text
stringlengths 0
6.48M
| meta
dict |
|---|---|
US Senate Votes to Require Women to Register for the Draft
As I have written about previously, the draft by the central government of the united States of America is not only unconstitutional, but it is morally and biblically a violation of the freedom and liberty that the men and women of this country possess. Yet, the US Senate has recently voted to demand that women register for the draft.
On Tuesday, the Senate approved an expansive military policy bill that would for the first time require young women to register for the draft. The shift, while fiercely opposed by some conservative lawmakers and interest groups, had surprisingly broad support among Republican leaders and women in both parties.
The United States has not used the draft since 1973 during the Vietnam War. But the impact of such a shift, reflecting the evolving role of women in the armed services, would likely be profound.
Under the Senate bill passed on Tuesday, women turning 18 on or after Jan. 1, 2018, would be forced to register for Selective Service, as men must do now. Failure to register could result in the loss of various forms of federal aid, including Pell grants, a penalty that men already face. Because the policy would not apply to women who turned 18 before 2018, it would not affect current aid arrangements.
“The fact is,” said Senator John McCain, Republican of Arizona and the chairman of the Armed Services Committee, “every single leader in this country, both men and women, members of the military leadership, believe that it’s fair since we opened up all aspects of the military to women that they would also be registering for Selective Services.”
Sadly, many men and women have abandoned the biblical principles our nation was first founded upon, namely the differences and roles of men and women. While the Supreme Court ruled in 1981 that women did not have to register for the draft so that they would not have to face the same requirements as men, the Obama administration has been advancing an assault on women since Defense Secretary Ashton Carter would open combat jobs to woman.
Here’s the root problem in this particular issue: the drafting of men into military service is wrong. It’s doubly wrong to draft women. It’s even worse when the central government is doing it to support unconstitutional wars, which they have been doing following World War II.
“It’s my personal view, every American who’s physically qualified should register for the draft,” said General Robert B. Neller, commandant of the Marine Corp.
Well, we appreciate the treasonous general’s “personal view,” but the Constitution specifically states in the Thirteenth Amendment:
Neither slavery nor involuntary servitude, except as a punishment for crime whereof the party shall have been duly convicted, shall exist within the United States, or any place subject to their jurisdiction.
This would include the illegal and immoral draft for both men and women.
The Bible is also clear about what god considers moral with regards to an army.
When Israel went to war, here were the stipulations that God put down for those who would engage in battle. The come from Deuteronomy 20.
“When you go out to battle against your enemies, and see horses and chariots and people more numerous than you, do not be afraid of them; for the Lord your God is with you, who brought you up from the land of Egypt. So it shall be, when you are on the verge of battle, that the priest shall approach and speak to the people. And he shall say to them, ‘Hear, O Israel: Today you are on the verge of battle with your enemies. Do not let your heart faint, do not be afraid, and do not tremble or be terrified because of them; for the Lord is He who goes with you, to fight for you against your enemies, to save you.” Deut. 20:1-4
The next section points out those who should return home rather than be a part of the militia.
“Then the officers shall speak to the people, saying, ‘What man is there who has built a new house and has not dedicated it? Let him go and return to his house, lest he die in the battle and another man dedicate it. And also what man is there who has planted a vineyard and has not eaten of it? Let him go and return to his house, lest he die in the battle and another man eat of it. And what man is there who is betrothed to a woman and has not married her? Let him go and return to his house, lest he die in the battle and another man marry her.'” Deut. 20:5-7
It even includes those who are cowards.
“The officers shall speak further to the people and say, ‘What man is there who is fearful and fainthearted? Let him go and return to his house, lest the heart of his brethren faint like his heart.’ And so it shall be, when the officers have finished speaking to the people, that they shall make captains of the armies to lead the people.” Deut. 20:8-9
The pretended law that requires men to sign up for the draft in clear violation of the Constitution has been upheld by the Supreme Court in 1981. This is par for a Supreme Court that has shown itself to be unconstitutional in its rulings time and again.
The Sons of Liberty is a politically neutral organization. We believe that the Judeo-Christian ethic has provided the principles upon which this nation was founded. It is our belief that these principles provide
not only the foundation and framework for American government and society, but are also essential to the maintenance of a fair and just society. All content is based on a Christian, Biblical world-view. | {
"pile_set_name": "Pile-CC"
} |
.\" @(#)awk.1 6.1 (Berkeley) 4/29/85
.\"
.TH AWK 1 "April 29, 1985"
.AT 3
.SH NAME
awk \- pattern scanning and processing language
.SH SYNOPSIS
.B awk
[
.BI \-F c
]
[ prog ] [ file ] ...
.SH DESCRIPTION
.I Awk
scans each input
.I file
for lines that match any of a set of patterns specified in
.IR prog .
With each pattern in
.I prog
there can be an associated action that will be performed
when a line of a
.I file
matches the pattern.
The set of patterns may appear literally as
.I prog,
or in a file
specified as
.B \-f
.IR file .
.PP
Files are read in order;
if there are no files, the standard input is read.
The file name `\-'
means the standard input.
Each line is matched against the
pattern portion of every pattern-action statement;
the associated action is performed for each matched pattern.
.PP
An input line is made up of fields separated by white space.
(This default can be changed by using FS,
.IR "vide infra" ".)"
The fields are denoted $1, $2, ... ;
$0 refers to the entire line.
.PP
.PP
A pattern-action statement has the form
.PP
pattern { action }
.PP
A missing { action } means print the line;
a missing pattern always matches.
.PP
An action is a sequence of statements.
A statement can be one of the following:
.PP
.nf
if ( conditional ) statement [ else statement ]
while ( conditional ) statement
for ( expression ; conditional ; expression ) statement
break
continue
{ [ statement ] ... }
variable = expression
print [ expression-list ] [ >expression ]
printf format [ , expression-list ] [ >expression ]
next # skip remaining patterns on this input line
exit # skip the rest of the input
.fi
.PP
Statements are terminated by
semicolons, newlines or right braces.
An empty expression-list stands for the whole line.
Expressions take on string or numeric values as appropriate,
and are built using the operators
+, \-, *, /, %, and concatenation (indicated by a blank).
The C operators ++, \-\-, +=, \-=, *=, /=, and %=
are also available in expressions.
Variables may be scalars, array elements
(denoted
x[i])
or fields.
Variables are initialized to the null string.
Array subscripts may be any string,
not necessarily numeric;
this allows for a form of associative memory.
String constants are quoted "...".
.PP
The
.I print
statement prints its arguments on the standard output
(or on a file if
.I >file
is present), separated by the current output field separator,
and terminated by the output record separator.
The
.I printf
statement formats its expression list according to the format
(see
.IR printf (3S)).
.PP
The built-in function
.I length
returns the length of its argument
taken as a string,
or of the whole line if no argument.
There are also built-in functions
.I exp,
.I log,
.I sqrt,
and
.IR int .
The last truncates its argument to an integer.
.IR substr(s,\ m,\ n)
returns the
.IR n -character
substring of
.I s
that begins at position
.IR m .
The function
.IR sprintf(fmt,\ expr,\ expr,\ ...)
formats the expressions
according to the
.IR printf (3S)
format given by
.I fmt
and returns the resulting string.
.PP
Patterns are arbitrary Boolean combinations
(!, \(or\(or, &&, and parentheses) of
regular expressions and
relational expressions.
Regular expressions must be surrounded
by slashes and are as in
.IR egrep .
Isolated regular expressions
in a pattern apply to the entire line.
Regular expressions may also occur in
relational expressions.
.PP
A pattern may consist of two patterns separated by a comma;
in this case, the action is performed for all lines
between an occurrence of the first pattern
and the next occurrence of the second.
.PP
.nf
A relational expression is one of the following:
.PP
.nf
expression matchop regular-expression
expression relop expression
.PP
.fi
where a relop is any of the six relational operators in C,
and a matchop is either ~ (for contains)
or !~ (for does not contain).
A conditional is an arithmetic expression,
a relational expression,
or a Boolean combination
of these.
.PP
The special patterns
BEGIN
and
END
may be used to capture control before the first input line is read
and after the last.
BEGIN must be the first pattern, END the last.
.PP
A single character
.I c
may be used to separate the fields by starting
the program with
.PP
BEGIN { FS = "c" }
.PP
or by using the
.BI \-F c
option.
.PP
Other variable names with special meanings
include NF, the number of fields in the current record;
NR, the ordinal number of the current record;
FILENAME, the name of the current input file;
OFS, the output field separator (default blank);
ORS, the output record separator (default newline);
and
OFMT, the output format for numbers (default "%.6g").
.PP
.SH EXAMPLES
.PP
Print lines longer than 72 characters:
.PP
.nf
length > 72
.fi
.PP
Print first two fields in opposite order:
.PP
.nf
{ print $2, $1 }
.fi
.PP
Add up first column, print sum and average:
.PP
.nf
{ s += $1 }
END { print "sum is", s, " average is", s/NR }
.fi
.PP
Print fields in reverse order:
.PP
.nf
{ for (i = NF; i > 0; \-\-i) print $i }
.fi
.PP
Print all lines between start/stop pairs:
.PP
.nf
/start/, /stop/
.fi
.PP
Print all lines whose first field is different from previous one:
.PP
.nf
$1 != prev { print; prev = $1 }
.fi
.SH SEE ALSO
.PP
lex(1), sed(1)
.br
A. V. Aho, B. W. Kernighan, P. J. Weinberger,
.I
Awk \- a pattern scanning and processing language
.SH BUGS
There are no explicit conversions between numbers and strings.
To force an expression to be treated as a number add 0 to it;
to force it to be treated as a string concatenate ""
to it.
| {
"pile_set_name": "Github"
} |
7 beautiful actresses who have played Feng Shao Feng's leading ladies
by Nancy Z on Fri, Jul 22, 2016
00
New Chinese fantasy drama Ice Fantasy stars handsome leading man Feng Shao Feng, who excels in both romantic and warrior roles. Many DramaFever fans know him as Prince of Lan Ling, one of the three most beautiful men, as documented in Chinese history. Many beautiful actresses have been paired with this top Chinese actor. Do you know who they are?
(There are actually more than these 7 actresses who have starred with the popular leading man. If you have a favorite one that you think should be in the list, please post in the comments section below.)
1. Prince of Lan Ling - Ariel Lin plays an innocent village girl who is a descendant of the Divine Sorceress. She meets the prince without knowing who he really is and they fall in love, but will the greedy emperor and jealous queen allow them to live happily ever after?
Prince of Lan Ling
2. Palace- Yang Mi (Les Interprètes) plays a 21st-century woman who travels back to the past and becomes a catalyst in the Qing dynasty's royal infighting among princes.
If the plot sounds familiar to you, yes, this drama has often been compared to the famous Scarlet Heart that stars Cecilia Liu and Nicky Wu. However, Palace has a different ending with Yang Mi's character ending up with a different prince. Guess who!
COMING SOON
Palace
3. The Emperor's Harem- Ady An (Autumn's Concerto) plays a young woman who is forced to enter the palace during the Ming dynasty, in a fictional romance drama. Will she ever gain freedom and unite with her true love Feng Shao Feng?
Feng Shao Feng is also popular in modern stories.
4. Love Will Tear Us Apart - Ni Nie and Feng Shao Feng play lovers stressed by city life in this movie about love and romance among China's new generation. Ni Nie was also Feng's real-life girlfriend for three years and they were reportedly heading to the altar, but their breakup was confirmed in 2015.
5. The Golden Era- Tang Wei(Late Autumn) portrays a writer in this period drama based on the life of the famous Chinese female writer Xiao Hong during the 1930s, when China was entering the modern age, but before the arrival of WW II turbulence. Feng Shao Feng plays her lover in this award-winning film.
6. White Vengeance (aka Feast at Hong Gate) - Liu Yifeistars as the concubine to Feng Shao Feng's famous general in this movie. Their heart-touching love story is based on real history from the turbulent times after the fall of Qin dynasty.
COMING SOON
White Vengeance
And now, Victoria of K-pop girls group f(x) joins the beautiful group of actresses who have starred with the handsome leading man. Victoria's popularity is so high in China that fans there voted her as the Asian Goddess of 2014, ahead of Park Shin Hye and Cecilia Liu.
7. Ice Fantasy - Victoria Songplays the eternal love to Feng Shao Feng's crown prince of the Ice tribe. The two lovers were forced to separate by adversaries who schemed to steal the throne. Will they ever be able to reunite? | {
"pile_set_name": "Pile-CC"
} |
Q:
JavaFX: If node equals node
I have a simple JavaFX program like this:
When I hit the first button it puts content1 in the right side of the split screen. When I hit button2 it puts content2 on the right (behaving like it should).
But when there is an TextField in for example content2 and I click button2 again, it resets.
How can I check if I am already in content2?
Controller.java:
@FXML private SplitPane splitpane;
@FXML private Node content;
@FXML
public void initialize() {
changeContent(new ContentA());
}
@FXML
public void onMenuClickA(ActionEvent event) {
changeContent(new ContentA());
}
@FXML
public void onMenuClickB(ActionEvent event) {
changeContent(new ContentB());
}
private void changeContent(Node node) {
if (node.equals(content)) { // <---- Not working
System.out.println("Same");
}
List<Node> splitpaneItems = splitpane.getItems();
splitpaneItems.set(splitpaneItems.indexOf(content), node);
content = node;
}
ContentA.java:
public class ContentA extends HBox {
public ContentA() {
FXMLLoader fxmlLoader = new FXMLLoader(getClass().getResource("/fxml/contents/Test1.fxml"));
fxmlLoader.setRoot(this);
fxmlLoader.setController(this);
try {
fxmlLoader.load();
} catch (IOException e) {
e.printStackTrace();
}
}
A:
There are a number of possible solutions, depending on the exact behavior you want.
If you never want to reset the individual components, just preload them in the initialize() method, and save them to instance variables:
public class Controller {
@FXML private SplitPane splitpane;
private ContentA contentA ;
private ContentB contentB ;
private int contentIndex ;
@FXML
public void initialize() {
contentA = new ContentA();
contentB = new ContentB();
contentIndex = splitPane.getItems().size() ;
splitPane.getItems().set(contentIndex, contentA);
}
@FXML
public void onMenuClickA(ActionEvent event) {
changeContent(contentA);
}
@FXML
public void onMenuClickB(ActionEvent event) {
changeContent(contentB);
}
private void changeContent(Node node) {
splitpaneItems.set(contentIndex, node);
}
}
On the other hand, if you want to "reset" the content when you load them, but want to prevent the user from reloading the current content, you could just disable the most recently pressed button:
public class Controller {
@FXML private SplitPane splitpane;
@FXML private Button buttonA ;
@FXML private Button buttonB ;
private int contentIndex ;
@FXML
public void initialize() {
buttonA.setDisable(true);
contentIndex = splitPane.getItems().size() ;
changeContent(new ContentA());
}
@FXML
public void onMenuClickA(ActionEvent event) {
buttonA.setDisable(true);
buttonB.setDisable(false);
changeContent(new ContentA());
}
@FXML
public void onMenuClickB(ActionEvent event) {
buttonA.setDisable(false);
buttonB.setDisable(true);
changeContent(new ContentB());
}
private void changeContent(Node node) {
splitpaneItems.set(splitpaneItems.indexOf(content), node);
}
}
Finally, if you want to be able to control different behavior for different content (e.g. always reload content A, never reload content B), you need to use a variable to keep track of the state of the content. An enum works well for this:
public class Controller {
private ContentB contentB ;
public enum Content {
A(() -> new ContentA()),
B(() -> contentB) ;
private final Supplier<Node> nodeLoader ;
Content(Supplier<Node> nodeLoader) {
this.nodeLoader = nodeLoader ;
}
public Node getContent() {
return nodeLoader.get();
}
}
private Content currentContent ;
@FXML
public void initialize() {
contentB = new ContentB();
contentIndex = splitPane.getItems().size() ;
changeContent(Content.A);
}
@FXML
public void onMenuClickA(ActionEvent event) {
changeContent(Content.A);
}
@FXML
public void onMenuClickB(ActionEvent event) {
changeContent(Content.B);
}
private void changeContent(Content content) {
this.currentContent = content ;
splitpaneItems.set(contentIndex, content.getContent());
}
}
| {
"pile_set_name": "StackExchange"
} |
Q:
Setting selected item to DropdownList in MVC Application?
I am having an MVC application in that I am having an dropdownList on the add client page.
The user selects the sates in the dropdownlists.
On the edit Page,I want the same state selected which the user selected on the add client page please tell what shall I do.
Thank You
Ritz
A:
Try to set selected option at data source (SelectList) like that :
Dictionary<string, string> list = new Dictionary<string, string>();
list.Add("State 1", "1");
list.Add("State 2", "2");
list.Add("State 3", "3");
var selectList = new SelectList(list,
"Value", "Key",
"2"); // selected item's value "State 2" is selected.
ViewData["States"] = selectList;
<%= Html.DropDownList("ddlStates", (SelectList)ViewData["States"]) %>
| {
"pile_set_name": "StackExchange"
} |
Procycling brings you the colour, action and drama of the world's most spectacular sport in a glossy and dynamic magazine.
It's the authoritative, worldwide voice of international professional road racing, distributed in every country where there are English-speaking fans.
With exclusive features and spectacular photography, Procycling brings to life the complexities, rivalries and hardships of the European professional scene.
Cycling Plus is the manual for the modern road cyclist.
Whether you're cycling weekly, an occasional new rider or a Tour de France fan you’ll find everything you need.
Every issue is packed with expert reviews of the latest road bikes and gear, inspirational routes and rides, evocative features that take you inside every aspect of cycling and unmatched nutrition, fitness and training advice.
What Mountain Bike is the magazine that gets to the heart of what matters in mountain biking.
Whether it's new bikes, fresh kit, inspiring photography or the low down on the latest trail developments, What Mountain Bike has something for every rider.
Our team cuts through jargon and marketing spin to tell you what you need to know, with honest, informed opinions and a wealth of experience.
Mountain Biking UK celebrates everything that is great about mountain biking, enabling people of all abilities and ages to have a better time on their bike.
MBUK brings you all the latest news, coolest kit, plus exclusive info on the newest and best bikes that you can buy.
Fat bikes galore - Interbike 2013
Carbon fat bikes, carbon fat bike rims and electric fat bikes
1 / 42
This Felt electric fat bike prototype, dubbed "Fat-E", features a 250-watt Bosch motor. The Fat-E is still in the early stages of development; the company expects it will be available in late 2014 or early 2015
(Josh Patterson/Future Publishing)
2 / 42
Felt claims the Bosch battery has an approximate run time of 2.5-3 hours
(Josh Patterson/Future Publishing)
3 / 42
The Bosch pedal assist system adds approximately 6lb (2.7kg) to a bike. The claimed weight for Felt's Fat-E prototype is 45lb (20.4kg)
(Josh Patterson/Future Publishing)
4 / 42
The Bosch head unit displays battery life as well as the functions one expects from a cycling computer such as max and average speed, total trip distance. It also has a USB port that allows it to act at a charger for external devices such as smartphones and lights
(Josh Patterson/Future Publishing)
5 / 42
The Fat-E has internal cable routing through a port on the side of the head tube
(Josh Patterson/Future Publishing)
6 / 42
While Felt's fat bike prototype has front and rear quick-release axles, the production version will likely sport thru-axles
(Josh Patterson/Future Publishing)
7 / 42
The Borealis Yampa shown here tips the scales at 21lb (9.5kg). The Yampa will be available with a SRAM XO/X9 build kit for US$3,599 and with a SRAM XX1 kit for US$5,449. The Yampa frame with carbon fork will retail for US$2,249 (UK pricing TBD)
(Josh Patterson/Future Publishing)
8 / 42
The Borealis Yampa has internal cable routing through the down tube
(Josh Patterson/Future Publishing)
9 / 42
The Yampa has a 100mm wide bottom bracket shell
(Josh Patterson/Future Publishing)
10 / 42
Race Face is one of the few companies making high-end cranks with extra long, fat bike-friendly spindles
(Josh Patterson/Future Publishing)
11 / 42
The Yampa fork as a claimed weight for 575g. The fork features a 135mm spacing and a 15mm thru-axle
(Josh Patterson/Future Publishing)
12 / 42
The Yampa frame has a 190mm rear spacing and uses a standard quick-release for the rear axle
(Josh Patterson/Future Publishing)
13 / 42
The Yampa frame has rear rack mounts
(Josh Patterson/Future Publishing)
14 / 42
The Yampa has slender seat stays to provide a bit of vertical flex, in case you needed more comfort than a 26x4.8in tire can provide
(Josh Patterson/Future Publishing)
15 / 42
The Yampa frame can accomodate 4.8in tires on 100mm-wide rims
(Josh Patterson/Future Publishing)
16 / 42
Borealis is one of the first companies to bring carbon fat bike rims to market, the rims feature a double-walled construction and have a claimed weight of 590g. A pair of these carbon rims retails for US$1,599, with complete wheelsets starting at US$1,999 (UK pricing TBD)
(Josh Patterson/Future Publishing)
17 / 42
The Borealis carbon rims have an internal width of 85mm and can be set up tubeless by sealing off the spoke holes
(Josh Patterson/Future Publishing)
18 / 42
Boo Bicycles line of value-oriented aluminum and bamboo bikes includes this Aluboo fat bike
(Josh Patterson/Future Publishing)
19 / 42
The bamboo main tubes are bonded to the aluminum front end
(Josh Patterson/Future Publishing)
20 / 42
The seat tube is also bamboo
(Josh Patterson/Future Publishing)
21 / 42
Fatback's Corvus carbon frame and fork will be available later this year for US$1,850 (UK pricing TBD)
(Josh Patterson/Future Publishing)
22 / 42
The Fatback Corvus frame on display was a 3D mockup of the production version, which will use a direct-mount front derailleur and a threaded, 100mm-wide bottom bracket shell
(Josh Patterson/Future Publishing)
23 / 42
The Fatback Corvus frame will use post-mount disc brake mounts and use a 190x12mm thru axle
(Josh Patterson/Future Publishing)
24 / 42
The Corvus has a slender top tube that bows downward for additional standover clearance
(Josh Patterson/Future Publishing)
25 / 42
The Fatback Corvus has a tapered head tube
(Josh Patterson/Future Publishing)
26 / 42
Vee Rubber had a number of fat bike tires on dislay
(Josh Patterson/Future Publishing)
27 / 42
Some beach cruisers even got the fat bike treatment
(Josh Patterson/Future Publishing)
28 / 42
The Surly Pugsley was one of the first widely available fat bikes
(Josh Patterson/Future Publishing)
29 / 42
Surly has also spearheaded the development of 29+ bikes such as the Surly Krampus, which was introduced at Interbike last year
(Josh Patterson/Future Publishing)
30 / 42
Surly has built upon the 29+ platform with the ECR, a Krampus designed with bike packing in mind
(Josh Patterson/Future Publishing)
31 / 42
The ECR fork bristles with braze-ons for rack, fender and water bottle mounts
(Josh Patterson/Future Publishing)
32 / 42
There's no shortage of mounts on the rear of the ECR
(Josh Patterson/Future Publishing)
33 / 42
Fatback worked with Vee Rubber to design the Sterling tire
(Josh Patterson/Future Publishing)
34 / 42
The Sterling has a tubeless bead and a 120tpi casing. Claimed weight for this 26x4.25in tire is 1300g
(Josh Patterson/Future Publishing)
35 / 42
9:ZERO:7 will be offering the carbon Whiteout as a frame and fork. The frame has a claimed weight of 2.8lb (1.27kg) and the fork has a claimed weight of 650g
(Josh Patterson/Future Publishing)
36 / 42
The Whiteout has a 135mm front spacing and uses a 15mm thru-axle
(Josh Patterson/Future Publishing)
37 / 42
The cables are routed through the Whiteout's top tube
(Josh Patterson/Future Publishing)
38 / 42
The rear derailleur cable exits the top tube just in front of the seat tube before entering the seatstay
(Josh Patterson/Future Publishing)
39 / 42
The Whiteout has a dropped top tube to improve standover clearance, which is particularly important when riding in snow
(Josh Patterson/Future Publishing)
40 / 42
The Whiteout's rear end uses a thru axle and takes a 190mm-wide rear hub
(Josh Patterson/Future Publishing)
41 / 42
The 9:ZERO:7 Whiteout can accomodate up the a 26x4.8in tire on a 100mm-wide rim
(Josh Patterson/Future Publishing)
42 / 42
The Whiteout frameset will be available in November. It will retail for US$2,299
It’s clear that 2013 has been a breakout year for fat bikes. Salsa gave us a preview of its carbon Beargrease prototype and we’ve seen large players such as Specialized, Trek and Norco jump on the big tire bandwagon as well. At Interbike, this year's Outdoor Demo was filled with bikes shod in massive tires rumbling though the Nevada desert.
Felt took attendees by surprise with its “Fat-E” electric-assist fat bike prototype. A trend we saw from this year’s Eurobike tradeshow was the incorporation of pedal assist technology into off-road capable models. Lapierre’s Overvolt and Cube’s Stereo Hybrid are two such bikes. Like these companies, Felt is incorporating electric assist technology from Bosch into several of its 2014 models, including the Fat-E prototype shown here. The bike has yet to be officially named and is slated for release in late 2014 or early.
Felt's Fat-E prototype stopped attendees in their tracks
Fatback, 9:ZERO:7 and Borealis all had new carbon fat bike frames on display in various stages of development. Borealis is venturing into new territory by developing double-walled carbon fat bike rims that, when set up tubeless, can shave as much as two pounds of rotating weight off the wheels — though there’s a significant sting to one’s wallet.
It appears that frame standards within the fat bike market are beginning to take hold: front axle spacing on many of the new models is set at 135mm, bottom bracket width is generally 100mm, and rear axle spacing appears to be settling on 190mm. Thru-axles are becoming more common, as are tapered forks. Several fat bike manufactures mentioned that they expect RockShox and X-Fusion to bring fat bike suspension forks to market in the near future, though neither company would comment on the possibility.
Click through the gallery at above right for a detailed look at these new fat bikes and components.
Josh has been riding and racing mountain bikes since 1998. Being stubborn, endurance racing was a natural fit. Josh bankrolled his two-wheeled addiction by wrenching at various bike shops across the US for 10 years and even tried his hand at frame building. These days Josh spends most of his time riding the trails around his home in Fort Collins, Colorado.
Discipline: Mountain, cyclocross, road
Preferred Terrain: Anywhere with rock- and root-infested technical singletrack. He also enjoys unnecessarily long gravel races. | {
"pile_set_name": "Pile-CC"
} |
Too many Intel Haswells will spoil the broth
Posted March 15, 2013 - 05:13
by
A Staff Writer
Intel is unlikely to release its Core i "Haswell" Platform in any serious numbers because of the "annoying" USB 3.0 flaw.
JoAnne Feeney, an analyst with Longbow Research, said that although Intel is on track to introduce its next-generation Core i-series "Haswell" microprocessors in June, it is unlikely we will see many of them.
When a PC system with Core i-series "Haswell" and 8-series chipset inside wakes from S3 sleep mode, it experiences issues with devices connected through USB 3.0. Intel seemingly defines the issue only as a nuisance as there would be no serious unpleasant consequences, such as data loss. You can fix it by restarting the software.
Feeney thinks that in high volumes this glitch will depress the ailing PC market. Intel is just better to wait and fix the problem first.
She wrote that Haswell for desktop will launch with cautious volume in June using the faulty C1 stepping, and then to see a stronger ramp once the glitch is worked out.
However this will not be a bad thing. Intel had not been expected to get Haswell out in June at all.
Feeney said that caution in Ivy Bridge units is still likely to constrain gross margin for Intel and contacts point to August as the more significant launch period.
So far Intel has not said how long it will take to get a revision of its 8-series chipsets with corrected USB 3.0 operations. Feeney thinks it should be by the end of Summer.
This will cause the industry to lean on the much safer Ivy Bridge platform which is socket compatible with Sandy Bridge, unlike Haswell.
By the end of the year Haswell will make up half of desktop CPU shipments, Feeney said. | {
"pile_set_name": "Pile-CC"
} |
#ifndef UNPARSER_JOVIAL
#define UNPARSER_JOVIAL
#include "unparser.h"
#include "Cxx_Grammar.h"
#include "unparseLanguageIndependentConstructs.h"
class Unparse_Jovial : public UnparseLanguageIndependentConstructs
{
public:
Unparse_Jovial(Unparser* unp, std::string fname);
virtual ~Unparse_Jovial();
virtual std::string languageName() const { return "Jovial Unparser"; }
void unparseJovialFile(SgSourceFile *file, SgUnparse_Info &info);
virtual void unparseLanguageSpecificStatement (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseLanguageSpecificExpression (SgExpression* expr, SgUnparse_Info& info);
virtual void unparseNullptrVal (SgExpression* expr, SgUnparse_Info& info);
virtual void unparseStringVal (SgExpression* expr, SgUnparse_Info& info);
virtual void unparseDefineDeclStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseDirectiveStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseCompoolStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseProgHdrStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseProcDeclStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseFuncDefnStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseNamespaceDeclarationStatement(SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseNamespaceDefinitionStatement (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseBasicBlockStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseLabelStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseForStatement (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseJovialForThenStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseWhileStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseGotoStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseIfStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseSwitchStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseCaseStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseDefaultStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseBreakStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseTypeDefStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseProcessControlStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseReturnStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseEnumDeclStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseOverlayDeclStmt (SgStatement* stmt, SgUnparse_Info& info);
void unparseTableDeclStmt (SgStatement* stmt, SgUnparse_Info& info);
void unparseTableBody (SgClassDefinition* table_def, SgUnparse_Info& info);
virtual void unparseVarDeclStmt (SgStatement* stmt, SgUnparse_Info& info);
virtual void unparseVarDecl (SgStatement* stmt, SgInitializedName* initializedName, SgUnparse_Info& info);
virtual void unparseExprStmt (SgStatement* stmt, SgUnparse_Info& info);
// Types
//
virtual void unparseType (SgType* type, SgUnparse_Info& info);
template <class T>
void unparseJovialType (T* type, SgUnparse_Info& info);
void unparseJovialType (SgArrayType* type, SgUnparse_Info& info);
void unparseJovialType (SgEnumType* type, SgUnparse_Info& info);
void unparseJovialType (SgFunctionType* type, SgUnparse_Info& info);
void unparseJovialType (SgModifierType* type, SgUnparse_Info& info);
void unparseJovialType (SgJovialTableType* type, SgUnparse_Info& info);
void unparseJovialType (SgPointerType* type, SgUnparse_Info& info);
void unparseJovialType (SgTypedefType* type, SgUnparse_Info& info);
void unparseTypeDesc (SgType* type, SgUnparse_Info& info);
void unparseTypeSize (SgType* type, SgUnparse_Info& info);
void unparseTypeSize (SgTypeFixed* type, SgUnparse_Info& info);
void unparseTypeSize (SgTypeString* type, SgUnparse_Info& info);
void unparseTypeSize (SgJovialBitType* type, SgUnparse_Info& info);
// Expressions
virtual void unparseUnaryOperator (SgExpression* expr, const char* op, SgUnparse_Info& info);
virtual void unparseBinaryOperator (SgExpression* expr, const char* op, SgUnparse_Info& info);
virtual void unparseCastExp (SgExpression* expr, SgUnparse_Info& info);
virtual void unparseSubscriptExpr (SgExpression* expr, SgUnparse_Info& info);
virtual void unparseArrayOp (SgExpression* expr, SgUnparse_Info& info);
virtual void unparseAsteriskShapeExpr (SgExpression* expr, SgUnparse_Info& info);
virtual void unparseAssignOp (SgExpression* expr, SgUnparse_Info& info);
virtual void unparseFuncRef (SgExpression* expr, SgUnparse_Info& info);
virtual void unparseVarRef (SgExpression* expr, SgUnparse_Info& info);
virtual void unparsePtrDeref (SgExpression* expr, SgUnparse_Info& info);
virtual void unparseTypeExpr (SgExpression* expr, SgUnparse_Info& info);
virtual void unparseFuncCall (SgExpression* expr, SgUnparse_Info& info);
void unparseOverlayExpr (SgExprListExp* overlay, SgUnparse_Info& info);
// Initializers
void unparseAssnInit (SgExpression* expr, SgUnparse_Info& info);
void unparseTablePreset (SgExpression* expr, SgUnparse_Info& info);
void unparseReplicationOp (SgExpression* expr, SgUnparse_Info& info);
// Table dimension list
void unparseDimInfo (SgExprListExp* dim_info, SgUnparse_Info& info);
private:
std::string ws_prefix(int nesting_level)
{
std::stringstream code;
for (int i = 0; i < nesting_level; i++) {
code << " ";
}
return code.str();
}
void curprint_indented(std::string txt, SgUnparse_Info& info)
{
curprint( ws_prefix(info.get_nestingLevel()) );
curprint( txt );
}
};
#endif
| {
"pile_set_name": "Github"
} |
Best Phone, Settings, Guide, Manual and Tutorials
How to Upgrade iPhone Without Problems? - It used to be relatively cheap and easy to upgrade to the latest iPhone. Choose an iPhone 7 models, iPhone 7 is also available in Jet Black, Black, Silver, Gold, and Rose Gold. Just renew your contract and get a new phone. Now that carriers are phasing out contracts, however, getting your paws on an iPhone 7 is going to cost you by follow iPhone upgrade program.
How to Upgrade iPhone Without Problems?
There are lots of great options for upgrade new iPhone. Whether you buy from Apple, a carrier, or another retailer, finding the best option for you really comes down to a few new iPhone upgrade problems. Let’s break it down.
Reasons upgrade new iPhone to pay all at once
One payment and you’re done.
You can choose your carrier and switch at any time.
You can upgrade whenever you want, without having to pay off a balance.
Reasons to pay over time
You pay in installments, often with 0% interest and no money down.
You can choose a payment plan that works for you.
There are many plans that let you upgrade to a new iPhone every year.
Do you have upgrade new iPhone or trade in?
With Apple and some carriers, you can get a credit of up to $260 per device to use toward the purchase of a new iPhone.So you’ll save money whether you pay all at once or over time.
Inevitably, the key to the best deal on a new iPhone is doing the research. You might still be eligible for a grandfathered-in upgrade, and there are plenty of trade-in programs worth considering. Apple’s own iPhone Upgrade Program is pretty appealing as well. But everybody’s options will be different, so let us walk you through the top five routes to a new iPhone to figure out how to get the best deal.
Upgrade iPhone Without Problems
Your specific situation depends on the paperwork you signed with your carrier many months or many years ago. To figure out what your upgrade options with that same carrier will be, you’ll need to get on the phone or log into your account to check your options.
But just because you’re eligible for an upgrade, doesn’t mean you should take it. When you’re on the phone asking about the new iPhone update problems, be sure to ask about the various payment plans and attached fees. There’s a good chance your carrier could end up charging you more than the retail value of a new iPhone in the long run. So let’s break it down.
1) Apple (800.MY.APPLE)
Let me be blunt: Apple’s iPhone Upgrade Program is probably your best option. It’s not the cheapest, with monthly payments starting at $32.41. But Apple’s plan guarantees that you get a new, unlocked iPhone every year and includes AppleCare+ protection, which is a good deal. The plan also works with Verizon, AT&T, T-Mobile, and Sprint.
If you consider that the major carriers’ own payment plans all start at around $27 a month, Apple’s iPhone Upgrade Program will end up costing you at least $220 more. But! Shave $130 off that premium for AppleCare+ and whatever amount you’re willing to pay to get a new iPhone every year, and you’re basically breaking even. All of the carriers charge upgrade fees that will cost you $20 to $50 over two years. So the Apple tax is actually moot.
It’s also worth pointing out that Apple’s good customer service is basically priceless. Anyone who’s ever been stuck on hold with a carrier will understand this point.
2) Verizon (800.922.0204 or dial *611 from your phone)
Like all other major carriers, Verizon has moved away from upgrade programs and towards a simple payment plan. Although the company hasn’t released specific numbers for the iPhone 7 quite yet, its payment plan for the iPhone 6s came out to $27.08 per month for 24 months with 0 percent APR. Since the iPhone 7 will have the same retail price tag, there’s a good chance that the new monthly payment will be very similar not only for Verizon but for all carriers.
You can also trade in your old phone when signing up for Verizon’s iPhone payment plan. The company advertises up to $300 in the form of a gift card, depending on the device and its condition. Verizon will only consider the Galaxy Note 5, Galaxy S6, Galaxy S6 edge/edge+, HTC M9, iPhone 6, LG G4, and LG V10. So if you’ve got an iPhone 5s, eBay might be your best option.
Then there are the fees. There’s a $20 activation fee that may or may not be waived, depending on your standing. There’s also a $20 upgrade fee, if you’re adding a new device to your account. That fee goes up to $40 if you do the two-year payment plan.
3) AT&T (800.331.0500 or dial 611 from your phone)
This one is confusing. A couple years ago, AT&T started migrating customers from traditional contracts to its AT&T Next and AT&T Next Every Year programs both of which get rid of the contract altogether. These are basically payment plans, and depending on when you last signed a contract, you may or may not be able to switch over.
The AT&T Next program may or may not require a 30 percent downpayment, and then 30 monthly installments to pay off the rest of the phone’s retail price. You can trade in your device for an upgrade, when you’ve paid off 80 percent of it. The AT&T Next Every Year program is similar except there are only 24 monthly payments, and you can upgrade after you’ve paid off 50 percent of the retail value. Both feature a 0 percent APR.
Confused yet? Long story short, AT&T’s prices will vary based on the size of your down payment and the price of your new iPhone. You’ll also have to pay a $20 activation fee.
4) T-Mobile (800.866.2453 or dial 611 from your phone)
If you’re hoping to seamlessly switch from an iPhone 6 to an iPhone 7, T-Mobile might be your best option. The company is offering a free 32GB iPhone 7 to anyone who pre-orders the new devices and trades in an iPhone 6, 6s, 6 Plus or 6s Plus. You can get more storage, or an iPhone 7 Plus, for $100 to $200 extra.
Otherwise, T-Mobile’s upgrade options are a bit like AT&T. The company offers the JUMP! and the JUMP! On Demand programs. JUMP! offers a 24-month payment plan and an upgrade after you’ve paid off 50 percent of the phone’s retail price tag. JUMP! On Demand is an 18-month payment plan, but you can upgrade any time you want, up to three times per year. Depending on which plan you choose, you might get hit with a $20 a month upgrade fee, too.
5) Sprint (866.866.7509 or dial *3 from your phone)
Similar to the T-Mobile deal, Sprint is offering a brand new iPhone 7 if they trade in a iPhone 6, iPhone 6s, Samsung Galaxy S7, or Samsung Galaxy S7 edge. That deal is only good until September 16. After that, you’re stuck with the regular old payment plan and a $30 upgrade or activation fee. And just like its competitors, Sprint basically lets you pay off the phone over a set number of months and waives the financing fees.
If you’re already a Sprint customer, it’s essential that you call the company and figure out what your options are. If you’re not a Sprint customer, think very hard about whether you want to be a Sprint customer. There are reasons this carrier is in last place.
Apple iPhone Upgrade Problems
Pay a few extra bucks and go through Apple, if you don’t want to deal with the headache of trying to figure out when and how to upgrade. If you don’t want to deal with any of this bullshit, the very best deal is simply buying a new, unlocked iPhone at retail value. This way you’re not locked into a payment plan, and you can switch carriers at your heart’s content.
Apple‑Authorized Service
Get repair or replacement service from Apple‑authorized technicians and software update support from Apple experts.
AppleCare+ Coverage includes:
Your iPhone
Battery
Included EarPods and accessories
Using iOS, iCloud, and Apple-made apps
Connecting to Wi-Fi
Accidental Damage
You’re covered for up to two incidents of accidental damage, each subject to a service fee plus applicable tax. AppleCare+ for iPhone provides coverage for up to two incidents of
accidental damage from handling. Each incident is subject to a service
fee of $29 for screen damage or $99 for any other damage, plus
applicable tax.
AppleCare+ Coverage includes:
Screen damage
Accidental drops
Liquid damage
Service coverage is available only for the iPhone and its original included accessories that are defective in materials or workmanship or for batteries that retain less than 80 percent of their original capacity. The replacement equipment that Apple provides as part of the repair or replacement service may be new or equivalent to new in both performance and reliability.
AppleCare+ for iPhone
Every iPhone comes with one year of hardware repair coverage through its limited warranty and up to 90 days of complimentary support. AppleCare+ for iPhone extends your coverage to two years from the original purchase date of your iPhone1 and adds up to two incidents of accidental damage coverage, each subject to a service fee of $29 for screen damage, or $99 for any other damage, plus applicable tax.2 In addition, you’ll get 24/7 priority access to Apple experts via chat or phone.
Extend your coverage to two years of service and expert telephone technical support
AppleCare+ One stop for technical support
Because Apple designs iPhone, iOS, and many applications, iPhone is a truly integrated system. And only AppleCare+ provides one-stop service and support from Apple experts, so most issues can be resolved in a single call
Carry-in repair4: Take your iPhone to an Apple Store or other Apple Authorized Service provider
Express Replacement Service
AppleCare+ hardware coverage
AppleCare+ provides repair or replacement coverage, both parts and labor, from Apple-authorized technicians. Service coverage includes the following:
Your iPhone
Battery
Included earphones and accessories
Coverage for up to two incidents of accidental damage, each subject to a service fee of $29 for screen damage, or $99 for any other damage, plus applicable tax
Software support included
With AppleCare+ for iPhone, Apple experts can help troubleshoot issues with your iPhone, iOS and iCloud, and Apple-branded apps, including:
Using iOS and iCloud
Questions about Apple-branded iPhone apps such as FaceTime, Mail, and Calendar
Connecting to wireless networks
Purchase AppleCare+ with your new iPhone. Or buy it within 60 days of your iPhone purchase:
Online (requires you to verify your serial number and run a remote diagnostic)
At an Apple Store (inspection of iPhone and proof of purchase are required)
Or call (800) 275-2273 (requires you to run a remote diagnostic and provide proof of purchase)
Whatever you do, don’t decide that your high-interest credit card could serve as a good substitute to all of these interest-free plans. If there’s any industry that’s more frustrating and expensive than mobile carriers, it’s credit cards. | {
"pile_set_name": "Pile-CC"
} |
COLDER Films. From the Ends of the Earth
Small by design, Eric's production credits span from feature length documentaries to branded content. COLDER Films is dedicated to creating
compelling and original stories for your organization through both video and stills.
On Thin Ice: An Epic Final Quest into the Melting Arctic
"This is easily one of the most difficult expeditions in the world. While there have been over 1,500 Mt. Everest summits in the past three years, no one else has
completed a full land to North Pole traverse since 2010." | {
"pile_set_name": "Pile-CC"
} |
Atherton Urban District
Atherton was, from 1863 to 1974, a local government district in Lancashire, England.
History
The township of Atherton historically lay in the large ecclesiastical parish of Leigh and Leigh Poor Law Union formed in 1837.
In 1863 Atherton Local Government District was created when the township adopted the Local Government Act 1858.
A local board was formed to govern the town.
The Local Government Act 1894 added part of the township to Leigh Urban District and reconstituted the rest of the township as an urban district, with Atherton Urban District Council replacing the local board.
The urban district council consisted of fifteen members, elected from five wards—Central, North, East, South, and West.
In 1974 Atherton Urban District was abolished by the Local Government Act 1972 and its former area transferred to Greater Manchester to form part of the Metropolitan Borough of Wigan.
References
External links
Chairs of Atherton Local Board and Urban District, 1864-1974
Category:Districts of England created by the Local Government Act 1894
Category:Districts of England abolished by the Local Government Act 1972
Category:History of Lancashire
Category:History of the Metropolitan Borough of Wigan
Category:Local government in the Metropolitan Borough of Wigan
Category:Urban districts of England
Category:Atherton, Greater Manchester | {
"pile_set_name": "Wikipedia (en)"
} |
1. Introduction {#sec1}
===============
Recently, a growing number of organizations have begun to consider renewable energy and industries related to their production, distribution, and services as opportunities to take rather than regulations \[[@B1]--[@B6]\]. Several factors including Kyoto Protocol, alarming reports from the Intergovernmental Panel on Climate Change (IPCC), and Copenhagen climate change conference (COP15) have contributed to this change in opinion, and many countries believe that the trend will continue such that it is very important for them to immediately prepare for the ''green race." The Algerian government and companies are not exceptions indeed; they have recently intensified their efforts towards promoting the economic growth via supporting green industries. Examples showing such efforts include plans for establishing numerous energy clusters in many areas like the proposed wind farm (project) with a capacity of 10 megawatts launched in Adrar and the hybrid plant in the region of Hassi R\'Mel (Laghouat) built and made operational in February 2011. Similar projects, environmentally friendly and producing clean and renewable energy, are scheduled for the areas of Timimoun and Kunta Zaouiet encouraging the use of renewable energy \[[@B7], [@B8]\].
Electrical energy generation from wind and PV sources is considered as being the most promising renewable energy and is, therefore, to be developed to replace coal, oil, gas, and even nuclear based production. However, any process of transforming energy from one form into another usable form is complex and naturally includes a certain number of economic and environmental features of different kinds (operation of large-scale renewable energy requires space where the resource is available that requires a "good" management planning and the electrical networks will also be adapted and managed so as to promote decentralized production). The obtained technoeconomic and environmental results allow reaching an objective judgment regarding the studied system.
2. Presentation of the Different Systems of Distributed Generation from Renewable Energy {#sec2}
========================================================================================
*Standalone Systems*. For standalone installations, the energy produced employing photovoltaic solar panels or wind generators is either immediately consumed (pumping, ventilation, lighting, refrigerator, etc.) or stored in batteries for later use. The produced current is either directly fed to the consuming equipment or converted using an inverter to supply devices that require AC power \[[@B9], [@B10]\].
*Multisource Hybrid Systems*. These systems supply electricity that is often used at remote sites and are built coupling different sources of production of electrical energy such as wind, solar, and others. They also allow a more reliable supply of electricity. Nearly two billion people are not connected to the utility grid (44% of the world population). Thus, the development of hybrid systems for renewable energy conversion will undoubtedly help to solve many social problems, especially in poor countries, and open up vast commercial markets \[[@B9], [@B11]--[@B14]\].
*Distributed Systems Connected to the Grid*. These are usually medium and large systems which are grid connected \[[@B15]--[@B18]\] and which, in general, produce electrical energy amounts depending on sunshine and wind conditions ([Figure 1](#fig1){ref-type="fig"}).
3. Characteristics of the PV-Wind Systems Considered {#sec3}
====================================================
The architecture presented in [Figure 1](#fig1){ref-type="fig"} is the one upon which this paper is based. With this type of PV-wind system for the generation of electrical energy the objective is to inject into the grid the energy thus generated.
For the design, the power production of the different sources becomes freely controllable without affecting the state values of the grid. Decoupling the state values means that the variations of the renewable resources like the velocity of the wind and the intensity of the solar radiation will not influence the state values of the electrical grid as the harmonics generation, flickers, frequency fluctuation, under voltage, and over voltage. These values are only controlled by the inverter for the photovoltaic generator and by the microprocessor-controlled OptiTip pitch regulation, ensuring continuous and optimal adjustment of the angles of the blades in relation to the prevailing wind, for the wind generator. On the other hand, changes in the loads, which influence the state values of the grid, will not affect the generation side.
A control/management strategy is developed for this architecture to operate it in the highest efficient way. The efficiency here means the most utilization of the renewable energy sources in order to minimize the cost of the produced energy while preserving the reliability of the system.
4. Methodology {#sec4}
==============
4.1. Theoretical Aspect of the Modeling {#sec4.1}
---------------------------------------
### 4.1.1. Modeling of the PV System {#sec4.1.1}
For each hour h in a year, the power delivered by a PV generator *P* ~pv-h~ (W) is described by the IV characteristic which varies with the hourly solar radiation *G* ~h~ and the hourly dry temperature *T* ~h~. This is given, in algebraic form, by $$\begin{matrix}
{I_{\text{pv-h}} = f\left( {V_{\text{ph-h}},G_{\text{h}},T_{\text{h}}} \right).} \\
\end{matrix}$$ Singer model \[[@B19], [@B20]\] has been used and MATLAB-SIMULINK program was developed for this purpose.
*MPPT Algorithm*. In MPPT (maximum power point tracking) operation, the PV array produces maximum power under variable conditions of solar radiation and ambient temperature. The MPPT algorithm which is used in this work is the incremental conductance algorithm (IC). Conductance algorithm is based on the differentiation of PV power and on condition of zero slope of PV curve. The MPPT can be tracked by comparing the incremental conductance *dI* ~pv-h~/*dV* ~pv-h~ to the instantaneous conductance /*V*. Therefore the sign of the quantity *dI* ~pv-h~/*dV* ~pv-h~ + *I* ~pv-h~/*V* ~pv-h~ indicates the correct direction of perturbation leading to the MPPT. When MPPT has been reached, the operation of the PV is held at this point and perturbation is stopped. If a change in *dI* is presented, the algorithm increments or decrements the *V* to track the new MPPT the increment (or decrement) size determines how fast the MPPT is tracked.
When the optimum operation point of PV curve is to the left of the MPPT, we have *dI* ~pv-h~/*dV* ~pv-h~ + *I* ~pv-h~/*V* ~pv-h~≺0 thus a reduction in PV\'s voltage is essential to achieve MPPT.
Similarly, when the optimum point is to the left of the MPPT, we have *dI* ~pv-h~/*dV* ~pv-h~ + *I* ~pv-h~/*V* ~pv-h~≻0; thus an increase in PV\'s voltage is essential to achieve MPPT. Traditionally these changes in PV\'s voltage may be done by coupling a DC/DC converter to PV and controlling properly its duty cycle. In the present study the used DC/DC converter in MPPT is the boost due to easy way of duty cycle control \[[@B21]\].
*Inverter*. In this paper the connection of PV system to the grid takes place in one stage using a voltage source inverter. In [Figure 2](#fig2){ref-type="fig"} we can see that between the PV generator and the inverter only one capacitor exists. Based on the IC algorithm, when the output voltage of PV generator is changed, the MPPT changes simultaneously. For the implementation of IC algorithm directly to the inverter, the switching elements of the inverter must be appropriately pulsed so that every moment the voltage capacitor of the DC bus is equal to the reference voltage which is given by MPPT algorithm (VDC-ref). Therefore, the algorithm brings in the capacitor voltage and the PV\'s current as inputs and the desirable PV\'s voltage (which is capacitors new reference voltage) as output \[[@B21]\].
*Control and Synchronization with the Grid*. In all the power conversion chains, it should be noticed that the inverter output voltages must be synchronized with the distribution grid \[[@B22]\]. For that purpose, we introduced and turned a phase locked loop (PLL) which delivers the angle *θ* = *ωt* mandatory for the Park transformation (translation into the synchronous frame). [Figure 3](#fig3){ref-type="fig"} shows the block diagram of this PLL algorithm. While supplying to the load or the grid a current corresponding to the real power reference, a swing is created between voltages and currents in order to deliver a reactive power according to the command.
A proportional integral controller is used to control the active and reactive power flowing.
### 4.1.2. Modeling of the Wind System {#sec4.1.2}
*Wind Speed Variation with Height \[[@B33]\]*. To calculate the output of the wind turbine in each of the 8760 hours in a year, the hourly values of measured wind speed in the Adrar site at the hub height of the machine is calculated by using $$\begin{matrix}
{v_{\text{hub-h}} = v\frac{\ln\left( {z_{\text{hub}}/z_{0}^{}} \right)}{\ln\left( {z_{\text{data}}/z_{0}} \right)},} \\
\end{matrix}$$ where *z* ~hub~ is the hub height of the wind turbine (m), *z* ~data~ is the anemometer height (m), *z* ~0~ is the surface roughness length (m) \[[@B24]\], and the *v* ~hub-h~ is the wind speed at the anemometer height during the hour h (m/s).
*Dynamic Model*. The types of wind turbine generators may vary from wind generator to wind generator due to different generator types (asynchronous, synchronous), especially the circuitry connecting the wind generator to the three-phase grid which can have two different forms (direct or indirect grid connection).
In the studied case, the generator has been connected directly to the three-phase alternating current grid. The resulting configuration is simple and, according to the literature \[[@B25], [@B26]\], is widely used in practice ([Figure 4](#fig4){ref-type="fig"}).
*Wind Turbine Dynamics Model*. The mechanical power extracted from the wind \[[@B27], [@B28]\] is given by the following relation: $$\begin{matrix}
{P_{t} = \frac{1}{2}\rho^{}{C_{p}}_{}\left( {\lambda_{},\beta} \right)^{}S_{}v^{3},} \\
\end{matrix}$$ with $$\begin{matrix}
{S = \pi_{}R_{t}^{2},} \\
\end{matrix}$$ where *S* is the area swept by the wind in m²; *ρ* is the air density equal at standard conditions 1.294 kg m^−3^; *v* is the wind speed in m/s; *R* ~*t*~ is the radius in m.
The power coefficient *C* ~*p*~ depends on the tip speed ratio (*λ*) and the blade angle (*β*). In the case of turbines without pitch control, the blade angle is constant and *C* ~*p*~ values only depend on those of *λ*, the tip speed ratio being expressed as follows: $$\begin{matrix}
{\lambda = \frac{\Omega_{t}R_{t}}{v}.} \\
\end{matrix}$$ Also, the mechanical torque produced by the wind is expressed in the following relation: $$\begin{matrix}
{T_{t} = \frac{P_{t}}{\Omega_{t}}.} \\
\end{matrix}$$ The VESTAS 47-660 wind generator experimental power output data given by the manufacturer as well as the *C* ~*p*~ curve \[[@B29]\] have been approximated by using a simple MATLAB polynomial interpolation, available as polyfit polynomial function and the obtained correlations are expressed as follows: $$\begin{matrix}
{P_{}\left( v \right) = 4240 - 4727^{}v - 2194_{}v^{2} - 562^{}v^{3}} \\
{+ 88.5_{}v^{4} -_{}8.91^{}v^{5} + 0.585_{}v^{6}} \\
{- 0.0249_{}v^{7} + 6.64 \cdot 10^{- 4}v^{8}} \\
{C_{p}\left( v \right) = 1.1072 - 1.2698v - 0.4931v^{2}} \\
{- 0.00084v^{3} + 0.0781v^{4} - {4.27 \cdot 10}^{- 4}v^{5}} \\
{+ {1.37 \cdot 10}^{- 5}v^{6} - {2.44 \cdot 10}^{- 7}v^{7} + {1.83 \cdot 10}^{- 9}v^{8}.} \\
\end{matrix}$$
Then, the operation of the wind turbine system is simulated using the wind turbine equations which evaluate the mechanical torque (*T* ~*t*~) and requires the turbine angular speed (*Ω* ~*t*~) and the wind speed (*v*) as data.
*Drive Drain Dynamics Model*. To evaluate the generator speed (*Ω* ~am~), the generator torque (*T* ~am~) and the turbine torque (*T* ~*t*~′) are required as data. The dynamic behaviour of the mechanical system is determined by using the classical rotational dynamics equations. The inertia is considered as concentrated in one lumped mass including the contribution of blades, generator shafts, and gear box. The dynamic motion equation of the mechanical system has the following expression: $$\begin{matrix}
{J\frac{d^{}\Omega_{\text{am}}}{dt} + {f_{v}}_{}\Omega_{\text{am}} = T_{t}^{\prime} - T_{\text{am}}.} \\
\end{matrix}$$
The turbine torque and generator speed (*T* ~*t*~′ and *Ω* ~am~) and the mechanical torque and turbine speed (*T* ~*t*~ and *Ω* ~*t*~) supplied to the wind turbine block simulation have been linked by means of the gear box whose ratio is *k* (*k* = 50.5) for the VESTAS 660-47 wind generator.
*Asynchronous Machine Dynamics Model.* The asynchronous machine equations permit to calculate the electrical power generation of the system and return the generator torque *T* ~am~, the active and reactive power. The generator speed *Ω* ~as~ and voltage *V* ~*d*,*q*~ are the required input parameters, obtained by using the Park transform block PT of the three-phase system into the two-phase system \[[@B30]\].
*(a) Electric and Magnetic Equations.* The voltage equations representing an induction machine \[[@B28], [@B31]\] in an arbitrary reference frame can be written, in terms of the phase currents, as given by \[[@B31]\].
In the present model, the stator and rotor voltages along the *d* and *q* axes are given by \[[@B31]\].
Using these last ones, a model for wound rotor generators can be developed. This latter has short circuited windings and, as a consequence, rotor voltages evaluate to zero (*V* ~*dr*~ = 0 and *V* ~*qr*~ = 0) in this case. Therefore, the representative wound rotor generator equations are $$\begin{matrix}
{s\varphi_{ds} = V_{ds} - R_{s}I_{ds} + \omega_{s} \cdot \varphi_{qs}} \\
{s\varphi_{qs} = V_{qs} - R_{s} \cdot I_{qs} - \omega_{s} \cdot \varphi_{ds}} \\
{s\varphi_{dr} = - R_{r} \cdot I_{dr} + \left( {\omega_{s} - \omega_{r}} \right) \cdot \varphi_{qr}} \\
{s\varphi_{qr} = - R_{r} \cdot I_{qr} - \left( {\omega_{s} - \omega_{r}^{}} \right)_{sr} \cdot \varphi_{dr},} \\
\end{matrix}$$ where $$\begin{matrix}
{\varphi_{ds} = L_{s} \cdot I_{ds} + L_{sr} \cdot I_{dr}} \\
{\varphi_{qs} = L_{s} \cdot I_{qs} + L_{sr} \cdot I_{qr}} \\
{\varphi_{dr} = L_{r} \cdot I_{dr} + L_{sr} \cdot I_{ds}} \\
{\varphi_{qr} = L_{r} \cdot I_{qr} + L_{sr} \cdot I_{qs}.} \\
\end{matrix}$$
*(b) Evaluation of the Electromagnetic Torque*. The electromagnetic torque has been calculated by employing ([11](#EEq11){ref-type="disp-formula"}), proposed by \[[@B28], [@B31]\].
Consider $$\begin{matrix}
{T_{\text{am}} = \left( \frac{3}{2} \right)P \cdot L_{sr}\left( {I_{sq} \cdot I_{rq} - I_{sd} \cdot I_{rq}} \right).} \\
\end{matrix}$$
*(c) Evaluation of Real and Reactive Power.* The active (*P*) and reactive (*Q*) power have been calculated by using the following equations: $$\begin{matrix}
\begin{Bmatrix}
{P = V_{ds}I_{ds} + V_{qs}I_{qs}} \\
{Q = V_{qs}I_{ds}^{} - V_{ds}I_{qs}} \\
\end{Bmatrix} \\
\end{matrix}$$ $$\begin{matrix}
{\begin{Bmatrix}
{P_{r} = - \left( V_{dr}I_{dr} + V_{qr}I_{qr} \right)} \\
{Q_{r} = - \left( V_{qr}I_{dr}^{} + V_{dr}I_{qr} \right)} \\
\end{Bmatrix}.} \\
\end{matrix}$$
Using these equations, a model for wound rotor generators can be developed. This type of generator has short circuited windings; thus the corresponding rotor voltages go to zero (*V* ~*dr*~ = 0, *V* ~*qr*~ = 0). Taking into account these conditions, ([13](#EEq13){ref-type="disp-formula"}) give *P* ~*r*~ = 0 and *Q* ~*r*~ = 0.
5. Simulation {#sec5}
=============
The energy system components are photovoltaic modules, wind turbine, grid, and power converter. This study develops a suitable assembly of the key parameters such as photovoltaic array power, wind turbine power curve, battery storage, and converter capacity to match the predefined load. For economic analysis, the cost including the initial capital, replacement cost, and operating and maintenance cost are considered as simulating conditions.
*Photovoltaic Arrays.* The initial cost of photovoltaic arrays may vary from \$4.00 to \$5.00 per watt. Considering a more optimistic system, the costs of installation, replacement, and maintenance of a 1 kW solar energy system are taken as \$5000 and \$4000. Sizes of the photovoltaic arrays are varied between 0, 100, 200, 300, 400, 500, 600, and 700 kW.
*Wind Turbine*. Energy generation form wind turbine depends on wind speed variations. The wind turbine rated power should be greater than average electrical load. Therefore, according to the load data discussed above, the average load is around a 7.7 MW. Therefore, a VESTAS 47--660 turbine manufactured by VESTAS wind power is used. Its rated power is 660 kW AC.
*Grid*. Grid exists as the main power component in this hybrid renewable energy system. Moreover, grid has the functions as a storage system, so a grid power system does not need a battery.
*Power Converter*. A converter is required for systems in which DC components serve an AD load or vice versa. For a 1 kW system the installation and replacement costs are taken as \$800 and \$750, respectively. Lifetime of a unit is considered to be 25 years with an efficiency of 90%.
For the considered system, it is necessary to simulate, during all the hours in a complete year, all the possible designs. Variables are considered hourly, and, therefore, there will be 8760 in a year. At the end of the simulation, we will know the quantity of electrical energy from a PV generator injected to the grid in the year and the electrical energy from wind turbines that is also injected \[[@B33]\].
As a sample site, the Adrar site has been chosen and the following data are used as input:the hourly global and diffuse radiation measured on a horizontal plane and the ambient temperature. From the data collected on a horizontal plane, the components of the solar irradiance have been projected onto the surface of a PV panel. Moreover, the inclination of the used solar panel corresponds to the yearly optimum slope as indicated in \[[@B34]\];the measured wind speeds and the electromechanical characteristics of a wind turbine, of the VESTAS 47--660 type. This is a three-blade model with a diameter of 46 m, a speed multiplier ratio of 50.5 and a hub height of 100 m \[[@B29]\]. Moreover, the power produced by this wind turbine has been calculated using the power curve ([Figure 5](#fig5){ref-type="fig"}), provided by the manufacturer.
5.1. Power Produced by the Photovoltaic Generator {#sec5.1}
-------------------------------------------------
For calculating the output characteristics of the photovoltaic system, a program has been developed which requires the global incident radiation and the air temperature as main input data. So, the research unit in renewable energy U.R.E.R. of Adrar provided hourly measured values over a full year of global and diffuse irradiation on a horizontal plane together with those related to the ambient temperature. From the global radiations on the horizontal plane collected data and based on the equations given in \[[@B20]\], the developed program calculates the overall incident irradiations on the surface of the PV panel. These latter and the ambient temperatures are used to calculate the power and current delivered by the PV generator.
The obtained results are presented in [Figure 6](#fig6){ref-type="fig"}.
5.2. Power Produced by the Wind Generator {#sec5.2}
-----------------------------------------
Generally, to calculate the power generated by a wind turbine, we use the data drawn from the main characteristic *p* = *f*(*v*) related to the turbine and supplied by the manufacturer ([Figure 5](#fig5){ref-type="fig"}). In this study, using the equations given in \[[@B32]\], the hourly values of the wind turbine are read from a file in which the wind speed for each hour of the year is given.
By using the power curve of the wind turbine, the output power is calculated. With the speed at the hub of the wind turbine, and using its power curve, the power that the wind turbine provides in an hour h, *p* ~w-h~ (W) is obtained. If there are *N* ~*w*~ wind turbine connected in parallel, this amount is multiplied by *N* ~*w*~ \[[@B33]\]. The obtained results are as follows:[Figure 7(a)](#fig7){ref-type="fig"} shows the evolution of hourly wind speeds;[Figure 7(b)](#fig7){ref-type="fig"} shows the plots of the active power developed at the asynchronous machine terminals;[Figure 7(c)](#fig7){ref-type="fig"} shows the plots of the reactive power developed at the asynchronous machine terminals;[Figure 7(d)](#fig7){ref-type="fig"} shows the current delivered by the wind generator.
5.3. Management of the System \[[@B33]\] {#sec5.3}
----------------------------------------
[Figure 8](#fig8){ref-type="fig"} presents the MATLAB-SIMULINK program diagram of the hybrid system. In this system the power delivered by each of the system devices (PV or wind) should be managed in such a way that the surplus of power produced by any of them is conducted to the grid without giving rise to any phenomena leading to a disturbance of any of these devices. These last ones disturbed by generating harmonics that may distort the grid waveform, flickers, high frequency wave, frequency fluctuation, under voltage, and over voltage.
Thus, for each hour of the year h, the amount of electrical energy available at the transformer connected to the grid is evaluated by \[[@B33]\] $$\begin{matrix}
{P_{\text{AC-h}} = \left( {P_{\text{pv-h}}\eta_{\text{INV}} + P_{\text{w-h}}} \right)^{}\eta_{\text{TR}},} \\
\end{matrix}$$ where *η* ~INV~ is the inverter efficiency rate, modeled as a variable depending on the power delivered by the inverter, *η* ~TR~ is the efficiency rate of the transformer connected to the electrical grid, including the losses of power in the transmission lines, *P* ~w-h~ is the power (W) generated by the wind generator within an hour time, and *P* ~pv-h~ is the power (W) generated by the PV generator within an hour time.
However, the amount of power that can be injected each hour into the grid, *P* ~EE-h~ (W), cannot be higher than the allowed evacuation capacity at the point of connection to the grid, *P* ~MAX-GRID~ (W) \[[@B33]\]: $$\begin{matrix}
{P_{\text{EE-h}} = \min\left( {P_{\text{MAX-GRID}},P_{\text{AC-h}}} \right),} \\
\end{matrix}$$ Where *P* ~MAX-GRID~ (W) is the maximum power evacuation value allowed, which the Algerian law fixes for 20 to 30% of the line thermal limit at the point of connection.
The amount of energy to be injected into the grid obtained from the PV generator (*P* ~EE-PV-h~) and the wind generator *P* ~EE-w-h~ will be calculated as indicated by [Figure 9](#fig9){ref-type="fig"}.
The results obtained in the case of the previously described scenario are represented in [Figure 10](#fig10){ref-type="fig"} which shows that the hourly produced power injected into the grid is lower than *P* ~MAX-GRID~.
5.4. Total Annual Production {#sec5.4}
----------------------------
The contribution of each part of the hybrid system (PV-wind-grid) to satisfy a specific load of the 34,815 MWh/yr is shown in [Figure 11](#fig11){ref-type="fig"}. It is to be noted that the PV generator produces only 365 MWh/year and covers only 1% of the load. The wind generator, in turn, produces 7,225 MWh/year which constitute nearly 21% of load requirements against a covered load rate of 78% (27,225 MWh/year) provided by the conventional electricity grid \[[@B35]\]. These results are explained by the fact that HOMER software promotes the wind system because of it\'s efficiency which is very higher than that of PV system.
5.5. Hours of Operation {#sec5.5}
-----------------------
[Figure 12](#fig12){ref-type="fig"} represents the duration of the operation (in hours) of each of the renewable energy equipment of the hybrid PV-wind-Grid system. It is found that the wind generator works over the longest time interval with a 48% rate of the total period, followed by the PV generator and inverter with a rate of 26% for each.
5.6. Economic Aspects {#sec5.6}
---------------------
The HOMER optimization model \[[@B33]\] uses relatively simple strategies based on the ones studied by Barley et al. \[[@B36]\] and it is able to obtain an optimal design of a hybrid system by selecting the most appropriate strategy.
Thus, from an economic point of view, it is found that the system composed of a 200 kW rated PV system and three 660 kW rated wind turbines can cover 22% of the electrical energy demand and has a net present cost (NPC) of \$177 million and a cost of energy per kilowatt hour (COE) of \$0.399/kWh. A comparative economic analysis between the conventional and the optimized system (PV-wind system) employing HOMER software package \[[@B35]\] has been performed and the results are presented in [Table 1](#tab1){ref-type="table"}. From these results, it is noticed that the hybrid system (PV-wind-grid) is more economical than the conventional system if the price per produced kWh of the latter is set to \$0.4/kWh. However, the net present cost is calculated for a project lifetime period of 25 years and on the basis of an interest rate of 6%. Figures [13](#fig13){ref-type="fig"} and [14](#fig14){ref-type="fig"} show the details of the corresponding costs to each of the systems and the related annual costs \[[@B37]\].
5.7. Environmental Aspects {#sec5.7}
--------------------------
The results regarding the effects of each system configuration, that is, the conventional grid and the hybrid system (PV-wind-grid), on the environment obtained by again using HOMER software in the case of the Adrar site are shown in [Table 2](#tab2){ref-type="table"} \[[@B37]\]. In this table the quantities of the main gases that are harmful to the environment including CO~2~, SO~2~, and NO~*x*~ are presented. From these results, it is found that the PV-wind-grid hybrid system produces a reduction in the carbon dioxide gas, sulfur dioxide, and nitrogen oxide rates by, respectively, 20%, 22%, and 22% as compared to the quantities produced by the conventional system \[[@B37]\].
5.8. Sensitivity Results {#sec5.8}
------------------------
In this study, sensitivity analysis was done to study the effects of variation in the solar irradiation and wind speed. The simulation software simulates the long-term implementation of the hybrid system based on their respective search size for the predefined sensitivity values of the components. The emissions, renewable fraction, NPC, and COE are simulated based on the three sensitivity variables: wind speed (m/s), solar irradiation (kW/m^2^/day), and grid electricity price (\$/kWh). A long-term simulation for every possible system combination and configuration was done for a one year period (from January 1st 2005 to December 31st 2005). In the present case, solar irradiation is set as sensitivity variables: *G* = 3.5, 4.5, 5, 5.5, 5.72, 7.8, 8 kW/m^2^/day, while wind speed are *v* = 6.9, 7, 7.5, 7.8, 8, 8.8 m/s. Moreover, the grid electricity price is also defined as a sensitivity variable (*p* = 0.1, 0.2, 0.3, 0.4 \$/kWh). A total of 192 sensitivity cases were tried for each system configuration. The simulation time was 23 minutes and 46 seconds on a personal computer with Intel CORE Intel Core Duo Processor of 2.53 GHz and a RAM of 2 GB. The sensitivity results in terms of solar irradiation, wind speed, and grid electricity price analyze the feasibility of each system. Here the feasibility of hybrid renewable energy system is analyzed based on emission reduction and cost saving. This type of sensitivity analysis of the systems provides information that a particular system would be optimal at certain sensitivity variables \[[@B18]\]. The PV-wind system is feasible when the grid electricity price is more than \$0.4 kW/h. Under this condition, the RF can be between 0.21 and 0.22. A PV-wind system is feasible when global solar irradiation is more than 5.72 kWh/m^2^ per day and the grid electricity price is more expensive than \$0.4 kWh. Based on the optimization results, wind energy production shows a bigger proportion of energy generation than solar. While the solar power occupies less than 1% of the total energy generation, wind power occupies approximately a quarter.
Therefore, the wind energy resource has more impact on the implementation. Figures [15](#fig15){ref-type="fig"}--[18](#fig18){ref-type="fig"} reflect the cost, renewable fraction, and emission variation dependent on the sensitivity variable wind speed. The NPC and COE of the hybrid power system reduce when the wind speed increases from 6.9 m/s to 8.8 m/s, [Figure 15](#fig15){ref-type="fig"}.
Simultaneously, as seen in [Figure 16](#fig16){ref-type="fig"}, renewable fraction rises sharply from 0 to 16% (when wind speed increases from 6.9 to 7 m/s) and then steadily increases to 24% at a slower rate. In addition, as shown in Figures [17](#fig17){ref-type="fig"} and [18](#fig18){ref-type="fig"}, the main emissions of carbon dioxide, sulfur dioxide, and nitrogen oxide persistently decrease 22%.
6. Problems Encountered in Decentralized Systems \[[@B37]\] {#sec6}
===========================================================
The major difficulty associated with decentralized energy sources is that they generally do not participate in ancillary services (voltage control, frequency, ability to operate in standalone mode, etc.). This is especially true for renewable energy sources whose power flow is unpredictable and very volatile. The integration of decentralized energy generation into power networks raises the following problems:random and unpredictable energy production (wind, solar);lack of power-frequency control;no voltage adjustment performed;sensitivity to voltage dips;significant sensitivity to changes in primary source (wind, solar) energy levels.
The failure to take part in system services makes this type of sources behave as passive generators, from the electrical energy generation point of view. The penetration of distributed energy generation must be limited from 20 to 30% of the consumed power in order to guarantee acceptable system stability \[[@B18]\].
7. Conclusion {#sec7}
=============
This study is related to the technical, economic, and environmental impact of grid-connected decentralized systems to which an appropriate management of energy is applied and by means of which are developed models of the different parts. The solar and wind energy resource data are collected from the weather station of Adrar which is a typical arid region. The most significant results are as follows.
The power that any subsystem can deliver depends on the weather conditions of the considered site.
The PV based system only covers 1% of the total load consumption. On the other hand, the wind generator contribution amounts to about 21% of the energy production while the remaining 78% are supplied by the conventional electricity grid.
From an economic point of view, it is found that for the Adrar site, which is characterized by a high wind potential, the hybrid system is competitive compared with the conventional system with a cost of the energy COE produced by the network equal to \$0.4/kWh since the estimated COE related to the hybrid system is equal to \$0,399/kWh, based on an average wind speed greater than or equal to 6 m/s.
From an environmental standpoint, the rates of greenhouse gases (CO~2~, SO~2~, and NO~*x*~) emissions are reduced from 20 to 22% in the case of a hybrid system, compared with the conventional system.
The sensitivity analysis indicates that PV-wind hybrid system is feasible under the meteorological conditions in Adrar region. With the increasing wind speed, the NPC, COE, and emissions of the hybrid renewable energy system reduce, and renewable fraction grows up.
Conflict of Interests
=====================
None of the authors of this paper has a financial or personal relationship with other people or organisations that could inappropriately influence or bias the content of the paper.
{#fig1}
![Schematic diagram of a connected PV-grid \[[@B23]\].](TSWJ2013-123160.002){#fig2}
{#fig3}
{#fig4}
{#fig5}
{#fig6}
{#fig7}
{#fig8}
{#fig9}
{#fig10}
{#fig11}
{#fig12}
{#fig13}
{#fig14}
{#fig15}
{#fig16}
{#fig17}
{#fig18}
######
Cost comparison between a standard system (grid) and a hybrid system (PV-wind-grid).
Cost Conventional system grid Hybrid system PV-wind-grid
-------------- -------------------------- ----------------------------
NPC (\$/yr) 177,714,200 177,090,600
COE (\$/kWh) 0.4 0.399
######
Emissions comparison between a standard system (grid) and a hybrid system (PV-wind-grid).
Pollutant Kg/yr Conventional system grid Hybrid system PV-wind-grid
----------------- -------------------------- ----------------------------
CO~2~ 21,965,160 17,199,524
SO~2~ 95,229 74,568
NO~X~ 46,572 36,467
[^1]: Academic Editors: N. F. Atta, M. Q. Fan, and M. Yari
| {
"pile_set_name": "PubMed Central"
} |
Gene--environment interactions influence feeding and anti-predator behavior in wild and transgenic coho salmon.
Environmental conditions are known to affect phenotypic development in many organisms, making the characteristics of an animal reared under one set of conditions not always representative of animals reared under a different set of conditions. Previous results show that such plasticity can also affect the phenotypes and ecological interactions of different genotypes, including animals anthropogenically generated by genetic modification. To understand how plastic development can affect behavior in animals of different genotypes, we examined the feeding and risk-taking behavior in growth-enhanced transgenic coho salmon (with two- to threefold enhanced daily growth rates compared to wild type) under a range of conditions. When compared to wild-type siblings, we found clear effects of the rearing environment on feeding and risk-taking in transgenic animals and noted that in some cases, this environmental effect was stronger than the effects of the genetic modification. Generally, transgenic fish, regardless of rearing conditions, behaved similar to wild-type fish reared under natural-like conditions. Instead, the more unusual phenotype was associated with wild-type fish reared under hatchery conditions, which possessed an extreme risk averse phenotype compared to the same strain reared in naturalized conditions. Thus, the relative performance of genotypes from one environment (e.g., laboratory) may not always accurately reflect ecological interactions as would occur in a different environment (e.g., nature). Further, when assessing risks of genetically modified organisms, it is important to understand how the environment affects phenotypic development, which in turn may variably influence consequences to ecosystem components across different conditions found in the complexity of nature. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
how to profile a statement used in a method in java
I know how to profile methods in netbeans to see which one is taking the most time, but I wonder if there is a way to find which line of statements in that method is responsible for that.
A:
Best commercial tools you can use (with a 30 days trial) is Yourkit java profiler which lets you know lots of details about your code , slow methods,dead locks,....
There a also some other profilers like Jprofiler which I did not use personally
and as free,easy to use you can take a look at java visualvm which comes with JDK 6 and higher.
| {
"pile_set_name": "StackExchange"
} |
1. Field of the Invention
The present invention relates to a glove interface object and associated methods and systems.
2. Description of the Related Art
The video game industry has seen many changes over the years. As computing power has expanded, developers of video games have likewise created game software that takes advantage of these increases in computing power. To this end, video game developers have been coding games that incorporate sophisticated operations and mathematics to produce a very realistic game experience.
Example gaming platforms, may be the Sony Playstation®, Sony Playstation2® (PS2), Sony Playstation3® (PS3), and Sony Playstation4® (PS4), each of which is sold in the form of a game console. As is well known, the game console is designed to connect to a monitor (usually a television) and enable user interaction through handheld controllers. The game console is designed with specialized processing hardware, including a CPU, a graphics synthesizer for processing intensive graphics operations, a vector unit for performing geometry transformations, and other glue hardware, firmware, and software. The game console is further designed with an optical disc tray for receiving game compact discs for local play through the game console. Online gaming is also possible, where a user can interactively play against or with other users over the Internet. As game complexity continues to intrigue players, game and hardware manufacturers have continued to innovate to enable additional interactivity and computer programs.
A growing trend in the computer gaming industry is to develop games that increase the interaction between the user and the gaming system. One way of accomplishing a richer interactive experience is to use wireless game controllers whose movement is tracked by the gaming system in order to track the player's movements and use these movements as inputs for the game. Generally speaking, gesture input refers to having an electronic device such as a computing system, video game console, smart appliance, etc., react to some gesture made by the player and captured by the electronic device.
Another way of accomplishing a more immersive interactive experience is to use a head-mounted display. A head-mounted display is worn by the user and can be configured to present various graphics, such as a view of a virtual space. The graphics presented on a head-mounted display can cover a large portion or even all of a user's field of view. Hence, a head-mounted display can provide a visually immersive experience to the user.
Another growing trend in the industry involves the development of cloud-based gaming systems. Such systems may include a remote processing server that executes a game application, and communicates with a local thin client that can be configured to receive input from users and render video on a display.
It is in this context that embodiments of the invention arise. | {
"pile_set_name": "USPTO Backgrounds"
} |
Q:
Number theory textbook based on the absolute Galois group?
I've just finished reading Ash and Gross's Fearless Symmetry, a wonderful little pop mathematics book on, among other things, Galois representations. The book made clear a very interesting perspective that I wasn't aware of before: that a large chunk of number theory can be thought of as a quest to understand $G = \text{Gal}(\overline{\mathbb{Q}}/\mathbb{Q})$. For example, part of the reason to study elliptic curves is to describe two-dimensional representations of $G$, and reciprocity laws are secretly about ways to describe the traces of Frobenius elements in various representations. (That's awesome! Why didn't anybody tell me that before?)
Are there number theory textbooks (presumably not introductory, but hopefully not too sophisticated either) which explicitly take this as a guiding principle? I think this is a great idea to organize things like quadratic reciprocity around and I'm wondering if anybody has decided to actually do that at the undergraduate (or introductory graduate, maybe) level.
Edit: In response to some comments and at least one downvote, most of the other questions on MO about the absolute Galois group that I can find are about the state of the art, and the references in them seem fairly sophisticated. But it seems to me there are still interesting things to say along the lines of Fearless Symmetry, but directed to an undergraduate or introductory graduate-level audience as a kind of "second course in number theory." I'm imagining a textbook like Serre's Course in Arithmetic.
A:
If you want to go further in understanding this point of view, I would advise you to begin learning class field theory. It is a deep subject, it can be understood in a vast variety of ways, from the very concrete and elementary to the very abstract, and although superficially it appears to be limited to describing abelian reciprocity laws, it in fact plays a crucial role in the study of non-abelian reciprocity laws as well.
The texts:
Ireland and Rosen for basic algebraic number theory, a Galois-theoretic proof
of quadratic reciprocity, and other assorted attractions.
Cox's book on primes of the form x^2 + n y^2 for an indication of what some of the content of class field theory is in elementary terms, via many wonderful examples.
Serre's Local Fields for learning the Galois theory of local fields
Cassels and Frolich for learning global class field theory
The standard book at the graduate level to learn the arithmetic of non-abelian (at least 2-dimensional) reciprocity laws is Modular forms and Fermat's Last Theorem, a textbook on the proof by Taylor and Wiles of FLT. But it is at a higher level again.
I don't think that you will find a single text on this topic at a basic level (if basic
means Course in arithmetic or Ireland and Rosen), because there is not much to say beyond what you stated in your question without getting into the theory of elliptic curves and/or the theory of modular forms and/or a serious discussion of class field theory.
Also, as basic suggests, you could talk to the grad students in your town, if not at your institution, then at the other one down the Charles river, which as you probably know is currently the world centre for research on non-abelian reciprocity laws (maybe shared with Paris). Certainly there are grad courses offered on this topic there on a regular basis.
A:
In the 1-dimensional case we are talking about class field theory, and I can't recall having seen anything better than Cox's book (already mentioned by Emerton) in this direction (undergrad etc.). With Artin's reciprocity law (the central role of the Frobenius elements in connection with reciprocity laws wasn't exactly kept secret 8-) under your belt you might want to check out
G. Shimura, A reciprocity in law in non-solvable extensions,
J. Reine Angew. Math. 221, 209-220 (1966)
and
J. Velu, Lois de reciprocite liees aux courbes elliptiques,
Semin. Delange-Pisot-Poitou, 14e annee 1972/73, Fasc. 1, 2, Expose 9, 5 p. (1973)
both of which are rather nice to read, and then continue with the articles by Serre and Swinnerton-Dyer that Emerton suggested (actually they were motivated by concrete problems concerning Ramanujan's $\tau$-function, and they've written quite a bit about it at the time).
| {
"pile_set_name": "StackExchange"
} |
PM05391: UPDATE TO VERSION TZDATA2010A OF THE OLSON DATABASE
Subscribe
APAR status
Closed as program error.
Error description
Error Message: N/A
.
Stack Trace: N/A
.
Local fix
Problem summary
The Olson timezone database is frequently updated.
Problem conclusion
This defect will be fixed in:
1.4.2 SR13 FP5
5.0.0 SR11 FP1
.
The JVM has been updated to conform to the latest version,
tzdata2010a, of the Olson timezone database.
.
To obtain the fix:
Install build 20100121 or later
.
The following timezones are affected:
Asia/Dhaka | {
"pile_set_name": "Pile-CC"
} |
Q:
how to do 301 redirect to multiple pages
i have two websites,
both websites contains few pages, and wordpress blog, please following structure
www.firstwebsite.com
-Root
-index.html
-about.html
-Blog
-blog page1
-blog page2
www.secondwebsite.com
-Root
-index.html
-about.html
-Blog
-blog page1
-blog page2
now, I want to redirect all the blog pages (i.e. pages under blog folder) of www.firstwebsite.com to the www.secondwebsite.com/blog, using htaccess 301 redirect.
I know i can redirect like
Redirect 301 /a.html www.secondwebsite.com/blog
Redirect 302 /b.html www.secondwebsite.com/blog
but if there any simple way, so i can redirect all pages by writing just line in .htaccess file, as destination for all the pages is same
A:
Use a RewriteRule for this
RewriteEngine On
# If the hostname for this request matches www.firstwebsite.com...
RewriteCond %{HTTP_HOST} ^www\.firstwebsite\.com$ [NC]
# Redirect all requests in Blog/ to the equivalent on www.secondwebsite.com
RewriteRule Blog/(.*) http://www.secondwebsite.com/Blog/$1 [L,R=301,QSA]
RewriteCond is a conditional match on the request's hostname. So above, we're only applying the rewrite to requests matching www.firstwebsite.com. The [NC] on the end makes it a case-insensitive match.
The RewriteRule uses the expression Blog/(.*) to match all requests to the Blog directory, capturing everything after / in a match group. The request is then rewritten into www.secondwebsite.com/Blog using the match from the request (.*) as $1, so the whole request comes out identically in www.secondwebsite.com.
| {
"pile_set_name": "StackExchange"
} |
Investigate Chris Dodd and the MPAA for bribery - palebluedot
https://wwws.whitehouse.gov/petitions#!/petition/investigate-chris-dodd-and-mpaa-bribery-after-he-publicly-admited-bribing-politicans-pass/DffX0YQv
======
mMark
20,000+ votes and counting!
| {
"pile_set_name": "HackerNews"
} |
Enhancement of battery performance is an important issue in the advancement of portable electronics, power grid regulation, and electrified vehicles. Rechargeable or secondary batteries generally include positive and negative electrodes, a separator, and an electrolyte. Current collectors are attached to each electrode in order to extract current from the battery. Rechargeable batteries, such as lithium-ion batteries, have not yet attained the necessary specifications in energy density and rate capability that are needed to make long-range electric vehicles (EVs) a viable option for many consumers. The relatively limited porosity of the electrodes, low specific capacities of cathode materials, and added weight from battery components are significant factors in these short comings. | {
"pile_set_name": "USPTO Backgrounds"
} |
Thousands of Canadians came together to loudly denounce the Conservative government’s proposed anti-terror legislation in dozens of rallies held across the country on Saturday.
At Jarry Park, a few dozen of the hundreds of demonstrators taped their mouths shut in protest of the bill, which opponents say would allow the government to stifle protest and dissent. As they marched toward the office of Liberal leader Justin Trudeau, many of the large contingent waved signs bearing messages such as “Stop Harper,” and “Activism is not a crime.”
The Conservative government introduced the legislation, known as Bill C-51, in January.
The wide-ranging bill would give police much broader powers and allow them to detain terror suspects and give new powers to Canada’s spy agency.
The organizers of the nationwide protest say the bill would infringe upon Canadians’ civil liberties and right to privacy, especially online.
Groups such as Amnesty international have also argued that the bill’s powers to limit “threats to the security of Canada” are too broad and may allow the government to shut down legitimate dissenters and protest groups who do not go through official channels.
In Montreal, the demonstrators were joined by New Democratic party leader Thomas Mulcair, who climbed onto a milk crate and reiterated his intention to vote against the bill.
“C-51 is a bill that could seriously endanger our right to protest peacefully, to stand up against a government or an infrastructure or an economic policy,” he said. “Mr Harper has never been able to give a single example of why this bill is necessary.”
Protesters also directed criticism at Trudeau, shouting “Harper terrorist, Trudeau complicit,” as they marched toward the Liberal leader’s constituency office. Trudeau has said that his party will support Bill-C51.
NDP Leader Thomas Mulcair.
Protesters demonstrate on a national day of action against Bill C-51, the government’s proposed anti-terrorism legislation, in Montreal, Saturday, March 14, 2015.
Protesters demonstrate to protest on a national day of action against Bill C-51, the government’s proposed anti-terrorism legislation, in Montreal, Saturday, March 14, 2015.
A young boy demonstrates to protest on a national day of action against Bill C-51, the government’s proposed anti-terrorism legislation, in Montreal, Saturday, March 14, 2015.
Protesters demonstrate to protest on a national day of action against Bill C-51, the government’s proposed anti-terrorism legislation, in Montreal, Saturday, March 14, 2015.
Protesters demonstrate to protest on a national day of action against Bill C-51, the government’s proposed anti-terrorism legislation, in Montreal, Saturday, March 14, 2015.
Protesters demonstrate to protest on a national day of action against Bill C-51, the government’s proposed anti-terrorism legislation, in Montreal, Saturday, March 14, 2015.
In Vancouver, a crowd of about 700 to 800 people according to a police estimate gathered in front of the city’s art gallery. Aboriginal leaders and civil liberties groups spoke to the crowd through a megaphone, while onlookers cheered and waved signs.
Protester Larry Johnny said he feared that First Nations protesting mines in the province could be labelled “terrorists” for speaking out if the bill is passed.
“These rights affect me today, but they’re also going to affect my grandnephews and nieces,” he said. “I’m here for them, because they’re the ones that are going to be growing up with these bills.”
The Conservative government has said that the bill will make Canadians safer and give police and security forces the tools they need to meet terrorist threats.
But many of Saturday’s protesters remained unconvinced by the government’s assurances that the bill would not infringe upon Canadians’ civil liberties and right to protest.
“I’m really worried about democracy, this country is going in a really bad direction,” said Toronto protester Stuart Basden.“Freedom to speak out against the government is probably at jeopardy … Even if you’re just posting stuff online you could be targeted, so it’s a really terrifying bill.”
This Week's Flyers
Comments
We encourage all readers to share their views on our articles and blog posts. We are committed to maintaining a lively but civil forum for discussion, so we ask you to avoid personal attacks, and please keep your comments relevant and respectful. If you encounter a comment that is abusive, click the "X" in the upper right corner of the comment box to report spam or abuse. We are using Facebook commenting. Visit our FAQ page for more information. | {
"pile_set_name": "Pile-CC"
} |
/* Copyright 2009-2020 David Hadka
*
* This file is part of the MOEA Framework.
*
* The MOEA Framework is free software: you can redistribute it and/or modify
* it under the terms of the GNU Lesser General Public License as published by
* the Free Software Foundation, either version 3 of the License, or (at your
* option) any later version.
*
* The MOEA Framework is distributed in the hope that it will be useful, but
* WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY
* or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public
* License for more details.
*
* You should have received a copy of the GNU Lesser General Public License
* along with the MOEA Framework. If not, see <http://www.gnu.org/licenses/>.
*/
package org.moeaframework.analysis.sensitivity;
import java.io.File;
import java.io.IOException;
import java.util.ArrayList;
import java.util.List;
import org.apache.commons.cli.CommandLine;
import org.apache.commons.cli.Option;
import org.apache.commons.cli.OptionGroup;
import org.apache.commons.cli.Options;
import org.moeaframework.core.EpsilonBoxDominanceArchive;
import org.moeaframework.core.NondominatedPopulation;
import org.moeaframework.core.Problem;
import org.moeaframework.core.spi.ProblemFactory;
import org.moeaframework.util.CommandLineUtility;
import org.moeaframework.util.TypedProperties;
/**
* Command line utility for merging the approximation sets in one or more result
* files across the seeds. For example, if {@link Evaluator} was run with 25
* different seeds and 100 different parameterizations, then each of the 25
* output files (from each seed) will contain 100 records. This command
* produces a single file with 100 records, where each record is produced by
* combining the approximation sets for that record across all seeds.
* <p>
* Usage: {@code java -cp "..." org.moeaframework.analysis.sensitivity.ResultFileSeedMerger <options> <files>}
* <p>
* Arguments:
* <table border="0" style="margin-left: 1em">
* <tr>
* <td>{@code -b, --problem}</td>
* <td>The name of the problem. This name should reference one of the
* problems recognized by the MOEA Framework.</td>
* </tr>
* <tr>
* <td>{@code -d, --dimension}</td>
* <td>The number of objectives (use instead of -b).</td>
* </tr>
* </tr>
* <tr>
* <td>{@code -o, --output}</td>
* <td>The output file where the extract data will be saved.</td>
* </tr>
* <tr>
* <td>{@code -e, --epsilon}</td>
* <td>The epsilon values for limiting the size of the results. This
* epsilon value is also used for any algorithms that include an
* epsilon parameter.</td>
* </tr>
* </table>
*/
public class ResultFileSeedMerger extends CommandLineUtility {
/**
* Constructs the command line utility for merging the approximation sets
* in one or more result files across the seeds.
*/
public ResultFileSeedMerger() {
super();
}
@Override
public Options getOptions() {
Options options = super.getOptions();
OptionGroup group = new OptionGroup();
group.setRequired(true);
group.addOption(Option.builder("b")
.longOpt("problem")
.hasArg()
.argName("name")
.build());
group.addOption(Option.builder("d")
.longOpt("dimension")
.hasArg()
.argName("number")
.build());
options.addOptionGroup(group);
options.addOption(Option.builder("o")
.longOpt("output")
.hasArg()
.argName("file")
.required()
.build());
options.addOption(Option.builder("e")
.longOpt("epsilon")
.hasArg()
.argName("e1,e2,...")
.build());
return options;
}
/**
* Returns all non-dominated approximation sets in the specified result
* file.
*
* @param file the result file
* @param problem the problem
* @return all non-dominated approximation sets in the specified result
* file
* @throws IOException if an I/O error occurred
*/
private List<NondominatedPopulation> load(File file, Problem problem)
throws IOException {
ResultFileReader reader = null;
try {
reader = new ResultFileReader(problem, file);
List<NondominatedPopulation> data =
new ArrayList<NondominatedPopulation>();
while (reader.hasNext()) {
data.add(reader.next().getPopulation());
}
return data;
} finally {
if (reader != null) {
reader.close();
}
}
}
@Override
public void run(CommandLine commandLine) throws Exception {
List<List<NondominatedPopulation>> entries =
new ArrayList<List<NondominatedPopulation>>();
Problem problem = null;
ResultFileWriter writer = null;
try {
// setup the problem
if (commandLine.hasOption("problem")) {
problem = ProblemFactory.getInstance().getProblem(commandLine
.getOptionValue("problem"));
} else {
problem = new ProblemStub(Integer.parseInt(commandLine
.getOptionValue("dimension")));
}
// load data from all input files
for (String filename : commandLine.getArgs()) {
entries.add(load(new File(filename), problem));
}
// validate the inputs
if (entries.isEmpty()) {
throw new IllegalArgumentException(
"requires at least one file");
}
int numberOfEntries = -1;
for (int i = 0; i < entries.size(); i++) {
if (numberOfEntries < 0) {
numberOfEntries = entries.get(i).size();
} else if (numberOfEntries != entries.get(i).size()) {
throw new IllegalArgumentException(
"unbalanced number of entries: "
+ commandLine.getArgs()[i]);
}
}
// process and output the merged sets
try {
writer = new ResultFileWriter(problem, new File(
commandLine.getOptionValue("output")));
for (int i = 0; i < numberOfEntries; i++) {
NondominatedPopulation mergedSet = null;
// configure epsilon-dominance
if (commandLine.hasOption("epsilon")) {
double[] epsilon = TypedProperties.withProperty(
"epsilon", commandLine.getOptionValue(
"epsilon")).getDoubleArray("epsilon", null);
mergedSet = new EpsilonBoxDominanceArchive(epsilon);
} else {
mergedSet = new NondominatedPopulation();
}
for (int j = 0; j < entries.size(); j++) {
mergedSet.addAll(entries.get(j).get(i));
}
writer.append(new ResultEntry(mergedSet));
}
} finally {
if (writer != null) {
writer.close();
}
}
} finally {
if (problem != null) {
problem.close();
}
}
}
/**
* Starts the command line utility for merging the approximation sets in one
* or more result files across the seeds.
*
* @param args the command line arguments
* @throws Exception if an error occurred
*/
public static void main(String[] args) throws Exception {
new ResultFileSeedMerger().start(args);
}
}
| {
"pile_set_name": "Github"
} |
Association of low-density lipoprotein particle size and ratio of different lipoproteins and apolipoproteins with coronary heart disease.
Worldwide coronary heart disease (CHD) is estimated to be the leading cause of death. Current knowledge about prevention of CHD is mainly derived from developed countries. Therefore, this study aimed to find out the association of CHD with ratios of different lipoproteins and apolipoproteins, LDL particle size, as well as different traditional risk factors in Asian Indian population in Eastern part of India. Case-control study of 100 patients with CHD and 98 healthy controls were age and sex matched. After clinical evaluation, blood samples were collected for biochemical assays. Multivariate logistic regression analysis found apoB (OR 2.96; 95% CI 1.02-8.54), apoB/HDL-c (OR 4.14; 95% CI 1.33-12.83), nonHDL-c (OR 5.41; 95% CI 2.08-14.10), apoB/apoAI (OR 6.64; 95% CI 2.37-18.57), and LDL particle size (9.59; 95% CI 2.92-31.54) were independently associated with CHD. Area under the ROC curves derived from the model (AUROC 0.947; 95% CI 0.916-0.977) are significantly higher than any other variables. Findings from the multivariate analysis, apoB, apoB/HDL-c, nonHDL-c, apoB/apoAI, and LDL particle size are potent indicators and useful for diagnosis of predisposed CHD. | {
"pile_set_name": "PubMed Abstracts"
} |
Myloops Alexandre Bergheau Trance Kicks
Alexandre Bergheau Trance Kicks contains 39 professional quality kick drums created specifically for trance music. Each of the 39 kick drums were especially designed by Alexandre Bergheau himself (known for his releases on Armada Music and FSOE Recordings, and who also produced *Alexandre Bergheau Construction Kits*).
•39 pristine quality kick drums
•Especially designed for Trance music
•The trance kicks are compressed, EQ’d, ready to use in your tracks
•No Filler content, only quality kicks
•Works in every sequencer on the market (WAV Format) | {
"pile_set_name": "Pile-CC"
} |
Bowel transition points: multiplicity and posterior location at CT are associated with small-bowel volvulus.
To retrospectively evaluate the sensitivity and specificity of the number and location of bowel transition points at computed tomography (CT) in the diagnosis of small-bowel volvulus, with surgical findings as the reference standard. This HIPAA-compliant study had institutional review board approval; informed consent was waived. One hundred adult patients who had undergone preoperative CT and who had surgically proved non-abdominal wall hernia small-bowel obstruction (n=68) or small-bowel volvulus (n=32) were retrospectively identified. The patients included 61 women and 39 men with a mean age of 57 years (range, 18-96 years). One reader, blinded to the diagnoses, recorded the number of transition points at CT, the anteroposterior location of each transition point relative to the anterior edge of the spine, and the presence or absence of a whirl sign. Statistical analyses were performed with the Fisher exact test, unpaired t tests, and multiple logistic regression. The frequency of the finding of multiple transition points was significantly higher in patients with volvulus (19 [59%] of 32) than in patients without volvulus (11 [16%] of 68) (P<.001). Transition points associated with volvulus were less likely to be located more than 7 cm anterior to the spine (four [12%] of 32 patients) than were transition points not associated with volvulus (31 [46%] of 68 patients) (P<.005). The whirl sign was an additional significant independent predictor of volvulus (P<.05). When all three of these predictors were present, the specificity for small-bowel volvulus was 100%. The presence of multiple transition points with a posterior location at CT in an adult with small-bowel obstruction is significantly associated with volvulus. | {
"pile_set_name": "PubMed Abstracts"
} |
976 F.2d 726
NOTICE: Fourth Circuit I.O.P. 36.6 states that citation of unpublished dispositions is disfavored except for establishing res judicata, estoppel, or the law of the case and requires service of copies of cited unpublished dispositions of the Fourth Circuit.Calvin LAWSON, Petitioner,v.WESTMORELAND COAL COMPANY, INCORPORATED; Director, Officeof Workers' Compensation Programs, United StatesDepartment of Labor, Respondents.
No. 91-1243.
United States Court of Appeals,Fourth Circuit.
Submitted: February 19, 1992Decided: September 29, 1992
On Petition for Review of an Order of the Benefits Review Board. (88-4139-BLA)
Calvin Lawson, Petitioner Pro Se.
Barbara J. Johnson, Russell Alan Shultis, UNITED STATES DEPARTMENT OF LABOR, Washington, D.C.; Ann Brannon Rembrandt, JACKSON & KELLY, Charleston, West Virginia, for Respondents.
Ben.Rev.Bd.
VACATED AND REMANDED.
Before WIDENER, SPROUSE, and WILKINS, Circuit Judges.
PER CURIAM:
OPINION
1
Calvin Lawson seeks review of the Benefits Review Board's decision and order affirming the administrative law judge's denial of black lung benefits pursuant to 30 U.S.C. §§ 901-945. We vacate the order of the Board and remand for further proceedings.1
2
We may only affirm the Board's decision on the grounds advanced by the Board. SEC v. Chenery Corp., 318 U.S. 80, 88 (1943). Because the Board relied on improper grounds for its decision, we must vacate the Board's decision and remand the case for re-evaluation of the claim under the proper standard.
3
The ALJ found that Lawson had established the existence of pneumoconiosis pursuant to 20 C.F.R. # 8E8E # 718.202(a)(1) and 718.202(a)(4), so that subject is not subject to re-examination. However, the ALJ found that Lawson failed to establish total disability as required in 20 C.F.R. § 718.204(c). Based on this finding, the ALJ denied benefits. The Board affirmed the decision.
4
Under 20 C.F.R. § 718, a claimant may establish total disability by means of (1) pulmonary function tests, (2) arterial blood gas tests, (3) evidence of cor pulmonale with right sided congestive heart failure, or (4) a physician's medical opinion. 20 C.F.R.s 718.204(c). The pulmonary function and arterial blood gas tests did not produce qualifying values under the regulations. No evidence was presented as to cor pulmonale. Therefore, the only basis upon which total disability could be found was by a medical opinion. To establish disability under the medical opinion option, a physician must conclude, based on his exercise of reasoned medical judgment and utilization of medically accepted clinical and laboratory techniques, that the miner's respiratory or pulmonary condition prevents the miner from engaging in his usual coal mine work or work in the immediate area of his residence, requiring comparable skills. 20 C.F.R. §§ 718.204(c)(4) and 718.204(b).
5
Three physicians submitted reports on the issue of total disability. Dr. Fonseca found "[p]ulmonary impairment as a result of coal dust exposure and tobacco abuse for many years resulting in moderate severe COPD [chronic obstructive pulmonary disease] with possible underlying cwp [coal workers' pneumoconiosis] which definite [sic] has impaired this patient's ability to pull an 8 hour shift of work."2 The other two physicians, Drs. Robinette and Endres-Bercher, found no evidence of any respiratory or pulmonary impairment.
6
The ALJ rejected Dr. Fonseca's report because "Dr. Fonseca did not state that the miner is completely unable to engage in heavy labor" and "the record does not indicate whether Dr. Fonseca's conclusions are based on objective data." Based on these findings, the ALJ found that Lawson failed to establish that he is totally disabled due to pneumoconiosis and, accordingly, denied Lawson's claim for benefits.
7
On appeal, the Board affirmed the ALJ's decision on the ground that Dr. Fonseca's opinion "was found not to be supported by the objective evidence." Thus it did not ever consider whether the various opinions of physicians were contradictory. We are of opinion the Board erred in determining that Dr. Fonseca's opinion was not adequately supported. Dr. Fonseca's opinion is contained in a three-page single spaced letter that includes detailed results of a physical examination and other pertinent information. The regulations require that the physician's opinion be "based on medically acceptable clinical and laboratory diagnostic techniques." 20 C.F.R.s 718.204(c)(4). Dr. Fonseca's opinion meets that required criteria. Therefore, we are of opinion that Dr. Fonseca's medical opinion was entitled to consideration by the ALJ and the Board. We vacate the Board's decision and remand for consideration of the issue of whether the evidence, including Dr. Fonseca's opinion, establishes total disability under 20 C.F.R. § 718.204(c)(4).
8
In addition, we are of opinion that Dr. Fonseca's opinion that Lawson's respiratory disease "impaired [his] ability to pull an 8 hour shift of work" is sufficient, if credited, to establish total disability. Physicians need not phrase their medical conclusions in terms of "total disability." Cf. Black Diamond Coal Mining Co. v. Benefits Review Board, 758 F.2d 1532, 1534 (11th Cir. 1985). The ALJ erroneously rejected Dr. Fonseca's opinion based on the ALJ's view that the doctor was required to state that Lawson was "completely unable to engage in heavy labor." See 758 F.2d at 1534 (Doctor's opinion that claimant was limited to one block of walking per day was sufficient fact from which ALJ could infer total disability. Fact that doctor placed no limit on lifting or carrying did not preclude finding of total disability.) The Board erred in not reversing the ALJ for applying the wrong standard in its evaluation of Dr. Fonseca's medical opinion.
9
The Board relied on improper grounds in affirming the ALJ's denial of Lawson's claim for benefits. Therefore, we vacate the decision of the Board and remand, which includes further remand to an ALJ, if appropriate, for reconsideration of Lawson's claim under the proper standard.
VACATED AND REMANDED
1
We dispense with oral argument because the facts and legal contentions are adequately presented in the materials before the Court and argument would not aid the decisional process
2
Lawson had quit smoking some 18 years prior to this case
| {
"pile_set_name": "FreeLaw"
} |
/* -*- mode: C; c-basic-offset: 4; tab-width: 4 -*-
*
* Copyright (c) 2008-2011 Apple Inc. All rights reserved.
*
* @APPLE_LICENSE_HEADER_START@
*
* This file contains Original Code and/or Modifications of Original Code
* as defined in and that are subject to the Apple Public Source License
* Version 2.0 (the 'License'). You may not use this file except in
* compliance with the License. Please obtain a copy of the License at
* http://www.opensource.apple.com/apsl/ and read it before using this
* file.
*
* The Original Code and all software distributed under the License are
* distributed on an 'AS IS' basis, WITHOUT WARRANTY OF ANY KIND, EITHER
* EXPRESS OR IMPLIED, AND APPLE HEREBY DISCLAIMS ALL SUCH WARRANTIES,
* INCLUDING WITHOUT LIMITATION, ANY WARRANTIES OF MERCHANTABILITY,
* FITNESS FOR A PARTICULAR PURPOSE, QUIET ENJOYMENT OR NON-INFRINGEMENT.
* Please see the License for the specific language governing rights and
* limitations under the License.
*
* @APPLE_LICENSE_HEADER_END@
*/
#ifndef __COMPACT_UNWIND_ENCODING__
#define __COMPACT_UNWIND_ENCODING__
#include <stdint.h>
//
// Compilers can emit standard Dwarf FDEs in the __TEXT,__eh_frame section
// of object files. Or compilers can emit compact unwind information in
// the __LD,__compact_unwind section.
//
// When the linker creates a final linked image, it will create a
// __TEXT,__unwind_info section. This section is a small and fast way for the
// runtime to access unwind info for any given function. If the compiler emitted
// compact unwind info for the function, that compact unwind info will be encoded
// in the __TEXT,__unwind_info section. If the compiler emitted dwarf unwind info,
// the __TEXT,__unwind_info section will contain the offset of the FDE in the
// __TEXT,__eh_frame section in the final linked image.
//
// Note: Previously, the linker would transform some dwarf unwind infos into
// compact unwind info. But that is fragile and no longer done.
//
// The compact unwind endoding is a 32-bit value which encoded in an architecture
// specific way, which registers to restore from where, and how to unwind out
// of the function.
//
typedef uint32_t compact_unwind_encoding_t;
// architecture independent bits
enum {
UNWIND_IS_NOT_FUNCTION_START = 0x80000000,
UNWIND_HAS_LSDA = 0x40000000,
UNWIND_PERSONALITY_MASK = 0x30000000,
};
//
// x86
//
// 1-bit: start
// 1-bit: has lsda
// 2-bit: personality index
//
// 4-bits: 0=old, 1=ebp based, 2=stack-imm, 3=stack-ind, 4=dwarf
// ebp based:
// 15-bits (5*3-bits per reg) register permutation
// 8-bits for stack offset
// frameless:
// 8-bits stack size
// 3-bits stack adjust
// 3-bits register count
// 10-bits register permutation
//
enum {
UNWIND_X86_MODE_MASK = 0x0F000000,
UNWIND_X86_MODE_EBP_FRAME = 0x01000000,
UNWIND_X86_MODE_STACK_IMMD = 0x02000000,
UNWIND_X86_MODE_STACK_IND = 0x03000000,
UNWIND_X86_MODE_DWARF = 0x04000000,
UNWIND_X86_EBP_FRAME_REGISTERS = 0x00007FFF,
UNWIND_X86_EBP_FRAME_OFFSET = 0x00FF0000,
UNWIND_X86_FRAMELESS_STACK_SIZE = 0x00FF0000,
UNWIND_X86_FRAMELESS_STACK_ADJUST = 0x0000E000,
UNWIND_X86_FRAMELESS_STACK_REG_COUNT = 0x00001C00,
UNWIND_X86_FRAMELESS_STACK_REG_PERMUTATION = 0x000003FF,
UNWIND_X86_DWARF_SECTION_OFFSET = 0x00FFFFFF,
};
enum {
UNWIND_X86_REG_NONE = 0,
UNWIND_X86_REG_EBX = 1,
UNWIND_X86_REG_ECX = 2,
UNWIND_X86_REG_EDX = 3,
UNWIND_X86_REG_EDI = 4,
UNWIND_X86_REG_ESI = 5,
UNWIND_X86_REG_EBP = 6,
};
//
// For x86 there are four modes for the compact unwind encoding:
// UNWIND_X86_MODE_EBP_FRAME:
// EBP based frame where EBP is push on stack immediately after return address,
// then ESP is moved to EBP. Thus, to unwind ESP is restored with the current
// EPB value, then EBP is restored by popping off the stack, and the return
// is done by popping the stack once more into the pc.
// All non-volatile registers that need to be restored must have been saved
// in a small range in the stack that starts EBP-4 to EBP-1020. The offset/4
// is encoded in the UNWIND_X86_EBP_FRAME_OFFSET bits. The registers saved
// are encoded in the UNWIND_X86_EBP_FRAME_REGISTERS bits as five 3-bit entries.
// Each entry contains which register to restore.
// UNWIND_X86_MODE_STACK_IMMD:
// A "frameless" (EBP not used as frame pointer) function with a small
// constant stack size. To return, a constant (encoded in the compact
// unwind encoding) is added to the ESP. Then the return is done by
// popping the stack into the pc.
// All non-volatile registers that need to be restored must have been saved
// on the stack immediately after the return address. The stack_size/4 is
// encoded in the UNWIND_X86_FRAMELESS_STACK_SIZE (max stack size is 1024).
// The number of registers saved is encoded in UNWIND_X86_FRAMELESS_STACK_REG_COUNT.
// UNWIND_X86_FRAMELESS_STACK_REG_PERMUTATION constains which registers were
// saved and their order.
// UNWIND_X86_MODE_STACK_IND:
// A "frameless" (EBP not used as frame pointer) function large constant
// stack size. This case is like the previous, except the stack size is too
// large to encode in the compact unwind encoding. Instead it requires that
// the function contains "subl $nnnnnnnn,ESP" in its prolog. The compact
// encoding contains the offset to the nnnnnnnn value in the function in
// UNWIND_X86_FRAMELESS_STACK_SIZE.
// UNWIND_X86_MODE_DWARF:
// No compact unwind encoding is available. Instead the low 24-bits of the
// compact encoding is the offset of the dwarf FDE in the __eh_frame section.
// This mode is never used in object files. It is only generated by the
// linker in final linked images which have only dwarf unwind info for a
// function.
//
// The following is the algorithm used to create the permutation encoding used
// with frameless stacks. It is passed the number of registers to be saved and
// an array of the register numbers saved.
//
//uint32_t permute_encode(uint32_t registerCount, const uint32_t registers[6])
//{
// uint32_t renumregs[6];
// for (int i=6-registerCount; i < 6; ++i) {
// int countless = 0;
// for (int j=6-registerCount; j < i; ++j) {
// if ( registers[j] < registers[i] )
// ++countless;
// }
// renumregs[i] = registers[i] - countless -1;
// }
// uint32_t permutationEncoding = 0;
// switch ( registerCount ) {
// case 6:
// permutationEncoding |= (120*renumregs[0] + 24*renumregs[1]
// + 6*renumregs[2] + 2*renumregs[3]
// + renumregs[4]);
// break;
// case 5:
// permutationEncoding |= (120*renumregs[1] + 24*renumregs[2]
// + 6*renumregs[3] + 2*renumregs[4]
// + renumregs[5]);
// break;
// case 4:
// permutationEncoding |= (60*renumregs[2] + 12*renumregs[3]
// + 3*renumregs[4] + renumregs[5]);
// break;
// case 3:
// permutationEncoding |= (20*renumregs[3] + 4*renumregs[4]
// + renumregs[5]);
// break;
// case 2:
// permutationEncoding |= (5*renumregs[4] + renumregs[5]);
// break;
// case 1:
// permutationEncoding |= (renumregs[5]);
// break;
// }
// return permutationEncoding;
//}
//
//
// x86_64
//
// 1-bit: start
// 1-bit: has lsda
// 2-bit: personality index
//
// 4-bits: 0=old, 1=rbp based, 2=stack-imm, 3=stack-ind, 4=dwarf
// rbp based:
// 15-bits (5*3-bits per reg) register permutation
// 8-bits for stack offset
// frameless:
// 8-bits stack size
// 3-bits stack adjust
// 3-bits register count
// 10-bits register permutation
//
enum {
UNWIND_X86_64_MODE_MASK = 0x0F000000,
UNWIND_X86_64_MODE_RBP_FRAME = 0x01000000,
UNWIND_X86_64_MODE_STACK_IMMD = 0x02000000,
UNWIND_X86_64_MODE_STACK_IND = 0x03000000,
UNWIND_X86_64_MODE_DWARF = 0x04000000,
UNWIND_X86_64_RBP_FRAME_REGISTERS = 0x00007FFF,
UNWIND_X86_64_RBP_FRAME_OFFSET = 0x00FF0000,
UNWIND_X86_64_FRAMELESS_STACK_SIZE = 0x00FF0000,
UNWIND_X86_64_FRAMELESS_STACK_ADJUST = 0x0000E000,
UNWIND_X86_64_FRAMELESS_STACK_REG_COUNT = 0x00001C00,
UNWIND_X86_64_FRAMELESS_STACK_REG_PERMUTATION = 0x000003FF,
UNWIND_X86_64_DWARF_SECTION_OFFSET = 0x00FFFFFF,
};
enum {
UNWIND_X86_64_REG_NONE = 0,
UNWIND_X86_64_REG_RBX = 1,
UNWIND_X86_64_REG_R12 = 2,
UNWIND_X86_64_REG_R13 = 3,
UNWIND_X86_64_REG_R14 = 4,
UNWIND_X86_64_REG_R15 = 5,
UNWIND_X86_64_REG_RBP = 6,
};
//
// For x86_64 there are four modes for the compact unwind encoding:
// UNWIND_X86_64_MODE_RBP_FRAME:
// RBP based frame where RBP is push on stack immediately after return address,
// then RSP is moved to RBP. Thus, to unwind RSP is restored with the current
// EPB value, then RBP is restored by popping off the stack, and the return
// is done by popping the stack once more into the pc.
// All non-volatile registers that need to be restored must have been saved
// in a small range in the stack that starts RBP-8 to RBP-1020. The offset/4
// is encoded in the UNWIND_X86_64_RBP_FRAME_OFFSET bits. The registers saved
// are encoded in the UNWIND_X86_64_RBP_FRAME_REGISTERS bits as five 3-bit entries.
// Each entry contains which register to restore.
// UNWIND_X86_64_MODE_STACK_IMMD:
// A "frameless" (RBP not used as frame pointer) function with a small
// constant stack size. To return, a constant (encoded in the compact
// unwind encoding) is added to the RSP. Then the return is done by
// popping the stack into the pc.
// All non-volatile registers that need to be restored must have been saved
// on the stack immediately after the return address. The stack_size/4 is
// encoded in the UNWIND_X86_64_FRAMELESS_STACK_SIZE (max stack size is 1024).
// The number of registers saved is encoded in UNWIND_X86_64_FRAMELESS_STACK_REG_COUNT.
// UNWIND_X86_64_FRAMELESS_STACK_REG_PERMUTATION constains which registers were
// saved and their order.
// UNWIND_X86_64_MODE_STACK_IND:
// A "frameless" (RBP not used as frame pointer) function large constant
// stack size. This case is like the previous, except the stack size is too
// large to encode in the compact unwind encoding. Instead it requires that
// the function contains "subq $nnnnnnnn,RSP" in its prolog. The compact
// encoding contains the offset to the nnnnnnnn value in the function in
// UNWIND_X86_64_FRAMELESS_STACK_SIZE.
// UNWIND_X86_64_MODE_DWARF:
// No compact unwind encoding is available. Instead the low 24-bits of the
// compact encoding is the offset of the dwarf FDE in the __eh_frame section.
// This mode is never used in object files. It is only generated by the
// linker in final linked images which have only dwarf unwind info for a
// function.
//
////////////////////////////////////////////////////////////////////////////////
//
// Relocatable Object Files: __LD,__compact_unwind
//
////////////////////////////////////////////////////////////////////////////////
//
// A compiler can generated compact unwind information for a function by adding
// a "row" to the __LD,__compact_unwind section. This section has the
// S_ATTR_DEBUG bit set, so the section will be ignored by older linkers.
// It is removed by the new linker, so never ends up in final executables.
// This section is a table, initially with one row per function (that needs
// unwind info). The table columns and some conceptual entries are:
//
// range-start pointer to start of function/range
// range-length
// compact-unwind-encoding 32-bit encoding
// personality-function or zero if no personality function
// lsda or zero if no LSDA data
//
// The length and encoding fields are 32-bits. The other are all pointer sized.
//
// In x86_64 assembly, these entry would look like:
//
// .section __LD,__compact_unwind,regular,debug
//
// #compact unwind for _foo
// .quad _foo
// .set L1,LfooEnd-_foo
// .long L1
// .long 0x01010001
// .quad 0
// .quad 0
//
// #compact unwind for _bar
// .quad _bar
// .set L2,LbarEnd-_bar
// .long L2
// .long 0x01020011
// .quad __gxx_personality
// .quad except_tab1
//
//
// Notes: There is no need for any labels in the the __compact_unwind section.
// The use of the .set directive is to force the evaluation of the
// range-length at assembly time, instead of generating relocations.
//
// To support future compiler optimizations where which non-volatile registers
// are saved changes within a function (e.g. delay saving non-volatiles until
// necessary), there can by multiple lines in the __compact_unwind table for one
// function, each with a different (non-overlapping) range and each with
// different compact unwind encodings that correspond to the non-volatiles
// saved at that range of the function.
//
// If a particular function is so wacky that there is no compact unwind way
// to encode it, then the compiler can emit traditional dwarf unwind info.
// The runtime will use which ever is available.
//
// Runtime support for compact unwind encodings are only available on 10.6
// and later. So, the compiler should not generate it when targeting pre-10.6.
////////////////////////////////////////////////////////////////////////////////
//
// Final Linked Images: __TEXT,__unwind_info
//
////////////////////////////////////////////////////////////////////////////////
//
// The __TEXT,__unwind_info section is laid out for an efficient two level lookup.
// The header of the section contains a coarse index that maps function address
// to the page (4096 byte block) containing the unwind info for that function.
//
#define UNWIND_SECTION_VERSION 1
struct unwind_info_section_header
{
uint32_t version; // UNWIND_SECTION_VERSION
uint32_t commonEncodingsArraySectionOffset;
uint32_t commonEncodingsArrayCount;
uint32_t personalityArraySectionOffset;
uint32_t personalityArrayCount;
uint32_t indexSectionOffset;
uint32_t indexCount;
// compact_unwind_encoding_t[]
// uintptr_t personalities[]
// unwind_info_section_header_index_entry[]
// unwind_info_section_header_lsda_index_entry[]
};
struct unwind_info_section_header_index_entry
{
uint32_t functionOffset;
uint32_t secondLevelPagesSectionOffset; // section offset to start of regular or compress page
uint32_t lsdaIndexArraySectionOffset; // section offset to start of lsda_index array for this range
};
struct unwind_info_section_header_lsda_index_entry
{
uint32_t functionOffset;
uint32_t lsdaOffset;
};
//
// There are two kinds of second level index pages: regular and compressed.
// A compressed page can hold up to 1021 entries, but it cannot be used
// if too many different encoding types are used. The regular page holds
// 511 entries.
//
struct unwind_info_regular_second_level_entry
{
uint32_t functionOffset;
compact_unwind_encoding_t encoding;
};
#define UNWIND_SECOND_LEVEL_REGULAR 2
struct unwind_info_regular_second_level_page_header
{
uint32_t kind; // UNWIND_SECOND_LEVEL_REGULAR
uint16_t entryPageOffset;
uint16_t entryCount;
// entry array
};
#define UNWIND_SECOND_LEVEL_COMPRESSED 3
struct unwind_info_compressed_second_level_page_header
{
uint32_t kind; // UNWIND_SECOND_LEVEL_COMPRESSED
uint16_t entryPageOffset;
uint16_t entryCount;
uint16_t encodingsPageOffset;
uint16_t encodingsCount;
// 32-bit entry array
// encodings array
};
#define UNWIND_INFO_COMPRESSED_ENTRY_FUNC_OFFSET(entry) (entry & 0x00FFFFFF)
#define UNWIND_INFO_COMPRESSED_ENTRY_ENCODING_INDEX(entry) ((entry >> 24) & 0xFF)
#endif
| {
"pile_set_name": "Github"
} |
Millions of White-Rodgers mercury-cell mechanical thermostats have been installed over the last 50 years.
The best mercury-free replacement is. White-Rodgers.
. Includes adjustable heat anticipator
. New mercury-free mechanicals offer quick and easy replacement
. Same size as our older models and feature updated styling
. Same footprint saves time and aggravation, so wall marks are not a problem and no cover-up wallplate is necessary
FEATURES:
. Replacement for Hundreds of White-Rodgers and Competitive Models Installed During the Past 50 Years
. Enclosed Contacts for Increased Reliability and Accuracy
. 5-Year Warranty
The actual temperature of the room shows up on the thermostat as being 10 degrees less than what the actual setting is. I am assuming that it was not calibrated correctly. I have had (and installed) other units and had no problem.
I was replacing a 30-year old White-Rodgers thermostat and wanted to get one that was exactly like the old one. This one was a perfect match. Even the wiring was exactly like the old one which made installation very easy.
This replaced my original 17 year old White Rodgers perfectly, and without the mercury. It was an easy install in about 10 minutes. The on off cycle of the central AC is a lot more efficient than the old one. It will definately outlive my current HVAC system.
I know that a lot of Air Conditioning companies push the digital, programmable thermostats, but from my experience, the manual thermostats are more accurate and easy to use. A few years ago, I had a digital thermostat installed at my home by our A/C guy who recommended it. It took me a year to figure out why our A/C was not working properly. Then I went back to a manual thermostat and when I did, I had no more problems with regulating the temperature and running cycles. White Rodgers carries this wonderful manual thermostat that is easy to install. I hope they don't ever quit producing manual thermostats.
I was very happy to see that I could buy the same kind of thermostat that I had before. I had looked at Home Depot and all they had were complicated ones that were digital. I like to control my hear and air and dont want to have to program 56 setting.
The actual temperature of the room shows up on the thermostat as being 10 degrees less than what the actual setting is. I am assuming that it was not calibrated correctly. I have had (and installed) other units and had no problem.
I was replacing a 30-year old White-Rodgers thermostat and wanted to get one that was exactly like the old one. This one was a perfect match. Even the wiring was exactly like the old one which made installation very easy.
This replaced my original 17 year old White Rodgers perfectly, and without the mercury. It was an easy install in about 10 minutes. The on off cycle of the central AC is a lot more efficient than the old one. It will definately outlive my current HVAC system.
I know that a lot of Air Conditioning companies push the digital, programmable thermostats, but from my experience, the manual thermostats are more accurate and easy to use. A few years ago, I had a digital thermostat installed at my home by our A/C guy who recommended it. It took me a year to figure out why our A/C was not working properly. Then I went back to a manual thermostat and when I did, I had no more problems with regulating the temperature and running cycles. White Rodgers carries this wonderful manual thermostat that is easy to install. I hope they don't ever quit producing manual thermostats.
I was very happy to see that I could buy the same kind of thermostat that I had before. I had looked at Home Depot and all they had were complicated ones that were digital. I like to control my hear and air and dont want to have to program 56 setting.
Millions of White-Rodgers mercury-cell mechanical thermostats have been installed over the last 50 years.
The best mercury-free replacement is. White-Rodgers.
. Includes adjustable heat anticipator
. New mercury-free mechanicals offer quick and easy replacement
. Same size as our older models and feature updated styling
. Same footprint saves time and aggravation, so wall marks are not a problem and no cover-up wallplate is necessary
FEATURES:
. Replacement for Hundreds of White-Rodgers and Competitive Models Installed During the Past 50 Years
. Enclosed Contacts for Increased Reliability and Accuracy
. 5-Year Warranty | {
"pile_set_name": "Pile-CC"
} |
You can find the Xiaomi Flash Tool Shortcut on your Windows Menu. And you can also start the Xiaomi Flash Tool directly from the installed folder (i.e C:> Program Files > Xiaomi > MiPhone > MiFlash.exe).
Readme Once:
[*] There is no need to install the drivers separately, as all the drivers came with the Xiaomi Flash Tool and get installed duing the Xiaomi Flash Tool installation process. | {
"pile_set_name": "Pile-CC"
} |
In addition, reinforcement with Neoloy Geocells significantly increases the service life of all types of green and permeable pavement structures. This reduces operational and maintenance costs, while lowering the total cost of ownership.Typical permeable applications include residential areas, parking lots, maintenance and emergency access and road or runway shoulders with concrete pavers or turf surface cover.
Contact Us
Follow Us
About
PRS (Professional Reinforcement Solutions) Geo Technologies is an engineering and technology company with innovative solutions for infrastructure, mining, energy exploration and the military based on the PRS Neoloy® geocell cellular confinement system.Learn More
Office Info
News Letter
This website uses cookies to optimise your online user experience. Some of the cookies we use are essential for the site to work. By continuing to use our site you agree to us using cookies in accordance with our Cookie Policy. | {
"pile_set_name": "Pile-CC"
} |
Q:
Can you play online coop between the Master Chief Collection and the individual Halo games?
With the Master Chief Collection, are you able to play online coop with someone who has one of the actual halo games? For example, will I be able to play online coop on halo 4 with my friend while I'm on the Master Chief Collection but they're on the actual halo 4 disc?
A:
It is not possible to play Halo MCC online with other people who are playing the individual games.
Confirmed by this reddit post.
| {
"pile_set_name": "StackExchange"
} |
Please don't use hnreputation - pg
A bunch of people have been emailing me asking to have their IP unblocked after using this script<p>http://github.com/brainkarma/hnreputation/tree/master<p>which apparently hits the server so hard that it gets their IP ignored.
======
nir
The whole idea of "Karma" is silly. It encourages conforming to majority views
and rewards people who are talkative rather than insightful - often mutually
exclusive groups, since insight is gained by thinking & doing rather than
posting comments.
I think HN would do well to drop karma scores altogether, making this script a
non-issue to begin with.
~~~
brk
While we're on the topic of suggestions that aren't likely to be implemented
;)
I like to see the user name hidden on comments and submissions until after you
vote and/or reply. Judge the content on the content alone, not on the author.
~~~
rincewind
I trust security advice from tptacek or cperciva more than from [name withheld
until you vote].
Threads get really confusing when [name withheld until you vote] argues with
himself all the time.
~~~
adimit
How about withholding the name still, but offering a way to 'opt-out' from
voting. You don't see the name until you either vote up or opt out. After
you've withheld your voice, you can't go vote again on that
submission/comment.
~~~
eru
> you either vote up or opt out
How about voting down?
~~~
Novash
You can't vote down until you hit a certain karma threshold.
~~~
eru
Yes, I know. I just could not resist making the itemization complete.
------
jnorthrop
For those that don't know what this is...
"This Greasemonkey script for news.ycombinator.com will display the reputation
of a user in the comment header as well as in the links' title tooltip."
~~~
DannoHung
This does not strike me as conducive to the purpose of HN.
~~~
mjgoins
It's not, and I seem to remember that this exact problem (the technical
problem, but also the one you mention) was pointed out when the script was
introduced.
------
brianto2010
jacquesm _did_ warn you guys:
<http://news.ycombinator.com/item?id=779181>
------
henning
It does one HTTP request for each comment in a thread, it looks like.
Kind of irresponsible coding, I think.
~~~
keyist
Irresponsible usage as well. Those who used the script should really have at
least eyeballed the source first.
[EDIT: This is HN. Surely I don't have to explain the pitfalls of downloading
a Greasemonkey script and running it in your browser without checking what it
does? It's even worse than uneducated users tricked into running malware since
you're knowingly installing a script.]
~~~
PieSquared
Whoa, _what_?!
~~~
PieSquared
True, I guess, but it seems a bit extreme to say that anyone downloading a
Greasemonkey script should be examining the javascript inside it to figure out
what it does. That's all I meant by my 'Wait, what' comment. Should've
elaborated, then.
~~~
jwecker
Looking at the karma there, it seems your explanation is exactly adequate.
------
sh1mmer
I think you should read all comment without knowing the person's karama.
You'll probably recognise some of our more illustrious users by username but
really you should be evaluating each comment on it's merit, not the author's
karma.
------
yan
If this functionality is desired enough for enough people to use this, why not
publish a list of users, updated say, hourly so these scripts can cache the
reputations? But then again, don't really see the point in using this.
Also, if reputation's that important, you can just cache the 'leaders' list.
~~~
icey
A) Reputation isn't a very good measure of anything as far as I'm concerned.
B) It's trivial to click on someone's name and see what their reputation is if
it's important to the person reading / replying.
| {
"pile_set_name": "HackerNews"
} |
Q:
SQLAlchemy join 3 tables ans select bigger count()
I have 3 entities: Seller, Customer, ProductBought.
ProductBought is assigned to a Customer, and Customer is assigned to Seller.
Each of these entities has an id field.
What is the SQLAlchemy query to select the id of the Seller who has more BoughtProduct?
I have come up with this query, but doesn't work:
best_seller = dbs.query(Seller).\
join(Customer).\
join(ProductBought).\
filter(and_ (Seller.id_ == Customer.id_, Customer.id_ == BoughtProduct.id_)).\
order_by(count()).\
first()
A:
It works like this: first you make a sub-query that aggregates per-customer sales data, then perform aggregate query on sellers joined to this sub-query.
customers = (session
.query(Customer.seller_id, func.count().label('bought_count'))
.join(ProductBought)
.group_by(Customer)
.subquery())
result = (session
.query(Seller, func.sum(customers.c.bought_count).label('total_sales'))
.join(customers, Seller.id==customers.c.seller_id)
.group_by(Seller)
.order_by(desc('total_sales'))
.first())
Complete code with model definitions and sample data initialization:
from sqlalchemy import (create_engine, event,
Column, Integer, String,
ForeignKey,
desc, func)
from sqlalchemy.orm import relationship, sessionmaker
from sqlalchemy.ext.declarative import declarative_base, declared_attr
from random import choice
engine = create_engine('sqlite:///sellers.db', echo=True)
event.listen(engine, 'connect',
lambda conn, rec: conn.execute('PRAGMA foreign_keys=ON;'))
Session = sessionmaker(bind=engine)
class Base(object):
@declared_attr
def __tablename__(cls):
return cls.__name__.lower()
id = Column(Integer, primary_key=True, autoincrement=True)
def __repr__(self):
clsname = self.__class__.__name__
return '<%s(%d)>' % (clsname, self.id)
Base = declarative_base(cls=Base)
class Seller(Base):
pass
class Customer(Base):
seller_id = Column(Integer, ForeignKey(Seller.id), nullable=False)
seller = relationship(Seller, backref='customers')
class Product(Base):
pass
class ProductBought(Base):
product_id = Column(Integer, ForeignKey(Product.id), nullable=False)
product = relationship(Product, backref='sales')
customer_id = Column(Integer, ForeignKey(Customer.id), nullable=False)
customer = relationship(Customer, backref='purchases')
def prepare_data():
Base.metadata.create_all(engine)
session = Session()
sellers = [Seller() for _ in xrange(5)]
customers = [Customer(seller=choice(sellers)) for _ in xrange(20)]
products = [Product() for _ in xrange(10)]
sales = [ProductBought(product=choice(products), customer=choice(customers))
for _ in xrange(100)]
session.add_all(sellers + customers + products + sales)
session.commit()
session.close()
def top_seller():
session = Session()
customers = (session
.query(Customer.seller_id, func.count().label('bought_count'))
.join(ProductBought)
.group_by(Customer)
.subquery())
result = (session
.query(Seller, func.sum(customers.c.bought_count).label('total_sales'))
.join(customers, Seller.id==customers.c.seller_id)
.group_by(Seller)
.order_by(desc('total_sales'))
.first())
session.close()
return result
def main():
Base.metadata.drop_all(engine)
prepare_data()
print top_seller()
if __name__ == "__main__":
main()
| {
"pile_set_name": "StackExchange"
} |
Q:
An admissible numbering of an acyclic quiver
Let $Q$ be an acyclic quiver. In here, we read that
there exists a bijection between $Q_0$ (set of vertices of $Q$) and the set $\{1,\dots,n\}$ such that if we have an arrow $i \to j$, then $j > i$; indeed such a bijection is constructed as follows. Let $1$ be any sink in $Q$, then consider the full subquiver $Q(1)$ of $Q$ having as set of points $Q_0 \setminus \{1\}$; let $2$ be a sink of $Q(1)$, and continue by induction. Such a numbering of the points of $Q$ is called an admissible numbering.
Let us do an example. Let $Q$ be the (acyclic) quiver:
\begin{equation*}
1 \gets 2 \to 3 \gets 4 \to 5
\end{equation*}
For example, $1$ is a sink, so we remove $1$ and we're left with:
\begin{equation*}
2 \to 3 \gets 4 \to 5
\end{equation*}
Then we decide to remove $5$, and so we get:
\begin{equation*}
2 \to 3 \gets 4
\end{equation*}
Now, only 3 is a sink, so we remove $3$ and I guess we're left with an empty quiver(?). So, as for our admissible numbering of $Q$, we got that the first 3 numbers are $\{1,5,3\}$ but what about the remaining $2$? Should our admissible numbering be $\{1,5,3,2,4\}$ or $\{1,5,3,4,2\}$? Or it doesn't matter? Can someone help me clarify what is the procedure in situations like this?
A:
If you remove the vertex $3$ you are not left with the empty quiver but with the quiver with two vertices, $2$ and $4$. Since there are no arrows in the quiver you get two possible numbering which are admissible $\{1,5,3,2,4\}$ and $\{1,5,3,4,2\}$. Notice that you also made a choice beforehand, your first vertex could be either $1$, $3$, or $5$. In the next step you can remove another one of those three. In the third step it even depends on what you have done before, i.e. if your first two choices were $1$ and $3$, you can take $2$ as your third choice. In this theory it often only matters that there exists an admissible ordering and in the concrete constructions you work with a particular fixed one of those. But there will in general be many possible admissible numberings and not all the constructions are independent of the ordering.
| {
"pile_set_name": "StackExchange"
} |
Caffeine and femproporex are psychostimulants drugs widely consumed in Brazil. Behavioral sensitization is defined as an augmentation in the behavioral effect of a psychostimulant upon re-administration. Repeated administration of a psychostimulant produces behavioral sensitization to that drug and cross-sensitization to other drugs. We investigated whether repeated administration of caffeine increases femproporex-induced locomotor activity in adolescent and adult rats. Forty-eight adolescent (postnatal day 27) and 32 adult (postnatal day 60) received i.p. injections of caffeine (CAF) (10.0 mg/kg) (adolescent N = 24; adult N = 16)) or saline (adolescent N = 24; adult N = 16) once daily for ten days. Three days following the last injection each group was subdivided and received a challenge injection of femproporex (2.0 mg/kg, i.p.) or saline. Locomotor activity was recorded for 1 hour in 5 - minute intervals. Our results showed that repeated injections of caffeine increased femproporex - induced locomotor activity in adult and adolescent rats. | {
"pile_set_name": "Pile-CC"
} |
<!doctype html>
<html>
<title>npm-unpublish</title>
<meta http-equiv="content-type" value="text/html;utf-8">
<link rel="stylesheet" type="text/css" href="../../static/style.css">
<link rel="canonical" href="https://www.npmjs.org/doc/cli/npm-unpublish.html">
<script async=true src="../../static/toc.js"></script>
<body>
<div id="wrapper">
<h1><a href="../cli/npm-unpublish.html">npm-unpublish</a></h1> <p>Remove a package from the registry</p>
<h2 id="synopsis">SYNOPSIS</h2>
<pre><code>npm unpublish [<@scope>/]<pkg>[@<version>]
</code></pre><h2 id="warning">WARNING</h2>
<p><strong>It is generally considered bad behavior to remove versions of a library
that others are depending on!</strong></p>
<p>Consider using the <code>deprecate</code> command
instead, if your intent is to encourage users to upgrade.</p>
<p>There is plenty of room on the registry.</p>
<h2 id="description">DESCRIPTION</h2>
<p>This removes a package version from the registry, deleting its
entry and removing the tarball.</p>
<p>If no version is specified, or if all versions are removed then
the root package entry is removed from the registry entirely.</p>
<p>Even if a package version is unpublished, that specific name and
version combination can never be reused. In order to publish the
package again, a new version number must be used.</p>
<p>The scope is optional and follows the usual rules for <code><a href="../misc/npm-scope.html">npm-scope(7)</a></code>.</p>
<h2 id="see-also">SEE ALSO</h2>
<ul>
<li><a href="../cli/npm-deprecate.html">npm-deprecate(1)</a></li>
<li><a href="../cli/npm-publish.html">npm-publish(1)</a></li>
<li><a href="../misc/npm-registry.html">npm-registry(7)</a></li>
<li><a href="../cli/npm-adduser.html">npm-adduser(1)</a></li>
<li><a href="../cli/npm-owner.html">npm-owner(1)</a></li>
</ul>
</div>
<table border=0 cellspacing=0 cellpadding=0 id=npmlogo>
<tr><td style="width:180px;height:10px;background:rgb(237,127,127)" colspan=18> </td></tr>
<tr><td rowspan=4 style="width:10px;height:10px;background:rgb(237,127,127)"> </td><td style="width:40px;height:10px;background:#fff" colspan=4> </td><td style="width:10px;height:10px;background:rgb(237,127,127)" rowspan=4> </td><td style="width:40px;height:10px;background:#fff" colspan=4> </td><td rowspan=4 style="width:10px;height:10px;background:rgb(237,127,127)"> </td><td colspan=6 style="width:60px;height:10px;background:#fff"> </td><td style="width:10px;height:10px;background:rgb(237,127,127)" rowspan=4> </td></tr>
<tr><td colspan=2 style="width:20px;height:30px;background:#fff" rowspan=3> </td><td style="width:10px;height:10px;background:rgb(237,127,127)" rowspan=3> </td><td style="width:10px;height:10px;background:#fff" rowspan=3> </td><td style="width:20px;height:10px;background:#fff" rowspan=4 colspan=2> </td><td style="width:10px;height:20px;background:rgb(237,127,127)" rowspan=2> </td><td style="width:10px;height:10px;background:#fff" rowspan=3> </td><td style="width:20px;height:10px;background:#fff" rowspan=3 colspan=2> </td><td style="width:10px;height:10px;background:rgb(237,127,127)" rowspan=3> </td><td style="width:10px;height:10px;background:#fff" rowspan=3> </td><td style="width:10px;height:10px;background:rgb(237,127,127)" rowspan=3> </td></tr>
<tr><td style="width:10px;height:10px;background:#fff" rowspan=2> </td></tr>
<tr><td style="width:10px;height:10px;background:#fff"> </td></tr>
<tr><td style="width:60px;height:10px;background:rgb(237,127,127)" colspan=6> </td><td colspan=10 style="width:10px;height:10px;background:rgb(237,127,127)"> </td></tr>
<tr><td colspan=5 style="width:50px;height:10px;background:#fff"> </td><td style="width:40px;height:10px;background:rgb(237,127,127)" colspan=4> </td><td style="width:90px;height:10px;background:#fff" colspan=9> </td></tr>
</table>
<p id="footer">npm-unpublish — npm@3.3.12</p>
| {
"pile_set_name": "Github"
} |
Q:
Z-Index not working over table elements
I have tried a lot but unable to figure out whats wrong. The z-index is not working at all when hovering over the Available Balance question mark (?). Upon hover over the question mark (?), it can be noticed that the tooltip is getting cut by the table heading area. Can someone please guide me what needs to be changed? Here is the complete code I am working with. Sorry for the long code but I have tried to put in as much as I can for some one to figure this out.
/* SECONDARY TOOLTIP (S) */
[tooltip] {
position: relative;
}
/* Arrow */
[tooltip]:before {
width: 16px;
height: 6px;
left: 50%;
margin-top: 1px;
top: calc(100% - 10px);
opacity: 1;
content: '';
position: absolute;
z-index: 10;
box-sizing: border-box;
border-left: 8px solid transparent;
border-right: 8px solid transparent;
border-bottom: 10px solid #00204e;
transform: translate(-50%, 0%);
opacity: 0;
-webkit-transition: all 0.2s cubic-bezier(0.71, 1.7, 0.77, 1.24);
-moz-transition: all 0.2s cubic-bezier(0.71, 1.7, 0.77, 1.24);
-ms-transition: all 0.2s cubic-bezier(0.71, 1.7, 0.77, 1.24);
-o-transition: all 0.2s cubic-bezier(0.71, 1.7, 0.77, 1.24);
transition: all 0.2s cubic-bezier(0.71, 1.7, 0.77, 1.24);
pointer-events: none;
}
/* Text */
[tooltip]:after {
transform: translate(-50%, 0%);
left: 50%;
margin-top: 11px;
top: calc(100% - 10px);
opacity: 1;
font-weight: normal;
text-shadow: none;
background: #00204e;
border-radius: 4px;
color: #fff;
content: attr(tooltip);
padding: 10px;
position: absolute;
white-space: normal;
width: max-content;
font-size: 9px;
font-family: 'Helvetica Neue';
line-height: normal;
max-width: 150px;
text-align: left;
height: auto;
display: inline-block;
opacity: 0;
-webkit-transition: all 0.2s cubic-bezier(0.71, 1.7, 0.77, 1.24);
-moz-transition: all 0.2s cubic-bezier(0.71, 1.7, 0.77, 1.24);
-ms-transition: all 0.2s cubic-bezier(0.71, 1.7, 0.77, 1.24);
-o-transition: all 0.2s cubic-bezier(0.71, 1.7, 0.77, 1.24);
transition: all 0.2s cubic-bezier(0.71, 1.7, 0.77, 1.24);
pointer-events: none;
/* overflow: overlay; */
z-index: 999999;
}
[tooltip]:hover:before,
[tooltip]:hover:after {
opacity: 1;
pointer-events: auto;
top: calc(100% + 0px);
z-index: 99999;
overflow: visible;
position: absolute;
}
/* SECONDARY TOOLTIP (E) */
.claro .dojoxGridHeader:first-child .dojoxGridRowTable {
border-left-width: 0;
}
.claro .dojoxGridMasterHeader .dojoxGridRowTable {
border-left: 1px solid #BCBCBC;
border-right: 1px solid white;
background-color: transparent;
}
.base .dojoxGridRowTable {
height: 30px !important;
word-wrap: break-word;
}
table.dojoxGridRowTable {
table-layout: auto;
}
.dojoxGridHeader table {
text-align: center;
}
.dojoxGrid table {
padding: 0;
}
.dojoxGridRowTable {
table-layout: fixed;
width: 0;
empty-cells: show;
}
table {
font-size: 100%;
}
table[Attributes Style] {
border-top-width: 0px;
border-right-width: 0px;
border-bottom-width: 0px;
border-left-width: 0px;
-webkit-border-horizontal-spacing: 0px;
-webkit-border-vertical-spacing: 0px;
}
user agent stylesheet
table {
display: table;
border-collapse: separate;
border-spacing: 2px;
border-color: grey;
}
.claro .dojoxGridHeader:first-child {
/* margin-left: -50px; */
text-align: left;
margin: 0px -1px;
}
.dojoxGridHeader {
position: absolute;
overflow: hidden;
cursor: default;
}
.base .dojoxGrid {
background-color: #FFFFFF;
font-size: 12px;
color: #00204e;
padding: 0px 1px 20px 0px;
border-top: 0px;
height: 40px;
/* margin-top: 115px; */
/* border-top: solid 1px #D0D0D0; */
/* border-bottom: solid 1px #D0D0D0; */
/* margin-bottom: 20px; */
width: 100%;
/* width: 647px; */
/* height: 226px !important; */
}
.base .dojoxGrid {
background-color: transparent;
border-width: 1px 0 0 0;
font-size: 1em;
}
.base .dojoxGrid {
font-size: 0.916em;
}
.dojoxGrid {
position: relative;
background-color: #EBEADB;
font-family: Geneva, Arial, Helvetica, sans-serif;
-moz-outline-style: none;
outline: none;
overflow: hidden;
height: 0;
}
.portlet {
margin: 4px 0 30px 0;
padding: 0;
font-size: 0.75em;
}
body {
/* font-family: "Helvetica Neue", Helvetica, Arial, sans-serif; */
font-size: 14px;
color: #00204c;
/* margin-left: 125px; */
margin: 0 auto;
}
tbody {
display: table-row-group;
vertical-align: middle;
border-color: inherit;
}
.base .dojoxGridRowTable {
height: 30px !important;
word-wrap: break-word;
}
.dojoxGridHeader table {
text-align: center;
}
.dojoxGridRowTable {
table-layout: fixed;
width: 0;
empty-cells: show;
}
table {
font-size: 100%;
}
table {
display: table;
border-collapse: separate;
border-spacing: 2px;
border-color: grey;
}
.claro .dojoxGridHeader:first-child {
/* margin-left: -50px; */
text-align: left;
margin: 0px -1px;
}
.dojoxGridHeader {
position: absolute;
overflow: hidden;
cursor: default;
}
.base .dojoxGrid {
background-color: #FFFFFF;
font-size: 12px;
color: #00204e;
padding: 0px 1px 20px 0px;
border-top: 0px;
height: 40px;
/* margin-top: 115px; */
/* border-top: solid 1px #D0D0D0; */
/* border-bottom: solid 1px #D0D0D0; */
/* margin-bottom: 20px; */
width: 100%;
/* width: 647px; */
/* height: 226px !important; */
}
.base .dojoxGrid {
background-color: transparent;
border-width: 1px 0 0 0;
font-size: 1em;
}
.base .dojoxGrid {
font-size: 0.916em;
}
.dojoxGrid {
position: relative;
background-color: #EBEADB;
font-family: Geneva, Arial, Helvetica, sans-serif;
-moz-outline-style: none;
outline: none;
overflow: hidden;
height: 0;
}
.claro .dojoxGridHeader .dojoxGridRowTable tr {
background: none;
}
.claro .dojoxGridRowTable tr {
background: url(images/row_back.png) #fff repeat-x;
}
tr {
display: table-row;
vertical-align: inherit;
border-color: inherit;
}
.base .dojoxGridRowTable {
height: 30px !important;
word-wrap: break-word;
}
.dojoxGridHeader table {
text-align: center;
}
.dojoxGridRowTable {
table-layout: fixed;
width: 0;
empty-cells: show;
}
table {
font-size: 100%;
}
table {
display: table;
border-collapse: separate;
border-spacing: 2px;
border-color: grey;
}
.claro .dojoxGridHeader:first-child {
/* margin-left: -50px; */
text-align: left;
margin: 0px -1px;
}
.dojoxGridHeader {
position: absolute;
overflow: hidden;
cursor: default;
}
.base .dojoxGrid {
background-color: #FFFFFF;
font-size: 12px;
color: #00204e;
padding: 0px 1px 20px 0px;
border-top: 0px;
height: 40px;
/* margin-top: 115px; */
/* border-top: solid 1px #D0D0D0; */
/* border-bottom: solid 1px #D0D0D0; */
/* margin-bottom: 20px; */
width: 100%;
/* width: 647px; */
/* height: 226px !important; */
}
.base .dojoxGrid {
background-color: transparent;
border-width: 1px 0 0 0;
font-size: 1em;
}
.base .dojoxGrid {
font-size: 0.916em;
}
.dojoxGrid {
position: relative;
background-color: #EBEADB;
font-family: Geneva, Arial, Helvetica, sans-serif;
-moz-outline-style: none;
outline: none;
overflow: hidden;
height: 0;
}
#AccountSummarySavingsListPortlet th[idx="3"], #AccountSummarySavingsListPortlet td[idx="3"] {
text-align: right !important;
}
.claro .dojoxGridHeader tr:first-child .dojoxGridCell {
border-top: 1px solid transparent;
}
.base .dojoxGridHeader th.dojoxGridCell {
background: none repeat scroll 0 0 #FFFFFF;
font-size: 1em;
font-weight: bold;
color: #00204e;
border-bottom: thin;
border-bottom-style: solid;
border-bottom-color: #D0D0D0;
height: 20px;
text-align: left !important;
/* white-space: nowrap !important; */
padding: 15px 0px;
}
.base .dojoxGridHeader th.dojoxGridCell {
background: none repeat scroll 0 0 #7692B7;
}
.base .dojoxGridHeader .dojoxGridCell {
padding: 5px;
}
.base .dojoxGridHeader .dojoxGridCell {
border: 1px solid #fff;
font-weight: bold;
color: #fff;
}
.base .dojoxGridHeader .dojoxGridCell {
text-align: center;
}
.claro .dojoxGridHeader .dojoxGridCell {
padding: 2px 5px;
background: transparent;
border-bottom: 1px solid #BCBCBC;
border-top: 1px solid white;
border-left: 1px solid white;
border-right: 1px solid #BCBCBC;
vertical-align: top;
}
.claro .dojoxGridHeader .dojoxGridCell {
background: url(images/header.png) #e5edf4 repeat-x top;
border-style: solid;
border-width: 1px;
border-color: #BCBCBC #BCBCBC #BCBCBC transparent;
}
.base .dojoxGrid th {
text-align: center;
}
.base .dojoxGridCell {
border: none;
/* padding-left: 0px; */
}
.base .dojoxGridCell {
border: none;
/* padding-left: 0px; */
}
.base .dojoxGridCell {
border: 1px solid #fff;
padding-left: 3px !important;
}
.claro .dojoxGridCell, .claro .dojoxGridCellFocus {
outline: none;
}
.claro .dojoxGridCell {
padding: 3px 5px;
border-color: transparent #E5DAC8 #E5DAC8 transparent;
}
.claro .dojoxGridCell {
padding: 0px;
border: 1px solid transparent;
}
.base .dojoxGridHeader th.dojoxGridCell {
background: none repeat scroll 0 0 #FFFFFF;
font-size: 1em;
font-weight: bold;
color: #00204e;
border-bottom: thin;
border-bottom-style: solid;
border-bottom-color: #D0D0D0;
height: 20px;
text-align: left !important;
/* white-space: nowrap !important; */
padding: 15px 0px;
}
.base .dojoxGridHeader th.dojoxGridCell {
background: none repeat scroll 0 0 #7692B7;
}
.base .dojoxGridHeader .dojoxGridCell {
padding: 5px;
}
.base .dojoxGridHeader .dojoxGridCell {
border: 1px solid #fff;
font-weight: bold;
color: #fff;
}
.base .dojoxGridHeader .dojoxGridCell {
text-align: center;
}
.claro .dojoxGridHeader .dojoxGridCell {
padding: 2px 5px;
background: transparent;
border-bottom: 1px solid #BCBCBC;
border-top: 1px solid white;
border-left: 1px solid white;
border-right: 1px solid #BCBCBC;
vertical-align: top;
}
.claro .dojoxGridHeader .dojoxGridCell {
background: url(images/header.png) #e5edf4 repeat-x top;
border-style: solid;
border-width: 1px;
border-color: #BCBCBC #BCBCBC #BCBCBC transparent;
}
.base .dojoxGrid th {
text-align: center;
}
.base .dojoxGridCell {
border: none;
/* padding-left: 0px; */
}
.base .dojoxGridCell {
border: none;
/* padding-left: 0px; */
}
.base .dojoxGridCell {
border: 1px solid #fff;
padding-left: 3px !important;
}
.claro .dojoxGridCell, .claro .dojoxGridCellFocus {
outline: none;
}
.claro .dojoxGridCell {
padding: 3px 5px;
border-color: transparent #E5DAC8 #E5DAC8 transparent;
}
.claro .dojoxGridCell {
padding: 0px;
border: 1px solid transparent;
}
.dojoxGridHeader .dojoxGridCell {
border: 1px solid;
border-color: #F6F4EB #ACA899 #ACA899 #F6F4EB;
background: url(images/grid_dx_gradient.gif) #E8E1CF top repeat-x;
padding-bottom: 2px;
}
.dojoxGridCell {
border: 1px solid;
border-color: #EBEADB;
border-right-color: #D5CDB5;
padding: 3px 3px 3px 3px;
text-align: left;
overflow: hidden;
}
caption, th {
text-align: left;
}
address, caption, cite, code, dfn, th, var {
font-style: normal;
font-weight: normal;
}
body, div, dl, dt, dd, li, h1, h2, h3, h4, h5, h6, pre, form, fieldset, input, textarea, p, blockquote, th, td {
/* margin: 0; */
padding: 0;
}
th {
font-weight: bold;
text-align: -internal-center;
}
table {
font-size: 100%;
}
/*------------------------------------------ */
table {
display: table;
border-collapse: separate;
border-spacing: 2px;
border-color: grey;
}
#A_12 {
border: 1px solid #00204e;
border-radius: 50%;
}
<table class="dojoxGridRowTable" border="0" cellspacing="0" cellpadding="0" role="presentation" style="width: 1001px;" id="TABLE_1"><tbody id="TBODY_2"><tr id="TR_3"><th tabindex="-1" aria-readonly="true" role="columnheader" id="TH_4" class="dojoxGridCell dojoDndItem dojoxGridCellFocus" idx="0" style="text-align: center;text-align: center;width:30%;" dndtype="gridColumn_grid1522757357169402654"><div class="dojoxGridSortNode" id="DIV_5">Account</div></th><th tabindex="-1" aria-readonly="true" role="columnheader" id="TH_6" class="dojoxGridCell dojoDndItem" idx="1" style="text-align: center;text-align: center;width:5%;" dndtype="gridColumn_grid1522757357169402654"><div class="dojoxGridSortNode" id="DIV_7">Currency</div></th><th tabindex="-1" aria-readonly="true" role="columnheader" id="TH_8" class="dojoxGridCell dojoDndItem" idx="2" style="text-align: right;text-align: center;width:12%;" dndtype="gridColumn_grid1522757357169402654"><div class="dojoxGridSortNode" id="DIV_9">Pending balance</div></th><th tabindex="-1" aria-readonly="true" role="columnheader" id="TH_10" class="dojoxGridCell dojoDndItem" idx="3" style="text-align: right;text-align: center;width:12%;" dndtype="gridColumn_grid1522757357169402654"><div class="dojoxGridSortNode" id="DIV_11">Available balance</div><a tooltip="this is a test" style="
position: relative;
text-align: center;
width: 100%;
display: block;
/* overflow: visible; */
" id="A_12">?</a>
</th><th tabindex="-1" aria-readonly="true" role="columnheader" id="TH_13" class="dojoxGridCell dojoDndItem" idx="4" style="text-align: center;text-align: center;width:12%;" dndtype="gridColumn_grid1522757357169402654"><div class="dojoxGridSortNode" id="DIV_14">Accrued Interest Rate</div></th><th tabindex="-1" aria-readonly="true" role="columnheader" id="TH_15" class="dojoxGridCell dojoDndItem" idx="5" style="text-align: center;text-align: center;width:10%;" dndtype="gridColumn_grid1522757357169402654"><div class="dojoxGridSortNode" id="DIV_16">Active</div></th><th tabindex="-1" aria-readonly="true" role="columnheader" id="TH_17" class="dojoxGridCell dojoDndItem " idx="6" style="text-align: center;text-align: center;width:12%;" dndtype="gridColumn_grid1522757357169402654"><div class="dojoxGridSortNode" id="DIV_18">Interest Rate</div></th></tr></tbody></table>
A:
because overflow is hidden in class .dojoxGridCell
set overflow to inherit
.dojoxGridCell {
border: 1px solid;
border-color: #EBEADB;
border-right-color: #D5CDB5;
padding: 3px 3px 3px 3px;
text-align: left;
overflow: inherit;
}
| {
"pile_set_name": "StackExchange"
} |
Swift-Useful-Extensions
=======================
##Int Extension##
isEven:Bool
isOdd:Bool
isPositive:Bool
isNegative:Bool
toDouble:Double
toFloat:Float
digits:Int
##Double Extension##
roundTo(decimals:Int) -> Double
##String Extension##
contains(_ string:String) -> Bool
contains(_ string:String, withCompareOptions compareOptions: NSString.CompareOptions) -> Bool
reverse() -> String
##UIView##
var width: CGFloat { get set }
var height: CGFloat { get set }
var size: CGFloat { get set }
var origin:CGPoint { get set }
var x:CGFloat { get set }
var y:CGFloat { get set }
var centerX:CGFloat { get set }
var centerY:CGFloat { get set }
var left:CGFloat { get set }
var right:CGFloat { get set }
var top:CGFloat { get set }
var bottom:CGFloat { get set }
roundCorner(radius:Float)
##NSDate##
daysInBetween(_ date: NSDate) -> Double
hoursInBetween(_ date: NSDate) -> Double
minutesInBetween(_ date: NSDate) -> Double
secondsInBetween(_ date: NSDate) -> Double
##UIImageView##
roundImage()
##UIImage##
croppedImage(bound : CGRect) -> UIImage
| {
"pile_set_name": "Github"
} |
Q:
Fields to 1 row
I'm working with SQL server 2014 and SSIS and I need to do the following:
I have one table with this info:
Location |Location Type |Region | World Region
1 | A | EU | EU
36 | V | AM | AM
24 | S | AS | AS
26 | G | AJ | AJ
and I need to get the next result
Locations
'1,A,EU,EU'
'36,V,AM,AM'
'24,S,AS,AS'
'26,G,AJ,AJ'
Does anybody know an alternative? I'm saving save into a variable the table name, so every table has different number of columns and I need to do this in 8 table.
A:
You can use a dynamic query
DECLARE @tblName VARCHAR(20) = 'your_tbl_name'
DECLARE @columns NVARCHAR(MAX), @sql NVARCHAR(MAX)
SELECT @columns = COALESCE(@columns, '') + '[' + COLUMN_NAME + '], '
FROM INFORMATION_SCHEMA.COLUMNS
WHERE TABLE_NAME = @tblName
SET @sql = 'SELECT CONCAT(' + STUFF(@columns, LEN(@columns), 1, '') + ') FROM ' + @tblName
EXEC(@sql)
| {
"pile_set_name": "StackExchange"
} |
-1512, -1418, -1286, -1116, -908?
-662
What comes next: -6068, -5816, -5792, -5996?
-6428
What is the next term in 30740, 61541, 92336, 123131, 153932, 184745?
215576
What is the next term in 38662, 154778, 348310, 619264, 967646?
1393462
What is the next term in 3744, 7123, 11040, 15495, 20488?
26019
What is next in 226591, 906342, 2039269, 3625378, 5664675, 8157166, 11102857?
14501754
What comes next: -6053, -11838, -17453, -22904, -28197, -33338, -38333?
-43188
What is next in -13182, -12108, -11034, -9960, -8886?
-7812
What comes next: -1233171, -2466745, -3700319, -4933893?
-6167467
What is the next term in 472, 448, 274, -50?
-524
What comes next: -97802, -97984, -98248, -98588, -98998, -99472, -100004, -100588?
-101218
What comes next: 10395, 9833, 9271?
8709
What comes next: 1195, 2599, 4215, 6151, 8515, 11415, 14959, 19255?
24411
What comes next: 53536768, 107073538, 160610308?
214147078
What is next in 925406, 1850814, 2776222, 3701630, 4627038, 5552446?
6477854
What is the next term in 254802, 509449, 764096, 1018743?
1273390
What comes next: 5444, 19279, 42344, 74639, 116164?
166919
What comes next: -278, -2122, -7132, -16892, -32986, -56998, -90512?
-135112
What comes next: -1013266, -1013256, -1013232, -1013188, -1013118, -1013016?
-1012876
What is next in -29470, -58772, -88080, -117394?
-146714
What is the next term in -26800, -26886, -27020, -27202, -27432?
-27710
What is the next term in -3341, -922, 1497?
3916
What is next in 1914, 1724, 1550, 1398, 1274, 1184, 1134?
1130
What is the next term in -4995910, -9991821, -14987732, -19983643, -24979554, -29975465?
-34971376
What is next in 146, -226, -816, -1606, -2578, -3714?
-4996
What is the next term in -135659, -1085284, -3662831, -8682260, -16957531, -29302604, -46531439, -69457996?
-98896235
What is the next term in 10184, 10439, 10698, 10961, 11228, 11499?
11774
What comes next: 23499, 23529, 23559, 23589, 23619?
23649
What is next in -18205, -37219, -57035, -77653?
-99073
What is the next term in 1936137, 3872271, 5808405, 7744539, 9680673?
11616807
What is next in -16055, -33101, -50147, -67193, -84239?
-101285
What is the next term in -203632, -407243, -610844, -814429, -1017992, -1221527?
-1425028
What is next in -999, -3944, -8953, -16146, -25643, -37564?
-52029
What is next in 50851, 50863, 50875, 50887, 50899, 50911?
50923
What is the next term in -1275302, -1275313, -1275342, -1275401, -1275502, -1275657?
-1275878
What is next in -21995926, -43991852, -65987778, -87983704, -109979630, -131975556?
-153971482
What is next in 1309416, 10475077, 35353300, 83800365, 163672552, 282826141?
449117412
What is next in -9111, -9233, -9377, -9543, -9731?
-9941
What is the next term in 817, 1530, 2249, 2968, 3681, 4382, 5065?
5724
What is the next term in 3532, 1637, -268, -2189, -4132, -6103, -8108?
-10153
What is next in 4015955, 8031912, 12047869?
16063826
What comes next: 143989, 288096, 432201, 576304, 720405?
864504
What comes next: -85971, -86106, -86219, -86298, -86331, -86306, -86211?
-86034
What is next in 206661, 206733, 206867, 207093, 207441, 207941?
208623
What is next in 759142, 3036546, 6832222, 12146170, 18978390, 27328882, 37197646?
48584682
What comes next: 414197, 1656819, 3727869, 6627347?
10355253
What comes next: 163, -20, -641, -1904, -4013?
-7172
What is the next term in 5960119, 5960125, 5960131?
5960137
What is the next term in -48691212, -97382422, -146073632, -194764842, -243456052, -292147262?
-340838472
What is next in -4687, -6654, -9991, -14704, -20799, -28282, -37159?
-47436
What is the next term in 1045, 1063, 1077, 1087, 1093, 1095, 1093?
1087
What is next in -5271, -5329, -5331, -5277, -5167, -5001, -4779?
-4501
What comes next: 70, 503, 828, 721, -142, -2085, -5432, -10507?
-17634
What is next in -140968, -563876, -1268740, -2255566, -3524360, -5075128?
-6907876
What comes next: 666, 2842, 6642, 12180, 19570, 28926?
40362
What is the next term in -1001373, -2002755, -3004137, -4005519?
-5006901
What is the next term in 20166, 45735, 71290, 96825, 122334, 147811?
173250
What comes next: -74152, -296637, -667460, -1186633, -1854168, -2670077, -3634372?
-4747065
What is the next term in 6963, 27319, 82557, 190113, 367423?
631923
What is the next term in 691721, 690825, 689927, 689027, 688125, 687221, 686315?
685407
What is the next term in 1603931, 3207833, 4811729, 6415619?
8019503
What comes next: -3819758, -7639523, -11459288, -15279053?
-19098818
What is next in -12280, -51695, -117384, -209347, -327584, -472095?
-642880
What is the next term in 426257, 852513, 1278755, 1704977, 2131173, 2557337?
2983463
What is next in 7097412, 7097413, 7097414?
7097415
What is the next term in -155, -285, -397, -503, -615, -745, -905, -1107?
-1363
What is the next term in -208481, -208466, -208451, -208436, -208421?
-208406
What comes next: 581, 2114, 4593, 8018, 12389, 17706?
23969
What is next in 1253303, 1253876, 1254447, 1255016?
1255583
What is next in -678, -1375, -2234, -3255, -4438, -5783?
-7290
What comes next: 5728699, 11457387, 17186075, 22914763?
28643451
What is next in 582163, 582182, 582199, 582214, 582227?
582238
What comes next: 275377, 275318, 275221, 275086?
274913
What is the next term in 18580, 37194, 55890, 74710, 93696, 112890, 132334?
152070
What comes next: -603, -1380, -2321, -3426, -4695, -6128, -7725?
-9486
What is the next term in 86234, 168015, 249794, 331571, 413346?
495119
What is the next term in 10293, 21641, 32987, 44331, 55673, 67013, 78351?
89687
What is the next term in 27646758, 55293516, 82940274, 110587032?
138233790
What is the next term in 2213849, 4427697, 6641545, 8855393, 11069241, 13283089?
15496937
What comes next: 1338384, 2676773, 4015162?
5353551
What is next in -71680907, -143361819, -215042731, -286723643?
-358404555
What is the next term in 954822, 1909703, 2864582, 3819459, 4774334, 5729207, 6684078?
7638947
What is the next term in 110932, 103800, 91910, 75256, 53832?
27632
What is the next term in -61109618, -122219236, -183328854, -244438472, -305548090?
-366657708
What is the next term in 5787990, 5787964, 5787924, 5787870, 5787802, 5787720?
5787624
What is next in -8620, -17372, -26132, -34900, -43676, -52460, -61252?
-70052
What comes next: -861, 2692, 8613, 16902?
27559
What comes next: 2465, 2418, 2301, 2084, 1737?
1230
What is the next term in 4307799, 8615599, 12923399, 17231199, 21538999, 25846799?
30154599
What is the next term in -5007, -4047, -3087, -2127, -1167, -207?
753
What is next in 7727, 30545, 68553, 121733, 190067, 273537?
372125
What is the next term in 1905618, 3811259, 5716900, 7622541, 9528182, 11433823?
13339464
What comes next: -170866484, -170866473, -170866462, -170866451, -170866440, -170866429?
-170866418
What is next in -346, 449, 2478, 6317, 12542, 21729?
34454
What is the next term in 89274, 357110, 803504, 1428456, 2231966?
3214034
What is the next term in -5403, -10444, -15461, -20442, -25375?
-30248
What comes next: -4765, -8917, -13065, -17209, -21349?
-25485
What is the next term in 260698, 1043681, 2348648, 4175599, 6524534, 9395453?
12788356
What comes next: 4698, 10590, 16480, 22368, 28254, 34138, 40020?
45900
What comes next: 5181, 10368, 15689, 21210, 26997, 33116?
39633
What is the next term in -673804, -673824, -673880, -673990, -674172, -674444, -674824?
-675330
What is next in -9257, -18534, -27823, -37124, -46437?
-55762
What is next in 15920, 16188, 16434, 16646, 16812?
16920
What is the next term in 116267, 116281, 116295, 116309, 116323, 116337?
116351
What comes next: -749770, -749777, -749784?
-749791
What comes next: -780558, -780559, -780560, -780561, -780562?
-780563
What comes next: -55347, -55301, -55205, -55029, -54743, -54317?
-53721
What is next in -14957374, -14957372, -14957370, -14957368, -14957366, -14957364?
-14957362
What comes next: 7840, -3450, -22266, -48608, -82476, -123870?
-172790
What is next in -177410, -177513, -177616, -177719, -177822?
-177925
What is next in -2039092, -2038861, -2038630, -2038399?
-2038168
What is next in -48752, -48869, -48996, -49133?
-49280
What is next in 2032198, 8128889, 18290040, 32515651, 50805722, 73160253?
99579244
What comes next: 47754, 96027, 145346, 196233, 249210?
304799
What is nex | {
"pile_set_name": "DM Mathematics"
} |
Expression of intermediate filament proteins by normal and transformed mouse epidermal-keratinocytes in culture.
The aberrant expression of embryonic simple epithelial keratins K8 and K18 has been previously detected in chemically-induced mouse skin carcinomas and in cultured epidermal keratinocytes containing H-ras oncogenes. In this study, we report that cell lines derived from benign papillomas do not generally synthesize simple epithelial keratins, regardless of the presence of H-ras gene alterations. These results reinforce our previous suggestion that the expression of these keratins during mouse epidermal carcinogenesis is a marker of malignant transformation. The comparison of the two-dimensional electrophoresis intermediate filament protein profiles of transformed keratinocytes in culture, reveal that during in vitro progression to the malignant phenotype increased synthesis of simple epithelial keratins is associated to a general disturbance on the expression of cytoskeletal proteins. | {
"pile_set_name": "PubMed Abstracts"
} |
Fancy Franks and Beans Dutch Oven Recipe
THE Best Crusty Bread (Dutch Oven)
the perfect Crusty Bread recipe. You know, the kind you find in great Italian restaurants that have a gorgeous crackly crust and a chewy inside, perfect for dipping in olive oil. 10 min prep, rest overnight, then bake in cast iron pot | {
"pile_set_name": "Pile-CC"
} |
Adele Island
Adele Island may refer to:
Adele Island (New Zealand), off the northern coast of the South Island of New Zealand
Adele Island (Western Australia), off the Kimberley coast of Western Australia | {
"pile_set_name": "Wikipedia (en)"
} |
Oromo conflict
The Oromo conflict was an armed conflict between the Oromo Liberation Front (OLF) and the Government of Ethiopia. The conflict began in 1973, when Oromo nationalists established the OLF and its armed wing, the Oromo Liberation Army (OLA).
Background
The Oromo people are an ethnic group that mainly inhabit Ethiopia, with communities in neighbouring Kenya and Somalia as well. They are the largest ethnic group in Ethiopia and the wider Horn of Africa; according to a 2007 census, they make up about 34.5% of Ethiopia's population, and others estimate that they make up about 40% of the population.
In 1967, the imperial regime of Haile Selassie I outlawed the Mecha and Tulama Self-Help Association (MTSHA), an Oromo social movement, and conducted mass arrests and executions of its members. The group's leader, Colonel General Tadesse Birru, who was a prominent military officer, was among those arrested. The actions by the regime sparked outrage among the Oromo community, ultimately leading to the formation of the Ethiopian National Liberation Front in 1967 and the Oromo Liberation Front in 1973.
Timeline
1970–1980
In 1974, the Ethiopian military ousted the imperial regime and seized control of the country. The new regime promptly arrested Oromo leaders; subsequently, the Oromo Liberation Front (OLF) was formed during a secret conference attended by Oromo leaders, including Hussein Sora and Elemo Qiltu. A group of armed Oromo fighters in the Chercher Mountains were adopted as the OLF's armed wing, the Oromo Liberation Army (OLA). The OLA increased its activities in the Chercher Mountains, prompting the Ethiopian regime to send its military to the region to quell the insurrection.
In June 1974, General Tadesse Birru, an Oromo nationalist who had been arrested by the imperial regime in 1966 along with other high ranking military officers, escaped from house arrest and joined Oromo rebels led by Hailu Regassa in Shewa. Birru and Regassa were later captured and executed by the Derg regime.
In late August 1974, an OLA unit came down from their stronghold in the Chercher Mountains and made their way closer to Gelemso, hoping that nearby fully grown crops would be able to hide them from Ethiopian soldiers as they advanced towards other nearby towns. Three of the unit's new recruits were unaccustomed to climbing long distances, so they spent the night around the bottom of the mountains, while the rest of the soldiers camped at the top.
When an OLA soldier was sent to retrieve the three recruits, it was discovered that they had been killed by Ethiopian militiamen who had followed the unit to Tiro. A large group of Ethiopian policemen and militiamen surrounded the OLA position in the mountains, and the two opposing groups began to exchange gunfire. A group of Ethiopian soldiers led by General Getachew Shibeshi later arrived, and began to shell the stronghold with mortar rockets, killing most of the OLA's members, including Elemo Qiltu. The event became known as the Battle of Tiro. Contingents of the OLA continued to fight the regime after the battle and later gained a massive influx of recruits and volunteers after the Derg regime executed Tadesse Birru and Hailu Regassa.
In 1976, the OLF established a stronghold in the Chercher Mountains and began reorganizing itself. A congress was created by Oromo leaders, which revised the 1973 OLF Political Program and issued a new detailed program. The program called for the "total liberation of the Oromo nation from Ethiopian colonialism". The conference is now known as the Founding Congress, and marked the beginning of modern Oromo nationalism.
1980–1990
In the 1980s, the OLF estimated that they had over 10,000 soldiers. They were poorly equipped in comparison to other rebel groups in Ethiopia at the time, such as the Eritrean People's Liberation Front (EPLF) and the Tigrayan People's Liberation Front (TPLF). The OLF also opened an office in Sudan in the 1980s, after its office in Somalia was closed down.
During the 1980s, the government of Ethiopia was accused of using scorched earth tactics, such as burning down entire villages and massacring inhabitants. The OLF also lost several prominent members due to government ambushes and heavy fire; the secretary general of the OLF at the time,
Galassa Dilbo, was nearly killed in one such ambush.
1990–2000
In the early 1990s, the Ethiopian Democratic People's Republic began to lose its control over Ethiopia. The OLF failed to maintain strong alliances with the other two big rebel groups at the time; the Eritrean People's Liberation Front (EPLF) and the Tigrayan People's Liberation Front (TPLF). In 1990, the TPLF created an umbrella organization for several rebel groups in Ethiopia, the Ethiopian People's Revolutionary Democratic Front (EPRDF). The EPRDF's Oromo subordinate, the Oromo People's Democratic Organization (OPDO) was seen as an attempted replacement for the OLF.
In 1991, the EPRDF seized power and established a transitional government. The EPRDF and the OLF pledged to work together in the new government; however, they were largely unable to cooperate, as the OLF saw the OPDO as an EPRDF ploy to limit their influence. In 1992, the OLF announced that it was withdrawing from the transitional government because of "harassment and [the]assassinations of its members". In response, the EPRDF sent soldiers to destroy OLA camps. Despite initial victories against the EPRDF, the OLF were eventually overwhelmed by the EPRDF's superior numbers and weaponry, forcing OLA soldiers to use guerrilla warfare instead of traditional tactics.
In the late 1990s, most of the OLF's leaders had escaped Ethiopia, and the land originally administer by the OLF had been seized by the Ethiopian government, now led by the EPRDF.
2000–2018
After the Eritrean–Ethiopian War, the OLF moved its leadership and headquarters to Eritrea. The OLA allegedly began receiving military training and arms from the Eritrean government. On 25 July 2000, OLF and IFLO signed a peace agreement after five days of negotiations, thus ending 20 years of inter-factional fighting. In 2004, the Gambela Region-based Ethiopian Unity Patriots Front (EUPF) rebel group launched forays into Oromia with the help of Eritrea. These raids were only limited in scope, however, as the EUPF had no popular support among the Oromo people, despite having some Oromo members.
In 2006, the OLA in southern Oromia retreated into Kenya in an attempt to regroup. That same year, Brigadier General Kemel Gelchu of the Ethiopian military took 100 of his soldiers and joined the OLF in Eritrea. Despite initially aiding the OLF as leader of its military wing, in 2008, General Kemel Gelchu took matters into his own hands and announced that the OLF would lay down its weapons and abandon its previous goal of seceding Oromia and instead work as a political party to democratize Ethiopia. Along with this announcement, he commanded OLF soldiers in south Oromia to lay down their weapons and surrender to the government.
On 30 May 2015, various media outlets reported that the OLF had attacked a federal police station in the Ethiopian side of Moyale town killing 12 Ethiopian soldiers. This occurred weeks after Ethiopian forces swarmed across the Kenyan border and began absuing locals of Sololo town looking for OLF troops. These forces later responded to the attack by launching an attack on Moyale District Hospital and killing one guard.
A roadside bomb struck a minibus traveling through a village in the Benishangul-Gumuz Region on 18 December 2018, killing ten civilians and injuring one. The police blamed the attack on the Oromo Liberation Front.
References
Works cited
Category:Oromo Liberation Front
Category:Wars involving Ethiopia
Category:Wars involving the states and peoples of Africa
Category:Civil wars involving the states and peoples of Africa
Category:Civil wars post-1945
Category:20th-century conflicts
Category:21st-century conflicts
Category:Ongoing insurgencies
Category:Insurgencies in Africa | {
"pile_set_name": "Wikipedia (en)"
} |
You Won’t BELIEVE What This Olympic Team Doctor DID To Young GIRLS
A former gymnast has testified in court that a sports doctor repeatedly molested her when she was a teenager.
Dr. Larry Nasser worked for USA Gymnastics which trains young gymnasts for the Olympics. There are four criminal cases pending against the doctor, all involving sex-related charges.
Rachel Denhollander has come forward as a witness against the doctor.
I was confident that an anonymous voice would not be enough to stop Nassar and any institution protecting him. She said it felt ‘very humiliating,’ but she trusted Nassar. She said the assaults continued during four subsequent visits, with the doctor also unfastening her bra and massaging her breasts.
— Rachel Denhollander in The Daily Mail
Dozens of young girls have come forward to accuse Nasser of molesting them as far back as the 1990’s.
Nassar was also the doctor for the Michigan State University gymnastics team where most of the abused took place. MSU has fired Nassar. | {
"pile_set_name": "Pile-CC"
} |
Home-user test
Home use tests (HUT) are product marketing tests performed in the consumer's home, contrary to central location tests.
Home test are done in consumers’ homes when products are consumed over a length of time or when an authentic consumption environment is required (for example, where people may modify the product by cooking methods, adding other ingredients or using the product in a personalised manner).
Typically, cleaning products, household goods, small electrodomestics, petfood and products, beauty and cosmetic products may all be tested in the home over a longer or shorter period of time.
Data is collected and processed in the lab.
Category:Market research
For more information on product testing in lab, home or hall see Attestia | {
"pile_set_name": "Wikipedia (en)"
} |
Mufflers are installed in the exhaust system of internal combustion engines and act as acoustic soundproofing devices that reduce noise generated by the exhaust of the internal combustion engine. Mufflers may include an inlet pipe through which the exhaust gas enters the muffler, an internal expansion chamber where the exhaust gases expand to reduce noise, and an outlet pipe through which the exhaust exits the muffler for emission to atmosphere. Some muffler designs also include a double shell housing having an annular inner shell, an annular outer shell, and a layer of insulation interposed between the inner shell and the outer shell. Furthermore, in some muffler designs, the inner shell and the outer shell may be connected by inverted U-ring brackets that are welded to both the inner shell and the outer shell. The inverted U-ring brackets may each extend around a circumferential axis between the inner shell and the outer shell.
The layer of insulation between the inner and outer shells may lead to a large temperature difference between the shells as the inner shell is exposed to the high temperature exhaust gases within the expansion chamber. When exposed to the high temperature exhaust gases, the inner shell may expand (or contract) thermally, thereby subjecting the double shell housing to thermal stress that is concentrated at the welding sites between the inner and outer shells. With extended use, the thermal stress may cause cracking of the outer shell at the welding sites, leading to a shortened lifetime for the muffler. Moreover, other locations of the muffler may also be susceptible to thermal stress and weld cracking where the inner shell is constrained to another component with welded connections.
U.S. Pat. No. 4,094,644 discloses a muffler having an inner shell and an outer shell that are welded together. While effective, the welds between the inner and outer shells may be vulnerable to thermal stress when thermal gradients exist between the inner and outer shells. Thus, there is a need for improved double shell muffler designs that mitigate thermal stress at welding sites of the muffler caused by thermal expansion of the inner shell. | {
"pile_set_name": "USPTO Backgrounds"
} |
Subscribe
'I must face these fears': HK shop owner on strike
Subscribe
When Alan Li listened to the Hong Kong government's response to Sunday's million-strong protest, he knew he had to do more. He's joining about 100 businesses and numerous workers in a rare strike to protest against an extradition bill that many fear will undermine freedom and confidence in the commercial hub. This is his story. (No reporter narration). | {
"pile_set_name": "Pile-CC"
} |
Q:
Sobolev inequalities on bounded open subsets of $\mathbb R^d$ whose boundary is not $C^1$ but Lipschitz
Do the Sobolev inequalities as they are stated on Wikipedia also hold on bounded open subsets of $\mathbb R^d$ whose boundary is not $C^1$ but Lipschitz?
If so, what is a good reference for a proof?
Actually, I'm looking for a reference where the inequalities are proved for any bounded, open set which has the "extension property" (see, for example, [Renardy, Definition 7.11]).
A:
Yes, those inequalities still hold. You only need the construction of the extension operator, which can be found, for example, in Stein's Singular Integrals.
| {
"pile_set_name": "StackExchange"
} |
Magnetic resonance imaging of the post-mortem autistic brain.
Magnetic resonance imaging (MRI) is a valuable, noninvasive tool for understanding structural abnormalities in the brain. The M.I.N.D. Institute at UC Davis has developed a protocol utilizing MRI to investigate anatomical differences in the post-mortem brain by applying a proton density weighted imaging sequence for optimal differences in image intensity (contrast) between gray and white matter. Images of the brain obtained prior to distribution of tissue and further neuropathological examination provide a record of how the brain appeared prior to tissue processing. The virtual representation of the whole brain can also be subjected to additional analyses, such as measuring the volume of brain regions or area of the cortical surface. We describe our procedures for carrying out post-mortem MRI of the human brain. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
Creating dynamic xml file using in linq to xml in C# Error "String cannot be of zero length. Parameter name: oldValue"
Here is the screenshot of the error
I want to happen is that create an xml file dynamically, the nodes of the xml will be the string[] textBoxNamesArray and the value will be the string[] textBoxTextArray
How to fix this issue?
A:
The problem is with the call to String.Replace. The first argument cannot be an empty string. And since you are replacing "" with string.Empty that call isn't really needed and can be removed.
So change the line to
xml.Add(new XElement(i, o));
| {
"pile_set_name": "StackExchange"
} |
/*
* Copyright (C) 2014-2020 Firejail Authors
*
* This file is part of firejail project
*
* This program is free software; you can redistribute it and/or modify
* it under the terms of the GNU General Public License as published by
* the Free Software Foundation; either version 2 of the License, or
* (at your option) any later version.
*
* This program is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License along
* with this program; if not, write to the Free Software Foundation, Inc.,
* 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA.
*/
#include <stdio.h>
#include <sys/types.h>
#include <sys/socket.h>
#include <sys/un.h>
int main(void) {
struct sockaddr_un addr;
int s;
const char *socketpath = "/var/run/minissdpd.sock";
// const char *socketpath = "/var/run/acipd.sock";
s = socket(AF_UNIX, SOCK_STREAM, 0);
if(s < 0) {
fprintf(stderr, "Error: cannot open socket\n");
return 1;
}
addr.sun_family = AF_UNIX;
strncpy(addr.sun_path, socketpath, sizeof(addr.sun_path));
if(connect(s, (struct sockaddr *)&addr, sizeof(struct sockaddr_un)) < 0) {
fprintf(stderr, "Error: cannot connect to socket\n");
return 1;
}
printf("connected to %s\n", socketpath);
close(s);
return 0;
}
| {
"pile_set_name": "Github"
} |
In addition to the $3 million the NHL will pay the University of Michigan to rent Michigan Stadium for the 2013 Winter Classic, NHL commissioner Gary Bettman presented U-M athletic director Dave Brandon a check for $250,000 on Thursday. The $250,000 will go to U-M's general scholarship fund.
Brandon said he began talking to the NHL in November, and the league asked whether Michigan Stadium could be used.
I may be in the minority here but one of the reasons I stopped going to Red Wing games is because of the drunken idiots who have seemed to increase in number over the years. At one point I was attending 10-15 games a year not including the play-offs.
I hope they break the attendance record, but I wonder how rowdy the crowd will be.
LOVE hockey...Kings fan but respect the Wings...& the Winter Classic is great but just feel the pros have NO business in the Big House, not to mention all that "red" in OUR house doesn't thrill me. Then, add the fact that our boys should be playing in the Rose Bowl...hopefully...the same day & doesn't really make sense to me!
What's wrong with putting the game in CoAmerica Park in downtown Detroit...that's where it belongs, no? Guess, Brandon couldn't turn down the $$...but Michigan playing in the Rose Bowl could have an adverse effect on the attendance IMO. Just my thoughts!
"No man is more important than the team, no coach is more important than the team...the Team, the Team, the Team!"
LOVE hockey...Kings fan but respect the Wings...& the Winter Classic is great but just feel the pros have NO business in the Big House, not to mention all that "red" in OUR house doesn't thrill me. Then, add the fact that our boys should be playing in the Rose Bowl...hopefully...the same day & doesn't really make sense to me!
What's wrong with putting the game in CoAmerica Park in downtown Detroit...that's where it belongs, no? Guess, Brandon couldn't turn down the $$...but Michigan playing in the Rose Bowl could have an adverse effect on the attendance IMO. Just my thoughts!
It will probably close to even with Red and Blue. Just a much uglier blue than ours.
I shared Wings season tickets for 14 seasons (1991-2005) and I'm psyched for this one- I'll definitely be there. For me, getting rid of my tickets wasn't the drunken fans; it was the ticket prices. To sit in Section 219 at the Joe and about 10 rows from the top was costing me $220 a game for 4 seats. That's pretty steep for sitting so far away...then you had to pay for all four rounds of the playoffs up front. It was time to find a new hobby after the prices started getting out of hand.
LOVE hockey...Kings fan but respect the Wings...& the Winter Classic is great but just feel the pros have NO business in the Big House, not to mention all that "red" in OUR house doesn't thrill me. Then, add the fact that our boys should be playing in the Rose Bowl...hopefully...the same day & doesn't really make sense to me!
What's wrong with putting the game in CoAmerica Park in downtown Detroit...that's where it belongs, no? Guess, Brandon couldn't turn down the $$...but Michigan playing in the Rose Bowl could have an adverse effect on the attendance IMO. Just my thoughts!
Sorry, this is a win - win and will generate HUGE bucks for Michigan, Ann Arbor and the Wings. The red in the stands? Big deal as long as there's a Winged Wheel on the front. There's going to be a ton of ugly blue there as well. It's not at Comerica because you can fit 70,000 more people in Michigan Stadium which is a no brainer for the NHL and Ilitch family to agree upon. There won't be any ill effects on attendance if UM plays in the Rose Bowl - the hockey game should be at 1:00, the Rose Bowl at 4:00/4:30 so it's a party all day... I like your optimism on UM being there though. I do question the logistics though... I plan on going but trying to hit the bathrooms at a good time will be a challenge and getting a beer is going to be verrrrry difficult. Parking is also going to be crappy because of snow/soft grass/ etc around the Stadium where parking usually is ok in Oct/Nov.
LOVE hockey...Kings fan but respect the Wings...& the Winter Classic is great but just feel the pros have NO business in the Big House, not to mention all that "red" in OUR house doesn't thrill me. Then, add the fact that our boys should be playing in the Rose Bowl...hopefully...the same day & doesn't really make sense to me!
What's wrong with putting the game in CoAmerica Park in downtown Detroit...that's where it belongs, no? Guess, Brandon couldn't turn down the $$...but Michigan playing in the Rose Bowl could have an adverse effect on the attendance IMO. Just my thoughts!
I LOVE seeing all the red in your house. Especially since I'm one of them. ;) | {
"pile_set_name": "Pile-CC"
} |
Statistical mechanics of interacting run-and-tumble bacteria.
We consider self-propelled particles undergoing run-and-tumble dynamics (as exhibited by E. coli) in one dimension. Building on previous analyses at drift-diffusion level for the one-particle density, we add both interactions and noise, enabling discussion of domain formation by "self-trapping," and other collective phenomena. Mapping onto detailed-balance systems is possible in certain cases. | {
"pile_set_name": "PubMed Abstracts"
} |
Loopmasters House and Nu Disco MULTiFORMAT | 696 Mb
Loopmasters are very proud to present House & Nu Disco, a creative fusion of two genres of music that simply doesn't get any better! As we all know House music made its way into the world through Disco and hasn't stopped pumping its way through the decades ever since, that said, this collection travels back in time and takes all the best sounds and influences from the roots of all that is fat and funky.
If you're looking for an inspirational collection of House & Nu Disco then look no further. Press play on the demo track and test drive the free taster samples, and then get ready to push your productions to the next level and download this super inspirational sample pack. This pack is suitable for all genres of House, NU Disco, and Indie Dance and is also suitable for any electronic music production that needs some House & Nu Disco vibes! | {
"pile_set_name": "Pile-CC"
} |
<?php
/**
* Zend Framework
*
* LICENSE
*
* This source file is subject to the new BSD license that is bundled
* with this package in the file LICENSE.txt.
* It is also available through the world-wide-web at this URL:
* http://framework.zend.com/license/new-bsd
* If you did not receive a copy of the license and are unable to
* obtain it through the world-wide-web, please send an email
* to license@zend.com so we can send you a copy immediately.
*
* @category Zend
* @package Zend_Rest
* @subpackage Client
* @copyright Copyright (c) 2005-2015 Zend Technologies USA Inc. (http://www.zend.com)
* @license http://framework.zend.com/license/new-bsd New BSD License
* @version $Id$
*/
/**
* Zend_Rest_Exception
*/
require_once 'Zend/Rest/Exception.php';
/**
* Zend_Rest_Server_Exception
*
* @package Zend_Rest
* @subpackage Client
* @copyright Copyright (c) 2005-2015 Zend Technologies USA Inc. (http://www.zend.com)
* @license http://framework.zend.com/license/new-bsd New BSD License
*/
class Zend_Rest_Client_Exception extends Zend_Rest_Exception
{
}
| {
"pile_set_name": "Github"
} |
On Friday, Gov. Andrew M. Cuomo signed a new law designed to address the opioid epidemic by funding diversion programs for opioid abusers involved in the criminal justice system.
The state will expand funding for diversion models, including law enforcement assisted diversion, known as LEAD.
A May 2018 report by the NYC Department of Health and Mental Hygiene depicts the rise in overdose deaths in Queens, Brooklyn and the Bronx. Chart by DOHMH.
“We must use every tool at our disposal to combat this nation’s opioid epidemic and the underlying issues that lead people to commit crime, and this legislation makes available additional funding to help New Yorkers in need,” Cuomo said. “By helping New Yorkers turn their lives around, this program helps strengthen communities, increase public safety and break the vicious cycle of recidivism once and for all.”
In 2016, at least 318 Queens residents were treated for opioid overdose and 235 died, according to data from the state Department of Health. In 2017, 172 residents died from opioid overdoses, the DOH reports.
Many opioid abusers are involved in the criminal justice system because they have been arrested for buying drugs or for engaging in behaviors associated with drug-seeking, including burglary and sex work.
The new law expands the allowable use of funding from seized or forfeited assets by prosecutors and the Office of Alcoholism and Substance Abuse.
“We’re working to enhance and reform our criminal justice system, and this legislation will support treatment services and help to reduce incarceration,” said Lt. Gov. Kathy Hochul. “Forfeiture funding will now be able to be used for substance abuse programs, mental health services and housing assistance. These actions will increase public safety across the state and help New Yorkers recover and turn their lives around.” | {
"pile_set_name": "Pile-CC"
} |
In recent years, remarkable progress has been made in terms of reducing the thickness and size of semiconductor chips. In particular, the semiconductor chips installed in IC cards such as memory cards and smart cards require a chip having a thickness of not more than 75 μm and a size of not more than 10 mm×10 mm. It is thought that as the demand for IC cards increases in the future, the requirement for small, thin chips will continue to grow.
Semiconductor chips are usually obtained by processing a semiconductor wafer to a prescribed thickness in a back grinding step or etching step or the like, and subsequently dividing the semiconductor wafer into individual chips in a dicing step. In the dicing step, a blade cutting method in which the semiconductor wafer is cut with a dicing blade is generally used. In the blade cutting method, minute defects (also referred to as “chipping”) are sometimes formed on the semiconductor chip as a result of the cutting resistance generated during the cutting process. This occurrence of chipping not only impairs the external appearance of the semiconductor chip, but depending on the degree of chipping, can sometimes cause damage to the circuit pattern on the semiconductor chip, and has recently been recognized as an important problem. In semiconductor chips that have been reduced in thickness and size, the permissible level of chipping is particularly stringent. It is expected that in the future, as further reductions are made in the thickness and size of semiconductor chips, the problem of chipping will become more critical.
The stealth dicing method is another method that can be used in the dicing step. The stealth dicing method is a method particularly suited for cutting ultra thin semiconductor wafers, and it is known that the stealth dicing method is able to suppress chipping. The stealth dicing method is performed in the following manner.
In one specific example of the stealth dicing method, first, a laser beam is irradiated onto the semiconductor wafer so that the focal point of the laser beam is located inside the interior of the semiconductor wafer, thereby forming a brittle modified section inside the semiconductor wafer as a result of multiphoton absorption. By moving the irradiation position of the laser beam along the lines which indicate the positions where the semiconductor wafer is to be divided into individual semiconductor chips (also referred to as “intended cutting lines”), modified sections (also referred to as “dicing lines”) can be formed along the intended cutting lines. Subsequently, a dicing tape is affixed to the rear surface of the semiconductor wafer (the surface on which no circuit is formed), and the dicing tape is then expanded. As a result, external stress is applied to the semiconductor wafer, and the semiconductor wafer cleaves along the intended cutting lines, thus dividing the wafer into individual semiconductor chips and widening the spaces between the semiconductor chips.
The step of expanding the dicing tape is usually called an expansion step. The expansion step is a step that is generally conducted regardless of whether the dicing step is performed using the blade dicing method or the stealth dicing method. When the dicing step is performed using the blade dicing method, the semiconductor wafer is divided into semiconductor chips using the dicing blade, and the expansion step is then performed to widen the spaces between the semiconductor chips. In this case, the expansion step is conducted mainly for the purpose of facilitating pickup of the semiconductor chips. However, when the dicing step is performed using the stealth dicing method, then as described above, the expansion step functions as a step for dividing the semiconductor wafer in which the dicing lines have been formed into individual semiconductor chips. Further, in addition, the expansion step also functions as a step for widening the spaces between the divided semiconductor chips. Examples of the methods and apparatus used in the expansion step are disclosed in Patent Literatures 1 to 3 and the like. | {
"pile_set_name": "USPTO Backgrounds"
} |
Expanding My Business Beyond Beyond Startups and Storytelling
After a couple of years in business, I moved into startup marketing from social media. I was being approached by startups looking for more marketing services from me. It was a more interesting proposition than telling companies how to post on Twitter and Facebook!
Built on my experience as a journalist, entrepreneur and consulting with dozens of clients, the book gives entrepreneurs insight into the value of storytelling and how to integrate it into marketing activities.
Now, I’m excited about broadening the scope of my business beyond startups and storytelling.
The “new approach” shines the spotlight on the broader marketing services that I deliver to clients, who now range from startups to well-established companies.
While they have different needs, the common denominator is they require marketing insight and expertise to accelerate their growth.
Both have varying degrees of marketing capabilities and both need someone with experience to show them the way forward and help them with tactical execution.
While startups want to create a marketing foundation or jump-start their marketing, larger businesses are looking for strategic guidance and tactical execution.
So, let’s start with my new value proposition: “I help fast-growing companies grow even faster by creating marketing that makes an impact”.
The positioning highlights the nature of my clients and their needs. The “makes an impact” reflects how my consulting is focused on the needs of a client’s customers so their marketing generates results – awareness, leads, and sales.
Customer discovery: Many companies need to do a better job of knowing their customers’ needs, interests, and motivations. Their marketing must be customer-centric and answer “What’s in it for me?” in ways that engage, educate and entertain.
Messaging and brand positioning: Having clear and well-articulated messaging about what you do, who you serve and why it matters is super important. I work with companies scrambling to tell better stories because their marketing isn’t resonating. It’s everything from value propositions and boilerplates to benefits, taglines, and elevator pitches.
Marketing strategy: A strategy tells you where you need to go, what you’re going to do and who’s going to do it. Too many brands take a “throw spaghetti at the wall” approach to marketing. Their marketing is unfocused and often a waste of time and resources. I deliver roadmaps for success driven by methodologies and frameworks.
Content marketing strategy: As a storytelling and ex-journalist, I understand the value of content. At the same, companies need to create content with a purpose that meets the interests of consumers. Too many companies don’t have a well-defined plan to create content that resonates.
Tactical execution: At the end of the day, companies need to get stuff done (aka tactical execution). My services include Website overhauls, eBooks, blog posts, sales sheets, brochures presentations, videos, infographics and more. It’s marketing and sales that get people into and through the funnel.
Optimization: Marketing is a mix of ideas, experiments, and creativity. As a result, marketing must be continually monitored, measured and improved. I drill into a company’s marketing, dashboards, data, and analytics to see how channels, content, and campaigns can be tweaked or refreshed to make their more effective.
On the other side of the house, I offer a “CMO for Hire” service, which serves three needs:
Operate: You don’t have a marketing team so you need someone to handle strategy and tactical execution. I deliver marketing content and collateral that engages and educates prospects and customers.
Build: With a well-defined marketing roadmap, we identify the right people needed to create a high-performance marketing team. Then, I work with your people to get them up to speed and tactically executing.
Lead: You have a marketing team but need an experienced marketer to guide, brainstorm and work with them. It gives you the confidence your people are well managed so that marketing really performs.
Coach: I work with entrepreneurs and marketing teams to ensure marketing is dialed in, you’re focused on the most effective channels and have people with the right skills to successfully execute.
In some ways, I’m pulling back the covers on the “new and improved ” ME Consulting. At the same time, I’m delivering the same services but crafted a refreshed story to better communicate what I do and the value delivered.
If you’re a fast-growing company interested in learning more, send me an email – mark@markevans.ca.
About Mark Evans
I help fast-growing companies grow even faster by creating marketing that actually works. Learn more about my services. | {
"pile_set_name": "Pile-CC"
} |
Fred E. Wright (director)
Fred E. Wright (1868-1936) was an American producer, scenarist, silent film director. He was born in Catskill, New York and died in Los Angeles, California. He was married to actress Nell Craig. Prior to entering silent films he was a producer on Broadway.
Filmography
the Clutch of Conscience (1913)*short
Innocence (1913)*short
The Escape (1913)*short
The Sheriff's Reward (1913)*short
The Engineer's Daughter (1913)*short
The Italian Bride (1913)*short
The Crooked Bankers (1913)*short
Puttin' It Over on Papa (1913)*short
A Redskin's Mercy (1913)*short
What the Good Book Taught (1913)*short
The Governor's Double (1913)*short
The Outlaw's Love (1913)*short
The Trapper's Mistake (1913)*short
The Missionary's Triumph (1913)*short
The Miner's Destiny (1913)*short
The Call of the Blood (1913)*short
The Price of Jealousy (1913)*short
The Accidental Shot (1913)*short
Her Brave Rescuer (1913)*short
The Blind Gypsy (1913)*short
Lillie's Nightmare (1913)*short
The Depth of Hate (1913)*short
Race Memories (1913)*short
A Break for Freedom (1913)*short
An Indian Don Juan (1913)*short
Down Lone Gap Way (1914)*short
Where the Heart Calls (1914)*short
The Bond of Love (1914)*short
Graustark (1915)
The White Sister (1915)
The Whirlpool (1915)*short
In the Palace of the King (1915)
The Second Son (1915)*short
Captain Jinks of the Horse Marines (1916)
The Little Shepherd of Bargain Row (1916)
Power (1916)*short
The War Bride of Plumville (1916)*short
The Prince of Graustark (1916)
The Breaker (1916)
The Trufflers (1917)
Be My Best Man (1917)*short
The Man Who Was Afraid (1917)
Star Dust (1917)*short
The Fable of Prince Fortunatus, Who Moved Away from Easy Street, and Silas, the Saver, Who Movied In (1917)*short
The Fibbers (1917)
The Kill-Joy (1917)
The Mysterious Client (1918)
For Sale (1918)
References
External links
Category:1868 births
Category:1936 deaths
Category:People from Catskill, New York
Category:Film directors from New York (state) | {
"pile_set_name": "Wikipedia (en)"
} |
---
Description: Indicates the date and time the document was last printed. The legacy name is &\#0034;DocLastPrinted&\#0034;.
ms.assetid: 57a08471-04b2-4c1e-9212-b76f6ca631f8
title: System.Document.DatePrinted
ms.topic: article
ms.date: 05/31/2018
---
# System.Document.DatePrinted
Indicates the date and time the document was last printed. The legacy name is "DocLastPrinted".
## Windows 10, version 1703, Windows 10, version 1607, Windows 10, version 1511, Windows 10, version 1507, Windows 8.1, Windows 8, Windows 7
```
propertyDescription
name = System.Document.DatePrinted
shellPKey = PKEY_Document_DatePrinted
formatID = F29F85E0-4FF9-1068-AB91-08002B27B3D9
propID = 11
SearchInfo
InInvertedIndex = false
IsColumn = true
typeInfo
type = DateTime
IsInnate = true
```
## Windows Vista
```
propertyDescription
name = System.Document.DatePrinted
shellPKey = PKEY_Document_DatePrinted
formatID = F29F85E0-4FF9-1068-AB91-08002B27B3D9
propID = 11
SearchInfo
IsColumn = true
typeInfo
type = DateTime
IsInnate = true
```
## Remarks
PKEY values are defined in Propkey.h.
## Related topics
<dl> <dt>
[propertyDescription](./propdesc-schema-propertydescription.md)
</dt> <dt>
[searchInfo](./propdesc-schema-searchinfo.md)
</dt> <dt>
[labelInfo](./propdesc-schema-labelinfo.md)
</dt> <dt>
[typeInfo](./propdesc-schema-typeinfo.md)
</dt> <dt>
[displayInfo](./propdesc-schema-displayinfo.md)
</dt> <dt>
[stringFormat](./propdesc-schema-stringformat.md)
</dt> <dt>
[booleanFormat](./propdesc-schema-booleanformat.md)
</dt> <dt>
[numberFormat](./propdesc-schema-numberformat.md)
</dt> <dt>
[dateTimeFormat](./propdesc-schema-datetimeformat.md)
</dt> <dt>
[enumeratedList](./propdesc-schema-enumeratedlist.md)
</dt> <dt>
[drawControl](./propdesc-schema-drawcontrol.md)
</dt> <dt>
[editControl](./propdesc-schema-editcontrol.md)
</dt> <dt>
[filterControl](./propdesc-schema-filtercontrol.md)
</dt> <dt>
[queryControl](./propdesc-schema-querycontrol.md)
</dt> </dl>
| {
"pile_set_name": "Github"
} |
Q:
Is it legal for users to make their SE posts native?
If a site uses content originating from a Stack Exchange site, is the user who owns the content legally permitted to make his post "native" to the non-SE site?
Here's what I mean. Some non-Stack Exchange site uses a post originating from an SE site, with all required attribution. The post was posted on SE by user X. If user X registers on the non-SE site, is the user allowed to remove the attribution and make it native to that site?
It should be, because it is the user's original content, but I just wanted to verify that this is legal.
A:
My iamnotalawyer understanding is that, yes, user X could remove the original attribution on the non-Stack Exchange site.
When an author creates any work in the first place, the act of posting it on SE grants a license to that work under CC BY-SA 3.0. The original author still can choose to use that work elsewhere and issue a different license to that same work as generally, their copyright or other moral rights are still reserved. (With the disclaimer that each locality has different interpretations of what a work for hire and what creations can even be protected by licenses.)
In almost all societies, Licensing a work under the SE/CC terms doesn't necessarily change an author's ability to reuse/relicense subsequent uses of that work - including copyright enforcement if the terms of the CC license are violated.
The original creator could still take their work and use it in some other way. For example, they may have applied a no-commercial CC licence to the work, but they could still separately sell that work to another party. They could choose to allow that third party to sell it on.
More concretely, you could publish Flickr photos with non-commercial licences, but still sell a photo to a newspaper, or offer it to a photo agency to sell on to newspapers and so on.
A:
According to Jaydies, VP of Community Growth, authors are explicitly free to do whatever they want with their content without attributing it back to Stack Exchange:
Philosophy: Your content is yours.
You give up one big thing by posting it here: Your right to stop us (and others who see it here) from sharing it with others who can be helped by it, provided they include the required attribution.
Posting your content here should not in any way restrict your rights to use or post it yourself.
To be clear, we did not intend to apply wacky requirements that you link back to us when you post your own content that you generously shared with the world on our site.
Source
| {
"pile_set_name": "StackExchange"
} |
The oxygen-substituted palmitic acid analogue, 13-oxypalmitic acid, inhibits Lck localization to lipid rafts and T cell signaling.
Palmitoylation of cysteines 3 and 5 is necessary for targeting Lck to lipid rafts and is needed for Lck function in T cell receptor (TCR) signaling. Point mutations of cysteines 3 and 5 result in a form of Lck that fails to associate with the plasma membrane, which limits the usefulness of this genetic approach to address the role of palmitoylation in the distribution of Lck within the plasma membrane. To circumvent this problem, we sought to identify a palmitic acid analogue that would enable plasma membrane association of Lck, but not facilitate its localization within lipid rafts. Here we examined the effects of the heteroatom-substituted analogue of palmitic acid, 13-oxypalmitic acid (13-OP), on Lck subcellular localization and function. 13-OP is similar in chain length to palmitic acid, but possesses reduced hydrophobicity. We found that treatment of cells with 13-OP inhibited incorporation of omega-[(125)I]iodopalmitate into Lck. 13-OP inhibited localization of Lck to lipid rafts without altering its membrane localization. Consistent with the dissociation of Lck from rafts, treatment with 13-OP abolished Lck association with the GPI-anchored protein, CD48, but not the transmembrane glycoprotein CD4. Jurkat T cells treated with 13-OP showed marked reduction in tyrosine phosphorylation and activation of mitogen-activated protein kinase upon TCR stimulation. In conclusion, the less hydrophobic analogue of palmitate, 13-OP, alters the normal acylation of Lck that provides Lck with the necessary hydrophobicity and tight packing order required for inclusion in lipid rafts. | {
"pile_set_name": "PubMed Abstracts"
} |
1. Field of the Invention
The present invention relates to movable partitions and, more particularly, to systems, apparatuses and methods for preventing lateral displacement of one or more portions of such partitions.
2. State of the Art
Movable partitions are utilized in numerous situations and environments for a variety of purposes. Such partitions may include for example, foldable or collapsible doors configured to close off an opening in order to enclose a room or to subdivide a single large room into one or more smaller rooms. The subdivision of a larger area may be desired, for example, to accommodate the simultaneous meeting of multiple groups. In such applications, movable partitions are useful for providing privacy and noise reduction.
Movable partitions may also be used to act as a security barrier, a fire barrier or as both. In such a case, the movable partition may be configured to automatically close upon the occurrence of a predetermined event such as the actuation of an associated alarm. For example, one or more movable partitions may be configured as a fire door or barrier wherein each door is formed with a plurality of panels connected to each other by way of hinge mechanisms. The hinged connection of the panels allows the door to fold up in a compact unit on one side of the opening or it may be stored in a pocket formed within a wall that is designed to conceal the door and preserve the aesthetics of the room where the door is installed. When deployment of the door is necessary, the door is driven by a motor along a track, which track may be incorporated into the header above the door, until the leading edge of the door, often defined by a component called a lead post, complementarily engages a mating receptacle. Such a mating receptacle may be referred to as a jamb or a door post when formed in a fixed structure (such as a wall), or as mating lead post when formed in another door or movable partition. In order for the door to securely close and form an adequate seal, the door's lead post and the doorjamb (or the mating lead post) must substantially align to enable mating engagement of such components and allow corresponding latch mechanisms to engage if desired.
However, even when a movable partition is properly closed, the door seal may be broken, for example, if the lower edge of the door is laterally displaced relative to the top edge of the door. Such lateral displacement of the lower edge of the door can be caused, for example, by a draft created by a fire, an improperly balanced HVAC system, or simply a person pushing on the door. When the seal is broken, smoke and flames may intrude around the door if the door is being used as a fire barrier. If the door is being used in a security installation, a person may sufficiently displace the door thereby allowing that person, or another, to slide or crawl underneath the door. At a minimum, displacement of the base of the door is unsightly and significantly reduces the door's effectiveness as a privacy screen and noise barrier.
One approach to preventing or controlling the lateral displacement of a door, including the door's lower edge, is to engage the lower edge of the door in a guide track that is either embedded in or otherwise attached to the floor. However, the use of a track can present various issues. For example, a track disposed in the floor can pose a safety issue, regardless of whether it protrudes above the floor or is recessed within the floor, potentially resulting in a person twisting an ankle or tripping and falling. Likewise, such a track may act as a significant obstacle for wheeled conveyances. Additionally, such a guide track, being exposed when an associated door is in a retracted state, is prone to damage and may act as a collection point for dirt and debris.
In view of the current state of the art, it would be advantageous to provide a method, apparatus and system to substantially secure a movable partition from lateral displacement. It would be additionally advantageous to provide a method, apparatus and system that substantially maintain the lateral position of a lower edge of a movable partition in order to maintain a seal effected by the partition without the use of a track. | {
"pile_set_name": "USPTO Backgrounds"
} |
Nutrition in Diabetes.
Medical nutrition therapy (MNT) is a key component of diabetes management. The importance of balancing macronutrients, reducing carbohydrate load, lowering glycemic index, and implementing an overall healthy dietary pattern are emerging as better approaches for MNT in diabetes. Recent research points to improved glycemic control, reduction in body weight, and improvement in many cardiovascular risk factors when these approaches are provided by registered dietitians or health care providers. This review article discusses the current evidence about the role of sensible nutrition in diabetes management. Specific eating plans for weight reduction and for patients with type 1 diabetes are also discussed. | {
"pile_set_name": "PubMed Abstracts"
} |
Thursday, October 30, 2014
This is a pair of baby rattles made of 2 pieces of scrap spruce. It is made using the 3D scroll sawing technique. It is a technique thats involves cutting with a scroll saw in more than one dimensions.
First of all I make my pieces square by planing them with my block plane. I secure the piece on my bench using clamps and a wedge.
Then I draw the basic shape of my maraca on the two sides of the piece.
First I cut the piece in half. It is easier to do that now.
Then I cut the exterior pieces. I keep the cut outs and clamp all the pieces together with tape.
I make the cut on the other face of the piece.
I have my basic shape ready. I draw the inner line of the maraca before hollowing it.
I secure the pieces on the bench using the scraps of the cut and clamps. I hollow them out using my curved chisels.
I stop the carving when light can pass through the piece. This technique is also used in spoon carving.
I add some nails to create the rattle noise and glue and clamp the pieces together. I use the cut out scraps to clamp the pieces easier.
Wednesday, October 22, 2014
First of all I cut the bottom of the piece. Then I cut one side. I continue by making two parallel cuts on the sides. Those last cuts do not go all the way.
Then I take my chisel and easily remove material with the direction of the grain. This way I hollowed the body of the piece.
Now I glue all the parts together and apply clamp pressure.
I fine tune the meeting points with my chisel.
I draw the facial characteristics on a scrap piece of plywood and cut them all on my scroll saw.
I glue them up. I apply pressure with a weight.
I fill the gaps with glue and wood dust by sanding over the glue. I sand the whole piece.
I apply a white base color to the piece.
I paint it black.
I wanted the facial characteristics to have a swirly look. So before the black dries completely I applied the green color. This way the two colors mix a little bit.
After the piece is dry, I apply 2 coats of clear satin water based varnish on it. To make things a little easier I made a base using hot glue and screws. This way I don't have to wait for the bottom to dry, before I varnish the rest of the piece because the piece can sit on it.
Tuesday, October 14, 2014
This is the classic "put the bird in the cage" game. One side has the bird and the other has the cage flipped. If you turn the disc fast, the brain takes the two images as one and as a result you see the bird inside the cage.
First of all I design my half basic shapes on a heavy piece of paper.
Then I cut the paper and use it as a template on a scrap piece of plywood. After I draw one side, I flip the paper over to trace the other side.
Then I cut the pieces on the scroll saw.
I sand with 120 grit sandpaper.
I drill the holes in the drill press.
I assemble the piece joining everything with a thin dowel.
I draw the cage with my pyrographer and then I flip the piece and draw the bird.
Saturday, October 11, 2014
Another wooden key rack I made out of a couple of scrap pine boards and iron scraps I had laying around.
First I cut the metallic pegs that will hold the keys. I do that with my dremel tool and metal cutting bits.
Then I secure the pieces on my vise and I use a file to smooth the edges, I also round them over a little bit.
I drill the holes for the screws on my drill press using special bits for metal and oil to cool down the iron while drilling. I use a bigger bit to create a cone for the screws heads to sit in.
Then I mount the pieces on my vise and using a hammer and cylindrical object ( I use my mallet) I bend the iron pegs to the shape I want.
The main body of the rack is made of two wooden pieces joint together with glue and dowels. I drill the holes for the dowels on my drill press and use my copper pointers to find where exactly I need to drill the holes on the opposite board.
I glue and apply some pressure with a couple of clamps and let it dry for a couple of hours.
Then I round over the edges on the scroll saw.
I use my micro carving chisels to carve the word home. I start by making stop cuts and then I slowly remove wood material with the direction of the grain (when possible).
I also carve out the holes for the pegs to sit on.
I apply a coat of primer on the pegs and screws. Then I apply a coat of high gloss black spray paint.
I use water based wood stain (walnut color) on the wood. I sand only the letters with 120 grit sand paper to give the rustic look.
Monday, October 6, 2014
My little mechanic helicopter. I made it out of some scrap pieces of plywood and dowels.
First I cut two round shapes for the gears. I do that with my hole saw bit.
Then I cut the pieces for the box on which the helicopter will sit. I join them with dowels and glue. I cut the dowels flush with a trim saw.
I draw the basic shape of the helicopter and it’s helix on a piece of plywood. For the helicopter’s body I glued two pieces together to have some more mass. I cut them out both on my scroll saw.
To make the gears I divide them in eight and drill them on my drill press. I join them with a dowel and drill all the holes at once to both of them. When I make the first hole I add another dowel to secure that nothing will move while drilling.
I cut the handle on the scroll saw. I secure the dowels on it by adding a small nail and glue. I do the same thing with the helix.
I mount the helicopter on the box with dowels.
I secure the gears on the dowels with a screw and no glue, in case I need to remove them in the future.
I fine tune the dowels diameter with a knife. This way they fit loosely enough. | {
"pile_set_name": "Pile-CC"
} |
6 Visitor Messages
Wanted to give you some Jessica Gamboa rep, but I haven't given enough to others since the last time I gave it to you. Ugh, the rep system here leaves a lot to be desired! Anyway, great pic, thanks for posting!
THX 4 the friend-request, i've seen a lot of great pics that you have posted latetly, including Bridgette B, Cali Carter, Gigi Allens i would to love rep you but i can't now.
Anyway good job thank you for sharing these hot pics with us!
Have a nice weekend! | {
"pile_set_name": "Pile-CC"
} |
The Kaguya clan (かぐや一族, Kaguya Ichizoku) is a now extinct clan, known to have been very barbaric. Select few, namely Kimimaro, possessed the kekkei genkaiShikotsumyaku; this ability was so powerful that even the war-loving Kaguya clan feared it. With the exception of Kimimaro, the clan was killed off when attacking Kirigakure in a failed attempt to show off their ferocity. The clan was very savage and had no tactics when going to battle, and refused to back down even when surrounded and completely outmatched, preferring to fight to the death for fun. Kimimaro would for years live as the last member of the Kaguya clan, but eventually died of a terminal disease.[1]
Apparently, the members who possess the Shikotsumyaku abilities have a different body structure than others, as when Kimimaro was fatally ill, Kabuto Yakushi claimed there had been too little information on his body to give any medical treatment.[1] | {
"pile_set_name": "Pile-CC"
} |
Introduction
============
> Don tilted his beetle eyebrows and asked, 'Tell me, why did you leave that place?'
>
> 'My bawss was sacked, so we got laid all together.'
>
> 'You got what?' Don asked with a start. A young secretary at another desk tittered.
> ([@B25], [@B25] , p. 25)
In this excerpt of Ha Jin's novel *A Free Life*, Nan, a Chinese immigrant in the US startled his interlocutor during a job interview by inadvertently omitting the preposition 'off' of the phrasal verb 'to lay off.' This kind of communication breakdown, as well as other types of difficulty arising from varying cultural norms surrounding communication practices, is a common experience for migrants. In the example above, Nan was able to repair the conversation and eventually obtained the job he was seeking; such happy outcomes are by no means guaranteed, however, and chronically experiencing communication difficulties can be stressful for migrants ([@B27]). Yet, although a substantial amount of cross-cultural psychology research has investigated acculturative stress in general, little attention has been devoted specifically to communication-related acculturative stress (CRAS). This research gap is unfortunate, as communication-related stress may impact not only migrants' well-being but also important aspects of second language (L2) learning such as their willingness to communicate with L2 speakers ([@B35]). As such, CRAS can have negative implications for migrants' social integration into the mainstream community.
In line with current perspectives that view intercultural communication as a key mechanism underlying cultural adaptation ([@B30]), the present study examines the hypothesis that the size and structure of migrants' L2 social networks are important predictors of CRAS. Given that migrants' ability to communicate in the dominant language of the new cultural environment (that is, in an L2) is a core aspect of cross-cultural adaptation, a better understanding of the antecedents of CRAS is essential. Despite [@B53] argument that social networks are ideally suited to research on cross-cultural adaptation, this approach has received surprisingly little empirical attention in areas related to acculturation and intercultural communication. The present study seeks to address this gap, as well as to integrate cross-cultural research on acculturation and research on L2 learning and intercultural communication.
Acculturation, Language, and Stress
===================================
The Role of Language in Acculturation
-------------------------------------
Psychological acculturation refers to the changes experienced by a person as a result of continuous first-hand cross-cultural contact, as s/he strives to be functional in the cultural contexts relevant to her/him ([@B30]; [@B2]). In the case of migrants, these changes are typically far reaching and lead to an extensive reconfiguration of their lives -- beyond acquiring a new language, understanding new cultural traditions, and learning new social norms, migrants need to form new social relationships, as well as create new and/or adjust old identities ([@B48]). To a large extent, these transformations occur through social interactions in the new environment. Migrants acquire knowledge of a new cultural tradition and negotiate their social position in the new environment through repeated communication activities, be it with members of the new cultural group or with cultural artifacts (e.g., television programs, advertisements, internet pages). As such, it is unsurprising that language and L2 competencies occupy a key position in most accounts of acculturation, both in the field of cross-cultural psychology ([@B43]; [@B36]) and of intercultural communication ([@B41]; [@B30]; [@B21]). Thus, the theoretical perspective adopted here views processes of cross-cultural adaptation as occurring "in and through communication" ([@B30], p. 36). While successful communication serves migrants' goals and reflects an adaptive level of social functioning ([@B16]), intercultural communication difficulties can potentially hinder cross-cultural adaptation.
Acculturative Stress
--------------------
Stemming from a stress and coping perspective ([@B33]), most research on psychological acculturation has examined the well-being and adjustment consequences of acculturative changes. Supporting the importance of language in acculturation, a number of studies showed that L2 competencies are a key predictor of adjustment (e.g., [@B43]; [@B31]; [@B56]; [@B27]). The construct of acculturative stress, referring to "a stress reaction in response to life events that are rooted in the experience of acculturation" ([@B48], p. 474), lies at the core of this research on migrants' well-being. Acculturative stress arises in situations where acculturative pressures exceed migrants' perceived ability to cope. Studies have found associations between acculturative stress and a range of negative outcomes, such as depression, suicide ideation, alcohol abuse, and self-reported physical health ([@B20]; [@B23]; [@B13]).
There is little doubt that many aspects of cross-cultural adaptation can be stressful, but critics have suggested that acculturative stress has come to represent a "catch-all concept for every kind of problem that minorities might encounter," thus resulting in "a history of confusion and confounds" ([@B46], p. 116). Indeed, accounts of acculturative stress, as well as scales measuring the construct, typically encompass a variety of difficulties, ranging from discrimination issues to communication difficulties to cultural isolation (e.g., [@B45]; [@B1]). We agree with [@B46] critique -- acculturative stress is a "catch-all" concept -- and believe that it might be important to examine classes of stressors separately. The antecedents and consequences of perceived cultural incompatibility may be quite different from those related to, say, work difficulties. To date, very little work has focused on "unpacking" acculturative stress. As a notable exception, [@B1] examined the personality antecedents of different aspects of acculturative stress as well as the differential ability of these aspects to predict bicultural identity integration.
In line with this view on the importance of unpacking acculturative stress, we focus specifically on CRAS. Conceptualizations of acculturative stress vary in the types of difficulties they encompass, but they consistently include L2 and intercultural communication issues. In fact, most commonly used acculturative stress scales contain items addressing language and communication difficulties (e.g., Social Attitudinal Familial and Environmental Acculturative Stress Scale: [@B44]; Acculturative Stress Scale for International Students: [@B49]; Multidimensional Acculturative Stress Inventory: [@B45]; Riverside Acculturative Stress Index: [@B1]).
Communication-Related Acculturative Stress
------------------------------------------
Communication-related acculturative stress is defined here as migrants' subjective stress reaction in response to chronic difficulties in L2-mediated communication with members of the mainstream cultural group. Both limited linguistic knowledge (i.e., knowledge of syntax, morphology, lexicon, and phonology of a language) and limited competence in sociocultural or pragmatic aspects of communication can lead to intercultural communication breakdowns ([@B55]) and thus result in feelings of incomprehension and frustration, both in native and non-native interlocutors.
We conceptualize CRAS as migrants' reaction to the regular occurrence of such situations. In turn, this stress reaction may impact not only migrants' well-being but also L2 learning variables such as willingness to communicate ([@B35]) or anxiety and uncertainty in the face of intercultural communication events ([@B21]). As such, CRAS may provide a link for integrating research in cross-cultural psychology on culture acquisition and adjustment with research on intercultural communication and on second language acquisition (SLA). With this work, we seek to contribute to a growing body of work (e.g., [@B43]; [@B16]) that aims to integrate these relatively separate strands of research. Our main goal is to examine the role of migrants' L2 social network size and structure in predicting CRAS.
Communication-Related Acculturative Stress and L2 Social Networks
=================================================================
The re-creation of a social architecture in a new cultural environment is a central task of acculturation ([@B32]). It allows migrants to re-establish an adequate support system and to gain access to resources that will facilitate cross-cultural adaptation. In particular, migrants' L2 social networks, referring to social relationships mediated through the L2, are critical for acquiring knowledge of the new cultural tradition ([@B53]) and for fostering communicative competence in the L2 ([@B8]; [@B54]). Similarly, [@B30], p. 123) argues that through engagement in their L2 social network, migrants can, "confirm or reject presumed meanings and motives in natives' communication behaviors." Furthermore, migrants' L2 social networks "exert social control by determining the language \[migrants\] must use and by conveying messages of cultural values and social approval or disapproval" (p. 123). This argument not only underscores the potential importance of L2 social networks in cross-cultural adaptation but also points to their specific role in facilitating socio-cultural and pragmatic aspects of intercultural communication.
Past research (reviewed extensively in [@B15]) has examined the relation between competence in L2 and L2 social networks. [@B8] found that among Spanish first language (L1) participants, proficiency in Basque L2 was associated with the proportion of Basque speakers in their social network. In a study of immigrant students to Sweden, [@B58] detected a similar relation between L2 Swedish proficiency and more Swedish-oriented social networks, although her results were limited to a description of proportions. Similarly, in a case study, [@B54] found a positive association between communicative competence and proportion of members of the mainstream cultural group in the social network of migrants. In parallel, several studies have examined the relation between social networks and adjustment. [@B32] found that higher interconnectedness among closest friends of Asian migrants to the US was related to less depression. Similarly, [@B17] showed that migrant women in Spain who included more Spaniards in their social networks experienced less depression. Taken together, these sets of results support the general hypothesis that characteristics of migrants' L2 social networks may predict CRAS. More specifically, we expect a negative relation between L2 social network size and CRAS.
These studies have focused primarily on the role of the number of social ties in predicting outcomes of interest. Conceptually, however, social network theory emphasizes that people are embedded in webs of social relations ([@B3]) and that the *structure* of the system influences and place constraints on individual actors within it. In line with this perspective, egocentric network analysis (analyzing an individual's personal network in contrast to analyzing a complete bounded network such as a school class or a department in a corporation) is primarily concerned with how characteristics of the social structure within which a person is embedded are associated with outcomes of interest for that person ([@B6]) -- here, CRAS. The interconnectedness of a network -- how tightly woven it is -- is a commonly examined structural feature. It is positively associated with social support, and more interconnected networks facilitate the transmission of information and resources ([@B26]). Translated into language terms for the present case, this suggests that greater interconnectedness in migrants' L2 social network may facilitate the transmission of normative language forms and communicative practices, and therefore be associated with lower CRAS. In a similar vein, [@B9] argues that a tightly connected network fosters norm conformity. This is likely to be beneficial for migrants, as such networks afford greater exposure to a unified representation of cultural norms and L2 communication practices and promotes reinforcement of those norms and practices through various interconnected channels. As such, a tighter L2 social network has the potential to scaffold and regulate intercultural communication more closely. Furthermore, interconnectedness fosters trust and beneficial interdependence among network members ([@B9]; [@B26]), which may also have positive consequences for intercultural communication. Indeed, [@B21] argues that reduced anxiety/uncertainty is key to successful intercultural communication, and a network structure that favors trust would likely contribute to reducing communication anxiety and stress within that network.
In addition, greater interconnectedness among network members indexes a higher likelihood of taking part in triadic communication (since more network members know one another) and therefore of observing L2-mediated interactions between two members of the mainstream group. Thus, greater within-network interconnectedness would reflect greater access to natural cultural representations and L2 communication practices. That is, mainstream members could be expected to avoid adjusting or modifying their interactions with one another given their assumed shared cultural reality and their shared language. By contrast, during one-on-one interactions between a migrant and a mainstream member, the mainstream member might consciously or unconsciously tailor/adapt his or her discourse and communication practices to accommodate the migrant's assumed cultural and communicative competence level. This effect, whereby the native speaker makes conversational adjustments to compensate for the interlocutor's (perceived) linguistic deficits, has been well-documented in the SLA literature (see [@B57], for a review). In triadic interactions involving the migrant and two or more native speakers -- which are more likely in more interconnected L2 networks -- conversational adjustments by well-meaning native speakers are much less likely to occur. In short, cultural transmission of sociolinguistic competency skills might be facilitated in more interconnected networks through observational learning. In line with this hypothesis, recent work has shown that norms can emerge within a network through observational rather than direct learning ([@B28]).
The above discussion underscores the positive potential of interconnected networks. In contrast, [@B4] contends that a tight network structure limits members' access to new information and constrains their social roles and opportunities to explore new ideas. He proposes that the ability to bridge holes in the social structure (weaker connections between densely connected clusters) creates a competitive advantage and gives access to diversified information and resources. [@B4] formulation, however, makes no specific reference to the particularities of immigration and L2 communication contexts, which are typically characterized by social isolation (see, e.g., [@B59]). In the present case, we would expect the benefits of an interconnected L2 social network to outweigh the detrimental constraints described by [@B4]. Therefore, we expect a greater L2 network interconnectedness to be associated with lower CRAS.
Density is the most commonly used index of network interconnectedness ([@B51]). It is defined as the ratio between the number of existing connections among network members and the total number of potential connections within the network. Density is a function of two other structural parameters of a network ([@B51]): (1) the sum of the degrees of network members (the degree of a member is the number of connections the member has to other members) and (2) inclusiveness, or the proportion of network members who know at least one other person in the network. As such, both inclusiveness and density index the level of interrelatedness within a network but at different levels of granularity. As can be seen in **Figure [1](#F1){ref-type="fig"}**, higher inclusiveness entails a lower threshold of interrelatedness (knowing only one or ten other network members contributes equally to inclusiveness) than does density, where the extent to which each person is him/herself interconnected is taken into account. We expect both indices to be associated with CRAS, but we form no specific hypothesis regarding the relative strength of these associations.
![**Relation between density and inclusiveness of social networks (figure design inspired by [@B51], p. 71)**.](fpsyg-06-01111-g001){#F1}
Specificity Considerations
==========================
In order to show that L2 social network size and structure uniquely predict variance in CRAS, we considered several alternative predictors. In addition to including sex and number of years lived in the country of settlement as demographic controls, we controlled for acculturation orientations, self-reported language proficiency, and overall intimacy in the L2 social network.
Acculturation Orientations
--------------------------
Defined here as migrants' motivation for cultural engagement and appreciation of a cultural tradition, acculturation orientations are arguably the most investigated antecedent of cross-cultural adaptation outcomes, with the general finding that more positive orientations toward both mainstream and heritage cultural groups are associated with better adjustment (see [@B40], for a meta-analysis). Past research also established a positive link between ethnolinguistic affiliation, language attitudes, and cultural attitudes on one side, and L2 competence and use on the other side ([@B39]; [@B52]; [@B19]). Similarly, intergroup attitudes and intergroup motivation are considered to be an important antecedent of willingness to communicate, which plays a key role in L2 learning and intercultural communication. Acculturation orientations are undergirded by a suite of behavioral, cognitive, and affective mechanisms that facilitate an approach-oriented stance toward a given culture. As such, they are conceptually very close to variables such as ethnolinguistic affiliation or intergroup attitudes and motivation. For this reason, and for the sake of parsimony, we use acculturation orientation toward the mainstream cultural group as a proxy for the intra-individual affective--cognitive context motivating migrants' L2 communication and engagement in the new cultural group, and acculturation orientation toward the heritage group as a proxy for affiliation with the heritage ethnolinguistic group.
Self-Reported L2 Proficiency
----------------------------
The main idea underlying the hypothesized relation between social network characteristics and CRAS is that more numerous and more interconnected social ties foster social and cultural aspects of communicative competence especially, thus protecting migrants' against the negative effects of intercultural communication difficulties. To support this idea, it is important to show that L2 social network size and structure can predict CRAS above and beyond linguistic knowledge, indexed by self-reported language proficiency.
Overall Intimacy in the L2 Social Network
-----------------------------------------
The nature of the relation between strength of L2 social ties and L2 communication is unclear. [@B30] argues that while strong ties (especially marital relationships) are particularly important for cross-cultural adaptation, all ties (including weak ones) are sources of information helping migrants learn L2 cultural communication patterns. However, measures of the overall strength of migrants' L2 social ties may be important for understanding acculturative stress in general, because such measures may serve as a proxy for the level of emotional support they can expect from their L2 network. A number of studies have established a positive relation between emotional support and adjustment among migrants (e.g., [@B10]; [@B50]). Therefore, it is important to control for this variable.
Communication-Related Acculturative Stress (CRAS) vs. General Acculturative Stress (GAS)
----------------------------------------------------------------------------------------
To further support a case for the role of L2 social networks in promoting social and cultural aspects of communicative competence in the L2, it is important to show their association with CRAS above and beyond any association with general acculturative stress (GAS). To do so, CRAS scores will be residualized on GAS scores, thus eliminating shared variance between the two. To further investigate the specificity of the relation between L2 social network characteristics and CRAS, we will probe whether the association between L2 characteristics and communicative aspects of acculturative stress is stronger than with other aspects of acculturative stress. Past research has established a positive connection between social ties and mental health ([@B29]), suggesting a possible negative relation between L2 network size and GAS. However, we would expect measures of L2 network interconnectedness, because of the fundamental role communication plays in establishing network interconnections, to be primarily related to communicative aspects over and above other aspects of acculturative stress. This test is also in line with our earlier proposal that it is important to examine the various facets of acculturative stress independently.
Present Study
=============
This study examines the specificity of the association between L2 social network characteristics and CRAS. In line with this goal, we focus on linguistically defined social ties instead of social ties in general. We have two research hypotheses:
1. H1: Greater L2 social network size (the number of members) and interconnectedness (inclusiveness and density within the L2 network) will be associated with lower CRAS residualized on GAS, after controlling for years in the new country, sex, acculturation orientations, self-reported language proficiency, average intimacy level in the L2 network.
The main idea underlying this hypothesis is that L2 social networks play an important role in fostering social and cultural aspects of communicative competence, and therefore in protecting migrants' against intercultural communication difficulties. To further investigate the degree of specificity of the relation hypothesized above, namely that the relationship is specific to CRAS and not GAS, we formulate the following secondary hypothesis:
1. H2: The association between interconnectedness measures (inclusiveness and density) in the L2 social network and residualized CRAS will be stronger than the association between interconnectedness measures and GAS residualized on CRAS.
H2 is in fact almost exactly the obverse of H1 (namely that the residualization is the exact reverse of that specified in H1) and so can be coherently interpreted in light of the outcome of the analyses regarding H1.
Materials and Methods {#s1}
=====================
Participants and Procedure
--------------------------
Multicultural students were recruited at an English-speaking university in Montreal, QC, Canada for a study on culture, identity, and language competence. The present sample included 100 participants (*M*~age~ = 24.18 years, SD~age~ = 4.20; 86 women) who were born outside of Canada and did not report English as their native language. Participants came from 46 different countries. On average, they had lived in Canada for 11.06 years (SD = 9.24). A student sample from an English-speaking university was chosen to ensure that all participants would have sufficient linguistic knowledge to be able to communicate and form new relationships in their L2 (English). Given their attendance at an English-speaking university located in a strongly English-speaking neighborhood of Montreal, we used English-speaking Canadians as the mainstream cultural reference group.
Participants were recruited using the local participant pool and received course credit as compensation for their time. The local Institutional Review Board approved the study. The study was administered online and took approximately 45 min to complete. After giving informed consent, participants provided demographic information and completed a number of measures.
Measures
--------
### CRAS and GAS
The Riverside Acculturation Stress Inventory (RASI; [@B1]) is a 15-item questionnaire assessing culture-related difficulties in different life domains (communication difficulties, work, intercultural relations, discrimination, and social isolation) on a 5-point rating scale. The mean score on three items assessing communication difficulties (e.g., 'I often feel misunderstood or limited in daily situations because of my English skills') constituted our measure of CRAS (Cronbach's α = 0.65). The mean score on the remaining 12 items (e.g., 'I feel the pressure that what "I" do is representative of my ethnic/cultural group's abilities.') constituted our measure of GAS (Cronbach's α = 0.80). Total scores can range from 1 to 5. A recent psychometric study showed the RASI is a valid and reliable acculturative stress questionnaire ([@B37]).
### Social Network Characteristics
Using an egocentric network survey, participants nominated up to 15 friends who are native English-speakers and with whom they typically interact in English. They rated their level of intimacy with each friend on a 4-point rating scale. They also indicated whether each pair of friends knew one another. Four indices were derived: L2 network size (number of L2 friends nominated); L2 intimacy (average intimacy rating across all friends nominated); L2 inclusiveness (number of non-isolated friends / total number of friends); and L2 density (number of existing links among nominated friends / number of possible links).
### Acculturation Orientations
The Vancouver Index of Acculturation (VIA; [@B47]) is a 20-item questionnaire that assesses orientations toward the mainstream (VIA-M subscale) and heritage (VIA-H subscale) cultural groups on a 9-point rating scale. Both subscales consist of 10 items with parallel wording. A sample item is: 'I am comfortable working with typical English--Canadian people/people of the same heritage culture as myself.' Total scores can range from 1 to 9. Past research has shown that the VIA is a valid and reliable acculturation orientation questionnaire ([@B47]; [@B24]). Internal consistency in this sample was good for both mainstream (Cronbach's α = 0.82) and heritage (Cronbach's α = 0.88) subscales. A Quebec version of the VIA distinguishes between English--Canadians and French--Canadians as possible mainstream groups. As noted earlier, English-speaking Canadians served as the mainstream reference group.
### Self-Reported L2 Proficiency
Four in-house items assessed participants perceived ability to understand, speak, read, and write English on a 5-point rating scale. Total scores can range from 1 to 5. Internal consistency was very good (Cronbach's α = 0.92).
Analytic Approach
-----------------
In line with our hypotheses, outcome variables were residualized: CRAS scores were residualized on GAS and vice-versa. We used multiple regression to test the study hypotheses. Variables were entered hierarchically to examine the unique predictive ability of social network size and structure. In terms of data preparation and screening, univariate outliers were winsorized to three median absolute deviations around the median ([@B34]). Two multivariate outliers were excluded from the analysis based on their robust Mahalanobis distance ([@B12]) at a stringent level of *p* \< 0.001, leaving 98 participants for the analysis. Unsurprisingly, density and inclusiveness were collinear and were therefore examined in separate models. We verified that statistical assumptions of the linear model were met through model diagnostics. Self-reported L2 proficiency suffered from serious range restriction (participants reported near perfect proficiency) and winsorizing the variable eliminated all residual variation. To retain some variation, we created two categories: participants with average L2 proficiency scores of 5 (ceiling L2 proficiency group) and participants with average L2 proficiency scores lower than 5 (non-ceiling L2 proficiency group). Finally, one observation was removed from analysis based on an overly large Cook's distance ([@B14]) in regression diagnostics, leaving a total sample size of *N* = 97. All analyses were conducting using R version 3.1.2 (package igraph 0.7.1 for network analyses).
Results
=======
Descriptive Results
-------------------
**Table [1](#T1){ref-type="table"}** shows the correlations of the continuous study variables. On average, participants reported low levels of communication-related (*M* = 2.00, SD = 0.96) and general (*M* = 2.56, SD = 0.76) acculturative stress, as measured by the RASI. Just over half the participants (52, or 54%) were in the ceiling L2 proficiency group, indicating native-like self-rated linguistic knowledge of English and 46 (46%) indicating less than native-like self-rated linguistic knowledge of English. Participants nominated 5.79 L2 friends on average (SD = 3.47) and their L2 social network was moderately inclusive (*M* = 0.53, SD = 0.39) and not very dense (*M* = 0.21, SD = 0.27). Participants reported a moderate level of intimacy with their L2 friends on average (*M* = 2.88, SD = 0.68). Participants' acculturation orientations, measured by the VIA, were more positive toward their heritage group (*M* = 7.29, SD = 1.33) than toward the mainstream (English-speaking) cultural group (*M* = 6.82, SD = 1.23), but they were fairly positive in both cases.
######
Zero-order intercorrelations of continuous study variables.
Variable 2 3 4 5 6 7 8 9
---------- ------------------ ---------- --------- ------------ ------------ ------- ---------- --------- -------------
1\. CRAS 0.30\*\* -0.25\* -0.32\*\* -0.21\* -0.09 -0.14 -0.08 -0.33\*\*\*
2\. GAS --- 0.02 -0.04 -0.01 -0.06 0.13 0.18^†^ -0.03
3\. L2 network size --- 0.44\*\*\* -0.05 -0.07 -0.01 -0.02 -0.02
4\. L2 inclusiveness --- 0.71\*\*\* -0.01 0.02 0.11 0.07
5\. L2 density --- 0.12 0.08 0.15 0.12
6\. L2 intimacy --- 0.33\*\* 0.03 0.05
7\. VIA-M --- 0.18^†^ 0.18^†^
8\. VIA-H --- 0.06
9\. Years in Canada ---
†
p
\< 0.10; \*
p
\< 0.05; \*\*
p
\< 0.01; \*\*\*
p
\< 0.001. CRAS, Communication-related acculturative stress; GAS, General acculturative stress; VIA-M, Vancouver Index of Acculturation -- Mainstream subscale; VIA-H, Vancouver Index of Acculturation -- Heritage subscale.
Zero-order correlations provide initial support for H1. L2 network size, *r* = --0.25, *p* = 0.01, 95% *CI* = \[--0.43;--0.05\], and both interconnectedness measures -- L2 inclusiveness, *r* = --0.32, *p \<* 0.001, 95% *CI* = \[--0.49;0--013\], and L2 density, *r* = --0.21, *p* = 0.04, 95% *CI* = \[--0.39;--0.01\] -- are significantly correlated with CRAS. As initial support for H2, neither L2 inclusiveness, *r* = --0.04, *p* = 0.70, 95% *CI* = \[--0.24;0.16\], nor L2 density, *r* = --0.01, *p* = 0.92, 95% *CI* = \[--0.21;0.19\]. are associated with GAS scores in a statistically significant way.
Hypothesis 1: Predicting Residualized Communication-Related Acculturative Stress (CRAS)
---------------------------------------------------------------------------------------
The left panel of **Table [2](#T2){ref-type="table"}** presents results of the regression predicting CRAS (residualized on GAS), as measured by the RASI, using L2 network inclusiveness as a measure of interconnectedness. Longer time lived in Canada is associated with lower CRAS, \[β (SE) = --0.27 (0.09), *p* = 0.004, 95% *CI* = \[--0.44;--0.09\]\], and greater L2 proficiency -- a categorical variable (ceiling versus non-ceiling self-reported L2 proficiency) -- is associated with lower CRAS, β (SE) = --0.87 (0.16), *p* \< 0.001, 95% *CI* = \[--1.19;--0.55\], indicating that, on average, CRAS scores for participants in the ceiling proficiency group are almost a full standard deviation lower than for participants in the non-ceiling group. Moreover, a simple Welch's *t*-test revealed that CRAS scores in the ceiling proficiency group are significantly lower than in the non-ceiling proficiency group, *t′* = --6.54, *df* = 70.09, *p* \< 0.001*)*. Also, being a male is associated with higher levels of CRAS, β (SE) = 0.49 (0.23), *p* = 0.03, 95% *CI* = \[0.04;0.93\]. Neither of the acculturation orientations, nor L2 intimacy, was significantly related to CRAS.
######
Multiple regression of Communication-Related Acculturative Stress (CRAS) and General Acculturative Stress (GAS) with inclusiveness as a measure of interconnectedness.
CRAS as outcome GAS as outcome
-------------------------------- -------------------- -------------------- ------------------ ------------------
Intercept 0.10 (0.60) 0.29 (0.60) -1.72 (0.59)\*\* -1.73 (0.60)\*\*
Sex (male) 0.36 (0.22) 0.44 (0.21)\* 0.23 (0.20) 0.24 (0.21)
Years in Canada -0.03 (0.01)\*\* -0.02 (0.01)\*\* 0.01 (0.01) 0.01 (0.01)
VIA-M 0.04 (0.07) 0.04 (0.06) 0.17 (0.06)\*\* 0.17 (0.06)\*
VIA-H -0.09 (0.06) -0.07 (0.05) 0.07 (0.05) 0.07 (0.05)
L2 proficiency (ceiling group) -0.86 (0.15)\*\*\* -0.79 (0.15)\*\*\* -0.26 (0.15)^†^ -0.26 (0.15)^†^
L2 intimacy 0.03 (0.11) 0.03 (0.11) -0.13 (0.11) -0.13 (0.11)
L2 network size 0.00 (0.02) 0.03 (0.02) 0.04 (0.02)
L2 inclusiveness -0.69 (0.20)\*\*\* -0.40 (0.20)
*R^2^* total 0.386 0.473 0.143 0.143
Adjusted *R^2^* 0.345 0.425 0.075 0.065
*F* total 9.44 (6,90)\*\*\* 9.85 (8,88)\*\*\* 2.12 (7,89)\* 1.84 (8,88)^†^
Δ*R*^2^ 0.09 0.00
†
p
\< 0.10, \*
p
\< 0.05, \*\*
p
\< 0.01, \*\*\*
p
\< 0.001.
β
(SE), unstandardized regression coefficients (standard error).
In support of H1, introducing social network characteristics (L2 network size and L2 inclusiveness) into the model resulted in a statistically significant 9% increase in explained variance, *F*(2,88) = 7.18, *p* = 0.001) and in higher inclusiveness being associated with lower CRAS, β (SE) = --0.30 (0.09), *p* \< 0.001, 95% *CI* = \[--0.46;--0.13\]. Contrary to H1, however, a larger social network alone did not predict lower CRAS in the final model, β (SE) = 0.02 (0.09), *p* = 0.85, 95% *CI* = \[--0.16;0.19\]. Given the statistically significant zero-order correlation between L2 network size and CRAS (*r* = --0.25, *p* = 0.01), we examined the role of L2 network size further. Supplementary analyses revealed that -- after controlling for sex, age, acculturation orientations, and L2 intimacy -- L2 network size was a significant predictor of CRAS, β (SE) = --0.26 (0.09), *p* = 0.004, 95% *CI* = \[--0.44;--0.08\]). Introducing L2 proficiency and L2 inclusiveness into the model eliminated the effect of L2 network size, reducing the strength of the association from β = --0.26 to β = 0.02. This indicates that the variable L2 network size shares most of its variance with L2 proficiency and L2 inclusiveness.
The left panel of **Table [3](#T3){ref-type="table"}** presents results of the regression predicting CRAS using density as a measure of interconnectedness. In this model, also supporting H1, the introduction of social network characteristics (L2 network size and L2 density) resulted in a statistically significant 6% increase in explained variance, *F*(2,88) = 4.26, *p* = 0.02. In line with H1, higher density was also associated with lower CRAS, β (SE) = --0.19 (0.08), *p* = 0.01, 95% *CI* = \[--0.35;--0.04\]. Comparing association strengths for inclusiveness and density with CRAS shows that inclusiveness is a better predictor of CRAS than density, β = --0.30 vs. β = --0.19. In addition, inclusiveness accounts for more unique variance in CRAS than density, Δ*R*^2^ = 0.07 with inclusiveness entered at the last step, versus Δ*R*^2^ = 0.04 for entering density at the last step.
######
Multiple regression of CRAS and GAS with density as a measure of interconnectedness.
CRAS as outcome GAS as outcome
-------------------------- -------------------- -------------------- ------------------ -----------------
Intercept 0.10 (0.60) 0.29 (0.62) -1.72 (0.59)\*\* -1.71 (0.60)\*
Sex (male) 0.36 (0.22) 0.38 (0.21) 0.23 (0.20) 0.23 (0.21)
Years in Canada -0.03 (0.01)\*\* -0.03 (0.01)\*\* 0.01 (0.01) 0.01 (0.01)
VIA-M 0.04 (0.07) 0.04 (0.07) 0.17 (0.06)\*\* 0.17 (0.06)\*
VIA-H -0.09 (0.06) -0.07 (0.05) 0.07 (0.05)^†^ 0.07 (0.05)
L2 proficiency (ceiling) -0.86 (0.15)\*\*\* -0.79 (0.15)\*\*\* -0.26 (0.15)^†^ -0.26 (0.15)^†^
L2 intimacy 0.03 (0.11) 0.05 (0.11) -0.13 (0.11) -0.13 (0.11)
L2 network size -0.03 (0.02) 0.03 (0.02) 0.03 (0.02)
L2 density -0.67 (0.27)\* 0.09 (0.26)
*R^2^* total 0.386 0.441 0.143 0.144
Adjusted *R^2^* 0.345 0.390 0.075 0.066
*F* total 9.44 (6,90)\*\*\* 8.66 (8,88)\*\*\* 2.12 (7,89)\* 1.85 (8,88)^†^
Δ*R*^2^ 0.06 0.00
†
p
\< 0.10, \*
p
\< 0.05, \*\*
p
\< 0.01, \*\*\*
p
\< 0.001.
β
(SE), unstandardized regression coefficients (standard error).
Hypothesis 2: Predicting Residualized GAS
-----------------------------------------
The right panel of **Table [2](#T2){ref-type="table"}** presents results of the regression predicting GAS (residualized on CRAS), as measured by the RASI, using L2 inclusiveness as a measure of interconnectedness. More positive mainstream acculturation orientation, as measured by the VIA-M, are associated with higher levels of GAS, β (SE) = 0.30 (0.11), *p* = 0.01, 95% *CI* = \[0.07;0.52\]. None of the other predictors was significantly related to GAS. Supporting H2, the confidence interval of the inclusiveness coefficient in the regression of CRAS scores (βinclusiveness-CRAS *CI* = \[--0.46;--0.13\], reported in the previous section) did not include the inclusiveness coefficient in the present regression predicting GAS (βinclusiveness-GAS = --0.02). Further supporting the possibility that L2 interconnectedness is associated primarily with communicative aspects of acculturative stress, L2 inclusiveness did not predict residualized GAS scores significantly, β (SE) = --0.02 (0.11), *p* = 0.85, 95% *CI* = \[--0.23;0.19\]. In addition, introducing inclusiveness in the model did not explain any additional variance, *F*(1,88) = 0.04, *p* = 0.85, compared to 7% additional explained variance when introducing this variable in the regression of CRAS scores. Collectively, these results fully support our second hypothesis for inclusiveness.
The right panel of **Table [3](#T3){ref-type="table"}** presents results of the regression predicting residualized GAS using L2 network density as a measure of interconnectedness. As in the case of inclusiveness, introducing L2 density did not explain any additional variance in GAS scores, *F*(1,88) = 0.12, *p* = 0.73, compared to 4% additional explained variance when introducing this variable in the regression of CRAS scores. In further support of H2, the confidence interval of the density coefficient in the regression of CRAS scores (βdensity-CRAS *CI* = \[--0.35;--0.04\], reported in the previous section) did not include the density coefficient in the present regression predicting GAS scores (βdensity-GAS = 0.03). Accordingly, the coefficient for L2 density was not statistically significant, β (SE) = 0.03 (0.09), *p* = 0.73, 95% *CI* = \[--0.16;0.22\]. These results show that interconnectedness measures are associated with CRAS, above and beyond any association with GAS, and that this relation is stronger than between interconnectedness and residualized GAS. Taken together, the results support the idea that L2 social network interconnectedness is associated with communicative aspects of acculturative stress but not with other aspects.
Discussion
==========
For migrants, the process of adapting to a new cultural environment occurs largely through L2-mediated communication with members of the new mainstream cultural group ([@B30]). In this study, we focused on migrants' subjective stress reaction in response to chronic difficulties in this type of intercultural communication. Our first hypothesis that migrants' L2 social network size and interconnectedness would predict CRAS was mostly supported. Larger L2 network size, higher L2 inclusiveness, and higher L2 density were all statistically significantly associated with lower CRAS scores. In addition, both interconnectedness measures uniquely accounted for a significant proportion of variance in the outcome variable after controlling for important covariates. These results support the idea that more interconnected L2 social networks can to some extent protect migrants against the negative psychological effects of intercultural communication difficulties.
However, contrary to our hypothesis, L2 network size did not uniquely predict CRAS. A closer look at the results indicated that the positive and significant relation between these variables disappeared once self-reported L2 proficiency was entered into the model. A possible explanation for this finding is that L2 proficiency mediates the relation between L2 network size and CRAS. Having more L2 friends means more occasions to use the L2. This may help migrants develop their linguistic knowledge of the L2, thus resulting in higher self-reported L2 proficiency scores. In turn, better L2 proficiency facilitates L2 communication in general. This is consistent with past research showing that greater L2 use is associated with greater L2 proficiency ([@B18]).
The finding that interconnectedness, but not L2 network size, accounted for unique variance in CRAS underscores the notion that the structure of L2 social networks matters. This idea, widely accepted in the social network literature ([@B5]; [@B3]), has received limited empirical attention in cross-cultural psychology research. Studies using social network variables to predict L2 or acculturation related phenomena typically focus on social network size rather than on structural variables (e.g., [@B8]; [@B17]; [@B58]; [@B22]). More recently, researchers have started taking structural aspects of social networks into consideration (e.g., [@B38]; [@B16]). The present study contributes to this limited body of work by showing that while the size of migrants' L2 friendship networks is not sufficient to predict CRAS, the configuration of these friendship networks has unique predictive ability. More broadly, these results suggest that not all types of social contact and language use may equally facilitate migrants' communicative competence and relieve associated stress. An interesting direction for future research therefore might be to identify the characteristics of social contact and L2 use situations that might moderate this relation.
Similarly, future research should examine the role of L2 social networks in CRAS in other cultural environments. Montreal is a very specific setting, characterized by two mainstream cultural groups: Francophone Canadians, and Anglophone Canadians. Although English is the dominant local language in the neighborhood where the study was conducted, Francophone Canadians represent the overall numerical majority in Montreal and in the rest of the province. This complexity in the cultural and linguistic composition of the wider study context renders a clear definition of "L2 social networks" difficult. Thus, it would be interesting to extend the current investigation to other cultural settings where the immigrants' L2 community is also the only mainstream cultural group (e.g., Turkish immigrants and Germans in Germany)
As mentioned in the Section "Introduction," a potential mechanism underlying the relation between interconnectedness of the L2 social network and CRAS is that more interconnected networks facilitate observational learning of normative language forms and communicative competence by increasing the likelihood of triadic interactions involving two or more native speakers of the L2, thus providing greater access to unmodified communication practices. Thus, interconnected L2 social networks may foster the learning of both cultural representations and L2 communication practices, which are closely intertwined. In future research, it would be important to further unpack how exactly greater interconnectedness helps learning. Cultural schemata for social interactions ([@B41]) may provide a useful starting point for such an exploration. Cultural schemata for social interactions are, "cognitive structures that contain knowledge for face-to-face interactions in one's cultural environment," ([@B42], p. 403) and that guide communication in this environment. Like other cultural schemata ([@B7]; [@B11]), they emerge out of repeated engagement with particular cultural contexts and become more organized, abstract, and compact through repeated use. In the process, they increasingly guide people's negotiation through their social environment. Cultural schemata for social interactions organize knowledge of cultural norms and preferences and as well as linguistic knowledge. In line with the above perspective on observational learning, more interconnected L2 social networks may facilitate the acquisition and automatization of cultural schemata for social interactions, which may in turn lead to more successful L2 communication, thus acting as a mediator.
Perhaps this greater access to unmodified natural cultural representations and L2 communication practices serves as a mechanism underlying the relation between interconnectedness and CRAS and thus also helps to explain the finding that L2 network inclusiveness was a stronger predictor than density. These two indices measure different stages in the formation of an interconnected social network; low inclusiveness entails low density, whereas high inclusiveness (even at a ceiling value of 1) can be associated with either low or high density. Perhaps early stages of social tie formation lead more to greater inclusiveness than to greater internal density (that is, people first get to know more individuals who are themselves somewhat connected to each other (a few classmates, workmates, immediate neighbors, etc.) and this translates into opportunities for L2-mediated interactions with two or more members of the mainstream group (since these network members know one another). This in turn potentially results in greater observation learning. Once an inclusive mainstream network is achieved, however, increased interconnectedness within the network might accrue little additional advantage.
The results presented here also supported our primary and secondary hypotheses when viewed together that greater interconnectedness in the L2 social network would be associated primarily with communicative aspects of acculturative stress (residualized on GAS) but not GAS (residualized on communicative acculturative stress), reinforcing the idea that the role of L2 interconnectedness is specific to L2 communication aspects of stress and is not simply a stress reliever in general. Nevertheless, it would be important in future research to study the role of L2 network variables in predicting other facets of acculturative stress separately. For example, given the hypothesized role of sustained relationships with members of the mainstream group in learning new cultural schema and minimizing intercultural strain, it would be interesting to examine the ability of these L2 network variables to predict acculturative stress arising from strained intercultural relations.
The ability of L2 interconnected to predict CRAS was in line with our hypothesis, but the finding that L2 network size did not predict GAS at all was somewhat surprising, given the existing literature on the salutary effects of social ties on mental health. One possible explanation of this null effect is the fact that we did not measure network size in general but the L2 network size specifically. Participants with few L2 friends may have a large social network in their L1 on which they rely for support and help meeting non-language-related acculturative hurdles. Another possibility lies in the fact that social ties have costs associated with them, expressed as social obligations and expectations of reciprocity ([@B29]). Nevertheless, the differential pattern of results in predicting communication-related versus GAS lends some support to [@B46], p. 116) argument that acculturative stress may be a, "catch-all concept for every kind of problem that minorities might encounter," and is in line with past research documenting the multifaceted relation between various aspects of acculturative stress and bicultural identity integration ([@B1]). We believe that research on cross-cultural adaptation would benefit from disentangling the various facets of acculturative stress and this study represents one step in that direction by showing that L2 social network interconnectedness is specifically related to CRAS and not to other facets of acculturative stress.
Despite this study's contribution, we want to discuss some limitations. First, reliance on a student sample, and the fact that most of the sample was female, limits the generalizability of the results and introduces potential pressures on social interactions and the form of social relationships that are captured by the L2 network. By attending university in their L2, students are more forced to pursue intercultural communication everyday and may have more opportunities to form relationships with native speakers of their L2 than community members whose days are more tightly structured by work obligations. Related to this, the L2 network was defined in "friendship" terms, which may differ across sexes. Also, friendship is a more central concern for young adults -- the typical student population -- than for people with family responsibilities. It is quite possible that the L2 network would still play a role in alleviating CRAS in a community sample, but the network instrument would have to be adapted to reflect the lived experience of migrants who work and take care of a family. It could, for example, include work relations and acquaintances.
A second limitation concerns the range restriction in English proficiency we observed in our sample. Participants reported very high levels of English proficiency and relatively low levels of acculturative stress on average, indicating good functioning in the new cultural environment overall. It is important to note, however, that we observed the same pattern of results when excluding participants in the "ceiling" L2 proficiency group from the analyses (the *p*-value for density decreased to 0.06 in the prediction of CRAS, but this likely due to a loss of power resulting from shrinking our sample size to 46 participants). In a way, this limitation in terms of range restriction, which raises questions about the generalizability of the results to people facing more difficulties with cross-cultural adaptation, is closely tied to participants being students. By definition, attending daily classes at an English-speaking university assumes a good level of English proficiency. Nevertheless, even such a sample would be expected to exhibit variation in L2 fluency and in more subtle sociolinguistic aspects of language proficiency. Our self-report measure did not allow us to detect this variation, but in future research it would be useful to use objective language measures assessing various aspects of linguistic knowledge.
A third limitation concerns the cross-sectional and correlational nature of the study, which prevents any inferences regarding the causality or temporal order in the relation between L2 interconnectedness and communication-related stress. For example, as an alternative to the observational learning mechanisms discussed earlier, people who experience more communication-related stress may feel more comfortable with L1 friends and not seek out or maintain L2 friendships. In the future, longitudinal studies could examine whether increases in L2 network size and interconnectedness prospectively predict decreased communication-related stress or whether the reverse temporal direction is supported. As a matter of fact, mutually reinforcing bidirectional effects -- whereby more numerous and more interconnected L2 friends buffer against communication-related stress, which in turn facilitates L2 friendships formation -- are likely. Better understanding these mechanisms could have important implications for interventions aimed at facilitating L2 learning and cross-cultural adaptation.
In spite of these limitations, the present study supports the idea that more interconnected L2 social networks can be protective against the negative psychological effects of L2 communication difficulties. In doing so, it shows that the structure of migrants' L2 network matters for language related outcomes. This study also contributes to the emerging body of work that attempts to integrate cultural/cross-cultural research on acculturation and applied linguistics research on communication and SLA. Of relevance to both strands of research, the present work provides support for the view that adapting to a new cultural environment and learning its normative communication practices are not only intertwined but also fundamentally social phenomena occurring through social interactions and relationships.
Author Contributions
====================
MD contributed to the design of the study, to data collection and analysis, and to data interpretation, and she drafted and contributed to revising the manuscript. RS contributed to data collection, to data interpretation, and to revising the manuscript. NS contributed to the design of the study, to data interpretation, and to revising the manuscript. AR contributed to the design of the study, to data interpretation, and to revising the manuscript. All authors approve the final version of this manuscript and agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Conflict of Interest Statement
==============================
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
This research was supported in part by a doctoral fellowship from the Fonds Québécois de Recherche sur la Société et la Culture (FQRSC) to the first author.
[^1]: Edited by: *Mutsumi Imai, Keio University, Japan*
[^2]: Reviewed by: *Hyun-joo Song, Yonsei University, South Korea; Veronica Benet-Martinez, Universitat Pompeu Fabra, Spain*
[^3]: This article was submitted to Cultural Psychology, a section of the journal Frontiers in Psychology
| {
"pile_set_name": "PubMed Central"
} |
Long-term anti-angiogenic activity of intravitreal ellipsoid particles for NVAMD Niranjan B. Pandey, Ph.D. - PI Aleksander S. Popel, Ph.D. - Co-I Jordan J. Green Ph.D. - Co-I Peter A. Campochiaro M.D. - Co-I of subaward Project Summary: Current therapies for wet age-related macular degeneration (AMD) target vascular endothelial growth factors (VEGFA, and placental growth factor PlGF). These include Ranibizumab and Aflibercept. Ranibizumab targets all forms of VEGFA while aflibercept also targets both forms of PlGF. However these drugs do not improve visual acuity in 60-65% of AMD patients, suggesting that other non-VEGF/PlGF pathways are active in these patients. Ranibizumab is administered intravitreally monthly while aflibercept is administered bimonthly after 3 months of monthly injections. Monthly injections increase the risk of infections and are burdensome to patients. Recently, patients have shown their desire to switch to fewer injections by the rapid pace with which aflibercept is making inroads into the AMD market compared to ranibizumab. Finally ranibizumab and aflibercept, although effective, do not cause regression of existing neovasculature, only inhibition of the growth of new vasculature, thus limiting their efficacy. Thus, there is an unmet medical need to target patients that do not respond to current therapies, to extend the time between intravitreal administrations even more to achieve cost savings and reduce side effects, and for agents that can reverse the symptoms of the disease in patients. We propose to develop a peptide therapeutic that could fulfill this medical need. We have developed an innovative prolate ellipsoid microrparticle (microtorpedo) that can encapsulate a wide variety of payloads and is expected to be long-lived in the eye because of its particular polymeric design and its phagocytosis-resistant shape. The anti-angiogenic peptide can block angiogenesis in the presence of VEGF and non-VEGF growth factors. Here we propose to combine these two technologies to design and fabricate a microtorpedo packaged with our lead anti-angiogenic biomimetic peptide derived from the 5 fibril of collagen IV. We present data showing potent efficacy of the peptide in 2 widely used mouse models of AMD and data showing that a close analog of the peptide causes regression of the neovasculature and shows promising inhibition of retinal detachment. Our therapeutic microtorpedo which has been designed for a long half-life in vivo will solve all 3 problems we set out to solve: they will relese peptide over a period of 6 months thus reducing the frequency of intravitreal injections from 12 times a year to 2 times a year, the released peptide will inhibit multiple angiogenic signaling pathways simultaneously because of its mechanism of action, and the peptide will also cause regression of the existing neovasculature thus potentially reversing symptoms of the disease. Any new drug introduced into this space should perform better than aflibercept in head-to-head in vivo models to be commercially viable; thus we propose to test our therapeutic compared to aflibercept in all of our in vivo studies. | {
"pile_set_name": "NIH ExPorter"
} |
It’s not everyday that you find a clean and simple miata. This one here is owned by 19 year old Gabe Santos. Previously he drove a slammed GTI, but has since moved on. He bought the Miata from his cousin about 6 months ago, after being car-less for months. So let’s just say that this one is going to be within the family for a while. Here is Gabe’s slammed Miata. Note: He raised it right before the shoot for his drive down to LA for Formula D Long Beach | {
"pile_set_name": "Pile-CC"
} |
1. Field of the Invention
The present invention relates to light-control devices and to methods of fabricating such devices (the term "light" being used herein to refer in the generic sense to visible light and infrared, ultraviolet and microwave radiation in neighboring portions of the electromagnetic spectrum). More particularly the present invention relates to light-control devices in which small light-control elements are selectively oriented by an electric or magnetic field, and to methods of manufacturing such devices.
2. Description of the Prior Art
Various field-addressable devices have been proposed for selectively controlling incident light (e.g., regulating its transmission, reflection, diffraction or absorption). The present invention pertains to active devices of this type (i.e., capable of rapid and recurring changes in light-control effect) as opposed to inactive devices (i.e., primarily intended for a relatively permanent light-control effect). Such active light-control devices have various applications, e.g., light modulators, display screens, image converters or image intensifiers.
U.S. Pat. No. 2,290,581 discloses an early electro-optic converter in which graphite or aluminum particles, suspended in a liquid medium, are selectively aligned by a scanning electron-gun to modulate the passage of light and provide a viewable image. Similar light-control devices, using dipole particles in liquid suspension and electric orienting fields, are disclosed in U.S. Pat. Nos. 3,257,903; 3,512,876 and 3,527,525.
Such prior art approaches present certain difficulties or disadvantages, for example, high fabrication cost, fragile packaging and high sensitivity to environmental change. Also, these devices have a slow recovery time, caused by their reliance on Brownian movement for returning dipole particles to an unoriented condition.
Recently a new light-control approach substantially avoiding the above-mentioned problems and disadvantages was disclosed by L. F. Frank and J. Y. Kaukeinen in Research Disclosure No. 15535, Vol. 155, pp. 64-71, March, 1977, published by Industrial Opportunities Ltd., Homewell, Havant, Hampshire, PO9 IEF, United Kingdom. This new concept provides a light-control device in which a plurality of light-control elements are dispersed in an elastomeric matrix. As in the prior liquid systems, the light-control elements of this new device have a configuration which can provide both a relatively small and a relatively large obstruction to the passage of light, i.e., having large and small silhouettes, and the dipole characteristic of aligning in a common orientation in an electric or magnetic field. However, in the new approach the elastomeric matrix restrains the elements from random movement within the layer and has an elasticity which allows orientation of the elements under the influence of the field. Upon termination of the field, the elements are quickly returned to their retained orientation by restoring forces of the elastic matrix. The elements disclosed in the aforementioned publication can be employed for area-wise light control, e.g., as camera shutters, or can be used in cooperation with various imagewise field producing means, e.g., a photoconductor, a discharge stylus, or a patterned electrode, to provide new and useful image display panels.
This new approach, utilizing dipole particles in a solid elastomeric material, affords many operational and fabrication advantages; however, in some instances, difficulties have been encountered because of irregularities in the size, shape and/or distribution of the light-control elements. | {
"pile_set_name": "USPTO Backgrounds"
} |
["html",
["p",
"A ",
["a",
{ "href" : "http://reference.com" },
"link using a reference"
],
"."
]
]
| {
"pile_set_name": "Github"
} |
Magpie ! Global Wide GPS Tracker
Anyone who are busy with their time and forgetting things knows the value of tracking. Technology has been changing rapidly, previously it very hard to track the thing and multiple things at once. Though there some devices which help you track your precious things like kids, pets, premium gadgets and many other but they are huge in size, hard to setup and limitations when you change your country.
Magpie is a small gadget with a straightforward objective: to enable you to discover the things you lost.
The GPS tracker is just around an inch in width and joins up with an Android or iOS application. It’s waterproof, and it can be joined to ordinary things – like keys, wallets, or tablets – or to a pet’s restraint or youngster’s knapsack
Magpie is equipped for tracking your relatives, kids, elders and pets and comes finish with its own particular cell phone partner application which bolsters both iOS and android gadgets.
Watch the show video underneath to take in more about the Magpie GPS tracker which is taken to Kickstarter to raise the required $10,000 to make its first generation run. | {
"pile_set_name": "Pile-CC"
} |
Q:
How to make sure only clean URL is used all the time?
Assuming my site will do something if the URL looks like this mysite.com/index.php?myparam=test
In .htaccess, I added the following line:
#RewriteRule ^([a-z]+)$ /index.php?myparam=$1 [L]
Which works great! URL mysite.com/test will redirect accordingly and everything works
I would like to get rid of the dirty URL so that if someone keys in manually mysite.com/index.php?myparam=test he will be redirected to mysite.com/test and still works, without going into an infinite loop..
A:
Ok after some further reading on the net and thanks to Salman's reply, I figured out the answer to my problem :)
the code below will rewrite the dirty url to clean one...
RewriteCond %{THE_REQUEST} ^.\?myparam=([a-zA-Z]+).
RewriteRule ^(.*)$ /%1? [R=301,L]
note that the question mark behind '/%1' is very very important because putting it there (on the redirect target) will clear the query string.
after that, the code below will redirect the clean url to the dirty one without changing the url(still remain clean)
RewriteRule ^([a-zA-Z]+)$ /index.php?myparam=$1 [L]
this won't cause an infinite loop due to the usage of THE_REQUEST which will only respond to your request and not server side redirect (i think)
you may need to read on mod_rewrite syntax guides to customize it for your own needs..
| {
"pile_set_name": "StackExchange"
} |
Small intestinal submucosa as a tunica albuginea graft material.
We evaluated the morphological, immunological and functional response to small intestinal submucosa grafting of the tunica albuginea to determine its potential as a grafting material for penile surgery. Male New Zealand White rabbits underwent a sham procedure (6) or tunical excision and grafting with small intestinal submucosa (6). The erectile response to the intracavernous vasoactive agents sodium nitroprusside plus a papaverine, phentolamine and prostaglandin E1 combination (Sigma Chemical Co., St. Louis, Missouri) was evaluated 45-day postoperatively. The area under the graft was evaluated for stromal collagen and smooth muscle content by Masson's trichrome stain. Protein expression of smooth muscle specific alpha-actin and the inflammatory markers inducible nitric oxide synthase (NOS) and transforming growth factor-beta1 (TGF-beta1) was evaluated by immunohistochemical methods. Total RNA was extracted from the corpora cavernosum underlying the small intestinal submucosa graft and reverse transcriptase-polymerase chain reaction (RT-PCR) was done using an Access system (Promega, Madison, Wisconsin) with gene specific primers for inducible NOS, TGF-beta1 and vascular endothelial growth factor (VEGF). Grafting of the tunica albuginea with small intestinal submucosa had no significant effect on the magnitude or duration of the erectile response to intracavernous vasoactive agents. Histological examination demonstrated no inflammatory changes in the tunica albuginea or corporeal tissue underlying the area of the small intestinal submucosa graft and there was no appreciable alteration in smooth muscle or collagen content. The 2 groups showed intense positive immunostaining to alpha-actin. Weak expression of TGF-beta1 predominantly associated with smooth muscle fibers was identified in the 2 groups of rabbits by immunostaining and RT-PCR. No significant inducible NOS was detected by immunostaining or RT-PCR in either group. Strong VEGF expression was observed in grafted rabbits. The most noticeable (3-fold) increase in expression was detected in splice variant 165. Small intestinal submucosa grafting of the tunica albuginea preserves the duration and magnitude of the erectile response to vasoactive agents. This type of tunical grafting does not stimulate a significant inflammatory response, or cause corporeal fibrosis or loss of cavernous smooth muscle content. Stimulating VEGF may facilitate wound healing and the maintenance of normal erectile function. | {
"pile_set_name": "PubMed Abstracts"
} |
1. Introduction
===============
Gastric cancer (GC) is the fifth most common malignancy and the third leading cause of cancer-related deaths worldwide, especially in East Asia.[@R1] Approximately 90% of stomach tumors are diagnosed as adenocarcinoma, which consist of 2 main histological subtypes: intestinal and diffuse.[@R2] Although the recent diagnostic and therapeutic opportunities have supported good survival in early gastric cancer patients, numerous patients are typically diagnosed at a late stage, leading to a high mortality rate.[@R3]
Many factors are correlated with the development of gastric cancer, such as *Helicobacter pylori* (*H. pylori*) infection, dietary and lifestyle factors, genetics, and epigenetic alterations.^\[^[@R4] [@R5]^\]^ DNA methylation as a major mechanism of epigenetic changes has been proven to involve in the carcinogenesis, progression, and prognosis of GC.^\[^[@R6]--[@R9]^\]^ The gene epigenomic regulation has 2 important components of the molecular mechanism, including the hypermethylation of tumor suppressor genes (TSGs) and hypomethylation of oncogenes.^\[^[@R10] [@R11]^\]^ Death-associated protein kinase (*DAPK*), a tumor suppressor gene, encoding a calcium/calmodulin-dependent serine/threonine kinase, is localized on human chromosome 9p34 and involves in various apoptosis triggered by tumor necrosis factor-alpha (TNF-α), Fas ligand, and interferon-γ (IFN-γ).^\[^[@R12] [@R13]^\]^ Moreover, *DAPK* also participates in a range of cellular processes such as growth factor signaling, inflammation and autophagy, as well as the regulation of immune responses.^\[^[@R14] [@R15]^\]^ The dysfunction of *DAPK* gene via promoter methylation has been linked with many cancers.^\[^[@R16]--[@R19]^\]^
However, the clinical significance of *DAPK* promoter methylation in GC remains to be determined. Therefore, we performed a meta-analysis to assess the strength of the association of *DAPK* promoter methylation in GC versus noncancerous controls, in relation to sex status, tumor stage, tumor histology, and lymph node status in gastric cancer.
2. Materials and methods
========================
2.1. Literature search
----------------------
A systematic search of the literature published without language restriction was conducted on PubMed, Embase, EBSCO, and Web of Science databases prior to May 26, 2016. We used the following keywords and search terms: (stomach OR gastric) AND (cancer OR tumor OR neoplasm OR carcinoma) AND (DAPK OR death-associated protein kinase OR DAPK-kinase) AND (methylation OR epigenetic silencing OR epigenetic inactivation). This study was approved by The Institutional Review Board of Ethics Committee of Beijing Hospital.
2.2. Study selection
--------------------
The eligibility of included studies had to meet the following criteria: (1) gastric cancer patients were histopathologically diagnosed; (2) studies were case-control design or case-series; (3) studies with sufficient information on the *DAPK* promoter methylation frequency were used to evaluate the correlation between *DAPK* promoter methylation and GC; (4) articles published as full papers in English were used in this analysis. The studies excluded did not meet inclusion criteria.
2.3. Data extraction
--------------------
The following data from eligible studies were extracted: the first author\'s surname, year of publication, methylation detection methodology, ethnicity, sample type, number of methylation, the number of the case and control groups, sample size of the different histology of GC, stage of GC, gender status, and lymph node status. Tumor stages of 0--II were defined as the early stage, and tumor stages of III--IV were defined as the advanced stage.
2.4. Statistical analysis
-------------------------
The meta-analysis was performed using the Stata 12.0 software (Stata Corporation, College Station, TX). The overall odds ratios (ORs) with its 95% confidence intervals (CIs) were calculated to evaluate the strength of the correlation between *DAPK* promoter methylation and GC. The Cochran *Q* statistic and *I* ^2^ tests were conducted to test the between-study heterogeneity.[@R20] If *I* ^2^ test shows ≥ 50%, which indicates strong heterogeneity, a random-effects model was applied; otherwise, a fixed-effects model was used.^\[^[@R21] [@R22]^\]^ Egger\'s test was used to assess the possible publication bias.[@R23]
3. Results
==========
3.1. General characteristics of included studies
------------------------------------------------
A total of 193 publications were identified by the original search as described above. Ultimately, 22 eligible studies^\[^[@R24]--[@R45]^\]^ involving 1606 GC patients and 1508 nonmalignant controls were included in the current meta-analysis based on our inclusion criteria (Fig. [1](#F1){ref-type="fig"}). Of the included studies, methylation detection methods included 1 study of combined bisulphite restriction analysis (COBRA) [@R43] and 21 studies of methylation-specific polymerase chain reaction (MSP).^\[^[@R24]--[@R42] [@R44] [@R45]^\]^ Eighteen studies including 1133 cases and 1508 controls assessed the *DAPK* promoter methylation status in gastric cancer and noncancerous samples.^\[^[@R24]--[@R27] [@R29] [@R30] [@R33]--[@R36] [@R38]--[@R45]^\]^ Fifteen studies comprising 813 male and 391 female GC patients investigated the relationship between *DAPK* promoter methylation and gender status.^\[^[@R24] [@R25] [@R27]--[@R29] [@R31] [@R32] [@R34] [@R36]--[@R38] [@R40]--[@R42] [@R44]^\]^ Nine studies comprising 235 early GC patients and 468 advanced GC patients investigated the association between *DAPK* promoter methylation and tumor stage.^\[^[@R24] [@R27]--[@R29] [@R31] [@R32] [@R36] [@R38] [@R44]^\]^ Twelve studies involving 607 lymph node-positive patients and 301 lymph node-negative patients investigated the association between *DAPK* promoter methylation and lymph node status.^\[^[@R24] [@R25] [@R27] [@R29] [@R32] [@R36]--[@R38] [@R40]--[@R42] [@R44]^\]^ Nine studies involving 438 intestinal gastric cancer patients and 356 nonintestinal gastric cancer patients investigated the association between *DAPK* promoter methylation and tumor histology.^\[^[@R25] [@R27] [@R28] [@R31] [@R32] [@R37] [@R38] [@R42] [@R44]^\]^ The basic characteristics of included studies were presented in Table [1](#T1){ref-type="table"}.
{#F1}
######
The baseline characteristics of eligible studies.
3.2. Pooled OR of *DAPK* promoter methylation in GC and noncancerous samples
----------------------------------------------------------------------------
A substantial heterogeneity was found in GC and noncancerous samples (*I* ^2^ = 88.6%), the random-effects model was conducted. The result demonstrated that GC had significantly higher level of *DAPK* promoter methylation than nonmalignant samples (OR = 3.23, 95% CI = 1.70--6.14, *P* \< 0.001, Fig. [2](#F2){ref-type="fig"}), which suggested that *DAPK* promoter methylation may play a key role in the carcinogenesis of GC.
{#F2}
3.3. Subgroup analyses
----------------------
In addition, subgroup analyses were analyzed to identify the influence of *DAPK* promoter methylation on the risk of GC based on ethnicity (Asians and Caucasians) and sample type (tissue and blood) (Table [2](#T2){ref-type="table"}). Subgroup analysis of ethnicity revealed that *DAPK* promoter methylation had a significant correlation with the risk of GC in Asian population (OR = 3.25, 95% CI = 1.51--7.01, *P* = 0.003), but not in Caucasian population (OR = 3.06, 95% CI = 0.96--9.70, *P* = 0.058).
######
Subgroup analyses in gastric cancer versus nonmalignant controls.
Subgroup analysis of sample type showed that there was a statistical association between *DAPK* promoter methylation and increased GC risk among tissue samples (OR = 3.01, 95% CI = 1.52--5.99, *P* = 0.002), but not in blood samples (OR = 9.20, 95% CI = 0.30--285.35, *P* = 0.205). However, the result should be careful as only small subjects in blood and Caucasian population subgroup.
3.4. Association between *DAPK* promoter methylation and gender status in GC
----------------------------------------------------------------------------
As shown in Table [3](#T3){ref-type="table"}, the pooled OR showed that *DAPK* promoter methylation had a similar OR in male and female under a fixed-effects model (*I* ^2^ = 0.0%, OR = 1.16, 95% CI = 0.89--1.51, *P* = 0.267), which suggested that *DAPK* promoter methylation was not associated with gender status in GC.
######
The association of *DAPK* promoter methylation and clinicopathological features.
3.5. Association between *DAPK* promoter methylation and tumor stage
--------------------------------------------------------------------
As shown in Fig. [3](#F3){ref-type="fig"}, the pooled OR revealed that *DAPK* promoter methylation was significantly lower in patients with early gastric cancer than in patients with advanced gastric cancer under a fixed-effects model (*I* ^2^ = 39.4%, OR = 0.69, 95% CI = 0.49--0.96, *P* = 0.03), which indicated that *DAPK* promoter methylation may have an increased risk in patients with advanced gastric cancer.
{#F3}
3.6. Association between *DAPK* promoter methylation and lymph node status
--------------------------------------------------------------------------
As shown in Fig. [4](#F4){ref-type="fig"}, the overall OR revealed that *DAPK* promoter methylation was significantly higher in lymph node-positive patients with gastric cancer than in lymph node-negative patients with gastric cancer under a fixed-effects model (*I* ^2^ = 16.8%, OR = 1.50, 95% CI = 1.12--2.01, *P* = 0.007), which indicated that *DAPK* promoter methylation was significantly increased risk of GC in lymph node-positive patients.
{#F4}
3.7. Association between *DAPK* promoter methylation and tumor histology
------------------------------------------------------------------------
As shown in Table [3](#T3){ref-type="table"}, the overall OR showed that *DAPK* promoter methylation had a similar OR in intestinal gastric cancer and nonintestinal gastric cancer under a fixed-effects model (*I* ^2^ = 0.0%, OR = 0.97, 95% CI = 0.72--1.32, *P* = 0.863), which suggested that *DAPK* promoter methylation was not correlated with tumor histology.
3.8. Publication bias
---------------------
Egger\'s test was conducted to investigate the publication bias in the present analysis (Table [3](#T3){ref-type="table"}). The results showed that no evidence of publication bias was observed in GC versus noncancerous controls, in relation to tumor stage, lymph node status, and tumor histology in cancer (all *P* \> 0.05), and Egger\'s test indicated an obvious evidence of publication bias in relation to gender status in cancer (*P* = 0.004).
4. Discussion
=============
The silencing or downregulation of many tumor-related genes by aberrant promoter methylation are implicated in the occurrence and development of cancers including GC.^\[^[@R14] [@R46]^\]^ In this study, aberrant methylation of tumor suppressor gene *DAPK* was the CpG islands of the promoter region for all eligible studies. However, the results of *DAPK* promoter methylation were inconsistent and controversial in GC and nonmalignant tissues. Two studies reported that the frequency of *DAPK* promoter methylation was significantly lower in GC than in nonmalignant tissues.^\[^[@R40] [@R41]^\]^ Three studies reported that *DAPK* promoter methylation had a similar level in GC and in nonmalignant tissues.^\[^[@R25] [@R34] [@R45]^\]^ The remaining other studies reported that *DAPK* promoter methylation had a relatively higher frequency in GC than in nonmalignant samples.^\[^[@R24] [@R26] [@R27] [@R29] [@R30] [@R33] [@R35] [@R36] [@R38] [@R39] [@R42]--[@R44]^\]^ Thus, we first determined whether *DAPK* promoter methylation was significantly correlated with the risk of GC. Next, we determined whether *DAPK* promoter methylation was associated with clinicopathological features.
Our findings revealed that the *DAPK* promoter methylation rate was significantly higher in GC than nonmalignant samples, which suggested that *DAPK* inactivation via promoter methylation plays an important in the tumorgenesis of GC. No obvious of publication bias was observed, which indicated that our result was reliable. Moreover, we conducted subgroup analyses to find the different association between *DAPK* promoter methylation and subgroups. Subgroup analysis based on ethnic population indicated that Asian population was susceptible to *DAPK* promoter methylation. Subgroup analysis based on sample type indicated that *DAPK* promoter methylation was significantly associated with the risk of GC in tissue subgroup, but not in blood subgroup, indicating that the use of *DAPK* promoter methylation as a noninvasive biomarker based on blood samples could not distinguish gastric cancer and nonmalignant samples. However, the result of blood and Caucasian population subgroup should be cautious because of small sample sizes.
To evaluate the clinical significance of *DAPK* promoter methylation in GC, we further determined whether *DAPK* promoter methylation was correlated with clinicopathological characteristics, including sex status, tumor stage, tumor histology, and lymph node status. Our results showed that *DAPK* promoter methylation was not correlated with gender status and tumor histology. However, we find that *DAPK* promoter methylation had a significant higher OR in lymph node-positive patients than in lymph node-negative patients. In addition, *DAPK* promoter methylation had a significant higher OR in advanced GC than in early GC. Our findings suggested that *DAPK* promoter methylation may involve in the occurrence and progression of GC. Egger\'s test showed that there was not significant publication bias in relation to tumor stage and lymph node status.
Compared with the previous meta-analysis of *DAPK* methylation status,[@R47] our study had some differences. First, our study analyzed nonmalignant samples as the control group, including benign lesions, adjacent tissues, or normal subjects. The previous study did not involve in benign lesions (chronic gastritis and gastric adenoma). Therefore, our study suggests that *DAPK* promoter methylation plays an important role in gastric cancer initiation. Second, our study provided more studies and samples on Caucasian population (our study: 4 studies with 363 samples; the previous study: 3 studies with 273 samples). Third, our study provided more samples in relation to tumor stage (our study: 703 samples; the previous study: 567 samples), in relation to lymph node status (our study: 908 samples; the previous study: 682 samples). Thus, our result suggests that *DAPK* promoter methylation plays an important role in gastric cancer progression. Fourth, our study suggested that no significant association was found in blood subgroup with 2 studies, indicating that the use of *DAPK* promoter methylation as a biomarker based on blood samples could not distinguish GC and nonmalignant samples. The previous study only analyzed the correlation in GC versus normal blood samples. Finally, our study analyzed whether *DAPK* promoter methylation was correlated with gender status and histological type, but the previous study did not evaluated them. In addition, our study included the expression level of *DAPK* to be more informative for clinical diagnosis from *DAPK* promoter methylation to *DAPK* expression to gastric cancer incidence.
Our study had several limitations. First, although we try to search PubMed, Embase, EBSCO, and Web of Science databases as fully as possible, publication bias was found in relation to gender status in GC. Papers with other styles, such as published papers in Chinese and other languages, were excluded due to unreadable content, and unpublished studies and conference abstracts were excluded due to insufficient data. Second, only 2 studies of blood sample were included in the present study, additional studies with larger sample sizes are essential to evaluate whether *DAPK* promoter methylation can become a noninvasive biomarker for GC diagnosis in the future.
In conclusion, our findings indicated that *DAPK* promoter methylation was significantly correlated with increased risk of GC, particularly in Asian subgroup and tissue subgroup. In addition, *DAPK* promoter methylation was also associated with tumor stage and lymph node status. We did not find that *DAPK* promoter methylation was associated with gender status and tumor histology. Further large-scale studies are necessary to provide more insight into the role of *DAPK* promoter methylation in GC patients.
Abbreviations: CIs = confidence intervals, *DAPK* = death-associated protein kinase, GC = gastric cancer, IFN-γ = interferon-γ, ORs = odds ratios, TNF-α = tumor necrosis factor-alpha, TSGs = tumor suppressor genes.
*Authorship*: WJ and TY contributed to the conception and design. XC, HY, and QA contributed to the completion of articles, the extraction of data, the calculation of data and the design of figures and tables. All the authors approved the final manuscript.
The authors have no funding and conflicts of interest to disclose.
| {
"pile_set_name": "PubMed Central"
} |
Brief report: autism awareness: views from a campus community.
This paper reports on a college community's views of the diagnostic characteristics and causes associated with autism spectrum disorders. An anonymous on-line survey of autism knowledge was distributed via campus server university-wide to all undergraduates, graduate students, faculty, and staff. Of the 1,057 surveys completed, 76 % of respondents had more correct answers than neutral and incorrect ones. Respondents who reported that they or someone in their immediate family had autism had significantly more correct responses than other respondents. Demographic variables of respondent sex, age, education, and role at the university independently accounted for significant, though modest, variance in autism knowledge. More accurate and widespread dissemination of information about autism may facilitate a smoother transition for college students who are on the spectrum. | {
"pile_set_name": "PubMed Abstracts"
} |
Xylariphilone: a new azaphilone derivative from the seagrass-derived fungus Xylariales sp. PSU-ES163.
One new azaphilone derivative, named xylariphilone (1), along with 10 known compounds was isolated from the seagrass-derived fungus Xylariales sp. PSU-ES163. Their structures were elucidated on the basis of extensive spectroscopic analysis. The absolute and relative configurations of 1 were determined by circular dichroism spectroscopy and NOEDIFF data. The antimicrobial and cytotoxic activities of the isolated compounds were evaluated. | {
"pile_set_name": "PubMed Abstracts"
} |
Easy Southwest Rice
This easy southwest rice makes a perfect side dish to justt about any Mexican or Southwest dish. It is full of flavorful spices and also has corn incorporated in there too.
A can of southwest corn is the kind of corn you use. That can of southwest corn includes red and poblano peppers. A can of chopped green chilies is also added in to the mix. That adds in flavor along with chili powder, cumin, garlic powder, oregano, and cilantro. Fresh cilantro is best to use, but dried will also work if you don’t have any on hand. I used dried when I made this for the post.
Last, you cook this all in chicken broth instead of water. It’s just another way to add in flavor. | {
"pile_set_name": "Pile-CC"
} |
Q:
How to survive The Last Stand Classic in Dawn of War II
How to survive all 20 waves of The Last Stand in Dawn of War II + Chaos Rising?
As far as I played this game, there is almost no problem to achieve 16th wave. In 16th wave, one could have some problems or complete it in about 1-2 minutes. But after this wave we have the 17th, 18th and 19th waves with some bosses and the ultimate 20th wave with epic bosses, re-spawned previous bosses and separated players. Personally I have no idea how to beat this level. Do you have some working strategy for achieving this?
A:
Mobility is the key. Hit and run, use your abiities smart and whatever you do, don't waste energy. That said, don't be so overly cautious with energy that you never use it, but don't spam rok strikes on single guys or summon dreadnoughts when you already have one. You should already know the effectiveness of blitzing one entrance at the start before everything merges into one massive crapstorm in the middle. A great stratergy is to kite your enemies around the outsides of the board, turning every once in a while to fire of shots etc.
Wave 20 is terribly difficult and it's annoying to fail after you've gotton so far. Once it starts, try to link up with your teammates as soon as possible, negotiate an entrance beforehand and try move to it around the outside of the board, as fast as you can. A farseer's group teleport can certainly help to move teamates rapidly around the board.
I do recommend a suppression weapon in wave 20. And all the minions you can muster. Forms of confuse can make a great impact as well. Finally, superabilities; Orbital Strikes, Roks, and Eldritch Storms can truly turn the tide of all the battles from wave 17 onwards, they are espacially deadly when coupled with suppression or knockdown weapons. Remember however, whatever you put on your hero will be thrown back in your face at wave 16.
| {
"pile_set_name": "StackExchange"
} |
16-Dec-2011
Moderating Inflation Gives Food For Harmless Fun
Since [the early 1970s and between late 1970s to early 1980s], high food inflation episodes were relatively short-lived, with the longest one lasting 27 months in the early 1990s. Even in the severe drought conditions of 1987, the double-digit food inflation episode lasted just 18 months.
All of that pales in comparison with the latest spell of 38 months when inflation stayed above 10 per cent, despite a record 13 rate hikes by the Reserve Bank of India since March last year. | {
"pile_set_name": "Pile-CC"
} |
Author
Keywords
Review Status
1 Introduction
This tutorial explains how to implement a Particle Swarm (PS) optimisation for robust regression as used in Gilli and Schumann [2]. It is still ongoing research, so comments are highly welcome.
The chosen examples are LTS- and LMS-regression.
2 The algorithm
The PS algorithm is implemented as a function PSO that is called with three arguments:
PSO(pso,dataList,OF)
pso is a list that holds the settings of the PS algorithm. dataList is a list that holds the pieces of data necessary to evaluate the objective function. For a regression model, dataList will typically contain the matrix $X$ and the vector $y$. OF is the objective function. In principle, we need not pass these data, since the scoping rules in R also allow to access objects outside a function's environment. However, it makes for a clearer structure of the algorithm to pass all required objects explicitly to the function.
The function will return a list of two elements: beta which is the estimated parameter vector of the model, and OFvalue, the objective function value associated with this solution.
Settings
PS requires us to set several parameters. These are collected in the list pso and then passed to the function. For a discussion of these parameters, see Gilli and Schumann [2]. Initial velocity initV serves as a factor to the randomly set the velocities (computed as $\mathtt{initV} \times \mathtt{mRU(d,nP)}$).
The objective function
Our solutions are stored in a matrix mP which we pass to the objective function. Alternatively, we could have called a function of the apply-family from the main algorithm. However, for objective functions that could be vectorised, this setup here allows for easier reuse of the code. Here, we use the Least Trimmed Squares (LTS) estimator.
In order not to depend on a single data set, we ran 50 times the data-generating model of Salibian-Barrera and Yohai [4] (see the function genData given above) with 400 observations and 40 outliers (set to 150). For each data set, we estimated coefficients with ltsReg and PSO and compute the quantity
for the residuals from ps. The $h$th order statistic of the squared residuals is defined by
h <- (nO+nP+1) %/% 2
The following figure gives the distribution of the ratio computed in Equation X for a model with three regressors. A value of 1 implies both models gave the same answer in terms of their objective functions, a value below unity indicates that the PS algorithm performed better.
Another criterion
Let us demonstrate the flexibility of PS by replacing the objective function: we now use the Least Median of Squares (LMS) estimator. The only thing we need to do is to rewrite the objective function. | {
"pile_set_name": "Pile-CC"
} |
ultiple of 10 and z(a)?
330
Calculate the smallest common multiple of 314 and 3 + -2 - 2 - (-237 + 223).
4082
Let u = 16 - 6. Let s be ((-51)/68)/(1*1/(-4)). Calculate the smallest common multiple of s - (-3)/1 - 2 - -2 and u.
30
Let d be 234/(-220)*(19 + -34). Let y = 9567/550 - d. Find the common denominator of y and -33/130.
650
Suppose u - 279 = l + 143, 0 = u - 3*l - 428. Let m = u + -1232/3. Find the common denominator of -13/80 and m.
240
Suppose 10*c - 216 = 8*c. Let g = -94 + c. What is the least common multiple of 794 and g?
5558
Let j = -92603/180 - -2061/4. Find the common denominator of 59/324 and j.
1620
Let u = -33/52 + 1247/572. Suppose 2*k = -k - 2163. What is the common denominator of u and 2 + 9/(-4) - k/196?
77
Let c(w) = -w**3 + 2*w**2 - 9*w + 2. Let i be c(4). Let j = i + 69. What is the common denominator of (j/108*267)/1 and -137/12?
12
Calculate the least common multiple of (-4 - 170/(-15))/(42/63) and 689.
7579
Let h = 2162071/854719745 + 2/1830235. Find the common denominator of h and -52/2335.
25685
Let k(r) = r**2 - 3*r - 4. Let a(b) = 9*b + 5. Let d be a(9). Suppose v - 4*p - 48 = 0, d = v + v + 2*p. Calculate the lowest common multiple of v and k(5).
132
Let h = -1398363 + 4636971749/3316. What is the common denominator of h and -103/12?
9948
Let i = 2370895/2676 + -886. Calculate the common denominator of i and 151/24.
5352
Let b(q) = q**3 - 1. Let d(n) = -13*n**3 - 5*n**2 - 4*n + 5. Let u(h) = 4*b(h) + d(h). Calculate the smallest common multiple of u(-2) and 7.
427
Suppose 11747*l = 11765*l - 24084. What is the least common multiple of 11 and l?
14718
Let z be (1 - 3)*-6*(-24)/(-18). Calculate the common denominator of 1/6 and (-6)/(-8)*((-5530)/378 + z).
36
Suppose 5*r + 4*g - 198 = 0, -2*r + 3*r - 39 = -g. Let l be r/(-9) + 6/9. Calculate the common denominator of -43/10 and (-260)/(-15) - l/(-1).
30
Let j = 368 - 373. What is the smallest common multiple of (j/(-4))/((-3)/(-120)) and 15?
150
Let s(q) = 2*q**2 + 19*q + 80. Let v be s(-5). Suppose 3*h - 3*d = 63, 8*h + 5*d = 6*h + v. Calculate the lowest common multiple of h and 12.
60
Suppose -5*f + 34 = 104. Calculate the common denominator of 67/2 and 10/f*(-220)/44.
14
Let m(k) = k**2 + 8*k + 14. Let d be m(-6). Let f be (d/(-4))/(3/9)*-4. Suppose -3*y + 18 = -f. What is the lowest common multiple of 14 and y?
56
Let l = 3780 - 151193/40. Calculate the common denominator of l and (-1505)/(-1125) - 2/(-9).
200
Let p = 6203581/1754564 + 2/62663. Find the common denominator of 106/(-4)*(-4)/6 and p.
84
Let x(q) = -24*q - 90. Let d be x(-4). Let k(t) = 5*t - 10. What is the least common multiple of 30 and k(d)?
60
Let f(h) = 10*h**2 + 87*h + 116. Let r(i) = 2*i**2 + 22*i + 29. Let g(m) = 2*f(m) - 9*r(m). Calculate the least common multiple of 6 and g(16).
198
Let m(p) = -4*p**2 + 3*p**2 - 9*p - 6 - 5*p - 36. What is the lowest common multiple of 135 and m(-6)?
270
Let f(a) = a + 13. Let k(u) = -u**2 - 7*u - 5. Let d = 29 - 36. Let v be k(d). What is the smallest common multiple of 9 and f(v)?
72
Suppose -132 = 3*u - 2*y, -4*u - 5*y = -u + 111. Let a = 30 - u. What is the smallest common multiple of 30 and a?
360
Find the common denominator of -47/22 and 5/(-4)*851/(-1480).
352
Let l = 2912 + -11645/4. Let m = 6648649/288 + -92341/4. Calculate the common denominator of m and l.
288
Suppose -5*p + p + 23 = -5*a, -2*p - a + 1 = 0. Calculate the lowest common multiple of (516/8)/(-6*p/(-16)) and 16.
688
Let p be (-32)/8 - (1 - 608). Let n = -4170/7 + p. Calculate the common denominator of n and -73/36.
252
Calculate the least common multiple of 1892 and 6/((-88)/12 - -8) - -163.
1892
Let o(l) be the second derivative of l**4/3 + 11*l**3/6 + 3*l**2/2 - 15*l. Let u be o(-3). Find the common denominator of u/20*2*(-14)/12 and -1/244.
1220
Let x be (-3 - -3) + (46 - (-1 + -4)). Suppose -2*q - q + 120 = 0. What is the least common multiple of 18 and x/10 + (-4)/q?
90
Suppose v + 11 = -o - 23, -3*o - 4*v - 103 = 0. Let b be 4/(-6) - (-671)/o. Calculate the common denominator of 7/18 and 66/b + 9/(-12).
252
Suppose 227*l - 11687 = 214*l. What is the smallest common multiple of l and 279?
8091
Let d be ((-3)/18 + 15/18)*-6. Let k(u) = 3*u**2 + u - 12. Let l be k(d). Suppose l*a - 30*a = 18. Calculate the smallest common multiple of 9 and a.
9
Let l(h) = 34*h + 36. Let k(p) = 68*p + 69. Let j(y) = -6*k(y) + 11*l(y). Calculate the least common multiple of j(-3) and 84.
84
Let x be 2 - 1385*(3 + -6). Let w = 2328 - x. Let q = 45697/25 + w. What is the common denominator of q and -29/2?
50
Let o = 32 + -2. Let v be (0 - -6)/(-2) + 13. Suppose 15*j + v*j = 250. What is the least common multiple of o and j?
30
Let m(h) = 5*h**3 + 8*h**2 + 2*h + 14. Let g be m(-6). Let r = 13849/2424 - 152/101. Calculate the common denominator of (-1 - 1) + g/(-210) and r.
168
Let g = -492 - -527. Suppose -g*d - 885 = -40*d. Calculate the least common multiple of 3 and d.
177
Let u = 9370/9 + -186617/180. Let f = -245586 + 49608275/202. Find the common denominator of f and u.
2020
Let o = -13 + 175. Find the common denominator of o/40 - 2/(-1) and -5/14.
140
Let s = 1487992945/462 + -3220767. Let r be 10/(-4)*38/(-33). Let d = r - s. What is the common denominator of -77/60 and d?
420
Let c(a) = -a**3 + 2*a**2 + 9*a - 5. Let g be c(4). Find the common denominator of (g + 40/6)/((-20)/12) and ((-47)/(-2))/(5 - 3).
20
Let v = -238103/32 - -7438. Find the common denominator of v and 15/292.
2336
Let w = -3587/585 - 42/65. What is the common denominator of w and (-192)/(-693) + (54/21 - 2)?
99
Let j(o) = 4*o**2 - o - 466. Calculate the smallest common multiple of j(-17) and 11.
7777
Calculate the common denominator of -4*(-261)/(-8640)*38 + 15/3 and (-129)/4*4/(-24).
120
Let c(v) = 11*v**2 + 3*v - 3. Let o be c(-1). Suppose o*t - 9 - 6 = -5*m, -5*t + 29 = -2*m. What is the lowest common multiple of t and (25/(-2))/(1/(-2))?
25
Let n be (3 + 0)*-2 - (0 + 0). Calculate the lowest common multiple of 2 and n/15 + (-201)/(-15).
26
Let q be 39 + 0*1/2 + 2. Let b = q - 23. What is the least common multiple of b and 42?
126
Let t be 6/(-9)*3*-26. Calculate the smallest common multiple of t/(-6)*(-46 - -43) and 130.
130
Find the common denominator of -11/21 and 90/12 + -8 - (-308)/(-63).
126
Let b = 407 - 452. What is the common denominator of 109/22 and -6*5/45 - b/(-4)?
132
Suppose -122*i + 66843 = -112741. Calculate the lowest common multiple of 1472 and i.
1472
Let l = 88 + -86. Suppose -2*g + j = 21, -l*g + 4*j = -0*g + 12. Find the common denominator of 7/3 and 68/(-24) - g/(-9).
6
What is the lowest common multiple of 1/5 + 13/((-325)/(-220)) and 300/(-700)*126/(-2)?
27
Let w(v) = -v**3 - v**2 - 2*v - 16. Let x be w(0). Let j = x + 52. What is the smallest common multiple of j and 36?
36
Let p be 48/27*183295/(-308). Let n = -1058 - p. What is the common denominator of 79/110 and n?
990
Calculate the common denominator of (-24)/(-30) - 741/(-180) and 273 - 255 - (-1647)/(-94).
564
Find the common denominator of 55/318 and 1*(-4)/20 + (-1211408)/101760 + 12.
1272
Let v = -780 + 780. Suppose -34*f + 52*f - 4482 = v. What is the lowest common multiple of 33 and f?
2739
Let z be 1*(-6 + 1) - -4262. Let c = z + -76709/18. Let h = 38765/8 - 4837. What is the common denominator of h and c?
72
Let k = -2 + 7. Let g(b) = -b**2 - 3*b + 30. Let t be g(4). Suppose -t*z - 3*z + 11 = 2*j, 5*z = 5*j - 10. What is the least common multiple of z and k?
5
Let l = -23973/3856622 - 36/2219. Find the common denominator of 17/2 and l.
1738
Let u = -16555/4 + 4161. Calculate the common denominator of -7/748 and u.
748
Let l = -7160 + 7190. What is the smallest common multiple of 1068 and l?
5340
Let m = 73 - 42. Suppose -r - 27 - m = 0. What is the common denominator of r/(-48) + 0 - 2 and 71/9?
72
Let x = 7990 - 7132. Calculate the least common multiple of 39 and x.
858
Let i = 93703677/1960 - 47808. Calculate the common denominator of -71/8 and i.
1960
Let h = 80657/6492 - 4/541. Let z = 9523809/1064 - 62660/7. What is the common denominator of h and z?
456
Suppose 0 = -3*k + 28*k - 700. Let v = -51 + 63. What is the least common multiple of v and k?
84
Let x(t) = 31*t**3 - t**2 - t + 1. Let z be x(1). Suppose l + z | {
"pile_set_name": "DM Mathematics"
} |
Love and Light
Love and Light may refer to:
Love and Light (Proud Mary album) 2004
Love and Light (Count Basic album), 2007 | {
"pile_set_name": "Wikipedia (en)"
} |
Protester And Convention Delegate Straddles Both Worlds
One of the people marching Sunday in protests tied to the Democratic National Convention will also be on the floor of the convention in a couple days as a full-fledge party delegate. WFAE's Julie Rose introduces us to a Charlotte man with a split identity: party insider and activist outsider.
Activists from around the region have spent days in a Charlotte warehouse painting and taping signs for today's march. Gautam Desai is right at home among them.
But he's also perfectly comfortable over at Mecklenburg County Democratic Party headquarters where he's first vice chair and member of the state party executive committee. What a weird spot to be in - marching through Charlotte chanting for change in the political system one day and the next cheering that system from the inside as a convention delegate.
But Desai feels no disconnect.
"That's just who I am and I cannot jettison one or the other identities or spheres," says Desai. "It falls on few people, to be the bee - to cross-pollinate."
Desai's path to political cross-pollinator began in India. He studied Gandhi's legacy and got involved in poverty and peace initiatives.
Sixteen years ago, just shy of his 30th birthday, Desai emigrated to Columbia, South Carolina for a master's in international business. He and his wife parlayed their careers in business and medicine into a comfortable middle-class life.
But the South proved fertile ground to Desai's passion for social justice and environmental causes, so he's rearranged his life to focus most of his time on them. Never did he imagine a role for himself inside a political party. But the fervor of the Obama campaign in 2008 sucked him in.
Before long he was helping recruit Democratic candidates as a local party leader, while still active in groups like Democracy NC that are openly critical of the Democratic Party for allowing itself to be influenced by corporate money.
That makes for some awkward conversations, admits Desai.
When activists doubt his sincerity, he points to Egypt, where the protesters toppled a dictator, but didn't get the reform they hoped for: "They fought such a revolution and what they got in terms of a choice was a Muslim Brotherhood and a military-backed candidate."
And to party loyalists offended that a convention delegate would have the gall to march at the DNC, Desai gently reminds them of the larger Republican threat.
"Protesters alone or electoral means alone are not going to defeat some of this extremist agenda," says Desai.
When fiery speeches are underway on the convention floor this week and cameras pan the crowd, Desai will be the one clapping politely, but deep in conversation with other Democrats about the how to combine the strength of the two worlds he inhabits: activist and party insider. | {
"pile_set_name": "Pile-CC"
} |
Coleville School District No. 3645
Coleville School District No. 3645 was created to educate students in the area of Coleville, Saskatchewan. The school district operated from 1913 to March 6, 1946, when it became a part of the consolidated Kindersley School Unit.
History
Coleville School District
Beginning in the fall of 1913, and continuing over the course of the next two years, the citizens of Coleville and the surrounding area met to organize the formation of a school district. While there was some opposition, on September 2, 1915, the Coleville School District No. 3645 was officially formed.
The school opened on October 13, 1915. Classes were held in Dumouchel's Hall until a dedicated school building could be completed. The first board of trustees, H.L. Dumouchel, Richard Chynoweth, Charlie Farris, and A. G. Bridger were authorized to borrow $1,600 towards the building and equipping of a new school. The debenture was to be repaid in ten consecutive annual installments, with interest not exceeding eight percent, was used to build a single-room wooden schoolhouse. While the lower grades were moved into the new schoolhouse, high school classes continued to be held in Dumouchel's Hall. On June 6, 1921, the school district was authorized to borrow $13,000 for the construction of a two-room brick schoolhouse, which was constructed shortly thereafter, and all grades moved into the new building.
The Great Depression of the 1930s caused significant hardships for the school district and the teachers. In 1931, salaries were lowered across the board. The principal's salary was reduced from $1,600 per year to $1,200 per year, and a teacher's salary was reduced from $1,000 per year to $900 per year. In 1933, wages were further reduced when the school district decided to only pay half-wages, while the other half was given in the form of a promissory note to be redeemed by the district "when times returned to normal". In 1938 teachers received no compensation at all for a portion of that year. Over the summer of 1937, the school district had more than 90 applications to fill a single position with a (nominal) wage of $600 a year. At the same time, the school district applied to the government for an interim grant in order to cover operating costs for the next school year, which was not filled when the school year started. While they waited for the government to pay the grant, teachers for the district continued to teach without receiving a wage. During this time, the teachers received a relief allowance of $11/month from the government. This was not enough to live on, and relief vouchers were not accepted by the CNR, leaving the teachers with limited means of getting to the nearest medical facility should they fall ill. In May 1938, the government cut off even this meagre allowance, stating that it was no longer necessary because provisions were being made by the government for paying of the interim grants. However, until the grants were actually paid, the school board could not provide the teachers with a salary, leaving them completely without income.
Tuition was initially charged to students entering grade 12. The tuition rate varied annually with the number of students taking grade 12, and the ability of families to pay the fee. In 1940, due to declining enrollment in grade 12, tuition for grade 12 was dropped in order to encourage students to complete their education.
The Warwick School was closed in July 1940, and students from that district were admitted into the Coleville district for a fee of $25 per family. In September of that year the principal of the Coleville school was drafted, leaving them without a principal for three months.
Consolidation with Kindersley School Unit No. 34 was discussed as early as 1939, as a means of reducing costs and improving educational opportunities. In February 1945, an application was made for the merger to occur. As a precondition, guarantees were sought for the high school to remain in Coleville after the consolidation, and on March 6, 1946 the Coleville School District became part of the Kindersley School Unit.
As Part of the Kindersley School Unit
Almost immediately, the Kindersley School Unit began to centralize the many smaller school districts. A "van system" was introduced, whereby local people used their own vehicles to transport students to central schools, with the costs borne by the unit. Later dedicated vans were used for this service, and in 1953 the vans were replaced by a bus.
The St. Florence School was closed in 1948, and students were "vanned" to the Coleville school. This was followed by Eureka in 1949. Driver School closed in 1959, and from 1963 until 1970 some of the districts primary grade students were routed to Coleville. In 1972 parts of the Driver and Buffalo Coulee school districts were added to the Coleville bus route, which now included all rural students in St. Florence, Eureka, Colville (rural), south Warwick, east Driver, and parts of Buffalo Coulee.
Rossville School was built in 1957, to accommodate the influx of people to the Coleville area after the discovery of oil in 1951. Soon after Rossville School was built, Coleville lost its high school, as upper grades were bussed to Kindersley: in 1957, grades 11 & 12; in 1959, grade 10; in 1960, grade 9; and in 1966 grades 7 and 8. In 1972 grade 7 was returned to Coleville.
Schools
Dumouchel's Hall
From October 13, 1915, until the construction of the brick school house in 1922, Dumouchel's Hall was used as a temporary school. Lower grades were moved out on completion of the wooden school house in 1916, however upper grades continued to hold classes in the hall.
The "Wooden" School
The single-room wooden schoolhouse was the first dedicated school building in the Colevile School District. It was built for a cost of $1,600, and was completed in 1916. The structure was built by Les Cole and Fred Wood. It was later connected to the "Brick" schoolhouse. After the brick schoolhouse was demolished, it was sold and moved out of town. In 1981 it was located on the farm of Alex Schmidt.
The "Brick" School
Construction of the two-room Brick schoolhouse began in 1921, after a loan of $13,000 was secured for the project. The building was completed in 1922, however the mortar work needed to be redone shortly after. On the main floor the building contained two classrooms, one for grades 1 through 6, and one for grades 7 through 12. In the basement were separate boys and girls playrooms, and indoor chemical toilets. In 1925 a well was dug in front of the school, and the schoolyard was treed.
In 1927 a third room added by connecting the new school to the original wooden school. Originally intermediate students were taught in the attached schoolhouse, but due to tight quarters this was changed in 1934, and elementary students were moved to this room.
As a result of fundraisers held in 1938, a piano was purchased for the school. The piano was located in the wooden schoolhouse, and lessons were given after school.
In March 1946, a fire of unknown origin broke out in the cloakroom of the brick schoolhouse. The fire was quickly extinguished, and the damage was repaired for $30.
The school was electrified in the early 1950s, along with the rest of the town. Water and sewer services did not come to the school until 1964. In response to the population boom after the discovery of oil in the area in 1951, the basement was remodeled and made into a classroom. The brick school continued to operate concurrently with Rossville School, built in 1957, until it was closed and demolished in 1973
Facilities in the brick school were limited compared with modern schools. The laboratory was a white table with black shelves located at the back of the classroom. Among the options for upper grades were classes in Agriculture, Latin, French and Chemistry. School plays were a regular part of school.
Rossville School
Rossville School was built in 1957, and was named after Ross Ferris, janitor for the school division for 37 years. Rossville contained 5 classrooms. Water and sewer service was extended to the school in 1964. The school was enlarged and renovated in 1986?
Kindergarten
Kindergarten was introduced to the Coleville area in 1960. For a tuition cost of $4 per month, kindergarten classes were held for 100 half-days (9:00AM to 11:30AM). Kindergarten was established and initially taught by Vivian Close, and classes were held in a small storage room in the basement of the brick school. The Coleville kindergarten became part of a provincial feasibility study regarding mandating kindergarten in all schools. Kindergarten eventually did become part of the school system, with classes occurring all day, every second day.
References
Category:Oakdale No. 320, Saskatchewan
Category:School districts in Saskatchewan | {
"pile_set_name": "Wikipedia (en)"
} |
In Vitro Evaluation of Titanium Exfoliation During Simulated Surgical Insertion of Dental Implants.
Dissolution of titanium wear particles in the oral environment, and their accumulation in the surrounding tissues have been associated with failure of dental implants (DI). The goal of this study is to investigate the effect of mechanical forces involved in surgical insertion of DI on surface wear and metal particle generation. It was hypothesized that mechanical factors associated with implant placement can lead to the generation of titanium particles in the oral environment. The testing methodology for surface evaluation employed simulated surgical insertion, followed by removal of DI in different densities of simulated bone material. Torsional forces were monitored for the insertion and removal of DI. The surface of the simulated bone materials was inspected with optical microscopy to detect traces of metallic particles that may have been generated during the procedure. Further characterization of the composition of powders collected from osteotomy cavities was conducted with powder X-ray diffraction. The results showed that the different densities of simulated bone material affected the torsional forces associated with implant insertion. However, the mechanical factors involved in the implant insertion/removal procedure did not generate wear particles, as confirmed by powder X-ray experiments. | {
"pile_set_name": "PubMed Abstracts"
} |
The present invention generally relates to integrated circuits (IC), and more particularly to fabricating IC chips having a programmable shelf life.
New IC technologies may include individual IC chips (i.e., “dies”) arranged into a three dimensional integrated circuit, also known as a three dimensional semiconductor package (3D package). One type of 3D package may include two or more layers of active electronic components stacked vertically and electrically joined with some combination of through substrate vias and solder bumps. Current IC chips may never expire, they may exhibit a long lifespan and may even last forever if not powered up.
To continue the miniaturization trend in current IC technology, copper (Cu) metallization may be extensively used due to its low resistivity and high migration resistance. Owing to the rapid diffusion of copper into silicon (Si) and silicon dioxide (SiO2), copper structures may be covered with barrier metals and barrier insulators to prevent degradation of the IC. In the presence of oxygen and at relatively low temperatures, copper may act as a catalyst during the oxidation of silicon to form silicon dioxide. | {
"pile_set_name": "USPTO Backgrounds"
} |
New Year’s Resolution: Buy a Pre-owned Car at Dann’s
Curious about what the Top 10 New Year’s resolutions were for 2017, and how many people followed through on theirs? Check out this handy statistical analysis. And now that we’re on to 2018, let’s talk about some worthwhile resolutions for the next 12 months – for example, buying a pre-owned vehicle at Dann’s Discount Auto Sales.
Rare is the car dealership in Central California that offers as many fantastic deals on pre-owned automobiles as we do. The fact that we offer regular specials means you don’t have to set a time limit on when to complete your “pre-owned resolution” – you can stop by whenever you’d like and get a terrific deal on one of our many used cars near Tulare, CA.
If you’re sedan shopping, we have specials running right now on three different sedans. One is a 2016 Nissan Versa, a small sedan that comes up big in terms of fuel economy, trunk size, and a very spacious backseat, along with a comfortable, refined ride. Another appealing pick at our local pre-owned car dealership is the 2017 Hyundai Elantra, fully redesigned for the 2017 model year. Highlights include a quiet, high-quality cabin, plentiful standard comfort/convenience features, and outstanding safety scores.
Along with specials on sedans, we have a 2016 Kia Soul available at a terrific price. This crossover SUV boasts ample curb appeal, along with a big, versatile cabin and a wide array of equipment. And if you’re in the market for a top-shelf pre-owned pickup, check out the powerful, stylish 2014 Chevy Silverado that’s on special right now! | {
"pile_set_name": "Pile-CC"
} |
Attention! Deficit Disorder
If overspending is so bad, why is the U.S. economy doing so well?
This week, the White House released its 2007 federal budget, which projected a shortfall of $423 billion for the current fiscal year. The good news: Budgeters predict diminishing deficits in years ahead, even while accounting for extending the Bush tax cuts. The bad news: For those forecasts to come true, Iraq will have to turn into Canada next year, Afghanistan into Sweden, and Congress into an order of mendicant monks.
Jacob Weisberg is chairman and editor-in-chief of The Slate Group and author of The Bush Tragedy. Follow him on Twitter.
Mostly the new deficit numbers—and the more realistic and depressing projections included in this Brookings paper—should shame the fiscally unbalanced Republicans who run the government. But there is also a shade of discomfort among those of us who love to hate deficits. We must acknowledge that the U.S. economy has performed pretty well in the Bush years, despite a stupendous reversal in the nation's fiscal position. Gross domestic product grew at a rate of 3.5 percent in 2005 on top of 4.2 percent in 2004. The January unemployment figure was 4.7 percent, which is within striking distance of its Clinton-era bottom. Despite massive Keynesian fiscal stimulation, long-term interest rates remain low and there's no sign of inflation. If deficits are so terrible, why is the economy so good?
Advertisement
One possibility is that Vice President Dick Cheney was right when he said that "Reagan proved deficits don't matter." The theory behind this view, to the extent there is one, is that in a global market for capital, government borrowing does not "crowd out" private investment the way it does in an insular economy. A Federal Reserve Board's model suggests that 1 percentage point of GDP in deficit spending raises long-term interest rates 50 to 70 basis points—.5 percent to .7 percent. We pretty clearly aren't seeing such a strong effect, at least in the short term. In 2003, when Washington decided to add another trillion dollars in deficit spending to pay for a Medicare prescription-drug program, rates barely budged. Perhaps bond traders are overdoing the serotonin reuptake inhibitors. Or perhaps the international appetite for Treasury bonds means that deficits no longer move interest rates the way they once did.
But even if that change is real, Cheney and others who wave aside the budget gap are still wildly, recklessly wrong. Deficits are as malignant as ever. The effects are just hard to make out at the moment. The basic problem is quite obvious: We are making ourselves poorer. Borrowing to consume, which is what the United States is doing, as opposed to borrowing to invest, is a lousy long-range strategy unless you plan to die young. Because of the deficit, our net national savings is now barely 1 percent of GDP. A society that saves and invests so little may be able to postpone a decline in living standards for a good while. But it cannot do so indefinitely.
The Bush binge could end with a bang or a whimper. If confidence in the U.S. economy erodes, foreigners may look askance at continuing to finance our deficits. The Treasury would have to offer higher returns to sell its bonds, raising long-term rates. The withdrawal of foreign capital could also prompt a decline in the value of the dollar, as traders sold instruments denominated in U.S. currency. Such trends can create a vicious cycle, in which misery is never at a loss for company. In a worst-case scenario, unchecked deficits could provoke a Mexican- or Asian-type financial crisis. The Fed might be able to forestall a meltdown—or it might not. As former Treasury Secretary Lawrence Summers once put it, the thing about a dysfunctional relationship with the rest of the world is that it can go on much longer than you expect, but it can also end much more suddenly than you expect.
Another hazard is losing what Robert E. Rubin, Summers' predecessor as treasury secretary and my guru on this subject, calls "resilience." A deficit of 3.2 percent of GDP, which is what Bush predicts for this year, curtails the ability of policy-makers to respond effectively to the unforeseen and unforeseeable. The U.S. economy was able to absorb the shock of Sept. 11 without falling into recession in part because of Washington's use of fiscal as well as monetary policy in response. But when the budget is already deeply in the red, the "break glass in case of fire" box comes pre-smashed. In the event of another major terrorist attack or natural disaster, such Keynesian tools as tax cuts and stimulus spending will be much harder to deploy than they were in 2001, when the budget was still in surplus.
Perhaps the gravest harm deficits do is undermining government's ability to take on the country's non-emergency problems and prepare for the future—the health-care mess, the education mess, the baby-boom generation's underfunded retirement, and so forth. Even into the 1990s, many Democrats tacitly approved of deficit spending, because it enabled them to do more without higher taxes. In those days, Republicans tended to oppose deficits, because they wanted government to do less. But during the Bush presidency, these roles have reversed. Republicans now see deficits as a way to disable the federal government by "starving the beast." Democrats, by contrast, have come to loathe deficits, because they prevent government from doing anything.
If we deficit hawks have failed to generate enough alarm to motivate action, it may be because our metaphors have gotten stale. Running a deficit isn't so much like shooting yourself in the foot, which hurts immediately. It's more like smoking, drinking to excess, and not exercising. It will in fact kill you—just not tomorrow. | {
"pile_set_name": "Pile-CC"
} |
2 comments:
Hi JudiI use a large card or discarded sheet of wc paper with an aperture cut out slightly larger than req uired. Then mask that with 1/4 inch overlap that does not tear as small surface area. My kindle book 'introduction to loose watercolor' shows that method. :-) | {
"pile_set_name": "Pile-CC"
} |
Introduction
============
The roles of eicosanoids in diverse physiologic and pathologic scenarios provide clear examples of the importance of fatty acid precursors such as arachidonic acid in cell communication, a sharp departure from their structural and storage assignments ([@bib1]--[@bib5]). Among the classes of bioactive eicosanoids, including prostaglandins, leukotrienes (LTs)[\*](#fn1){ref-type="fn"}, lipoxins (LX), and cis-epoxyeicosatrienoic acids or EETs ([@bib4], [@bib6]), it is now apparent that counterregulatory autacoids exist within these classes of eicosanoids. Of the cyclooxygenase pathways, prostacyclin and thromboxane are important vascular counterregulators ([@bib7]). In inflammation, LT products of the 5-lipoxygenase (LO) are proinflammatory mediators ([@bib4], [@bib8]), and LXs generated via LO interactions can counterregulate certain LT-mediated events (for a review, see reference [@bib9]). The emergence of temporal and spatial separation in biosynthesis of eicosanoids during inflammation sheds light on distinct functional settings for LXs as "stop" or proresolution signals ([@bib10]). Moreover, aspirin (ASA) treatment can pirate the LX system, triggering formation of their 15-epimeric or their *R*-containing isoform (ASA-triggered LX) that serve as LX mimetics, to mount proresolution status ([@bib9], [@bib11], [@bib12]), as well as enhancers in epithelial-based antimicrobial host defense ([@bib13]).
Leukocytes from several species of fish rich in omega-3 fatty acids generate prostaglandins, LTs, and LXs from both arachidonic acid (C20:4) and eicosapentaenoic acid (EPA) (C20:5). Their immune functions in marine organisms appear similar to those in humans; namely, as drivers of cell motility. Yet, fish cells generate quantitatively similar levels of both 4 and 5 series (EPA-derived) LTs and LXs, which is sharply different than human tissues that use predominantly C20:4-derived mediators (for a review, see reference [@bib14]). An extensive literature, accrued for several decades, implicates omega-3 fatty acids such as EPA (C20:5) and docosahexaenoic acid (DHA, C22:6) as beneficial in several human diseases including atherosclerosis, asthma, cardiovascular, cancer (for a review, see reference [@bib15]), and, more recently, mental depression ([@bib16], [@bib17]) and preventing sudden death after myocardial infarction ([@bib18], [@bib19]). Of interest are results from the GISSI-Prevenzione trial that evaluated omega-3 polyunsaturated fatty acid (PUFA) supplementation with \>11,300 patients that provide compelling evidence for a decrease of ∼45% in cardiovascular death ([@bib20]). It is noteworthy that both patient groups received aspirin in the GISSI trial while comparing tocopherol versus omega-3 supplementation ([@bib20]) as did a significant number of participants in the most recent Physician Health study report ([@bib18]). The impact of ASA to the results of these studies was not tested although firmly concluding the benefits of omega-3 fatty acids in risk reduction ([@bib18], [@bib20], [@bib21]). Eating fish rich in omega-3s is now recommended by the American Heart Association (see <http://www.americanheart.org>). However, what is evident from animal studies is that DHA is the bioactive cardiovascular protective component of fish oils ([@bib22]). The mechanism(s) for omega-3 protective properties in heart disease and in prostate cancer remains unclear and the molecular bases are still sought to explain the clinical phenomena associated with fish oil trials.
The heightened awareness that unresolved inflammation is important in many chronic disorders including heart disease, atherosclerosis, asthma, and Alzheimer\'s disease ([@bib23], [@bib24]) leads us to question whether omega-3 utilization during ASA therapy is converted to endogenous bioactive compounds relevant in human disease and health. Recently, we uncovered that at sites of inflammation omega-3 PUFA EPA is converted to potent bioactive products that target neutrophil recruitment ([@bib2]). Hence, cyclooxygenase (COX)--2, which has a larger substrate tunnel/channel than COX-1 ([@bib25], [@bib26]), acts on C20:4 as well as additional substrates that can be productively accommodated as exemplified by the ability to convert the omega-3 polyene family of lipids (i.e., C18:3 and C20:5), possibly for tissue-specific COX-2 missions ([@bib2]) such as those associated with ischemic preconditioning ([@bib19]), resolution ([@bib10], [@bib12], [@bib27]), and/or other disease processes. Our recent results with EPA and COX-2 ([@bib2]) as well as earlier findings of others with DHA ([@bib28]--[@bib32]) raise the possibility that, in addition to arachidonic acid, omega-3 fatty acids in certain biologic processes, e.g., ischemia-induced cardiac arrhythmias ([@bib22]), may serve as substrates for conversion to potent bioactive products ([@bib2]). However, the biological role and significance of products that could be derived from DHA in inflammation has remained to be established.
In this report, we demonstrate that ASA treatment of murine in vivo and human tissues in vitro carrying COX-2 initiates the production of novel 17*R*-hydroxy series docosanoids via previously undescribed biosynthetic circuits that counterregulate proinflammatory responses (i.e., cytokine production, peritonitis). During stress, these cellular pathways utilize omega-3 fatty acids to biosynthesize endogenous compounds that serve in antiinflammation signaling. Thus, we termed the family of compounds Resolvins because they are (i) generated during the resolution phase and (ii) chemically redundant signals that play protective roles in dampening inflammation to promote a proresolution status.
Materials and Methods
=====================
Zymosan A, hematin, NADPH, 15-LO, ASA, and other NSAIDs were from Sigma-Aldrich. Potato 5-LO, DHA, and EPA were from Cayman Chemical Co.; other synthetic standards, hydroxy fatty acids and intermediates used for MS identification and fragment ion references were purchased from Cascade Biochem Ltd. Authentic standards for 4*S*-hydroxy-5*E*, 7*Z*, 10*Z*, 13*Z*, 16*Z*, 19*Z*-DHA (4*S*-HDHA), 17*S*-hydroxy-4*Z*, 7*Z*, 10*Z*, 13*Z*, 15*E*, 19*Z*-DHA (17*S*-HDHA), and the racemate 17*R/S*-hydroxy-4*Z*, 7*Z*, 10*Z*, 13*Z*, 15*E*, 19*Z*-DHA (denoted 17*R/S*-HDHA) were from Penn Bio-Organics, and NMR analyses established the respective double bond configurations. Additional materials used in LC-MS-MS analyses were from vendors reported in references ([@bib2], [@bib33]).
Incubations.
------------
Human PMNs were freshly isolated from venous blood of healthy volunteers (that declined taking medication for ∼2 wk before donation; BWH protocol no. 88--02642) by Ficoll gradient and enumerated. Cells were divided into 50 × 10^6^ cells, 1 ml DPBS with Ca^2+^ and Mg^2+^, denoted +/+, and incubations (40 min, 37°C) were performed with either 17*R/S*-HDHA (Penn Bio-Organics) or 17*R*-HDHA with zymosan A (100 ng/ml; Sigma-Aldrich). Human umbilical vein endothelial cells (HUVECs) or human microvascular endothelial cells (HMVECs; Cascade Biologics) were cultured for transendothelial migration ([@bib34]) and incubations with HMVEC monolayers (1, 2, or 3 passages) seeded (∼2 × 10^5^ cells/cm^2^) on polycarbonate permeable supports precoated with 0.1% gelatin for ASA and DHA. For hypoxia experiments, plates of HUVECs treated with TNF-α and IL-1β (both 1 ng/ml) were placed in a hypoxic chamber (3 h, 37°C) and returned to normoxia (21 h, 37°C). Next, ASA (500 μM, 30 min) was added followed by DHA (∼5 μM) and A23187 (2 μM; 60 min, 37°C). Individual whole brains were rapidly isolated from killed mice immediately before incubations (each half/2 ml), washed with cold DPBS^+/+^ and incubated with ASA (45 min, 37°C, 500 μM). Incubations were stopped with 5 ml cold methanol, and held at −20°C for analyses.
Recombinant COX-2 and Product Analyses.
---------------------------------------
Human recombinant COX-2 was overexpressed in *Sf*9 insect cells (American Type Culture Collection). The microsomal fractions (∼8 μl) were suspended in Tris (100 mM, pH 8.0) as in reference [@bib35]. ASA was incubated (∼2 mM, 37°C, 30 min) with COX-2 before addition of DHA (10 μM), or in some experiments \[1-^14^C\]-labeled DHA (American Radiolabeled Chemicals, Inc.), and conversions were monitored in parallel using \[1-^14^C\]-labeled C20:4 (with ASA) (as in [Fig. 2](#fig2){ref-type="fig"} ; also see text).
{#fig2}
Incubations were extracted with deuterium-labeled internal standards (15-HETE and C20:4) for LC-MS-MS analysis as in reference [@bib33] using a Finnigan LCQ liquid chromatography ion trap tandem mass spectrometer equipped with a LUNA C18--2 (150 × 2 mm × 5 μm or 100 × 2 mm × 5 μm) column and a rapid spectra scanning UV diode array detector that monitored UV absorbance ∼0.2 min before samples entering the MS-MS. All intact cell incubations and in vivo exudates were stopped with 2 ml cold methanol and kept at −80°C for \>30 min. Samples were extracted using C18 solid phase extraction and analyzed using gas chromatography-mass spectrometry (GC-MS) (see [Table II](#tbl2){ref-type="table"}; Hewlett-Packard), thin layer chromatography or tandem liquid chromatography-mass spectrometry (LC-MS-MS). Also, a Chiralcel OB-H column (4.6 × 250 mm; J.T. Baker, Inc., Phillipsburg, NJ) was used to determine *R* and *S* alcohol configurations of monohydroxy-PUFA using isocratic mobile phase (hexane:isopropanol; 97.5:2.5, vol:vol, with a 0.6 ml/min flow rate). Detailed procedures for isolation, quantitation, and structural determination of lipid-derived mediators were reported recently ([@bib36]) and used here essentially as reported for elucidation of novel products. Biogenic synthesis of the novel docosanoids were performed using isolated enzymes, i.e., potato 5-LO, rhCOX-2, or ASA treated rhCOX-2 and 15--LO each incubated in tandem sequential reactions with either DHA or 17*R*-HDHA to produce the novel compounds in scale up quantities for isolation and confirmation of physical and biological properties.
PMN Migration, Murine Air Pouch Exudates, and Peritonitis.
----------------------------------------------------------
Human PMN transendothelial migration was quantitated by monitoring myeloperoxidase an azurophilic granule marker as in ([@bib34], [@bib37]). Inflammatory exudates were initiated with intrapouch injection of recombinant mouse TNF-α (100 ng/pouch; R&D Systems) into dorsal air pouches ([@bib10]) of 6--8 wk male FVB mice fed laboratory rodent diet 5001 (Lab Diet, Purina Mills) containing \<0.25% arachidonic acid, 1.49% EPA, and 1.86% DHA followed by 500 μg ASA at 3.5 h and 300 μg DHA/pouch at 4 h after TNF-α injection. At 6 h (within the resolution phase), pouches were lavaged (3 ml saline) and exudate cells were enumerated. Inhibition of TNF-α stimulated (100 ng/pouch) PMN infiltration with intravenous tail injection of either 17*R*-HDHA (as prepared with COX-2 vide infra), 5S,12,18*R*-HEPE, or a 15-epi-LXA~4~ analogue were determined with pouch lavages taken at 4 h. Peritonitis was performed using 6--8-wk-old FVB male mice (Charles River Laboratories) fed laboratory Rodent Diet 5001 (Purina Mills) that were anesthetized with isoflurane, and compounds to be tested (125 μl) were administered intravenously. Zymosan A in 1 ml (1 mg/ml) was injected ∼1--1.5 min later in the peritoneum. Each test compound (100 ng/incubation, i.e., 17R-HDHA in ethanol) or vehicle alone was suspended in ∼5 μl and mixed in sterile saline 120 μl. 2 h after the intraperitoneal injections, and in accordance with the Harvard Medical Area Standing Committee on Animals protocol no. 02570, mice were killed and peritoneal lavages rapidly collected for enumeration.
Cell Culture.
-------------
Human glioma cells DBTRG-05MG cells (American Type Culture Collection) were cultured as recommended by American Type Culture Collection. For analyses, 10 × 10^6^ cells per well in 6-well plates (Falcon) were stimulated for 16 h with 50 ng/ml of human recombinant TNF-α (GIBCO BRL) in the presence of specified concentrations of test compounds (i.e.,17*R*-HDHA) or vehicle (0.04% ethanol). Cells were washed in DPBS^+/+^ and harvested in 1 ml of Trizol (GIBCO BRL). For RT-PCR, RNA purification and RT-PCR were performed as in reference [@bib38]. Primers used in amplifications were: 5′GGAAGATGCTGGTTCCCTGC3′ and 5′CAACACGCAGGACAGGTACA3′ for IL-1β; 5′TCCACCACCGTGTTGCTGTAG3′; and 5′GACCACAGTCCATGACATCACT3′ for GAPDH. PCR products obtained with these primers were confirmed by sequencing. Analyses were performed for both genes (i.e., GAPDH and IL-1β) in the linear range of the reaction. Results were analyzed using the NIH Image program (<http://rsb.info.nih.gov/nih-image>).
Results
=======
Lipidomics of the Exudate Resolution Phase.
-------------------------------------------
It is well appreciated that orderly resolution in healthy individuals is influenced by both systemic and local host factors that include nutrition, metabolic status (i.e., diabetes is associated with delayed healing) and circulatory status as some of the key determinants in the duration of resolution ([@bib39]). In experimental acute inflammatory challenge that undergoes spontaneous resolution, namely in the murine air pouch model of exudate formation and resolution, we found a temporal dissociation between the formation and actions of local chemical mediators ([@bib10]). LTs and prostaglandins are generated rapidly and appear with leukocyte recruitment to the air pouch exudate in line with their known actions as proinflammatory mediators. LX biosynthesis concurs with spontaneous resolution and the loss of PMN from the murine air pouch exudate, providing evidence that functionally distinct lipid mediator profiles switch from proinflammatory to antiinflammatory mediators such as LXs during resolution ([@bib10]).
Recently, we found that EPA is transformed in murine exudates treated with ASA to novel products that possess antiinflammatory properties, providing a potential mechanism for omega-3 beneficial actions in many diseases ([@bib2]). Since DHA is cardioprotective ([@bib22]), abundant in brain and retina, and displays an impact in many physiologic processes ([@bib28]--[@bib32]), lipidomic analyses were undertaken to determine whether inflammatory exudates utilize DHA in the resolution phase with ASA treatment.
Inflammatory exudates obtained within the resolution phase formed within dorsal skin air pouches after injection of TNF-α, DHA, and aspirin treatment contained several previously undescribed compounds revealed with LC-MS-MS analysis ([Fig. 1](#fig1){ref-type="fig"}) . It is noteworthy that the Lab Diet 5001 used to feed these mice contained 1.86% DHA and 1.49% EPA with \<0.25% arachidonic acid (Purina Mills). Additional mass spectral analysis using both GC-MS (with derivatized products) and liquid chromatography-UV diode array detector-tandem mass spectrometry (LC-UV-MS-MS)-based analyses (which did not require derivatization) indicated that the inflammatory exudate-derived materials contained novel hydroxy acids produced from both DHA and EPA, namely these products were not present in our database of properties of reported lipid mediators. The EPA-derived products were established recently ([@bib2]). Selected ion chromatograms and MS-MS from results acquired at m/z 343 were consistent with the production of 17-HDHA ([Fig. 1, A and B](#fig1){ref-type="fig"}), with lesser amounts of 7*S*- and 4*S*-HDHA ([Fig. 1](#fig1){ref-type="fig"} A) within the exudates. These products coeluted with authentic 17(*R/S* racemic)-HDHA and 4*S*-HDHA (qualified by NMR; see Materials and Methods) in three different chromatographic systems (unpublished data), and their basic structural properties were consistent with those of related DHA-derived products ([@bib28]--[@bib30]). ASA-treatment also gave novel di- and tri-hydroxy products carrying the DHA backbone within the inflammatory exudates; at this dose ASA completely inhibited the in vivo production of thromboxane and prostanoids. Importantly, ASA treatment in vivo and COX-2 gave previously unknown products from DHA that possess bioactive properties (vide infra).
######
Inflammatory exudates from mice treated with ASA generate novel compounds: LC-MS-MS-based lipodomic analysis. (A) TNF-α--induced leukocyte exudates from dorsal air pouches. Samples were collected at 6 h from FVB mice given ASA and DHA (Materials and Methods). Selected ion chromatogram (*m/z* 343) showing the production of 17*R*-HDHA, 7*S*-HDHA, and 4*S*-HDHA. Using the diene UV chromophores for quantitation, 7-HDHA was ∼15% of the exudate materials and was identified using a SIM trace for *m/z* 141 with ms/ms 343. In some exudates 17*S*-HDHA was also present from LO-dependent routes (see text). MS-MS for B: 17*R*-HDHA (*m/z* 343); C: 7*S*,17*R*-diHDHA (*m/z* 359); and D: 4,11,17*R*-triHDHA (*m/z* 375). See text for diagnostic ions. Results are representative of *n* = 7.
Results in [Fig. 1](#fig1){ref-type="fig"} C show the MS-MS spectra of a dihydroxy-containing DHA with fragment ions consistent with the structure shown in the inset, namely 7,17-diHDHA; m/z 359 \[M-H\], m/z 341 \[M-H-H~2~O\], m/z 323 \[M-H-2H~2~O\], m/z 315 \[M-H-CO~2~\], and m/z 297 \[M-H-CO~2~-H~2~O\]. Additional diagnostic ions consistent with the 7- and 17-hydroxy-containing positions were present at m/z 261, 247, and 217. A representative of the several novel trihydroxy-containing DHA-derived compounds also present in inflammatory exudates is shown in [Fig. 1](#fig1){ref-type="fig"} D. Ions present were consistent with its \[M-H\] = m/z 375, 357 \[M-H-H~2~O\], 339 \[M-H-2H~2~O\], 331 \[M-H-CO~2~\], 313 \[M-H-CO~2~-H~2~O\], 306, 303, 276, 273, 255 \[273-H~2~O\], 210, 195, and 180. These physical properties (i.e., MS-MS, UV, LC retention time) were entered into our database and used throughout to identify these and related compounds and to assess their bioimpact. These compounds were deemed of interest because transfer of materials extracted from inflammatory exudates in DHA plus ASA pouches to naive mouse (intravenous or via intraperitoneal administration) sharply reduced zymosan-induced PMN infiltration by ∼60%, indicating the in vivo utilization of DHA and production of bioactive products within exudates (vide infra).
The Role of COX-2 and ASA in Biosynthesis of R-containing HDHA.
---------------------------------------------------------------
Chirality of the alcohol group at carbon-17 ([Fig. 1](#fig1){ref-type="fig"} B) was established for the product that matched exudate-derived 17-HDHA using a chiral HPLC column. The alcohol at carbon 17 position proved to be predominantly in the *R* configuration (\>95%; *n* = 4), indicating that this was indeed a novel product of enzymatic origin formed in vivo that was not known earlier. For example, 17*S*-HDHA is generated via 15-lipoxygenation or via autooxidation in racemic ∼50:50 ratio of *R/S* mixtures ([@bib40], [@bib41]). Hence, the presence of the alcohol group in the *R* configuration as 17*R*-HDHA from exudates ([Fig. 1](#fig1){ref-type="fig"}) was indicative of an enzymatic origin. The substrate channel of COX-2 is larger than COX-1 ([@bib26]), suggesting the possibility of substrates larger than arachidonic acid. Consistent with this, DHA was transformed by rhCOX-2 to 13-HDHA ([Fig. 2](#fig2){ref-type="fig"}, left). The MS-MS obtained were consistent with oxygen addition at the 13 position (i.e., m/z 193 and m/z 221) and, when COX-2 was treated with aspirin to acetylate serine within the catalytic site ([@bib1], [@bib26], [@bib42]), DHA was enzymatically converted to 17*R*-HDHA ([Fig. 2](#fig2){ref-type="fig"}, right). The MS-MS and diagnostic ions at m/z 343 \[M-H\], 325 \[M-H-H~2~O\], 299 \[M-H-CO~2~\], 281 \[M-H-H~2~O-CO~2~\], 245 and 274 consistent with 17-carbon alcohol group and chiral analysis using chiral HPLC with reference materials (Materials and Methods) indicated that the conversion of DHA by aspirin-acetylated COX-2 yielded predominantly (\>98%) 17*R*-HDHA. The product of COX-2 matched the physical properties of the dominant 17-hydroxy--containing DHA-derived compound identified in inflammatory exudates ([Fig. 1](#fig1){ref-type="fig"}) in vivo with aspirin treatment. Unlike COX-1, shown earlier not to convert DHA ([@bib43]), results with recombinant COX-2 in [Table I](#tbl1){ref-type="table"} and [Fig. 2](#fig2){ref-type="fig"} indicate that aspirin treatment of this enzyme generates predominantly 17*R*-HDHA. Other commonly used nonsteroidal antiinflammatory drugs, i.e., indomethacin, acetaminophen, or the COX-2 inhibitor (e.g., NS-398), did not give appreciable amounts of 17*R*-HDHA. Treatment with aspirin gave a reciprocal relationship between 17- versus 13-position oxygenation. Also in these incubations, indomethacin, acetaminophen, and NS-398 each reduced the overall oxygenation of DHA (to 13- as well as 17-HDHA; [Table I](#tbl1){ref-type="table"}), but did not share the ability of ASA to produce 17*R*-HDHA. For direct comparison, conversion of C20:4 by ASA-acetylated COX-2 to 15*R*--HETE (67 ± 5% substrate conversion; *n* = 3) was monitored in parallel with the conversion of DHA to 17*R*-HDHA (52 ± 3%; mean ± SEM; *n* = 3).
######
Impact of NSAIDs on COX-2 Conversion of DHA
-----------------------------------------------------------------------
NSAID Percentage of\ Percentage of increase of\
inhibition of\ 17-HDHA
13-HDHA
------------------------- ---------------- ----------------------------
\% \%
ASA 85.7 ± 5.6 97.8 ± 2.0
Indomethacin 89.8 ± 0.5 0.0
Acetaminophen 87.7 ± 4.3 0.0
NS398 (COX-2 inhibitor) 97.3 ± 1.0 0.0
-----------------------------------------------------------------------
Results are the mean ± SEM, *n* = 3. Products were extracted, identified, and quantitated using deuterium internal standards and LC-MS-MS (Materials and Methods). NSAIDs were incubated 30 min with human recombinant COX-2 (Materials and Methods). 2 mM ASA, 200 mM indomethacin, 500 mM acetaminophen, and 100 mM NS398 were used.
Brain and Vascular Biosynthesis of the New Compounds.
-----------------------------------------------------
In brain, COX-2 is present in constitutive as well as in inducible pool(s) ([@bib28], [@bib44]). Results in [Fig. 3, A and B](#fig3){ref-type="fig"} indicate that ASA-treated brain contained 17*R*-HDHA produced from the endogenous sources of DHA. To address the possible cell types involved in 17*R*-HDHA generation in brain, human microglial cells were exposed to TNF-α, which upregulated expression of COX-2, followed by treatment with ASA and the agonist ionophore A23187. Human microglial cells generated 17*R*-HDHA in an ASA-dependent fashion ([Fig. 3](#fig3){ref-type="fig"} C). Hypoxia is also known to induce COX-2 ([@bib45]), and hypoxic endothelial cells exposed to cytokine IL-1β, as endothelial cells might encounter at inflammatory loci or with ischemic events ([@bib23]), treated with aspirin were a source of 17*R*-HDHA ([Fig. 4](#fig4){ref-type="fig"}) .
######
Endogenous 17*R*-HDHA from brain and human microglial cells treated with aspirin. (A) LC-MS-MS chromatogram obtained from brain for relative abundance at m/z 327 for DHA and m/z 343 for the monohydroxy product. (B) MS-MS spectrum of brain 17R-HDHA (m/z 343). Murine brain samples were incubated with ASA (45 min, 37°C). Results are representative of *n* = 6 mice treated with ASA versus five mice without ASA. (C) Human microglial cells (HMG) treated with ASA; MS-MS spectrum of HMG 17R-HDHA. 10 × 10^6^ cells were exposed to 50 ng/ml TNF-α and incubated (24 h, 37°C). Cells were treated with ASA (500 μM, 30 min, 37°C) followed by addition of ionophore A23187 (5 μM, 25--30 min). Incubations were stopped with MeOH, extracted and analyzed by tandem UV, LC-MS-MS ([Fig. 3](#fig3){ref-type="fig"} inset shows UV-chromatogram plotted at 235 nm absorbance) (*n* = 4, d = 20). Both 17R-HDHA and DHA were identified on the basis of individual retention times, parent ions, and daughter ions obtained.
{#fig4}
Of interest, in the absence of ASA treatment, 17*S*-HDHA and corresponding 17*S*-hydroxy-containing diHDHA and triHDHA were products in murine exudates and human cells. Their formation differs from the present biosynthesis in that, rather than COX-2-ASA, 15-LO initiates biosynthesis in sequential lipoxygenation reactions to produce di- and trihydroxy-DHA (i.e., 7*S*,17*S*-diHDHA, 10,17*S*-diHDHA, 4*S*,17*S*-diHDHA, 4*S*,11,17*S*-triHDHA and 7*S*,8,17*S*-triHDHA; [Table II](#tbl2){ref-type="table"}) via epoxide intermediates. The biosynthesis of these 17*S*-containing epimers and their actions will be reported elsewhere.
Bioactions of the New Compounds.
--------------------------------
Since microglial cells are involved in host defense and inflammation in neural tissues, we incubated human microglial cells with the COX-2 products 13- and 17*R*-HDHA (each at 100 nM) to determine if they had an impact on the generation of inflammatory mediators ([Fig. 5](#fig5){ref-type="fig"} A, inset). At nM concentrations, these novel cyclooxygenase-2 products inhibit TNF-α-induced cytokine production with apparent IC~50~ ∼50 pM, as did the 17-containing di- and trihydroxy-HDHA compound ([Fig. 5](#fig5){ref-type="fig"} A). Next, the HDHA were tested for their ability to regulate transendothelial migration of human PMN. In the nM range, neither of the COX-2--derived monohydroxy-DHA products had a direct impact on PMN transmigration across endothelial cell monolayers ([Fig. 5](#fig5){ref-type="fig"} B). This finding contrasts results obtained with both EPA- and arachidonic acid--derived eicosanoid products that directly downregulate PMN transmigration in vitro ([@bib2], [@bib3]). For purposes of direct comparison, results with an ASA-triggered EPA pathway product 18*R*,5,12-triHEPE (P \< 0.01 by ANOVA) ([@bib2]) were compared with those obtained with 15-epi-16-para(fluoro)-phenoxy-LXA~4~ (P \< 0.01 by ANOVA), a stable analogue of ASA-triggered 15*R*-LXA~4~ produced with ASA treatment from arachidonic acid ([@bib10], [@bib37]).
######
Bioimpact properties of omega-3-derived resolvins. (A) Human glioma cells: inhibition of TNF-stimulated IL-1β transcripts. DBTRG-05MG cells 10^6^/ml were stimulated with 50 ng/ml of human recombinant TNF-α for 16 h to induce expression of IL-1β transcripts. Concentration dependence with COX-2 products: 17-HDHA (▪), 13-HDHA (•), and di-/tri-HDHA (□). The IC~50~ for both compounds is ∼50 pM. (insets) Results are representative of RT-PCR gels of MG cells exposed to 100 nM of 13-HDHA or 17-HDHA and graphed after normalization of the IL-1β transcripts using GAPDH. *n* = 2. (B) Influence of eicosanoids and docosanoids on fMLP-induced neutrophil migration across microvascular endothelial monolayers. Neutrophils (10^6^ cells per monolayer) were exposed to vehicle containing buffer, or indicated concentrations of aspirin-triggered LXA~4~ analogue (black diamonds) 5*S*,12,18*R*-triHEPE (black squares), 17*R*-HDHA (black circles) or 13-HDHA (black triangles) for 15 min at 37°C. Neutrophils were then layered on HMVEC monolayers and stimulated to transmigrate by a 10^−8^ M fMLP gradient for 1 h at 37°C. Transmigration was assessed by quantitation of the neutrophil marker myeloperoxidase. Results are presented as mean ± SEM number of PMNs (*n* = 8--12 monolayers per condition). (C) Reduction of PMN in murine peritonitis and skin pouch. Compounds (100 ng in 120 μl sterile saline) were injected by intravenous bolus injection into the mouse tail vein and followed by 1 ml zymosan A (1 mg/ml) into the peritoneum. Peritoneal lavages were collected (2 h) and cell types were enumerated. Air pouch--compounds (dissolved in 500 μl of PBS without Ca^2+^ or Mg^2+^) injected into the air pouch via intrapouch injection or via intravenous administration (in 120 μl sterile saline) followed by intrapouch injection of TNF-α. 4 h later air pouch lavages were collected and cells were enumerated and differentiated. Compounds were prepared by biogenic synthesis or isolated from in vivo exudates. The ratio of 7,17*R*-diHDHA to 4,17*R*-diHDHA was ∼8:1; the ratio of 4,11,17*R*-triHDHA and 7,16,17*R*-triHDHA was ∼2:1; and the ratio of di- to triHDHA was ∼1:1.3. Exudate transfers to a native mouse (see text). ATL denotes 15-epi-16-para(fluoro)-phenoxy-LXA~4~ (administered at 100 ng/mouse). Values represent mean ± SEM from 3--4 different mice; \*P \< 0.05 when infiltrated PMN is compared with vehicle control.
Biosynthesis of Novel Docosanoids by Human PMN: Cell--Cell Interaction Products Matched in Exudates.
----------------------------------------------------------------------------------------------------
Next, since PMNs interact with vascular cells during inflammation ([@bib7]), the contribution of leukocytes was assessed in the production of the novel di- and tri-hydroxy compounds present in inflammatory exudates ([Fig. 1, A--D](#fig1){ref-type="fig"}). To this end, human PMNs were exposed to zymosan and 17*R*-HDHA produced via ASA-treated COX-2 or endothelial cells. PMNs engaged in phagocytosis transform 17*R*-HDHA to both di- and tri-hydroxy-DHA ([Fig. 6](#fig6){ref-type="fig"}) . The main conversions were to dioxygenation products including 7*S*,17*R*-diHDHA and 10,17*R*--diHDHA with lesser amounts of 4*S*,17*R*-diHDHA as the main dihydroxy--containing products present when monitored at m/z 359 ([Fig. 6](#fig6){ref-type="fig"}). In addition, novel 17*R*-trihydroxy-containing products monitored at m/z 375 were present including 4*S*,11,17*R*-triHDHA as well as a set of trihydroxytetraene containing 7,8,17*R*-triHDHA ([Table II](#tbl2){ref-type="table"}). These compounds formed by human PMN match those produced within exudates generated in vivo in both their chromatographic behavior and prominent ions present in their respective mass spectra. LC-MS and on-line UV diode array profiles shown in [Fig. 7](#fig7){ref-type="fig"} from exudates of mice treated with ASA indicate the in vivo production of both sets of 17R series di- and tri-hydroxy-containing products that carry triene and tetraene chromophores ([Table II](#tbl2){ref-type="table"}). Sources for these trihydroxy-DHA products as schematically illustrated include omega-1 hydroxylation at carbon 22 of either 7*S*,17*R*-diHDHA or 4*S*,17*R*-diHDHA via a p450-like reaction (reference [@bib6] and [Fig. 8](#fig8){ref-type="fig"}) that likely represents inactivation pathway products as with LTs such as formation of 20-OH-LTB~4~, a product of omega-oxidation of LTB~4~ ([@bib2], [@bib3], [@bib6]).
{#fig6}
{ref-type="fig"} for details. Exudates were obtained and analyzed by procedures essentially identical to those described in [Fig. 1](#fig1){ref-type="fig"}. (A) *m/z* were plotted at 375 (top), 359 (middle), and 343 (bottom). (B) UV absorbance was plotted at 300 nm to mark tetraene-containing chromatophores. (C) MS-MS of 7*S*,8,17*R*-triHDHA.](20020760f7){#fig7}
![Biosynthetic scheme proposed for resolvins: aspirin-triggered omega-3-derived products. Acetylation of COX-2 by ASA treatment generates novel 17*R*-H(p)DHA from DHA that is reduced to its corresponding alcohol and converted via sequential actions of a leukocyte 5--LO and leads to formation of both dihydroxy- and trihydroxy-containing docosanoids that retain their 17*R* configuration. Pathways are denoted in blue for omega oxidation products that are likely to be in vivo markers of enzymatic inactivation. The resolvin pathways appear to be maximally induced during the "spontaneous resolution" phase of inflammation and compounds are activated to dampen PMN infiltration, which reduces exudate PMN numbers to promote proresolution of inflammatory exudates (resolvins from EPA, the 18*R*-HEPE series, are denoted in green) that leads to potent inhibitors of PMN recruitment in vitro and in vivo (see pathway, right, text, and reference [@bib2]). The complete stereochemistries of the new di- and tri-hydroxy--containing compounds remain to be established and are depicted here in their likely configuration based on biogenic total synthesis. See [Table II](#tbl2){ref-type="table"} and text for further details.](20020760f8){#fig8}
Transformation of 17*R-*HDHA by activated human PMNs involved a 5-LO and an LTA~4~ synthase reaction that gave triHDHA products via the formation of respective 4*S*-hydro(peroxy)-17*R*-hydroxy- and 7*S*-hydro(peroxy)-17*R*-hydroxy-containing intermediates. Each was converted to epoxide-containing intermediates, i.e., 4(5) epoxide or 7(8) epoxide intermediates, that open via hydrolysis to give rise to 4*S*,11,17*R*-triHDHA or in a parallel route to diols such as the trihydroxytetraene set 7*S*,8,17*R*-triHDHA ([Figs. 4](#fig4){ref-type="fig"}, [7](#fig7){ref-type="fig"}, and [8](#fig8){ref-type="fig"}). The mechanism used by PMNs to convert the 17*R*-HDHA precursor appeared similar to that established and identified for the epoxide generating capacity of the human PMN 5-lipoxgenase, which performs both a lipoxygenation and epoxidation step ([@bib2], [@bib4]) as demonstrated with the potato 5--LO ([@bib46]). The conversion of 17*R*-HDHA by human PMNs displayed similar features as those established for the conversion of arachidonic acid to either LTB~4~ or LXs as well as the recently uncovered 18*R* series of EPA products ([@bib4], [@bib9]). We modeled these in vivo biosynthetic sequences of events using both plant (5-LO potato or 15-LO soybean) and human enzymes added in tandem "one pot" incubations that produce these compounds and matched those of human PMNs and murine exudates (Materials and Methods and [Table II](#tbl2){ref-type="table"}). Our findings with 17*R*-HDHA are of interest because the *S* isomer 17*S*-HDHA, a product of 15-LO, can inhibit human neutrophil 5-LO production of LTs from endogenous substrate ([@bib47]). Along these lines, we found that 17*R*-HDHA was converted by isolated potato 5-LO to both 4*S*-hydro-(peroxy)-17*R*-hydroxy- and 7*S*-hydro-(peroxy)--17*R*-hydroxy-containing products that were reduced to 4*S*,17*R*-diHDHA and 7*S*,17*R*-diHDHA, respectively. These, as well as trihydroxy-DHA (see [Table II](#tbl2){ref-type="table"}), are new products and indicate that 17*R*-HDHA is a substrate for 5-LO and its epoxidase activity. The biogenic synthesis and physical properties of the compounds produced (i.e., major ions of the methyl ester trimethylsilyl-derivatives) with GC-MS analysis were consistent with the fragments obtained without derivatization using LC-MS-MS ([Table II](#tbl2){ref-type="table"}) and support the proposed structures as well as was both the murine exudate and human PMN biosynthesis from DHA (reference [@bib29] for monohydroxy products). Of interest, when added to human PMNs, 17*R*-HDHA prevented formation of LTs both in vitro with human PMNs and in murine exudates (*n* = 4; data not shown).
Inhibition of PMN Recruitment in Peritonitis and Air Pouch: Antiinflammatory Properties (Intravenous and Topical) of Resolvins.
-------------------------------------------------------------------------------------------------------------------------------
Although 17*R*-HDHA did not directly inhibit neutrophil transmigration in vitro ([Fig. 5](#fig5){ref-type="fig"} B), 17*R*-HDHA did regulate in vivo PMN exudate cell numbers in peritonitis as well as in the dermal air pouch ([Fig. 5](#fig5){ref-type="fig"} C). Also, 17*R*-HDHA was a potent inhibitor of zymosan-induced peritonitis, as were both the di- and tri-hydroxy-containing compounds (i.e., 7*S*,17*R*-diHDHA and 4*S*,11,17*R*-triHDHA). In addition to their ability to inhibit PMN recruitment when injected i.v. within zymosan-induced peritonitis, the 17*R*-hydroxy-HDHA-derived di- and trihydroxy-containing products proved to be potent regulators of leukocyte recruitment into the air pouch when administered intravenously as well as topically with local administration ([Fig. 5](#fig5){ref-type="fig"} C). Thus, these results indicate that human and murine leukocytes convert 17*R*-HDHA to a novel series of 17*R*-hydroxy-containing di- and triHDHA; namely, an ASA-triggered circuit to utilize DHA to produce a 17*R*-series of docosanoids ([Fig. 8](#fig8){ref-type="fig"}).
Discussion
==========
These results indicate that cells expressing COX-2 in exudates and brain treated with ASA enzymatically transform omega-3 DHA to previously unrecognized compounds with bioactive properties in inflammation resolution, i.e., a novel 17*R* series of hydroxy-DHAs. The ASA-acetylated COX-2 present in these tissues generates predominantly 17*R*-HDHA that is converted further enzymatically to potent bioactive 17*R* series via lipoxygenation and epoxidation in leukocytes to both di- and tri-hydroxy--containing novel docosanoids ([Fig. 8](#fig8){ref-type="fig"}). DHA is the most unsaturated of the omega-3 polyene family of fatty acids in mammalian and fish tissues. In humans, DHA is abundant in brain, retina, and testes ([@bib28], [@bib48]). The levels of DHA increase in adult human brain with age, which is required for optimal neural development ([@bib49]) and DHA is rapidly esterified in retinal epithelium photoreceptors as well as into the phospholipids of resting human neutrophils ([@bib28], [@bib50]). At high micromolar values, DHA is held to possess both physiologic roles and direct action on neural voltage gated K^+^ channels ([@bib51]), binds RXR in neural tissues ([@bib52]) and is held to be the active compound of fish oil supplements that is cardioprotective ([@bib21]). Also, addition of DHA can correct and reverse the pathology associated with cystic fibrosis in *cftr* ^−/−^ mice ([@bib53])*.* However, it is not clear from the results of these studies ([@bib21], [@bib51], [@bib52]) or of the many reported clinical trials whether DHA is precursor to potent bioactive structures that are responsible for the many reported properties attributed to DHA itself in regulating biological systems of interest.
The three major LOs (i.e., 5-LO, 12-LO, and 15-LO) that act on arachidonate can each convert DHA to *S*-containing products, but their function in the immune system or elsewhere is not clear. In the brain, 12-LO of pineal body converts DHA to 14*S*-HDHA and 15-LO to 17*S*-HDHA ([@bib40]). DHA can also be converted by human neutrophils to 7*S*-HDHA that does not stimulate chemotaxis ([@bib31]), and retina converts DHA to both mono- and di-hydroxy products via LO(s) ([@bib28]). While not a substrate for COX-1 ([@bib43]), oxidized isoprostane-like compounds can also be produced from DHA that appear to reflect oxidative free radical catalyzed events ([@bib54]). Hence, the new 17*R*-hydroxy series of docosanoids generated by neural tissues, leukocytes, and inflammatory exudates uncovered in these experiments and their role(s) are of interest in inflammation resolution, a process now considered to be associated with many human diseases.
Although an extensive literature obtained with omega-3 fish oils encompassing both animal and human studies suggests that EPA and DHA could have a beneficial impact in the treatment of many chronic diseases (such as cardiovascular disease, atherosclerosis, and asthma, as well as antitumor and antiproliferative properties; references [@bib15] and [@bib55]), the molecular rationale for their use remains of interest. Most of the earlier studies focused on uptake of omega-3 PUFA (i.e., EPA and DHA), namely their esterification into phospholipid and other lipid stores of many human tissues that in some cells reduces the availability of endogenous arachidonic acid for processing to proinflammatory prostaglandins ([@bib55]). The body of results now available indicates that, in addition to proinflammatory roles, specific 15-LO, 5-LO, and/or LO-LO interaction products formed during cell--cell interactions such as LXs serve as endogenous antiinflammatory mediators promoting resolution ([@bib9], [@bib10], [@bib12]). Like other LO-derived eicosanoids, LXs are potent-local acting in subnanomolar levels with precise stereochemical requirements for evoking their actions ([@bib4], [@bib9]). Hence, the production of 18*R* and 15*R* series products from EPA that inhibit PMN transmigration and inflammation within the low nanomolar range emphasizes the functional redundancies within chemical mediators produced from the omega-3 family of polyene fatty acids, namely the recently identified compounds from COX-2 EPA ([@bib2]) or DHA-derived compounds as indicated from the present results ([Figs. 6](#fig6){ref-type="fig"}--[8](#fig8){ref-type="fig"}). It is important to note that with these small molecular weight mediators subtle changes in chirality of alcohol-i.e., *S* to *R*--can change a compound from active to inactive or vice versa ([@bib3], [@bib4], [@bib9]). In this regard, the 15*R*-hydroxy-containing compounds generated from either arachidonic acid or EPA and 18*R* series from EPA, as well as 17*R*-hydroxy series from DHA, each display similar functional redundancies in inflammation resolution. Hence, uncovering the 17*R* series of both mono- and di-oxygenation products in inflammatory exudates and a role for COX-2 in the generation of the 17*R*-hydroxyl configuration in HDHA described here for the first time opens new avenues for considering the overall functional redundancies of mediators that dampen and/or counter the many proinflammatory signals to promote resolution.
COX-2 is induced in most inflammatory cell types, but can also be constitutive in neural and vascular tissue ([@bib44], [@bib56]). The importance of the enlarged substrate tunnel in COX-2 becomes of interest when considering possible physiologic roles of this enzyme in these localities in vivo. It is now clear from numerous studies that aspirin has beneficial effects in and apart from other nonsteroidal antiinflammatory drugs ([@bib57], [@bib58]). In this regard, ASA has a unique ability to acetylate both isoforms of COX-1 and COX-2. It is also noteworthy that DHA is cardioprotective in the ischemic heart ([@bib22]) and that COX-2 is involved in preconditioning ([@bib19]) as well as resolution ([@bib12]). Our present results indicate that DHA is a precursor and is converted to 17*R*-HDHA via ASA-acetylated COX-2 at sites of inflammation in vivo ([Fig. 1](#fig1){ref-type="fig"}), murine brain ([Fig. 3](#fig3){ref-type="fig"}), and by acetylated recombinant COX-2 in vitro ([Fig. 2](#fig2){ref-type="fig"})*.* Both 13- and 17*R*-HDHA inhibit cytokine generation by microglial cells at the transcript level in the picomolar range ([Fig. 5](#fig5){ref-type="fig"} A). Human microglial cells generate these 17*R*-HDHA series products when given aspirin and TNF-α, which upregulate COX-2 expression ([Fig. 3](#fig3){ref-type="fig"} C). In addition, murine inflammatory exudates produced a family of novel di- and tri-hydroxy products that were also produced by human PMN via transcellular processing of 17*R*-HDHA. The proposed pathways for transcellular processing of acetylated COX-2--derived 17*R*-HDHA highlighting the generation of dioxygenated intermediates and epoxidation to form novel diHDHA during vascular inflammation-associated events are illustrated in [Fig. 8](#fig8){ref-type="fig"}. It should be noted that these and related structures can be generated via cell--cell interactions or single cell types as depicted in [Fig. 8](#fig8){ref-type="fig"}, but could in theory also be produced via several sequential oxygenation routes by a single enzyme as well (see [Fig. 8](#fig8){ref-type="fig"} legend). When these products were prepared by biogenic total synthesis and added back via topical administration into the air pouch, they inhibited TNF-α--induced leukocyte infiltration. Also, each member of the pathway carried biological activity with increased potencies as the di- and tri-hydroxy products compared with the monohydroxy-containing products, findings that suggest that activation of the entire pathway is involved in evoking responses. Also, with intravenous administration these compounds inhibited leukocyte recruitment in both murine air pouch and in zymosan-induced peritonitis ([Fig. 5](#fig5){ref-type="fig"}). Taken together, these results indicate that ASA-acetylated COX-2--derived products can downregulate cytokine generation and leukocyte (i.e., neutrophil) recruitment to sites of inflammation. The EPA-derived 5,12,18*R* series product proved to be as effective as a potent stable analogue of 15-epi-LXA~4~ in preventing leukocyte diapedesis and exudate formation ([Fig. 5](#fig5){ref-type="fig"} C). For comparison, both the EPA- and DHA-derived resolvins at a 100 ng dose/mouse were more potent than indomethacin at an equal dose that gave ∼25% inhibition at 100 ng/mouse or 3 μg/kg in zymosan-induced peritonitis (*n* = 3). Since 17*R*-HDHA did not have a direct impact on human PMN transmigration in these conditions, but reduced exudate PMN numbers in vivo as well as regulates gene expression in human microglial cells, it is highly likely that a multilevel mechanism of action accounts for the in vivo properties of this ASA-triggered pathway. Moreover, there appear to be functional redundancies between the pathways in that the 18*R* series from EPA- and 17*R* series DHA-derived hydroxy-containing compounds share in their ability to regulate PMN exudate numbers ([Fig. 5](#fig5){ref-type="fig"}).
Emergence of the finding that arachidonic acid-derived LXs inhibit PMN trafficking and serve as endogenous antiinflammatory mediators while activating monocytes in a nonphlogistic fashion ([@bib11], [@bib59]), as well as accelerating the uptake of apoptotic PMN by macrophages at sites of inflammation ([@bib28]), indicates that not all LO pathway products from the arachidonic acid precursor are "pro"-inflammatory. Given their longer half-life and bioavailability, the metabolically more stable analogs of these local-acting lipid mediators derived from arachidonate in vivo and prepared by total organic synthesis provide further evidence for their roles in promoting resolution ([@bib37]). Moreover, these results suggest that the new resolving properties belong to a larger class of endogenous compounds with mechanisms directed toward enhancing resolution. Also, the link between antiinflammation and enhanced endogenous antimicrobial activities ([@bib13]) by LXs and ASA-triggered LXs sets a unique precedent for the importance of cell--cell communication and transcellular biosynthesis in host defense and in the clearance and resolution of inflammatory sequelae. These results disclosing 17*R* series oxygenated DHA products and with the 15*R* and 18*R* series from EPA as prototypes ([@bib2]), taken together, suggest that the generation of local-acting lipid mediators with beneficial actions relevant in human disease may not be restricted to arachidonic acid alone as an important precursor. Also, they indicate that transcellular biosynthesis unveils previously unrecognized pathways that are evoked by ASA treatment with DHA. Acetylated COX-2 acts in an "*R*-oxygenation" mechanism to initiate the conversion of DHA to a 17*R* series of di- and tri-hydroxy docosanoids that display downregulatory actions in vivo in inflammation as do the omega-3 EPA-derived 18*R*-series-products. Hence, it follows that once inflammation is initiated, upon ASA treatment with omega-3 supplementation, these pathways can be operative in vascular tissues to generate products that appear to have properties as ASA-triggered lipid mediators similar to either the 15-epi-LXs or 18*R*-- and 15*R* series products from EPA. These compounds are generated via lipoxygenation followed by epoxidation and subsequent steps ([Fig. 8](#fig8){ref-type="fig"} and reference [@bib2]). Also of interest are our findings that, in the absence of ASA, COX-2 converts DHA to 13-HDHA, a previously unknown route that might also be relevant in tissues that constitutively express COX-2, which is also converted to dihydroxy DHA products (4,13-diHDHA, 7,13-diHDHA, and 13,20-diHDHA), and during resolution, induction, and conversion by 15-LO ([@bib10]) to 10,17*S*-diHDHA and 7*S*,17*S*-diHDHA, the pathways and actions of which will be reported elsewhere.
Since the properties of the omega-3--derived products from acetylated COX-2 via transcellular biosynthesis appear to dampen events in inflammation apparently in a functionally redundant fashion (i.e., 17*R*--HDHA series, 18*R*- and 15*R*-HEPA series), the term "resolvins" is introduced for this family of new compounds and bioactions. Resolvins, by definition, are endogenously generated within the inflammatory resolution phase and downregulate leukocytic exudate cell numbers to prepare for orderly and timely resolution. These results indicate that the 17*R* series of di- and tri-hydroxy DHA pathways are potent in models relevant in inflammation. It is likely that these compounds will also have actions in other tissues, in view of the many reports of the clinical actions for EPA and DHA, where high concentrations of these PUFA are used and required to evoke responses in vitro. Theses results indicate that cell--cell interactions at sites of inflammation resolution utilize omega-3 fatty acids to generate novel omega-3--derived products including 17*R*-HDHA series and 18*R*-HEPE series of oxygenated bioactive products termed resolvins ([Fig. 8](#fig8){ref-type="fig"}). Given their potent actions, the production of *Resolvins* may, in part, provide a molecular rationale underlying the beneficial actions of omega-3 fatty acids ([@bib15]--[@bib22]) in neoplasia, chronic immune, and cardiovascular diseases and serve as new biotemplates for therapeutic development.
We thank Mary Halm Small for assistance in manuscript preparation. We also acknowledge the efforts of Dr. Clary Clish and Jessica Brannon in the initial mass spectral analysis with COX-2 and DHA, and Dr. Nan Chiang and Dr. Francesca Bianchini for in vivo peritonitis studies.
This work was supported in part by grants no. GM38765 and P01-DE13499 (to C.N. Serhan) from the National Institutes of Health.
*Abbreviations used in this paper:* ASA, aspirin; COX, cyclooxygenase; DHA, docosahexaenoic acid; EPA, eicosapentaenoic acid; GC-MS, gas chromatography-mass spectrometry; HMVEC, human microvascular endothelial cell; HUVEC, human umbilical vein endothelial cell; LC-UV-MS-MS, liquid chromatography-UV diode array detector-tandem mass spectrometry; LO, lipoxygenase; LT, leukotriene; LX, lipoxin; PUFA, polyunsaturated fatty acid.
[^1]: Address correspondence to Charles N. Serhan, Center for Experimental Therapeutics and Reperfusion Injury, Thorn Medical Research Bldg., 7th Floor, Brigham and Women\'s Hospital, Boston, MA 02115. Phone: 617-732-8822; Fax: 617-582-6141; E-mail: <cnserhan@zeus.bwh.harvard.edu>
| {
"pile_set_name": "PubMed Central"
} |
Peripheral nerves do not play a trophic role in limb skeletal morphogenesis.
Research was undertaken to test the hypothesis that thalidomide-induced limb defects resulted from damage to the neural crest or peripheral nerves and that normal limb development depends upon either the quality (level specific) or quantity of peripheral nerves. Barriers which were placed into early chick embryos to block brachial plexus-level neural crest cells from reaching the limb resulted in normal limb skeletons. These data agree with previous work in suggesting that skeletal morphology is independent of innervation. | {
"pile_set_name": "PubMed Abstracts"
} |
Simple Lovely Email
Highrise
Integrate email marketing with this simple CRM from 37Signals
Integrate Highrise contacts with your Mad Mimi account
Highrise helps you remember who you need to reach out to, but what happens when you're ready to reach out via a beautiful HTML newsletter?
This integration streamlines the connection between your contacts and the email newsletter you need to send them. Add your Highrise contacts into a list into your Mad Mimi audience and send them those lovely email newsletters in just a couple of clicks. | {
"pile_set_name": "Pile-CC"
} |
Effects of atorvastatin and vitamin C on endothelial function of hypercholesterolemic patients.
We tested the effects of vitamin C and atorvastatin treatment on endothelium-dependent and endothelium-independent vasodilation in 18 hypercholesterolemic patients (ten men and eight women, aged 20-46 years) in comparison with 12 normal volunteers (seven men and five women, aged 20-45 years). The responses of the forearm blood flow (FBF) to acetylcholine (ACh) (7.5, 15 and 30 microg/min), sodium nitroprusside (SNP) (0.8, 1.6, 3.2 microg/min) and L-NMMA (2, 4, 8 micromol/min) were evaluated at baseline and after 1 month of atorvastatin (10 mg/day) treatment. Drugs were infused into the brachial artery and FBF was measured by strain-gauge plethysmography. At baseline, the response to ACh was significantly attenuated in hypercholesterolemics versus controls: at the highest dose (30 microg/min), FBF was 27.0+/-3.4 versus 11.5+/-1.9 ml.100 ml tissue(-1).min(-1) respectively (P<0.0001). No significant differences were found between groups during SNP infusion. The atorvastatin treatment significantly improved ACh-stimulated FBF: at highest dose the FBF increased to 14.9+/-1.5 ml.100 ml tissue(-1). min(-1) (P<0.0001). Similarly, the L-NMMA endothelial effects were significantly enhanced by lipid-lowering treatment, supporting the improvement of basal nitric oxide. Vitamin C increased ACh-vasodilation in the same way before and after atorvastatin treatment. In conclusion, the endothelial dysfunction in hypercholesterolemics is due to an oxidative stress and atorvastatin rapidly improves both basal and stimulated endothelium-dependent vasodilation. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
Reader doesn't wake up once writer finishes writting in Reader writer lock
class ReadLock
{
private:
std::mutex readWriteMutex;
std::mutex conditionmtx;
std::condition_variable cv;
int readings = 0;
int writings = 0;
int writers = 0;
public:
void AquireReadLock()
{
readWriteMutex.lock();
if (writers)
{
std::unique_lock<std::mutex> lck(conditionmtx);
cv.wait(lck);
}
while (writings)
{
std::unique_lock<std::mutex> lck(conditionmtx);
cv.wait(lck);
}
readings++;
readWriteMutex.unlock();
}
void ReleaseReadLock()
{
readWriteMutex.lock();
//std::unique_lock<std::mutex> lck(conditionmtx);
cv.notify_all();
readings--;
readWriteMutex.unlock();
}
void AquireWriteLock()
{
readWriteMutex.lock();
writers++;
while (readings || writings)
{
std::unique_lock<std::mutex> lck(conditionmtx);
cv.wait(lck);
}
writings++;
readWriteMutex.unlock();
}
void ReleaseWriteLock()
{
readWriteMutex.lock();
writings--;
writers--;;
//std::unique_lock<std::mutex> lck(conditionmtx);
cv.notify_all();
readWriteMutex.unlock();
}
};
ReadLock lock;
void WriteFunction(int id)
{
std::cout << "thread " + std::to_string(id) + " asks for write " << '\n';
lock.AquireWriteLock();
std::cout << "thread " + std::to_string(id) + " writting" << '\n';
std::this_thread::sleep_for(std::chrono::milliseconds(3500));
std::cout << "thread " + std::to_string(id) + " finished writting" << '\n';
lock.ReleaseWriteLock();
}
void ReadFunction(int id)
{
if (id == 0)
std::this_thread::sleep_for(std::chrono::milliseconds(500));
std::cout << "thread " + std::to_string(id) + " asks for read" << '\n';
lock.AquireReadLock();
std::cout << "thread " + std::to_string(id) + " reading" << '\n';
std::this_thread::sleep_for(std::chrono::milliseconds(2500));
std::cout << "thread " + std::to_string(id) + " finished reading" << '\n';
lock.ReleaseReadLock();
}
int _tmain(int argc, _TCHAR* argv[])
{
std::thread threads[3];
for (int i = 0; i < 3; ++i)
if (i % 2 == 0)
threads[i] = std::thread(ReadFunction, i);
else
threads[i] = std::thread(WriteFunction, i);
for (auto& th : threads) th.join();
}
i am trying to implement reader writer lock using condition variable and Mutex. Thread 2 writes first and thread 0 and thread 1 waits for thread 2 to finish writing but once thread 2 finished writing thread 1 and thread 0 are not waking up to read.can someone Help me out with this ? i am new to c++ synchronisation
A:
This code generates a deadlock either on the writerRelease() or the readerRealease() debending which was fist aqcuired.
How to find out ?
Multithread code is difficult to debug. I suggest you to add here some logging with to show when entering in an aquire/release function and when the mutex was locked.
For example:
void ReleaseReadLock()
{
cout <<this_thread::get_id()<< " will release ReadLock" << endl;
readWriteMutex.lock();
cout << this_thread::get_id() << " ...mutex locked" << endl;
cv.notify_all();
cout << this_thread::get_id() << " ...notified" << endl;
readings--;
readWriteMutex.unlock();
cout << this_thread::get_id()<<" released ReadLock " << endl;
}
With such code, you will observe this scenario (or a slight variant of it):
5204 thread 1 asks for write
3692 thread 2 asks for read
5204 will aquire WriteLock ==> start write lock acquisition
3692 will aquire ReadLock ==> start read lock acquisition
3692 ...mutex locked ==> mutex was locked for read lock acquisition
3692 aquired ReadLock ==> mutex was unlocked : end read lock acquisition.
5204 ...mutex locked ==> mutext was locked for writelock
3692 thread 2 reading
5288 thread 0 asks for read
5288 will aquire ReadLock ==> another read lock will wait for mutex
3692 thread 2 finished reading
3692 will release ReadLock ==> Reader can't release lock because mutex is locked by writelock
What happens ?
The release lock was aquired succesfully. So readings is 1 .
To decrease this variable, releaseReadLock() has to terminate its job. But it can't because the mutex it needs at the beginning of the function, is still held by the aquireWriteLock(). So it waits.
But the aquireWriteLock() is stuck in a loop, that will continue to loop as long as readings or writings. It will release the mutex only of readings goes back to 0.
In short, releaseReadLock() and acquireWriteLock() are both stuck, waiting for each other.
How to solve it ?
Well, deadlocks are a pretty nasty thing.
One thing that helsp is to always perform locking on several objects in the same order. Then one thred might eventiually fail the locking, but there'll be no "kiss of death".
More specifically, looking at your code, I have the impression that your readWriteMutex is there mostly to protect against race conditions on your 3 counters. I'd suggest to get rid of this mutex and use atomic variables instead.
Then in ReleaseReadLock() you should decrement the number of readers before notifying the waiting threads. With these two measures, I could run several times without deadlock (which do not prove that it's perfect, but at least the most obvious cases are avoided. up to you to analyse/verify in detail).
class ReadLock
{
private:
std::mutex conditionmtx;
std::condition_variable cv;
atomic<int> readings = 0; // atomics don't need mutex for being updated
atomic<int> writings = 0;
atomic<int> writers = 0;
public:
void AquireReadLock()
{
cout << this_thread::get_id() << " will aquire ReadLock" << endl;
if(writers) {
std::unique_lock<std::mutex> lck(conditionmtx);
cv.wait(lck);
}
while(writings) {
std::unique_lock<std::mutex> lck(conditionmtx);
cv.wait(lck);
}
readings++;
cout << this_thread::get_id() << " aquired ReadLock" << endl;
}
void ReleaseReadLock()
{
cout <<this_thread::get_id()<< " will release ReadLock" << endl;
readings--;
cv.notify_all();
cout << this_thread::get_id()<<" released ReadLock " << endl;
}
void AquireWriteLock()
{
cout << this_thread::get_id() << " will aquire WriteLock" << endl;
writers++;
while(readings || writings) {
std::unique_lock<std::mutex> lck(conditionmtx);
cv.wait(lck);
}
writings++;
cout << this_thread::get_id() << " aquired WriteLock" << endl;
}
void ReleaseWriteLock()
{
cout << this_thread::get_id() << " will release WriteLock" << endl;
writings--;
writers--;;
cv.notify_all();
cout << this_thread::get_id() << " ...notified" << endl;
cout << this_thread::get_id() << " released WriteLock" << endl;
}
};
| {
"pile_set_name": "StackExchange"
} |
Q:
How to check whether two sets contain the same objects
I have a class IntegerType:
public class IntegerType implements DataType {
private int value;
public IntegerType(int value) {
this.value = value;
}
@Override
public NativeType nativeType() {
return NativeType.INTEGER;
}
@Override
public int size() {
return Integer.BYTES;
}
@Override
public Integer value() {
return this.value;
}
@Override
public boolean equals(Object o) {
boolean result = false;
if (o == null || o.getClass() != getClass()) {
result = false;
} else {
IntegerType integerType = (IntegerType) o;
if (this.value == integerType.value()) {
result = true;
}
}
return result;
}
}
And I essentially want to check whether two sets containing instances of IntegerType are the same based on whether the instances have the same .value parameter:
IntegerType int1 = new IntegerType(1);
IntegerType int2= new IntegerType(1);
Set<IntegerType> set1 = new HashSet<>();
set1.add(int1);
Set<IntegerType> set2 = new HashSet<>();
set2.add(int2);
System.out.println(set1.equals(set2));
However running the above code prints out false. From what I understand it should print true since int1.equals(int2) is true. What am I missing here?
A:
As the name suggests, HashSet requires you to override the hashCode method, which it uses to determine whether or not two objects could possibly be equal. Here is a possible implementation:
@Override
public int hashCode() {
final int prime = 31;
int result = 1;
result = prime * result + value;
return result;
}
Demo
| {
"pile_set_name": "StackExchange"
} |
Q:
How to export an asp:GridView's TemplateField fields to excel in c#?
Does anyone have an example (code or a link) that will allow me to export a gridview template field to excel? Here is an example of what I mean. Assume I have the following GridView Declaration:
<asp:GridView Id="gvResults" runat="server">
<Columns>
<asp:TemplateField HeaderText="Contact Info">
<ItemTemplate>
<b>Name:</b><%# Eval("Name") %><br/>
<b>Address:</b><%# Eval("Address") %><br/>
<b>Phone:</b><%# Eval("Phone") %><br/>
<b>E-mail:</b><%# Eval("Email") %>
</ItemTemplate>
</asp:TemplateField>
</Columns>
</asp:GridView>
When I export to excel, I want to export the fields in the template field to columns in the excel file, so it will look similar to this:
Name Address Phone E-mail
==== ======= ==== =====
John 123 Rd 40330 J@j.com
Mark 456 St 22039 M@M.com
A:
I would highly recommend to anyone using out of the box asp gridview controls to consider spending some money on a third party package (DevExpress is my favorite)
That being said, I have used this before when I had no other choice
| {
"pile_set_name": "StackExchange"
} |
484 F.3d 149
The BANK OF NEW YORK, Interpleader-Plaintiff-Appellee,v.Jenny RUBIN, Daniel Miller, Abraham Mendelson, Stuart Hersch, Renay Frym, Noam Rozenman, Elena Rozenman and TZVI Rozenman,* Interpleader-Defendants-Appellants,Bank Melli Iran New York Representative Office, Interpleader-Defendant-Appellee,Bank Saderat Iran, Bank Sepah Iran and Bank Saderat Iran Dubai Branch, Interpleader-Defendants.Docket No. 06-1606-cv.
United States Court of Appeals, Second Circuit.
Argued: March 27, 2007.
Decided: April 11, 2007.
David Strachman (Robert J. Tolchin, Jaroslawicz & Jaros, on the brief), McIntyre, Tate & Lynch, LLP, Providence, Rhode Island, for interpleader-defendants-appellants.
John D. Winter (Wendy K. Akbar, on the brief), Patterson Belknap Webb & Tyler, LLP, New York, New York, for interpleader-defendant-appellee Bank Melli Iran New York Representative Office.
Michael J. Garcia, United States Attorney for the Southern District of New York (Lara K. Eshkenazi, Beth E. Goldman, on the brief), New York, New York, for amicus curiae United States of America in support of interpleader-defendant-appellee Bank Melli Iran New York Representative Office.
Before FEINBERG, SOTOMAYOR, and KATZMANN, Circuit Judges.
PER CURIAM.
1
Interpleader-defendants-appellants Jenny Rubin et al. (the "Rubin defendants") appeal from a March 15, 2006 opinion and order of the United States District Court for the Southern District of New York (Cote, J.), determining that assets held in accounts with interpleader-plaintiff-appellee the Bank of New York on behalf of interpleader-defendant-appellee Bank Melli Iran New York Representative Office ("Bank Melli") are not blocked assets subject to attachment pursuant to the Terrorism Risk Insurance Act of 2002 ("TRIA"), Pub. L. No. 107-297, 116 Stat. 2322. See Bank of New York v. Rubin, No. 05 Civ. 4926(DLC), 2006 WL 633315 (S.D.N.Y. March 15, 2006).
2
The Rubin defendants hold a default judgment against the Islamic Republic of Iran ("Iran") arising from its provision of training and material support to the group responsible for a 1997 terrorist bombing in Israel in which they or their relatives were injured. To satisfy the judgment, they registered it in the United States District Court for the Southern District of New York and attempted to attach, pursuant to section 201 of the TRIA, the assets of three Iranian banks held in accounts with the Bank of New York. Section 201 provides, in pertinent part, that "in every case in which a person has obtained a judgment against a terrorist party on a claim based upon an act of terrorism . . . the blocked assets of that terrorist party (including the blocked assets of any agency or instrumentality of that terrorist party) shall be subject to execution or attachment in aid of execution in order to satisfy such judgment to the extent of any compensatory damages for which such terrorist party has been adjudged liable." TRIA § 201(a), 116 Stat. at 2337. The TRIA defines "blocked asset" as "any asset seized or frozen by the United States under section 5(b) of the Trading With the Enemy Act (50 U.S.C.App. § 5(b)) or under sections 202 and 203 of the International Emergency Economic Powers Act (50 U.S.C. §§ 1701; 1702)." TRIA § 201(d)(2), 116 Stat. at 2339.
3
For the reasons thoroughly stated in Judge Cote's fine opinion below, incorporating the persuasive analysis of Judge Leonard D. Wexler of the United States District Court for the Eastern District of New York addressing a similar claim against the same bank accounts, see Weinstein v. Islamic Republic of Iran, 299 F.Supp.2d 63 (E.D.N.Y.2004), we hold that assets blocked pursuant to Executive Order 12170, 44 Fed. Reg. 65,729 (Nov. 14, 1979), and its accompanying regulations, see 31 C.F.R. Part 535, that are also subject to the general license of 31 C.F.R. § 535.579, are not blocked assets under the TRIA and therefore are not subject to attachment under that statute.
4
The government, which entered this case as amicus curiae in support of Bank Melli, notified the Court prior to oral argument that the Department of the Treasury has recently frozen the assets of interpleader-defendant Bank Sepah Iran ("Bank Sepah") because of its role as the "financial linchpin of Iran's missile procurement network." See News Release, Department of the Treasury, Iran's Bank Sepah Designated by Treasury, Sepah Facilitating Iran's Weapons Program, 2007 WL 54930 (Jan. 9, 2007) (internal quotation marks omitted). Although neither Bank Sepah nor interpleader-defendants Bank Saderat Iran and Bank Saderat Iran Dubai Branch made appearances below, Judge Cote, in a footnote to her opinion and order, stated that "[a]s the parties have provided no reason to distinguish among the Iranian banks, the . . . analysis [with respect to Bank Melli] will apply to all of the funds held by the Bank of New York." Rubin, 2006 WL 633315, at *1 n. 1. The district court did not enter a separate judgment with respect to these banks or direct the release of their funds, and they have not appeared in the proceedings on appeal. Pursuant to a stipulation and order, however, the banks' funds have been placed in the district court's registry pending the outcome of the Rubin defendants' appeal, just as Bank Melli's funds, pursuant to a separate stipulation and order, are being held in an escrow account with its attorneys. Construing this as evidence of a final judgment with respect to Bank Sepah, cf. Vona v. County of Niagara, 119 F.3d 201, 206 (2d Cir.1997) ("Even though a document does not comprehensively list all of the [district] court's decisions, we may consider it to be a final judgment if it is clear that the court so intended it."), we vacate that judgment and remand so that the district court may determine whether the Rubin defendants may now attach Bank Sepah's assets deposited in the registry of the district court.
5
For the foregoing reasons, the judgment of the district court is VACATED as to Bank Sepah and otherwise is AFFIRMED, and the case is REMANDED in part for proceedings not inconsistent with this opinion.
Notes:
*
We direct the Clerk of the Court to amend the official caption to include Elena Rozenman as an interpleader-defendant-appellant
| {
"pile_set_name": "FreeLaw"
} |
Subsets and Splits