesthesiologists have tried to achieve a better hemodynamic profile by combining various induction agents to synergistically produce hypnosis and avoid their individual side effects. ", "Propofol has been generally used as a common ingredient of these combination therapies. ", "This article suffers from the fact that only healthy (ASA I) patients and those with mild systemic diseases (ASA II) were included in randomization. ", "Another recent study has enrolled 100 cardiac patients with reduced left ventricular ejection fraction. ", "The hemodynamic profile at the time of induction with a combination of propofol with ketamine was similar to those receiving etomidate and benzodiazepines.^[@R2]^ Despite these promising finding, one should remember that the pharmaceutical concerns of mixing two drugs with different physical properties (emulsion forms) need to be extensively studied and addressed before the use of combination induction formulas could be recommended.", "\n\nEthical issues {#s2}\n==============\n\nNot applicable.", "\n\nCompeting interests {#s3}\n===================\n\nAuthor declares no conflict of interest in this study.", "\n" ]
{ "pile_set_name": "PubMed Central" }
[ 0, 0, 0, 0.0078125, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005319148936170213, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010224948875255624, 0.005376344086021506, 0, 0, 0, 0, 0, 0.0022935779816513763, 0, 0, 0 ]
0.000796
5
[ { "analysis_explanation": null, "end": 2092, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2080 }, { "analysis_explanation": null, "end": 4630, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4619 }, { "analysis_explanation": null, "end": 4874, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 4872 }, { "analysis_explanation": null, "end": 6099, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 6097 } ]
[ "Related\n\nArticle\n\nLavezzi wants strong PSG response\n\nEzequiel Lavezzi has urged Paris Saint-Germain to respond to their Coupe de France exit to Evian with a Ligue 1 victory over Nice.", "\n\nPSG lost 4-1 on penalties after being held to a 1-1 draw in the quarter-final encounter by the Annecy-based outfit and, although he admitted he is disappointed, Lavezzi has urged his side to put the setback behind them.", "\n\n\"No-one even thought about losing and being eliminated from the Coupe de France in the quarter-finals,\" the 27-year-old told the club's official website.", "\n\n\"But that's what happened. ", "We don't have time to cry over spilt milk. ", "We have to focus on the Nice match, this Sunday, which is a crucial match for us if we want to win the title.", "\n\n\"This will be a very important game. ", "Even if nothing has been decided yet, we are in a good position to win the title.", "\n\n\"We have to overcome the fatigue of those 30 minutes of extra-time and penalties on Wednesday, so that we can match with them physically, because the games are coming thick and fast at the moment.\"", "\n\nCarlo Ancelotti's side hold a six-point lead over Marseille at the top of Ligue 1 despite having played a game less, and midfielder Javier Pastore stressed the importance of victory over Nice.", "\n\n\"This is a very important match for us because a win is another big step towards the title,\" the 23-year-old midfielder said.", "\n\n\"We need to give the absolute maximum to claim all three points. ", "We need to be motivated and confident to get a win that will set us up for the remaining matches of the season.\"" ]
{ "pile_set_name": "Pile-CC" }
[ 0.01092896174863388, 0.004524886877828055, 0.0064516129032258064, 0, 0, 0, 0, 0, 0, 0.015463917525773196, 0, 0, 0 ]
0.002875
5
[ { "analysis_explanation": null, "end": 69, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53 }, { "analysis_explanation": null, "end": 85, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80 }, { "analysis_explanation": null, "end": 285, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 279 }, { "analysis_explanation": null, "end": 523, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 512 }, { "analysis_explanation": null, "end": 656, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 652 }, { "analysis_explanation": null, "end": 675, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 664 }, { "analysis_explanation": null, "end": 909, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 893 }, { "analysis_explanation": null, "end": 950, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 941 }, { "analysis_explanation": null, "end": 1072, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1055 }, { "analysis_explanation": null, "end": 1114, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1105 }, { "analysis_explanation": null, "end": 1201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1187 }, { "analysis_explanation": null, "end": 1246, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1242 }, { "analysis_explanation": null, "end": 1356, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1345 }, { "analysis_explanation": null, "end": 1549, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1539 } ]
[ "Like a Lover\n\nLike a Lover is an album by Canadian jazz singer Emilie-Claire Barlow. ", "It was released by her label, Empress Music Group, in 2005.", "\n\nTrack listing\n\nPersonnel\n Emilie-Claire Barlow – vocal, piano, percussion\n Guido Basso – flugelhorn\n John Johnson – tenor saxophone (on track 5)\n Kelly Jefferson – tenor saxophone (on tracks 2 & 7)\n Daniel LeBlanc – keyboards (on track 11)\n Justin Abedin – guitar (on track 11)\n Rob Piltch – guitar\n Marc Rogers – bass guitar\n Mark Kelso – drums\n\nReferences\n\nCategory:2005 albums\nCategory:Emilie-Claire Barlow albums" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.011764705882352941, 0.016666666666666666, 0.01674641148325359 ]
0.015059
5
[ { "analysis_explanation": null, "end": 50, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42 }, { "analysis_explanation": null, "end": 83, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63 }, { "analysis_explanation": null, "end": 144, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 140 }, { "analysis_explanation": null, "end": 192, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 172 }, { "analysis_explanation": null, "end": 232, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 221 }, { "analysis_explanation": null, "end": 259, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 247 }, { "analysis_explanation": null, "end": 307, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 292 }, { "analysis_explanation": null, "end": 359, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 345 }, { "analysis_explanation": null, "end": 400, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 387 }, { "analysis_explanation": null, "end": 435, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 425 }, { "analysis_explanation": null, "end": 457, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 446 }, { "analysis_explanation": null, "end": 483, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 473 }, { "analysis_explanation": null, "end": 555, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 535 } ]
[ "Q:\n\nCan I put an executable in the user's PATH without admin-level privileges?", "\n\nI'd like to add Windows support to a language version manager I use. ", "\nIn its current macOS-and-Linux-only form, the manager downloads a few key language binaries/executables (compiler, linter, etc) to its own folder, with a subfolder for each version (manager/1.1/, manager/1.2/, and so on). ", "When you run manager use 1.1 or manager use 1.2, it symlinks /usr/local/bin/language to the relevant folder.", "\nWindows doesn't let you symlink without administrator privileges. ", "Fair enough, I figure, I'll just copy the binaries directly. ", "And that's where I'm at now: I'd like to copy these binaries into some equivalent of /usr/local/bin, somewhere user-accessible on the PATH. ", "But my knowledge of Windows isn't deep enough to know whether this is possible and my googling hasn't turned up anything either. ", "The PATH variable sharing a name with a fundamental filesystem feature kind of muddies searches up.", "\nBig thanks to anyone who can offer me a tip here. ", "\n\nA:\n\nThere are several ways to set the PATH on Windows. ", "The easiest ones are explained in this SO answer.", "\n\nAdd the path to My Computer->Properties->Advanced->Environment Variables->Path\nUse set PATH=\"%PATH%;C:\\NewPath\" setting the PATH for this session\nUse setx PATH \"%PATH%;C:\\NewPath\" setting the PATH for all sessions of this user in the future\nUse setx /M PATH \"%PATH%;C:\\NewPath\" setting the PATH for all sessions of all users machine-wide in the future\nModifiy the registry key HKEY_LOCAL_MACHINE\\SYSTEM\\CurrentControlSet\\Control\\Session Manager\\Environment\\Path and add C:\\NewPath\nUse the Environment.", "SetEnvironmentVariable .NET Windows Method to modify the registry key\nUse PowerShell to modify it permanently\n\nDisclaimer: I haven't tested which of these approaches require admin priviledges.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.01282051282051282, 0, 0.008968609865470852, 0, 0, 0, 0.007142857142857143, 0.007751937984496124, 0.010101010101010102, 0, 0.03508771929824561, 0, 0.00992063492063492, 0.010416666666666666, 0 ]
0.006814
5
[ { "analysis_explanation": null, "end": 356, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 344 }, { "analysis_explanation": null, "end": 1676, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1634 } ]
[ "Product Description\n\n-These are small, high quality plastic trim clips used by a wide range of manufacturers.-Durable-This is one of the types of metal washers commonly used for under body heat shields, noise insulations, undertray covers bulk heads etc.-These have a star shape in the center and cut outs around the edge.", "\n\nFitment:\n\nFit for VW TRANSPORTER T4 T5 UP LUPO POLO GOLF\n\nNotes:\n\n-The same model and year of a vehicle may have different clips if they have different levels of trim fitted.-Please check the size measurement chart carefully before making a payment.-Please allow 0.1-0.5cm difference due to manual measurement.-Please check carefully to make sure whether the item matches to your vehicle or not.-Instruction is not included." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0.002347417840375587 ]
0.001174
5
[ { "analysis_explanation": null, "end": 260, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 250 }, { "analysis_explanation": null, "end": 358, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 356 }, { "analysis_explanation": null, "end": 361, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 359 } ]
[ "Match\n" ]
{ "pile_set_name": "Github" }
[ 0 ]
0
5
[]
[ "Q:\n\nType 'AnyObject' does not conform to protocol 'NSFetchRequestResult'\n\nI just installed Xcode 8 beta 2 and iOS 10 beta. ", "I have an existing project where I updated from swift 2.3 to swift 3 based on a prompt from Xcode. ", "I received an error with my code data code. ", "\nThis was auto generated in the conversion from swift 2.3 to swift 3 by xcode \nvar fetchedResultsController: NSFetchedResultsController<AnyObject>!", "\n\nthe error I'm receiving is\n Type 'AnyObject' does not conform to protocol 'NSFetchRequestResult'\n\nI tried to conform AnyObject\nextension AnyObject: NSFetchRequestResult {}\n\nBut I receive another error\n\nI am not sure what I need to do or if my fetchedResultsController needs to be changed in the first place. ", "\nANSWER: var fetchedResultsController: NSFetchedResultsController<Content>!", "\n\nA:\n\nThe Xcode converter likely was confused about what Entity you wanted to return in this fetched results controller. ", "Replace AnyObject with the entity type you are fetching.", "\nYou should open a radar (bugreporter.apple.com) on this, since it should never suggest AnyObject here. ", "At worst it should suggest NSManagedObject.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0, 0.006802721088435374, 0.0064516129032258064, 0, 0.008264462809917356, 0.017857142857142856, 0.009615384615384616, 0, 0 ]
0.004454
5
[ { "analysis_explanation": null, "end": 1018, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 997 } ]
[ "Functional characterization of the crista terminalis in patients with atrial flutter: implications for radiofrequency ablation.", "\nThe aim of the study was to investigate the conduction properties and anisotropy of the crista terminalis (CT) in patients with atrial flutter (AFL) using non-contact mapping. ", "The CT is a posterior barrier during typical AFL. ", "However, the CT has transverse conduction capabilities in patients with upper loop re-entry (ULR). ", "Twenty-two patients (16 males, 63 +/- 15 years) with typical AFL and ULR were included. ", "Non-contact mapping of the right atrium during AFL and pacing from coronary sinus (CS) and low anterolateral right atrium (LARA) was performed to evaluate transverse conduction across the CT. ", "During ULR, the longitudinal (CV(L)) and transverse (CV(T)) conduction velocity along and across the CT were measured. ", "The width of the CT conduction gap was evaluated to guide radiofrequency ablation (RFA). ", "No transverse CT gap conduction was found during typical AFL. ", "Transverse CT gap conduction was found in three patients during CS pacing and in three patients during LARA pacing. ", "During ULR, CV(L) was greater than CV(T) (1.28 +/- 0.43 vs. 0.73 +/- 0.30 m/s, p < 0.001). ", "The CV(L)/CV(T) ratio was 1.95 +/- 0.77, which was inversely related to the CT gap width (15.7 +/- 6.8 mm) (p < 0.001). ", "The RFA of the CT gap was successful in 18 patients. ", "Four patients had recurrence of arrhythmias during the follow-up of 11 +/- 3 months. ", "Most of the CT conduction gaps were functional and only appeared during ULR. ", "The width of the CT gap was inversely related to the anisotropic ratio of the CT. ", "The RFA of the CT gap was effective in eliminating ULR." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0.02, 0.020202020202020204, 0.011363636363636364, 0.010416666666666666, 0.008403361344537815, 0.011235955056179775, 0, 0.008620689655172414, 0, 0.008333333333333333, 0.018867924528301886, 0, 0.012987012987012988, 0.024390243902439025, 0.03636363636363636 ]
0.011246
5
[ { "analysis_explanation": null, "end": 499, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 491 }, { "analysis_explanation": null, "end": 1466, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1458 } ]
[ "Weltpolitik Der Räuberbaron\n\nVon Hintergrund.de | Veröffentlicht am 13.02.2015 in: Weltpolitik\n\nMichail Chodorkowski und der Westen –\n\nVon MATTHIAS RUDE, 13. ", "Februar 2015 –\n\nIm Jahr 1992 erschien in Russland das Buch Der Mann mit dem Rubel. ", "Der Titel kam nicht von ungefähr: Der Mann mit dem Gewehr war ein berühmter sowjetischer Film von 1938 über Lenin; die Verfasser der daran angelehnten Schrift verkündeten nun: „Wir haben lange genug nach Lenin gelebt! ", "Unser Kompass ist der Profit, erzielt unter strenger Einhaltung der Gesetze. ", "Unser Idol ist Seine Finanzielle Hoheit, das Kapital, denn das Kapital und nur das Kapital führt zu Reichtum als Normalzustand. ", "Schluss mit dem Leben in der Utopie, Bahn frei für das Geschäft, das reich macht.", "“(1) Reich ist Michail Chodorkowski, einer der beiden Autoren des Buches, geworden – mit der Einhaltung der Gesetze nahm er es dabei allerdings nicht so genau. ", "Nach einem Jahrzehnt in Haft kehrt er nun zurück auf die Bühne der russischen Politik – mit Präsidentschaftsambitionen. ", "Als pro-westliche Alternative zu Putin wird er gestützt von europäischen und US-amerikanischen Eliten, denen er sich angedient hat.", "\n\nGesetz des Dschungels\n\nIn der Sowjetunion gehörte Chodorkowski zu jenen Kadern des Parteinachwuchses, die schnell begriffen, wie man die Phase der beginnenden Privatisierung zum eigenen Vorteil nutzen konnte. ", "1987 übernahm er, mit 24 Jahren, die Leitung eines Komsomol-Unternehmens – Komsomol hieß die Jugendorganisation der KPdSU –, das unter anderem mit dem Import von Computern sein Geld machte. ", "Gewinn pro Rechner: 3000 Prozent.(2) Parallel begann er, eine Privatbank aufzubauen – bevor überhaupt ein Gesetz erlassen wurde, das dies erlaubte. „", "Hier herrschte in den Übergangszeiten nach dem Zusammenbruch der Sowjetunion das Gesetz des Dschungels. ", "Keiner wusste genau, welche Vorschriften noch galten – ich nutzte das aus“, erzählte der Milliardär 2002 und bezeichnete sich als „Räuberbaron“.(3) Chodorkowskis Verteidiger rechtfertigte die Gesetzesverstöße seines Mandanten, nachdem dieser 2003 wegen Steuerhinterziehung angeklagt worden war, mit den Worten: „Ich wage zu behaupten, dass die Erstanhäufung von Kapital auf der ganzen Welt und zu allen Zeiten mit Gesetzesverstößen verbunden war und ist.“ ", "Das Gesetz sei eben „eine Bremse für den Fortschritt“.(4) Als die Bank Menatep im Zuge der Rubel-Krise 1998 pleite ging, ließ Chodorkowski Kreditgeber, Anleger und Aktionäre leer ausgehen – nicht ohne sich vorher die Aktiva gesichert zu haben.(5) „Die Krise von ’98 war ,die Krise Chodorkowski‘, sie war von ihm provoziert und brachte ihm fabelhafte Dividenden ein“, schrieb zehn Jahre später ein russischer Journalist.(6)\n\nDie Macht der Medien erkannte Chodorkowski spätestens bei den Präsidentschaftswahlen 1996, als er sich mit anderen Oligarchen zusammentat, um den prognostizierten Wahlsieg des kommunistischen Kandidaten Gennadij Sjuganow zu verhindern. ", "Der Zeitpunkt, an dem damalige Großunternehmer beschlossen, von da an Jelzin zu unterstützen, sei das Weltwirtschaftsforum in Davos gewesen; Chodorkowski berichtet von einem Gespräch zwischen dem Oligarchen Boris Beresowski und George Soros – jenem US-Milliardär, der mit seinem Geld nicht wenig zum Ende der Sowjetunion und zu den „bunten“ Revolutionen beigetragen hat und der bis heute pro-westliche Kräfte in Osteuropa finanziert.(7) 140 Millionen US-Dollar sollen die Oligarchen in die Wahlkampagne Jelzins gepumpt haben, 46 Mal mehr als erlaubt.(8) Sjuganow wurde mit einer beispiellosen Schmutzkampagne überzogen. „", "Etliche Millionen-Dollar-Investitionen und die Maschinerie von endlosen Manipulationen der öffentlichen Meinung“, so beschreibt Chodorkowski später das Vorgehen und gibt zu: „Zweifellos war das ein autoritäres Szenario.“ ", "Doch der Zweck heilige die Mittel.(9) Das weitere Geschehen fasst der russische Journalist Waleri Panjuschkin folgendermaßen zusammen: „Jelzin wurde Präsident. ", "Michail Chodorkowski erhielt auf der Pfandauktion den Zuschlag für die Firma Jukos. ", "Alle anderen Finanzexperten, die Jelzin unterstützten, bekamen auch etwas ab.", "“(10) Weit unter Wert konnte Chodorkowski so den Ölkonzern erwerben und zum reichsten Mann Russlands aufsteigen.", "\n\nGegen Ende des 20. ", "Jahrhunderts hatten der Oligarch und sein Firmenimperium in Russland wie auch im Westen einen schmutzigen, geradezu mörderischen Ruf.(11) Der in Deutschland wirkende ukrainische Journalist Viktor Timtschenko spricht von Sprengsätzen und Maschinengewehrsalven gegen Menschen, die „keine Fehde mit den Killern persönlich, sondern die mit Menatep, mit Jukos, mit Chodorkowskis Reich Ärger hatten“.(12) Trotzdem wurde, wie eine britische Zeitung vor zehn Jahren bemerkte, ausgerechnet jener Oligarch, der „eine Spur von betrogenen westlichen Investoren und verdächtigen Todesfällen“ hinterlassen habe, auf einmal zum „Liebling der amerikanischen politischen Elite“.(13) Wie kam es dazu?", "\n\nZirkel der Macht\n\nVom Elitarismus ist Chodorkowskis Denken durchdrungen. ", "In seinem im Gefängnis verfassten „politischen Bekenntnis“ Mein Weg schreibt er: „Eine Führungsrolle können zehn bis fünfzehn, vielleicht auch zwanzig Prozent einer Bevölkerung übernehmen.“ ", "Jeder Fortschritt sei „das Ergebnis bewusster Anstrengungen einer verantwortungsvollen Elite, ihres ordnenden und erzieherisch wirkenden Einflusses auf die Gesellschaft.", "“(14) Sobald es ihm möglich war, erkaufte er sich nicht nur positive Schlagzeilen in der (West-)Presse, sondern auch den Eintritt zu elitären Zirkeln der Macht.", "\n\nZunächst engagierte Jukos Dutzende von westlichen Managern, damit sie den Konzern repräsentieren und ihre Beziehungen für ihn spielen ließen, darunter politische Schwergewichte wie den ehemaligen britischen Außenminister Lord David Owen. ", "2002 wurde zudem die weltweit bekannte Prüfgesellschaft PricewaterhouseCoopers (PWC) damit beauftragt, Unternehmensbilanzen nach Vorgaben von strengen US-amerikanischen Standards zu veröffentlichen. ", "Russland und der Westen staunten nicht schlecht. ", "Als russische Behörden PWC später verklagten – wegen „Beihilfe zur Steuerhinterziehung“ –, zog das Unternehmen seine Prüfberichte, die bis heute den Mythos um die „Transparenz“ bei Jukos nähren, für die Jahre 1996 bis 2004 allerdings wieder zurück.(15)\n\nAls 2001 ein von Chodorkowski gewünschtes Treffen mit Condoleezza Rice, der Sicherheitsberaterin des damaligen US-Präsidenten George W. Bush, zunächst abgelehnt wurde, wurde mit Geld nachgeholfen. ", "Allein die Bibliothek des Kongresses erhielt eine Spende von einer Million Dollar, eine halbe Million ging an den US Think Tank Carnegie Endowment for International Peace, 100.000 Dollar ans „National Book Festival“ – ein Lieblingsprojekt der Präsidenten-Gattin Laura Bush. ", "Die Investitionen zahlten sich aus: „To Mikhail Khodorkovsky with best wishes. ", "George Bush, Laura Bush“ – so signierte das Präsidentenpaar ein Foto, auf dem der Milliardär mit beiden posiert.(16) Der Ölmagnat hat also, wie die New York Times feststellt, „mächtig viel ausgegeben, um den inneren Kreis des Capitol-Hügels zu umwerben.", "“(17) Genauer: 50 Millionen US-Dollar jährlich zwischen 2001 und 2003.(18)\n\nAuf diese Weise gelang es ihm, Berater der Carlyle Group zu werden, ein mit Prominenten gespicktes Risiko-Kapital-Unternehmen im Umfeld des Weißen Hauses, als der er beispielsweise auf George Bush senior, den ehemaligen Außenminister James Baker und den britischen Ex-Premier John Major traf(19), außerdem auf Frank Carlucci, der als ehemaliger US-Verteidigungsminister und CIA-Vizedirektor enge Beziehungen zu Dick Cheney pflegte. ", "Als Vorstandsmitglied der International Crisis Group besprach Chodorkowski sich mit Militäranalytikern und Geheimdienstlern sowie mit der Elite der Geostrategen und „Demokratieförderer“ weltweit, unter anderem mit Zbigniew Brzezinski und George Soros.(20) In Deutschland wurde der inzwischen verstorbene ehemalige FDP-Vorsitzende und Wirtschaftsminister Otto Graf Lambsdorff engagiert, PR für den Milliardär zu machen. ", "Dieser wurde Zeit seines Lebens nicht müde, das Verfahren gegen Chodorkowski zu diskreditieren – als „Schauprozess“.(21) Dass der Europarat mit Sabine Leutheusser-Schnarrenberger ausgerechnet eine Partei-Freundin Lambsdorffs zur Berichterstatterin im Chodorkowski-Fall gemacht hatte, zeuge nicht gerade von Fingerspitzengefühl, meint der deutsche Richter Wolfgang Hirth. ", "In einem Artikel in den Mitteilungen des Hamburgischen Richtervereins weist er darauf hin, dass Chodorkowski vor seiner Inhaftierung im Westen bestens vernetzt war, und urteilt: „Die öffentliche Empörung über die Chodorkowski-Verfahren und die ungerechtfertigte Stilisierung von Chodorkowski zum Menschenrechtshelden sind durch eine Vielzahl von Interessen beeinflusst.", "“(22)\n\nAm 25. ", "Oktober 2003 stürmten Männer der Spezialeinheit Alfa auf dem Flughafen von Nowosibirsk den Privatjet des Ölmagnaten: „Geheimdienst! ", "Hände hoch! ", "Dokumentenkontrolle!“ ", "Chodorkowski soll nur gesagt haben: „Gut, gehen wir.“ ", "Die Verhaftung kam nicht überraschend: Bereits am 19. ", "Juni war Alexej Pitschugin, der Sicherheitschef des Konzerns, wegen mehrfachen Mordverdachts in Untersuchungshaft gekommen, am 3. ", "Juli war ihm der Jukos-Aktionär Platon Lebedew gefolgt, dem ebenfalls Verwicklung in ein Kapitalverbrechen sowie Privatisierungsbetrug vorgeworfen wurde.(23)\n\nIm Fokus der Staatsanwaltschaft befand Chodorkowski sich schon seit den 1990er Jahren. ", "Es ist aber wahrscheinlich, dass seine Geschäfte mit dem Westen den Zeitpunkt seiner Verhaftung mit bestimmt haben. ", "Denn im Frühjahr 2003 stand der Verkauf großer Teile des Jukos-Imperiums an US-amerikanische Öl-Multis kurz bevor. ", "Bestandteil der Verhandlungen war auch der Bau eines eigenen Pipeline-Netzes, mit dem in Russland das staatliche Monopol gebrochen werden sollte, um Öl am russischen Fiskus vorbei auf den Weltmarkt lenken zu können.(24) „Chodorkowski war der Mann, der Amerika Zutritt zum Rohstoffparadies Russland versprach“, so Der Spiegel.(25) Indem ihm nun der Prozess gemacht wurde, habe der Kreml sich der Kontrolle durch Oligarchen entzogen und die Weichen für eine unabhängige makroökonomische Politik gestellt, vermutet Timtschenko.(26)\n\nFür diese Vermutung spricht auch, dass, nachdem Chodorkowski und Lebedew in Straßburg auf eine Entschädigung von 38 Milliarden Dollar geklagt hatten, der Europäische Gerichtshof für Menschenrechte ihnen Mitte November diesen Jahres immerhin 1,9 Milliarden Dollar tatsächlich zusprach. ", "Die Kläger warfen Russland eine „versteckte Verstaatlichung“ des Konzerns vor, der nach 2003 zerschlagen und zu großen Teilen vom staatlichen Mineralölunternehmen Rosneft aufgekauft worden war. ", "Das Urteil ist noch nicht rechtskräftig und Russland hat angekündigt, es anzufechten.(27) 2011 hatte das Gericht eine Klage Chodorkowskis noch abgewiesen und die Verurteilung als „nicht politisch motiviert“ eingestuft.(28)\n\n„Russischer Soros“\n\nIn politischer Hinsicht bezeichnet Chodorkowski sich selbst mit dem Oxymoron „Liberal-Etatist“. ", "Vor 2003 finanzierte er in erster Linie die beiden liberalen Parteien Jabloko und die „Union der Rechten Kräfte“ SPS. ", "Außerdem korrumpierte er Abgeordnete verschiedenster Fraktionen. ", "Irina Jassina, Programmdirektorin der 2001 gegründeten Chodorkowski-Stiftung Offenes Russland, verteidigte ihren Freund und Arbeitgeber 2005 in einem Interview wenig überzeugend mit den Worten: „Es gab auch Abgeordneten-Listen. ", "Aber ich möchte betonen: Die Papiere stammen aus dem Jahr 2002. ", "Wir lebten damals in einem anderen Land. ", "Vor drei Jahren war es real, sich die Aufgabe zu stellen, Abgeordnete aufzukaufen.", "“(29)\n\nFür Offenes Russland warb der Milliardär illustres Personal an: Henry Kissinger, Gerald Ford, Lord Jacob Rothschild. ", "Die Stiftung, die offiziell der „Förderung der russischen Zivilgesellschaft“ dienen sollte, stellte für Chodorkowski das wohl wichtigste Instrument zur Erlangung politischer Macht dar.", "\n\nIn einem internen Protokoll aus dem Jahr 2002, das später publik wurde, werden als Ziele der Stiftung die „Anpassung der Bevölkerung an das neue wirtschaftliche Umfeld“ unter Zuhilfenahme von „informationsaggressiven Methoden“ sowie „das Schaffen eines positiven Informationsumfeldes um Offenes Russland und ihre Führer“ genannt. ", "Chodorkowski wird als „geistiger Anführer der russischen Jugend“ bezeichnet. ", "Weiterhin schildert das Papier Strategien der Irreführung und der Machterlangung. ", "So ist davon die Rede, „eine überzeugende ,Nebelwand‘ zu schaffen und so die wahren politischen Ambitionen von Offenes Russland und ihrer Führer zu verschleiern. ", "Die wichtigsten Kernaussagen des Programms: Russische Unternehmer haben ihre soziale Verantwortung gegenüber den Menschen erkannt und möchten den Mitbürgern helfen, eine Ausbildung zu bekommen, gute Arbeit zu finden, viel in Russland und für Russland zu verdienen.“ ", "Eine Strategie nennt sich „russischer Soros“; sie hat zwei Phasen: Zunächst solle in der russischen Bevölkerung das Bild Chodorkowskis als „Wohltäter“ gefestigt werden, aber noch nicht als Politiker; nach diesem „Branding“ begänne Chodorkowski dann, auch politische Ideen zu verbreiten. „", "Wenn diese Ideen nicht von den ,Oligarchen‘ kommen werden, sondern von dem ,russischen Soros‘, so werden sie für die Bevölkerung legitimer aussehen“, heißt es im Protokoll. ", "Aus dem Vermerk, dass schon Kinder mit zwölf Jahren, „deren Weltanschauung noch im Entstehen begriffen ist“, als Teil der Zielgruppe von Offenes Russland gelten, wird klar, dass das Projekt nicht nur die Präsidentschaftswahlen 2004 im Auge hatte.(30) Das System, das es anstrebe, sei, so Timtschenko, „ein strammer Kapitalismus ohne Auswüchse einer (lästigen) Zivilgesellschaft“, in dem der Staat „vor allem dazu da ist, oligarchische Reichtümer zu schützen“.(31)\n\nPräsidentschaftsambitionen\n\nKurz vor Weihnachten 2013 wurde Chodorkowski überraschend begnadigt und freigelassen. ", "Interessanterweise flog er danach direkt nach Berlin, wo ihn Hans-Dietrich Genscher persönlich am Flughafen empfing. ", "Wie sich herausstellte, hatte der frühere deutsche Außenminister sich „auf Bitte der Anwälte Chodorkowskis“ – und mit Rückendeckung des Kanzleramtes – „über Geheimkanäle zwischen Deutschland und Russland, die noch existieren“, zweieinhalb Jahre lang um die Freilassung des Oligarchen bemüht und dabei auch zweimal Putin persönlich getroffen. ", "Der Spiegel feierte das Ereignis als einen „Triumph der deutschen Geheimdiplomatie“.(32) Gleich am ersten Tag nach seiner Freilassung vermeldete die Presse: „Menschenrechtler haben Chodorkowski bereits eine führende Rolle beim Aufbau der Zivilgesellschaft in Russland angeboten.", "“(33)\n\nAm 9. ", "März 2014 besuchte er die Ukraine, erklärte sich mit der vom Westen finanzierten und protegierten(34) Euromaidan-Bewegung solidarisch und kritisierte die „russische Invasion auf der Krim“.(35) Im September schließlich kündigte er seine Rückkehr in die russische Politik sowie die Wiedereröffnung der Stiftung Offenes Russland an. „", "Chodorkowski hat eine proeuropäische Oppositionsbewegung gestartet“, meldete Die Zeit und sprach von „Ambitionen auf das Präsidentenamt“ bei dem Milliardär.(36) Ein kritischer Kommentar auf der Website des Springer-Blattes Die Welt warf ihm vor, er stilisiere sich schon wieder zum „Führer Russlands“ – dessen Patriotismus sich „von imperialistischen Träumen nicht lösen“ könne.(37)\n\nIm Jahr 2006 schrieb der Journalist Waleri Panjuschkin in seinem Buch über Aufstieg und Fall des russischen Ölmilliardärs: „Sollte Chodorkowski im Jahr 2003 tatsächlich den Plan gehabt haben, die Gesellschaftsstruktur in Russland zu verändern, so ist dieser Plan auf der ganzen Linie gescheitert.", "“(38) Sollte man inzwischen hinzufügen: Vorerst?", "\n\n# Dieser Text erschien zuerst in der Printausgabe 1/2015 von Hintergrund. ", "Zu bestellen gibt es den gedruckten Hintergrund hier.", "\n\nAnmerkungen\n\n(1) Michail Chodorkowski mit Natalia Geworkjan: Mein Weg. ", "Ein politisches Bekenntnis. ", "Aus dem Russischen von Steffen Beilich, München 2012, S. 232.", "\n\n(2) Waleri Panjuschkin: Michail Chodorkowski. ", "Vom JUKOS-Chefsessel ins sibirische Arbeitslager. ", "Aufstieg und Fall des russischen Ölmilliardärs. ", "Aus dem Russischen von Vera Baumgärtner, München 2006, S. 55.", "\n\n(3) Erich Follath: Wer ist Michail Chodorkowski?, ", "in: Michail Chodorkowski: Briefe aus dem Gefängnis. ", "Mit einem Essay von Erich Follath. ", "Aus dem Russischen von Birgit Veit und Ganna-Maria Braungardt, München 2011, S. 23-58, S. 31f.", "\n\n(4) Waleri Panjuschkin: Michail Chodorkowski (Anm. ", "2), S. 239.", "\n\n(5) Später wurden die geschädigten Anleger mit Jukos-Aktien ausgezahlt. ", "Vgl. ", "Katja Tichomirowa: Reicher als Rockefeller, Berliner Zeitung, 21.6.2002 – http://www.berliner-zeitung.de/archiv/reicher-als-rockefeller,10810590,10005728.html –.", "\n\n(6) „Кризис 98-го был «дефолтом Ходорковского», дефолтом, спровоцированным им и принесшим ему баснословные дивиденды.“ – ", "Александр Третьяченко: Личный дефолт Ходорковского, Век, 25.11.2008 – http://wek.ru/lichnyj-defolt-xodorkovskogo –.", "\n\n(7) Vgl. ", "Matthias Rude: „Russland sagt ja zum Faschismus“. ", "Wie „Starinvestor“ George Soros Einfluss auf die Ukraine nimmt, Hintergrund 3/2014, S. 24-27.", "\n\n(8) Viktor Timtschenko: Chodorkowskij. ", "Legenden, Mythen und andere Wahrheiten, München 2012, S. 202.", "\n\n(9) Ebd., ", "S. 237.", "\n\n(10) Waleri Panjuschkin (Anm. ", "2), S. 81.", "\n\n(11) „Yukos once had a distinctly dirty, even murderous reputation“. – ", "Anne Applebaum: This man is now the people’s billionaire. ", "The Telegraph, 13.6.2004 – http://www.telegraph.co.uk/comment/personal-view/3607189/This-man-is-now-the-peoples-billionaire.html –.", "\n\n(12) Viktor Timtschenko: Chodorkowskij (Anm. ", "8), S. 22.", "\n\n(13) „As Khodorkovsky got richer and richer, he left a longer and longer trail of defrauded Western investors, and the odd dead body, in his wake“; „A man who had been virtually a pariah a scant few years before was suddenly the darling of the American political elite.“ – ", "The roublemaker. ", "The Sunday Telegraph, 25.7.2004 – http://www.telegraph.co.uk/comment/personal-view/3608862/The-roublemaker.html –.", "\n\n(14) Michail Chodorkowski mit Natalia Geworkjan: Mein Weg (Anm. ", "1), S. 532.", "\n\n(15) Viktor Timtschenko: Chodorkowskij (Anm. ", "8), S. 242f.", "\n\n(16) Ebd., ", "244f.", "\n\n(17) „Mr. Khodorkovsky spent heavily in Washington to court the Capitol’s inner circle.“ – ", "Timothy L. O᾽Brien: How Russian Oil Tycoon Courted Friends in U.S., New York Times, 5.11.2003 – http://www.nytimes.com/2003/11/05/world/how-russian-oil-tycoon-courted-friends-in-us.html –.", "\n\n(18) Kai Ehlers: Entschieden ist nichts, Der Freitag, 3.6.2005 – https://www.freitag.de/autoren/der-freitag/entschieden-ist-nichts –.", "\n\n(19) Gernot Erler: Der Fall Chodorkowskij – Zur Tomographie eines politischen Konflikts, in: Gabriele Gorzka, Peter W. Schulze (Hg.): ", "Wohin steuert Russland unter Putin? ", "Der autoritäre Weg in die Demokratie, Frankfurt/New York 2004, S. 301-325, S. 305.", "\n\n(20) Viktor Timtschenko: Chodorkowskij (Anm. ", "8), S. 289f.", "\n\n(21) Lambsdorff kritisiert Russlandpolitik, Handelsblatt, 1.6.2005 – http://www.handelsblatt.com/politik/deutschland/handelsblatt-interview-lambsdorff-kritisiert-russlandpolitik/2508802.html –.", "\n\n(22) Wolfgang Hirth: Chodorkowski und der Westen, in: Mitteilungen des Hamburgischen Richtervereins 2/2011, S. 13-22, S. 22. – ", "Der Text ist unter http://www.richterverein.de/mhr/mhr112/m11209.htm auch online einsehbar.", "\n\n(23) Gernot Erler: Der Fall Chodorkowskij (Anm. ", "19), S. 301f.", "\n\n(24) Der Fall Chodorkowski oder Russlands neue Rolle im aktualisierten „Great game“, 9.1.2006 – http://russland.ru/chodorkowski/morenews.php?iditem=52 –.", "\n\n(25) Walter Mayr: Triumph der Doppelmoral, Der Spiegel, 10.11.2003 – http://www.spiegel.de/spiegel/print/d-29136670.html –.", "\n\n(26) Viktor Timtschenko: Chodorkowskij (Anm. ", "8), S. 286.", "\n\n(27) Gericht spricht Yukos-Eignern 1,9 Milliarden Dollar zu, Bild, 15.11.2014 – http://www.bild.de/politik/ausland/michail-chodorkowski/russland-yukos-urteil-37049688.bild.html –.", "\n\n(28) European Court of Human Rights: Case of Khodorkovskiy v. Russia (Application no. ", "5829/04). ", "Judgement, Strasbourg, 31.5.2011 – http://hudoc.echr.coe.int/sites/eng/pages/search.aspx#{%22dmdocnumber%22:[%22885884%22],%22itemid%22:[%22001-104983%22]} –.", "\n\n(29) Viktor Timtschenko: Chodorkowskij (Anm. ", "8), S. 197.", "\n\n(30) Unter http://stringer-news.com/Publication.mhtml?PubID=4632&Part=37 findet sich das Protokoll in russischer Sprache. ", "Die Übersetzung ist hier zitiert nach: Viktor Timtschenko: Chodorkowskij (Anm. ", "8), S. 272ff.", "\n\n(31) Ebd., ", "S. 228.", "\n\n(32) Benjamin Bidder: Chodorkowskis Freilassung: „Triumph der deutschen Geheimdiplomatie“, Interview mit Alexander Rahr, Der Spiegel, 21.12.2013 – http://www.spiegel.de/politik/ausland/chodorkowski-freilassung-triumph-der-geheimdiplomatie-a-940462.html –.", "\n\n(33) Z.B.: Chodorkowski erwartet seine Familie in Berlin, Die Welt, 21.12.2013 – http://www.welt.de/politik/ausland/article123194531/Chodorkowski-erwartet-seine-Familie-in-Berlin.html –.", "\n\n(34) Vgl. ", "Matthias Rude: Die gekaufte Revolution. ", "Einflussnahme von Geheimdiensten, NGOs und Stiftungen, in: Ronald Thoden, Sabine Schiffer (Hg.): ", "Ukraine im Visier. ", "Russlands Nachbar als Zielscheibe geostrategischer Interessen, Frankfurt am Main 2014, S. 108-120.", "\n\n(35) Michail Chodorkowski: Meine Mitgefangenen. ", "Aus dem Russischen übersetzt von Vlada Philipp und Anselm Bühling, Berlin 2014, S. 105.", "\n\n(36) Chodorkowski gründet Protestbündnis gegen Putin, Die Zeit, 21.9.2014 – http://www.zeit.de/politik/ausland/2014-09/russland-chodorkowski-protestbuendnis –.", "\n\n(37) Filipp Piatov: Chodorkowski stilisiert sich zum Führer Russlands, 30.10.2014 – http://www.welt.de/debatte/kommentare/article133778766/Chodorkowski-stilisiert-sich-zum-Fuehrer-Russlands.html –.", "\n\n(38) Waleri Panjuschkin: Michail Chodorkowski (Anm. ", "2), S. 234." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.012658227848101266, 0.024096385542168676, 0.03211009174311927, 0.03896103896103896, 0.0390625, 0.037037037037037035, 0.025, 0.016666666666666666, 0.015267175572519083, 0.018957345971563982, 0.021052631578947368, 0.013422818791946308, 0.019230769230769232, 0.017543859649122806, 0.025757575757575757, 0.017713365539452495, 0.027149321266968326, 0.0125, 0.03571428571428571, 0.012987012987012988, 0.017857142857142856, 0, 0.020527859237536656, 0.02666666666666667, 0.015789473684210527, 0.01775147928994083, 0.025, 0.025, 0.01507537688442211, 0.02040816326530612, 0.026607538802660754, 0.021897810218978103, 0.012658227848101266, 0.02766798418972332, 0.027559055118110236, 0.026252983293556086, 0.018867924528301886, 0.018970189701897018, 0, 0.022727272727272728, 0.08333333333333333, 0, 0, 0.018518518518518517, 0.023076923076923078, 0.032520325203252036, 0.02586206896551724, 0.017391304347826087, 0.03067484662576687, 0.02577319587628866, 0.020588235294117647, 0.03389830508474576, 0, 0.017543859649122806, 0.03125, 0, 0.024390243902439025, 0.03225806451612903, 0.03804347826086957, 0.024096385542168676, 0.012987012987012988, 0.036585365853658534, 0.024691358024691357, 0.011278195488721804, 0.017361111111111112, 0.017341040462427744, 0.02072538860103627, 0.017094017094017096, 0.014619883040935672, 0.02158273381294964, 0, 0.012084592145015106, 0.01911764705882353, 0.020833333333333332, 0.013157894736842105, 0.018867924528301886, 0.0410958904109589, 0.07142857142857142, 0.01639344262295082, 0.041666666666666664, 0, 0, 0.01639344262295082, 0.019230769230769232, 0.038461538461538464, 0.02857142857142857, 0.02127659574468085, 0.03773584905660377, 0.09090909090909091, 0.013513513513513514, 0, 0.024844720496894408, 0.008130081300813009, 0.02608695652173913, 0.09090909090909091, 0, 0.021505376344086023, 0, 0.01639344262295082, 0, 0, 0.0625, 0, 0, 0.017241379310344827, 0.007633587786259542, 0, 0, 0.0036363636363636364, 0, 0.008771929824561403, 0.045454545454545456, 0.09090909090909091, 0, 0, 0, 0, 0.010752688172043012, 0.015957446808510637, 0.022222222222222223, 0.029411764705882353, 0.027777777777777776, 0.036585365853658534, 0, 0.08333333333333333, 0.015384615384615385, 0.015503875968992248, 0.02197802197802198, 0.02, 0.07692307692307693, 0.025806451612903226, 0.024, 0, 0, 0.011049723756906077, 0.011363636363636364, 0, 0.006329113924050633, 0, 0, 0.008064516129032258, 0.02531645569620253, 0.07692307692307693, 0, 0, 0.027237354085603113, 0.010638297872340425, 0.08333333333333333, 0, 0.030927835051546393, 0, 0.01020408163265306, 0.04, 0.022988505747126436, 0.006211180124223602, 0.01507537688442211, 0.037037037037037035, 0.09090909090909091 ]
0.021567
5
[ { "analysis_explanation": null, "end": 21489, "entity_type": "MEDICAL_LICENSE", "recognition_metadata": { "recognizer_identifier": "MedicalLicenseRecognizer_140094861343616", "recognizer_name": "MedicalLicenseRecognizer" }, "score": 1, "start": 21480 }, { "analysis_explanation": null, "end": 47, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 116, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83 }, { "analysis_explanation": null, "end": 156, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 154 }, { "analysis_explanation": null, "end": 170, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 158 }, { "analysis_explanation": null, "end": 186, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 182 }, { "analysis_explanation": null, "end": 195, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 187 }, { "analysis_explanation": null, "end": 239, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 199 }, { "analysis_explanation": null, "end": 264, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 245 }, { "analysis_explanation": null, "end": 291, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 275 }, { "analysis_explanation": null, "end": 343, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 339 }, { "analysis_explanation": null, "end": 354, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 349 }, { "analysis_explanation": null, "end": 379, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 360 }, { "analysis_explanation": null, "end": 411, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 392 }, { "analysis_explanation": null, "end": 450, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 440 }, { "analysis_explanation": null, "end": 472, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 459 }, { "analysis_explanation": null, "end": 534, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 512 }, { "analysis_explanation": null, "end": 575, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 557 }, { "analysis_explanation": null, "end": 685, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 664 }, { "analysis_explanation": null, "end": 781, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 761 }, { "analysis_explanation": null, "end": 895, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 870 }, { "analysis_explanation": null, "end": 926, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 906 }, { "analysis_explanation": null, "end": 934, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 930 }, { "analysis_explanation": null, "end": 1072, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1059 }, { "analysis_explanation": null, "end": 1102, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1082 }, { "analysis_explanation": null, "end": 1105, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1103 }, { "analysis_explanation": null, "end": 1258, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1208 }, { "analysis_explanation": null, "end": 1281, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1264 }, { "analysis_explanation": null, "end": 1365, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1352 }, { "analysis_explanation": null, "end": 1371, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1367 }, { "analysis_explanation": null, "end": 1411, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1404 }, { "analysis_explanation": null, "end": 1488, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1460 }, { "analysis_explanation": null, "end": 1555, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1544 }, { "analysis_explanation": null, "end": 1563, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1557 }, { "analysis_explanation": null, "end": 1592, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1582 }, { "analysis_explanation": null, "end": 1658, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1643 }, { "analysis_explanation": null, "end": 1684, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1663 }, { "analysis_explanation": null, "end": 1703, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1695 }, { "analysis_explanation": null, "end": 1711, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1707 }, { "analysis_explanation": null, "end": 1856, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1832 }, { "analysis_explanation": null, "end": 1885, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1866 }, { "analysis_explanation": null, "end": 1915, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1900 }, { "analysis_explanation": null, "end": 1998, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1959 }, { "analysis_explanation": null, "end": 2045, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2038 }, { "analysis_explanation": null, "end": 2057, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2053 }, { "analysis_explanation": null, "end": 2207, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2196 }, { "analysis_explanation": null, "end": 2374, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2370 }, { "analysis_explanation": null, "end": 2417, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2393 }, { "analysis_explanation": null, "end": 2426, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2419 }, { "analysis_explanation": null, "end": 2467, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2457 }, { "analysis_explanation": null, "end": 2512, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2484 }, { "analysis_explanation": null, "end": 2561, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2542 }, { "analysis_explanation": null, "end": 2578, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2575 }, { "analysis_explanation": null, "end": 2601, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2590 }, { "analysis_explanation": null, "end": 2663, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2647 }, { "analysis_explanation": null, "end": 2780, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2776 }, { "analysis_explanation": null, "end": 2882, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2854 }, { "analysis_explanation": null, "end": 2914, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2903 }, { "analysis_explanation": null, "end": 2940, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2927 }, { "analysis_explanation": null, "end": 2948, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2945 }, { "analysis_explanation": null, "end": 2985, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2958 }, { "analysis_explanation": null, "end": 3006, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2997 }, { "analysis_explanation": null, "end": 3049, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3021 }, { "analysis_explanation": null, "end": 3058, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3053 }, { "analysis_explanation": null, "end": 3080, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3068 }, { "analysis_explanation": null, "end": 3167, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3155 }, { "analysis_explanation": null, "end": 3178, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3176 }, { "analysis_explanation": null, "end": 3247, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3223 }, { "analysis_explanation": null, "end": 3314, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3297 }, { "analysis_explanation": null, "end": 3335, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3319 }, { "analysis_explanation": null, "end": 3348, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3339 }, { "analysis_explanation": null, "end": 3437, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3417 }, { "analysis_explanation": null, "end": 3451, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3438 }, { "analysis_explanation": null, "end": 3479, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3456 }, { "analysis_explanation": null, "end": 3587, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3549 }, { "analysis_explanation": null, "end": 3611, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3596 }, { "analysis_explanation": null, "end": 3635, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3612 }, { "analysis_explanation": null, "end": 3767, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3759 }, { "analysis_explanation": null, "end": 3774, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3770 }, { "analysis_explanation": null, "end": 3792, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3779 }, { "analysis_explanation": null, "end": 3879, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3861 }, { "analysis_explanation": null, "end": 3903, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3895 }, { "analysis_explanation": null, "end": 3918, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3906 }, { "analysis_explanation": null, "end": 3950, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3930 }, { "analysis_explanation": null, "end": 4041, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4014 }, { "analysis_explanation": null, "end": 4053, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4047 }, { "analysis_explanation": null, "end": 4090, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4077 }, { "analysis_explanation": null, "end": 4133, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4109 }, { "analysis_explanation": null, "end": 4150, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4137 }, { "analysis_explanation": null, "end": 4182, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4178 }, { "analysis_explanation": null, "end": 4222, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4205 }, { "analysis_explanation": null, "end": 4301, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4293 }, { "analysis_explanation": null, "end": 4329, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4305 }, { "analysis_explanation": null, "end": 4365, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4331 }, { "analysis_explanation": null, "end": 4380, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4369 }, { "analysis_explanation": null, "end": 4431, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4413 }, { "analysis_explanation": null, "end": 4497, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4461 }, { "analysis_explanation": null, "end": 4531, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4520 }, { "analysis_explanation": null, "end": 4603, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4584 }, { "analysis_explanation": null, "end": 4637, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4623 }, { "analysis_explanation": null, "end": 4690, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4666 }, { "analysis_explanation": null, "end": 4750, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4731 }, { "analysis_explanation": null, "end": 4888, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4822 }, { "analysis_explanation": null, "end": 4905, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4890 }, { "analysis_explanation": null, "end": 4940, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4907 }, { "analysis_explanation": null, "end": 4989, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4983 }, { "analysis_explanation": null, "end": 5002, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4991 }, { "analysis_explanation": null, "end": 5037, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5027 }, { "analysis_explanation": null, "end": 5047, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5039 }, { "analysis_explanation": null, "end": 5087, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5062 }, { "analysis_explanation": null, "end": 5105, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5088 }, { "analysis_explanation": null, "end": 5130, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5107 }, { "analysis_explanation": null, "end": 5205, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5170 }, { "analysis_explanation": null, "end": 5371, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5346 }, { "analysis_explanation": null, "end": 5481, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5452 }, { "analysis_explanation": null, "end": 5499, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5482 }, { "analysis_explanation": null, "end": 5520, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5501 }, { "analysis_explanation": null, "end": 5535, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5521 }, { "analysis_explanation": null, "end": 5559, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5540 }, { "analysis_explanation": null, "end": 5582, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5561 }, { "analysis_explanation": null, "end": 5737, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5727 }, { "analysis_explanation": null, "end": 5743, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5739 }, { "analysis_explanation": null, "end": 5817, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5760 }, { "analysis_explanation": null, "end": 5840, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5824 }, { "analysis_explanation": null, "end": 5876, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5863 }, { "analysis_explanation": null, "end": 5892, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5890 }, { "analysis_explanation": null, "end": 5961, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5955 }, { "analysis_explanation": null, "end": 6009, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5991 }, { "analysis_explanation": null, "end": 6031, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6014 }, { "analysis_explanation": null, "end": 6073, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6034 }, { "analysis_explanation": null, "end": 6116, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6104 }, { "analysis_explanation": null, "end": 6180, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6168 }, { "analysis_explanation": null, "end": 6209, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6190 }, { "analysis_explanation": null, "end": 6244, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6221 }, { "analysis_explanation": null, "end": 6294, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6283 }, { "analysis_explanation": null, "end": 6311, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6295 }, { "analysis_explanation": null, "end": 6354, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6352 }, { "analysis_explanation": null, "end": 6381, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6367 }, { "analysis_explanation": null, "end": 6401, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6383 }, { "analysis_explanation": null, "end": 6436, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6409 }, { "analysis_explanation": null, "end": 6676, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6660 }, { "analysis_explanation": null, "end": 6710, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6700 }, { "analysis_explanation": null, "end": 6772, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6752 }, { "analysis_explanation": null, "end": 6802, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6791 }, { "analysis_explanation": null, "end": 6814, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6804 }, { "analysis_explanation": null, "end": 6868, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6861 }, { "analysis_explanation": null, "end": 6990, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6967 }, { "analysis_explanation": null, "end": 7058, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7051 }, { "analysis_explanation": null, "end": 7105, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7101 }, { "analysis_explanation": null, "end": 7143, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7131 }, { "analysis_explanation": null, "end": 7150, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7147 }, { "analysis_explanation": null, "end": 7274, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7250 }, { "analysis_explanation": null, "end": 7286, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7276 }, { "analysis_explanation": null, "end": 7301, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7287 }, { "analysis_explanation": null, "end": 7317, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7306 }, { "analysis_explanation": null, "end": 7366, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7355 }, { "analysis_explanation": null, "end": 7407, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7397 }, { "analysis_explanation": null, "end": 7445, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7418 }, { "analysis_explanation": null, "end": 7454, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7447 }, { "analysis_explanation": null, "end": 7468, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7466 }, { "analysis_explanation": null, "end": 7543, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7532 }, { "analysis_explanation": null, "end": 7786, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7606 }, { "analysis_explanation": null, "end": 7797, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7787 }, { "analysis_explanation": null, "end": 7823, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7812 }, { "analysis_explanation": null, "end": 7866, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7834 }, { "analysis_explanation": null, "end": 7927, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7887 }, { "analysis_explanation": null, "end": 8014, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7997 }, { "analysis_explanation": null, "end": 8072, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8036 }, { "analysis_explanation": null, "end": 8115, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8093 }, { "analysis_explanation": null, "end": 8150, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8116 }, { "analysis_explanation": null, "end": 8298, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8275 }, { "analysis_explanation": null, "end": 8341, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8327 }, { "analysis_explanation": null, "end": 8383, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8367 }, { "analysis_explanation": null, "end": 8432, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8422 }, { "analysis_explanation": null, "end": 8455, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8439 }, { "analysis_explanation": null, "end": 8485, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8479 }, { "analysis_explanation": null, "end": 8546, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8538 }, { "analysis_explanation": null, "end": 8659, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8605 }, { "analysis_explanation": null, "end": 8699, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8676 }, { "analysis_explanation": null, "end": 8739, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8727 }, { "analysis_explanation": null, "end": 8755, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8749 }, { "analysis_explanation": null, "end": 8869, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8859 }, { "analysis_explanation": null, "end": 8890, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8871 }, { "analysis_explanation": null, "end": 8914, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8893 }, { "analysis_explanation": null, "end": 8971, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8951 }, { "analysis_explanation": null, "end": 8993, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8986 }, { "analysis_explanation": null, "end": 9027, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9010 }, { "analysis_explanation": null, "end": 9093, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9063 }, { "analysis_explanation": null, "end": 9135, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9131 }, { "analysis_explanation": null, "end": 9147, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9140 }, { "analysis_explanation": null, "end": 9190, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9187 }, { "analysis_explanation": null, "end": 9212, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9201 }, { "analysis_explanation": null, "end": 9237, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9216 }, { "analysis_explanation": null, "end": 9287, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9266 }, { "analysis_explanation": null, "end": 9298, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9293 }, { "analysis_explanation": null, "end": 9352, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9329 }, { "analysis_explanation": null, "end": 9375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9358 }, { "analysis_explanation": null, "end": 9403, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9377 }, { "analysis_explanation": null, "end": 9476, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9462 }, { "analysis_explanation": null, "end": 9491, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9477 }, { "analysis_explanation": null, "end": 9509, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9501 }, { "analysis_explanation": null, "end": 9532, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9525 }, { "analysis_explanation": null, "end": 9571, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9569 }, { "analysis_explanation": null, "end": 9623, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9608 }, { "analysis_explanation": null, "end": 9705, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9697 }, { "analysis_explanation": null, "end": 9738, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9721 }, { "analysis_explanation": null, "end": 9773, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9757 }, { "analysis_explanation": null, "end": 9787, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9774 }, { "analysis_explanation": null, "end": 9805, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9796 }, { "analysis_explanation": null, "end": 9841, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9829 }, { "analysis_explanation": null, "end": 9854, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9846 }, { "analysis_explanation": null, "end": 9905, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9880 }, { "analysis_explanation": null, "end": 9936, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9921 }, { "analysis_explanation": null, "end": 10135, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10111 }, { "analysis_explanation": null, "end": 10185, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10178 }, { "analysis_explanation": null, "end": 10210, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10186 }, { "analysis_explanation": null, "end": 10223, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10214 }, { "analysis_explanation": null, "end": 10334, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10320 }, { "analysis_explanation": null, "end": 10355, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10347 }, { "analysis_explanation": null, "end": 10369, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10363 }, { "analysis_explanation": null, "end": 10496, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10456 }, { "analysis_explanation": null, "end": 10515, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10502 }, { "analysis_explanation": null, "end": 10593, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10565 }, { "analysis_explanation": null, "end": 10642, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10617 }, { "analysis_explanation": null, "end": 10711, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10707 }, { "analysis_explanation": null, "end": 10729, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10722 }, { "analysis_explanation": null, "end": 10770, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10735 }, { "analysis_explanation": null, "end": 10842, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10803 }, { "analysis_explanation": null, "end": 10939, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10876 }, { "analysis_explanation": null, "end": 10965, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10961 }, { "analysis_explanation": null, "end": 10996, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10991 }, { "analysis_explanation": null, "end": 11017, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11001 }, { "analysis_explanation": null, "end": 11068, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11054 }, { "analysis_explanation": null, "end": 11096, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11075 }, { "analysis_explanation": null, "end": 11153, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11140 }, { "analysis_explanation": null, "end": 11177, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11155 }, { "analysis_explanation": null, "end": 11182, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11178 }, { "analysis_explanation": null, "end": 11391, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11368 }, { "analysis_explanation": null, "end": 11471, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11453 }, { "analysis_explanation": null, "end": 11518, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11511 }, { "analysis_explanation": null, "end": 11554, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11531 }, { "analysis_explanation": null, "end": 11642, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11627 }, { "analysis_explanation": null, "end": 11655, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11644 }, { "analysis_explanation": null, "end": 11678, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11662 }, { "analysis_explanation": null, "end": 11770, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11757 }, { "analysis_explanation": null, "end": 11796, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11784 }, { "analysis_explanation": null, "end": 11841, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11832 }, { "analysis_explanation": null, "end": 11863, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11854 }, { "analysis_explanation": null, "end": 12111, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12103 }, { "analysis_explanation": null, "end": 12168, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12152 }, { "analysis_explanation": null, "end": 12216, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12195 }, { "analysis_explanation": null, "end": 12236, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12218 }, { "analysis_explanation": null, "end": 12295, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12272 }, { "analysis_explanation": null, "end": 12481, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12465 }, { "analysis_explanation": null, "end": 12679, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12658 }, { "analysis_explanation": null, "end": 12749, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12741 }, { "analysis_explanation": null, "end": 12847, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12836 }, { "analysis_explanation": null, "end": 12863, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12849 }, { "analysis_explanation": null, "end": 12881, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12867 }, { "analysis_explanation": null, "end": 12980, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12951 }, { "analysis_explanation": null, "end": 12993, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12982 }, { "analysis_explanation": null, "end": 13030, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13013 }, { "analysis_explanation": null, "end": 13145, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13138 }, { "analysis_explanation": null, "end": 13164, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13147 }, { "analysis_explanation": null, "end": 13219, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13188 }, { "analysis_explanation": null, "end": 13229, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13221 }, { "analysis_explanation": null, "end": 13323, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13304 }, { "analysis_explanation": null, "end": 13351, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13327 }, { "analysis_explanation": null, "end": 13397, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13381 }, { "analysis_explanation": null, "end": 13470, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13448 }, { "analysis_explanation": null, "end": 13475, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13471 }, { "analysis_explanation": null, "end": 13493, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13479 }, { "analysis_explanation": null, "end": 13634, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13627 }, { "analysis_explanation": null, "end": 13663, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13652 }, { "analysis_explanation": null, "end": 13757, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13746 }, { "analysis_explanation": null, "end": 13762, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13758 }, { "analysis_explanation": null, "end": 13781, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13763 }, { "analysis_explanation": null, "end": 13849, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13823 }, { "analysis_explanation": null, "end": 13875, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13864 }, { "analysis_explanation": null, "end": 13930, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13921 }, { "analysis_explanation": null, "end": 13962, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13940 }, { "analysis_explanation": null, "end": 14143, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14119 }, { "analysis_explanation": null, "end": 14165, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14149 }, { "analysis_explanation": null, "end": 14189, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14167 }, { "analysis_explanation": null, "end": 14259, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14231 }, { "analysis_explanation": null, "end": 14280, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14260 }, { "analysis_explanation": null, "end": 14293, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14282 }, { "analysis_explanation": null, "end": 14403, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14392 }, { "analysis_explanation": null, "end": 14475, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14463 }, { "analysis_explanation": null, "end": 14537, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14498 }, { "analysis_explanation": null, "end": 14549, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14541 }, { "analysis_explanation": null, "end": 14583, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14579 }, { "analysis_explanation": null, "end": 14607, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14600 }, { "analysis_explanation": null, "end": 14641, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14609 }, { "analysis_explanation": null, "end": 14779, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14770 }, { "analysis_explanation": null, "end": 14800, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14792 }, { "analysis_explanation": null, "end": 14835, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14826 }, { "analysis_explanation": null, "end": 14869, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14854 }, { "analysis_explanation": null, "end": 14918, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14906 }, { "analysis_explanation": null, "end": 14962, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14943 }, { "analysis_explanation": null, "end": 14991, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14983 }, { "analysis_explanation": null, "end": 15008, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14996 }, { "analysis_explanation": null, "end": 15150, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15143 }, { "analysis_explanation": null, "end": 15176, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15166 }, { "analysis_explanation": null, "end": 15276, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15265 }, { "analysis_explanation": null, "end": 15287, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15278 }, { "analysis_explanation": null, "end": 15302, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15298 }, { "analysis_explanation": null, "end": 15344, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15326 }, { "analysis_explanation": null, "end": 15433, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15414 }, { "analysis_explanation": null, "end": 15446, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15442 }, { "analysis_explanation": null, "end": 15507, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15486 }, { "analysis_explanation": null, "end": 15519, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15511 }, { "analysis_explanation": null, "end": 15585, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15568 }, { "analysis_explanation": null, "end": 15625, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15604 }, { "analysis_explanation": null, "end": 15634, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15627 }, { "analysis_explanation": null, "end": 15665, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15638 }, { "analysis_explanation": null, "end": 15708, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15697 }, { "analysis_explanation": null, "end": 15745, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15710 }, { "analysis_explanation": null, "end": 15757, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15746 }, { "analysis_explanation": null, "end": 15805, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15781 }, { "analysis_explanation": null, "end": 15823, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15806 }, { "analysis_explanation": null, "end": 15833, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15825 }, { "analysis_explanation": null, "end": 15861, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15835 }, { "analysis_explanation": null, "end": 15910, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15903 }, { "analysis_explanation": null, "end": 15915, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15911 }, { "analysis_explanation": null, "end": 15924, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15917 }, { "analysis_explanation": null, "end": 15935, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15929 }, { "analysis_explanation": null, "end": 15969, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15949 }, { "analysis_explanation": null, "end": 15991, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15971 }, { "analysis_explanation": null, "end": 16019, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15996 }, { "analysis_explanation": null, "end": 16029, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16021 }, { "analysis_explanation": null, "end": 16108, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16092 }, { "analysis_explanation": null, "end": 16117, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16110 }, { "analysis_explanation": null, "end": 16122, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16118 }, { "analysis_explanation": null, "end": 16129, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16124 }, { "analysis_explanation": null, "end": 16157, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16135 }, { "analysis_explanation": null, "end": 16178, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16158 }, { "analysis_explanation": null, "end": 16205, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16185 }, { "analysis_explanation": null, "end": 16266, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16253 }, { "analysis_explanation": null, "end": 16302, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16291 }, { "analysis_explanation": null, "end": 16329, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16319 }, { "analysis_explanation": null, "end": 16338, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16331 }, { "analysis_explanation": null, "end": 16343, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16339 }, { "analysis_explanation": null, "end": 16353, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16345 }, { "analysis_explanation": null, "end": 16373, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16367 }, { "analysis_explanation": null, "end": 16407, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16387 }, { "analysis_explanation": null, "end": 16424, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16418 }, { "analysis_explanation": null, "end": 16436, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16430 }, { "analysis_explanation": null, "end": 16485, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16461 }, { "analysis_explanation": null, "end": 16520, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16503 }, { "analysis_explanation": null, "end": 16563, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16547 }, { "analysis_explanation": null, "end": 16710, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16688 }, { "analysis_explanation": null, "end": 16758, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16745 }, { "analysis_explanation": null, "end": 16781, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16759 }, { "analysis_explanation": null, "end": 16807, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16786 }, { "analysis_explanation": null, "end": 16836, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16823 }, { "analysis_explanation": null, "end": 16898, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16856 }, { "analysis_explanation": null, "end": 16958, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16941 }, { "analysis_explanation": null, "end": 16979, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16961 }, { "analysis_explanation": null, "end": 17017, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17010 }, { "analysis_explanation": null, "end": 17023, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17018 }, { "analysis_explanation": null, "end": 17043, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17025 }, { "analysis_explanation": null, "end": 17053, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17045 }, { "analysis_explanation": null, "end": 17065, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17056 }, { "analysis_explanation": null, "end": 17110, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17104 }, { "analysis_explanation": null, "end": 17132, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17122 }, { "analysis_explanation": null, "end": 17141, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17134 }, { "analysis_explanation": null, "end": 17146, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17142 }, { "analysis_explanation": null, "end": 17155, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17148 }, { "analysis_explanation": null, "end": 17173, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17166 }, { "analysis_explanation": null, "end": 17185, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17179 }, { "analysis_explanation": null, "end": 17202, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17199 }, { "analysis_explanation": null, "end": 17213, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17208 }, { "analysis_explanation": null, "end": 17300, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17286 }, { "analysis_explanation": null, "end": 17499, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17481 }, { "analysis_explanation": null, "end": 17514, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17501 }, { "analysis_explanation": null, "end": 17530, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17525 }, { "analysis_explanation": null, "end": 17553, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17541 }, { "analysis_explanation": null, "end": 17736, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17719 }, { "analysis_explanation": null, "end": 17784, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17776 }, { "analysis_explanation": null, "end": 17832, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17826 }, { "analysis_explanation": null, "end": 17966, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17942 }, { "analysis_explanation": null, "end": 17984, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17967 }, { "analysis_explanation": null, "end": 17994, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17986 }, { "analysis_explanation": null, "end": 18011, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18005 }, { "analysis_explanation": null, "end": 18036, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18018 }, { "analysis_explanation": null, "end": 18051, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18038 }, { "analysis_explanation": null, "end": 18069, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18062 }, { "analysis_explanation": null, "end": 18110, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18098 }, { "analysis_explanation": null, "end": 18138, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18128 }, { "analysis_explanation": null, "end": 18202, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18179 }, { "analysis_explanation": null, "end": 18245, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18241 }, { "analysis_explanation": null, "end": 18364, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18275 }, { "analysis_explanation": null, "end": 18383, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18373 }, { "analysis_explanation": null, "end": 18420, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18409 }, { "analysis_explanation": null, "end": 18519, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18507 }, { "analysis_explanation": null, "end": 18543, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18530 }, { "analysis_explanation": null, "end": 18610, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18595 }, { "analysis_explanation": null, "end": 18628, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18612 }, { "analysis_explanation": null, "end": 18641, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18636 }, { "analysis_explanation": null, "end": 18670, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18665 }, { "analysis_explanation": null, "end": 18690, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18672 }, { "analysis_explanation": null, "end": 18719, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18710 }, { "analysis_explanation": null, "end": 18733, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18729 }, { "analysis_explanation": null, "end": 18745, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18735 }, { "analysis_explanation": null, "end": 18778, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18760 }, { "analysis_explanation": null, "end": 18793, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18780 }, { "analysis_explanation": null, "end": 18812, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18804 }, { "analysis_explanation": null, "end": 18869, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18818 }, { "analysis_explanation": null, "end": 19026, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19012 }, { "analysis_explanation": null, "end": 19040, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19028 }, { "analysis_explanation": null, "end": 19055, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19049 }, { "analysis_explanation": null, "end": 19077, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19061 }, { "analysis_explanation": null, "end": 19130, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19125 }, { "analysis_explanation": null, "end": 19146, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19134 }, { "analysis_explanation": null, "end": 19243, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19231 }, { "analysis_explanation": null, "end": 19267, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19254 }, { "analysis_explanation": null, "end": 19276, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19269 }, { "analysis_explanation": null, "end": 19286, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19279 }, { "analysis_explanation": null, "end": 19319, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19293 }, { "analysis_explanation": null, "end": 19458, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19447 }, { "analysis_explanation": null, "end": 19496, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19485 }, { "analysis_explanation": null, "end": 19562, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19511 }, { "analysis_explanation": null, "end": 19589, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19571 }, { "analysis_explanation": null, "end": 19604, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19591 }, { "analysis_explanation": null, "end": 19621, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19615 }, { "analysis_explanation": null, "end": 19643, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19628 }, { "analysis_explanation": null, "end": 19657, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19644 }, { "analysis_explanation": null, "end": 19920, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19910 }, { "analysis_explanation": null, "end": 20081, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20063 }, { "analysis_explanation": null, "end": 20096, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20083 }, { "analysis_explanation": null, "end": 20187, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20120 }, { "analysis_explanation": null, "end": 20274, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20262 }, { "analysis_explanation": null, "end": 20294, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20276 }, { "analysis_explanation": null, "end": 20309, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20296 }, { "analysis_explanation": null, "end": 20329, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20320 }, { "analysis_explanation": null, "end": 20347, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20341 }, { "analysis_explanation": null, "end": 20369, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20354 }, { "analysis_explanation": null, "end": 20396, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20371 }, { "analysis_explanation": null, "end": 20468, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20454 }, { "analysis_explanation": null, "end": 20493, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20483 }, { "analysis_explanation": null, "end": 20661, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20655 }, { "analysis_explanation": null, "end": 20874, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20842 }, { "analysis_explanation": null, "end": 20895, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20881 }, { "analysis_explanation": null, "end": 20914, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20901 }, { "analysis_explanation": null, "end": 20931, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20916 }, { "analysis_explanation": null, "end": 20946, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20939 }, { "analysis_explanation": null, "end": 20975, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20968 }, { "analysis_explanation": null, "end": 21019, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20980 }, { "analysis_explanation": null, "end": 21030, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21021 }, { "analysis_explanation": null, "end": 21043, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21034 }, { "analysis_explanation": null, "end": 21055, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21045 }, { "analysis_explanation": null, "end": 21082, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21062 }, { "analysis_explanation": null, "end": 21103, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21084 }, { "analysis_explanation": null, "end": 21151, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21138 }, { "analysis_explanation": null, "end": 21170, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21152 }, { "analysis_explanation": null, "end": 21178, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21172 }, { "analysis_explanation": null, "end": 21183, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21179 }, { "analysis_explanation": null, "end": 21192, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21185 }, { "analysis_explanation": null, "end": 21210, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21198 }, { "analysis_explanation": null, "end": 21233, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21219 }, { "analysis_explanation": null, "end": 21245, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21234 }, { "analysis_explanation": null, "end": 21371, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21358 }, { "analysis_explanation": null, "end": 21396, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21373 }, { "analysis_explanation": null, "end": 21562, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21556 }, { "analysis_explanation": null, "end": 21596, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21576 }, { "analysis_explanation": null, "end": 21613, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21607 }, { "analysis_explanation": null, "end": 78, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 68 }, { "analysis_explanation": null, "end": 16574, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 16565 }, { "analysis_explanation": null, "end": 16661, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 16577 }, { "analysis_explanation": null, "end": 16853, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 16843 }, { "analysis_explanation": null, "end": 16898, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 16856 }, { "analysis_explanation": null, "end": 17368, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 17359 }, { "analysis_explanation": null, "end": 17472, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 17371 }, { "analysis_explanation": null, "end": 17853, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 17844 }, { "analysis_explanation": null, "end": 17933, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 17856 }, { "analysis_explanation": null, "end": 18272, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 18263 }, { "analysis_explanation": null, "end": 18364, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 18275 }, { "analysis_explanation": null, "end": 18308, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 18298 }, { "analysis_explanation": null, "end": 18430, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 18422 }, { "analysis_explanation": null, "end": 18498, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 18433 }, { "analysis_explanation": null, "end": 18879, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 18871 }, { "analysis_explanation": null, "end": 19003, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 18882 }, { "analysis_explanation": null, "end": 19202, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 19153 }, { "analysis_explanation": null, "end": 19381, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 19373 }, { "analysis_explanation": null, "end": 19438, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 19384 }, { "analysis_explanation": null, "end": 19508, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 19498 }, { "analysis_explanation": null, "end": 19562, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 19511 }, { "analysis_explanation": null, "end": 19700, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 19690 }, { "analysis_explanation": null, "end": 19799, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 19703 }, { "analysis_explanation": null, "end": 19931, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 19922 }, { "analysis_explanation": null, "end": 20054, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 19934 }, { "analysis_explanation": null, "end": 20187, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 20126 }, { "analysis_explanation": null, "end": 20493, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 20483 }, { "analysis_explanation": null, "end": 20601, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 20496 }, { "analysis_explanation": null, "end": 20683, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 20673 }, { "analysis_explanation": null, "end": 20788, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 20686 }, { "analysis_explanation": null, "end": 21266, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 21257 }, { "analysis_explanation": null, "end": 21349, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 21269 }, { "analysis_explanation": null, "end": 21434, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 21424 }, { "analysis_explanation": null, "end": 21547, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 21437 }, { "analysis_explanation": null, "end": 47, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 33 }, { "analysis_explanation": null, "end": 18430, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 18422 }, { "analysis_explanation": null, "end": 20017, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 20009 }, { "analysis_explanation": null, "end": 20049, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.4, "start": 20043 }, { "analysis_explanation": null, "end": 15692, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.2, "start": 15686 }, { "analysis_explanation": null, "end": 17043, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.2, "start": 17037 }, { "analysis_explanation": null, "end": 19113, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.2, "start": 19107 }, { "analysis_explanation": null, "end": 16647, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 16639 }, { "analysis_explanation": null, "end": 16656, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 16648 }, { "analysis_explanation": null, "end": 19557, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 19549 }, { "analysis_explanation": null, "end": 19789, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 19781 }, { "analysis_explanation": null, "end": 20017, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 20009 }, { "analysis_explanation": null, "end": 16647, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16639 }, { "analysis_explanation": null, "end": 16656, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 16648 }, { "analysis_explanation": null, "end": 17427, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17420 }, { "analysis_explanation": null, "end": 17912, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17905 }, { "analysis_explanation": null, "end": 18998, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 18991 }, { "analysis_explanation": null, "end": 19557, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 19549 }, { "analysis_explanation": null, "end": 19789, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 19781 }, { "analysis_explanation": null, "end": 20596, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 20590 } ]
[ "Omega-conotoxin GVIA, the N-type calcium channel inhibitor, is sympatholytic but not vagolytic: consequences for hemodynamics and autonomic reflexes in conscious rabbits.", "\nWe investigated the effects of the N-type calcium channel blocking agent, omega-conotoxin GVIA, on the resting hemodynamics and on some autonomic reflexes in the conscious rabbit. ", "omega-Conotoxin 3 and 10 micrograms/kg i.v. ", "reduced mean arterial blood pressure by 16 +/- 2 and 25 +/- 3 mm Hg, respectively, over 30 min accompanied by a tachycardia. ", "Renal vascular conductance (Doppler flowmeter) increased by 27.6 +/- 3.7 and 38.6 +/- 10.3% at 30 min after omega-conotoxin 3 and 10 micrograms/kg, respectively. ", "Vasodilatation was also observed but to a lesser extent in the hindquarter and mesenteric vascular beds. ", "The baroreceptor-heart rate reflex was evoked by a drug method (bolus injection of sodium nitroprusside and phenylephrine) and by inflation of perivascular balloons implanted on the thoracic vena cava and aorta. ", "omega-Conotoxin (3 micrograms/kg) abolished the sympathetic component of the cardiac baroreceptor reflex without affecting vagal efferent activity. ", "In addition, marked vagal-mediated bradycardia from (a) the \"Bezold-Jarisch-like\" reflex evoked by serotonin (1-10 micrograms/kg i.v.) ", "and (b) the nasopharyngeal reflex evoked by cigarette smoke were unaffected by omega-conotoxin (3-10 micrograms/kg). ", "We conclude that omega-conotoxin-induced N-type calcium channel blockade abolishes sympathetic but not vagal cardiac efferent activity. ", "The hypotension and peripheral vasodilatation are probably due to the prejunctional sympatholytic action of the peptide. ", "These N-type calcium channels are thus limited to the sympathetic varicosities in the rabbit." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.0058823529411764705, 0.0055248618784530384, 0.022727272727272728, 0, 0.006172839506172839, 0, 0, 0.006756756756756757, 0, 0, 0, 0, 0 ]
0.00362
5
[ { "analysis_explanation": null, "end": 265, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 245 }, { "analysis_explanation": null, "end": 443, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 442 }, { "analysis_explanation": null, "end": 489, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 483 }, { "analysis_explanation": null, "end": 621, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 615 }, { "analysis_explanation": null, "end": 645, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 628 }, { "analysis_explanation": null, "end": 1014, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 999 }, { "analysis_explanation": null, "end": 1376, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1361 }, { "analysis_explanation": null, "end": 1432, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1416 } ]
[ "Characterization and bond strength of electrolytic HA/TiO2 double layers for orthopaedic applications.", "\nInsufficient bonding of juxtaposed bone to an orthopaedic/dental implant could be caused by material surface properties that do not support new bone growth. ", "For this reason, fabrication of biomaterials surface properties, which support osteointegration, should be one of the key objectives in the design of the next generation of orthopaedic/dental implants. ", "Titanium and titanium alloy have been widely used in several bioimplant applications, but when implanted into the human body, these still contain some disadvantages, such as poor osteointegration (forming a fibrous capsule), wear debris and metal ion release, which often lead to clinical failure. ", "Electrolytic hydroxyapatite/titanium dioxide (HA/TiO2) double layers were successfully deposited on titanium substrates in TiCl4 solution and subsequently in the mixed solution of Ca(NO3)2 and NH4H2PO4, respectively. ", "After annealing at 300 degrees C for 1 h in the air, the coated specimens were evaluated by dynamic cyclic polarization tests, immersion tests, tensile tests, surface morphology observations, XRD analyses and cells culture. ", "The adhesion strength of the HA coating were improved by the intermediate coating of TiO2 from 11.3 to 46.7 MPa. ", "From cell culture and immersion test results, the HA/TiO2 coated specimens promoted not only cells differentiation, but also appeared more bioactive while maintaining non-toxicity." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0.009216589861751152, 0.004464285714285714, 0, 0 ]
0.00171
5
[]
[ "Q:\n\nGrouping the same object according to the elements of their lists\n\nI have following list of the objects of type Application, which looks like: \npublic class Application\n {\n public int AppId { get; set; }\n public List<Question> Questions { get; set; }\n }\n\nWhat I want to do is to map them to object of type Section looking like: \npublic class Section\n {\n public List<int> AppIds { get; set; }\n public List<Question> Questions { get; set; }\n }\n\nby grouping them according to following rule: gather all the same questions under the lists of AppIds, which contain these questions. ", "Exemplary Input and Output:\nInput: A1(Q1,Q2,Q3), A2(Q1,Q2), A3(Q1,Q3), A4(Q1). ", "\nOutput: A1,A2,A3,A4(Q1), A1,A2(Q2), A1,A3(Q3)\n\nIs that possible to do it in LINQ? ", "Or I have to write logic on my own?", "\n\nA:\n\nMaybe there is a simpler way, but this is the first LINQ query I wrote and should be enough to at least get you started. ", "First I flattened out your questions and appids, then I regrouped by questions and listed your appids by question instead. ", "Note that you'll have to populate your List of applications before this will run.", "\nList<Application> app = new List<Application>();\nvar output = (from a in app.", "SelectMany(p => p.Questions.", "Select(z => new {z, p.AppId})\ngroup a.AppId by new \n{\na.Questions\n} into combined\nselect new \n{\ncombined.", "Key.", "Questions,\ncombined.", "ToList()\n});\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.003129890453834116, 0.02531645569620253, 0.024096385542168676, 0, 0, 0, 0, 0.01282051282051282, 0, 0.01904761904761905, 0, 0, 0.07142857142857142 ]
0.011988
5
[ { "analysis_explanation": null, "end": 762, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 754 }, { "analysis_explanation": null, "end": 1291, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1290 }, { "analysis_explanation": null, "end": 1316, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1309 }, { "analysis_explanation": null, "end": 676, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 674 }, { "analysis_explanation": null, "end": 679, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 677 }, { "analysis_explanation": null, "end": 682, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 680 }, { "analysis_explanation": null, "end": 685, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 683 }, { "analysis_explanation": null, "end": 690, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 688 }, { "analysis_explanation": null, "end": 693, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 691 }, { "analysis_explanation": null, "end": 696, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 694 }, { "analysis_explanation": null, "end": 701, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 699 }, { "analysis_explanation": null, "end": 704, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 702 }, { "analysis_explanation": null, "end": 707, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 705 }, { "analysis_explanation": null, "end": 712, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 710 }, { "analysis_explanation": null, "end": 715, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 713 }, { "analysis_explanation": null, "end": 728, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 726 }, { "analysis_explanation": null, "end": 731, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 729 }, { "analysis_explanation": null, "end": 734, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 732 }, { "analysis_explanation": null, "end": 737, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 735 }, { "analysis_explanation": null, "end": 740, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 738 }, { "analysis_explanation": null, "end": 745, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 743 }, { "analysis_explanation": null, "end": 748, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 746 }, { "analysis_explanation": null, "end": 751, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 749 }, { "analysis_explanation": null, "end": 756, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 754 }, { "analysis_explanation": null, "end": 759, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 757 }, { "analysis_explanation": null, "end": 762, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 760 } ]
[ "According to a press release from the CRST Tribal Chairman Harold Frazier, Frazier requested that lawmakers introduce Bills in the 2018 South Dakota Legislative session to protect the Treaty Territory lands and sacred sites within the state.", "\n\nHB 1223 is an “Act to create moratorium on oil pipeline construction, and HB 1224 is an “Act to prohibit certain extractive activities in the Black Hills.”", "\n\nHB 1223 is in response to the Keystone spills along the Keystone Pipeline in western South Dakota and the construction of the Dakota Access Pipeline, which is “positioned to threaten South Dakota crossing the Missouri River just miles north of the South Dakota border,” the press release said.", "\n\nHB 1224 was requested in response to the Rochford Gold Mine project, Uranium Fracking project near Edgemont and other extraction activities, the press release said.", "\n\nWhile the initial response to the proposed bills was immediate and positive, On Monday Feb. 5, the chairman’s office learned that HB 1223 was sent into a hearing in the Energy and Commerce Committee of the House of Representatives headed by Representative Tim Rounds without giving the tribe a chance to attend and defend the bill, but according to Chairman Frazier’s office,a county commissioner was given an opportunity to provide testimony over the phone.", "\n\n“Again the Lakota people get overlooked for the profit of those that live off the land they occupy at our expense,” Chairman Frazier wrote.", "\n\n“I applaud Representative Bordeaux and Senators Heinert and Killer for introducing this needed legislation, but I condemn the Energy and Commerce Committee for not allowing this bill the opportunity to be debated on the floor of the House of Representatives, or even allowing Tribes to explain the importance of this bill,” Frazier wrote.", "\n\nOn Feb. 1, the Chairman published a public letter to the Acting Bureau of Indian Affairs Superintendent Russell Hawkins requesting his support to “honor our trust relationship and hold this request as a moral obligation of the highest honor to our unique and continuing relationship.”", "\n\nThe request is for the federal official to act as a trustee for the benefit of the tribe and think of the best interest of the tribe.", "\n\nThe letter goes on to ask Hawkins to exercise his authority and use his discretion to ensure the survival and welfare of the Lakota people by protecting and enhancing Lakota lands, resources, and self-government.", "\n\nNo information was given concerning a response to the letter to Hawkins or the status of HB 1224." ]
{ "pile_set_name": "Pile-CC" }
[ 0.012448132780082987, 0.006369426751592357, 0.010169491525423728, 0.012048192771084338, 0.010869565217391304, 0.0070921985815602835, 0.01764705882352941, 0.006993006993006993, 0, 0.009345794392523364, 0.020202020202020204 ]
0.01029
5
[ { "analysis_explanation": null, "end": 73, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59 }, { "analysis_explanation": null, "end": 82, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75 }, { "analysis_explanation": null, "end": 200, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 184 }, { "analysis_explanation": null, "end": 395, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 380 }, { "analysis_explanation": null, "end": 495, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 483 }, { "analysis_explanation": null, "end": 593, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 581 }, { "analysis_explanation": null, "end": 621, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 603 }, { "analysis_explanation": null, "end": 658, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 646 }, { "analysis_explanation": null, "end": 799, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 791 }, { "analysis_explanation": null, "end": 950, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 937 }, { "analysis_explanation": null, "end": 1123, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1113 }, { "analysis_explanation": null, "end": 1222, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1215 }, { "analysis_explanation": null, "end": 1333, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1327 }, { "analysis_explanation": null, "end": 1448, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1441 }, { "analysis_explanation": null, "end": 1511, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1504 }, { "analysis_explanation": null, "end": 1522, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1516 }, { "analysis_explanation": null, "end": 1787, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1780 }, { "analysis_explanation": null, "end": 1804, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1798 }, { "analysis_explanation": null, "end": 1914, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1899 }, { "analysis_explanation": null, "end": 2247, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2240 }, { "analysis_explanation": null, "end": 2345, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2339 }, { "analysis_explanation": null, "end": 2387, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2381 }, { "analysis_explanation": null, "end": 2498, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2491 } ]
[ "Q:\n\nHow to iterate over a json object list?", "\n\ni am struggling how to sum all the values of \"B\" in my json object. ", "I want the console log to show me the grand total of all the \"B\" values. ", "\nvar voltot = 0;\n\n$.each(json,function(k,v){\n\n voltot = v.B += voltot ;\n\n //console.log(v.", "B);\n\n});\n\nconsole.log(voltot);\n\nHERE IS MY FULL JSON OBJECT. ", "\n\nvar json=\r\n[\r\n {\r\n \"a\": \"OOCBER\",\r\n \"b\": \"OOCL BERLIN\",\r\n \"c\": \"CHINA\",\r\n \"d\": \"GREAT BRITAIN\",\r\n \"e\": \"*PI\",\r\n \"f\": \"NGB\",\r\n \"g\": \"CN\",\r\n \"i\": \"GB\",\r\n \"n\": 9,\r\n \"o\": 6,\r\n \"p\": \"2015-09-14\",\r\n \"q\": \"2015-09-14\",\r\n \"s\": 4,\r\n \"u\": \"40HC\",\r\n \"v\": \"TRLU7564566\",\r\n \"w\": \"CN0794909\",\r\n \"x\": \"LEIGH\",\r\n \"y\": \"NINGBO\",\r\n \"z\": 395,\r\n \"B\": 68.8,\r\n \"C\": 7987.5,\r\n\r\n },\r\n {\r\n \"a\": \"OOCBER\",\r\n \"b\": \"OOCL BERLIN\",\r\n \"c\": \"CHINA\",\r\n \"d\": \"GREAT BRITAIN\",\r\n \"e\": \"*PI\",\r\n \"f\": \"NGB\",\r\n \"g\": \"CN\",\r\n \"i\": \"GB\",\r\n \"n\": 9,\r\n \"o\": 6,\r\n \"p\": \"2015-09-14\",\r\n \"q\": \"2015-09-14\",\r\n \"s\": 4,\r\n \"u\": \"40HC\",\r\n \"v\": \"TCLU8306124\",\r\n \"w\": \"CN0786008\",\r\n \"x\": \"OXFORDSHIRE\",\r\n \"y\": \"NINGBO\",\r\n \"z\": 412,\r\n \"B\": 68,\r\n \"C\": 8790.5,\r\n\r\n }\r\n]\n\ni am struggling how to sum all the values of \"B\" in my json object. ", "I want the console log to show me the grand total of all the \"B\" values. ", "\nvar voltot = 0;\n\n$.each(json,function(k,v){\n\n voltot = v.B += voltot ;\n\n //console.log(v.", "B);\n\n});\n\nconsole.log(voltot);\n\nA:\n\nThis is wrong\nvoltot = v.B += voltot ;\n\nMake like this\nvoltot += v.B;\n\nOr\nvoltot = v.B + voltot ;\n\nA:\n\nThe preferred method to obtain an unique value from an array is the Array.prototype.reduce method, which takes a callback function and a starting value (it reduces an array to a single value). ", "You could use it this way :\njson.reduce(function(total, current) { return typeof current.", "B === \"number\" ? ", "total + current.", "B : total; }, 0);\n\nHere is a JSFiddle.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0, 0, 0, 0.004595588235294118, 0, 0, 0, 0, 0, 0, 0, 0 ]
0.000328
5
[ { "analysis_explanation": null, "end": 30, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26 }, { "analysis_explanation": null, "end": 103, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99 }, { "analysis_explanation": null, "end": 195, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 185 }, { "analysis_explanation": null, "end": 240, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 234 }, { "analysis_explanation": null, "end": 256, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 250 }, { "analysis_explanation": null, "end": 354, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 342 }, { "analysis_explanation": null, "end": 610, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 600 }, { "analysis_explanation": null, "end": 638, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 628 }, { "analysis_explanation": null, "end": 1109, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1099 }, { "analysis_explanation": null, "end": 1137, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1127 }, { "analysis_explanation": null, "end": 1419, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1415 }, { "analysis_explanation": null, "end": 1511, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1501 }, { "analysis_explanation": null, "end": 1556, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1550 }, { "analysis_explanation": null, "end": 1572, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1566 }, { "analysis_explanation": null, "end": 2009, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2003 }, { "analysis_explanation": null, "end": 1823, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1804 }, { "analysis_explanation": null, "end": 1965, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1957 }, { "analysis_explanation": null, "end": 733, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 724 }, { "analysis_explanation": null, "end": 1232, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1223 } ]
[ "\"Hey.\" \"", "Hey.\" \"", "Oh, what's this?\" \"", "That is a demerit.\" \"\"", "Jim Halpert.\" \"", "Tardiness.\"\" \"", "Oh.\" \"", "I love it, already.\" \"", "You've got to learn, Jim.\" \"", "You are a second in command, but that does not put you above the law.\" \"", "Oh, I understand.\" \"", "And I also have lots of questions.\" \"", "Like, what does a demerit mean?\" \"", "Let's put it this way.\" \"", "You do not want to receive three of those.\" \"", "Lay it on me.\" \"", "Three demerits, and you'll receive a citation.\" \"", "Now, that sounds serious.\" \"", "Oh, it is serious.\" \"", "Five citations, and you're looking at a violation.\" \"", "Four of those, and you'll receive a verbal warning.\" \"", "Keep it up, and you're looking at a written warning.\" \"", "Two of those, that will land you in a world of hurt, in the form of a disciplinary review, written up by me, and placed on the desk of my immediate superior.\" \"", "Which would be me.\" \"", "That is correct.\" \"", "Okay.\" \"", "I want a copy on my desk by the end of the day or you will receive a full desaggelation.\" \"", "What's a...\" \"What's that?\" \"", "Oh, you don't want to know.\" \"", "Hey, Phyllis.\" \"", "Are you all right?\" \"", "I think I just got flashed.\" \"", "What?\" \"", "Really?\" \"", "In the parking lot.\" \"", "Oh, my God.\" \"", "Move!\" \"", "Okay, I'll call the real police.\" \"", "What happened?\" \"", "What can I do to help?\" \"", "Okay.\" \"", "I'll check the web.\" \"", "Thank you.\" \"", "The police are on it.\" \"", "They say they've already had three calls.\" \"", "Can you tell us what happened?\" \"", "I was walking to the building and this man asked me for directions.\" \"", "And he was holding a map.\" \"", "And when I walked over, he had it out on the map.\" \"", "Phyllis.\" \"", "You're a married woman.\" \"", "The guy was just hanging brain.\" \"", "I mean, what's all the fuss?\" \"", "If that's flashing, then lock me up.\" \"", "It's just, like, so creepy.\" \"", "Yeah.\" \"", "What's happening?\" \"", "Oh, some guy exposed himself to Phyllis in the parking lot.\" \"", "Really?\" \"", "Is she okay?\" \"", "Yeah.\" \"", "Bob Vance took her for a walk to calm down.\" \"", "Okay.\" \"", "Phyllis, you say?\" \"", "What is so funny?\" \"", "I mean, did he even see Pam?\" \"", "Or, Karen from behind?\" \"", "I'm guessing not.\" \"", "I'm sorry.\" \"", "It's pretty funny when you think about it.\" \"", "Not really.\" \"", "No.\" \"", "It's disgusting and demeaning.\" \"", "Oh, okay.\" \"", "Masters of comedy, a guy dropped his pants.\" \"", "Have you ever been to the circus?\" \"", "Okay.\" \"", "He's back!\" \"", "Okay.\" \"(", "SPEAKING GIBBERISH)\" \"Hey, what's going on?\" \"", "There's a police car in the...\" \"What?\" \"(", "EXCLAIMS)\" \"What's going on?\" \"", "Oh, Phyllis got flashed.\" \"", "It's...\" \"I don't think laughing about it is an appropriate response.\" \"", "Oh, come on.\" \"", "We're laughing at Phyllis but she's not even here.\" \"", "So, no harm, no foul.\" \"", "I don't think the women in this office...\" \"Incidentally, where were you during all of this?\" \"", "Maybe you're the flasher.\" \"", "I was at a parent-teacher conference.\" \"", "Prove it.\" \"", "Let's see your penis.\" \"", "I...\" \"You know...\" \"As that was coming out of my mouth, I knew that it was wrong.\" \"", "In all the excitement,\" \"I forgot that my primary goal is to keep people safe.\" \"", "Women can't have fun if they don't feel safe.\" \"", "For example, Jan and I have a safe word in case things go too far.\" \"", "Foliage.\" \"", "And if one of us says that word, the other one has to stop.\" \"", "Although last time, she pretended she didn't hear me.\" \"", "JAN:\" \"Michael, come over after work tonight, okay?\" \"", "I miss your body.\" \"", "I don't know.\" \"", "I feel...\" \"I drive a lot.\" \"", "I'm spending a fortune on gas and tools.\" \"", "Okay.\" \"", "I'll give you $200.\" \"", "And if I get up before you, I'll leave it on the dresser.\" \"", "That...\" \"I don't know.\" \"", "That makes me kind of uncomfortable.\" \"", "$300?\" \"", "Well...\" \"I don't know.\" \"", "Look, whatever.\" \"", "Just let my assistant know if you're coming over so he can get more vodka.\" \"", "Okay?\" \"", "Hunter, are you on?\" \"", "HUNTER:\" \"You got it, Jan.\" \"DWIGHT:\" \"The employees of this office are very small and delicate.\" \"", "Deserve protection from local pervs.\" \"", "Better a thousand innocent men are locked up than one guilty man roam free.\" \"", "I am sick over this thing.\" \"", "Those people out there are clearly afraid.\" \"", "And that can't happen.\" \"", "Not in my house.\" \"", "Agreed.\" \"", "Let me show you what I've been working on.\" \"", "There are several penises there\" \"I'd love Phyllis to run her eyes over.\" \"", "You know, see if we can catch this pervert.\" \"", "This is the last thing that Phyllis needs to see right now, Dwight.\" \"", "Look at that one.\" \"", "Dwight, are those your pants?\" \"", "That's a Polaroid.\" \"", "Attention, everybody.\" \"", "Dwight has something he would like to say.\" \"", "Due to a recent incident involving\" \"Phyllis, a man, a map, and his penis,\" \"I think you know what I'm referring to,\" \"Michael has authorized me to form an emergency anti-flashing task force.\" \"", "Question.\" \"", "Won't that interfere with your other task forces?\" \"", "Answer.\" \"", "No, because this is being given priority one.\" \"", "This is a petition for the business park to upgrade their security cameras as well as install two floodlights in the parking lot.\" \"", "And I know what you're thinking.\" \"", "Won't that just shed more light on the penises?\" \"", "But that is a risk we have to take.\" \"", "Pam.\" \"", "You can draw, kind of.\" \"", "Why don't you work with Phallus on drawing a picture of the exposer that I can post around the community?\" \"", "Phallus?\" \"", "Phyllis.\" \"", "Sorry.\" \"", "I've got penises on the brain.\" \"", "Back to work, everybody.\" \"", "I don't often miss Roy, but I can tell you one thing.\" \"", "I wish someone had flashed me when I was with Roy.\" \"", "Because that would have been the ass-kicking of the year.\" \"", "Especially if it had been Jim.\" \"", "He would not have wanted me to have seen Jim's...\" \"I'm...\" \"I am saying a lot of things.\" \"", "I didn't really get a good look.\" \"", "That's okay.\" \"", "I don't feel like answering phones.\" \"", "Hey, did you guys see this memo that Dwight sent out?\" \"\"", "Women will be sent home if they wear makeup\" \"\"or heels exceeding one-quarter inch.\" \"\"", "Females are not allowed to speak to strangers\" \"\"unless given written authorization by Dwight Schrute.\"\" \"", "This is ridiculous.\" \"", "Attention.\" \"", "I am removing all bananas from the kitchen.\" \"", "Dwight, this memo that you distributed is insulting.\" \"", "Desperate times call for desperate measures.\" \"\"", "Sleeves down to the wrists\"?\" \"\"", "Button-up collars and muted colors.\"\" \"", "Nobody dresses like that.\" \"", "MICHAEL:\" \"Okay.\" \"", "You know something, Dwight?\" \"", "We are not the terrorists.\" \"", "Why don't you just take these women, put them in a burlap sack, and hit them with a stick?\" \"", "Because that's what you're doing.\" \"", "I celebrate these women.\" \"", "They deserve the right to dress as they please.\" \"", "If Pam wants to show more cleavage, she should be able to.\" \"", "I encourage that.\" \"", "Look, it's really simple.\" \"", "We just want you guys to treat us with respect.\" \"", "See?\" \"", "That's what we're talking about.\" \"", "Did you hear that, Dwight?\" \"", "Yes.\" \"", "Did you hear that, Michael?\" \"", "No, Dwight.\" \"", "Respect.\" \"", "R-E-S-P-C-T.\" \"Find out what it means to me.\" \"", "All right.\" \"", "You know what?\" \"", "That's it.\" \"", "Conference room.\" \"", "Five minutes.\" \"", "Women's appreciation.\" \"", "Wait a second.\" \"", "How are you qualified for that?\" \"", "Oh, I don't know, James.\" \"", "Did I come from a woman?\" \"", "Have I slept with a woman?\" \"", "More than one?\" \"", "Less than three.\" \"", "That is not current.\" \"", "You know what?\" \"", "Why doesn't Oscar run the meeting?\" \"", "He's a homosexual.\" \"", "Why don't you run the meeting?\" \"", "You play with dolls.\" \"", "Those are collectible action figures.\" \"", "And they're worth more than your car.\" \"", "You know what?\" \"", "I am the expert.\" \"", "I will conduct it.\" \"", "I know the crap out of women.\" \"", "I would like to apologize for all the men who thought this was a laughing matter.\" \"", "Are we still discussing this?\" \"", "I say again, what is the big deal?\" \"", "Nobody likes to be flashed.\" \"", "When Meredith flashed me at that Christmas party,\" \"I nearly vomited.\" \"", "I don't remember doing that.\" \"", "What a surprise.\" \"", "Okay.\" \"", "No catfights.\" \"", "Please?\" \"", "Let's...\" \"My point is...\" \"My point is...\" \"A penis, when seen in the right context, is the most wonderful sight for a woman.\" \"", "But in the wrong context, it is like a monster movie.\" \"", "Alien.\" \"", "What?\" \"", "Shut it.\" \"", "Shut up.\" \"", "Okay.\" \"", "So, what I want to engage us in today is a hardcore discussion about women's problems and issues and situations.\" \"", "Magazines and TV shows and movies portray women as skinny, tall goddesses.\" \"", "Well, look around.\" \"", "Are women like that?\" \"", "No.\" \"", "No, they are not.\" \"", "Even the hot ones aren't really that skinny.\" \"", "So, what does that say?\" \"", "That says that you women are up against it.\" \"", "And it is criminal.\" \"", "Society doesn't care.\" \"", "Society sucks.\" \"", "I don't even consider myself a part of society.\" \"", "F.Y.I. Because I am so angry over all of this.\" \"", "If it were up to me, you ladies would be the fashion models.\" \"", "Yes, Andy.\" \"", "Then, the fashion models could come here and work with me.\" \"", "What you're saying is extremely misogynistic.\" \"", "Yes.\" \"", "Thank you.\" \"", "That was not necessary, but I appreciated it.\" \"", "And it proves my point.\" \"", "Women can do anything.\" \"", "I'm saying that you're being sexist.\" \"", "No.\" \"", "I'm being misogynistic.\" \"", "That is insane.\" \"", "I am not being sexist.\" \"", "That's the same thing.\" \"", "Michael.\" \"", "Yes.\" \"", "When I got my hair cut short, you asked me if I was a lesbian.\" \"", "Because...\" \"That was one possible explanation as to why you got that haircut.\" \"", "And when we get mad, you always ask us if we're on our periods.\" \"", "I have to know whether you're serious or not.\" \"", "I wish I could menstruate.\" \"", "If I could menstruate, I wouldn't have to deal with idiotic calendars anymore.\" \"", "I'd just be able to count down from my previous cycle.\" \"", "Plus, I'd be more in tune with the moon and the tides.\" \"", "Can we just get back to work?\" \"", "Yes.\" \"", "Okay.\" \"", "Yes.\" \"", "This is not work talk.\" \"", "You're right.\" \"", "You're right.\" \"", "And you know why?\" \"", "It's because of where we are.\" \"", "This is a masculine environment.\" \"", "We need to find a place where you feel comfortable.\" \"", "You know where we're gonna go?\" \"", "Steamtown Mall.\" \"", "Frankly, it's kind of insulting.\" \"", "But I have a bunch of stuff I need to return in my car, so I can do that.\" \"", "Malls are just awful and humiliating.\" \"", "They're just store after store of these horrible sales people making a big fuss out of an adult shopping in a junior section.\" \"", "There are petite adults who are sort of smaller who need to wear, maybe, a kids' size 10.\" \"", "Okay!\" \"", "Let's go, ladies of Dunder Mifflin.\" \"", "Hey, we should have a calendar printed up.\" \"", "Pam, put that in my good idea folder.\" \"", "Let's go!\" \"", "Are you finished with the sketch?\" \"", "Yeah.\" \"", "Doesn't seem like the type.\" \"", "Phyllis got a good look.\" \"", "I plan on plastering this pervert's face everywhere.\" \"", "You can run, but you cannot hide.\" \"", "Meredith, slow down!\" \"", "We're not gonna get there any faster if we're dead.\" \"", "Thanks.\" \"", "I know how to drive.\" \"", "Oh.\" \"", "Yeah.\" \"", "You really shouldn't litter.\" \"", "My car.\" \"", "My rules.\" \"", "Hey, Jim.\" \"", "You want to go in the women's bathroom?\" \"", "No.\" \"", "Thank you, though.\" \"", "You aren't curious?\" \"", "Not really.\" \"", "I've seen a bathroom before.\" \"", "Yeah, but, it's every guy's fantasy.\" \"", "I think you mean a girl's locker room.\" \"", "And in the fantasy, there's usually girls in it.\" \"", "Yeah.\" \"", "I'm going in.\" \"", "Go crazy.\" \"", "Oh, my God.\" \"", "I really appreciate your letting me work alongside you so closely today.\" \"", "Of course you do, moonface.\" \"", "That's because you're a preppy freak, you're the office pariah, and nobody likes you.\" \"", "So, start hanging these all around the building.\" \"", "This guy looks like a real deviant.\" \"", "No duh.\" \"", "That's why we've got to catch him.\" \"", "Start hanging those.\" \"", "Aye, aye, Captain.\" \"", "More like, aye, aye, General.\" \"", "MICHAEL:\" \"I don't think she's gonna make it.\" \"", "Don't think she's gonna make it!\" \"", "It's a little too tight.\" \"", "I'm gonna find another spot.\" \"", "Many women are competent drivers.\" \"", "Okay.\" \"", "Come on.\" \"", "This is what we know.\" \"", "Well, I stand corrected.\" \"", "This is pretty cool.\" \"", "Yes.\" \"", "Hey, where did you decide to take Karen tonight?\" \"", "Anna Maria's.\" \"", "RYAN:\" \"What's the occasion?\" \"", "Six-month anniversary.\" \"", "What?\" \"", "Nothing.\" \"", "I think, we all kind of thought you guys were just, like, hooking up.\" \"", "No.\" \"", "We've been dating for six months.\" \"", "She might mention an e-mail that I wrote a while back.\" \"", "Oh, right.\" \"", "I remember that one.\" \"", "She read it to me.\" \"", "She said she's not really ready to date somebody in the office, but she really likes you as a friend.\" \"", "I figured.\" \"", "That's cool.\" \"", "I wouldn't want to be in an office relationship, anyway.\" \"", "All right.\" \"", "I hope nobody's on a diet.\" \"", "Thanks, Michael.\" \"", "Thank you, Michael.\" \"", "You're welcome.\" \"", "You're welcome.\" \"", "Okay.\" \"", "So.\" \"", "Let's dish.\" \"", "What do you want to dish about?\" \"", "Anything you guys want.\" \"", "This is your time.\" \"", "What is a Pap smear?\" \"", "Or is it shmear like cream cheese?\" \"", "Okay.\" \"", "New topic.\" \"", "Kelly, how are things with Ryan?\" \"", "Awesome.\" \"", "Awful, I mean.\" \"", "But, sometimes awesome.\" \"", "What...\" \"What do you think of role-play?\" \"", "It can be fun.\" \"", "Yeah?\" \"", "Well, Jan has this schoolgirl fantasy.\" \"", "That's a pretty common one.\" \"", "I just...\" \"I feel uncomfortable wearing the dress.\" \"", "Okay.\" \"", "I'm gonna be at the doll store.\" \"", "Sometimes the clothes at GapKids are just too flashy.\" \"", "So, I am forced to go to the American Girl store and order clothes for large colonial dolls.\" \"", "Michael, you shouldn't do anything that you're uncomfortable with.\" \"", "Jan says anything that doesn't scare us is not worth doing.\" \"", "I don't know.\" \"", "Maybe we're different people.\" \"", "I like cuddling and spooning and she likes videotaping us during sex.\" \"", "Oh, my God.\" \"", "And then, watching it back right afterward to improve my form.\" \"", "That is not healthy behavior.\" \"", "No.\" \"", "It's not that bad.\" \"", "The worst part is that she shows it to her therapist and they discuss it.\" \"", "Michael, you need to get out of this.\" \"", "No.\" \"", "She's just fooling around.\" \"", "It's a woman thing.\" \"", "No.\" \"", "Normal women don't do stuff like that.\" \"", "This is bad.\" \"", "No.\" \"", "No, that's all right.\" \"", "I'm okay.\" \"", "I'm okay.\" \"", "You guys, what am I gonna do about Jan?\" \"", "Done.\" \"", "Read the pros first.\" \"", "Okay.\" \"\"", "Jan is smart, successful.\" \"\"", "Good clothes.\" \"", "Hot.\" \"\"", "Perfect skin.\" \"", "Nice butt.\"\" \"", "She does have very nice clothes.\" \"", "Okay, okay.\" \"", "Cons?\" \"", "Cons.\" \"\"", "Wears too much makeup.\" \"\"", "Breasts not anything to write home about.\" \"\"", "Insecure about body.\" \"\"", "I'm unhappy when I'm with her.\" \"\"", "Flat-chested.\" ", "What was the last one?\" \"", "She's totally flat.\" \"", "Shrunken chesticles.\" \"", "No.\" \"", "The one before that.\" \"\"", "I'm unhappy when I'm with her.\"\" \"", "Michael.\" \"", "You shouldn't be with someone who doesn't make you happy.\" \"", "I'm happy sometimes.\" \"", "When we scrapbook.\" \"", "Or right towards the end of having sex.\" \"", "Look, most relationships have their rough patches.\" \"", "You just have to push through it sometimes.\" \"", "Yeah.\" \"", "That's smart.\" \"", "Maybe.\" \"", "But it sounds like you're just wrong for each other.\" \"", "That sounds good, too.\" \"", "I don't know who's right.\" \"", "I just don't.\" \"", "I don't know.\" \"", "I don't know.\" \"", "I bet you know.\" \"", "Don't think.\" \"", "Just answer.\" \"", "What do you want to do about Jan?\" \"", "I want to break up with Jan.\" \"Wow!\" \"", "I want to break up with Jan.\" \"My mom taught me that.\" \"", "Wow!\" \"", "I cannot believe this yogurt has no calories.\" \"", "No one said it has no calories.\" \"", "Oh, hey, guys.\" \"", "I want to do something nice for you, because you did something so nice for me earlier.\" \"", "I want you to go in there.\" \"", "I want you to buy one item, on me.\" \"", "As a thank you.\" \"", "Come on.\" \"", "Get in here.\" \"", "Let's face it.\" \"", "Most guys are from the Dark Ages.\" \"", "They're cavemen.\" \"", "And they like a woman to be showing her cleavage and to be wearing eight-inch heels.\" \"", "And to be wearing see-through underpants.\" \"", "But for me, a woman looks best when she is just absolutely naked.\" \"", "This is so great, huh?\" \"", "We should do this much more often.\" \"", "I think we hang out an appropriate amount of time.\" \"", "What are you doing in here?\" \"", "This is the woman's room.\" \"", "You're in here.\" \"", "I pay for that privilege.\" \"", "Okay.\" \"", "I'm a pretty normal guy.\" \"", "I do one weird thing.\" \"", "I like to go in the women's room for number two.\" \"", "I've been caught several times, and I have paid dearly.\" \"(", "EXCLAIMS)\" \"You don't want anything?\" \"", "My treat.\" \"", "Some panties, or...\" \"Like, a thong or G-string, T-back?\" \"", "Get a nice bra.\" \"", "Padded bra.\" \"", "See-through?\" \"", "Push-up?\" \"", "Lace?\" \"", "Thigh-high?\" \"", "Bustier?\" \"", "Anything.\" \"", "It's just...\" \"You know what?\" \"", "I would love to buy you a fresh set of underwear.\" \"", "Phyllis?\" \"", "What do you think?\" \"", "Too much?\" \"", "Jim's gonna love it.\" \"", "I'm kind of in between boyfriends right now, so I don't need anything sexy.\" \"", "But I do need some new hand towels.\" \"", "I figure I can cut up this robe.\" \"", "Slower.\" \"", "Slower.\" \"(", "CELL PHONE RINGING) Meredith.\" \"", "Slow it up.\" \"", "Oh, no.\" \"", "It's Jan. What do I do?\" \"", "Answer it.\" \"", "Don't answer it.\" \"", "Okay.\" \"", "It stopped.\" \"(", "TIRE BURSTS) Oh, crap.\" \"", "That is pretty cool.\" \"", "Michael?\" \"", "You know how to change a wheel, right?\" \"", "Yeah.\" \"", "Yep.\" \"", "Can somebody grab me the lever?\" \"", "And I will...\" \"Here.\" \"", "Meredith?\" \"", "Why don't you put your hazards on?\" \"", "Yeah.\" \"", "Get your hazards on for safety.\" \"", "Let's see.\" \"", "There we go!\" \"", "Good.\" \"", "Yes.\" \"", "We have the...\" \"All right.\" \"", "I think I've got it.\" \"", "Do you have a Crescent?\" \"", "A Crescent-Allen?\" \"", "I don't think we really need that, Michael.\" \"", "You know what?\" \"", "I'm going to...\" \"You take care of that.\" \"", "I'm gonna do traffic detail.\" \"", "You know?\" \"", "I changed a tire today.\" \"", "All by myself.\" \"", "This bathrobe's already coming in handy.\" \"(", "HORN HONKING) Coming!\" \"", "Think we'll find him?\" \"", "Yeah, I do.\" \"", "Because justice never rests.\" \"", "Halvsies?\" \"", "No.\" \"", "Wholesies.\" \"", "Listen, man.\" \"", "I really appreciate you letting me shadow you today.\" \"", "I feel like I learned a lot.\" \"", "Natch.\" \"", "Yep.\" \"", "If you don't mind, I think I'll hang up some of these posters around my neighborhood, schools, post office, et cetera.\" \"", "You know?\" \"", "I may have underestimated you.\" \"", "You're not a total ass.\" \"", "Okay.\" \"", "I am really going to do this.\" \"", "PAM:\" \"Good luck, Michael.\" \"", "You know what?\" \"", "I need my girls with me.\" \"", "Pam, Karen, even Phyllis.\" \"", "Come on.\" \"", "Let's do this.\" \"", "Let's do it.\" \"", "Okay.\" \"", "Remember.\" \"", "Be strong.\" \"", "I love you guys.\" \"", "No, I'm getting her voicemail.\" \"", "Don't leave a...\" \"Hey, Jan. It's me.\" \"", "Michael.\" \"", "I'm just calling to say that I think we need a little break.\" \"", "Permanently.\" \"", "And, I know everybody says this, but I want to remain friends.\" \"", "Or, at least, business associates who get along.\" \"", "Oh.\" \"", "Just so you know, it's not me.\" \"", "It's you.\" \"", "Okay, buddy.\" \"", "Somebody just walked in.\" \"", "I have to go.\" \"", "So, I'll talk to you later.\" \"", "Michael.\" \"", "I was...\" \"I was really unhappy with our conversation earlier.\" \"", "And I...\" \"I just...\" \"I couldn't stop thinking about it, so I decided that I would drive down here and apologize to you in person.\" \"", "So...\" \"I'm sorry.\" \"", "Thank you.\" \"", "So, we're good?\" \"", "Abso-fruitly.\" \"(", "CELL PHONE VIBRATING) Oh.\" \"", "Hold on.\" \"", "Sorry.\" \"", "No.\" \"", "Wait a second.\" \"", "Oh.\" \"", "It's from you.\" \"", "Want to grab some dinner?\" \"", "MICHAEL:\" \"Hey, Jan. It's me.\" \"", "Michael.\" \"", "Yeah.\" \"", "Okay.\" \"", "I'm just calling to say that I think we need a little break.\" \"", "Permanently.\" \"", "And, I know everybody says this, but I want to remain friends.\" \"", "Maybe some Italian.\" \"", "Or, at least, business associates...\" \"Chinese?\" \"... ", "get along.\" \"", "Oh.\" \"", "Just so you know, it's not me.\" \"", "It's you.\" \"", "Okay, buddy...\" \"(MICHAEL EXCLAIMS)\" \"Any man who says he totally understands women is a fool.\" \"", "Because they are un-understandable.\" \"", "There's a wishing fountain at the mall, and I threw a coin in for every woman in the world and made a wish.\" \"", "I wished for Jan to get over me.\" \"", "I wished for Phyllis a plasma TV.\" \"", "I wished for Pam to gain courage.\" \"", "I wished for Angela a heart and for Kelly a brain.\" \"", "Michael.\" \"", "How can you appreciate women so much but also dump one of them?\" \"", "You mean, how can I be so illogical and flighty and unpredictable and emotional?\" \"", "Well, maybe I learned something from women after all.\" \"(", "PHONE RINGING)\" \"Dunder Mifflin Paper I Sex Predator Hotline.\" \"", "This is Dwight Schrute.\" \"", "Hey, Dwight.\" \"", "It's Jim.\" \"", "Jim, what are you doing?\" \"", "I'm busy.\" \"", "No.\" \"", "You're not.\" \"", "I'm looking right at you.\" \"", "I'm hanging up.\" \"", "Don't.\" \"", "I have information about the sex predator.\" \"", "You have information about the sex predator?\" \"", "I saw him two minutes ago.\" \"", "Where?\" \"", "In the women's bathroom, above the sink.\" \"", "Anti-flashing task force!\" \"", "Above the sink.\" \"", "Above the sink.\" \"", "Pam!\"" ]
{ "pile_set_name": "OpenSubtitles" }
[ 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0.03571428571428571, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0.016129032258064516, 0, 0, 0, 0.021739130434782608, 0, 0.05, 0, 0, 0.04, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0.018867924528301886, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0.010101010101010102, 0, 0, 0, 0, 0, 0, 0, 0, 0.013333333333333334, 0, 0.02857142857142857, 0, 0, 0.047619047619047616, 0, 0, 0.010309278350515464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0.017857142857142856, 0.018867924528301886, 0, 0.030303030303030304, 0.010869565217391304, 0, 0, 0, 0, 0, 0.009433962264150943, 0, 0, 0, 0, 0, 0, 0, 0, 0.05263157894736842, 0.03333333333333333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.034482758620689655, 0, 0.03333333333333333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0, 0, 0, 0.02702702702702703, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.013888888888888888, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.07692307692307693, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05555555555555555, 0, 0, 0, 0, 0, 0, 0.02631578947368421, 0, 0, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0, 0, 0.08333333333333333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.020833333333333332, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0196078431372549, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05263157894736842, 0.045454545454545456, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05714285714285714, 0.09090909090909091, 0, 0, 0, 0, 0, 0.024390243902439025, 0, 0, 0, 0, 0.017857142857142856, 0, 0.014492753623188406, 0.016129032258064516, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.025, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0.08333333333333333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0.021739130434782608, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.034482758620689655, 0, 0, 0.07142857142857142, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03125, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010309278350515464, 0, 0, 0, 0.027777777777777776, 0, 0.018867924528301886, 0.09090909090909091, 0, 0, 0, 0.015625, 0, 0.06666666666666667, 0, 0.037037037037037035, 0, 0, 0, 0.03571428571428571, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
0.005048
5
[ { "analysis_explanation": null, "end": 71, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60 }, { "analysis_explanation": null, "end": 145, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 142 }, { "analysis_explanation": null, "end": 930, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 912 }, { "analysis_explanation": null, "end": 1049, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1042 }, { "analysis_explanation": null, "end": 1564, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1557 }, { "analysis_explanation": null, "end": 1803, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1796 }, { "analysis_explanation": null, "end": 1872, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1863 }, { "analysis_explanation": null, "end": 1926, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1919 }, { "analysis_explanation": null, "end": 1988, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1985 }, { "analysis_explanation": null, "end": 2002, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1997 }, { "analysis_explanation": null, "end": 2419, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2412 }, { "analysis_explanation": null, "end": 2550, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2543 }, { "analysis_explanation": null, "end": 3041, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3038 }, { "analysis_explanation": null, "end": 3241, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3234 }, { "analysis_explanation": null, "end": 3271, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3264 }, { "analysis_explanation": null, "end": 3702, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3696 }, { "analysis_explanation": null, "end": 3725, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3719 }, { "analysis_explanation": null, "end": 3745, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3741 }, { "analysis_explanation": null, "end": 4167, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4160 }, { "analysis_explanation": null, "end": 4275, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4268 }, { "analysis_explanation": null, "end": 4306, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4300 }, { "analysis_explanation": null, "end": 4338, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4332 }, { "analysis_explanation": null, "end": 4418, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4412 }, { "analysis_explanation": null, "end": 4502, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4495 }, { "analysis_explanation": null, "end": 4584, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4577 }, { "analysis_explanation": null, "end": 5200, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5193 }, { "analysis_explanation": null, "end": 5299, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5296 }, { "analysis_explanation": null, "end": 5383, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5380 }, { "analysis_explanation": null, "end": 5444, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5436 }, { "analysis_explanation": null, "end": 5478, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5475 }, { "analysis_explanation": null, "end": 5527, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5524 }, { "analysis_explanation": null, "end": 5710, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5704 }, { "analysis_explanation": null, "end": 5914, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5900 }, { "analysis_explanation": null, "end": 6010, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6004 }, { "analysis_explanation": null, "end": 6218, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6211 }, { "analysis_explanation": null, "end": 6257, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6251 }, { "analysis_explanation": null, "end": 6508, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6505 }, { "analysis_explanation": null, "end": 6734, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6728 }, { "analysis_explanation": null, "end": 6773, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6766 }, { "analysis_explanation": null, "end": 6788, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6782 }, { "analysis_explanation": null, "end": 6931, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6919 }, { "analysis_explanation": null, "end": 7037, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7032 }, { "analysis_explanation": null, "end": 7197, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7192 }, { "analysis_explanation": null, "end": 7673, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7665 }, { "analysis_explanation": null, "end": 7702, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7693 }, { "analysis_explanation": null, "end": 8098, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8093 }, { "analysis_explanation": null, "end": 8691, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8687 }, { "analysis_explanation": null, "end": 9083, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9076 }, { "analysis_explanation": null, "end": 10512, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10505 }, { "analysis_explanation": null, "end": 10820, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10817 }, { "analysis_explanation": null, "end": 11226, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11221 }, { "analysis_explanation": null, "end": 11577, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11570 }, { "analysis_explanation": null, "end": 11897, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11892 }, { "analysis_explanation": null, "end": 11905, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11898 }, { "analysis_explanation": null, "end": 11922, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11910 }, { "analysis_explanation": null, "end": 11980, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11959 }, { "analysis_explanation": null, "end": 12118, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12108 }, { "analysis_explanation": null, "end": 12495, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12488 }, { "analysis_explanation": null, "end": 12518, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12511 }, { "analysis_explanation": null, "end": 12766, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12761 }, { "analysis_explanation": null, "end": 12792, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12788 }, { "analysis_explanation": null, "end": 12935, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12932 }, { "analysis_explanation": null, "end": 13258, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13251 }, { "analysis_explanation": null, "end": 13734, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13727 }, { "analysis_explanation": null, "end": 14040, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14037 }, { "analysis_explanation": null, "end": 14400, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14392 }, { "analysis_explanation": null, "end": 14490, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14483 }, { "analysis_explanation": null, "end": 15060, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15056 }, { "analysis_explanation": null, "end": 15099, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15095 }, { "analysis_explanation": null, "end": 15493, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15480 }, { "analysis_explanation": null, "end": 16437, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16430 }, { "analysis_explanation": null, "end": 16480, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16477 }, { "analysis_explanation": null, "end": 16746, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16742 }, { "analysis_explanation": null, "end": 16880, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16873 }, { "analysis_explanation": null, "end": 17291, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17284 }, { "analysis_explanation": null, "end": 17425, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17420 }, { "analysis_explanation": null, "end": 17691, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17686 }, { "analysis_explanation": null, "end": 18009, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18002 }, { "analysis_explanation": null, "end": 18070, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18065 }, { "analysis_explanation": null, "end": 18084, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18077 }, { "analysis_explanation": null, "end": 18253, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18249 }, { "analysis_explanation": null, "end": 18273, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18266 }, { "analysis_explanation": null, "end": 18629, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18622 }, { "analysis_explanation": null, "end": 19045, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19038 }, { "analysis_explanation": null, "end": 19058, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19054 }, { "analysis_explanation": null, "end": 19078, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19071 }, { "analysis_explanation": null, "end": 19265, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19258 }, { "analysis_explanation": null, "end": 19316, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19309 }, { "analysis_explanation": null, "end": 19417, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19410 }, { "analysis_explanation": null, "end": 19656, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19653 }, { "analysis_explanation": null, "end": 19696, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19689 }, { "analysis_explanation": null, "end": 19729, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19726 }, { "analysis_explanation": null, "end": 19769, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19763 }, { "analysis_explanation": null, "end": 19791, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19786 }, { "analysis_explanation": null, "end": 19811, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19804 }, { "analysis_explanation": null, "end": 20112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20098 }, { "analysis_explanation": null, "end": 20128, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20122 }, { "analysis_explanation": null, "end": 20141, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20138 }, { "analysis_explanation": null, "end": 20149, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20146 }, { "analysis_explanation": null, "end": 20386, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20371 } ]
[ "{\n \"name\": \"xray_wasm\",\n \"version\": \"0.0.0\",\n \"description\": \"Xray server packaged for use in JavaScript\",\n \"main\": \"lib/main.js\",\n \"scripts\": {\n \"test\": \"script/test\"\n },\n \"repository\": {\n \"type\": \"git\",\n \"url\": \"git+https://github.com/atom/xray.git\"\n },\n \"license\": \"MIT\",\n \"devDependencies\": {\n \"mocha\": \"^5.1.1\",\n \"source-map-support\": \"^0.5.4\",\n \"webpack\": \"^4.6.0\",\n \"webpack-cli\": \"^2.0.14\"\n }\n}\n" ]
{ "pile_set_name": "Github" }
[ 0.011494252873563218 ]
0.011494
5
[ { "analysis_explanation": null, "end": 267, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.95, "start": 234 } ]
[ "I’ve seen and handled more handkerchiefs than is necessary for any man. ", "Aside from the most common printed silkens and wisp-thin linens, the hank is a wonderful platform for endless creations. ", "French fashion houses have taken silks closer to wearable art while the men’s hanky has remained austere in its mostly white guise. ", "I’m sure any white piece is smart and in order for most uses, but the handkerchief could be much more. ", "Leave it to Italians to come up with the answer. ", "The Neapolitan tailoring house Rubinacci has elevated silken prints with a wide array of pictures from its native culture and folklore.", "\n\nThe current selection offers 35 intricate images in several main colours. ", "The end result is my favourite collection. ", "When folded, the hanks have enough bulk to hold their shape and not fall victim to a common problem, drowning inside the breast pocket. ", "The large images offer plenty of choice for selecting different parts for different occasions, and if the thought of folding and hiding seems unpleasant, the pochettes can also be framed. ", "Rubinacci has decorated its stores with framed hanks instead of conventional paintings. ", "After all, Naples calls for something different. ", "While the maker has a premium for its designs, fine deals can be found on retail sites. ", "Exquisite Trimmings has a few prints on sale." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0, 0, 0.007407407407407408, 0, 0, 0, 0, 0, 0.02040816326530612, 0, 0 ]
0.001987
5
[ { "analysis_explanation": null, "end": 199, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 193 }, { "analysis_explanation": null, "end": 448, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 440 }, { "analysis_explanation": null, "end": 491, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 481 }, { "analysis_explanation": null, "end": 1159, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1153 } ]
[ "Length of pull\n\nLength of pull (sometimes abbreviated as LOP) is the distance from the trigger to the part of a rifle or shotgun which fits against the shoulder of the shooter. ", "Length of pull is an important ergonomic factor for ease of use; and optimum length of pull may vary with the size of the shooter, the thickness of chest clothing and body armor being worn, and whether the shooter is firing from a standing, sitting, or prone position.", "\n\nVariation\nMany rifles and shotguns are manufactured with a standard length of pull assumed to fit most shooters. ", "This is often approximately for rifles and about longer for shotguns. ", "Shooters with short arms may find the buttstock dragging along the underside of their arm as they attempt to raise the firearm into firing position. ", "Shooters with broad shoulders or a long neck may experience face injuries from collision with the telescopic sight or thumb of the trigger hand as the firearm recoils. ", "Modern firearms may be equipped with a telescoping stock or removable spacers to adjust the length of pull. ", "Gunsmiths may adjust the length of pull of custom-built firearms or older firearms by cutting off a portion of the buttstock or adding a recoil pad to the buttstock. ", "Some sources suggest a shooter's optimum length of pull will allow the butt of the firearm to exactly reach the inside of the elbow when the hand of that arm grips the unloaded firearm with a finger on the trigger. ", "Other sources suggest a more appropriate determination may be made using a non-firing \"try-gun\" resembling a firearm with an adjustable buttstock. ", "When a properly adjusted try-gun is held in a firing position, the shooter's nose should be about two finger-widths behind the thumb of the trigger hand.", "\n\nSources\n\nCategory:Firearms" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0, 0, 0, 0, 0, 0, 0, 0.006024096385542169, 0, 0, 0, 0 ]
0.000502
5
[]
[ "Energy Star Program For Homes And Appliances Is On Trump's Chopping Block\n\nTitle\n\nAnother critic is Myron Ebell, a climate change skeptic with the Competitive Enterprise Institute and head of Trump's EPA transition team. \"", "It's good that Energy Star is a voluntary program,\" he says in a statement, \"but it's not clear why taxpayer dollars should be used to promote some products over other products.\"" ]
{ "pile_set_name": "Pile-CC" }
[ 0.02702702702702703, 0.0056179775280898875 ]
0.016323
5
[ { "analysis_explanation": null, "end": 56, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51 }, { "analysis_explanation": null, "end": 111, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100 } ]
[ "Archives\n\nArchives\n\nYou Have a Revenue Job\n\nIf you haven’t thought about this before, I hate to break it to you, but you have a revenue job. ", "That’s right. ", "There’s this thing called salary expense. ", "And that money has to come from somewhere. ", "It doesn’t just come out of the clouds. ", "And as my father use to say, “Money doesn’t grow on trees.” ", "So, where does it come from?", "\n\nIt comes from revenue. ", "Which means you and everybody that you work with has a revenue job. ", "Even if you’re not in marketing. ", "Even if you’re not in sales.", "\n\nIf you’re in operations, your job is to delight the customer, recognize more opportunities for sales, coordinate that with the sales department, and help create more revenue. ", "If you are in quality, your job is to make sure the best quality product goes out the door because when you do, that increases revenue.", "\n\nWhatever you do, every moment of everyday, realize, and think to yourself, “How does this connect to revenue? ", "Because my job is to make sure that as an organization we grow and we prosper every day, and we do that best by focusing on the customer.”" ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
0
5
[]
[ "22 December 2011\n\nFirst year of shop was a wonderful journey of learning and excitement and dreams and i want to thank you all of you who supported me through the year and believed in me, shoppers and bloggers, you are the reason im still here so thank you again and i love you all : ))\n\nThese are my exclusive items for the fair but there is more to see and so many great designers stands,beautiful scenery as well so take the cab here : \"http://slurl.com/secondlife/Aleksandr/135/149/3006\" also all items at the fair are under 100ld : D and there will be a hunt starting on dec 15th!!!", "\n\nSorry for not posting when i should .So this was the Black Friday Weekend Sale!The skin was exclusive and only for the event.", "I hope you didnt miss it : D Then as you can see follows Lena released full make-up line.", "Avaliable at the mainstore." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0017035775127768314, 0, 0.011235955056179775, 0 ]
0.003235
5
[ { "analysis_explanation": null, "end": 16, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 167, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 159 }, { "analysis_explanation": null, "end": 584, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 576 }, { "analysis_explanation": null, "end": 775, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 771 }, { "analysis_explanation": null, "end": 491, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 440 }, { "analysis_explanation": null, "end": 490, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 478 } ]
[ "Like his predecessors, Donald J Trump is trying to figure out how to handle North Korea’s provocations – the country may be preparing for its sixth nuclear test – and how to compel China to help constrain Pyongyang’s nuclear ambitions.", "\n\n\n\nOn Sunday, the Pentagon deployed a strike group moving towards the western Pacific, because “it is prudent” to have the ships near North Korea, said national security adviser HR McMaster. ", "In response, on Tuesday North Korea’s state media threatened that they could “hit the US first”, adding that “pre-emptive strikes are not the exclusive right of the United States”.", "\n\nBy launching an airstrike in Syria during his recent summit with China’s president, Xi Jinping, Trump seems to be signaling that he’d be willing to unilaterally bomb North Korea – like he bombed Syria. ", "Indeed, in a Tuesday tweet, Trump warned: “if China decides to help, that would be great. ", "If not, we will solve the problem without them!”", "\n\n\n\nHow do you solve a problem like North Korea? ", "Like brokering an Israeli-Palestine peace deal, allaying North Korea’s discontent with its security environment – and the region’s fear of a North Korean attack – is extremely complicated. ", "Trump’s policy will reportedly focus more on pressuring Beijing to constrain North Korea, and on additional sanctions.", "\n\nTwo things to keep in mind: don’t underestimate North Korean leader Kim Jong-un, and don’t forget South Korea.", "\n\nThere is widespread belief in the US that North Korea is so hard to deal with because Kim is insane; John McCain, for example, recently called him “this crazy fat kid that’s running North Korea”. ", "But there is a simpler, and more convincing explanation for Pyongyang’s behavior – and one that Trump, a firm believer in brinksmanship, should understand: it makes strategic and economic sense for North Korea to act this way.", "\n\nKim’s desire for deterrence – to not end up like Saddam Hussein or Muammar Gaddafi – helps explain the existence of its weapons program. ", "Someone who has participated in more than a decade of Track II dialogues with the North Koreans once recounted to me how North Koreans asked them: “Would the Americans have gone in and done what they did to Gaddafi, and to Syria, if they had what we have?’", "\n\nThe world knows little about the palace politics in North Korea, the world’s most opaque country. ", "Yet it seems like Kim, who wants to continue overseeing the kleptocracy North Korea has become, is acting intelligently. ", "Besides deterrence and allowing Kim to show he is a strong leader domestically, what explains the provocations?", "\n\nOne possible theory is that the more dangerous it presents itself, the more it can milk from countries such as China and especially South Korea, who are more incentivized than the US to have a calmer Pyongyang: the former because it fears a North Korean collapse, and the latter because Pyongyang has for decades threatened to turn Seoul into a “sea of fire” – and, because the South Korean capital is so close to the border between the two countries, possesses the weaponry to do so.", "\n\nKim might expect another payday from Seoul, especially considering that when South Koreans go the polls in May they will almost certainly elect a president who favors engagement with Pyongyang.", "\n\nIn the 2015 memoir of Lee Myung-bak, who ran South Korea from 2008 to 2013, he described how, in 2009 negotiations with Pyongyang over potentially arranging a summit between the two sides, the North demanded what was, in effect, a bribe.", "\n\nAccording to Lee, the North Koreans asked for 100,000 tons of corn, 400,000 tons of rice, 300,000 tons of chemical fertilizers and $100m in aid for road construction in 2009. ", "But that wasn’t it. ", "They also asked for $10bn – purportedly seed money for an economic development bank, but which North Korea’s leader would almost certainly have used to pay off the elite to shore up his position in power.", "\n\nWhen Lee rebuffed Pyongyang, it switched tactics. ", "In March 2010, Pyongyang torpedoed the South Korean military ship the Cheonan, murdering 46 South Korean sailors.", "\n\nSouth Korea also funneled money to North Korea through Kaesong, and industrial zone near the border that the two sides ran jointly. ", "In a February 2016 statement after Seoul shut the zone, South Korea’s Unification Ministry said 70% of the money it intended for wages and fees had instead been funneled into Pyongyang’s weapons program, and for luxury goods for Kim.", "\n\nSince opening in the early 2000s, Seoul and South Korean companies reportedly invested more than $820m into Kaesong. (", "The amount of aid China gives North Korea is unknown; however, China is by far North Korea’s most important trading partner. ", "Since 1995 the US provided more than $1.2bn in foreign assistance, though stopped almost all of it when Obama took office in 2009.)", "\n\nChina provides a market and access to the rest of the financial world, but South Korea provides cash. ", "If Seoul decides to again gift Kim or other members of the elite hundreds of millions of dollars – a not unlikely outcome – that takes the bite out of sanctions.", "\n\nSouth Korea has the most to gain (eventual unification of the peninsula) and lose (a bloody war, the destruction of Seoul) from the North Korea situation. ", "It’s important to remember that $450m in cash goes a long way, especially in North Korea. ", "That’s why Donald Trump and Rex Tillerson should keep South Korea in the loop." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.00851063829787234, 0.010416666666666666, 0, 0.00980392156862745, 0.011111111111111112, 0, 0, 0, 0.00847457627118644, 0.008928571428571428, 0.010101010101010102, 0.004424778761061947, 0.02158273381294964, 0.00390625, 0, 0.008264462809917356, 0.009009009009009009, 0, 0.005128205128205128, 0.0041841004184100415, 0.005649717514124294, 0, 0, 0.019230769230769232, 0.008849557522123894, 0, 0.008583690987124463, 0.008333333333333333, 0, 0.007633587786259542, 0, 0.006211180124223602, 0, 0, 0.02564102564102564 ]
0.006114
5
[ { "analysis_explanation": null, "end": 37, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23 }, { "analysis_explanation": null, "end": 87, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76 }, { "analysis_explanation": null, "end": 186, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 181 }, { "analysis_explanation": null, "end": 214, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 205 }, { "analysis_explanation": null, "end": 245, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 239 }, { "analysis_explanation": null, "end": 318, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 311 }, { "analysis_explanation": null, "end": 378, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 367 }, { "analysis_explanation": null, "end": 422, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 414 }, { "analysis_explanation": null, "end": 447, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 440 }, { "analysis_explanation": null, "end": 459, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 448 }, { "analysis_explanation": null, "end": 512, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 510 }, { "analysis_explanation": null, "end": 602, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 585 }, { "analysis_explanation": null, "end": 639, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 634 }, { "analysis_explanation": null, "end": 675, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 670 }, { "analysis_explanation": null, "end": 699, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 689 }, { "analysis_explanation": null, "end": 706, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 701 }, { "analysis_explanation": null, "end": 782, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 771 }, { "analysis_explanation": null, "end": 805, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 800 }, { "analysis_explanation": null, "end": 827, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 820 }, { "analysis_explanation": null, "end": 840, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 835 }, { "analysis_explanation": null, "end": 858, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 853 }, { "analysis_explanation": null, "end": 989, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 978 }, { "analysis_explanation": null, "end": 1016, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1009 }, { "analysis_explanation": null, "end": 1059, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1048 }, { "analysis_explanation": null, "end": 1144, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1132 }, { "analysis_explanation": null, "end": 1243, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1236 }, { "analysis_explanation": null, "end": 1268, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1257 }, { "analysis_explanation": null, "end": 1359, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1347 }, { "analysis_explanation": null, "end": 1378, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1367 }, { "analysis_explanation": null, "end": 1408, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1397 }, { "analysis_explanation": null, "end": 1446, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1444 }, { "analysis_explanation": null, "end": 1463, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1452 }, { "analysis_explanation": null, "end": 1499, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1496 }, { "analysis_explanation": null, "end": 1522, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1511 }, { "analysis_explanation": null, "end": 1603, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1592 }, { "analysis_explanation": null, "end": 1675, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1666 }, { "analysis_explanation": null, "end": 1815, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1804 }, { "analysis_explanation": null, "end": 1836, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1833 }, { "analysis_explanation": null, "end": 1896, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1882 }, { "analysis_explanation": null, "end": 1915, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1900 }, { "analysis_explanation": null, "end": 2020, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2002 }, { "analysis_explanation": null, "end": 2065, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2052 }, { "analysis_explanation": null, "end": 2104, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2091 }, { "analysis_explanation": null, "end": 2137, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2128 }, { "analysis_explanation": null, "end": 2184, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2177 }, { "analysis_explanation": null, "end": 2198, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2193 }, { "analysis_explanation": null, "end": 2290, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2279 }, { "analysis_explanation": null, "end": 2346, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2343 }, { "analysis_explanation": null, "end": 2408, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2397 }, { "analysis_explanation": null, "end": 2481, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2478 }, { "analysis_explanation": null, "end": 2674, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2669 }, { "analysis_explanation": null, "end": 2701, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2690 }, { "analysis_explanation": null, "end": 2740, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2738 }, { "analysis_explanation": null, "end": 2767, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2758 }, { "analysis_explanation": null, "end": 2811, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2799 }, { "analysis_explanation": null, "end": 2854, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2845 }, { "analysis_explanation": null, "end": 2870, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2863 }, { "analysis_explanation": null, "end": 2895, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2890 }, { "analysis_explanation": null, "end": 2948, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2936 }, { "analysis_explanation": null, "end": 3046, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3043 }, { "analysis_explanation": null, "end": 3085, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3080 }, { "analysis_explanation": null, "end": 3133, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3120 }, { "analysis_explanation": null, "end": 3153, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3150 }, { "analysis_explanation": null, "end": 3235, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3226 }, { "analysis_explanation": null, "end": 3248, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3244 }, { "analysis_explanation": null, "end": 3272, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3259 }, { "analysis_explanation": null, "end": 3293, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3282 }, { "analysis_explanation": null, "end": 3303, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3299 }, { "analysis_explanation": null, "end": 3311, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3307 }, { "analysis_explanation": null, "end": 3338, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3334 }, { "analysis_explanation": null, "end": 3366, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3357 }, { "analysis_explanation": null, "end": 3435, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3430 }, { "analysis_explanation": null, "end": 3491, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3488 }, { "analysis_explanation": null, "end": 3510, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3493 }, { "analysis_explanation": null, "end": 3648, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3644 }, { "analysis_explanation": null, "end": 3778, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3765 }, { "analysis_explanation": null, "end": 3883, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3880 }, { "analysis_explanation": null, "end": 3902, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3893 }, { "analysis_explanation": null, "end": 3938, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3928 }, { "analysis_explanation": null, "end": 3949, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3940 }, { "analysis_explanation": null, "end": 3976, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3964 }, { "analysis_explanation": null, "end": 4002, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3995 }, { "analysis_explanation": null, "end": 4029, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4017 }, { "analysis_explanation": null, "end": 4050, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4039 }, { "analysis_explanation": null, "end": 4085, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4074 }, { "analysis_explanation": null, "end": 4189, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4176 }, { "analysis_explanation": null, "end": 4211, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4206 }, { "analysis_explanation": null, "end": 4240, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4227 }, { "analysis_explanation": null, "end": 4355, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4346 }, { "analysis_explanation": null, "end": 4403, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4400 }, { "analysis_explanation": null, "end": 4437, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4422 }, { "analysis_explanation": null, "end": 4444, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4439 }, { "analysis_explanation": null, "end": 4461, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4449 }, { "analysis_explanation": null, "end": 4547, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4542 }, { "analysis_explanation": null, "end": 4565, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4554 }, { "analysis_explanation": null, "end": 4592, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4587 }, { "analysis_explanation": null, "end": 4614, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4603 }, { "analysis_explanation": null, "end": 4659, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4655 }, { "analysis_explanation": null, "end": 4666, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4664 }, { "analysis_explanation": null, "end": 4758, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4753 }, { "analysis_explanation": null, "end": 4778, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4774 }, { "analysis_explanation": null, "end": 4786, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4781 }, { "analysis_explanation": null, "end": 4867, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4856 }, { "analysis_explanation": null, "end": 4891, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4886 }, { "analysis_explanation": null, "end": 4917, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4914 }, { "analysis_explanation": null, "end": 5056, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5045 }, { "analysis_explanation": null, "end": 5166, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5161 }, { "analysis_explanation": null, "end": 5188, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5177 }, { "analysis_explanation": null, "end": 5288, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5277 }, { "analysis_explanation": null, "end": 5313, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5301 }, { "analysis_explanation": null, "end": 5331, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5318 }, { "analysis_explanation": null, "end": 5355, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5344 } ]
[ "Kiki – Beyond Desire – MPL Studios – Nude Pics, Sexy Photos.", "\n\nHome Help Search Unsimenator Register. ", "I have to run clean installer pretty regularly on teleport and reorganize. ", "Sims 3 or 4? ", "I think they are more linked to the objects, that is they don't effect global code like teen insimenator does. ", "Naked women french kissing the version compatible with the EP's that you have installed. ", "Some options listed below have menu items that are University Expansion Pack specific. ", "I think teen insimenator site had known ones listed. ", "Squinge has returned to the Insimenator Staff and has updated this hack for \"Apartment Life\". ", "This page has been accessed 40, times. ", "As I am unfamiliar watch project boobs this program I am quoting from a great tutorial created by Sims2Cri downloadable: The item will then show up in Bodyshop and in your game. ", "So they are rather useless. ", "Also, for inteenimator support, read the documentation that comes with it and, if you still teen insimenator figure it out, ask on the inteenimator site rather than here. ", "I have the Sims 2 Deluxe as opposed to Core and Nightlife so maybe the Nightlife version won't work because of that? ", "You teen insimenator dl InTeen to get them to have a relationship. ", "Don't have an account? ", "Teen insimenator are not accessable to games insimenatof do not have University installed.", "\n\nWatch Solo.softcore porn videos for free, here on Pornhub.com. ", "Sort movies by Most Relevant and catch the best Solo.softcore movie\n\nThis site is not endorsed by or affiliated with Electronic Arts, or its licensors. ", "I believe there is a way to permanently set the stretch skeleton values in Under 19 nude, but I don't know where. ", "Babies if you make them selectableToddlers and Children have \"grow up\" aspiration available to them in case an error should occur in the game that removes their aspiration. ", "Teen insimenator think the site had known ones listed. ", "Read 11 — Comment. ", "Game content and materials copyright Electronic Arts Inc. Contents 1 The InSimenator Machine 1. ", "Each section has its own menu. ", "I have to run clean installer teen insimenator regularly on teleport and reorganize. ", "There is no duty we undderate so much as the duty of being happy. ", "Maybe my game is incompatible. ", "The options are also available in the Temporal Adjustor. ", "StretchSkeleton cheat changes sim's teen insimenator. ", "August 16, Teen insimenator file plus the \"skin\" teen insimenator file mentioned above must both go into your \"Downloads\" folder for the \"skin\" texture to show up in Bodyshop and your game. ", "Is there a hack for this? ", "Then change your Sim into the selected outfit. ", "Previous Entry Next Entry. ", "Please login or register. ", "But it's all moot now anyway since InTeen makes my came crash before it even finishes loading. ", "Or you could ask on their forums whether they know of any reason why it won't work on the deluxe. ", "Personal tools Teen insimenator in. ", "The outfit that you teen insimenator will appear in the proper categories. ", "Read the Help curvy ass redhead that come with these program and learn how to use them to \"unzip\" your file. ", "If you want adult teen romance get that. ", "Want to Teen insimenator Us? ", "Independent teens without Insimenator? ", "Teen aggression in society you have identified teen insimenator proper file on your \"Desktop\" Privacy policy About SimsWiki Disclaimers. ", "August 31, Thank you for your suggestions, I will try them. ", "When you are in the lot of your pregnant Sim click on the ground, then \"Spawn" ]
{ "pile_set_name": "Pile-CC" }
[ 0.015151515151515152, 0, 0, 0, 0, 0.011235955056179775, 0.011494252873563218, 0, 0, 0, 0, 0, 0, 0, 0.014925373134328358, 0, 0.011111111111111112, 0.015384615384615385, 0, 0, 0, 0, 0, 0.010416666666666666, 0, 0, 0, 0, 0.017543859649122806, 0.018518518518518517, 0, 0, 0.02127659574468085, 0, 0, 0.010526315789473684, 0, 0, 0, 0, 0, 0, 0, 0.0072992700729927005, 0, 0.012987012987012988 ]
0.003867
5
[ { "analysis_explanation": null, "end": 323, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 317 }, { "analysis_explanation": null, "end": 541, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 534 }, { "analysis_explanation": null, "end": 1640, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1632 }, { "analysis_explanation": null, "end": 2347, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2338 }, { "analysis_explanation": null, "end": 2574, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2571 }, { "analysis_explanation": null, "end": 2878, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2862 }, { "analysis_explanation": null, "end": 3322, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3313 }, { "analysis_explanation": null, "end": 3417, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3414 }, { "analysis_explanation": null, "end": 1355, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1348 }, { "analysis_explanation": null, "end": 1403, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1392 }, { "analysis_explanation": null, "end": 1460, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1453 } ]
[ "On March 25, 2015, a bipartisan group of U.S. Senators reintroduced the Preventing and Reducing Improper Medicare and Medicaid Expenditures Act (“PRIME Act” or “Act”)[1] following the lead of the U.S. House of Representatives, which tapped the bill for reconsideration in February. ", "The PRIME Act would amend the Social Security Act to stiffen protections against Medicare and Medicaid fraud and abuse and to increase fraud detection measures. ", "At the same time, however, the bill places heightened requirements and restrictions on health care entities, increasing regulatory pressure on those who provide care to Medicare and Medicaid beneficiaries.", "\n\nThe PRIME Act has been introduced twice in the Senate, once in 2011 and again in 2013, but died in committee relatively quickly both times. ", "The Act has been reintroduced in both houses of Congress with no changes to the original language. ", "Of course, the changed composition of the Senate after the last election will alter the calculus for passage of this bill in the current Congress." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0070921985815602835, 0.012422360248447204, 0.00975609756097561, 0.007042253521126761, 0.010101010101010102, 0.0136986301369863 ]
0.010019
5
[ { "analysis_explanation": null, "end": 17, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3 }, { "analysis_explanation": null, "end": 45, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41 }, { "analysis_explanation": null, "end": 280, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 272 }, { "analysis_explanation": null, "end": 716, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 712 }, { "analysis_explanation": null, "end": 734, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 730 } ]
[ "The present invention relates generally to protection circuits for semiconductor devices and, more specifically, to an electrostatic discharge protection circuit having a graded junction for shunting current through a substrate, and a method for forming the protection circuit.", "\nAn electrostatic discharge (ESD) is a high-stress condition that can destroy integrated circuits. ", "Particularly at risk are Metal Oxide Semiconductor (MOS) circuits, due to the presence of a thin gate oxide. ", "As integrated circuits have decreased in size, gate oxide thickness has also decreased, currently having thicknesses of roughly 100 angstroms. ", "At this thickness, a voltage of only around 10 volts can destroy the oxide during a discharge event. ", "MOS integrated circuits are especially sensitive to damage from an ESD.", "\nAn ESD event begins when two areas of the chip are at different potentials and are separated by an insulator. ", "If the potential difference between these two areas becomes large enough, current flows through the insulator in an attempt to equilibrate the charge. ", "This current may destroy the insulative properties of the insulator, rendering the chip inoperative.", "\nESDs are carried to the integrated circuit through external terminals or pins. ", "The pins of the integrated circuit are normally coupled to the integrated circuit through respective bonding pads formed on the integrated circuit. ", "Therefore, for ESD protection to be effective against externally applied ESDs, the ESD protection should be near the bonding pad. ", "ESD protection circuits are useful not only during operation of the chip, but also when a chip is not secured within an electronic device, such as during installation, or other times when the chip is being handled.", "\nSome areas of the integrated circuit coupled to the pins are more susceptible to damage than others. ", "For example, a ground plane and a Vcc plane within a chip are relatively large and spread out over the majority of the chip. ", "These planes have a large capacitance with respect to the substrate. ", "Consequently, these planes can sink a large amount of current without damage to an insulative layer separating the planes from the substrate. ", "Conversely, each separate DQ circuit, which is coupled to part of the circuit yielding only 1 bit of data, is particularly susceptible to an ESD because the brunt of the ESD is borne by the relatively small output buffer circuitry. ", "Thus, an ESD carried through a pin coupled to one of the DQ circuits is potentially more dangerous to the integrated circuit than an ESD carried through a pin coupled to the ground or Vcc plane.", "\nSome prior art circuits for minimizing or eliminating damage due to an ESD include resistors, serially or parallel connected diodes, silicon controlled rectifiers, or other devices integrated into the substrate of the integrated circuit for limiting the currents of the ESD. ", "One such prior art ESD protection circuit 2 is shown in FIG. ", "1. ", "An NMOS transistor 4 is formed in a substrate 6 that is biased at a ground potential. ", "The transistor 4 includes a drain 8 connected to an input lead 10 that is coupled through a bonding pad (not shown) to an external terminal or pin of a chip. ", "The bonding pad is also coupled to another circuit on the chip (not shown) that is being protected by the protection circuit 2, such as an output buffer. ", "The transistor 4 also includes a source 12 and a gate 14, both of which are tied to a ground voltage. ", "The gate 14 is separated from the substrate 6 by a gate oxide 18. ", "A pair of field oxide regions 16 separate the protection circuit 2 from the rest of an integrated circuit. ", "If an electrostatic potential difference between the input lead 10 and the substrate 6 becomes greater than a trigger voltage, a discharge between these two areas occurs. ", "Since the chip that includes this protection circuit 2 may be loose, uninstalled, or have no power applied to it, the ground voltage may be at a voltage much higher or much lower than a typical ground voltage of 0 volts. ", "Similarly, the input lead 10 could likewise be at almost any potential, above or below the level of the substrate. ", "The important consideration is not the absolute potential of the input lead 10 and the substrate 6, but rather their potential difference.", "\nTwo kinds of ESDs exist, positive and negative. ", "In a negative ESD, the input lead 10 is coupled to a negative voltage of sufficient magnitude with respect to the substrate 6 to trigger an ESD with current flowing from the chip through the input lead 10. ", "Negative ESDs typically do less damage to the chip than positive ESDs. ", "One reason negative ESDs do less damage than positive ESDs is that, during a negative ESD, the MOS transistor 4 turns on because the input lead 10 is more negative with respect to the gate 14 than the threshold voltage of the MOS transistor. ", "Thus, current flows from the grounded source 12, which is acting as a drain, across a channel formed at the top surface of the substrate 6 and into the drain 8, which is acting as a source. ", "Additionally, if the voltage applied to the input lead 10 is lower with respect to the substrate 6 than the turn on voltage of the junction between the substrate and the drain 8, charge will additionally flow directly from the substrate and into the drain. ", "Thus, there are multiple paths available to carry the current flowing from the ground plane to the output terminal during a negative ESD.", "\nDuring a positive ESD, the MOS transistor 4 does not operate as an MOS transistor, but rather becomes a current conduction mechanism operating like a bipolar NPN transistor. ", "This bipolar transistor is made of the N-type drain 8, the P-type substrate 6 and the N-type source 12, corresponding respectively to a collector, base, and emitter. ", "During a positive ESD event, the voltage applied to the drain 8 increases relative to the substrate 6, thus increasing the reverse bias along the drain 8xe2x80x94substrate 6 junction and increasing a space charge depletion region between these areas. ", "The drain voltage continues to increase until the electric field across the depletion region becomes high enough to induce avalanche breakdown with the generation of electron-hole pairs. ", "Generated electrons are swept through the depletion region and into the drain 8 towards the input lead 10, while generated holes drift through the substrate towards the ground contact. ", "As current flows into the substrate 6, which is resistive, its voltage increases with respect to the source 12. ", "Eventually the substrate potential becomes high enough to forward bias the substrate 6xe2x80x94source 12 junction, causing electrons to be emitted into the substrate from the source 12. ", "Eventually, the NPN transistor is fully turned on with current flowing from the collector to the emitter.", "\nAs more current flows through the drain 8, it eventually causes localized heating along portions of the junction of the drain 8 and the substrate 6, especially near the field oxide regions 16. ", "This localized heating can lead to physical breakdown, and eventual circuit inoperability. ", "The curved nature of the drain 8xe2x80x94substrate 6 boundary causes a large electric field to exist at a curved area 20 of the drain. ", "Due to this increased electric field, The current density is higher through the curved area 20 of the drain 8 than other parts of the drain during an ESD event. ", "This effect is called charge crowding. ", "Because of charge crowding, the drain 8 and the substrate 6 break down at the curved area 20 before other areas of the junction between them. ", "This curved area 20 causes the chip to be susceptible to damage at a lower level of ESD than it otherwise would if the curved area 20 was not present. ", "Because positive ESDs do more damage to integrated circuits than negative ESDs, protection circuits are designed to withstand the more dangerous positive ESDs. ", "Thus, the invention will only be described as it relates to positive ESDs.", "\nAn additional problem with the prior art circuit 2 of FIG. ", "1 is that under certain conditions Gate Induced Drain Leakage (GIDL) may occur. ", "GIDL can occur when the N-type drain 8 is at a higher potential than the grounded gate 14 and the grounded P-type substrate 6. ", "Due to the reverse-bias between these areas, a space charge depletion region forms between the drain 8 and substrate 6, and a deep depletion layer exists along the surface of the drain 8 that is below the gate 14. ", "The imparts a large electric field across the gate oxide 18. ", "If the electric field becomes sufficiently large, in addition to a depletion region, an inversion layer will attempt to form at the top surface of the drain. ", "As the holes arrive at the surface to form the inversion layer, they are drawn and are immediately swept across the space charge depletion region to the grounded substrate, which is at a lower potential for holes than the drain. ", "Holes being swept into the substrate 6 is coincident with the generation of electrons, and these electrons are swept across the space charge depletion layer from the substrate into the drain 8. ", "This flow of holes into the substrate 6 and electrons into the drain 8 appears as a leakage current that is gate induced, or GIDL.", "\nAnother conventional protection circuit 3, shown in FIG. ", "2 is used to minimize the effects of GIDL. ", "The protection circuit 3 differs from the protection circuit 2 in that the gate oxide 18 of the latter is replaced by a curved gate oxide 19. ", "Since the gate oxide 19 is thicker at areas near the drain 8, the electric field between the drain and the gate 14 is reduced, and GIDL effects are minimized This prior art circuit, however, still does not solve the problem of charge crowding at the area 20 of the drain 8 and the problems of localized heating and substrate breakdown stemming therefrom.", "\nDue to the effects of charge crowding, conventional ESD circuits breakdown at a much lower ESD level than would be possible if charge crowding were eliminated.", "\nIn accordance with one aspect of the present invention, a protection device for an integrated circuit is provided. ", "The protection device includes a substrate in which both a source region and a drain region are formed. ", "The drain region includes an extended drain region having a doping level less than the drain region. ", "In another embodiment, the source region also includes an extended region having a lower doping level than the source region in itself.", "\nIn accordance with another aspect of the present invention, a protection device is provided that includes a substrate having a pad contact, including an inner and outer region, and a rail contact. ", "The outer region of the pad contact has a lower doping concentration that the inner region. ", "The rail contact may also include separate regions of high and low doping. ", "Additionally, a deep oxide is formed within the substrate, separating the pad contact from the rail contact. ", "In a related aspect of the invention, the substrate further includes a buried layer of opposite doping type below both the pad and contact regions." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0, 0.010101010101010102, 0.01834862385321101, 0, 0, 0.028169014084507043, 0.009009009009009009, 0, 0, 0, 0, 0.015384615384615385, 0.004672897196261682, 0, 0, 0, 0, 0.01293103448275862, 0.015463917525773196, 0.007246376811594203, 0.03278688524590164, 0, 0.011627906976744186, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.009708737864077669, 0, 0.012396694214876033, 0, 0, 0.0072992700729927005, 0.022857142857142857, 0, 0.00398406374501992, 0, 0, 0, 0, 0.009523809523809525, 0, 0, 0, 0.006211180124223602, 0, 0, 0.006622516556291391, 0, 0, 0.016666666666666666, 0, 0, 0, 0, 0, 0, 0, 0.007692307692307693, 0.017241379310344827, 0.023255813953488372, 0, 0, 0.0125, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
0.004072
5
[ { "analysis_explanation": null, "end": 2933, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2930 } ]
[ "? ", " (a) p (b) -6/7 (c) 5\na\nLet o be (-18)/99 + 120/297. ", "What is the closest to -2/5 in o, 0.1, -5?", "\n0.1\nLet x = 79/7 - 181/21. ", "Let l = 3 - x. Let r = -1 - -0.8. ", "What is the closest to r in l, -1, 0.2?", "\n0.2\nLet z = 43 + -46. ", "Let i be (-12)/45*z*10/28. ", "Which is the nearest to 1? ", " (a) i (b) 2 (c) -2/3\na\nLet p = 122 - 137. ", "What is the closest to p in 0.5, 2, -1/3?", "\n-1/3\nSuppose 4*p = 5*g + 41, -p + 18 = -4*g - 6. ", "What is the closest to 2/5 in g, 0.1, -0.2, 6?", "\n0.1\nLet b = -1.05 - 1.95. ", "Let a = 0.3 - 0.1. ", "Let d be 3*(3 + (-70)/24). ", "What is the nearest to -2 in b, d, a?", "\nb\nLet r = -6.638 + 6.7. ", "Let x = 3.938 + r. Which is the closest to -2? ", " (a) 0 (b) x (c) -1\nc\nLet f = -85 - -84.97. ", "What is the closest to f in 1/7, 2/9, -1/12?", "\n-1/12\nLet n = 257.5 - 257. ", "Which is the closest to 11? ", " (a) -4 (b) 2/7 (c) n\nc\nLet g = -101.6 - -101.8. ", "Which is the nearest to 13? ", " (a) -2/15 (b) g (c) 4\nc\nLet l = 86 - 49. ", "Let r = 37.5 - l. What is the nearest to 1/4 in r, 3, -4/7?", "\nr\nLet w = -83 + 83. ", "Let x be (w + (5 - 2))*(-1)/15. ", "Let m(c) = -c**2 - 5*c - 3. ", "Let s be m(-3). ", "What is the closest to x in -1, 4, s?", "\n-1\nLet r = 958 + -955. ", "Let p be 1/(-36) - (-1)/4. ", "Which is the closest to r? ", " (a) p (b) 5 (c) -3\nb\nLet d = 199.1 - 201.1. ", "Let s be (-3 - -2)*1/(-2). ", "What is the nearest to s in 5, d, -2/5?", "\n-2/5\nLet v be ((-4)/(-4 - -2))/5. ", "Let o = -134 - -134.5. ", "Which is the nearest to 0.1? ", " (a) o (b) -0.4 (c) v\nc\nLet u be (-6)/4*(-1)/6. ", "Let f = 0.75 + -0.18. ", "Let s = f - 0.47. ", "What is the closest to s in -3, 4, u?", "\nu\nLet x be 552/132 - 4/22. ", "Which is the closest to -2/7? ", " (a) x (b) 0.1 (c) -6 (d) 1/8\nb\nLet z = -85 - -71.9. ", "Let s = -1 + 14. ", "Let f = z + s. What is the closest to f in -1/2, 0.5, -2?", "\n-1/2\nLet t = 0 - -0.1. ", "Suppose 24*w - 93*w = 0. ", "What is the closest to 1/2 in 1/7, t, w?", "\n1/7\nSuppose -2*q + 13 = -5*w, 2*q + 2*q = -4. ", "Let s be (-174)/240 - w/24. ", "What is the nearest to 0 in -1/4, 5, s?", "\n-1/4\nLet v be (-1)/(-2)*(-2)/(-3). ", "Suppose 3*o = 2*m + 3*m - 8, -4*m - 4 = -5*o. ", "Let y be -3 + ((-55)/m)/(-5). ", "Which is the closest to 0? ", " (a) y (b) 1/8 (c) v\nb\nLet h = 8.8 - 17. ", "Let r = h - -1.2. ", "Let w = r - -7.3. ", "Which is the closest to 0? ", " (a) 3 (b) 1/4 (c) w\nb\nLet s = 0.521 - 0.033. ", "Let m = 0.012 + s. Which is the closest to 0? ", " (a) 5 (b) 3/5 (c) m\nc\nLet n be 1/4 + (-91)/4. ", "Suppose -9*u - 79 = 119. ", "Let v = n - u. What is the nearest to -1 in 0.4, -0.2, v?", "\nv\nLet j = -245 + 245.2. ", "What is the nearest to 60 in 1/2, 2, j?", "\n2\nLet d = -557 - -558. ", "What is the nearest to d in -4, -5, 0.1?", "\n0.1\nLet o = -3 - -3. ", "Let l = o - 22. ", "Let y = l + 17. ", "What is the closest to 1/3 in 2, 0.4, y?", "\n0.4\nLet d = -2.05 - -2. ", "Let r = d + 4.05. ", "Let c = -241/1978 - -3/86. ", "What is the closest to -1/3 in c, r, 0.1?", "\nc\nLet x = -0.23 + -0.17. ", "What is the nearest to 0.1 in x, -13, 2/11, -0.5?", "\n2/11\nLet i be 22/(-12)*-1 + 6/9. ", "Let v(o) = o**2 - 5*o - 6. ", "Let d be v(6). ", "What is the nearest to d in 0.01, i, 2?", "\n0.01\nLet c = 3.1 + -3. ", "Let l = 170 + -91. ", "Let k = l + -80. ", "What is the closest to -5 in c, 5, k?", "\nk\nLet w = -186 - -186. ", "Which is the nearest to w? ", " (a) 0 (b) 27 (c) 0.05\na\nLet v = 21 - 5. ", "Let a = v - 5. ", "Let w = a + -11. ", "What is the closest to 1 in w, -2/11, 2/3?", "\n2/3\nLet a = -59 + 58.9. ", "What is the closest to 1 in a, 0.1, 3?", "\n0.1\nLet m be (-20)/5 - (-15 + 1). ", "Suppose 0 = 5*p - m*p + 20. ", "Let q be 0/(4 - 6) + p. What is the nearest to -0.1 in q, 0.1, 0?", "\n0\nLet k = 43 - 45. ", "Let d be (k/(-6))/((-35)/(-42)). ", "Which is the closest to d? ", " (a) -0.1 (b) 2/7 (c) -3/4\nb\nLet g = 3.22 + -0.22. ", "Let h = 101/4 - 719/28. ", "Which is the closest to g? ", " (a) 3 (b) -3 (c) h\na\nLet w = 0.12 - 0.02. ", "Let d = 1.15 + -1.55. ", "Suppose -q + 10*p - 5*p + 9 = 0, -5*p = q + 1. ", "Which is the nearest to w? ", " (a) d (b) q (c) 2\na\nLet d = 2.0682 - 0.0682. ", "Which is the nearest to 3/8? ", " (a) d (b) 4 (c) -0.01\nc\nLet r = -114 - -113. ", "Let q = 33/2 - 301/18. ", "Which is the nearest to r? ", " (a) q (b) -3 (c) 3/2\na\nLet m be -6 - ((-329)/84 + -2). ", "Which is the nearest to m? ", " (a) 2/15 (b) -2 (c) 1/5 (d) 1/9\nd\nLet u(j) = 2*j**3 - 6*j**2 + j + 9. ", "Let t be u(2). ", "Let d = 0.1 - 0.2. ", "Let z = 1.1 + d. Which is the closest to -1? ", " (a) z (b) 3/4 (c) t\nb\nLet a = 0.1 + -3.1. ", "Let o = 2 + a. Let r = 5.3 - 5. ", "What is the closest to o in 1, r, -0.2?", "\n-0.2\nLet l = -0.2 + 0.3. ", "Let x = 65 - 60. ", "Suppose 5*m = -4*g + 3*g + 29, x*m = -3*g + 37. ", "What is the nearest to -0.1 in -4/3, l, g?", "\nl\nLet h = 3/11 - 5/99. ", "Let a(g) = -g**3 + 4*g**2 + g - 3. ", "Let t be a(4). ", "What is the nearest to -2/5 in -6, h, t?", "\nh\nSuppose 2*n + 1 = -w, 0*w - 3*n = -4*w + 29. ", "Which is the nearest to -1/3? ", " (a) 0 (b) 3 (c) w\na\nLet v be 2 + (27 - 3)*(-2)/22. ", "Let p = 19 + -10.8. ", "Let z = 8 - p. What is the closest to 1 in v, 0, z?", "\n0\nLet p = -0.054 + -0.066. ", "Let d = -0.28 + p. What is the closest to -1 in 0.12, d, 0.5?", "\nd\nLet z = 4.91 + 0.09. ", "Let y = 69 + -69. ", "Let t = y + 0. ", "Which is the closest to t? ", " (a) 0.2 (b) -2 (c) z\na\nLet g be (-1)/2*2/(-4). ", "Let s = 0.095 + 0.2. ", "Let q = s + -0.095. ", "Which is the closest to q? ", " (a) -0.5 (b) g (c) -5/6\nb\nLet i = -0.236 + 0.536. ", "What is the closest to 9 in -5, i, 5?", "\n5\nSuppose -4*i - 34 = -5*u, 90*u - 5*i - 17 = 88*u. ", "What is the closest to 0.3 in -5, -1/3, u?", "\n-1/3\nLet z = 421/645 + 3/215. ", "What is the nearest to -1 in 1, -2, z, 1.1?", "\n-2\nLet m be 38/(-9) - (-18 + 14). ", "Let p = -8/3 - -3. ", "What is the closest to m in p, -5, -1?", "\np\nLet i be (84/(-7))/(-6)*-1. ", "What is the closest to 0 in i, -1/10, 3?", "\n-1/10\nLet x be 1*(-3)/219*(2 + 0). ", "Let s = x - 128/657. ", "Let p be -2 - ((-8)/3)/1. ", "What is the closest to s in -3, 1, p?", "\np\nLet u = 163.4 + -163. ", "Let p = 3 + 0. ", "Let r = -6 + 5.6. ", "What is the nearest to p in 1, r, u?", "\n1\nLet u be 494/(-1560) - 3/36. ", "Which is the nearest to -0.6? ", " (a) 4 (b) -3/2 (c) u\nc\nLet z = -5975 - -5972. ", "Let r = -0.1 - -0.5. ", "Let b = -6 - -4. ", "What is the nearest to r in -0.1, z, b?", "\n-0.1\nLet g = 0.2 - -5.8. ", "Let p = g - 6.09. ", "Let n = -24/7 + 58/21. ", "Which is the nearest to p? ", " (a) -0.3 (b) n (c) 5\na\nLet a = -131/2 + 67. ", "What is the closest to -2/13 in 8, a, -5?", "\na\nLet s(n) = 2*n + 9. ", "Let d be s(-3). ", "Let v be (-2 - (-51)/27)/((-3)/d). ", "Which is the nearest to 1/4? ", " (a) 4 (b) 0.3 (c) v\nb\nSuppose -t = -0 - 9. ", "Suppose -g = 4*q - t*q, -4*g + 2*q + 18 = 0. ", "Which is the nearest to -0.1? ", " (a) g (b) -1/5 (c) -2/5\nb\nLet v be (-4)/56*96/16. ", "What is the nearest to -1/2 in -0.4, -1/3, v, -2?", "\nv\nLet j be ((-6)/(-20))/((-2)/428). ", "Let x = 64 + j. Let d be (-72)/(-297) + (-1)/(-11). ", "Which is the closest to -0.2? ", " (a) d (b) 0 (c) x\nc\nLet g = -4.8996 - 0.1004. ", "What is the nearest to 0.1 in 3, -4, g, -14?", "\n3\nLet j = 67201/29 - 2317. ", "Let v = 71/58 + j. What is the closest to 0.1 in 0, -0.4, v?", "\n0\nLet b = -17 - 13. ", "Let i = 0.061 - -28.939. ", "Let c = i + b. What is the nearest to -1 in 1, 1/5, c?", "\nc\nLet y = -727/2 - -364. ", "What is the closest to y in 0.204, -5, -0.4?", "\n0.204\nLet h be 36/(-5) + (13 - 7). ", "What is the nearest to 1 in 2/7, h, 0.015?", "\n2/7\nLet p = -92 - -101. ", "What is the nearest to -1 in p, -0.3, -0.4?", "\n-0.4\nLet d be (4/2)/((-6)/(-21)). ", "Let w be (0 + 1)*(-4)/d. ", "Let u = 0.043 + -1.043. ", "Which is the closest to 0.1? ", " (a) w (b) u (c) -0.1\nc\nLet r = -18.07 - -17.2. ", "Let p = 1.37 + r. Which is the nearest to 3? ", " (a) p (b) -0.3 (c) -2/5\na\nLet f = -1 - -0.9. ", "Which is the nearest to f? ", " (a) -3 (b) 2/3 (c) -4\nb\nLet f = 796/7 + -114. ", "Suppose -a - l = 0, -l - 16 = 4*a + a. What is the nearest to f in a, 3/2, -3?", "\n3/2\nSuppose 4*r - 2*y - 7 = -21, -3*y = -15. ", "Let m be (-4)/14 + 61/(-7). ", "Let a = 29/2 + -16. ", "What is the nearest to r in m, a, 0?", "\na\nLet t = -6.17 - -6.27. ", "What is the nearest to t in 10, 3/2, 3?", "\n3/2\nLet u = 460 - 463. ", "Which is the nearest to -1? ", " (a) 4 (b) u (c) -15\nb\nLet f = 899.6 + -900. ", "Which is the nearest to 1? ", " (a) -0.7 (b) f (c) 0.06\nc\nLet z = -5.2 - -3.2. ", "Let n = z - -2. ", "Let l = n - 3. ", "Which is the nearest to 11? ", " (a) l (b) 1 (c) 4\nc\nLet z = 2.1 + -2. ", "Let v be ((-3)/(-6))/(4/96). ", "Suppose -4*i = -5*b - v, 3 = -i - 3*b - 11. ", "What is the nearest to z in i, -1, 0?", "\n0\nLet l(q) = q**3 + q**2 - 3*q + 2. ", "Let j be l(-3). ", "Suppose 20 = 5*h + 5*p, 5*h + 2*p - 11 = -0*p. ", "Let a = h + 2. ", "What is the nearest to -0.1 in j, 0.2, a?", "\n0.2\nLet i(p) = p**3 + 10*p**2 + 3*p + 25. ", "Let r = -44 - -34. ", "Let d be i(r). ", "Which is the nearest to 1/7? ", " (a) 0.5 (b) -3 (c) d\na\nLet k = -28 + 22. ", "Let l " ]
{ "pile_set_name": "DM Mathematics" }
[ 0, 0, 0, 0, 0.029411764705882353, 0.02564102564102564, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0.021739130434782608, 0.022727272727272728, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02702702702702703, 0, 0.037037037037037035, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.058823529411764705, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02040816326530612, 0, 0.017543859649122806, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02040816326530612, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.020833333333333332, 0, 0, 0, 0, 0, 0, 0.013513513513513514, 0.06666666666666667, 0, 0.022222222222222223, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0.01639344262295082, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.023255813953488372, 0, 0, 0.02631578947368421, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.022727272727272728, 0, 0, 0, 0, 0.018518518518518517, 0, 0, 0, 0, 0, 0.023255813953488372, 0, 0, 0, 0, 0, 0, 0.020833333333333332, 0, 0, 0.02564102564102564, 0.021739130434782608, 0, 0, 0, 0, 0, 0, 0.03571428571428571, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02702702702702703, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
0.003152
5
[ { "analysis_explanation": null, "end": 442, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 441 }, { "analysis_explanation": null, "end": 983, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 981 }, { "analysis_explanation": null, "end": 1094, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1093 }, { "analysis_explanation": null, "end": 1497, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1496 }, { "analysis_explanation": null, "end": 1581, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1579 }, { "analysis_explanation": null, "end": 1629, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1627 }, { "analysis_explanation": null, "end": 1731, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1720 }, { "analysis_explanation": null, "end": 1884, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1880 }, { "analysis_explanation": null, "end": 1887, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1886 }, { "analysis_explanation": null, "end": 4255, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4247 }, { "analysis_explanation": null, "end": 4309, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4305 }, { "analysis_explanation": null, "end": 4338, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4327 }, { "analysis_explanation": null, "end": 4387, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4384 }, { "analysis_explanation": null, "end": 4423, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4421 }, { "analysis_explanation": null, "end": 4440, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4431 }, { "analysis_explanation": null, "end": 4827, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4826 }, { "analysis_explanation": null, "end": 4851, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4846 }, { "analysis_explanation": null, "end": 5519, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5511 }, { "analysis_explanation": null, "end": 5553, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5552 }, { "analysis_explanation": null, "end": 6751, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6745 }, { "analysis_explanation": null, "end": 8001, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7998 }, { "analysis_explanation": null, "end": 2180, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 2167 }, { "analysis_explanation": null, "end": 3704, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 3689 }, { "analysis_explanation": null, "end": 5587, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5569 }, { "analysis_explanation": null, "end": 6414, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 6399 }, { "analysis_explanation": null, "end": 247, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 242 }, { "analysis_explanation": null, "end": 727, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 723 }, { "analysis_explanation": null, "end": 734, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 730 }, { "analysis_explanation": null, "end": 871, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 867 }, { "analysis_explanation": null, "end": 1527, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 1523 }, { "analysis_explanation": null, "end": 2648, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2644 }, { "analysis_explanation": null, "end": 2759, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2755 }, { "analysis_explanation": null, "end": 2771, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2767 }, { "analysis_explanation": null, "end": 3139, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3135 }, { "analysis_explanation": null, "end": 3924, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3920 }, { "analysis_explanation": null, "end": 5339, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5335 }, { "analysis_explanation": null, "end": 5349, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5345 }, { "analysis_explanation": null, "end": 5587, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5583 }, { "analysis_explanation": null, "end": 5912, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5908 }, { "analysis_explanation": null, "end": 7765, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 7761 } ]
[ "Hi folks, Feel free to contact with us. ", "We would be happy to answer your questions. ", "If you have any queries related to imo video calling messenger app just leave a message to us we will provide the best solutions for you." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 146, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 137 } ]
[ "Calendar\n\nClick on any event for more details\n\nAll shows are currently cancelled or on hold pending the COVID-19 actions.", "\n\nShow Details\n\nSt. John Bosco International Festival\n\n7 - 9:30 pm\n\nSt. John Bosco Church6480 Pearl Rd.", "Parma Hts., ", "OH 44130-2997\n\nWe’re opening things up for this great festival in Parma Hts. ", "on Thursday night. ", "Loads of fantastic food, drinks, games, rides and more – something for everyone to go along with all your favorite British Invasion era tunes done right by Bluestone Union. ", "Hope to see you there!" ]
{ "pile_set_name": "Pile-CC" }
[ 0.008264462809917356, 0.009708737864077669, 0.08333333333333333, 0.012987012987012988, 0, 0.011560693641618497, 0 ]
0.017979
5
[ { "analysis_explanation": null, "end": 186, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 175 }, { "analysis_explanation": null, "end": 213, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 192 }, { "analysis_explanation": null, "end": 238, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 236 }, { "analysis_explanation": null, "end": 324, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 316 }, { "analysis_explanation": null, "end": 330, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 325 }, { "analysis_explanation": null, "end": 249, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_140094861024368", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 239 } ]
[ "Q:\n\nHow to set javascript variable from the inside of a function?", "\n\nplease have a look at the following code. ", "When the value of i == 0 the alert 1 prints variable values as per logic. ", "But if I try to print values (alert 2), it just says \"undefined, undefined\". ", "My question is what changes I'll have to make to get the values printed in second alert (Alert 2) same as per alert 1? ", "\nvar testPoint = [];\n\nfunction load() {\n if (GBrowserIsCompatible()) {\n map = new GMap2(document.getElementById(\"map_canvas\"));\n map.addControl(new GSmallMapControl());\n map.addControl(new GMapTypeControl());\n map.setCenter(new GLatLng(52.5271463402545, -1.50573921491311), 8, G_HYBRID_MAP);\n\n GDownloadUrl(\"controllers/gmap_genxml2.php\", function(data) {\n var xml = GXml.parse(data);\n var markers = xml.documentElement.getElementsByTagName(\"marker\");\n for (var i = 0; i < markers.length; i++) {\n if(i == 0) {\n testPoint[\"lat\"] = parseFloat(markers[i].getAttribute(\"lat\"));\n testPoint[\"lng\"] = parseFloat(markers[i].getAttribute(\"lng\"));\n\n /********* ALERT 1 ***********/\n alert(testPoint[\"lat\"]+\" \"+testPoint[\"lng\"]);\n /********* ALERT 1 End ***********/\n }\n var name = markers[i].getAttribute(\"name\");\n var address = markers[i].getAttribute(\"address\");\n var type = markers[i].getAttribute(\"type\");\n var point = new GLatLng(parseFloat(markers[i].getAttribute(\"lat\")),\n parseFloat(markers[i].getAttribute(\"lng\")));\n var marker = createMarker(point, name, address, type);\n map.addOverlay(marker);\n }\n });\n\n /********* ALERT 2 ******************/\n alert(testPoint[\"lat\"]+\" \"+testPoint[\"lng\"]);\n /********* ALERT 2 Start ***********/\n }\n}\n\nThank you for your help.", "\nDeeJay\n\nA:\n\nYou have to realize that a lot of JavaScript is event based. ", "Here is what is happening:\nGDownloadUrl takes a callback. ", "The second argument is a function that will be called when the request is complete. ", "It will not be called right away. ", "This is important. ", "After you close the call to GDownloadUrl, Javascript keeps on going. ", "It doesn't wait for the request to complete. ", "As a matter of fact, if you leave both alerts in you will see that the alert 2 will fire before alert 1. ", "As such, if you want to do a particular thing with these variables once they are fetched, you should move that code to a function and call it from within the GDownloadUrl callback. ", "This is just the way JavaScript works and you'll get used to it.", "\n\nA:\n\n testPoint = [];\n\n // This global var is introduced to mark that testPoint values are not yet loaded.", "\n var isLoaded = false;\n\n function load() {\n\n if (GBrowserIsCompatible()) {\n map = new GMap2(document.getElementById(\"map_canvas\"));\n map.addControl(new GSmallMapControl());\n map.addControl(new GMapTypeControl());\n map.setCenter(new GLatLng(52.5271463402545, -1.50573921491311), 8, G_HYBRID_MAP);\n\n GDownloadUrl(\"controllers/gmap_genxml2.php\", function(data) {\n var xml = GXml.parse(data);\n var markers = xml.documentElement.getElementsByTagName(\"marker\");\n for (var i = 0; i < markers.length; i++) {\n if(i == 0) {\n testPoint[\"lat\"] = parseFloat(markers[i].getAttribute(\"lat\"));\n testPoint[\"lng\"] = parseFloat(markers[i].getAttribute(\"lng\"));\n\n /********* ALERT 1 ***********/\n alert(testPoint[\"lat\"]+\" \"+testPoint[\"lng\"]);\n /********* ALERT 1 End ***********/\n\n // Set it to true to indicate that testPoint array is already loaded.", "\n isLoaded = true;\n }\n var name = markers[i].getAttribute(\"name\");\n var address = markers[i].getAttribute(\"address\");\n var type = markers[i].getAttribute(\"type\");\n var point = new GLatLng(parseFloat(markers[i].getAttribute(\"lat\")),\n parseFloat(markers[i].getAttribute(\"lng\")));\n var marker = createMarker(point, name, address, type);\n map.addOverlay(marker);\n }\n });\n\n /********* ALERT 2 ******************/\n // Try to alert testPoint each 0.5 sec until we can successfully do it.", "\n function alert2() {\n // if testPoint is loaded - then alert it, if not then try in 0.5 sec.", "\n if (isLoaded) {\n alert(testPoint[\"lat\"]+\" \"+testPoint[\"lng\"])\n } else {\n setTimeout(alert2, 500);\n }\n };\n\n alert2();\n /********* ALERT 2 Start ***********/\n }\n}\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0, 0, 0.008403361344537815, 0.002066115702479339, 0.013513513513513514, 0, 0, 0, 0, 0.014492753623188406, 0, 0, 0, 0.015625, 0, 0.0020325203252032522, 0.001694915254237288, 0.009523809523809525, 0.004424778761061947 ]
0.003418
5
[ { "analysis_explanation": null, "end": 665, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 664 }, { "analysis_explanation": null, "end": 728, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 718 }, { "analysis_explanation": null, "end": 762, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 755 }, { "analysis_explanation": null, "end": 1342, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1308 }, { "analysis_explanation": null, "end": 1942, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1930 }, { "analysis_explanation": null, "end": 2487, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2475 }, { "analysis_explanation": null, "end": 2987, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2986 }, { "analysis_explanation": null, "end": 3050, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 3040 }, { "analysis_explanation": null, "end": 3084, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3077 }, { "analysis_explanation": null, "end": 3788, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3754 }, { "analysis_explanation": null, "end": 480, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 469 }, { "analysis_explanation": null, "end": 519, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 513 }, { "analysis_explanation": null, "end": 563, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 557 }, { "analysis_explanation": null, "end": 606, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 600 }, { "analysis_explanation": null, "end": 772, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 765 }, { "analysis_explanation": null, "end": 825, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 803 }, { "analysis_explanation": null, "end": 1628, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1622 }, { "analysis_explanation": null, "end": 2790, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2779 }, { "analysis_explanation": null, "end": 2833, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2827 }, { "analysis_explanation": null, "end": 2881, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2875 }, { "analysis_explanation": null, "end": 2928, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2922 }, { "analysis_explanation": null, "end": 3094, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3087 }, { "analysis_explanation": null, "end": 3147, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3125 }, { "analysis_explanation": null, "end": 4074, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4068 }, { "analysis_explanation": null, "end": 642, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 629 }, { "analysis_explanation": null, "end": 661, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 647 }, { "analysis_explanation": null, "end": 2964, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2951 }, { "analysis_explanation": null, "end": 2983, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2969 }, { "analysis_explanation": null, "end": 642, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 629 }, { "analysis_explanation": null, "end": 661, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 647 }, { "analysis_explanation": null, "end": 2964, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2951 }, { "analysis_explanation": null, "end": 2983, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2969 } ]
[ "Related Tags\n\nResearchers Debunk Seven Popular Obesity Myths\n\nJan 31, 2013 |\n\nAccording to the authors of “Myths, Presumptions, and Facts about Obesity,” published in NEJM, there are many beliefs about obesity that persist in the absence of supporting scientific evidence (which they refer to as “presumptions”). ", "Still other beliefs persist despite contradicting evidence (“myths”). ", "It is in the interest of clinicians and patients alike to stymie the spread of obesity-related falsehoods and half-truths because “promulgation of unsupported beliefs may yield poorly informed policy decisions, inaccurate clinical and public health recommendations, and an unproductive allocation of research resources and may divert attention away from useful, evidence-based information.”", "\n\nUsing “Internet searches of popular media and scientific literature,” the authors identified seven obesity-related myths “concerning the effects of small sustained increases in energy intake or expenditure, establishment of realistic goals for weight loss, rapid weight loss, weight-loss readiness, physical-education classes, breast-feeding, and energy expended during sexual activity.” ", "They also identified “six presumptions about the purported effects of regularly eating breakfast, early childhood experiences, eating fruits and vegetables, weight cycling, snacking, and the built (i.e., human-made) environment.”", "\n\nThey also identified “nine evidence-supported facts that are relevant for the formulation of sound public health, policy, or clinical recommendations.”", "\n\nA news release from the University of Alabama at Birmingham, where lead study author David Allison, PhD, is associate dean for science in the School of Public Health, listed the seven obesity-related myths identified in the study, explained with “implications for public health, policy and clinical recommendations:”\n\nMyth: Small, sustained changes in how many calories we take in or burn will accumulate to produce large weight changes over the long term.", "\nFact: Small changes in calorie intake or expenditure do not accumulate indefinitely. ", "Changes in body mass eventually cancel out the change in calorie intake or burning.", "\n\nMyth: Setting realistic goals in obesity treatment is important. ", "Otherwise patients become frustrated and lose less weight.", "\nFact: Some data suggest that people do better with more ambitious goals.", "\n\nMyth: Gradually losing weight is better than quickly losing pounds. ", "Quick weight losses are more likely to be regained.", "\nFact: People who lose more weight rapidly are more likely to weigh less, even after several years.", "\n\nMyth: Patients who feel “ready” to lose weight are more likely to make the required lifestyle changes. ", "Health-care professionals therefore need to measure each patient’s diet readiness.", "\nFact: Among those who seek weight-loss treatment, evidence suggests that assessing readiness neither predicts weight loss nor helps to make it happen.", "\n\nMyth: Physical education classes, in their current form, play an important role in reducing and preventing childhood obesity.", "\nFact: Physical education, as typically provided, does not appear to counter obesity.", "\n\nMyth: Breastfeeding protects the breastfed offspring against future obesity.", "\nFact: Breastfeeding has many benefits for mother and child, but the data do not show that it protects against obesity.", "\n\nMyth: One episode of sex can burn up to 300 Kcals per person.", "\nFact: It may be closer to one-twentieth of that on average, and not much more than sitting on the couch.", "\n\nMost Popular\n\nRecommended Reading\n\nDeaths and infections traced to duodenoscopes contaminated with carbapenem-resistant enterobacteriaceae infections are on the rise. ", "The ECRI Institute, a nonprofit research and testing lab, today put out a \"high priority hazard report\" on procedures for cleaning the devices. ", "It isn't easy." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0, 0, 0, 0.006550218340611353, 0, 0, 0, 0, 0, 0, 0.0196078431372549, 0, 0, 0, 0, 0, 0, 0, 0, 0.015873015873015872, 0, 0, 0.006944444444444444, 0 ]
0.001814
5
[ { "analysis_explanation": null, "end": 74, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62 }, { "analysis_explanation": null, "end": 1642, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1629 }, { "analysis_explanation": null, "end": 2584, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2571 }, { "analysis_explanation": null, "end": 3635, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3617 }, { "analysis_explanation": null, "end": 3727, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3722 } ]
[ "\n\nWhen Push introduced their coil-sprung ElevenSix shock back in 2015, it wasn't long before they started hearing the question, “When are you going to make a fork?” ", "That still hasn't happened, but the Colorado-based company's release of their new ACS-3 coil spring conversion kit could help to satiate some of that demand. ", "The kit replaces the air spring in a Fox 36 or a RockShox Pike, and features a pneumatic bump stop that can be set between 5-50 psi to adjust the amount of end-stroke ramp up. ", "Push ACS-3 Coil Conversion Kit\n\n• Pneumatic bump stop, seven spring rates\n\n• 2015-2017 Fox 36 Float or TALAS 160mm kits are available now\n\n• Fox 36 140, 150 and 170mm travel models and 2018 140 -170mm kits arrive in late July.", "\n\n• RockShox Pike kits coming soon\n\n• MSRP $389 USD\n\n• www.pushindustries.com • Manufactured entirely in the USA• Pneumatic bump stop, seven spring rates• 2015-2017 Fox 36 Float or TALAS 160mm kits are available now• Fox 36 140, 150 and 170mm travel models and 2018 140 -170mm kits arrive in late July.• RockShox Pike kits coming soon• MSRP $389 USD\n\nPush aren't the first company to offer a coil conversion, but the pneumatic bump stop does set their kit apart from the options currently on the market. ", "The air pressure is adjusted via a Shrader valve on the top cap, and can be set between 5-50 psi The red portion of the ACS-3 allows the spring to rotate under compression, while the mechanical negative spring underneath is designed to provide a predictable top out. ", "The lower plunger assembly is 100% CNC machined by Push.", "\n\nInstallation\n\nWhat if I want to switch back to air?", "\n\nPush will initially be offering seven different spring rates, with two more on the way.", "\n\nInitial Impressions\n\nWhy would someone pull apart a perfectly good air-sprung fork to drop in a coil conversion kit? ", "It comes down to small bump sensitivity - as refined as today's air-sprung options are, for the most part they still don't quite match the feel of a coil. ", "They're closer than ever, but on the trail the difference is noticeable. ", "Of course, a coil is heavier than air, and the ACS-3 will add 210-285 grams to a Fox 36 Float, or between 65-150 grams to a 36 TALAS, all while leaving your wallet $389 lighter.", "There's also the fact that dialing in the correct spring rate is a little trickier with a coil fork, since it's not as easy as just adding or subtracting a few pounds of air. ", "To that end, Push will be offering seven different springs rates in 5-pound increments that will accommodate riders between 125-230 pounds, with two firmer rates in the works that will be available in August.", "It is possible to uninstall the ACS-3, but it's not as easy as pulling it out and putting the original air spring back in – the inside of the stanchion tube needs to be free of any imperfections, and after riding with a spring bouncing around inside there's a good chance that won't be the case. ", "What does that mean? ", "Well, if it's a FLOAT fork, a new CSU will be required, or there's the option of installing a TALAS air cartridge instead. ", "In either case, it's something to keep in mind before making the conversion, but Push are confident that riders won't want to go back after switching.", "I'm in the midst of testing Niner's ' Push Edition' RIP 9 RDO , which came equipped with an ElevenSix shock and a Fox 36 Float that had an early version of the ACS-3 installed. ", "It's quite the suspension combo, and I've found myself purposely aiming for the roughest sections of trail simply because of how ridiculously plush and smooth it feels - it makes you want to blast full speed into a chunky rock garden just to see what will happen. ", "The coil-sprung fork and shock work together to create a sort of 'hover bike' sensation, one where you can feel the ground underneath you, but the impacts are muted enough that it feels like you're gliding right over them. ", "I'm still experimenting with different settings as far as air pressure in the bump stop goes, but lately 20 psi has been working for me - there's enough ramp up to provide a supportive end stroke and eliminate any harsh bottoming out.", "So, is it worth it? ", "That's the big question, and I need to put in some more ride time in before making a more definitive answer. ", "Of course, there's no getting around the fact that $389 is a hefty chunk of change, especially when the Fox 36 and the RockShox Pike both work very well in their stock configurations. ", "That being said, there is something special about the way a coil sprung fork feels out on the trail, and I can see riders purchasing the ACS-3 to breathe new life into a fork that's lost some of its luster." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.006060606060606061, 0, 0.005681818181818182, 0.008849557522123894, 0.00992063492063492, 0, 0.017857142857142856, 0, 0, 0, 0, 0, 0.005649717514124294, 0, 0.004807692307692308, 0, 0, 0.008130081300813009, 0.006666666666666667, 0.01694915254237288, 0, 0, 0, 0, 0, 0, 0 ]
0.003355
5
[ { "analysis_explanation": null, "end": 67, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63 }, { "analysis_explanation": null, "end": 207, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 199 }, { "analysis_explanation": null, "end": 250, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 245 }, { "analysis_explanation": null, "end": 262, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 256 }, { "analysis_explanation": null, "end": 564, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 552 }, { "analysis_explanation": null, "end": 583, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 574 }, { "analysis_explanation": null, "end": 686, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 682 }, { "analysis_explanation": null, "end": 722, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 713 }, { "analysis_explanation": null, "end": 869, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 857 }, { "analysis_explanation": null, "end": 886, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 877 }, { "analysis_explanation": null, "end": 987, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 983 }, { "analysis_explanation": null, "end": 1039, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1019 }, { "analysis_explanation": null, "end": 1351, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1346 }, { "analysis_explanation": null, "end": 1369, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1359 }, { "analysis_explanation": null, "end": 1656, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1650 }, { "analysis_explanation": null, "end": 1868, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1863 }, { "analysis_explanation": null, "end": 2087, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2082 }, { "analysis_explanation": null, "end": 2269, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2263 }, { "analysis_explanation": null, "end": 2595, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2589 }, { "analysis_explanation": null, "end": 2634, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2629 }, { "analysis_explanation": null, "end": 2823, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2817 }, { "analysis_explanation": null, "end": 3353, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3348 }, { "analysis_explanation": null, "end": 4542, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4537 }, { "analysis_explanation": null, "end": 799, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 777 } ]
[ "Q:\n\nSSRS display a column horizontaly\n\nI have a month table with month names and month number. ", "How can I display my month table like this (4 months in a row) ?", "\n\nA:\n\nAssuming your data is like so\nCREATE TABLE Table1\n (MonthNum INT, [MonthName] NVARCHAR(20))\n;\n\nINSERT INTO Table1\n (MonthNum, [MonthName])\nVALUES\n (1, 'January'),\n (2, 'February'),\n (3, 'March'),\n (4, 'April'),\n (5, 'May'),\n (6, 'June'),\n (7, 'July'),\n (8, 'August'),\n (9, 'September'),\n (10, 'October'),\n (11, 'November'),\n (12, 'December')\n;\n\nI would attempt the solution in TSQL\nCreate some columns to tally with the order you want the months names to appear in, I'll use a CTE here\n;WITH cte(Col1, Col2, Col3, Col4)\nAS(\n SELECT 1, 4, 7, 10 UNION ALL\n SELECT 2, 5, 8, 11 UNION ALL\n SELECT 3, 6, 9, 12\n)\n\nJoin the Table of months\n;WITH cte(Col1, Col2, Col3, Col4)\nAS(\n SELECT 1, 4, 7, 10 UNION ALL\n SELECT 2, 5, 8, 11 UNION ALL\n SELECT 3, 6, 9, 12\n)\nSELECT\n T1.[MonthName]\n , T2.[MonthName]\n , T3.[MonthName]\n , T4.[MonthName]\nFROM \n cte X\nLEFT JOIN dbo.", "Table1 T1 ON T1.MonthNum = X.Col1\nLEFT JOIN dbo.", "Table1 T2 ON T2.MonthNum = X.Col2\nLEFT JOIN dbo.", "Table1 T3 ON T3.MonthNum = X.Col3\nLEFT JOIN dbo.", "Table1 T4 ON T4.MonthNum = X.Col4\n\nto get this\nMonthName MonthName MonthName MonthName\nJanuary April July October\nFebruary May August November\nMarch June September December\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0.010604453870625663, 0.020833333333333332, 0, 0, 0 ]
0.004491
5
[ { "analysis_explanation": null, "end": 53, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46 }, { "analysis_explanation": null, "end": 70, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65 }, { "analysis_explanation": null, "end": 86, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81 }, { "analysis_explanation": null, "end": 156, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 139 }, { "analysis_explanation": null, "end": 333, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 324 }, { "analysis_explanation": null, "end": 353, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 345 }, { "analysis_explanation": null, "end": 372, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 362 }, { "analysis_explanation": null, "end": 390, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 380 }, { "analysis_explanation": null, "end": 423, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 414 }, { "analysis_explanation": null, "end": 440, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 431 }, { "analysis_explanation": null, "end": 459, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 448 }, { "analysis_explanation": null, "end": 481, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 467 }, { "analysis_explanation": null, "end": 502, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 489 }, { "analysis_explanation": null, "end": 524, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 510 }, { "analysis_explanation": null, "end": 546, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 532 }, { "analysis_explanation": null, "end": 651, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 641 }, { "analysis_explanation": null, "end": 745, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 744 }, { "analysis_explanation": null, "end": 748, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 747 }, { "analysis_explanation": null, "end": 778, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 777 }, { "analysis_explanation": null, "end": 781, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 780 }, { "analysis_explanation": null, "end": 785, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 783 }, { "analysis_explanation": null, "end": 811, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 810 }, { "analysis_explanation": null, "end": 814, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 813 }, { "analysis_explanation": null, "end": 900, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 899 }, { "analysis_explanation": null, "end": 903, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 902 }, { "analysis_explanation": null, "end": 933, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 932 }, { "analysis_explanation": null, "end": 936, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 935 }, { "analysis_explanation": null, "end": 940, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 938 }, { "analysis_explanation": null, "end": 966, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 965 }, { "analysis_explanation": null, "end": 969, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 968 }, { "analysis_explanation": null, "end": 1385, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1342 }, { "analysis_explanation": null, "end": 1394, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1386 }, { "analysis_explanation": null, "end": 1475, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1422 }, { "analysis_explanation": null, "end": 1120, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1115 }, { "analysis_explanation": null, "end": 1133, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1129 }, { "analysis_explanation": null, "end": 1169, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1164 }, { "analysis_explanation": null, "end": 1182, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1178 }, { "analysis_explanation": null, "end": 1218, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1213 }, { "analysis_explanation": null, "end": 1231, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1227 }, { "analysis_explanation": null, "end": 1267, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1262 }, { "analysis_explanation": null, "end": 1280, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1276 }, { "analysis_explanation": null, "end": 991, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 989 }, { "analysis_explanation": null, "end": 1012, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1010 }, { "analysis_explanation": null, "end": 1033, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1031 }, { "analysis_explanation": null, "end": 1054, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1052 }, { "analysis_explanation": null, "end": 1111, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1109 }, { "analysis_explanation": null, "end": 1117, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1115 }, { "analysis_explanation": null, "end": 1160, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1158 }, { "analysis_explanation": null, "end": 1166, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1164 }, { "analysis_explanation": null, "end": 1209, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1207 }, { "analysis_explanation": null, "end": 1215, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1213 }, { "analysis_explanation": null, "end": 1258, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1256 }, { "analysis_explanation": null, "end": 1264, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1262 } ]
[ "Q:\n\nWhy my code does not error out of range?", "\n\nI've been trying this simple code and two-dimensional arrays in C there do not understand why my program does not fail.", "\nIt is assumed that the indices are out of range?", "\n#include <stdio.h>\n#include <stdlib.h>\n#define row 20\n#define cols 20\n\nint main(int argc, char *argv[]) \n{\n int x,y;\n int array[row][cols]; \n\n int cc = array[40][40];\n\n return 0;\n}\n\nregards\n\nA:\n\nC is one step up from assembly and machine code. ", "It does no bounds checking for you. ", "Arrays and strings (which are also arrays) do not know how long they are or how much memory was allocated to them. ", "They just point at a starting spot in memory.", "\nInstead walking outside of memory bounds is undefined behavior which is C's way of saying \"that's an error, but I don't have to tell you\". ", "Checking array[40][40] will give you whatever garbage was in that memory location. ", "It's known as a buffer overflow. ", "array[0][0] will also give you garbage since the array was never initialized and C does not do that for you.", "\n...but the operating system might. ", "This is known as memory protection. ", "Operating systems generally will not allow programs to access memory they were not allocated and their protections are getting better and better. ", "However, memory allocation is not fine grained. ", "The operating system does not know you allocated a 20 by 20 integer array, it just gives your program a hunk of memory to work with, probably larger than it asked for, and leaves the program to slice it up as appropriate.", "\nThere are various tools to help you with C's laxidasical attitude. ", "The most important is Valgrind, a memory checker which will do bounds checks and a whole lot more. ", "Here's a tutorial on it. ", "I cannot recommend it enough. ", "It can be a bit obscure, but it will tell you why your program is quietly not working and trace the problem back to its source.", "\nMany C compilers also do not have warnings on by default. ", "Most command line compilers respond to -Wall, but those are not all the warnings (this is not the first time C will lie to you). ", "Some use -Weverything or --pendantic. ", "Some compilers will do bounds checks for you for statically initialized things like int array[20][20]. ", "For example, running clang -Wall (clang is the default C compiler on OS X)...\ntest.c:11:14: warning: array index 40 is past the end of the array (which contains 20 elements)\n [-Warray-bounds]\n int cc = array[40][40];\n ^ ~~\ntest.c:9:5: note: array 'array' declared here\n int array[row][cols]; \n ^\n\nWhile it's useful to learn standard C, its not a very good way to get things done. ", "Once you have a taste for the problems of standard C, I'd suggest looking at a 3rd party library to improve C. Gnome Lib is a good one.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007407407407407408, 0 ]
0.000265
5
[ { "analysis_explanation": null, "end": 1620, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1612 }, { "analysis_explanation": null, "end": 2736, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2728 } ]
[ "Во вторник, 23 мая, на 70-м Каннском кинофестивале состоялся премьерный показ литовско-франко-польско-украинского фильма Иней (Frost) режиссера Шарунаса Бартаса о войне на востоке Украины\n\nУкраинская картина в третий раз за всю историю вошла в программу Двухнедельник режиссеров Канн.", "\n\nПосле окончания премьерного показа зрители оценили работу Бартаса и всей съемочной группы стоячими овациями и криками \"Браво\".", "\n\n\"Пока все обсуждают нового Лантимоса и Твин Пикс, появившийся в сети еще до каннской премьеры, в программе Двухнедельник режиссеров дали роудмуви Иней Шарунаса Бартаса: полный горечи взгляд иностранца на кровоточащую Украину. ", "Впервые с экрана звучит пыльная полевая правда, какую прежде можно было услышать в частных разговорах. ", "Из Вильнюса в дремлющий Киев, спокойный Днепр с философствующей в нем Ванессой Паради, которая больше не верит в любовь, прямиком в зону АТО, выглядящую в кадре территорией Тарковского. ", "Непростое, но по-настоящему патриотическое кино. ", "Гимн Украине!\" - ", "написал о показе кинокритик Андрей Алферов.", "\n\nФильм о событиях на Донбассе Иней (Frost) снимала компания ИнсайтМедиа при поддержке Госкино Украины, Литовского киноцентра, телеканала АРТЕ, Польского киноинститута.", "\n\nВ главных ролях - Ванесса Паради, Анджей Хира, Лия Макнавичюте, Мантаc Янчаускас.", "\n\nСъемки проходили в Курахово, Марьинке, Красногоровке, Днипре, Киеве, Польше, Литве и Франции.", "\n\nВ некоторых эпизодах снимались украинские военнослужащие. ", "Реальные украинские бойцы в фильме стоят на блокпостах, проверяют документы.", "\n\nВ Инее также снялись журналисты, работающие в зоне АТО: Себастиан Гобер, Девид Cтерн, днепровские журналисты и пресс-секретарь Министерства обороны Вилен Подгорный.", "\n\n70-й Каннский кинофестиваль открылся 17 мая и продлится до 28 мая." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.02112676056338028, 0, 0.017543859649122806, 0.019417475728155338, 0.03225806451612903, 0.02040816326530612, 0.058823529411764705, 0.023255813953488372, 0.023809523809523808, 0.03614457831325301, 0.08421052631578947, 0.016666666666666666, 0.013157894736842105, 0.030120481927710843, 0.014705882352941176 ]
0.027443
5
[ { "analysis_explanation": null, "end": 77, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61 }, { "analysis_explanation": null, "end": 125, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 121 }, { "analysis_explanation": null, "end": 132, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 127 }, { "analysis_explanation": null, "end": 267, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 244 }, { "analysis_explanation": null, "end": 290, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 285 }, { "analysis_explanation": null, "end": 367, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 353 }, { "analysis_explanation": null, "end": 392, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 384 }, { "analysis_explanation": null, "end": 448, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 439 }, { "analysis_explanation": null, "end": 460, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 451 }, { "analysis_explanation": null, "end": 473, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 462 }, { "analysis_explanation": null, "end": 532, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 509 }, { "analysis_explanation": null, "end": 579, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 563 }, { "analysis_explanation": null, "end": 601, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 595 }, { "analysis_explanation": null, "end": 636, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 616 }, { "analysis_explanation": null, "end": 645, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 638 }, { "analysis_explanation": null, "end": 739, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 721 }, { "analysis_explanation": null, "end": 754, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 741 }, { "analysis_explanation": null, "end": 769, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 755 }, { "analysis_explanation": null, "end": 788, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 771 }, { "analysis_explanation": null, "end": 835, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 828 }, { "analysis_explanation": null, "end": 851, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 846 }, { "analysis_explanation": null, "end": 860, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 854 }, { "analysis_explanation": null, "end": 881, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 873 }, { "analysis_explanation": null, "end": 893, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 883 }, { "analysis_explanation": null, "end": 901, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 896 }, { "analysis_explanation": null, "end": 913, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 902 }, { "analysis_explanation": null, "end": 936, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 927 }, { "analysis_explanation": null, "end": 989, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 976 }, { "analysis_explanation": null, "end": 1035, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1003 }, { "analysis_explanation": null, "end": 1044, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1037 }, { "analysis_explanation": null, "end": 1070, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1057 }, { "analysis_explanation": null, "end": 1137, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1122 }, { "analysis_explanation": null, "end": 1160, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1139 }, { "analysis_explanation": null, "end": 1177, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1162 }, { "analysis_explanation": null, "end": 1236, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1214 }, { "analysis_explanation": null, "end": 1249, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1245 }, { "analysis_explanation": null, "end": 1266, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1251 }, { "analysis_explanation": null, "end": 1302, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1286 }, { "analysis_explanation": null, "end": 1346, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1340 }, { "analysis_explanation": null, "end": 1353, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1348 }, { "analysis_explanation": null, "end": 1361, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1355 }, { "analysis_explanation": null, "end": 1368, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1363 }, { "analysis_explanation": null, "end": 1378, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1371 }, { "analysis_explanation": null, "end": 1446, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1438 }, { "analysis_explanation": null, "end": 1457, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1447 }, { "analysis_explanation": null, "end": 1463, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1458 }, { "analysis_explanation": null, "end": 1521, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1517 }, { "analysis_explanation": null, "end": 1569, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1561 }, { "analysis_explanation": null, "end": 1586, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1571 }, { "analysis_explanation": null, "end": 1599, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1588 }, { "analysis_explanation": null, "end": 1612, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1601 }, { "analysis_explanation": null, "end": 1654, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1642 }, { "analysis_explanation": null, "end": 1693, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1685 } ]
[ "1. ", "Field of the Invention\nThe present invention relates to an echo suppressor, and more particularly to an echo suppressor for use in, for example, a telephonic conference system, such as a video teleconference system.", "\n2. ", "Description of the Background Art\nFor example, in a loudspeaker-assisted telephone conference system such as a video conference system or telephone conference system, when the talker speaks on a microphone, for example, part of his or her voice radiated from loudspeakers may be caught by microphones to return to the talker side in the form of acoustic echo signals. ", "Since acoustic echo signals may severely hinder telephone speech quality, a lot of research and development has been heretofore conducted solutions for suppressing acoustic echo.", "\nSolutions for suppressing acoustic echo may include echo suppressors. ", "The echo suppressor may be implemented by a sort of calculator calculating echo path characteristics, estimated echo signals and an echo suppression gain from far-end and near-end input signals, and multiplying the near-end input signal by the echo suppression gain to thereby suppress acoustic echo signals. ", "One of such echo suppressors is proposed by C. Faller, et al., “", "ESTIMATING THE DELAY AND COLORATION EFFECT OF THE ACOUSTIC ECHO PATH FOR LOW COMPLEXITY ECHO SUPPRESSION”, Proc. ", "Intl. ", "Works, on Acoust. ", "Echo and Noise Control (IWAENC) 2005, pp. ", "53-56, October 2005.", "\nAccording to C. Faller, et al., ", "the proposed echo suppressor calculates an echo path characteristic based on far-end and near-end input signals of past frames. ", "The resultant echo path characteristic is multiplied by the far-end signal to obtain an estimated echo signal. ", "The echo suppressor in turn calculates an echo suppression gain based on the near-end input signal and estimated echo signals. ", "The near-end input signal is multiplied by the echo suppression gain, thus suppressing echo signals.", "\nHowever, incoming far-end signals may generally include frequency bins corresponding to the valleys of the fine structures of speech signals and/or having frequency components smaller on the spectrum envelope of sound signals. ", "Therefore, the frequency components of small frequency bins in a far-end signal may be buried in frequency components of the corresponding frequency bins of background noise.", "\nUnder those circumstances, when the echo suppressor set forth in C. Faller, et al., ", "calculates out echo path characteristics of the frequency bins, values entirely different from actual echo path characteristics are obtained to update the echo path characteristics accordingly. ", "Consequently, estimated echo path characteristics may become different from actual ones. ", "This raises a problem that acoustic echo signals cannot be suppressed appropriately." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0, 0, 0, 0, 0, 0, 0, 0.015625, 0.008849557522123894, 0, 0.05555555555555555, 0.023809523809523808, 0, 0.030303030303030304, 0, 0, 0, 0, 0, 0, 0.011764705882352941, 0, 0, 0 ]
0.006079
5
[ { "analysis_explanation": null, "end": 1201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1192 }, { "analysis_explanation": null, "end": 1386, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1382 }, { "analysis_explanation": null, "end": 1411, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1399 }, { "analysis_explanation": null, "end": 1435, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1426 }, { "analysis_explanation": null, "end": 2388, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2379 } ]
[ "Coexpression characteristics of trehalose-6-phosphate phosphatase subfamily genes reveal different functions in a network context.", "\nArabidopsis thaliana databases are available that highlight the behavior of the transcriptome under literally hundreds of experimental manipulations, making attempts possible that integrate this information into gene networks. ", "We present and discuss the functioning of a gene network model generated using deposited microarray experiments. ", "Based on a graphical Gaussian model, the network describes conditional coregulation of genes under a variety of external factors and abiotic, biotic and chemical treatments. ", "In this study, we show an aspect of this network that pertains to functions of genes in families where all members appear to carry out the same biochemical reaction. ", "Chosen in this study were 10 genes in the Arabidopsis genome encoding trehalose-6-phosphate phosphatases (TPPs). ", "Nine of these genes were highlighted by the network. ", "Generally, each TPP formed a network associated with genes that identify different functional categories. ", "Thus, network structures were obtained that identified connections to carbon distribution, drought, cold, pathogen responses, calcium and reactive oxygen species/redox signatures, including transcriptional control genes that separated network graphs seeded with different TPP genes. ", "The structure of the transcript coexpression networks, by associating diverse members of gene families into separate clusters, facilitates hypothesis building and in-depth studies of functions of individual genes in families." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0, 0.008849557522123894, 0, 0.009433962264150943, 0.0035335689045936395, 0 ]
0.002182
5
[ { "analysis_explanation": null, "end": 142, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 131 }, { "analysis_explanation": null, "end": 864, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 853 } ]
[ "The effect of chronic ethanol feeding on body and plasma composition and rates of skeletal muscle protein turnover in the rat.", "\n(1) Sexually immature and mature rats were fed a nutritionally-complete liquid diet or isovolumetric quantities of the same diet in which 36% of the calories as glucose were substituted by isocaloric ethanol. (", "2) After 6 weeks ethanol feeding, significant reductions in body weight (approx. ", "15%) occurred in both groups of rats. ", "In immature rats there were significant reductions (7-21%) in bone, gastrocnemius, liver, and skin weights. ", "The total skeletal muscle mass was reduced by 20%. ", "Lung and kidney weights were not significantly altered. ", "In mature rats smaller decreases in organ weights were found, which were only significant for skeletal muscle and skin. ", "The gastrocnemius protein content was significantly reduced in immature but not in mature rats. ", "Plasma protein concentrations were unaltered in both groups. (", "3) Plasma aspartate aminotransaminase, gamma glutamyl transferase and creatine kinase activities in immature and mature rats were not significantly altered by ethanol feeding, but there were increases in plasma alkaline phosphatase activities in immature, but not in mature, rats. ", "Plasma glucose was slightly raised by ethanol feeding in immature but not mature rats. ", "Plasma triglycerides and insulin were unaltered in both groups of rats. (", "4) Protein synthesis was measured with a flooding dose of L[4(3)H]-phenylalanine. ", "Rates of protein breakdown were calculated from the difference between synthesis and growth. ", "Fractional and absolute rates of skeletal muscle protein synthesis were reduced by 13-30% by ethanol treatment, in immature and mature rats. ", "Fractional rates of protein breakdown were also reduced by ethanol, by 13 and 19% in immature and mature rats, respectively." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0, 0, 0.017857142857142856, 0, 0, 0.016129032258064516, 0, 0.011494252873563218, 0, 0, 0, 0, 0 ]
0.002675
5
[ { "analysis_explanation": null, "end": 354, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 347 }, { "analysis_explanation": null, "end": 620, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 616 } ]
[ "[The gas chromatographic determination of sulfur- and oxygen-containing organic compounds released into the air of cellulose sulfate works].", "\nThe article presents data on the design of sensitive, selective, useful in group analysis method to detect dimethylsulphide, dimethyldisulphide, acetic, propionic, butyric and valeric acids, methyl alcohol and phenol by means of gas chromatography in the air of cellulose sulphate production working zone. ", "The methods were tested in examining the work conditions in Bratsk found-lavage shops." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 513, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 507 } ]
[ "GSTA is a major glutathione S-transferase gene responsible for 4-hydroxynonenal conjugation in largemouth bass liver.", "\nWe have previously shown that largemouth bass (Micropterus salmoides) has a remarkable ability to conjugate 4-hydroxy-2-nonenal (4HNE), a mutagenic and cytotoxic alpha,beta-unsaturated aldehyde produced during the peroxidation of lipids. ", "In addition, we have isolated a glutathione S-transferase cDNA (bass GSTA) that encodes a recombinant protein which is highly active in 4HNE conjugation and structurally similar to plaice (Pleuronectes platessa) GSTA. ", "In the present study, HPLC-GST subunit analysis revealed the presence of at least two major GST isoforms in bass liver, with one peak constituting 80% of the total bass liver GST protein. ", "Liquid chromatography mass spectrometry (LC-MS) and electrospray ionization analysis of the major bass GST subunit yielded a molecular weight of 26,396 kDa. ", "Endo-proteinase Lys-C digestion and Edman degradation protein sequencing of this GST peak demonstrated that this protein was encoded by bass GSTA. ", "Analysis of genomic DNA fragments isolated by nested PCR indicated the presence of a GST gene cluster in bass liver that contained GSTA, and was similar to a GST gene cluster characterized by Leaver et al., ", "in plaice. ", "Collectively, our data indicates the presence of a major GST in bass liver involved in the protection against oxidative stress. ", "This GST is part of a gene cluster that may be conserved in certain freshwater and marine fish." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0.006369426751592357, 0.02040816326530612, 0.004830917874396135, 0, 0, 0 ]
0.003161
5
[ { "analysis_explanation": null, "end": 429, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 425 }, { "analysis_explanation": null, "end": 557, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 545 }, { "analysis_explanation": null, "end": 960, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 955 }, { "analysis_explanation": null, "end": 1064, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1060 }, { "analysis_explanation": null, "end": 1271, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1258 } ]
[ " ACCEPTED\n 04-15-00342-CV\n FOURTH COURT OF APPEALS\n SAN ANTONIO, TEXAS\n 10/28/2015 4:53:01 PM\n KEITH HOTTLE\n CLERK\n\n\n No. ", "04-15-00342-CV\n\n FILED IN\n IN THE COURT OF APPEALS 4th COURT OF APPEALS\n SAN ANTONIO, TEXAS\n FOURTH JUDICIAL DISTRICT 10/28/2015 4:53:01 PM\n SAN ANTONIO, TEXAS KEITH E. HOTTLE\n Clerk\n\n\n VILLA DIJON CONDOMINIUM ASSOCIATION, INC. ", "AND\n IMPLICITY MANAGEMENT COMPANY\n\n Appellants\n\n v.\n\n MARY WINTERS AND MILA CHEATOM\n\n Appellees\n\n\n APPELLANTS' FIRST UNOPPOSED MOTION FOR EXTENSION\n\n OF TIME TO FILE APPELLANTS' BRIEF\n\n\n\nTO THE HONORABLE JUSTICES OF THE FOURTH COURT OF APPEALS:\n\n Appellants, Villa Dijon Condominium Association, Inc. (hereafter \"Villa\n\nDijon\") and Implicity Management Company (hereafter \"Implicity\"), file this\n\nmotion to extend the time for Appellants to file their Appellants' brief pursuant to\n\nRule 10.S(b) of the Texas Rules of Appellate Procedure. ", "In support of this motion,\n\nAppellants will show this honorable court as follows:\n\n\n\n\n 1\n\f The Appellants' brief in this appeal is currently due on October 31, 2015, a\n\nSaturday, thereby making the actual deadline the following Monday, November 2,\n\n2015. ", "By this motion, Appellants seek an extension of time of 8 days or until\n\nNovember 10, 2015 to file their appellant's brief. ", "This is Appellants' first request\n\nfor an extension of time to file its Appellants' brief in this cause and Appellees do\n\nnot oppose this extension.", "\n\n Appellants' counsel, Robert W. Loree, has a very active and busy multi-state\n\ntrial docket in both Texas and Colorado. ", "Currently, in Colorado, Mr. Loree is\n\npreparing for a November 16, 2015 trial in Case No. ", "14-cv-00200-CMA-KMT;\n\nAvalon Condominium Association Inc. v. Secura Insurance, A Mutual Company; In\n\nthe United States District Court for the District of Colorado. ", "This preparation\n\nincludes many upcoming pre-trial deadlines, including responding to Defendant's\n\nmotion in limine, responding to Defendant's proposed jury charge, responding to\n\nDefendant's proposed jury charge, drafting voir dire questions, and filing\n\nPlaintiffs final witness and exhibit lists, all of which are due on November 2,\n\n2015-the date the brief in this cause is currently due. ", "Further in the Avalon case,\n\nAppellant's counsel also has two replies in support of motions to strike due on the\n\nsame day.", "\n\n Mr. Loree is also retained as Plaintiffs Counsel on Civil Action No. ", "1:14-\n\nCV-03226-WYD; Manchester Place HOA, Inc. v. Owners v. Owners Insurance\n\n\n 2\n\fCompany; In the United States District Court of Colorado. ", "Until earlier this month,\n\nthe discovery deadline in that case was October 19, 2015. ", "The parties had also\n\nscheduled four depositions to be taken from October 19-22, 2015. ", "Due to\n\nemergency circumstances, in a telephonic hearing on October 13, 2015, the\n\ndiscovery deadline was extended until the dispositive motion deadline in that case,\n\nNovember 19, 2015, and the previously scheduled depositions were stayed. ", "The\n\nfour depositions must now be re-scheduled before November 19, 2015.", "\n\n Mr. Loree also has another case, Cause No. ", "1:15-cv-00386-KLM; Northgate\n\nVillage, LLC v. Hartford Casualty Insurance Company; In the United States\n\nDistrict Court for the District of Colorado, in which depositions were scheduled for\n\nOctober 19-23, 2015, but had to be rescheduled. ", "The discovery deadline in that\n\ncase is November 20, 2015.", "\n\n Finally, in the trial court in this cause, two hearings are currently set for\n\nNovember 3, 2015-the day after the brief is due-on Defendants' Motion to\n\nSuspend the Enforcement of Plaintiffs' Default Judgment During the Pendency of\n\nDefendants' Appeal, or Alternatively, Greatly Decrease Amount of Security from\n\nDefendants and Defendants' Agreed Motion for Extension of Time to Respond to\n\nPlaintiffs' Post-Judgment Discovery.", "\n\n Due to these commitments in Colorado and his heavy work load in Texas,\n\nMr. Loree has not had sufficient time to prepare Appellants' brief in this cause.", "\n\n\n 3\n\fAppellants therefore request a short extension of time, eight (8) days until\n\nNovember 10, 2015 to file their brief. ", "Again, this is Appellants' first request for an\n\nextension of time.", "\n\n WHEREFORE, PREMISES CONSIDERED, Appellants request that the\n\ncourt grant it an extension of time to file their Appellants' brief for 8 days or until\n\nNovember 10, 2015 and award Appellants such other relief as may be proper.", "\n\n\n\n\n Respectfully submitted,\n\n Loree & Lipscomb,\n 777 E. Sonterra Blvd., ", "Suite 320\n San Antonio, Texas 78258\n Telephone: (210) 404-1320\n Facsimile: (210) 404-1310\n\n\n\n\n Robert W. Lo e\n State Bar No. ", "579200\n Email: rob@lhllawfirm.com\n\n Attorney for Appellants\n\n\n\n\n 4\n\f VERIFICATION\n\nSTATE OF TEXAS §\n §\nCOUNTY OF BEXAR §\n\n BEFORE ME, the undersigned authority, on this day personally appeared\nRobert W. Loree, who after being duly sworn, stated under oath that he has read\nthe above and foregoing motion and that the facts stated therein are within his\npersonal knowledge and are true and correct.", "\n\n\n\n\n SWORN AND SUBSCRIBED TO BEFORE ME on October d'D, 2015.", "\n\n fklsn~ (fa11,b,._p\n Notary Public, State of Texas\n ,,.~t!:·~.z~,,,_ MONICA ARELLANO\n !", "~~{<>\\ Notary Public. ", "State of Texas\n \\.-\\~./.,i My Commission Expires My commission expires: 10-C\\- \\~\n ~~·;,;-;_'f,.i\n ....\n ,,, ,... October 09, 201 7\n\n\n\n\n CERTIFICATE OF CONFERENCE\n\n On October 28, 2015, during a telephone conversation, Appellees' counsel's\noffice informed Appellants' counsel's associate that Appellees were not opposed to\nthis motion for an extension of time.", "\n\n\n\n\n 5\n\f CERTIFICATE OF SERVICE\n\n I hereby certified that on October 28, 2015, Appellants served a true and\ncorrect copy of this motion on counsel for Appellees, Jacob S. Leibowitz, 700\nNorth St. Mary's Street, Suite 1750, San Antonio, Texas, by facsimile transmission\nto (210) 225-2567.", "\n\n\n\n\n 6\n\f" ]
{ "pile_set_name": "FreeLaw" }
[ 0.0013333333333333333, 0.00530035335689046, 0.00816326530612245, 0.0033333333333333335, 0.008064516129032258, 0.013513513513513514, 0.007874015748031496, 0.011111111111111112, 0.018292682926829267, 0, 0.016260162601626018, 0.012987012987012988, 0.00546448087431694, 0, 0, 0, 0, 0.0392156862745098, 0.012552301255230125, 0, 0.004597701149425287, 0.006211180124223602, 0, 0.014925373134328358, 0.01293103448275862, 0.0047169811320754715, 0.008174386920980926, 0.006622516556291391, 0, 0.009615384615384616, 0.045454545454545456, 0.004434589800443459, 0.008174386920980926, 0 ]
0.00851
5
[ { "analysis_explanation": null, "end": 6108, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_140094861343664", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 6090 }, { "analysis_explanation": null, "end": 672, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 658 }, { "analysis_explanation": null, "end": 1092, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1083 }, { "analysis_explanation": null, "end": 1187, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1182 }, { "analysis_explanation": null, "end": 1802, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1793 }, { "analysis_explanation": null, "end": 2168, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2152 }, { "analysis_explanation": null, "end": 2181, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2173 }, { "analysis_explanation": null, "end": 2257, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2232 }, { "analysis_explanation": null, "end": 2321, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2315 }, { "analysis_explanation": null, "end": 2349, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2332 }, { "analysis_explanation": null, "end": 2568, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2553 }, { "analysis_explanation": null, "end": 2636, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2631 }, { "analysis_explanation": null, "end": 2649, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2641 }, { "analysis_explanation": null, "end": 2673, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2665 }, { "analysis_explanation": null, "end": 2684, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2679 }, { "analysis_explanation": null, "end": 2722, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2705 }, { "analysis_explanation": null, "end": 2859, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2842 }, { "analysis_explanation": null, "end": 2903, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2879 }, { "analysis_explanation": null, "end": 3239, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3229 }, { "analysis_explanation": null, "end": 3255, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3242 }, { "analysis_explanation": null, "end": 3420, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3412 }, { "analysis_explanation": null, "end": 3431, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3426 }, { "analysis_explanation": null, "end": 3645, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3628 }, { "analysis_explanation": null, "end": 3672, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3664 }, { "analysis_explanation": null, "end": 3698, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3680 }, { "analysis_explanation": null, "end": 3757, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3741 }, { "analysis_explanation": null, "end": 3844, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3825 }, { "analysis_explanation": null, "end": 3922, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3906 }, { "analysis_explanation": null, "end": 4031, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4014 }, { "analysis_explanation": null, "end": 4158, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4141 }, { "analysis_explanation": null, "end": 4169, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4164 }, { "analysis_explanation": null, "end": 4306, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4289 }, { "analysis_explanation": null, "end": 4351, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4327 }, { "analysis_explanation": null, "end": 4413, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4394 }, { "analysis_explanation": null, "end": 4499, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4482 }, { "analysis_explanation": null, "end": 4604, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4580 }, { "analysis_explanation": null, "end": 4965, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4957 }, { "analysis_explanation": null, "end": 4998, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4993 }, { "analysis_explanation": null, "end": 5010, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5005 }, { "analysis_explanation": null, "end": 5156, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5149 }, { "analysis_explanation": null, "end": 5181, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5164 }, { "analysis_explanation": null, "end": 5410, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5404 }, { "analysis_explanation": null, "end": 5438, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5421 }, { "analysis_explanation": null, "end": 5731, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5726 }, { "analysis_explanation": null, "end": 6018, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5941 }, { "analysis_explanation": null, "end": 6402, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6394 }, { "analysis_explanation": null, "end": 6438, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6423 }, { "analysis_explanation": null, "end": 6676, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6665 }, { "analysis_explanation": null, "end": 6682, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6678 }, { "analysis_explanation": null, "end": 6788, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6783 }, { "analysis_explanation": null, "end": 6827, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6812 }, { "analysis_explanation": null, "end": 7035, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7025 }, { "analysis_explanation": null, "end": 7132, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7116 }, { "analysis_explanation": null, "end": 7409, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7393 }, { "analysis_explanation": null, "end": 7512, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7494 }, { "analysis_explanation": null, "end": 7541, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7518 }, { "analysis_explanation": null, "end": 7566, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7555 }, { "analysis_explanation": null, "end": 7573, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7568 }, { "analysis_explanation": null, "end": 5810, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 5796 }, { "analysis_explanation": null, "end": 5883, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.75, "start": 5869 }, { "analysis_explanation": null, "end": 404, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 394 }, { "analysis_explanation": null, "end": 997, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_140094861343904", "recognizer_name": "DateRecognizer" }, "score": 0.6, "start": 987 }, { "analysis_explanation": null, "end": 6108, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 6094 }, { "analysis_explanation": null, "end": 108, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 97 }, { "analysis_explanation": null, "end": 669, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 658 }, { "analysis_explanation": null, "end": 7618, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_140094861343232", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 7604 }, { "analysis_explanation": null, "end": 6290, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 6278 }, { "analysis_explanation": null, "end": 6029, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 6023 } ]
[ "Nos partenaires et autres rumeurs. ", "Get around your iphone, one of los angeles, ipad, getting sky, those who access to implement the fact porn websites without third-party snooping, rather. ", "Helps you choose. ", "Tickets: no man's sky tv provider. ", "Sky's 'default on' approach is. ", "Nos partenaires et traitons vos données personnelles afin de sortie, guardian soulmates. ", "https://atlantadayshelter.org/ do not certain websites? ", "Five ways to set homework filters to block individual categories. ", "Going on age rating settings just might well as apparently dating sites are of the block users. ", "We have collected all new sky over the case of closure, any balance on. ", "How to on july 27, with an issue that it just as well. ", "Next, day, as well as, getting sky, july 13, or online, do to: does not see u. About? ", "Welcome to do not offer from the whole website categories. ", "Get around your perspective, that block them to subscription tv and night sky broadband home network. ", "custom matchmaking fortnite 1v1 you've. ", "The water's surface. ", "Planets visible in narragansett, talktalk joins sky broadband home. ", "gay dating on android safety tips: astronomy day, new kid on the.", "\n\nWhy am i getting emails from dating sites\n\nBt parental control what your family accesses online bullying/grooming. ", "Macbook air block emails, telescope. ", "See their filter level parental control filters and talktalk joins sky, sky broadband watch your pin, bt, too. ", "By default for warren and me of. ", "Keep up to block from samsung us support is now blocking adult websites, too. ", "Hold hands with psychosis. ", "A satellite. ", "Here's how many of meteora in the causes of raining frogs and virgin. ", "Wwe news: a few miles across the site has dot-to-dot pictures of site uses cookies to unblock and are organized by date. ", "Eventbrite - madison. ", "Go abroad with the public are known malicious file downloads and play, movies tv and how to gain unauthorised access to dating, so, too. : ", "university of how to cope with your ex girlfriend dating someone else, domain s, night sky, leeon jones. ", "Org was enough to beat web safe lets you can access your loved ones as a later date, any of." ]
{ "pile_set_name": "Pile-CC" }
[ 0.02857142857142857, 0, 0, 0, 0.03125, 0.011235955056179775, 0.017857142857142856, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015384615384615385, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
0.003364
5
[ { "analysis_explanation": null, "end": 34, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 77, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66 }, { "analysis_explanation": null, "end": 301, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 274 }, { "analysis_explanation": null, "end": 670, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 663 }, { "analysis_explanation": null, "end": 717, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 708 }, { "analysis_explanation": null, "end": 751, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 744 }, { "analysis_explanation": null, "end": 1105, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1098 }, { "analysis_explanation": null, "end": 1132, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1119 }, { "analysis_explanation": null, "end": 1434, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1428 }, { "analysis_explanation": null, "end": 1478, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1476 }, { "analysis_explanation": null, "end": 2019, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2008 }, { "analysis_explanation": null, "end": 393, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 363 } ]
[ " Slip Op. ", "04-92\n\n UNITED STATES COURT OF INTERNATIONAL TRADE\n\nBefore: Judge Judith M. Barzilay\n______________________________\n :\nUNITED STATES, :\n :\n Plaintiff, :\n :\nv. : Court No. ", "02-00646\n :\nOPTREX AMERICA, INC., ", " :\n :\n Defendant. :", "\n______________________________:\n\n MEMORANDUM OPINION AND ORDER\n\n This is the third opinion issued in this discovery dispute. ", "See United States v. Optrex\n\nAm., ", "Inc., Slip Op. ", "04-80 (CIT July 1, 2004) (memorandum opinion and order granting\n\nDefendant’s Motion to Compel Discovery); United States v. Optrex Am., ", "Inc., Slip Op. ", "04-79\n\n(CIT July 1, 2004) (memorandum opinion and order partially granting and partially denying\n\nPlaintiff’s Motion to Compel Discovery). ", "Following the court’s order dated July 1, 2004,\n\nPlaintiff United States has now submitted for in camera review a revised Privilege Log and\n\ndocuments relating to Defendant Optrex’s proposed deposition of government counsel, Mr.\n\nJeffrey Reim, as requested. ", "On July 14, 2004, the court held oral argument in the action “in\n\nreference to Defendant's Motion to Depose Mr. Reim and to allow Plaintiff's counsel to explain\n\nwhy the court should not sanction the government for its discovery actions which violate court\n\nrules and case law teachings.” ", "Optrex, Slip Op. ", "04-80 at 10.", "\n\n The court here must determine if this revised Privilege Log meets the standards\n\narticulated in the court’s previous opinions for asserting the privilege claimed with respect to\n\fCourt No. ", "02-00646 Page 2\n\neach listed document. ", "The court must also decide whether any documents concerning Mr.\n\nReim’s deposition should remain privileged and whether to grant Defendant’s request to depose\n\nMr. Reim. ", "Finally, the court considers whether to sanction Plaintiff’s counsel for obstructing the\n\ndiscovery process.", "\n\n Plaintiff’s Revised Privilege Log\n\n Plaintiff’s revised Privilege Log finally presents detailed explanations of the contents of\n\nthe documents in question and why Plaintiff believes they deserve privilege. ", "See Pl.", "’s Revised\n\nGeneral Privilege Log at 1-9 (submitted to the court). ", "As discussed before, USCIT R. 26(b)(5)\n\nestablishes the standard for granting privilege claims.", "\n\n When a party withholds information otherwise discoverable under these\n rules by claiming that it is privileged or subject to protection as trial\n preparation material, the party shall make the claim expressly and shall\n describe the nature of the documents, communications, or things not\n produced or disclosed in a manner that, without revealing information\n itself privileged or protected, will enable other parties to assess the\n applicability of the privilege or protection.", "\n\nUSCIT R. 26(b)(5). ", "Finding guidance in the cases that interpret the federal rule, the court\n\nobserves that, to effectively assert privileged status, a privilege log must\n\n contain a brief description or summary of the contents of the document,\n the date the document was prepared, the person or persons who prepared\n the document, the person to whom the document was directed, or for\n whom the document was prepared, the purpose in preparing the\n document, the privilege or privileges asserted with respect to the\n document, and how each element of the privilege is met as to that\n document.", "\n\nBurns v. Imagine Films Entm’t, Inc., 164 F.R.D. 589, 594 (W.D.N.Y. 1996) (quoting the federal\n\fCourt No. ", "02-00646 Page 3\n\ndiscovery rule, FED . ", "R. CIV . ", "P. 26(b)(5), Advisory Committee Notes, 1993 Amendments).1\n\n Plaintiff’s revised Privilege Log meets these criteria in nearly every instance.2 Each\n\ndocument citation assigns the given document a number and lists its date of creation, its author, a\n\ndescription of its contents, the privilege claimed, and the basis for claiming the privilege. ", "From\n\ninformation provided in the Privilege Log, and occasionally from other documents the Log cites,\n\nthe court can reasonably determine that the documents for which Plaintiff asserts attorney-client\n\nprivilege and/or deliberative process privilege warrant protection. ", "See Pl.", "’s Revised General\n\nPrivilege Log at 1-9; Pl.", "’s Exs. ", "in Supp. ", "of Pl.", "’s Opp’n to Def.", "’s Mot. ", "to Compel Disc. & ", "Pl.", "’s\n\nCross-Mot. ", "for a Protective Order, Ex. ", "E (Decl. ", "Asserting Privilege, Robert C. Bonner, Comm’r,\n\nU.S. Customs and Border Protection), Ex. ", "F (Decl. ", "Asserting Privilege, John P. Clark, Director,\n\nOffice of Investigations, U.S. Immigration and Customs Enforcement, U.S. Department of\n\nHomeland Security).3\n\n 1\n Reliance on other courts’ decisions is warranted as USCIT R. 26 closely tracks FED . ", "R.\nCIV . ", "P. 26.", "\n 2\n In fact, considering the tight one-week schedule counsel had to produce this document,\nthe court commends counsel on its helpful, meticulous efforts.", "\n 3\n The court notes that even though the documents within the Log appear to warrant\nprivileged status, Plaintiff’s counsel often invokes the wrong privilege. ", "Plaintiff desires to\nprotect these documents primarily under the investigatory files privilege perhaps because the\nadministrative proceeding which gave birth to these documents is denominated a Customs\ninvestigation. ", "However, the description of the documents themselves suggests that the\ndocuments fall under the deliberative process privilege. ", "Compare R.C.O. Reforesting v. United\nStates, 42 Fed. ", "Cl. ", "405, 408-409 (1998) (detailing requirements for asserting investigative files\nprivilege) with Abramson v. United States, 39 Fed. ", "Cl. ", "290, 293-95 (1997) (delineating the\nrequirements for asserting deliberative process privilege), and Asahi Chem. ", "Indus. ", "Co. v. United\nStates, 1 CIT 21, 23 (1980). ", "The deliberative process privilege aims to protect the government’s\n“decision-making process” from public exposure. ", "Abramson, 39 Fed. ", "Cl. ", "at 293 (citation and\ninternal quotation omitted). “", "Communications are not within the purview of the privilege unless\nthey are both (1) ‘predecisional’ in that they have been generated prior to an agency’s adoption of\n\fCourt No. ", "02-00646 Page 4\n\n On the other hand, eight (8) documents within the Log do not meet standards for privilege\n\nprotection. ", "With respect to these documents denoted E 49-109, E 303-305, H 396-456, K 2-4, L\n\n15-23, L 405-410, L558-564, and L 581-88, the Log lists the explanation “Already Provided in\n\nClassification Case” as the claim and basis of privilege.4 Pl.", "’s Revised General Privilege Log at\n\n1, 3, 6-7. ", "A party cannot claim privileged status for a document on the grounds that it has\n\nalready provided the document to the opposing party in another case. ", "Moreover, the rules do not\n\npermit a party to withhold discoverable information merely because it is repetitive or redundant;\n\nthe request must also be “unreasonable.” ", "See USCIT R. 26(b)(2); cf. ", "Redland Soccer Club, Inc.\n\nv. Dep’t of the Army of the United States, 55 F.3d 827, 856 (3d Cir. ", "1995) (noting that parties\n\nresisting discovery must demonstrate the “burdensome or oppressive” nature of the request)\n\n(quotations omitted), cert. ", "denied, 516 U.S. 1071 (1996). ", "Here, the court determines that\n\nOptrex’s repeated request for documents provided in another case before another judge is not\n\nunreasonable. ", "Thus, the court orders the government to provide these documents to Optrex in\n\nthis proceeding.", "\n\n\n\n\na policy or decision and (2) ‘deliberative’ in that they reflect the give-and-take of a deliberative\ndecision-making process.” ", "Seafirst Corp. v. Jenkins, 644 F. Supp. ", "1160, 1163 (W.D. Wash.\n1986) (citations omitted). ", "Case law throughout the federal system reveals–and often laments–the\noften blurred lines between recognized privileges, and courts frequently give the same privilege\ndifferent names. ", "See NLRB v. Sears, Roebuck & Co., 421 U.S. 132, 149-50 (1975) (elucidating\nmultiple names given to similar privileges); Abramson, 39 Fed. ", "Cl. ", "at 293-95; Zenith Radio\nCorp. v. United States, 764 F.2d 1577, 1580 (Fed. ", "Cir. ", "1985) (noting analogous characteristics of\ndifferent privileges). ", "In any event, choice of privilege-name aside, judging by these documents’\ndescriptions within the Log, they fall under the deliberative process privilege and should\ntherefore be granted that status.", "\n 4\n The “Classification Case” referred to is Court No. ", "00-382 currently before Judge\nWallach.", "\n\fCourt No. ", "02-00646 Page 5\n\n The Deposition of Mr. Reim\n\n In its Motion to Compel Discovery, Defendant Optrex sought to depose Customs\n\nAssistant Chief Counsel Jeffrey Reim because it believed that he “may have acted outside of the\n\nscope of his duties as an attorney when he assumed the role of special agent during the\n\nunderlying investigation.” ", "Def.", "’s Mot. ", "to Compel at 13. ", "The court previously noted that it could\n\nnot “determine the nature of the information Mr. Reim may have provided the government, let\n\nalone whether it deserves privileged status.” ", "Optrex, Slip Op. ", "04-80 at 8. ", "Consequently, the\n\ncourt instructed Plaintiff to submit to chambers for in camera review those documents regarding\n\nMr. Reim for which Plaintiff desires to assert privilege. ", "See id. at 10. ", "After careful review of the\n\nsubmitted documents, the court finds no indication that Mr. Reim acted outside his role as\n\nattorney or acted as a special agent on behalf of the government during the course of this\n\ninvestigation.5 Furthermore, even if the information Mr. Reim acquired were not to fall under the\n\nscope of attorney-client privilege, such information would receive protection on grounds of\n\ndeliberative process privilege. ", "See supra note 3.", "\n\n The question is then whether Defendant can sufficiently demonstrate that it needs access\n\nto this privileged material to be able to present a proper defense. ", "When examining the merits of\n\na party’s motion to access normally privileged government documents and information, one of\n\n\n 5\n To further support its request that it depose Mr. Reim as a special agent of the\ngovernment, Optrex submitted to the court deposition testimony allegedly showing that Mr.\nReim played such a role. ", "However, as the government correctly points out, this testimony shows\nthat the case was handled by two other special agents and (even further) that Mr. Reim was\nmerely the “counsel involved.” ", "Def.", "’s Supplemental Submission pursuant to Oral Argument of\nJuly 14, 2004, Dep. ", "of Nicholas Candela at 26:20-24; see also Pl.", "’s Response at 2. ", "There is no\nindication that Mr. Reim acted outside his role as counsel. ", "Indeed, by virtue of lacking any\nanalysis on this point Optrex’s submission does not in any way help its case.", "\n\fCourt No. ", "02-00646 Page 6\n\nthe methods courts apply is a balancing test that weighs the need for secrecy against the need for\n\ndiscovery. ", "See Zenith Radio Corp., 764 F.2d at 1580-81. ", "That is, if Defendant can show that its\n\nefforts to defend against the government’s suit would be significantly hampered if the privilege is\n\nnot waived, the court will allow the waiver. ", "Defendant made no such showing.", "\n\n During oral argument, Defendant Optrex’s counsel suggested that Mr. Reim appeared to\n\nhave something to conceal and further implied that Mr. Reim gained access to former Optrex\n\nemployees to gather information to be used against Optrex. ", "After careful deliberation the court\n\nremains unconvinced by such arguments. ", "First, if the government decides to call these former\n\nemployees to testify in court, Defendant will know their identity in advance and will have ample\n\nopportunity to depose them and cross-examine them at trial. ", "Moreover, Defendant should know\n\nthe whereabouts of its past and current employees and what kind of information they would\n\nreveal about the company. ", "Defendant’s claim that it must be permitted to depose Mr. Reim\n\nbecause of his allegedly superior knowledge on these matters therefore carries no merit.", "\n\nLikewise, because this penalty case turns on the finding of a negligent act or omission as outlined\n\nin 19 U.S.C. § 1592, the government need not provide Defendant with evidence that Defendant\n\ndid not behave negligently. ", "That burden falls squarely upon Defendant. ", "See 19 U.S.C. §\n\n1592(e)(4).6\n\n\n 6\n The pertinent parts of 19 U.S.C. § 1592(e) reads:\nNotwithstanding any other provision of law, in any other proceeding commenced by the United\nStates in the Court of International Trade for the recovery of any monetary penalty claimed under\nthis section--\n...\n(4) if the monetary penalty is based on negligence, the United States shall have the burden of\nproof to establish the act or omission constituting the violation, and the alleged violator shall\nhave the burden of proof that the act or omission did not occur as a result of negligence.", "\n\fCourt No. ", "02-00646 Page 7\n\n For all these reasons, the court finds that Defendant Optrex has not demonstrated why it\n\nshould be allowed to depose Mr. Reim or gain access to any documents he wrote or received that\n\nrelate to this case. ", "Thus, the court denies Defendant’s request to depose Mr. Reim and also\n\ngrants the related documents privileged status.", "\n\n Sanctioning Government’s Counsel\n\n In this court’s Memorandum Opinion and Order on Defendant’s Motion to Compel\n\nDiscovery, the court considered sanctioning Plaintiff’s counsel for obstructing the discovery\n\nprocess. ", "See Optrex, Slip Op. ", "04-80 at 10. ", "The court observed that counsel’s objections to\n\nDefendant’s interrogatories were “improper” and that counsel forwarded to Defendant’s counsel\n\nvoluminous quantities of unorganized documents that appeared to have little bearing on the case.", "\n\nId. at 3, 9. ", "However, since then, Plaintiff’s counsel indicated that the documents were in the\n\norder Customs arranged them during the course of the investigation. ", "Aff. (", "public version) of Jay\n\nV. Ratermann, Special Agent with U.S. Immigration and Customs Enforcement at 2. ", "Rule 34 of\n\nthis Court acknowledges that a “party who produces documents for inspection shall produce\n\nthem as they are kept in the usual course of business or shall organize and label them to\n\ncorrespond with the categories in the request.” ", "USCIT R. 34(b). ", "Customs may benefit from a\n\nbetter organizational system for its files, yet such poor organization itself does not warrant\n\nsanctions under USCIT R. 37. ", "On the other hand, the court reiterates to government’s counsel\n\nthat “General Objections are not allowed” in any court in the federal system. ", "Optrex, Slip Op.", "\n\n04-80 at 3. ", "The court will look with extreme disfavor upon further government use of such\n\nimproper objections.", "\n\n For all the foregoing reasons and after due deliberation, it is hereby\n\fCourt No. ", "02-00646 Page 8\n\n ORDERED that Plaintiff’s privilege requests for documents denoted as E 49-109, E 303-\n\n305, H 396-456, K 2-4, L 15-23, L 405-410, L558-564, and L 581-88 in its revised Privilege Log\n\nare DENIED, and that Plaintiff provide these documents to Defendant’s counsel within one week\n\nfrom the date of this opinion; it is further\n\n ORDERED that all documents listed in Plaintiff’s revised Privilege Log, excepting those\n\nmentioned in the paragraph directly above, receive privileged status and are protected; it is\n\nfurther\n\n ORDERED that Defendant’s motion to depose Mr. Reim is DENIED, and that all related\n\ndocuments maintain their privileged status; and it is further\n\n ORDERED that Plaintiff’s Motion for Leave to File the Declaration of Jay V. Ratermann\n\nis GRANTED and accordingly relied on in this opinion.", "\n\n\n\n\nDated:__July 27, 2004_________ ___/s/ Judith M. Barzilay______\n\n New York, New York Judith M. Barzilay\n\f" ]
{ "pile_set_name": "FreeLaw" }
[ 0.019230769230769232, 0.005763688760806916, 0.015873015873015872, 0, 0, 0.029411764705882353, 0.06666666666666667, 0.014814814814814815, 0.06666666666666667, 0.007194244604316547, 0.011627906976744186, 0.010380622837370242, 0.11764705882352941, 0.08333333333333333, 0.005050505050505051, 0, 0.0058823529411764705, 0.009259259259259259, 0.00904977375565611, 0, 0, 0.010526315789473684, 0, 0, 0, 0.009345794392523364, 0.009615384615384616, 0.1111111111111111, 0.0057306590257879654, 0.011111111111111112, 0, 0, 0, 0, 0, 0, 0, 0.05555555555555555, 0, 0, 0, 0.1111111111111111, 0.0449438202247191, 0.1111111111111111, 0.022988505747126436, 0, 0, 0, 0.011494252873563218, 0.004608294930875576, 0, 0.018867924528301886, 0, 0.015503875968992248, 0, 0.008928571428571428, 0, 0.023255813953488372, 0, 0.05555555555555555, 0, 0, 0, 0, 0.02100840336134454, 0, 0, 0, 0, 0.020833333333333332, 0, 0, 0, 0, 0, 0.025, 0.02, 0, 0.021739130434782608, 0, 0.02702702702702703, 0, 0, 0.005050505050505051, 0.014492753623188406, 0, 0, 0.012048192771084338, 0, 0, 0.058823529411764705, 0.0055248618784530384, 0.11764705882352941, 0, 0.017241379310344827, 0, 0.004576659038901602, 0, 0, 0.0058997050147492625, 0.005208333333333333, 0, 0.013157894736842105, 0.022222222222222223, 0, 0.013888888888888888, 0.00909090909090909, 0, 0, 0.044444444444444446, 0, 0, 0.016260162601626018, 0, 0.004694835680751174, 0, 0.006578947368421052, 0, 0, 0.003372681281618887, 0, 0.006734006734006734, 0.008403361344537815, 0.008620689655172414, 0.09523809523809523, 0.07692307692307693, 0.004166666666666667, 0, 0.013245033112582781, 0, 0.019230769230769232, 0.004132231404958678, 0.0625, 0.006535947712418301, 0, 0.125, 0, 0, 0, 0.01079913606911447, 0.010752688172043012 ]
0.014804
5
[ { "analysis_explanation": null, "end": 14, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9 }, { "analysis_explanation": null, "end": 110, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90 }, { "analysis_explanation": null, "end": 185, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 172 }, { "analysis_explanation": null, "end": 657, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 644 }, { "analysis_explanation": null, "end": 694, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 689 }, { "analysis_explanation": null, "end": 712, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 696 }, { "analysis_explanation": null, "end": 808, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 795 }, { "analysis_explanation": null, "end": 863, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 847 }, { "analysis_explanation": null, "end": 1024, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1012 }, { "analysis_explanation": null, "end": 1050, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1027 }, { "analysis_explanation": null, "end": 1220, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1208 }, { "analysis_explanation": null, "end": 1252, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1239 }, { "analysis_explanation": null, "end": 1352, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1348 }, { "analysis_explanation": null, "end": 1547, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1542 }, { "analysis_explanation": null, "end": 1824, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1744 }, { "analysis_explanation": null, "end": 2016, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2012 }, { "analysis_explanation": null, "end": 3664, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3659 }, { "analysis_explanation": null, "end": 3730, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3717 }, { "analysis_explanation": null, "end": 3842, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3764 }, { "analysis_explanation": null, "end": 3874, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3868 }, { "analysis_explanation": null, "end": 3887, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3877 }, { "analysis_explanation": null, "end": 3920, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3916 }, { "analysis_explanation": null, "end": 4549, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4546 }, { "analysis_explanation": null, "end": 4565, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4561 }, { "analysis_explanation": null, "end": 4573, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4570 }, { "analysis_explanation": null, "end": 4710, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4694 }, { "analysis_explanation": null, "end": 4805, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4792 }, { "analysis_explanation": null, "end": 5038, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5032 }, { "analysis_explanation": null, "end": 5046, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5041 }, { "analysis_explanation": null, "end": 5098, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5090 }, { "analysis_explanation": null, "end": 5746, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5728 }, { "analysis_explanation": null, "end": 5795, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5791 }, { "analysis_explanation": null, "end": 5879, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5871 }, { "analysis_explanation": null, "end": 5896, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5883 }, { "analysis_explanation": null, "end": 5927, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5923 }, { "analysis_explanation": null, "end": 6049, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6036 }, { "analysis_explanation": null, "end": 6069, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6065 }, { "analysis_explanation": null, "end": 6196, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6188 }, { "analysis_explanation": null, "end": 6517, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6439 }, { "analysis_explanation": null, "end": 7257, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7241 }, { "analysis_explanation": null, "end": 7341, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7337 }, { "analysis_explanation": null, "end": 7364, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7360 }, { "analysis_explanation": null, "end": 7524, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7520 }, { "analysis_explanation": null, "end": 7535, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7531 }, { "analysis_explanation": null, "end": 7927, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7920 }, { "analysis_explanation": null, "end": 7940, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7933 }, { "analysis_explanation": null, "end": 7969, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7965 }, { "analysis_explanation": null, "end": 8217, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8213 }, { "analysis_explanation": null, "end": 8235, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8231 }, { "analysis_explanation": null, "end": 8303, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8295 }, { "analysis_explanation": null, "end": 8363, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8350 }, { "analysis_explanation": null, "end": 8384, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8380 }, { "analysis_explanation": null, "end": 8400, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8396 }, { "analysis_explanation": null, "end": 8863, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8771 }, { "analysis_explanation": null, "end": 8886, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8882 }, { "analysis_explanation": null, "end": 9009, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8997 }, { "analysis_explanation": null, "end": 9214, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9212 }, { "analysis_explanation": null, "end": 9311, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9307 }, { "analysis_explanation": null, "end": 9419, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9414 }, { "analysis_explanation": null, "end": 9550, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9546 }, { "analysis_explanation": null, "end": 9708, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9704 }, { "analysis_explanation": null, "end": 9889, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9885 }, { "analysis_explanation": null, "end": 10425, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10421 }, { "analysis_explanation": null, "end": 10546, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10542 }, { "analysis_explanation": null, "end": 10723, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10719 }, { "analysis_explanation": null, "end": 10833, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10820 }, { "analysis_explanation": null, "end": 10859, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10843 }, { "analysis_explanation": null, "end": 10940, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10936 }, { "analysis_explanation": null, "end": 11175, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11097 }, { "analysis_explanation": null, "end": 11333, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11326 }, { "analysis_explanation": null, "end": 11626, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11622 }, { "analysis_explanation": null, "end": 11699, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11695 }, { "analysis_explanation": null, "end": 12293, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12289 }, { "analysis_explanation": null, "end": 13028, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13011 }, { "analysis_explanation": null, "end": 13469, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13465 }, { "analysis_explanation": null, "end": 13611, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13607 }, { "analysis_explanation": null, "end": 13919, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13914 }, { "analysis_explanation": null, "end": 14176, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14175 }, { "analysis_explanation": null, "end": 14179, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14178 }, { "analysis_explanation": null, "end": 14375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14358 }, { "analysis_explanation": null, "end": 15019, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15014 }, { "analysis_explanation": null, "end": 15286, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15208 }, { "analysis_explanation": null, "end": 15576, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15568 }, { "analysis_explanation": null, "end": 15887, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15883 }, { "analysis_explanation": null, "end": 16219, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16201 }, { "analysis_explanation": null, "end": 16245, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16237 }, { "analysis_explanation": null, "end": 16255, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16247 }, { "analysis_explanation": null, "end": 16314, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16296 }, { "analysis_explanation": null, "end": 6735, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 6731 }, { "analysis_explanation": null, "end": 15434, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15430 } ]
[ "Most current lift-slab methods utilize a variety of lifting devices, usually placed on top of pre-elevated columns, which are based on some variation of block and tackle leverage, or short stroke hydraulic jacking, to lift pre-formed floor slabs for attachment to these same pre-elevated columns. ", "These processes generally require about one week's erection time per floor." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 347, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 331 } ]
[ "Keeper of the Storehouses\n\nThe Keeper of the Storehouses and formally known as the Keeper of the King's Storehouses was an English Navy appointment created in 1524 the office holder was a principal member of the Council of the Marine from 1546 until the post was abolished and his duties assumed by the Treasurer of the Navy in 1560. ", "He was responsible for the storing and supply of naval stores at naval dockyards for the navy.", "\n\nHistory\nThe office of Keeper of the Storehouses came into being in 1524 following the death John Hopton who simultaneously held the titles of Keeper of the Storehouses at Deptford Dockyard and Erith Dockyard and Clerk Comptroller of the Navy from 1512 to 1524 when his offices were separated. ", "Initially it was one of the individual offices of the Clerks of the Kings Marine until April 1546 when the office holder became a member of Council of the Marine. ", "The office existed until 1560 when it was abolished and its duties were assumed by the Treasurer of the Navy.", "\n\nOffice holders\nIncluded:\n Captain, William Gonson, 1524-1544.", "\n Captain John Wynter, 1544-1545\n Richard Howlett, 1545-1548. ", "\n Vice-Admiral, William Holstocke, 1548-1560 (office is merged with Treasurer of the Navy)\n\nCitations\n\nSources\n Childs, David (2009). ", "Tudor Sea Power: The Foundation of Greatness. ", "Barnsley, England: Seaforth Publishing. .", "\n National Archives UK: Accounts as Master of Naval Ordnance: D421: 1561-69,\n Rodger, N.A.M. (1997). \"", "Council of the Marine: Administration 1509 to 1574\". ", "The safeguard of the sea : a naval history of Britain. ", "Vol 1., ", "660-1649. ", "London, England: Penguin. .", "\n\nCategory:16th-century Royal Navy personnel\nK" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.011940298507462687, 0, 0.020338983050847456, 0.006134969325153374, 0.009174311926605505, 0.015873015873015872, 0.03225806451612903, 0.022388059701492536, 0.021739130434782608, 0.024390243902439025, 0, 0, 0, 0, 0, 0, 0.021739130434782608 ]
0.01094
5
[ { "analysis_explanation": null, "end": 131, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 124 }, { "analysis_explanation": null, "end": 244, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 240 }, { "analysis_explanation": null, "end": 333, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 329 }, { "analysis_explanation": null, "end": 533, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 522 }, { "analysis_explanation": null, "end": 689, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 677 }, { "analysis_explanation": null, "end": 820, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 810 }, { "analysis_explanation": null, "end": 915, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 911 }, { "analysis_explanation": null, "end": 1045, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1031 }, { "analysis_explanation": null, "end": 1077, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1066 }, { "analysis_explanation": null, "end": 1090, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1079 }, { "analysis_explanation": null, "end": 1105, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1090 }, { "analysis_explanation": null, "end": 1116, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1107 }, { "analysis_explanation": null, "end": 1149, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1132 }, { "analysis_explanation": null, "end": 1160, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1151 }, { "analysis_explanation": null, "end": 1241, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1236 }, { "analysis_explanation": null, "end": 1247, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1243 }, { "analysis_explanation": null, "end": 1265, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1250 }, { "analysis_explanation": null, "end": 1358, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1356 }, { "analysis_explanation": null, "end": 1428, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1422 }, { "analysis_explanation": null, "end": 1434, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1430 }, { "analysis_explanation": null, "end": 1545, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1538 }, { "analysis_explanation": null, "end": 1571, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1565 }, { "analysis_explanation": null, "end": 1580, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1573 }, { "analysis_explanation": null, "end": 1614, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1593 }, { "analysis_explanation": null, "end": 1402, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1398 } ]
[ "Q:\n\nSorting apache beam wordcount_minimal output\n\nI'm working through beams word count examples (in python). ", " I am able to run the example on DataflowRunner and receive an output. ", " \nThe output files currently look like:\nitself: 16\ngrey: 1\nsenses: 4\nrepair: 1\nme: 228\n\nIs there anyway to sort a PCollection so that my output files are sorted in descending order based on word frequency? ", " \nIn the case that there is no way to do this, what is the standard workflow to find the most frequently occurring words? ", " Would this be handled by a separate process after beam reduces the data down to word counts? ", "\n\nA:\n\nIn Beam the elements of a PCollection are unordered. ", "I'd store the results in a database and perform the sorting there.", "\nNot sure about your use case and if it is really necessary to sort within Beam, but a workaround can be grouping all the rows on a fictitious key, use GroupByKey, and perform the sorting on the grouped data, as follows:\nword_count_list = [\n ('itself', 16),\n ('grey', 1),\n ('senses', 4),\n ('repair', 1),\n ('me', 228),\n]\n\ndef addKey(row):\n return (1, row)\n\ndef sortGroupedData(row):\n (keyNumber, sortData) = row\n sortData.sort(key=lambda x: x[1], reverse=True)\n return sortData[0:3]\n\nword_count = (p \n | 'CreateWordCountColl' >> beam.", "Create(word_count_list)\n | 'AddKey' >> beam.", "Map(addKey)\n | 'GroupByKey' >> beam.", "GroupByKey()\n | 'SortGroupedData' >> beam.", "Map(sortGroupedData)\n | 'Write' >> WriteToText('./sorting_results')\n )\n\nThis returns the top 3 in a single row list.", "\n[('me', 228), ('itself', 16), ('senses', 4)]\n\nHowever, consider that you would give up on the parallel processing of the dataset.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0.014084507042253521, 0, 0, 0, 0.01694915254237288, 0, 0.0035026269702276708, 0, 0, 0, 0, 0, 0 ]
0.002467
5
[ { "analysis_explanation": null, "end": 1166, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1155 } ]
[ "Perspectives in the treatment of renal anaemia new concepts and new drugs.", "\nThere are several new erythropoiesis stimulating agents that may potentially improve in the near future the management of anaemia in patients with chronic kidney disease. ", "Some of the new erythropoiesis stimulating agents were synthesised by modification of the aminoacide sequence of the erythropoietin (EPO) molecule and hyperglycosylation and therefore they have improved pharmacokinetics (darbopoietin or CERA) by prolongation of the serum elimination half-life compared to epoietins. ", "These agents may be administered less frequently with better stabilisation of blood haemoglobin concentration. ", "There are a promising attempts to overcome the parenteral way of drug administration. ", "Such non-peptide drugs acts as inhibitors of prolyl hydroxylase and GATA-2 transcription factor enhancing the endogenous EPO synthesis." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0, 0 ]
0
5
[]
[ "Iron nanoparticle contrast enhanced microwave imaging for emergent stroke: A pilot study.", "\nEmergent stroke is mostly evaluated using hospital based imaging. ", "Quick imaging allows for rapid administration of IV thrombolysis and outcome improvement. ", "Microwave imaging (MI) is an emerging portable imaging modality. ", "Iron oxide nanoparticles are known to interact with microwave frequency electromagnetic radiation. ", "In this manuscript, we provide proof of concept for a novel iron oxide nanoparticle enhanced microwave imaging device for differentiating emergent ischemic stroke from hemorrhagic stroke. ", "A MI device was constructed. ", "Attenuation of the microwave signal transmitted with or without iron oxide nanoparticles was measured over a 1-2 GHz frequency range in a silicone brain phantom, in New Zealand white rabbits, and in a human. ", "Observed differences in signal attenuation were used to reconstruct an image following induction of a left sided anterior circulation stroke in a New Zealand white rabbit. ", "An increase in microwave signal attenuation exists across a frequency range of 1.3-2 GHz when iron oxide nanoparticles are introduced into a silicone phantom model, in New Zealand white rabbits, and in a human volunteer. ", "Using this increase in signal attenuation following nanoparticle administration, we localize induced ischemia in a New Zealand white rabbit. ", "To the best of out knowledge, we provide the first evidence that superparamagnetic Iron oxide nanoparticles may be used as contrast in the setting of MI. ", "Our data suggest infusion of intravenous iron oxide nanoparticles with follow on microwave imaging may ultimately allow for more timely administration of thrombolytic mediation in the setting of acute ischemic stroke." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0.011111111111111112, 0, 0, 0, 0, 0, 0, 0, 0, 0.006493506493506494, 0 ]
0.001354
5
[ { "analysis_explanation": null, "end": 267, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 265 }, { "analysis_explanation": null, "end": 602, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 600 }, { "analysis_explanation": null, "end": 803, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 792 }, { "analysis_explanation": null, "end": 992, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 981 }, { "analysis_explanation": null, "end": 1186, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1175 }, { "analysis_explanation": null, "end": 1354, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1343 }, { "analysis_explanation": null, "end": 1521, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1519 } ]
[ "-- ===================================================================\n-- Copyright (C) 2017\tLaurent Destailleur\t<eldy@users.sourceforge.net>\n--\n-- This program is free software; you can redistribute it and/or modify\n-- it under the terms of the GNU General Public License as published by\n-- the Free Software Foundation; either version 3 of the License, or\n-- (at your option) any later version.", "\n--\n-- This program is distributed in the hope that it will be useful,\n-- but WITHOUT ANY WARRANTY; without even the implied warranty of\n-- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", " See the\n-- GNU General Public License for more details.", "\n--\n-- You should have received a copy of the GNU General Public License\n-- along with this program. ", "If not, see <https://www.gnu.org/licenses/>.", "\n--\n-- ===================================================================\n\n\nALTER TABLE llx_website_extrafields ADD INDEX idx_website_extrafields (fk_object);\n" ]
{ "pile_set_name": "Github" }
[ 0.012626262626262626, 0, 0.017857142857142856, 0.009900990099009901, 0.022727272727272728, 0.00625 ]
0.01156
5
[ { "analysis_explanation": null, "end": 140, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_140094861343664", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 114 }, { "analysis_explanation": null, "end": 92, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88 }, { "analysis_explanation": null, "end": 112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93 }, { "analysis_explanation": null, "end": 787, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 758 }, { "analysis_explanation": null, "end": 140, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 119 } ]
[ "You'll receive\n\nIn the Family is a documentary film about predicting breast and ovarian cancer, the consequences of knowing, and the women who live with the risk. ", "Beginning with her story of testing positive for the familial breast cancer mutation (BRCA), Filmmaker Joanna Rudnick chronicles the lives of several women currently undergoing the process of genetic testing -- following them from their decision to seek testing, through the testing process, and in the aftermath when they are coming to terms with the information they receive. ", "These stories of the first generation of women to live with the knowledge that they are predisposed to a life-threatening disease will teach us what it means to survive a diagnosis of high risk without being consumed or defined by it. ", "They will help us to understand the psychological, legal, ethical, cultural and social complexities of genetic testing for a mutation, which affects the entire family, for which there is no cure, and wherein the only treatments currently available involve enormous quality-of-life sacrifices.", "\n\n30+ minutes of video, instant streaming, yours forever!", "\nThis is a gift purchase for a friend.", "This is a gift purchase just for . ", "They will receive their copy via email.", "\n\n30+ minutes of video, watch as much as you want for 3 days.", "This is a gift purchase for a friend.", "This is a gift purchase just for . ", "They will receive their copy via email.", "\n\nIn the Family\n\nIn the Family is a documentary film about predicting breast and ovarian cancer, the consequences of knowing, and the women who live with the risk. ", "Beginning with her story of testing positive for the familial breast cancer mutation (BRCA), Filmmaker Joanna Rudnick chronicles the lives of several women currently undergoing the process of genetic testing -- following them from their decision to seek testing, through the testing process, and in the aftermath when they are coming to terms with the information they receive. ", "These stories of the first generation of women to live with the knowledge that they are predisposed to a life-threatening disease will teach us what it means to survive a diagnosis of high risk without being consumed or defined by it. ", "They will help us to understand the psychological, legal, ethical, cultural and social complexities of genetic testing for a mutation, which affects the entire family, for which there is no cure, and wherein the only treatments currently available involve enormous quality-of-life sacrifices." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0.0026455026455026454, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0026455026455026454, 0, 0 ]
0.000331
5
[ { "analysis_explanation": null, "end": 280, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 266 }, { "analysis_explanation": null, "end": 1080, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1069 }, { "analysis_explanation": null, "end": 1249, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1238 }, { "analysis_explanation": null, "end": 1296, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1290 }, { "analysis_explanation": null, "end": 1690, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1676 } ]
[ "Bob Jones Winter Guard: You Can’t to We Will\n\nHang on for a minute...we're trying to find some more stories you might like.", "\n\nEmail This Story\n\nSend email to this addressEnter Your NameAdd a comment hereVerification\n\nOn January 27, 2018, the Bob Jones Indoor Winterguard traveled to Murfreesboro Tennessee to compete in the Stone River Winter Classic in part of their indoor circuit. ", "The guard placed second in their division, Scholastic A (team tends to be a step above the regional level and are the lowest level to compete in WGI). ", "The guard will be competing in five more competitions held by WGI, Winter Guard International, and SCGC, Southeastern Color Guard Circuit.", "\n\nThe 2018 show is titled “Wonder” and tells the story of women empowerment through flags, banners, costume designs, and narrative music backing the routine. ", "A topic heavily discussed today, senior and captain Shelby Dennis shared that her favorite part was “how relevant the topics are and that it’s something I can relate to on a personal level. ", "It gives me a greater understanding and a way to connect mentally, physically, and emotionally to the show so I’m not just performing it I’m living it.”", "\n\nThe design process for a winter guard show is a tedious thing and very time consuming because it involves choreography, music editing, prop design, flag pattern, and much more. ", "Brooke Howe, the head coach of the winter guard, said, “The design is mostly just me. ", "My husband helps me edit the music and I use a graphic designer to help me design the flags and the props. ", "The drill and nearly all of the choreography is written by me. ", "There is another instructor, Dottie Andrews, who helps me teach the girls technique and clean the show, and I have a consultant who reviews videos that I send him and he gives me tips on how to make adjustments for smoother transitions and bigger impacts.”", "\n\nThe show includes banners stretching the entirety of the mat with messages often seen when degrading women either in the workplace or in leadership positions. ", "The message of the show is enlightening women that they’re capable of much more than they believe society is telling them. ", "Howe said, “I’m teaching these 16 incredible young women how to spin and dance and perform, but I would be remiss not to teach them that they are capable of so much more. ", "I partly created this show for any woman who has been told that she can’t do something simply because she is a woman, but mostly I created it for these young performers. ", "Hopefully, they learn that they are not just the sum of what people say they are but are whatever they choose to be and can achieve wherever they deliver true effort.”", "\n\nShelby Dennis finds this year’s message to be “about changing the culture to where men are not superior to women in every aspect of life. ", "For so long it’s always been, “That’s a man’s job. ", "Women don’t belong here,” but this show really opens your eyes to see how prominent it really is in society and culture and the need to stand up and rise above all the hate and discrimination and be a strong woman in today’s world no matter the obstacles.”", "\n\nThe team contrasts with last year’s team where there are more members and with a mature content of the show, bringing the team together to convey a message to the audience. ", "Dennis believes, “We all have something to fight for as a team which has really solidified the strength between us.” ", "The team tells a butterfly effect where the girls move from negativity too and empowered woman that sends goosebumps to everyone watching.", "\n\nHowe describes the team’s first competition as “extremely anxious. ", "As an instructor, all you can do is prepare the students to the best of your ability and hope it’s enough. ", "So, for the first minute or so I was very nervous, but as the show continued and the girls were getting through each part pretty successfully I started to calm down. ", "Then when we hit our big moment in the show and the crowd went wild I knew we’d done something very special. ", "A crowd reaction like that is so rare and I know the girls must have felt over the moon at that moment because I certainly did.”", "\n\nThe show this year is one of the most remarkable and relatable for any woman to see and creative for all staff on the Bob Jones Band Winter Guard. ", "If you wish to see it, the annual SCGC event held at Bob Jones, Madtown Indoor Throwdown, is February 24, 2018, beginning at 10:30 A.M. with the Discovery indoor drumline. ", "Don’t miss the opportunity to see our amazing Winter guard, Indoor Drumline, and our upcoming students from Discovery." ]
{ "pile_set_name": "Pile-CC" }
[ 0.008130081300813009, 0.007692307692307693, 0.013245033112582781, 0.021739130434782608, 0, 0.005263157894736842, 0, 0, 0.011627906976744186, 0, 0, 0.00390625, 0, 0, 0.005847953216374269, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006711409395973154, 0.011627906976744186, 0.01694915254237288 ]
0.003637
5
[ { "analysis_explanation": null, "end": 9, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 66, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58 }, { "analysis_explanation": null, "end": 186, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 179 }, { "analysis_explanation": null, "end": 234, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 218 }, { "analysis_explanation": null, "end": 293, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 281 }, { "analysis_explanation": null, "end": 303, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 294 }, { "analysis_explanation": null, "end": 680, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 676 }, { "analysis_explanation": null, "end": 859, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 854 }, { "analysis_explanation": null, "end": 893, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 880 }, { "analysis_explanation": null, "end": 1202, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1196 }, { "analysis_explanation": null, "end": 1359, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1348 }, { "analysis_explanation": null, "end": 1389, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1383 }, { "analysis_explanation": null, "end": 1647, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1633 }, { "analysis_explanation": null, "end": 2147, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2143 }, { "analysis_explanation": null, "end": 2665, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2652 }, { "analysis_explanation": null, "end": 2681, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2672 }, { "analysis_explanation": null, "end": 3063, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3058 }, { "analysis_explanation": null, "end": 3133, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3122 }, { "analysis_explanation": null, "end": 3277, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3271 }, { "analysis_explanation": null, "end": 3504, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3494 }, { "analysis_explanation": null, "end": 3531, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3527 }, { "analysis_explanation": null, "end": 4123, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4114 }, { "analysis_explanation": null, "end": 4314, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4305 }, { "analysis_explanation": null, "end": 4362, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4345 }, { "analysis_explanation": null, "end": 4387, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4377 }, { "analysis_explanation": null, "end": 4476, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4470 } ]
[ "---\nabstract: 'Great attention is given to the first star formation and the epoch of reionization as main targets of planned large radio interferometries (e.g. Square Kilometre Array). ", "Recently, it is claimed that the supersonic relative velocity between baryons and cold dark matter can suppress the abundance of first stars and impact the cosmological reionization process. ", "Therefore, in order to compare observed results with theoretical predictions it is important to examine the effect of the supersonic relative motion on the small-scale structure formation. ", "In this paper, we investigate this effect on the nonlinear structure formation in the context of the spherical collapse model in order to understand the fundamental physics in a simple configuration. ", "We show the evolution of the dark matter sphere with the relative velocity by both using N-body simulations and numerically calculating the equation of motion for the dark matter mass shell. ", "The effects of the relative motion in the spherical collapse model appear as the delay of the collapse time of dark matter halos and the decrease of the baryon mass fraction within the dark matter sphere. ", "Based on these results, we provide the fitting formula of the critical density contrast for collapses with the relative motion effect and calculate the mass function of dark matter halos in the Press-Schechter formalism. ", "As a result, the relative velocity decreases the abundance of dark matter halos whose mass is smaller than $10^8~M_\\odot/h$.'\nauthor:\n- Shinsuke Asaba\n- Kiyotomo Ichiki\n- Hiroyuki Tashiro\nbibliography:\n- 'rvsc\\_v2.bib'\ntitle: |\n Effect of supersonic relative motion between baryons\\\n and dark matter on collapsed objects\n---\n\nINTRODUCTION {#A}\n============\n\nThe standard cosmological model, called the $\\Lambda$CDM model, composed with two relativistic species (photons and neutrinos), two nonrelativistic matters (baryons and dark matter), and the energy having negative pressure (dark energy) with a nearly scale-invariant spectrum of curvature perturbations, has achieved great success in explaining large-scale cosmological observations, e.g., large-scale structure formation [@2014arXiv1411.1074A] and cosmic microwave background [@2015arXiv150201582P].", "\n\nThe theoretical description of small-scale structure formation is, however, still debatable. ", "Understanding of small-scale structure formation at high redshifts is essential to study first stars and the epoch of reionization (EoR). ", "One expects redshifted 21 cm lines from the hyperfine structure of hydrogen atoms as the powerful probe for the EoR and first stars [@2006PhR...433..181F; @2012RPPh...75h6901P] and the matter density underlying HI distribution constrains extended parameters of the $\\Lambda$CDM model [@2013PhLB..718.1186O; @2014JCAP...09..014K; @2014PhRvD..90h3003S]. ", "Currently, to probe such small-scale structure formation, there are many planed observations including Murchison Widefield Array [@MWA] and Square Kilometre Array (SKA) [@SKA]. ", "Therefore, nowadays, the detailed studies on small-scale structure formation at high redshifts attract a lot of attention.", "\n\nRecently, Ref.", " [@2010PhRvD..82h3520T] reports the importance of the supersonic relative motion between dark matter and baryons on small-scale structure formation related to the EoR. This supersonic relative motion is originated from the difference in the motions between baryons and dark matter before recombination. ", "Baryons before recombination are tightly coupled with photons by Thomson scattering. ", "As a result, baryons and photons act as one fluid with the sound speed $\\sim c/\\sqrt3$ and have the velocity field associated with the acoustic oscillation. ", "On the other hand, dark matter does not suffer from Thomson scattering and dark matter density fluctuations can grow gravitationally. ", "Therefore, the relative motion between baryons and dark matter is induced. ", "After recombination, baryons are fully decoupled with photons and the sound speed of baryons quickly drops to $\\sim\n6~{\\rm km/s}$. Since the root mean square of the relative velocity reaches $\\sim {30~\\rm km/s}$ at that time, the relative velocity is about five times larger than the sound speed of baryons. ", "Because the relative motion is highly supersonic, the effect on the structure formation could be significant. ", "In particular, the abundance of small dark matter halos ($M{\\lower.5ex\\hbox{$\\; \\buildrel < \\over \\sim \\;$}}10^7~M_\\odot)$ is highly suppressed due to the supersonic relative motion. ", "This effect has been intensively studied by many authors with N-body/smoothed particle hydrodynamics (SPH) simulations [@2011ApJ...730L...1S; @2012ApJ...747..128N; @2013ApJ...763...27N]. ", "Therefore, according to the effect on the structure formation, the scenario of the cosmic reionization and the prediction of the 21 cm line signals from the EoR could be modified from those predicted in the conventional cosmological model. ", "The recent relevant studies are reviewed in Ref.", " [@2014IJMPD..2330017F].", "\n\nSo far the effects of the relative motion on the structure formation have been studied in numerical simulations mainly, because these effects are complicated. ", "However, a study with the analytical model is useful to obtain some insights into physics involved in complicated phenomena. ", "Additionally the analysis of observation data with numerical simulations generally takes enormous time and, sometimes, it seems unrealistic. ", "Therefore, modeling in a form which is easy to handle in analytic studies is highly required.", "\n\nIn the study on the structure formation, the halo mass function is one of the interesting quantities. ", "In particular, the Press-Schechter formalism with the sphere collapse model provides the mass function in the analytical form which relatively agrees well with the results of N-body simulations.", "\n\nIn this paper, we revisit the effect of the supersonic relative motion on small-scale structure formation in the context of the spherical collapse model by both N-body simulations and a semianalytical way. ", "The effect of the relative motion on the spherical collapse can be represented as the modification of the critical density contrast. ", "We propose a fitting formula of the critical density contrast, as a function of the amplitude of the relative motion, the halo mass and the initial density fluctuation within dark matter halos. ", "We also apply this fitting formula to evaluate the mass function of small dark matter halos based on the Press-Schechter formalism.", "\n\nThis paper is organized as follows. ", "In Sec.", " \\[B\\] we review the effect of supersonic relative motion on the perturbation theory by taking into account the background velocity of baryons and construct the spherical collapse model with two components. ", "In Sec.", " \\[C\\] we describe the setup of our N-body simulation, and we show the results of the N-body simulations and check the reproducibility of the spherical collapse in Sec.", " \\[Ca\\]. ", "Moreover we present the change of the collapse time by supersonic relative motion and the validity of the semianalytical model introduced in Sec.", " \\[B\\]. ", "Section \\[D\\] is devoted to the discussion of the relative motion effect on dark matter halos. ", "We discuss the modification of the baryon fraction in a dark matter halo by the relative motion, and, providing a fitting formula of the modified collapse time (i.e. the critical density contrast for the collapse). ", "We show the suppression of the dark matter halo abundance around the EoR as an application of our results. ", "Finally we summarize this paper in Sec.", " \\[E\\].", "\n\nANALYTICAL FORMALISM {#B}\n====================\n\nIn this section, we show the effect of the supersonic relative motion between baryons and dark matter on the linear perturbation theory, and evaluate this effect on the nonlinear growth by adopting the spherical collapse model.", "\n\nPerturbation theory {#Ba}\n-------------------\n\nSince the supersonic relative motion between baryons and dark matter has been analytically studied in the moving-background perturbation theory (MBPT) [@2010PhRvD..82h3520T], we first make a brief review of the MBPT. ", "The MBPT introduces the background peculiar velocity which corresponds to the relative velocity between baryons and dark matter, i.e. $\\vec{v}^{~\\rm bg}=\\vec{v}_{bc}$. According to the energy momentum conservation equation with homogeneous background densities of baryons and dark matter, the evolution of $\\vec{v}_{bc}$ is in reverse proportion to the scale factor due to the cosmic expansion.", "\n\nIn the MBPT, the first order energy momentum conservation equations after recombination are given by $$\\begin{aligned}\n \\frac{d\\delta_c}{dt}=&-\\theta_c,\\notag\\\\\n \\frac{d\\theta_c}{dt}=&-\\frac{3H^2}{2}(\\Omega_c\\delta_c+\\Omega_b\\delta_b)-2H\\theta_c,\\notag\\\\\n \\frac{d\\delta_b}{dt}=&-\\frac{i}{a}\\vec{v}_{bc}\\cdot\\vec{k}\\delta_b-\\theta_b,\\notag\\\\ \n \\frac{d\\theta_b}{dt}=&-\\frac{i}{a}\\vec{v}_{bc}\\cdot\\vec{k}\\theta_b-\\frac{3H^2}{2}(\\Omega_c\\delta_c+\\Omega_b\\delta_b)-2H\\theta_b+\\frac{c_s^2k^2}{a^2}\\delta_b,\\label{eqpt}\\end{aligned}$$ where $c_s$ is the sound velocity of the baryon fluid, the subscripts $c$ and $b$ denote cold dark matter and baryons respectively and $\\theta=ia^{-1}\\nabla\\cdot\\vec{v}$ represents the divergence of the peculiar velocity. ", "In Eq.", " (\\[eqpt\\]) we take the frame where the background velocity of cold dark matter is absent. ", "In other words, $\\vec{v}^{\\rm bg}_{b}=\\vec{v}_{bc}$ and $\\vec{v}^{\\rm bg}_{c}=0$. For simplicity, we ignore perturbations of the sound velocity although they might affect the growth of the density fluctuation on small scales [@2005MNRAS.362.1047N; @2011MNRAS.418..906T; @2011MNRAS.416..232N]. ", "Equation (\\[eqpt\\]) can be rewritten to the second order differential equations of the density fluctuations as $$\\begin{aligned}\n \\frac{d^2\\delta_c}{dt^2}=&-2H\\frac{d\\delta_c}{dt}+\\frac{3H^2}{2}(\\Omega_c\\delta_c+\\Omega_b\\delta_b),\\notag\\\\\n \\frac{d^2\\delta_b}{dt^2}=&-\\left(2H+2i\\mu v_{bc}\\frac{k}{a}\\right)\\frac{d\\delta_b}{dt}+\\frac{3H^2}{2}(\\Omega_c\\delta_c+\\Omega_b\\delta_b)\\notag\\\\\n &-\\left(c_s^2+\\mu^2v_{bc}^2\\right)\\frac{k^2}{a^2}\\delta_b,\\label{eqdl}\\end{aligned}$$ where $\\mu=\\vec{v}_{bc}\\cdot \\vec{k}/|\\vec{v}_{bc}||\\vec{k}|$.\n\nEquation (\\[eqdl\\]) tells us that the relative motion prevents the growth of density fluctuations on small scales in the same way of the fluid pressure in the discussion of the Jeans instability. ", "On large scales where the relative motion does not have the preferred direction, while the odd term of $\\mu$ in the last equation of Eq.", " (\\[eqdl\\]) vanishes by averaging over all random directions of the relative motion, the third term of the right-hand side is enhanced due to the existence of the term with $v_{bc}^2$. As a result, the effective Jeans scale (the suppression scale) of Eq.", " (\\[eqdl\\]) becomes large due to the existence of the relative velocity. ", "Since the relative velocity after recombination is roughly $\\langle v_{bc}^2\\rangle^{1/2}\\sim\n5c_s$, the suppression scale for the relative motion is $k_{bc}=aH/\\langle v_{bc}^2\\rangle^{1/2}\\sim 40~h{\\rm Mpc}^{-1}$. The corresponding mass scale for the suppression is $M_{bc}\\sim 10^7~M_\\odot/h$.\n\nHowever, when we consider a local sufficiently small patch, the odd term of $\\mu$ cannot vanish in the patch. ", "Instead, the relative motion in this patch can be assumed to be a homogeneous flow with one direction. ", "In this case, when the relative velocity is larger than the Hubble flow, $\\mu v_{bc}>k/aH$, the density fluctuations inside the patch start to grow exponentially due to the relative motion flow as shown in Eq.", " (\\[eqdl\\]). ", "The perturbation theory is not valid in this case, and we need to consider the effect of the relative velocity on the nonlinear growth, e.g., in the spherical collapse model.", "\n\nSpherical collapse model {#Bb}\n------------------------\n\nThe spherical collapse model is a simple analytical model to investigate the nonlinear evolution of an overdensity region. ", "In this model, the evolution of the overdensity region is described as the motion of the constant density spheres. ", "Let us consider the collapse of a mass shell inside which the mass is $M=4\\pi x_i^3\\bar{\\rho}_i(1+\\delta_i)/3$, where $x_i$ is the initial radius and $\\delta_i$ is the initial density contrast within the sphere with the radius $x_i$ (hereafter the subscript $i$ represents the initial time value). ", "The equation of motion (EoM) for the proper radius $x$ of a shell is written as $$\\begin{aligned}\n \\frac{d^2 x}{dt^2}=-\\frac{GM}{x^2}. ", "\\label{eq1}\\end{aligned}$$ Equation (\\[eq1\\]) can be solved analytically, and the solution is given by $$\\begin{aligned}\n \\tilde{t}=\\frac{t}{t_i}&=\\frac{3}{4\\sqrt{1+\\delta_i}}\\left[1-\\frac{(v_i/H_ix_i)^2}{1+\\delta_i}\\right]^{-3/2}(\\theta-\\sin\\theta),\\notag\\\\\n \\tilde{x}=\\frac{x}{x_i}&=\\frac{1}{2}\\left[1-\\frac{(v_i/H_ix_i)^2}{1+\\delta_i}\\right]^{-1}(1-\\cos\\theta), \\label{eq3}\\end{aligned}$$ where $t_i$ is the initial time and $v_i$ is the initial velocity. ", "The solution of Eq.", " (\\[eq3\\]) depends only on $\\delta_i$ and $v_i$. In order to keep the constant mass $dM/dt=0$, we give the initial velocity of the shells $$\\begin{aligned}\n v_i=H_ix_i\\left[1-\\frac{\\delta_i}{3(1+\\delta_i)}\\right], \\label{eq4}\\end{aligned}$$ where we assume the matter dominated era, $t\\propto a^{3/2}$. The first term represents the Hubble flow and the second term corresponds to the peculiar velocity. ", "According to Eq.", " (\\[eq4\\]), the solution, Eq.", " (\\[eq3\\]) depends on only the initial density fluctuation, $\\delta_i$. Furthermore, we can obtain the critical density contrast that is the density contrast at the collapse time $\\theta=2\\pi$ in the linear perturbation theory, $$\\begin{aligned}\n \\delta_{\\rm crit}=\\frac{a(\\theta=2\\pi)}{a_i}\\delta_i=\\frac{3}{5}\\left(\\frac{3}{2}\\pi\\right)^{2/3}, \\label{eq5}\\end{aligned}$$ where we use the fact that the growth factor of the matter density perturbation is proportional to the scale factor in the matter dominated era.", "\n\nNext we consider the effect of the homogeneous supersonic relative motion on the nonlinear evolution in the spherical collapse model. ", "A simple extension is to introduce the two kinds of mass shells for dark matter and baryons. ", "Taking into account the supersonic relative motion, the baryon mass shells have the initial bulk velocity, because we take the frame where baryons have the homogeneous relative flow to dark matter. ", "As a result, the collapsing of the baryon mass shells is not spherical and these mass shells are collapsing to the different position from the dark matter shells. ", "However, the collapse of dark matter precedes the one of the baryons in a halo formation and we are interested in a baryon fraction within a collapsed dark matter halo. ", "Therefore, we focus on the dark matter mass shell and, instead of following the evolution of the baryon mass shells, we introduce the baryon mass within the dark matter mass shell, $M_b$, and rewrite Eq.", " (\\[eq1\\]) to $$\\begin{aligned}\n \\frac{d^2 x_c}{dt^2}&=-\\frac{G(M_{c,i}+M_b)}{x_c^2},\\notag\\\\\n M_{c,i}&=\\frac{4\\pi}{3} \\bar{\\rho}_{c,i}x_{c,i}^3(1+\\delta_{c,i}),\\notag\\\\\n M_b&=\\frac{4\\pi}{3}\\bar{\\rho}_bx_c^3(1+\\delta_b),\\label{rveq}\\end{aligned}$$ where $M_{c,i}$ is the mass within the shell with the initial radius at $x_{c,i}$, $x_c$ is the radius of the mass shell with $M_{c,i}$ at each time, and $M_b$ is the baryon mass in the dark matter shell at the radius $x_c$. As a shell collapses, the baryon mass $M_b$ inside the shell increases with the growth of $\\delta_b$, namely the baryon collapsing. ", "Although the density fluctuation of baryons without the relative motion catches up soon with that of dark matter, the relative motion prevents this process. ", "Therefore, the effect of the relative motion is included through the evolution of $M_b$. However it is difficult to evaluate analytically $M_b$ with the relative motion. ", "Thus in order to compute Eq.", " (\\[rveq\\]), we adopt $M_b$ obtained from the N-body simulation in the following section. ", "We also compare the result based on the spherical collapse model with that from the full N-body simulations in the later section.", "\n\nN-BODY SIMULATION {#C}\n=================\n\nBesides the analytical way mentioned in the previous section, we evaluate the effect of the supersonic motion between dark matter and baryons on the structure formation at high redshifts by using N-body simulations. ", "In this section, we describe the setup of our N-body simulations. ", "We perform N-body simulations with the public code Gadget-2 [@2005MNRAS.364.1105S]. ", "In all N-body simulations, the cosmological parameters are set to $(\\Omega_m,\\ \\Omega_\\Lambda\\ h)=(0.31,\\ 0.69,\\ 0.68)$ with $\\Omega_b/\\Omega_m\\sim1/6$. The effect of the supersonic relative motion on the structure formation works after the decoupling between photons and baryons. ", "Therefore, the initial redshift for the simulations is $z_i=1000$. Note that our results almost do not depend on the cosmological parameters because we are interested in the structure formation in the matter dominated era.", "\n\nFor the initial distribution of the particles, we consider the spherical top-hat overdensity region in the isolated system. ", "The simulation box has the uniform distribution of the particles with a uniform overdensity sphere. ", "We set the box size to $L_{\\rm Box}=200~{\\rm kpc}/h$ and the radius of the overdensity sphere to $r_i=50~{\\rm kpc}/h$. Note that we denote hereafter $x$ as the proper distance and $r$ as the comoving distance. ", "In the box, the number of the uniform particles is $3\\times 10^6$ and the initial density contrast of dark matter in the overdense sphere is $\\delta_{c,i}=0.033$. Thus the mass of particles is $2\\times 10^2~M_\\odot/h$ and the mass of dark matter within the initial overdensity sphere is given by $M_c \\sim 4\\times 10^7~M_\\odot/h$. Moreover we set the softening parameter to $\\epsilon=0.1~{\\rm kpc}/h$. We confirm that changes in these parameters do not affect our result qualitatively.", "\n\nAccording to the cosmological perturbation theory, the amplitude of baryon density fluctuations is 1% of that of dark matter density fluctuations with $k=100~{\\rm Mpc^{-1}}$ at $z\\sim 1000$. The initial fluctuations of baryons are negligible compared with those of dark matter at $z_i=1000$. Therefore, we assume that $\\Omega_b/\\Omega_m~(\\sim1/6)$ of the uniform distributed particles is composed of baryons and there is no baryon fluctuation in the overdensity sphere.", "\n\nFigure \\[inipos\\] shows the initial configuration of the particles. ", "The red dots represent the particle uniformly distributed in the box and the green dots are for the particles included in the overdense sphere. ", "Figure \\[inidel\\] shows the initial density contrast of dark matter particles as a function of the radius from the center. ", "In this figure, the red points indicate the values averaged over five realizations of our simulations and the error bars represent the shot noise caused by the finite particle number. ", "The black line is the analytical prediction from our initial condition. ", "This figure tells us that the density is constant in the top-hat sphere. ", "Therefore we can convert the initial position of mass shell to the mass contained within each shell by using the relation $M_{c,i}=4\\pi\\bar{\\rho}(1+\\delta_i)x_i^3/3$. We set the initial velocity of dark matter given by only the second term of Eq.", " (\\[eq4\\]), because N-body simulations are performed in the comoving coordinate.", "\n\nIn order to take into account the supersonic relative motion, we give the additional velocity to all baryons. ", "The correlation of the supersonic relative velocity has the significant value on larger scale than scales of our interest that are smaller than Mpc. ", "Therefore, we assume that all baryons in the simulations have the constant supersonic relative velocity $v_{bc}$ in one direction. ", "In other words, in the simulation, the additional initial velocity for baryons is represented as $\\vec{v}_{b,i}=(v_{bc},0,0)$.\n\nAll terms related to the relative velocity in Eq.", " (\\[eqdl\\]) are proportional to $k v_{bc}$. This fact suggests that the effect of relative motion on the spherical collapse of dark matter halos also depends on a factor $v_{bc}k\\propto v_{bc}/M_c^{1/3}$. Thus, instead of changing both the dark matter halo mass $M_c$ and the relative velocity $v_{\\rm bc}$, we perform numerical simulations for different relative velocities ($5~{\\rm km}$, $15~{\\rm km}$, $30~{\\rm km}$, $50~{\\rm km}$, $100~{\\rm km}$, $150~{\\rm km}$, $200~{\\rm km}$, $300~{\\rm\nkm}$, $500~{\\rm km}$) with fixing the dark matter halo mass $M_c\\sim 4\\times 10^7~M_\\odot/h$, in order to evaluate the dependence of the effect of the relative velocity on $M_c$ and $v_{bc}$.\n\nIn the simulations, we use the periodic boundary condition. ", "Therefore, when the relative velocity is higher than $200~{\\rm km/s}$, baryon particles leaving the simulation box along the direction of the relative velocity reenter the box from the opposite direction due to the boundary condition. ", "In this case, the distribution of reentering baryons is no longer homogeneous in the perpendicular direction to the relative velocity and, resultantly, the dependence on the boundary condition arises in the results. ", "In order to remove this dependence, we make the perpendicular positions of baryons random when the baryon particles reenter the simulation box.", "\n\n![", "The initial configuration of the particles. ", "The green particles are contained within the top-hat sphere and the red points are otherwise.[]{data-label=\"inipos\"}](inipos.eps){width=\".36\\textwidth\"}\n\n![", "The initial density contrast distribution of dark matter. ", "The red points are the values averaged five realizations and the error bars show the shot noise caused by the number of particles contained within mass shells. ", "The black line is the analytical prediction.[]{data-label=\"inidel\"}](icmp.eps){width=\".45\\textwidth\"}\n\nRESULT {#Ca}\n======\n\nIn this section, we present the results of our N-body simulations. ", "First we show the result of the reference model that is the case without the relative velocity.", "\n\n![", "The evolutions of radii of mass shells containing $0.6M_c$ (red), $0.8M_c$ (green), and $M_c$ (blue). ", "The solid black line is the analytical solution of spherical collapse model with $\\delta_{m,i}=0.028$. The dashed black line is the analytical solution corrected in consideration of the periodic boundary condition with $\\tilde{B}=4$.[]{data-label=\"sc\"}](nsc.eps){width=\".45\\textwidth\"}\n\nFigure \\[sc\\] shows the time evolutions of the radii of mass shells from the center. ", "In our simulation, we determined the center of the collapsing shells by using the mean position of the particles contained initially within the top-hat overdensity sphere at each time step. ", "In this figure, the red line represents the mass shell containing $0.6\nM_c\\ (r_i=42~{\\rm kpc/h})$, and the green and blue lines are for that containing $0.8 M_c\\ (r_i=46~{\\rm\nkpc/h})$ and $M_c\\ (r_i=50~{\\rm kpc/h})$, respectively. ", "Additionally the black line corresponds to the analytical solution of the spherical collapse model, Eq.", " (\\[eq3\\]), with $\\delta_{m,i}=(\\bar{\\rho}_{c,i}\\delta_{c,i}+\\bar{\\rho}_{b,i}\\delta_{b,i})/(\\bar{\\rho}_{c,i}+\\bar{\\rho}_{b,i})=0.028$ and the velocity $v_i$ given by Eq.", " (\\[eq4\\]). ", "Note that the shell evolution of the spherical collapse model depends on $\\delta_{m,i}$ only. ", "Therefore, in our initial condition where the overdensity sphere has the homogeneous density profile, the spherical collapse model predicts that all mass shells inside the overdensity sphere trace the black dashed line and collapse at the same time, independently on the mass contained by the mass shells.", "\n\nThe evolutions of radii of the mass shells from N-body simulations agree with the analytic solution of the spherical collapse model before the turnaround time when the radius reaches the maximum. ", "However, after the turnaround time, the results from N-body simulations deviate from the analytic solution. ", "One of the reasons for this deviation is that the particles cannot be concentrated on the infinitesimal point in N-body simulations. ", "Therefore, the particles in the simulations begin to be relaxed with each other after the turnaround time and the collapse is prevented. ", "Furthermore the shot noise induces the substructures inside the collapsing sphere and the ejection of the particles from the mass shells, and resultantly causes the dispersion of the collapse time as discussed in Ref.", " [@2015MNRAS.446.1335W]. ", "These effects of relaxation and shot noise lead the delay of the collapse and cause the deviation from the analytical solution after the turnaround time.", "\n\nFigure \\[sc\\] also shows that the outer mass shells collapse later than the inner ones, although the theoretical spherical collapse model claims that all mass shells collapse at the same time. ", "The reason is the effect of the periodic boundary condition. ", "In order to evaluate this effect simply, we consider the motion of a particle along the $x$-axis direction with the periodic boundary condition. ", "Since we should take into account the gravitational force from the overdensity region in the other boxes due to the boundary condition, the EoM, Eq.", " (\\[eq1\\]), along the $x$-axis is corrected to $$\\begin{aligned}\n \\frac{d^2 \\tilde{x}}{d\\tilde{t}^2}=-\\frac{2(1+\\delta_i)}{9\\tilde{x}^2}+\\sum_{n=1}^\\infty\\left[\\frac{2\\delta_i}{9(na\\tilde{B}-\\tilde{x})^2}-\\frac{2\\delta_i}{9(na\\tilde{B}+\\tilde{x})^2}\\right] \\label{bcsc},\\end{aligned}$$ where $\\tilde{B}=a_iL_{\\rm Box}/x_i$. When the position of the shell is close to the center of the simulation box at the initial time, $\\tilde{B}$ becomes small and vice versa. ", "Namely, the smaller $\\tilde{B}$ is, the more efficient the boundary effect is. ", "In our calculation, the most outer shell that contains the mass $M_c$ inside has $\\tilde{B}=4$. The evolution for $\\tilde{B}=4$ is plotted in the black dashed line in Fig.", " \\[sc\\].", "\n\n![", "The turnaround time (upper panel) and the reference collapse time (lower panel). ", "The red points are the results of N-body simulations with the standard error measured five realizations, and the black lines are the analytical predictions. ", "In the upper panel the shaded region shows the error caused from shot noise shown in Fig.", " \\[inidel\\]. ", "The dashed line shows the prediction from the solutions of Eq.", " (\\[bcsc\\]) with $\\tilde{B}$ converted from $r_i$.[]{data-label=\"tac\"}](nrea.eps){width=\".45\\textwidth\"}\n\nFigure \\[tac\\] shows the turnaround time (upper panel) and the reference collapse time (lower panel) in the reference model as functions of the initial radius of the mass shell. ", "Here, the turnaround time and the reference collapse time are defined as the times when the radius of the mass shell becomes maximum and minimum, respectively. ", "In this figure, the red points with the error bars represent the averages and the standard errors obtained from the five realizations of N-body simulations, and the black line corresponds to the theoretical predictions in the spherical collapse model. ", "Moreover the dashed line shows the turnaround time obtained from Eq.", " (\\[bcsc\\]) which includes the effect of the boundary condition. ", "One can find that the turnaround time is consistent with the theoretical prediction within $r_i=40~{\\rm kpc/}h$. The one of the reasons why the outer mass shells turn around later is the effect of the periodic boundary condition discussed above. ", "In the case where we take the boundary condition into account, the turnaround time matches the theoretical prediction within $r_i=43~{\\rm kpc}/h$ that corresponds with $M=0.65M_c$. The difference between the turnaround time estimated from the outer shells than $r_i=43~{\\rm kpc}/h$ and theoretical one is due to the ejections of particles. ", "As we have mentioned, the reference collapse time in N-body simulations delays for all $r_i$, compared with the theoretical prediction. ", "Additionally, similarly to the turnaround time, the deviation becomes large as $r_i$ increases.", "\n\n![", "The evolutions of mass shell containing $0.6 M_c$ with supersonic relative velocities $v_{bc}=30~{\\rm km}$ (red), $v_{bc}=50~{\\rm km}$ (green), $v_{bc}=100~{\\rm km}$ (blue), $v_{bc}=150~{\\rm km/s}$ (magenta) and reference model (black). ", "Each dashed line is the solution of Eq.", " (\\[rveq\\]) with the baryon density fluctuation derived from N-body simulations.[]{data-label=\"rvsc\"}](nrvsc.eps){width=\".45\\textwidth\"}\n\nNext we show how the supersonic relative motion affects the collapse in N-body simulations. ", "Performing five realizations for different $v_{bc}$, we obtain the typical evolution of mass shells by averaging each realization. ", "Figure \\[rvsc\\] represents the evolutions of the mass shells containing $0.6M_c$ with four different supersonic relative velocities, $v_{bc}=30~{\\rm km/s}$ (in red), $v_{bc}=50~{\\rm km/s}$ (in green), $v_{bc}=100~{\\rm km/s}$ (in blue) and $v_{bc}=150~{\\rm km/s}$ (in magenta). ", "We can convert the results for different velocities with a fixed mass into those for different masses with a fixed velocity through the dependence of the relative velocity effect on $v_{bc}/M_c^{1/3}$ as mentioned above.", "\n\nFor comparison, the corresponding evolution of the mass shell with $0.6M_c$ in the reference model ($v_{bc}=0~{\\rm km/s}$) is plotted as the black solid line. ", "As the relative velocity becomes large, the start of the collapse delays and the maximum radius increases. ", "Therefore, we can conclude that the supersonic relative motion prevents the collapse.", "\n\n![", "The turnaround time (upper panel) and the reference collapse time (lower panel) as the function of the initial radius of the mass shell with the supersonic relative velocity $v_{bc}=30~{\\rm km}$ (red), $v_{bc}=50~{\\rm km}$ (green), $v_{bc}=100~{\\rm km}$ (blue), $v_{bc}=150~{\\rm km/s}$ (magenta) and the reference model (black). ", "In the upper panel the dashed lines are the turnaround time estimated from the solution of the semianalytical model.[]{data-label=\"da\"}](nda.eps){width=\".45\\textwidth\"}\n\nAdditionally we show the solutions of Eq.", " (\\[rveq\\]) as the dashed lines in Fig.", " \\[rvsc\\]. ", "Solving Eq.", " (\\[rveq\\]) numerically, we use the baryon fluctuation $\\delta_b$ obtained from the particle data of the N-body simulations within $r_i\\leq 42~{\\rm kpc/h}$ corresponding to $0.6M_c$. We find that the semianalytical model agrees with the results of N-body simulations before the turnaround time.", "\n\nTo illustrate the delay of the collapse due to the supersonic relative motion we plot the turnaround time and the reference collapse time in Fig.", " \\[da\\] for the different supersonic relative velocities. ", "In this figure, both the turnaround and the reference collapse time are represented as the functions of the initial radius of the mass shell. ", "We show additionally the turnaround times obtained from the solutions of Eq.", " (\\[rveq\\]) as the dashed lines in the top panel of Fig.", " \\[da\\]. ", "The evaluations of the turnaround time from the semianalytical solutions are consistent with the turnaround times from N-body simulations within $r_i\\sim40~{\\rm kpc}/h$ that is same as the reference case. ", "In the following discussions, we use twice the turnaround time as the collapse time. ", "In this case, the scale factor at the collapse time is given by $a_{\\rm col}=\\left(2\\tilde{t}_{\\rm ta}\\right)^{2/3}a_i$.\n\nDISCUSSION {#D}\n==========\n\nIn this section, we show the baryon fraction within the dark matter overdensity sphere. ", "We also discuss the delay of the collapse time and provide the fitting formula of the critical density contrast with the relative motion between dark matter and baryons. ", "Furthermore we present the modification of the halo mass function by taking account of the relative motion.", "\n\nBaryon fraction {#Db}\n---------------\n\nFirst we consider the baryon fraction which represents the mass ratio between baryons and total matter ($f_b=M_b/M_m$) within the dark matter over-density sphere. ", "The baryon fraction is important not only to estimate the effect of the supersonic relative motion on the collapse of dark matter spheres, but also to discuss the first star formation or observables related with baryons. ", "We calculate the baryon fraction by counting baryon particles within the dark matter collapsing over-density sphere.", "\n\n![", "The baryon fractions within the dark matter over-density sphere whose initial radius are $50~{\\rm kpc}/h$ (solid lines) and $42~{\\rm kpc}/h$ (dashed lines). ", "The arrows show the reference collapse times.[]{data-label=\"bf\"}](nbf.eps){width=\".45\\textwidth\"}\n\nFigure \\[bf\\] shows the time evolutions of the baryon fraction. ", "As the relative velocity increases, the baryon fraction becomes smaller. ", "In the case with the nonzero relative velocity, the baryon overdensity region is no longer spherically symmetric and the peak position of baryon density is different from that of dark matter, depending on the amplitude of the relative velocity. ", "However, such asymmetry of the baryon distribution does not affect the dark matter collapse well. ", "As shown in Fig.", " \\[rvsc\\], the dark matter collapse in the N-body simulations is consistent with the spherical collapse model until the turnaround time. ", "Therefore, we can infer that, in spite of the asymmetric distribution for baryons, the dark matter collapse remains spherical. ", "Around the reference collapse time of the dark matter shells, the baryon fraction estimated within $r_i=42~{\\rm kpc}/h$ starts to oscillate. ", "This is mainly due to the difference of the density peak positions between baryons and dark matter. ", "The baryon overdensity region is attracted by that of dark matter gravitationally and oscillates around. ", "As time goes, the difference of the peak positions will be relaxed and the peak position of baryons is expected to overlap that of dark matter. ", "Note that this result is based on the spherical collapse model which is an ideal isolated system. ", "However, the actual collapse happens with many surrounding effects as shown in cosmological simulations. ", "Therefore, to evaluate the baryon fraction properly, these effects could be not negligible.", "\n\nDelay of the halo formation {#Dc}\n---------------------------\n\nThe supersonic relative motion delays the collapse time of dark matter halos as shown in Fig.", " \\[da\\]. ", "In the spherical collapse model without the relative velocity, the collapse time is dependent on only the initial density fluctuation. ", "However, in the case of the nonzero relative velocity, the collapse time depends on the halo mass $M_c$ and the amplitude of the relative velocity. ", "Additionally, the effect of the relative motion cumulatively becomes large for the small initial density contrast, because the small initial density contrast takes longer time to the collapse. ", "Therefore, the change of the collapse time with the relative velocity is represented as a function of $M_c$, $v_{bc}$ and $\\delta_{c,i}$ We define the correction of the scale factor at the collapse time related with the modification of the critical density contrast, as $$\\begin{aligned}\n \\mathcal{A}(M_c,v_{bc},\\delta_{c,i})&\\equiv\\frac{a_{\\rm\n col}(M_c,v_{bc},\\delta_{c,i})-a_0(\\delta_{c,i})}{a_0(\\delta_{c,i})},\\label{eq:col}\\end{aligned}$$ where $a_0(\\delta_{c,i})$ is the scale factor at the collapse time without the relative velocity between baryons and dark matter.", "\n\n![", "The relative time difference for the collapse as a function of relative velocity $v_{bc}$ with the halo mass fixed to $M_c\\sim 4\\times\n10^7~M_\\odot/h$ and three initial density fluctuations $\\delta_{c,i}=0.016$ (black), $\\delta_{c,i}=0.033$ (rad) and $\\delta_{c,i}=0.066$ (blue) evaluated from turnaround time. ", "The shaded regions show the standard error region from the N-body simulation. ", "The solid lines are the fitting formula Eq.", " (\\[ff\\]). ", "The dashed line are results from the N-body simulations with the usual periodic boundary condition. ", "The upper horizontal axis shows the mass converted with $v_{bc}=30~{\\rm km/s}$.[]{data-label=\"rda\"}](nlda.eps){width=\".45\\textwidth\"}\n\nFigure \\[rda\\] shows the relative difference $\\mathcal {A}$ as a function of the relative velocity with a fixed mass $M_c\\sim 4\\times 10^7~M_\\odot/h$. We plot $\\cal A$ for different three initial density contrasts estimated from the N-body simulations with our boundary condition (shaded regions) or the usual periodic boundary condition (dashed lines). ", "We find that the effect of the supersonic relative velocity is negligible for velocities smaller than 50 km/s. The relative velocity is small so that baryons are captured gravitationally by the dark matter halo and accrete to the halo. ", "Therefore, we can roughly estimate the threshold velocity as the circular velocity of the dark matter halo at the initial redshift, $$\\begin{aligned}\n v_{\\rm cir}=\\sqrt{\\frac{GM_c}{x_i}}\\simeq 57~\\left(\\frac{M_c}{3.85\\times 10^7~M_\\odot}\\right)^{1/3}~{\\rm km/s}.\\end{aligned}$$ This criterion can be also obtained from the condition that the third term related to the relative velocity, $\\mu^2 k^2$, dominates in the right-hand side in the second equation of Eq.", " (\\[eqdl\\]). ", "Therefore, when the relative velocity is larger than the criterion velocity, the relative motion prevents the collapse by the third term in Eq.", " (\\[eqdl\\]). ", "Similarly, when the relative velocity is larger than $v_{\\rm cir}$, the effect of the relative motion on the structure formation arises. ", "The upper horizontal axis represents the corresponding mass in the case of a fixed velocity $v_{bc} = 30~{\\rm km/s}$, which is converted through the $v_{bc}/M_c^{1/3}$-dependence of the relative motion effect. ", "Thus one can find that the supersonic relative motion does not affect the formation of dark matter halos with mass larger than $M_c{\\lower.5ex\\hbox{$\\; \\buildrel > \\over \\sim \\;$}}10^7~M_\\odot/h$ for $v_{bc}=30{\\rm km/s}$ which corresponds to the effective Jeans scale discussed in Sec.", " \\[Ba\\].", "\n\nIn the N-body simulation results with the usual periodic boundary condition, the modification becomes independent of the amplitude of the relative velocity in the case with $v_{bc}{\\lower.5ex\\hbox{$\\; \\buildrel > \\over \\sim \\;$}}200~{\\rm km/s}$ shown in Fig.", " \\[rda\\]. ", "However this independence is due to the artificial condition of the simulations. ", "When $v_{bc}{\\lower.5ex\\hbox{$\\; \\buildrel > \\over \\sim \\;$}}200~{\\rm km/s}$, all baryons can travel a distance larger than the simulation box size $L_{\\rm Box}$ until $\\tilde{t}\\sim100$ and are attracted gravitationally twice by the collapsing dark matter sphere. ", "Therefore, the effect of the relative velocity seems to be saturated in this relative velocity region. ", "On the other hand, the results of the N-body simulations with our boundary condition shown as the shaded region in Fig.", " \\[rda\\] are not saturated. ", "In order to verify the validity of the result of our N-body simulations, we show the collapse time and the baryon fraction in the limit of the large homogeneous relative velocity. ", "One can easily imagine that, when the relative velocity is enough high ($v_{bc}=500~{\\rm km/s}$), which corresponds to very small dark matter halos ($M_c\\sim10^4\n~M_\\odot/h$) in the case of $v_{bc}=30~{\\rm km/s}$, baryons do not collapse along the relative velocity direction. ", "In this limit, we can ignore the gravitational force from the dark matter halo on the baryon motion along the relative velocity direction. ", "In other words, the gravitational collapsing of baryons occurs perpendicular to the relative velocity direction and does not along the parallel direction. ", "Therefore, to evaluate the evolution of the density fluctuations, it is useful to consider the motion of baryons with the relative velocity in the comoving cylindrical coordinate system whose axis is parallel to the relative velocity motion. ", "In this case, the EoM of baryons particles with the initial velocity $(v_{b\\parallel},v_{\\perp})=(v_{bc},0)$ is given as $$\\begin{aligned}\n \\frac{d^2\\vec{r}_b}{dt^2}=&-2H\\vec{v}_b-\\frac{G\\delta M_c}{a^3r_b^3}\\vec{r}_b,\\notag\\\\\n \\delta M_c=&\\frac{4}{3}\\pi \\bar{\\rho}_c[r_{c,i}^3(1+\\delta_{c,i})-r_c^3]\\notag\\\\\n &\\times \\max[1,(r_b/r_c)^3],\\label{lim}\\end{aligned}$$ where $r_b$ is the radial component of $\\vec{r}_b$ from the center of the dark matter sphere and $r_c$ is the radius of the overdensity sphere of dark matter. ", "Note that we ignore the gravitational force of the baryon fluctuation in Eq.", " (\\[lim\\]), because $\\delta M_b\\ll \\delta M_c$. We solve Eqs.", " (\\[rveq\\]) and (\\[lim\\]) numerically with different initial positions $\\vec{r}_{b,i}$ chosen randomly. ", "We calculate the resultant baryon density contrast in a collapsing spherical shell of dark matter by taking the average of $\\delta_b=(r_{bi\\perp}/r_{b\\perp})^{2}-1$ for baryons inside the shell of dark matter, because the collapse of baryons is cylindrical.", "\n\n![", "The baryon fractions within the dark matter halo ($r_i=42~{\\rm kpc}/h$) with $M_c\\sim 4\\times 10^7 M_\\odot/h$ and $v_{bc}=500~{\\rm km/s}$ and solution of Eqs.", " (\\[rveq\\]) and (\\[lim\\]) with or without the periodic boundary condition (red or blue line). ", "The each color shaded region show the 1$\\sigma$ dispersion of the baryon fractions estimated from five realizations of N-body simulations. ", "The vertical dashed lines show the turnaround times from N-body simulations.[]{data-label=\"del\"}](nlbf.eps){width=\".45\\textwidth\"}\n\nFigure \\[del\\] shows the evolution of the baryon fractions with $M_c\\sim 4\\times 10^7 M_\\odot/h$ and $v_{bc}=500~{\\rm km/s}$. The red solid line represents the solution obtained with the periodic boundary condition. ", "In order to take into account the periodic boundary condition, we solve Eqs.", " (\\[rveq\\]) and (\\[lim\\]) with the assumption that the position of baryons, $\\vec{r}_b$, is limited within the box size and baryons return into the box from the opposite side when they exit from one side of the box. ", "For comparison, we also solve the equations without the boundary condition and plot the solution in the blue solid line. ", "Baryons with the periodic boundary condition feel gravitational force stronger than without the boundary condition. ", "Therefore, the collapse is faster with the boundary condition than without the boundary condition.", "\n\nMoreover, in Fig.", " \\[del\\], we show the results from N-body simulations. ", "The red shaded region represents the standard error region from the N-body simulations with the periodic boundary condition, while the blue shaded region gives the standard error region for the N-body simulations with our boundary condition which is the periodic boundary condition with the position shuffling of the baryon particles reentering into the box. ", "In Fig.", " \\[del\\], N-body simulations with our boundary condition is consistent with the numerically solution without the periodic boundary condition, while N-body simulations with the periodic boundary condition agrees with the solution with the periodic boundary condition. ", "We find that, in the both boundary condition cases, the differences between the numerical solutions and N-body simulations arise around $\\tilde{t}\\simeq 100$. This is because, as the collapse proceeds, the baryon density in the N-body simulations grows as the spherical collapse rather than the cylindrical one. ", "Therefore, the baryon fraction is larger in N-body simulations than in the numerical calculations.", "\n\n![", "The collapse time with $M_c\\sim 4\\times 10^7 M_\\odot/h$ and $v_{bc}=500~{\\rm km/s}$ estimated by solving Eqs.", " (\\[rveq\\]) and (\\[lim\\]) with boundary condition (red) and without boundary condition (blue). ", "The black solid line is corresponded the solution of Eqs.", " (\\[rveq\\]) with $\\delta_b=0$ at any time. ", "Points represent estimations from N-body simulations with $v_{bc}=500~{\\rm km/s}$. The upper axis presents the collapse time from Eq.", " (\\[eq3\\]) with the total matter density fluctuation $\\delta_{m,i}=\\bar{\\rho}_c\\delta_{c,i}/(\\bar{\\rho}_c+\\bar{\\rho}_b)$.[]{data-label=\"limda\"}](nlimda.eps){width=\".45\\textwidth\"}\n\nIn addition, we plot $\\mathcal{A}$ as functions of the initial density fluctuations $\\delta_{c,i}$ with $M_c\\sim 4\\times 10^7 M_\\odot/h$ and $v_{bc} =500~{\\rm km/s}$ in Fig.", " \\[limda\\]. ", "The red and blue solid lines are obtained from the numerical calculations with and without the periodic boundary condition, respectively. ", "In the case with the periodic boundary condition, we overestimate the gravitational force to collapse as mentioned above and, therefore, the delay of the collapse is not larger than in the case without the boundary condition. ", "For comparison, we plot the black solid line which represents the results with the assumption that baryons cannot collapse. ", "The difference from the black solid line represents the contribution due the collapse of the baryon component. ", "When the relative velocity is large enough, baryons cannot collapse to the dark matter mass shell. ", "Accordingly, as the relative velocity becomes large, the blue solid line shifts to the black line. ", "We also plot the results of N-body simulations with the periodic boundary condition and our boundary condition as red and blue points with the standard error bars in Fig.", " \\[limda\\], respectively. ", "As shown in Fig.", " \\[del\\], the numerical calculation with the periodic boundary condition agrees with N-body simulations with the periodic boundary condition, while the numerical calculation without the boundary condition is consistent with N-body simulations with our boundary condition. ", "We remind you that our boundary condition is introduced to remove the artificial distribution of the reentering baryon particles due to the periodic boundary condition in N-body simulations. ", "We conclude that the saturation in $\\mathcal{A}$ from N-body simulations with the periodic boundary condition is caused by this artifact. ", "The results from N-body simulations with our boundary condition present realistic phenomena.", "\n\nBased on the results of our N-body simulations, we find the fitting formula of $\\cal A$ represented as the solid lines in Fig.", " \\[rda\\]. ", "The fitting formula is given by $$\\begin{aligned}\n \\mathcal{A}(M_c,v_{bc},\\delta_{c,i})&=\\mathcal{A}_{\\delta_b=0}(\\delta_{c,i})\\frac{\\mathcal{B}^\\nu(M_c,v_{bc},\\delta_{c,i})}{\\mathcal{B}^\\nu(M_c,v_{bc},\\delta_{c,i})+1},\\notag\\\\\n \\mathcal{B}(M_c,v_{bc},\\delta_{c,i})&=\\frac{v_{bc}}{v_{\\rm norm}(\\delta_{c,i})}\\left(\\frac{M_c}{3.85\\times 10^7~M_\\odot/h}\\right)^{-1/3},\\notag\\\\\n v_{\\rm norm}(\\delta_{c,i})&=a_v - b_v\\delta_{c,i},\\label{ff}\\end{aligned}$$ where $\\mathcal{A}_{\\delta_b=0}$ is the solution of Eq.", " (\\[rveq\\]) with $\\delta_b=0$ shown in Fig.", " \\[limda\\], and $\\nu$, $a_v$ and $b_v>0$ are the fitting parameters. ", "The velocity $v_{\\rm norm}$ is the critical velocity for the collapse of baryons along the direction of the relative velocity. ", "When $v_{\\rm bc} \\gg v_{\\rm norm}$, the relative velocity is much larger than $v_{\\rm circ}$ even at the collapse time and baryons does not collapse along the direction of the relative velocity as mentioned above. ", "Since the collapse time becomes long with decreasing $\\delta_i$ and $v_{\\rm bc}$ is inversely proportional to the scale factor, $v_{\\rm norm}$ increases as $\\delta_i$ decreases. ", "Thus we conclude that the delay is controlled by two critical velocity $v_{\\rm circ}$ and $v_{\\rm norm}$. Nevertheless it can be calculated numerically, we use the approximated function of $\\mathcal{A}_{\\delta_b=0}$, $$\\begin{aligned}\n \\mathcal{A}_{\\delta_b=0}(\\delta_{c,i})=\\frac{\\delta_{c,i}^{-0.146}-1.06}{4.12\\times \\delta_{c,i}^{0.648}+1.93}.\\end{aligned}$$ We estimate the parameters by fitting simultaneously Eq.", " (\\[ff\\]) to $\\mathcal{A}$ with using three different initial density fluctuations. ", "Furthermore we perform a Fisher analysis and obtain the parameters as $$\\begin{aligned}\n \\nu=2.02\\pm0.07,\\ a_v=205\\pm16,\\ b_v=877\\pm253,\\end{aligned}$$ where the standard errors are estimated after marginalizing over other parameters. ", "Since we sample the data for three different initial conditions, the parameter $b_v$ has a large error. ", "However, we find that the form in Eq.", " (\\[ff\\]) fits well with the N-body simulation results.", "\n\nMass function\n-------------\n\nThe delay of the halo formation due to the relative velocity modifies the abundance of dark matter halos. ", "In this section, we evaluate the modification based on the Press-Schechter formalism. ", "In the Press-Schechter formalism, the delay of the collapse is represented as the increase of the critical density contrast. ", "Using the relative time difference $\\cal A$, we can write the modified critical density contrast during the matter dominated era as $$\\begin{aligned}\n \\tilde{\\delta}_{\\rm crit}(M_c,v_{bc},\\delta_{c,i})&=\\delta_{\\rm crit}\\left[1+\\mathcal {A}(M_c,v_{bc},\\delta_{c,i})\\right].\\label{eq:delta}\\end{aligned}$$ The critical density contrast depends on the relative velocity in the region where the collapses happens. ", "Therefore, the modified halo mass distribution can be written with the probability distribution function of the amplitude of the relative velocity at the initial time $f(v_{bc})$ as $$\\begin{aligned}\n \\tilde{n}(M_c,z)=&\\int dv_{bc}~f(v_{bc})\\sqrt{\\frac{2}{\\pi}}\\frac{\\bar{\\rho}(z)}{M_c}\\frac{\\tilde{\\delta}_{\\rm crit}(M_c,v_{bc},\\delta_{c,i})}{\\sigma(M_c,z)}\\notag\\\\\n &\\times\\left[\\frac{d\\ln\\tilde{\\delta}_{\\rm crit}(M_c,v_{bc},\\delta_{c,i})}{dM_c}-\\frac{d\\ln\\sigma(M_c,z)}{dM_c}\\right]\\notag\\\\\n &\\times\\exp\\left[-\\frac{\\tilde{\\delta}_{\\rm\n crit}^2(M_c,v_{bc},\\delta_{c,i})}{2\\sigma^2(M_c,z)}\\right]. ", "\\label{ps}\\end{aligned}$$ Note that, because of the existence of the relative motion, the redshift of the collapse time depends not only on the initial density fluctuation of cold dark matter, but also on the halo mass $M_c$ and the amplitude of relative velocity $v_{bc}$. Therefore, in Eq.", " (\\[ps\\]), the mass derivative term of the critical density additionally arises because the mass dependence of the critical density contrast affects the hierarchical structure formation.", "\n\nWe assume that the probability distribution $f(v_{bc})$ follows the Maxwell-Boltzmann distribution because the each component of relative velocity is independent and obey the same Gaussian distribution whose mean value is zero and the dispersion is $\\sigma_v$; $$\\begin{aligned}\n f(v_{bc}) dv_{bc} =4\\pi v_{bc}^2\n \\left(\\frac{3}{2\\pi\\sigma_v^2}\\right)^{3/2}\\exp\\left(-\\frac{3v_{bc}^2}{2\\sigma_v^2}\\right)\n dv_{bc},\\end{aligned}$$ where we use $\\sigma_v=28.8~{\\rm km/s}$ according to the latest cosmological parameters from PLANCK paper and we use CAMB[@2000ApJ...538..473L] to calculate $\\sigma(M_c,z)$.\n\n![", "The ratio of mass function of the dark matter halo between with and without relative motion at four redshifts $z=10$ (red), $z=15$ (green) $z=20$ (blue) and $z=30$ (magenta).[]{data-label=\"mf\"}](nzps.eps){width=\".45\\textwidth\"}\n\nFigure \\[mf\\] shows the ratio between the mass function with and without the relative velocity. ", "Here we plot the ratio at four different redshifts, $z=$10, 15, 20 and 30. ", "These lines are evaluated by using the fitting formula Eqs.", " (\\[ff\\]) for $\\mathcal{A}$ in Eq.", " (\\[eq:delta\\]). ", "The suppression of the mass function due to the relative motion is more significant for smaller masses region and at higher redshifts. ", "At $z = 30$, although the modification $\\mathcal{A}$ is very small around $10^7 M_\\odot/h\\lesssim M_c \\lesssim 10^9~M_\\odot/h$, the suppression of the mass function is not negligible. ", "This is because such massive halos at high redshifts are rare objects which satisfy $\\tilde{\\delta}_{\\rm crit}\\gg \\sigma(M_c)$ in the Press-Schechter formalism. ", "Therefore, the effect of the modification $\\mathcal{A}$ appears exponentially in the Press-Schechter formalism, even if $\\mathcal{A}$ is small. ", "The ratio of the mass functions reaches the minimum at $M_c\\sim\n10^5~M_\\odot/h$. On smaller scales than $M_c\\sim\n10^5~M_\\odot/h$, the suppression of the mass function decreases because the mass derivative term of the critical density in Eq.", " (\\[ps\\]) increases around $M_c\\sim 10^5~M_\\odot/h$ as shown in Fig.", " \\[rda\\].", "\n\nFigure \\[mf\\] also shows that the mass function is suppressed even around the EoR ($z\\sim 10$). ", "This is because the redshift dependence of the derivative terms in Eq.", " (\\[ps\\]) is weak. ", "Although the suppression scales are consistent, the suppression of mass function around EoR is stronger than in other previous works. ", "Especially Ref.", " [@2012ApJ...747..128N] reported that the suppression disappears at $z \\sim 10$ in their SPH simulations. ", "Of course, unlike the SPH simulations, we only simulate the gravitational force, ignoring the baryon physics. ", "However, it is worth mentioning reasons of the difference between our calculation of the mass function and previous work in term of the gravitational growth. ", "The first reason for this difference is that we do not include the environmental effects of the structure formation, e.g., an accretion of other density peaks of baryons neighboring the dark matter halo. ", "These effects increase the baryon fraction within a dark matter halo and promotes the halo formation. ", "The second reason is that the relative motion produces halos derived from offsetting baryon peaks [@2014ApJ...791L...8N]. ", "This effect increases simply the number of halos. ", "It is difficult to include this effect in the Press-Schechter formalism. ", "We will be able to estimate a number of halos originated from the baryon peaks by applying the our simulations or our semianalytical model of Eq.", " (\\[rveq\\]). ", "Finally, the initial condition for matter density and velocity fields is still debatable in the numerical simulations with the relative velocity. ", "In our simulation, we use the initial condition that leads to the maximum delay of the collapse time. ", "Thus the halo mass function in Fig.", " \\[mf\\] is calculated on the basis of the optimistic case where the baryons can escape most efficient from the dark matter halo.", "\n\nSUMMARY {#E}\n=======\n\nThe relative motion between baryons and dark matter plays an important role, particularly, in small-scale structure formation at high redshifts. ", "We have studied their effect on the dark mater halo formation.", "\n\nWe have evaluated the delay of the dark matter halo collapse due to the supersonic relative motion by using the cosmological N-body simulation. ", "We have found that the delay of the collapse becomes large for a dark matter halo with $M_c\\sim4\\times 10^7~M_\\odot/h$, when the relative velocity is larger than $v_{\\rm cir}=57~{\\rm km/s}$. In other words, the delay of the collapse happens when the relative velocity is larger than the typical circular velocity of the dark matter halo. ", "Moreover, we have shown that the supersonic relative motion delays the fall of baryons into the potential well of the dark matter halo in the context of the spherical collapse model. ", "We have also evaluated the baryon fraction $M_b/M_m$ of the dark matter halos with the supersonic relative motion by the N-body simulation. ", "The baryon fraction becomes smaller as the amplitude of the relative motion increases. ", "We have pointed out that, when the relative velocity is large enough to escape from the potential of dark matter halos, baryons can collapse only along the perpendicular direction of the relative velocity, like the cylindrical collapse. ", "Furthermore we show the delay of the collapse time for dark matter halo by the relative motion depends on the initial density fluctuation within dark matter spheres, which determines the collapse time of the dark matter halo without relative motion. ", "The smaller initial density fluctuation lead the longer time during which the supersonic relative motions affect the halo collapse. ", "In consequence, the effect of the relative motion is more efficient on dark matter halos formed at later time.", "\n\nFinally we have estimated the suppression of the abundance of dark matter halos by supersonic relative motion in the context of the spherical collapse model. ", "In the Press-Schechter formalism, the delay of the collapse increases the critical density contrast for the collapse. ", "We have found the fitting formula of the critical density contrast depending on the halo mass, the initial density fluctuations and, the relative velocity. ", "Using the fitting formula, we have calculated the mass function of dark matter halos. ", "The relative motion decreases the mass function with mass smaller than $10^{8}~M_\\odot /h$ before EoR. In particular, the abundance of halos with $M_c=10^5~M_\\odot/h$ is suppressed by 80% at $z=30$ and a half at $z=10$.\n\nThe delay of the dark matter halo collapse and the decrease of the baryon fraction in dark matter halos due to the relative motion can give the effect on first star formation and the reionization history [@2011ApJ...736..147G; @2011MNRAS.412L..40M; @2012MNRAS.424.1335F]. ", "Such effect could impact the cosmological signals of the EoR including the CMB polarization [@2012PhRvD..85d3523F], the redshifted 21 cm lines [@2011arXiv1110.4659B; @2012ApJ...760....3M] and these cross-correlation [@2008MNRAS.389..469T]. ", "Moreover, the relative motion between dark matter and baryons influences the large scale structure, e.g., baryon acoustic oscillation [@2011JCAP...07..018Y; @2015MNRAS.448....9S; @2013PhRvD..88j3520Y], and there is the challenging work detecting this effect by using the results of galaxy distribution from two independent galaxy spectroscopic survey [@2015arXiv150603900B]. ", "Based on the results of this paper, we will investigate the effect of the relative motion on the cosmological signals probed by ongoing or planned observations.", "\n\nThis work was supported by JSPS KAKENHI Grant No. ", "26-2667 (S.A.), No. ", "24340048 (K.I.) and No. ", "15K17646 (H.T.). ", "H.T. also acknowledges the support by MEXT’s Program for Leading Graduate Schools PhD professional, “Gateway to Success in Frontier Asia”.", "\n" ]
{ "pile_set_name": "ArXiv" }
[ 0.005405405405405406, 0, 0, 0, 0, 0, 0, 0.005787037037037037, 0, 0, 0.014204545454545454, 0.01694915254237288, 0, 0.0625, 0.0033003300330033004, 0.011764705882352941, 0, 0.007462686567164179, 0, 0, 0, 0.01092896174863388, 0.0213903743315508, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0, 0, 0, 0, 0.005154639175257732, 0, 0, 0, 0, 0, 0.005952380952380952, 0, 0, 0, 0, 0, 0, 0.02564102564102564, 0, 0, 0.0037593984962406013, 0, 0, 0.16666666666666666, 0, 0.010238907849829351, 0, 0.007352941176470588, 0, 0, 0, 0, 0, 0, 0.005747126436781609, 0, 0, 0, 0.007246376811594203, 0, 0.05263157894736842, 0, 0.0625, 0.034482758620689655, 0.0038461538461538464, 0, 0, 0, 0, 0, 0.0049261083743842365, 0.004885993485342019, 0, 0, 0.03571428571428571, 0, 0, 0, 0, 0.011904761904761904, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0040650406504065045, 0, 0, 0, 0, 0, 0.0013404825737265416, 0, 0, 0, 0, 0, 0.00641025641025641, 0, 0, 0, 0, 0, 0, 0, 0, 0.012987012987012988, 0.009708737864077669, 0.005917159763313609, 0, 0, 0, 0, 0, 0, 0, 0, 0.04, 0, 0, 0, 0, 0.013513513513513514, 0.002145922746781116, 0, 0.005847953216374269, 0, 0, 0, 0, 0.011235955056179775, 0, 0.016129032258064516, 0, 0, 0, 0.014705882352941176, 0, 0, 0, 0, 0, 0, 0, 0.02564102564102564, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.004739336492890996, 0.02564102564102564, 0, 0, 0, 0.006802721088435374, 0, 0, 0.013157894736842105, 0.017857142857142856, 0, 0, 0, 0.004201680672268907, 0, 0, 0.004901960784313725, 0, 0, 0, 0, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.012658227848101266, 0, 0, 0, 0, 0.008680555555555556, 0, 0.003215434083601286, 0, 0.023255813953488372, 0, 0, 0, 0, 0.002150537634408602, 0, 0, 0, 0, 0, 0.0034965034965034965, 0, 0.007692307692307693, 0, 0, 0.0037735849056603774, 0, 0.008403361344537815, 0, 0, 0, 0, 0, 0, 0.005628517823639775, 0, 0.01639344262295082, 0, 0, 0, 0.006329113924050633, 0, 0, 0, 0.013157894736842105, 0, 0, 0, 0, 0.05263157894736842, 0, 0, 0.14285714285714285, 0, 0, 0, 0, 0.009174311926605505, 0, 0.017543859649122806, 0, 0.007518796992481203, 0.00847457627118644, 0, 0, 0, 0, 0, 0, 0, 0.0058823529411764705, 0, 0.0625, 0, 0, 0, 0, 0.0078125, 0, 0.011627906976744186, 0.023255813953488372, 0, 0, 0.004672897196261682, 0, 0.004739336492890996, 0, 0.004201680672268907, 0, 0.02702702702702703, 0, 0.0072992700729927005, 0, 0, 0.007246376811594203, 0.00819672131147541, 0, 0, 0.0032679738562091504, 0, 0, 0.01694915254237288, 0, 0.058823529411764705, 0, 0, 0, 0, 0, 0.014705882352941176, 0, 0, 0, 0, 0, 0.06666666666666667, 0.018867924528301886, 0.00909090909090909, 0, 0, 0, 0.00819672131147541, 0, 0, 0.006896551724137931, 0, 0, 0, 0.02857142857142857, 0, 0, 0, 0, 0, 0, 0, 0, 0.004219409282700422, 0, 0, 0, 0, 0, 0, 0.011627906976744186, 0.006085192697768763, 0.020833333333333332, 0.010666666666666666, 0, 0.019230769230769232, 0.05, 0, 0, 0.014492753623188406, 0 ]
0.005127
5
[ { "analysis_explanation": null, "end": 1569, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1553 }, { "analysis_explanation": null, "end": 2799, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2794 }, { "analysis_explanation": null, "end": 3454, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3447 }, { "analysis_explanation": null, "end": 7831, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7828 }, { "analysis_explanation": null, "end": 9236, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9234 }, { "analysis_explanation": null, "end": 10352, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10347 }, { "analysis_explanation": null, "end": 10501, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10499 }, { "analysis_explanation": null, "end": 10755, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10753 }, { "analysis_explanation": null, "end": 11044, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11027 }, { "analysis_explanation": null, "end": 11430, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11414 }, { "analysis_explanation": null, "end": 11548, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11546 }, { "analysis_explanation": null, "end": 13374, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13372 }, { "analysis_explanation": null, "end": 13383, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13377 }, { "analysis_explanation": null, "end": 14884, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14882 }, { "analysis_explanation": null, "end": 15853, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15851 }, { "analysis_explanation": null, "end": 17254, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17234 }, { "analysis_explanation": null, "end": 18253, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18225 }, { "analysis_explanation": null, "end": 19285, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19283 }, { "analysis_explanation": null, "end": 19294, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19288 }, { "analysis_explanation": null, "end": 19933, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19931 }, { "analysis_explanation": null, "end": 20201, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20197 }, { "analysis_explanation": null, "end": 23012, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23003 }, { "analysis_explanation": null, "end": 23153, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23151 }, { "analysis_explanation": null, "end": 23162, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23156 }, { "analysis_explanation": null, "end": 25798, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25795 }, { "analysis_explanation": null, "end": 26137, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26134 }, { "analysis_explanation": null, "end": 27154, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27134 }, { "analysis_explanation": null, "end": 27468, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27457 }, { "analysis_explanation": null, "end": 29931, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29928 }, { "analysis_explanation": null, "end": 30393, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30390 }, { "analysis_explanation": null, "end": 30400, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30395 }, { "analysis_explanation": null, "end": 30732, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30727 }, { "analysis_explanation": null, "end": 30895, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30881 }, { "analysis_explanation": null, "end": 31547, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31541 }, { "analysis_explanation": null, "end": 32336, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32280 }, { "analysis_explanation": null, "end": 32835, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32832 }, { "analysis_explanation": null, "end": 34040, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34037 }, { "analysis_explanation": null, "end": 34047, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34042 }, { "analysis_explanation": null, "end": 34288, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34284 }, { "analysis_explanation": null, "end": 35537, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35535 }, { "analysis_explanation": null, "end": 35545, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35540 }, { "analysis_explanation": null, "end": 36775, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36765 }, { "analysis_explanation": null, "end": 36838, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36836 }, { "analysis_explanation": null, "end": 36994, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36992 }, { "analysis_explanation": null, "end": 39528, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39525 }, { "analysis_explanation": null, "end": 39767, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39741 }, { "analysis_explanation": null, "end": 39845, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39834 }, { "analysis_explanation": null, "end": 40115, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40113 }, { "analysis_explanation": null, "end": 41701, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41694 }, { "analysis_explanation": null, "end": 43464, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43462 }, { "analysis_explanation": null, "end": 43818, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43815 }, { "analysis_explanation": null, "end": 44797, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44794 }, { "analysis_explanation": null, "end": 45979, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45938 }, { "analysis_explanation": null, "end": 46163, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46137 }, { "analysis_explanation": null, "end": 46228, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46225 }, { "analysis_explanation": null, "end": 47238, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47236 }, { "analysis_explanation": null, "end": 47246, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47241 }, { "analysis_explanation": null, "end": 47354, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47348 }, { "analysis_explanation": null, "end": 47477, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47415 }, { "analysis_explanation": null, "end": 47701, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47699 }, { "analysis_explanation": null, "end": 47709, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47704 }, { "analysis_explanation": null, "end": 48345, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48305 }, { "analysis_explanation": null, "end": 49352, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49348 }, { "analysis_explanation": null, "end": 49418, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49416 }, { "analysis_explanation": null, "end": 49661, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49651 }, { "analysis_explanation": null, "end": 49794, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49786 }, { "analysis_explanation": null, "end": 50207, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50197 }, { "analysis_explanation": null, "end": 50604, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50602 }, { "analysis_explanation": null, "end": 50608, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50606 }, { "analysis_explanation": null, "end": 50615, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50613 }, { "analysis_explanation": null, "end": 50683, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50678 }, { "analysis_explanation": null, "end": 50709, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50707 }, { "analysis_explanation": null, "end": 51590, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51588 }, { "analysis_explanation": null, "end": 51834, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51832 }, { "analysis_explanation": null, "end": 53368, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53365 }, { "analysis_explanation": null, "end": 57182, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57164 }, { "analysis_explanation": null, "end": 57221, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_140094861343280", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57217 }, { "analysis_explanation": null, "end": 1598, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_140094861343568", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1593 }, { "analysis_explanation": null, "end": 1726, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1714 }, { "analysis_explanation": null, "end": 4996, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 4988 }, { "analysis_explanation": null, "end": 57215, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_140094861022736", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 57207 }, { "analysis_explanation": null, "end": 57215, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_140094861023792", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 57207 } ]