_id
stringlengths 7
16
| description
stringlengths 55
95.2k
|
|---|---|
pmc-6017159-1 | A 19-year-old healthy male with no significant medical history presented with complaints of palpitations for one day along with chest pain and shortness of breath. It started when he was working on a Christmas tree farm. The patient reported a history of similar episodes for last six years usually triggered with mild exertion. He had noticed increased frequency and severity of symptoms for last six months and it started happening at least twice per week. He denied smoking, drinking alcohol, excessive caffeine consumption, substance use, recent travel, cough, fever, chills, night sweats, hemoptysis, weight loss, joint pain, rash, nausea, vomiting, abdominal pain and syncopal episodes. The patient has been feeling more fatigued and tired for last few months. On admission, vitals were normal. On physical examination, he was anxious and appeared to be in distress, rest of the systemic examination was unremarkable. Laboratory results showed normal liver, kidney functions and troponins. Urine drug screen was negative. Chest X-ray showed a right perihilar mass of 3.1 x 3.4 cm (Figure ).
Computed tomography scan of the chest showed stippled-type calcified mediastinal lymphadenopathy of 1.6 cm x 2.1 cm, and right hilar mass of 3.8 x 4.8 cm (Figure ).
The patient had a bronchoscopy with fine needle aspiration (FNA) of mediastinal mass and lymph nodes. FNA results came back negative for malignancy, gram stain and cultures, acid-fast bacilli (AFB) stain and cultures, fungal stain and cultures were all negative. Histological examination showed predominant necrosis with rare benign lymphoid tissue. Urine histoplasma antigen and serum Aspergillus galactomannan antigens were negative. The patient continued to have chest discomfort and dyspnea after bronchoscopy. He had a mediastinoscopy with lymph node biopsy which showed an inflammatory granulomatous process. Pathology report showed lymphoid tissue with necrotizing granulomatous inflammation and positive fungal stain and morphology consistent with histoplasma species. Fungal and AFB cultures remained negative. The patient was started on oral itraconazole 200 mg twice a day with a plan for regular outpatient follow-up. He had improvement in chest symptoms during routine infectious disease clinic follow-up. He could not tolerate itraconazole due to diffuse rash after two weeks of treatment. He was switched to oral fluconazole 400 mg once daily which he tolerated without any problems. |
pmc-6017160-1 | A 69-year-old man presented with chief complaints of a growing mass on his nose, concomitant nasal airway obstruction, visual field impairment, and an inability to wear glasses. The patient also described the recent appearance of a glabellar lesion. Several weeks prior to our consultation, the patient sought the care of his primary care physician, who incised this newer lesion hoping to drain it. When this procedure was unsuccessful, the patient was referred for further treatment.
Upon physical examination, the patient was found to have an extensive rhinophyma and additional lesions of the nasal glabella and right upper forehead regions (Figures , ). The rhinophyma measured 6.7 centimeters (cm) in diameter. The patient reported that it had been enlarging for six years. Observation revealed an irregular, nodular tumor with telangiectasia and sebum inspissation. The glabellar lesion measured 3.0 cm in diameter and appeared as a discrete erythematous tumor with central ulceration and necrosis. The location of this lesion on non-sebaceous skin suggested a non-rhinophymatous lesion and raised our suspicion for malignancy. An additional 1.5 cm lesion of the right forehead region appeared as a round, telangiectatic nodule with a waxy border. A preoperative diagnosis of basal cell carcinoma for this separate lesion was confirmed by the pathological report.
Surgery was performed on the nasal lesions. The rhinophyma was excised and debulked, then closed with adjacent cheek flaps and skin graft. The glabellar lesion extended to the left medial canthal area. It was treated with wide local excision and was closed with forehead flaps. Frozen section analysis of the glabellar specimen revealed a diagnosis of diffuse large B-cell lymphoma. The area of rhinophyma on the lower portion of the nose displayed no evidence of lymphoma. After a three-week interval, the basal cell carcinoma of the right forehead was removed, and closure was accomplished with double opposing V-Y advancement flaps (Figures , ).
The final pathology report confirmed the diagnosis of diffuse large B-cell lymphoma (DLBCL) with BCL6 positivity. The patient was referred to an oncologist for further treatment. Subsequent oncological workup revealed several positive lymph nodes in the anterior cervical chain. One such node was biopsied by a general surgeon and was found to be positive for diffuse large B-cell lymphoma. Intensive combination chemotherapy, including Rituxan®, Cytoxan®, Oncovin®, Adriamycin®, and prednisone, was initiated. |
pmc-6017181-1 | A 64-year-old African American female with a past medical history of insulin-dependent diabetes mellitus, hypertension, hyperlipidemia, prior history of stroke, hypothyroidism, and family history of coronary artery disease presented to the emergency department with complaints of typical chest pain. The patient's chest pain was associated with nausea and vomiting. The physical examination and initial electrocardiogram were unremarkable. Cardiac enzymes were negative. The patient was started on aspirin, statin, and nitroglycerin. Cardiology was consulted and they decided to do left heart catheterization through right radial access and an echocardiogram, as the patient was having unstable angina. The echocardiogram showed a normal ejection fraction with no wall motion abnormalities.
Left heart catheterization showed anomalous coronaries, with all three coronaries arising from the right coronary cusp with a separate ostium, as shown in Figures -.
The left anterior descending artery (LAD) had an anomalous origin with a separate ostium from the right coronary cusp. There was focal moderate to severe 70%-80% disease in the mid vessel. The LAD was a small vessel. The left circumflex artery had an anomalous origin with a separate ostium from the right coronary cusp. Mild luminal irregularities were present. The right coronary artery was a large dominant vessel with mild luminal irregularities. It was decided to treat the patient with medical management. |
pmc-6018091-1 | A 13-year-old boy presented with a history of headache, nausea and vomiting with an acute onset 2 weeks earlier. Magnetic Resonance Imaging (MRI) of the brain and spinal cord revealed left cerebellar expansive lesion with no evidence of metastasis. Cerebrospinal fluid (CSF) examination revealed no evidence of dissemination. He underwent complete surgical resection as confirmed by postoperative imaging. Histopathological analysis including reticulin staining revealed a desmoplastic/nodular MB (confirmed by a central review by T.P.) as shown in Figure . Diffuse severe cytological anaplasia was not present. Complementary immunophenotypic characterization as described (, ) suggested a MB with SHH activation, TP53 wild-type (Figure ). Of note, nuclear INI-1 staining was preserved (Figure ) while P53 immunostaining showed nuclear positivity only in a small proportion of the tumor cells (data not shown). There was no evidence of MYCN or MYCC amplification by fluorescence in-situ hybridization (FISH). Next generation sequencing (NGS) over a panel of 50 genes (Ion AmpliSeq™ Cancer Hotspot Panel v2) revealed IDH1 R132C mutation in 46% of cells. NGS was repeated over a panel of 400 genes (Ion AmpliSeq™ Comprehensive Cancer Panel)1 and it revealed IDH1 R132C mutation in 24% of cells as well as SMARCB1-R201G in 30% of cells and CDH11-L625T in 26% of cells (Table A1). The panel was tested on both tumor and normal tissue to confirm the somatic nature of the mutations. Of note, mutations in SMO, PTCH1, SUFU and TP53 were not detected. Infinium Methylation EPIC BeadChip (850k) array revealed highest resemblance to the methylation class MB, subclass SHH A (children and adult). However, the calibrated score was 0.44 so that a clear subgroup assignment could not be done (). Calculation of a low density copy number profile from the array data indicated a flat genome without relevant chromosomal aberration (Figure ). Deletions of chromosome 9q (PTCH1) were absent. Assessment of overall CpG methylation and CpG island methylation levels of the tumor showed relative CpG hypermethylation compared to other reference classes of MB () (Figure ). There was no family history indicating a tumor predisposition syndrome.
The patient started treatment according to the HIT-SIOP PNET 4 protocol on the standard radiotherapy (RT) arm () where he received cranio-spinal RT (23.4 Gy) with boost to the posterior fossa up to 55.8 Gy in 30 fractions over 42 days. Adjuvant chemotherapy started 6 weeks after the end of RT and it includes eight cycles of maintenance chemotherapy (). Treatment was well tolerated with no major life-threatening adverse events or dose limiting toxicities. To date, the patient is in complete remission more than 2 years since diagnosis.
Several mutation databases were searched, namely; the catalog of somatic mutations in cancer (COSMIC) database (), the cBioPortal for cancer genomics database (), the integrative onco genomics (IntOGen) database for mutational cancer drivers (), the cancer genetics web database () as well as the medulloblastoma advanced genomics international consortium (MAGIC) project (). We checked for reported IDH1 and SMARCB1 mutations in MB samples.
The COSMIC database reports on IDH1 mutation in only 5 tumor samples from 4 patients with MB; three samples from two adult cases (, ) and two samples from two pediatric patients [(), ICGC PedBrain Tumor Project; unpublished data]. Searching other databases didn't reveal any additional reported cases.
As for the SMARCB1 mutation, the COSMIC database reports only on 9 mutated samples of MB from four different studies (, –). Similarly, we couldn't find any additional reported cases in other mutation databases. The specific mutation (SMARCB1-R201G) was only reported in a single case of ovarian cancer, and wasn't previously reported in any central nervous system (CNS) tumor.
There was no reported case of a MB harboring both mutations of IDH1 and SMARCB1 in any of the above mentioned databases. |
pmc-6018093-1 | A 10 year old male was referred to endocrinology clinic for evaluation of obesity, rapid weight gain, and growth deceleration. His mother noted he was previously one of the tallest children in his class, but now was one of the shortest. Review of previous growth charts revealed growth at the 90th percentile for height at 8 years of age with decrease to the 75th percentile at 9 years, and the 50th percentile by 10 years. His weight was consistently at the 95th percentile, but he had gained 5.5 kg (12 lbs) in the past year with weight now at the 97th percentile and body mass index (BMI) 27.5 kg/m2 at the 99th percentile, meeting criteria for extreme obesity.
His mother noted he had been markedly hyperactive as a child and that this behavior had decreased over the past 1–2 years with great improvement in his grades over the past year. His medical history was unremarkable and he did not take medication. Review of systems was unremarkable and he denied fatigue, muscle weakness, constipation, or cold intolerance. He had a good energy level and there were no recent changes in appetite or concentration. He had occasional dry skin. Family history was remarkable for maternal grandmother and mother with hypothyroidism. His midparental target height was 176.5 cm (69.5 inches) at the 50th percentile for height.
On physical examination, the patient measured 134.9 cm (26th percentile) and weighed 50.2 kg (97th percentile) with BMI 27.5 kg/m2 (99th percentile). He had a normal blood pressure 104/55 mm Hg and heart rate of 84 bpm. The patient was well appearing without dysmorphic features and had a normal affect. He had cherubic facies and fundi appeared normal. His thyroid was palpable and smooth with right and left lobe each measuring 4 cm with no lymphadenopathy. His chest, heart, and abdomen were normal. He had Tanner stage 1 genital development with 3 cc testes and no pubic hair. Skin examination was negative for rash, acanthosis, or striae. |
pmc-6018135-1 | A 20 years old woman was referred to Gazi University Department of Prosthodontics with a chief complaint of tooth discoloration, diastema, unsatisfactory esthetics and slight tooth sensitivity. The medical and dental history revealed that the patient’s family was not affected by AI. A renal ultrasound scan was normal, and it showed no evidence of nephrocalcinosis. Laboratory findings, including serum electrolytes, calcium, phosphate, urea, creatinine, alkaline phosphatase and parathormone levels were all normal. Clinical examination of the patient showed the insufficient enamel thickness, and the patient’s anterior and posterior teeth were discolored (Fig. ). The panoramic radiography also showed that the thin enamel layer could not be distinguished from the underlying dentin (Fig. ). There were no anterior open bite and missing teeth. However, short crowns, multiple diastema, occlusal wear with exposed dentin in the posterior areas, poor contact points and dental caries are the additional clinical findings (Figs. and ). The roots showed normal length and form. The pulp chambers were regular in size. Her oral hygiene was acceptable with no signs of gingivitis (Fig. ).
The maxillary and mandibular left third molar teeth were extracted to perform SEM and histologic analyzes. These teeth were totally covered by mucosa (Fig. ). Therefore, they were selected for SEM and histologic analyzes by the purpose of examining the tooth structure of the patient which had not been exposed to the oral environment. SEM and histologic analyzes were performed on the extracted mandibular and maxillary third molar teeth (Figs. and ). One of the third molar teeth was fixed in 4% glutaraldehyde. The tooth was then cut longitudinally, and the sections were coated with gold (Sputter Coater SC7620, Polaron, VG Microtech, England). The analysis was done via SEM (JEOL, JSM-6060LV, Tokyo, Japan). SEM analysis showed that there was an insufficient enamel layer (Fig. ). Additionally, the other third molar tooth was demineralized with 10% formaldehyde for 3 weeks. The tooth was then cut longitudinally, and it was stained with hematoxylin-eosin stain. Histological findings revealed that dentin structure was intact and there was no irregularity in tubular structure. These findings confirmed that there was no defect related to dentin (Fig. ).
Diagnostic casts were attached on a semi-adjustable articulator (Stratos 200; Ivoclar Vivadent Ag, Pforzeim, Germany) in centric occlusion. The occlusal vertical dimension was determined by the Niswonger method [] and verified with the closest speaking space method. The interocclusal distance at the physiologic rest position was 6 mm. In order to ensure proper vertical dimension and to create enough space for a restorative reconstruction, the bite was opened 5 mm in the anterior region. Furthermore, to predict the last appearance of the restoration, diagnostic wax-up was prepared at the determined vertical dimension (Fig. ), and expected treatment outcome was performed with the digital smile design software (Romexis 4.5, Planmeca USA, Inc).
Under local anesthesia, all teeth were prepared with chamfer margins. The crown length of maxillary and mandibular posterior teeth was insufficient for crown retention. In addition, there was an asymmetry of the gingival contours in the anterior maxillary teeth (Fig. ). After periodontal evaluation, because of insufficient crown length, ostectomy procedure was performed for maxillary and mandibular posterior teeth. In addition, gingivectomy was applied for maxillary anterior teeth. All periodontal surgery procedures were performed by the periodontologist. The impressions for provisional casts were made with a condensation silicone impression material (Zetaflow; Zhermack, Italy). Then, an interocclusal record was prepared with a hard addition-type A-silicon material (Imprint™ Bite, 3M ESPE) at the increased vertical dimension (5 mm in anterior region) which was determined in diagnostic wax-up stage. The autopolymerizing acrylic resin (ALIKETM; GC America, Alsip, IL, USA) provisional crowns were fabricated at the determined vertical dimension extraorally by an indirect method, then they were cemented with temporary cement (Temp Bond NETM; Kerr) (Fig. ). These restorations were assessed in terms of esthetic and phonetics. 1, 2 and 3 month regular checkups were performed. The speech, swallowing, anterior and posterior speaking space, muscle sensitivity, mastication, TMJ discomfort, were assessed during this period. The patient was asymptomatic. The criteria of the success for increased vertical dimension were the absence of pain, no sensitivity in facial and masticatory muscles, phonetic and swallowing satisfaction. At the end of the 3 months follow up period, definitive impressions were made with a condensation silicone impression material (Zetaflow; Zhermack, Italy). Occlusal registration was obtained with a hard addition-type A-silicon material (Imprint™ Bite, 3M ESPE) with a slightly reduced vertical dimension from the provisional restoration. After that, the working casts were obtained and mounted on the semi-adjustable articulator (Stratos 200) using a face-bow transfer (Facebow UTS-3D, Ivoclar Vivadent) (Fig. ).
The patient was rehabilitated with metal alloy (Mıcrolit Isı, Schütz Dental Group) - ceramic (Cerabien ZR Noritake) fixed partial dentures in the posterior regions. In order to achieve better esthetic appearance and to camouflage the AI affected tooth color, zirconia ceramic (Katana, Kuraray Noritake Dental Inc) based crowns were used in the anterior regions of low and upper jaws (Fig. ). With this prosthodontic rehabilitation, maximum interdigitation and a canine guidance could be achieved. Metal-ceramic fixed partial dentures were cemented with zinc polycarboxylate cement (Adhesor® Carbofine; Kerr) and zirconia ceramic crowns cemented with self-etch dual cured resin cement (Maxcem Elite, MXE; Kerr). Following cementation, a maxillary protective occlusal splint was manufactured to protect the restorations from chipping or fracture due to the bruxism. The patient was instructed about oral hygiene maintenance. |
pmc-6018178-1 | In March of 2017, a 20-year-old virgin female with
achronic pelvic pain was referred to our center. The patient
complained of severe pelvic pain with verbal numerical
rating scale (VNRS) of 9 during the menstrual
cycle. This chronic pain had lasted for almost one year.
The patient did not mention dyschezia, pain during or afterurination,
orother symptoms associated with diaphragmatic
endometriosis, such as chest pain, shoulder pain, or
right upper abdominal pain. Furthermore, she had used no
hormone replacement therapy.
In abdominal examination, there was fullness on the
left side, while in both rectal examination and abdominal
examination, there was fullness in the posterior cul-de-
sac. An immobile 10-cm mass wasfelt on the left side,
whereas another immobile 5-6-cm mass was on the right
side that was fixed to the uterus.
Pelvic ultrasonography results indicated a cyst with an
approximate size of 12×7 cm consisting of thick contents
in the left ovary with internal septae, raising suspicion
regarding formation of the tubo ovarian complex in endometrial
cavity. Furthermore, the ultrasound findings
showed an endometrium a cyst with an approximate dimension
of 4 cm on the right side with adhesion and endometrial
nodule of the posterior fundus with moderate
adhesion to the rectosigmoid. Therefore, magnetic resonance
imaging (MRI) was performed to exclude the left
mass from adenocarcinoma, while the results showed normal
upper abdominal organs, including liver, spleen, pancreas,
kidneys, adrenal, as well asthe lungs. In pelvic MRI
findings, there was endometrium in both adnexae along
with hydrosalpinx on the left side, whereas enhancement
was not reported in the left adnexal masses.
In addition, the blood test showed an anti mullerian hormone
(AMH) of 1.82 and CA-125 of 125.1, while other
tumor markers, including risk of ovarian malignancy algorithm
(ROMA) and HE4 were normal.
During laparoscopy, we noticed extensive endometriosis
that involved the anterior and posteriorcul-de-sac, both pelvic
side walls, both ovaries, and sigmoid colon. The left
ovary contained a cyst measured 10-12 cm with severe adhesion
to the rectum, while the right ovary contained a cyst
measured approximately 6 cm with moderate adhesion to
the tube and the right ovary. There was also no evidence
of endometriosis in ureters. Anatomy of pelvis restored,
pelvic Die corrected and a 2-cm endometriotic nodule attached
to the rectovaginal septum (RVS) was shaved.
On exploring the upper abdomen, 5 to 6 areas of superficial
endometriosis were discovered in the, anterior and center
of the right hemi-diaphragm (Figes, ), but the left hemi-
diaphragm was intact. The tota Redwine l surface area of the
diaphragm (left side, center, and right side) was thoroughly
investigated when the patient was put into reverse Trendelenburg
position. The fulguration was performed using bipolar
energy for endometriotic lesions of the diaphragm. The
endoscopic exploration of thoracic cavity was not performed
because the patient had no symptoms of shoulder or chest
pain, no history of catamenial hemothorax or pneumothorax
and diaphragmatic involvement was superficial. |
pmc-6018244-1 | A 50-year-old male with HIV, ESRD on PD, HTN, and recently diagnosed DLBCL presented to the Emergency Department with RUE pain and swelling ten days after receiving his first cycle of R-CHOP (cyclophosphamide dose reduced for PD) through a peripheral IV in the right hand. The patient reported that the swelling began in his right hand six days after the chemotherapy infusion, and was associated with tender, itchy, and notably darkened forearm veins. He also described shooting pains coming from the darkened veins. He denied any other rash or erythema, and endorsed chills but no fever. Physical examination was remarkable for mildly tender, deeply hyperpigmented veins originating at the site of his chemotherapy infusion site, and edema of the dorsum of the right hand without warmth or erythema (). Labs were significant only for neutropenia (ANC 900). An upper extremity ultrasound was performed to rule out a DVT associated with this possible thrombophlebitis which was negative.
The patient was diagnosed with serpentine supravenous hyperpigmentation (SSH) and discharged home with supportive care on hospital day 2. Upon follow-up in the office four months later, the original SSH in his right arm had improved significantly (), but he developed new SSH in his left arm where he was now getting his chemotherapy infusions ().
In this instance, however, he did not feel any pain or discomfort from the darkened veins. |
pmc-6018445-1 | Brown-skinned patient, 20 years old, female, presented with good general health and excellent oral health. Her main complaint concerned the projection of the lower incisors out of the mouth. She presented a Class III skeletal pattern, aggravated by the lack of space for correct alignment of the lower arch, due to the presence of two supernumerary lower incisors.
Frontal facial examination revealed mandibular asymmetry to the right side. In sagittal view, the lower facial third was increased in comparison to the upper and middle thirds. The facial profile was concave due to mandibular projection, with passive lip seal. The aesthetics of smile was impaired due to the anterior crossbite.
The patient had a Class III skeletal pattern, and facial growth was predominantly horizontal. Occlusal analysis revealed Angle Class I malocclusion with 1-mm overbite and anterior crossbite. The mandibular arch presented moderate anterior crowding and the maxillary arch exhibited anterior contraction on the right side ().
Bolton’s analysis revealed inferior excess of 7.5 mm, considering the proportion between the sum of the mesiodistal widths of the fourteen lower and twelve upper teeth; and inferior excess of 9.2 mm, considering the proportion between the anterior lower teeth with the anterior upper teeth.
The periapical and panoramic radiographs revealed intact roots, absence of the upper and lower third molars on the right side, presence of two fully erupted supernumerary incisors, as well as light horizontal bone loss in the lower arch (Figs 2 and 3).
Cephalometry confirmed the Class III skeletal pattern with ANB = -3o, horizontal growth pattern (SN.GoGn = 22o and FMA = 12o) and compensatory inclinations of the incisors (1.NA = 29o, 1.NB = 37o and IMPA = 107o).This positioning of incisors contributed to an unfavorable tegumentary relationship that impaired the patient’s facial aesthetics (Upper lip - S line = 0mm, Lower lip - S line = 4mm) ( and ). |
pmc-6018529-1 | Case 1: A 53-year-old woman presented with a recurrent headache, blurred vision, and progressive memory loss. The headache first appeared 5 years earlier and worsened gradually. One and a half years ago, she developed blurred vision. Brain magnetic resonance imaging (MRI) at that time showed hydrocephalus. Repeated lumbar punctures revealed increased opening pressure, elevated protein and pleocytosis without identifing the etiology. Two months ago, she developed progressive memory loss. She also had recurrent grand mal seizures about 20 years ago. On admission, head computed tomography (CT) showed scattered parenchymal calcified lesions in the right frontal lobe, right parietal lobe, right thalamus, left temporal lobe, left occipital lobe, and bilateral basal ganglia area (Figure ). Brain MRI showed hydrocephalus and diffuse T2-weighted hyperintensity in the juxta-ventricular white matter, together with enhancement of the meninges, especially the basal meninges, and multiple cystic lesions in the prepontine cistern, ambient cistern, and suprasellar cistern (Figures ). CSF cytology revealed increased eosinophils. NGS of CSF identified T. solium DNA sequences (Figures ). Therefore, the serum and CSF samples were sent for C. cellulosae IgG testing; and both were positive. Plain x-rays showed scattered “cigar-shaped” calcified lesions in the legs. She was diagnosed with NCC (basal subarachnoid NCC and parenchymal NCC with calcified cysts) and was treated with albendazole and dexamethasone. She also underwent an endoscopic third ventriculostomy (ETV) because of the severe hydrocephalus. The patient's symptoms, neuroimaging and CSF findings improved markedly after treatment. |
pmc-6018529-2 | Case 2: A 57-year-old man presented with paroxysmal blurred vision for 2 months. When he was admitted 1 month ago, lumbar puncture revealed increased opening pressure, pleocytosis, elevated protein level, and reduced glucose level. CSF cytology showed lymphocytic inflammation. Cryptococcus antigen test and Mycobacterium PCR of the CSF were negative. He was diagnosed with possible tuberculous meningitis and started on empirical anti-tuberculous treatment. However, he was readmitted after 1 month when his symptoms were not relieved. Lumbar puncture was repeated and NGS of CSF was negative. Serum and CSF samples were both positive for C. cellulosae IgG. Head CT revealed a single calcified lesion in the left frontal lobe (Figure ). Brain MRI revealed no obvious abnormalities, including hydrocephalus (Figure , Supplementary Figure ). Spine MRI was not performed. He was diagnosed with parenchymal NCC (calcified cyst), and possibly extraparenchymal NCC or spinal NCC without radiological evidence. Treatment with albendazole and dexamethasone was started. However, the symptoms and CSF findings worsened initially. To validate the diagnosis and rule out other possibilities, NGS of CSF was repeated 1.5 months later and identified T. solium DNA sequences (Figures ). The albendazole and dexamethasone were continued and the patient's symptoms and CSF findings improved. Note that the diagnosis of extraparenchymal NCC or spinal NCC in Case 2 was not very convincing without radiological proof. A false-positive result was not completely ruled out in this patient. |
pmc-6018529-3 | Case 3: A 58-year-old man presented with recurrent headache, transient loss of consciousness (LOC), and progressive memory loss. Eight years before admission, his symptoms began with recurrent headache and transient LOC. Lumbar puncture revealed increased opening pressure, pleocytosis, elevated protein level, and reduced glucose level. He was diagnosed with possible tuberculous meningitis and given empirical anti-tuberculous treatment for more than 1 year. Six years ago, he was admitted with the same symptoms and diagnosed with possible cryptococcal meningitis, for which he received fluconazole for more than 6 months and amphotericin B for 1 month. Three months before admission, he developed progressive memory loss. On admission, brain MRI showed an enhanced lesion posterior to the medulla (Figures ) and hydrocephalus (Figure ). NGS of CSF identified T. solium DNA sequence (Figures ). Plain x-rays showed scattered “cigar-shaped” calcified lesions in the legs and thoracic wall. Serum and CSF samples were both positive for C. cellulosae IgG antibodies. He was diagnosed with intraventricular NCC and treated with albendazole and dexamethasone. The symptoms and CSF findings subsequently improved. |
pmc-6018529-4 | Case 4: A 31-year-old man presented with progressive blurred vision for 3 weeks. On admission, brain MRI showed multiple cystic lesions in the suprasellar cistern (Figures ). Lumbar puncture revealed increased opening pressure, an elevated white blood cell count, elevated protein level, and reduced glucose level. CSF cytology revealed increased eosinophils. Cryptococcus antigen tests and an Xpert-MTB assay of the CSF were negative. NGS of CSF identified T. solium DNA sequences (Figures ). Serum and CSF were positive for C. cellulosae IgG antibodies. He was diagnosed with basal subarachnoid NCC and was treated with albendazole, dexamethasone, and ETV. His symptoms and CSF findings improved significantly after treatment. |
pmc-6018596-1 | A 46-year-old gentleman, morbidly obese (BMI 57.4 kg/m2), was referred to our institute 20 days after a laparoscopic sleeve gastrectomy, complicated by gastric leak. On presentation, he was septic and in distress, tachycardic, and tachypneic. He was febrile and complaining of abdominal pain. Examination revealed a distended abdomen with diffuse tenderness and left basilar crackles on lung examination. Initial laboratory tests revealed elevated WBC and CRP. Upper GI series and CT scan of the abdomen showed evidence of contained gastric fistula with perigastric fluid collection (Figs. and ).
The patient was kept NPO, started on parenteral nutrition, intravenous antibiotics and was well-hydrated to control the sepsis. He underwent CT-guided drainage of the collection. One week post-drainage, upper GI series was repeated showed a well-drained gastric leak.
After 10 days of stabilization, the patient showed marked improvement, became afebrile, and his WBC and CRP normalized, so a decision to undergo a Baltazar procedure was taken (Fig. ).
After insufflation of the abdomen and insertion of trocars, lysis of loose adhesions was successfully done, in aim to uncover the gastric tube, which was covered with omental adhesions. The perigastric cavity was opened and well-irrigated, and with careful dissection, we unexpectedly identified two leak sites along the staple line, the first one was located 4 cm below the gastroesophageal junction, and the second one was located 6 cm away from the first fistula site. Unfortunately, stenting was not available at our institution.
After careful assessment, intra-op decision was made to attempt a new surgical technique: double Baltazar procedure. Two fistulo-jejunostomies were done with the same jejunal limb. The first fistulo-jejunostomy was done at the cephalic gastric fistula site with handsewn double-running 2/0 PDS suture. More distally to the created fistulo-jejunostomy, along the same jejunal loop, the second fistulo-jejunostomy was done using the same technique. Methylene blue test was done and showed no residual leak. Jejuno-jejunostomy (Brown anastomosis) was done after that to divert the biliary secretions and to protect the anastomotic sites. All quadrants of the abdomen were drained (Fig. ). |
pmc-6018767-1 | This is a 50-year-old right-handed male, with 33-year history of T6 AIS A SCI from a gunshot wound complicated by chronic pain, left hip and knee heterotophic ossification, and a chronic dislocation of his right hip, who initially presented to the emergency room with a right shoulder mass in September 2014. While he initially noticed the mass about 2 months earlier, he presented for evaluation now because of acute onset of pain, weakness and paresthesias in the right arm. He was admitted to the general medicine service for pain management and underwent an initial work up for his right shoulder mass, including advanced imaging and a core biopsy. Physiatry was consulted due to his functional deterioration that precluded him from returning to his previous independent living arrangement. He demonstrated diffuse, mild weakness throughout the right arm that was variable and seemed to be correlated with his reported pain level, but his most consistent and weakest movement patterns were his grade 4/5 weakness in finger abduction and distal interphalangeal joint flexion. He had reduced pin prick sensation over the volar surface of digits 3–5, palm and forearm of the right arm and hand. He was not able to perform transfers to or from his manual wheelchair due to his level of pain. The magnetic resonance imaging (MRI) revealed a heterogeneously enhancing mass with a maximum diameter of 6.9 cm (Fig. ) that involved the right deltoid and pectoralis major muscles. His core biopsy demonstrated a STS that was classified as a high grade (III) spindle cell sarcoma.
Oncology recommended treatment for his STS with a course of outpatient neo-adjuvant radiation therapy followed by gross total resection with wide margins. Physiatry pre-operative consult focused heavily on functional prognostication. The patient expressed multiple times that he placed the highest priority on return to his previous modified independent living arrangement and not only survival after his STS treatment course. The patient’s personal values combined with the physiatric assessment informed the pre-surgical planning. In particular a decision was made to take a narrower surgical margin around key muscle group (pectoralis major and deltoids) in order to help maintain the man’s manual wheelchair mobility and his ability to independently transfer himself.
He completed neo-adjuvant radiation therapy in November of 2014 and underwent radical excision of his right shoulder mass with flap closure that December. He began intensive inpatient rehabilitation after he was given clearance to weight bear through his arm about 8 weeks later. Initially he required total assistance for most ADL’s, including transfers, manual wheelchair propulsion, dressing and toileting. Despite the extensive surgery and radiation treatments, the gentleman was able to return to a functional level, approaching his pre-morbid status (modified independence). He was successfully discharged home to live alone in his accessible apartment complex. |
pmc-6018942-1 | A 70-year-old woman was diagnosed with DLBCL (Ann Arbor Stage: IIIA) and received chemotherapy but relapsed. She was admitted to our hospital in 2017 to undergo auto-PBSCT after salvage chemotherapy. She suddenly developed grade 3 haematuria on the day of transplantation. We detected a BKV DNA load of 5.0 × 107 copies/mL and adenovirus (ADV) type 11 DNA load of 5.0 × 107 copies/mL in the urine and diagnosed her with haemorrhagic cystitis (HC) associated with BKV and ADV. Although she received immunoglobulin and adenine arabinoside, the HC symptoms did not improve. Moreover, we detected a BKV DNA load of 2.2 × 102 copies/mL in the blood and diagnosed the patient with BK viraemia with complications. Although we administered cidofovir (1 mg/kg, three times a week) from days 8 to 26 post-auto-PBSCT, the HC symptoms persisted. The ADV DNA load in urine became negative, but the BKV DNA load in urine did not decrease. Overall, the BKV infection did not stabilize adequately.
She exhibited respiratory failure and elevated serum C-reactive protein levels at day 32 (Table ). Chest computed tomography (CT) showed ground-glass opacity (GGO) in the bilateral upper lobe, and we performed BAL at day 34. Although BAL fluid (BALF) was not macroscopically reddish, BAL slightly detected red blood cells on cytology. In BALF, the BKV DNA load was 1.5 × 102 copies/mL, although the ADV and cytomegalovirus DNA loads were not elevated. Although we could not perform lung biopsy because the blood platelet count was low, we diagnosed the patient with BKV pneumonia. After re-administering cidofovir, respiratory symptoms and GGO in CT abated, although HC symptoms persisted (Fig. ). The patient has not experienced a relapse of BKV pneumonia and DLBCL even after 11 months. |
pmc-6019205-1 | A 6-month old exclusively breastfed, African boy presented to the emergency department (ED) with an out-of-hospital cardiac arrest. In the weeks prior to presentation, he had 3 brief episodes of peri-oral cyanosis and pallor and presented twice to ED with increased work of breathing. On initial assessment by paramedics he showed no signs of life and was in asystole. He was resuscitated until spontaneous circulation was restored at 36 min. Investigations revealed low ionised calcium (0.72 mmol/L), warranting repeated intravenous calcium boluses followed by continuous infusion. Cefotaxime was commenced for presumed sepsis, and oseltamivir was added after isolating influenza A on a nasal swab. Intravenous fluids and inotropes were administered. In the intensive care unit, an echocardiogram showed severe dilated cardiomyopathy with poor left ventricular ejection fraction (LVEF) of 25–30% [normal 55–70%]), fractional shortening (FS) of 7% [normal 29–40%], dyskinetic septal motion, global hypokinesia, and moderate to severe mitral regurgitation with a structurally normal heart. Rickets was confirmed radiographically (Fig. ), with elevated serum ALP and PTH concentrations, and low 25OHD < 15 nmol/L (Table ). Cholecalciferol (6000 IU daily) was commenced, and intravenous calcium was continued until serum calcium normalised (72 h). Cardiac failure was managed with diuretics and vasodilators. Brain Magnetic resonance imaging (MRI) revealed severe hypoxic-ischaemic encephalopathy, correlating with the clinical finding of unresponsiveness to external stimuli. The care team and family elected to withdraw life support, and the infant died 6 days after presentation.
Post-mortem examination confirmed severe nutritional rickets with rachitic rosary (enlarged rib growth plates) (Fig. ), craniotabes, soft ribs, dilated cardiomyopathy (heart weight 71 g [>95th centile], with multifocal myocardial necrosis) and massive ischaemic brain injury. Histological analysis of a 7th rib growth plate showed extreme disarray, widening and lengthening, with islands of hypertrophic chondrocytes reaching far into the primary spongiosa and mature bone, typical of rickets (Fig. ). Histomorphometric analysis of a transiliac bone sample identified severe osteomalacia with increased osteoid thickness (23.2 μm [normal 6.4 +/− 1.4]), osteoid surface/bone surface (76.3% [normal 24.9 +/− 10]) and osteoid volume/bone volume (40.5% [normal 2.4 +/− 1.22]). Specifically, osteoid thickness was + 262% and osteoid volume/bone volume + 1573% of normal reference values [9]. Since Goldner’s Trichrome staining does not discriminate well between non-mineralized and poorly mineralized matrix, we also performed quantitative backscattered electron imaging, which confirmed the extremely low bone mineralization density (Fig. ).
The mother had received antenatal multivitamin supplementation and attended all post-natal child surveillance and vaccination appointments. She was not informed of the need for infant vitamin D supplementation. Mother (Table ) and a 9-year old sibling had suboptimal 25OHD concentrations. |
pmc-6019205-2 | A 6-month old, partially breastfed and previously well Somali boy presented to the ED following respiratory arrest and seizure. He was found pale, floppy and not breathing while held by his sibling. Following emergency telephone advice, his mother, a nurse, commenced Cardio-pulmonary resuscitation (CPR) at home. Two minutes later he had a 2-min tonic-clonic seizure. With continued CPR, spontaneous breathing was established at 4 min. Paramedics found him drowsy with normal blood glucose. In the ED, he responded to pain, respiratory rate was 40/min, heart rate was 112/min with normal capillary refill. A grade 2/6 systolic ejection murmur was present. A venous blood gas was normal except for low ionised calcium (0.66 mmol/L). A chest radiograph showed cardiomegaly (Fig. ), and echocardiogram demonstrated a structurally normal heart with severely dilated left ventricle with reduced LVEF of 29%, FS of 7%, global hypokinesia and moderate mitral regurgitation, confirming hypocalcemic dilated cardiomyopathy. Diuretic and ACE (Angiotensin converting enzyme) inhibitor therapy was commenced. Nutritional rickets due to vitamin D deficiency was confirmed with knee radiographs (Fig. ), elevated serum ALP and PTH, and low 25OHD of < 5.2 nmol/L (Table ). He received intravenous calcium and oral cholecalciferol (6000 IU daily). Alfacalcidol (1-hydroxycholecalciferol) was temporarily administered to improve calcium absorption. On day 3, following a switch from intravenous to oral calcium, he had another seizure with respiratory arrest in hospital, requiring mechanical ventilation and intensive care. Intravenous calcium was recommenced, and a head computed tomography was normal. He was extubated 24 h later and continued intravenous calcium for 5 more days. He was discharged home on day 17 and 3 months later showed slow recovery (LVEF 35%; FS 16%; Left ventricle diameter 42 mm [Z-score + 4.7], marked reduction in mitral regurgitation).
The mother had been provided with one bottle of vitamin D for the baby at birth but was not informed to continue supplementation, and adherence was not assessed. She (Table ) and three of the infant’s four siblings (aged 3, 6, 7, 9 years) were vitamin D deficient, with elevated ALP and PTH. |
pmc-6019205-3 | A five-month old British Pakistani girl presented to ED with cough, difficulty in breathing and poor feeding. She was born at 35 weeks with a birth weight of 1.75 Kg (9th centile) and required admission to the neonatal unit for 6 days to establish oral feeding. At presentation, she was found to be pale, irritable, tachypnoeic and tachycardic. She had faltering growth (fall across ≥2 weight centiles) with a weight of 4.5 kg (< 0.4th centile) and length 58 cm (on 0.4th centile). She was diagnosed with bronchiolitis. Only the faltering growth triggered further investigations which identified hypocalcemia (1.96 mmol/L). Further evaluation of hypocalcemia revealed raised ALP and PTH, and low 25OHD of 12.5 nmol/L (Table ) and rickets on knee radiograph (Fig. ). An echocardiogram performed in view of persistent tachycardia, systolic murmur and cardiomegaly on chest radiograph (Fig. ) revealed a structurally normal heart with a severely dilated left ventricle (LVEF of 25%, FS of 15%, global hypokinesia and severe mitral regurgitation), confirming hypocalcemic dilated cardiomyopathy. She was commenced on oral calcium supplements (500 mg/day in divided doses) and cholecalciferol (initially 3000 IU daily, later increased to 6000 IU daily) and transferred to our tertiary center for specialist cardiology care. She was commenced on diuretics and ACE inhibitors.
Nobody had informed mother of the need for vitamin D supplementation during pregnancy and infancy. Her 3 year old sibling had normal 25OHD levels, however mum was deficient with a raised PTH (Table ). |
pmc-6019218-1 | A 45-year-old previously healthy Asian man presented with a history of intermittent fever with chills and rigors over 2 months’ duration. There were associated night sweats, loss of appetite, and loss of weight. There was a history of transient macular rash at the onset of the fever which spontaneously resolved without treatment. Generalized lymphadenopathy was noted by our patient mainly involving cervical, axillary, and inguinal regions over 1 month which became extremely painful a few days prior to his presentation. He had synovitis involving lower limb small joints following the presentation, progressing to lower limb large joints and ultimately upper limb small and large joints over 3 days. He did not have past history or family history of arthritis and he had an unremarkable past medical history. He worked as a mason but had never been exposed to toxic environmental conditions to his knowledge and there was no promiscuous sexual behavior. He did not consume alcohol and he did not smoke tobacco.
On examination at the initial presentation he was emaciated, febrile, and pale. There were bilateral, firm, matted lymph nodes of varying sizes of 2–3 cm in the cervical, axillary, and inguinal regions which were tender. There was tender hepatosplenomegaly. The rest of the examination was normal. However, a few days following admission there was bilateral symmetrical polyarthritis involving both small and large joints of upper and lower limbs with lower limb predominance. There was marked synovitis of distal and proximal interphalangeal joints of lower limbs compared to the rest of his joints.
Laboratory investigations revealed high white cell counts with normocytic anemia. Platelets were within the normal range. His inflammatory markers were high and they were in a rising trend following the onset of arthritis. His liver and renal functions were normal. Rheumatoid factor, anti-cyclic citrullinated peptide, anti-nuclear antibodies, human immunodeficiency virus (HIV) 1 and 2 antibodies, Epstein–Barr virus immunoglubulin G (IgG) and immunoglubulin M (IgM), cytomegalovirus IgG and IgM, and Toxoplasma antibodies were all negative or within normal limits. His serum uric acid was marginally elevated. An X-ray of his hands and feet showed soft tissue swelling without evidence of erosions or osteopenia.
His first lymph node biopsy showed a reactive lymph node. The biopsy was repeated due to a strong suspicion of lymphoma. The second lymph node biopsy with immunohistochemistry showed large pleomorphic cells with CD20 positivity and small lymphoid cells with CD3 positivity. The population of T cells was high, but the presence of B cells arranged in cohesive clusters and sheets favored a high grade DLBCL. Contrast-enhanced computed tomography (CT) of his neck, chest, and abdomen staged him at Ann Arbor stage IV.
He was started on non-steroidal anti-inflammatory agents and colchicine for the arthritis but there was no response to treatment. Treatment with rituximab, cyclophosphamide, vincristine, doxorubicin, and prednisolone (RCHOP) commenced; following the first cycle of therapy, his arthritis showed marked response with complete resolution of the synovitis. He completed his chemotherapy but intermittently succumbed to infections. His synovitis completely resolved following chemotherapy. |
pmc-6019221-1 | A 33-year-old nulliparous woman was referred to our institution from a private infertility clinic complaining of lower abdominal pain. She reported a history of 5 weeks and 4 days of amenorrhea and had undergone intrauterine insemination (IUI) 27 days previously. Ovarian hyperstimulation for IUI was started with Clomiphene citrate 100 mg daily during the 3rd–7th days of the menstrual cycle, followed by 75 IU hMG (IVF-M HP, LG life science, Seoul, Korea) daily on the 7th–9th days of the menstrual cycle. Transvaginal ultrasound had revealed four dominant follicles in the left ovary after ovarian stimulation.
On physical examination, she had normal vital signs and diffuse lower abdominal tenderness. The serum beta-chorionic gonadotropin level was 3154 mUI/mL. Transvaginal ultrasound performed in the gynecology department revealed a large hyperechoic mass, a suspected hematoma, in the cul-de-sac. It also revealed a normal-sized uterus without an intrauterine gestational sac, and endometrial thickening of 20 mm. Both right and left adnexa were normal on the ultrasound. The initial complete blood count was as follows: hematocrit 35.9%, hemoglobin 11.9 g/dL, white blood cells 9.3 × 109/L and platelets 252 × 109/L. The provisional diagnosis was ruptured ectopic pregnancy with hemoperitoneum, and emergency laparoscopy was performed. Intraoperatively, a dark blood clot of about 800 ml was seen along with a small amount of fresh blood (Fig. ). An approximately 2 × 2 × 1.5 cm unruptured ectopic pregnancy was found in the right fallopian tube (Fig. ), while the left fallopian tube appeared to be normal. While examining the ovaries to locate the cause of the bleeding, we observed minimal bleeding from the proximal pole of the left ovary, where there was a 1.0 × 0.5 × 0.5 cm hemorrhagic mass with surrounding blood clot suggestive of a ruptured ectopic pregnancy (Fig. ). We resected the mass from the left ovary and performed a right salpingectomy using monopolar electrocautery and 5 mm multi-functional bipolar electrocoagulation forceps (LiNA PowerBlade; LiNA Medical, Glostrup, Hovedstaden DK-2600, Denmark) (Fig. ). After intraperitoneal irrigation with 3 L of saline, we ascertained that there were no abnormal findings. We therefore placed drains into the cul-de sac and finished the operation (Additional file ). Histopathological analysis demonstrated a left ovarian pregnancy with presence of chorionic villi within the ovarian tissue, along with a right tubal pregnancy (Fig. ). |
pmc-6019233-1 | A 25-year-old female with a two-year history of erythema, papules, nodules, and scales on her sole of left foot was presented to our outpatient center. She has no history of autoimmue disease and untreated with immunosuppressive therapy. Considering her pregnancy, she was not given treatments for 1 year. The left foot skin lesion on the medial and lateral margins and on the fourth toe dorsum became enlarged with evident pain after more than 1 year (Fig. ). Approximately 1 month before visiting our department, she received treatment ineffectively in a local clinic, and the diagnosis was unclear.
Samples were obtained by the scraping of lesion and for light microscopy. Hyphae were observed by microscopic examination (Fig. ).
We carried out a skin tissue biopsy, which showed multiple granulomatous nodules (Fig. ). The Ziehl–Neelsen stain was negative. Periodic acid–Schiff (PAS) and Grocott methenamine silver (GMS) staining were carried out two times. Results were also negative. Biopsy specimens were also inoculated onto two kinds of media: Sabouraud’s dextrose agar (SDA), where one of which contained chloramphenicol and cycloheximide, and the other one contained chloramphenicol only. After being cultured on SDA at 27 °C for 7 days, spreading-woolly-white colonies grew on the inoculation sites of media containing chloramphenicol only and there,s no other colonies grew (Fig. ). The colonies produced an unpleasant smell like biogas. No colony was observed on the media with chloramphenicol and cycloheximide. Clamp connections, spicules, tear-like secretions, and medusa-like isomers were observed on the slide culture at 27 °C after 3 days (Fig. ). Urease activity tests were also performed. Trichophyton rubrum standard strain and the isolated strain were cultured on urease media at 27 °C for 7 days. The T. rubrum standard strain was negative, whereas the isolated strain turned red (Fig. ).
Sequencing of large subunit rDNA was performed by using the E.Z.N.A.™ Fungal DNA Mini Kit (Omega Biotek, USA). We utilized set primers for the region of internal transcribed spacer (ITS) and performed PCR. The PCR primers were ITS1: 5′-TCCGTAGGTGAACCTGCGG-3′ and ITS4: 5′-TCCTCCGCTTATTGATATGC-3′. The PCR-amplified DNA was matched with that of S. commune (Nos. KP 326677.1 and KP 004975.1) with a homology of 100%. After identification, the sequence was submitted to the GenBank (MF 495704).
Pathological finding and mycological examination indicated a cutaneous granuloma caused by S. commune. Oral itraconazole (100 mg) was applied twice a day. The rashes on the left foot and the pain regressed after 1 month of treatment (Fig. ). Follow-up is currently under way. |
pmc-6019244-1 | This was a 69-year-old man diagnosed with metastatic colorectal adenocarcinoma to liver, lung, and skeletal. He underwent previous treatments with schemes based on fluoropyrimidine, platinum, antiangiogenics, and irinotecan and cetuximab, however, the patient's disease had progressed with all these therapies. Treatment was initiated with pembrolizumabe 10mg/kg every 2 weeks, although this medicines use to the patient's disease is not approved in Brazil. After second administration, the patient reported fatigue and dyspnea. Upon physical examination, he had saturation of 83% in an open environment. Chest tomography evidenced infiltrated interstitial to left and bilateral pleural effusion without signs of pulmonary thromboembolism. Blood count showed leukocytosis with 21,580 leukocytes, 69% of them were segmented, 11% rod cells and 3% metamyelocyte. After thoracocentesis, antibiotic therapy with ceftriaxone and clarithromycin was initiated, and oxygen intake with nasal catheter was maintained, however, no improvement was observed. Reassessment of chest computed tomography showed increase of ground-glass infiltrate () that suggested drug reaction (acute interstitial pneumonitis pattern); a lung biopsy was not performed for histological confirmation. Because of worsening in patients’ conscious level and respiratory pattern, after discussion with his family, the sedation was initiated for patient's comfort. |
pmc-6019244-2 | This was a 73-year-old man diagnosed with melanoma on his right thigh. He underwent resection and clinical follow-up. After 8 years, he had untreatable metastatic lung melanoma without mutations. The patient was treated with dacarbazine followed by ipilimumab, but disease had progressed. After, we opted to begin pembrolizumab 2mg/kg administration every 3 weeks.
Fourteen days after first cycle, the patient had a dry cough but without fever or other symptoms, no changes in blood count was observed. Chest computed tomography showed opacities in ground-glass in both lungs (). The hypothesis raised was pembrolizumab-induced pneumonitis, although lung biopsy was not performed for histological confirmation. A treatment with 1mg/kg prednisone associated with antibiotic therapy and the patient had a rapid and important improvement in symptoms. Two months later, a staging computed tomography showed complete resolution of clinical feature (). Patient maintained treatment with pembrolizumab, and showed good tolerance. |
pmc-6019244-3 | This was an 81-year-old man diagnosed with untreatable stage IIIA lung adenocarcinoma without mutation. He underwent surgery followed by radiotherapy and adjuvant chemotherapy with carboplatin and pemetrexed. After 4 months of follow-up, the patient evolved with local recurrence. The affected site was irradiated but no response was seen, therefore, we opted for palliative chemotherapy with carboplatin and paclitaxel. A progression of the disease was also observed. Subsequently, we decided to begin immunotherapy with pembrolizumab 2mg/kg every 3 weeks. After four cycles, the patient had dyspnea and dry cough with oxygen saturation of 80%. Chest tomography showed extensive bilateral pulmonary infiltration (), and blood count showed leukocytosis. No lung biopsy was performed to confirm pathology. Corticosteroid therapy was introduced with metilprednisolone 2mg/kg and antibiotic therapy. An important clinical improvement was seen and resolution of findings from controlled computed tomography (). |
pmc-6019244-4 | This was a 54-year-old man diagnosed with pulmonary large-cell neuroendocrine carcinoma located and resected that evolved for metastatic disease. Initially the patient was treated with carboplatin and paclitaxel followed by cisplatin and etoposide, and radiotherapy for controlling specific injuries. The disease progressed to central nervous system and liver. We opted for immunotherapy with pembrolizumab 2mg/kg every 3 weeks.
After 5 cycles of treatment, patients’ clinical feature evolved with dyspnea and cough, but no fever. Upon clinical examination his oxygen saturation was 84% in an open environment. In thorax angiotomography the possibility of pulmonary thromboembolism was discarded and it identified opacities in bilateral ground-glass. Thus, we opted for treatment with metilprednisolone 2mg/kg associated with piperaciline-tazobactam 4.5g every 6 hours for the hypothesis of pneumonitis, although no histological confirmation was performed. An important clinical improvement was seen within 24 hours. The controlled computed tomography performed 1 week after treatment showed almost full resolution of pulmonary opacities (). |
pmc-6019244-5 | This was a 70-year-old man with metastatic lung epidermoid carcinoma with multiple liver injuries. The first-line treatment adopted included nivolumab 3mg/kg every 2 weeks, even without these agents approval in Brazil and in the United States considering the patient's status because he had contraindication for platinum-based chemotherapy.
After 4 cycles, the patient had mental confusion, dyspnea and dry cough, without fever and oxygen saturation of 74% in an open environment. Blood count result was normal. We performed a chest tomography with appearance of infiltrated areas in ground-glass (). The hypothesis raised was pembrolizumab-induced pneumonitis, although the lung biopsy was not performed to confirm the disease. We opted for treatment with methylprednisolone 60mg every 8 hours and also antibiotic therapy. The patient improved clinically within few hours and he was discharged asymptomatic after 3 days of hospitalization. |
pmc-6019328-1 | We present a case of a 49-year-old male with a lung metastasis from hepatocellular carcinoma in the upper lobe of the left lung. He received radiotherapy to the lung metastasis according to the method described hereinafter. The proposed workflow started with acquiring planning CT images under deep inspiration breath-hold condition with a commercial gold coil marker, Visicoil 21G slim line (IBA Dosimetry, Schwarzenbruck, Germany) of diameter 0.5 mm and length 10 mm, implanted using CT guidance as close as possible to a tumor as shown in Figure . Then the CT images were exported to a treatment planning system, Monaco (Elekta AB, Stockholm, Sweden). A single-arc coplanar VMAT plan (gantry rotation from 320° to 100° ) was created with an isotropic planning target volume (PTV) margin of 5 mm and a prescribed dose of 60 Gy in 20 fractions as indicated in Figure . The plan was exported to a linac, Synergy (Elekta AB, Stockholm, Sweden), equipped with a kV fluoroscopic and cone-beam CT (CBCT) imager, Xray Volume Imaging (XVI).
Because VMAT beam-on-time typically exceeds 60 seconds, multiple breath-holds were required to complete the delivery. In other words, the single-arc VMAT beam was divided into several segmented VMAT beams each having different gantry start and stop angles. After performing CT imaging for the treatment planning, breath-hold training was given to each patient for optimizing the breath-hold and the following free breathing periods so that each segmented breath-hold VMAT delivery could be successfully completed.
In order to deliver segmented VMAT beams while the implanted marker stays at the planned breath-hold position, a DRR image at the gantry start angle was created in the Monaco TPS and transferred to the XVI. Subsequently, two lateral lines were drawn 2.5 mm above and below the center of the planned breath-hold marker position on the DRR image. Those lines were manually copied onto a fluoroscopic image window of the XVI display using a transparent sheet, each line being used as a tolerance limit for the breath-hold beam delivery.
Prior to the beam delivery, CBCT imaging under free-breathing condition was performed to adjust the position of the patient couch by matching bone anatomy between the planning CT and the CBCT images. Subsequently, the patient was asked to breathe in slowly under fluoroscopy. Immediately after the marker position on the fluoroscopic image moved inside the tolerance range, the patient was asked to hold the breath and the VMAT beam was delivered. During the beam delivery, the breath-hold status was continuously monitored by checking if the deviation of the marker position exceeded the tolerance limit. As long as the marker stayed within the tolerance range, a segmented VMAT delivery continued for a preset period of 15 to 30 seconds depending on the breath-hold capability of each patient. As soon as each segmented delivery was completed, the beam interrupt button was pushed; and then, the patient was asked for free breathing. This procedure was repeated until all the segmented VMAT beams were delivered. Even when an intermediate beam interrupt due to a breath-hold failure during each segmented beam delivery was observed, the remaining beam delivery can be safely performed by referring to the two lateral tolerance lines for reproducing the breath-hold status for any gantry angles. It was decided that patients unable to hold the breath at least for15 seconds were considered not applicable. The patient who could hold the breath for 20 seconds was selected for this study after written informed consent was obtained. In order to confirm that the marker position relative to the tumor remained unchanged, multiple breath-hold CBCT imaging was also performed with the marker being inside the tolerance limit, thereby allowing comparison of the marker positions between planning CT and the breath-hold CBCT images.
Video shows a fluoroscopic movie showing the movement of the coil marker during the first coplanar segmented VMAT delivery (gantry rotation from 320° to 0° ) on the patient in reference to the two lateral lines (green color) giving a tolerance limit of 2.5 mm above and below the projected center of the marker. As long as the marker center stayed within the tolerance range, the segmented VMAT delivery continued for a preset period of about 25 seconds depending on the breath-hold capability of the patient. Unexpected intermediate beam interrupts due to a breath-hold failure during the segmented VMAT delivery can be well managed because the remaining beam delivery can be restarted at any gantry angle once the marker comes back within the tolerance range. In this lung tumor case, the total VMAT delivery time for a prescribed fraction dose of 3 Gy was approximately 115 sec with three beam interrupts and a 25 sec segmented beam delivery followed by 20 sec free breathing. |
pmc-6019330-1 | A 19-year-old female was admitted to the emergency department with complaints of pain and swelling on the lateral side of the ankle after sustaining an ankle sprain. The patient was unable to bear weight upon admission. On physical examination, there was prompt swelling over the lateral side of the ankle and the tip of the fibula was tender on palpation. The ankle's range of motion was limited. The neurovascular examination was normal and the direct radiographic examination revealed a displaced distal fibular fracture (Weber type A) (Figure ). As the fracture was intra-articular and there was considerable displacement (>4 mm), fixation of the fracture was mandatory.
Under spinal anesthesia and tourniquet control, a small longitudinal incision was made over the distal fibula. The fracture was reduced and fixed with a single, 3.2 mm, intramedullary, magnesium headless compression screw (MAGNEZIX CS, Syntellix AG, Hannover, Germany) in a retrograde manner from the tip of the fibula. A short-leg plaster cast was applied to the patient for four weeks. After the removal of the cast, full weight-bearing was encouraged and ankle joint exercises were started. During the follow-up, fracture union was achieved without any complications within eight weeks (Figure ).
At the final follow-up examination, two years after the operation, the American Orthopaedic Foot & Ankle Society (AOFAS) score was 100 points and the patient had returned to the pre-injury level of activity. During the serial radiographic follow-up, a radiolucent zone was seen around the screw, but on the final follow-up radiograph, this radiolucency had almost completely disappeared (Figure ). |
pmc-6019331-1 | The patient is a 16-year-old male without a significant past medical history who was transferred to our institution after a gunshot injury to the right lower extremity. On physical examination, two bullet entry points were evident at the right popliteal fossa and dorsal soft tissues of the distal right leg. Initial radiographs were negative for fractures or dislocation.
Computed tomography angiography (CTA) demonstrated a retained bullet fragment within the popliteal fossa abutting the dorsal aspect of the popliteal artery. An 8 millimeter (mm) soft tissue density abutting the medial aspect of the popliteal artery was also identified, concerning for either a small pseudoaneurysm or short segment intramural hematoma. Streak artifact from the retained bullet precluded adequate assessment of this region. The peroneal artery demonstrated a 10 centimeter (cm) occlusion 2.5 cm distal to its origin but reconstituted distally at the level of the mid-tibia. The anterior and posterior tibial arteries were both normal in appearance and patent. The dorsalis pedis artery was unremarkable. There was subcutaneous emphysema throughout the deep and superficial posterior compartment of the knee and throughout the medial aspect of the leg.
The patient was taken to the interventional radiology suite and a right lower extremity diagnostic runoff angiogram was performed. Initial images obtained with the patient’s leg held in extension demonstrated abrupt cutoff of the popliteal artery immediately adjacent to the bullet fragment (Figure ). We then proceeded to reposition the patient’s right leg in the “frog-leg position”. A second diagnostic runoff angiogram was then performed demonstrating mild short segment narrowing of the popliteal artery immediately adjacent to the bullet fragment but with reconstitution of flow down to the level of the tibial-peroneal trunk (Figure ). The anterior and posterior tibial arteries demonstrated patency on both the extension and frog-leg positions. It was concluded that leg straightening/extension was contributing to extrinsic compression and subsequent dynamic occlusion of the popliteal artery secondary to the bullets close proximity to the vessel.
The patient was subsequently taken to the operating room for exploration and removal of the bullet fragment. An intraoperative angiogram was negative for popliteal artery vascular injury, and the anterior and posterior tibial arteries were both patent without evidence of injury or flow-limiting stenosis. |
pmc-6019431-1 | A previously healthy 3-year-old Moroccan boy was admitted with anemia and thrombocytopenia. He had been well until 3 weeks prior to presentation, when he developed a febrile erythematous rash. Fever recurred a week before admission, associated with lethargy, vomiting, and non-bloody diarrhea. Family history is negative for kidney or hematological disorders; the non-consanguineous parents and the boy’s three siblings are healthy.
The patient appeared pale, with bruises on abdomen, back, and lower extremities. The clinical exam was otherwise unremarkable. Laboratory work-up revealed hemolytic anemia with marked reticulocytosis, presence of schistocytes, profound thrombocytopenia, elevated uric acid, and normal serum creatinine concentrations. Plasma haptoglobin was undetectable, lactate dehydrogenase (LDH) elevated, and direct Coombs test negative. A stool sample was negative for E. coli O157:H7. Anti-streptolysin titers were only marginally elevated. D-dimers were increased to 2.49 μg/mL fibrinogen-equivalent units (N 0.02–0.47 μg/mL). Prothrombin, international normalized ratio (INR), partial thromboplastin time, fibrinogen, and C3 and C4 concentrations were normal, and sC5b-9 was increased to 653 ng/mL (normal < 300 ng/mL; SC5b-9 Plus MicroVue, ELISA, TECOmedical/Quidel, San Diego, CA). Urinalysis revealed microscopic erythrocyturia and mild proteinuria. On Day 2, the patient received transfusions of red blood cells and platelets. Hemoglobin (Hb) continued to fall to 48 g/L, and platelets dropped to 5 × 109/L within 2 days of the transfusions (Table ).
A tentative diagnosis of aHUS was made, and a single dose of eculizumab (~ 900 mg/m2) was given 2 days after admission. The patient was vaccinated against N. meningitidis and started amoxicillin prophylaxis. Platelet count, Hb, and LDH started to improve after 4 days and normalized within 17 days. The diagnosis was corrected to TTP several days after discharge from hospital, when the ADAMTS13 activity in the pre-treatment plasma sample was found to be unmeasurably low using the fluorescence resonance energy transfer (FRETS-VWF73 substrate) assay (Peptide International Inc. Louisville KY) []. The patient also had anti-ADAMTS13 IgG antibodies (1:64) (in-house titration ELISA with recombinant ADAMTS-13 (Baxter, Mississauga, Canada) as target antigen and serial plasma dilutions). Incubating patient and reference plasma (ADAMTS13 activity 0 and 100%, respectively) in equal volumes at 37 °C for 30 min reduced the ADAMTS13 activity in the mixture to 0%, indicating the presence of an inhibitor in an assay analogous to the Bethesda assay using the FRETS-VWF73 substrate. Due to rapid clinical and laboratory improvement following treatment with eculizumab, we refrained from PLEX and immunosuppressive therapy. ADAMTS13 activity normalized completely after 15 months (Fig. and Table ).
The initial mutation screen for ADAMTS13 and genes encoding complement factors CFH, CFI, and CFB, CD46/membrane cofactor protein (MCP), factor H-related protein (CFHR) 5, C3, apelin and thrombomodulin was negative. CFH protein concentration was normal. Comprehensive re-testing confirmed the previous results and excluded mutations of diacylglycerol kinase-epsilon (DGKE), plasminogen (PLG) and methylmalonic aciduria and homocystinuria, cblC complementation type (MMACHC), but identified a homozygous deletion of CFHR3/1. No anti-CFH antibodies were demonstrated during active disease and follow-up, and there was no documented relapse of TTP or TMA over the 4 years of observation. A moderate, temporary increase of plasmatic sC5b-9 was noted > 2½ years after presentation in the absence of clinical symptoms or hematological evidence of TMA. At the time, ADAMTS13 activity had normalized, and anti-CFH antibodies were undetectable (Table and Fig. ). |
pmc-6019439-1 | A 57-year-old man presented with neutropenia, since May 2016 due to a myelodysplastic syndrome. The revised international prognostic scoring system was 0, and no specific treatment was undertaken. Other significant past medical history included well-controlled hypertension treated with quinapril and type 2 diabetes mellitus without medication.
In November 2016, he experienced severe asthenia and excessive sweating. Laboratory tests revealed leukocyte count of 8,000 per cubic millimeter with hyperblastosis (23%), anemia, and thrombocytopenia. The results of the bone marrow aspiration confirmed AML (M4 type) according to the French–American–British classification, without extramedullary manifestations. FLT3, CEBPα, and NPM1 were not mutated and no cytogenetic abnormalities were found. This AML was secondary to a myelodysplastic syndrome with single lineage dysplasia. For these reasons, the patient was eligible for a hematopoietic stem cell allograft.
In the Hematology department, an asymptomatic hypoglycemia that persists despite glucose infusion was found. Laboratory tests showed type B LA with an elevated blood lactate of 14 mmol/L (normal range, 0.5–2 mmol/L) associated with a slightly decreased pH of 7.35 (normal range, 7.38–7.42). Serum bicarbonate was low at 13 mmol/L (normal range, 24–32 mmol/L) with normal renal function tests and an elevated anion gap of 28 mmol/L. Liver function tests were normal.
The patient was transferred to the Intensive Care unit. His temperature was 37.7°C, his blood pressure was normal at 149/82 mmHg, his pulse was 119 bpm, and the respiratory rate was 28 per minute without respiratory distress which indicated Kussmaul breathing. The patient did not present any signs of hypoperfusion (he had normal blood pressure, absence of mottling, normal capillary refilling test). The palpation of the abdomen was normal without diarrhea. In the absence of a type A LA etiology, and in the context of AML, we suspected WE. Chemotherapy by doxorubicin 60 mg/m2 and cytarabine 100 mg/m2 was initiated at day 1. A slight tumor lysis syndrome was observed without kidney injury. We noted no recurrence of hypoglycemia, a rapid normalization of pH, and a decrease in the blood lactate level: 12.1 mmol/L at day 2, 9.2 mmol/L at day 3, 2.6 mmol/L at day 5, and 1.6 mmol/L at day 7 (Figure ). We observed no further complications, allowing ICU discharge at day 8.
Unfortunately, a relapse of AL occurred at day 43. This relapse was associated with a new hyperlactatemia (pH: 7.37 and blood lactate level: 12.8 mmol/L) and asymptomatic hypoglycemia related to a recurrence of WE (Figure ). Salvage chemotherapy with cytarabine 1,500 mg/m2 and gemtuzumab 3 mg/m2 was initiated, resulting in the disappearance of WE. However, the patient later developed septic shock as a complication of chemotherapy-induced aplasia and digestive infection. We suspected infectious colitis because of diarrhea and abdominal guarding. Unfortunately, the CT scan was not contributory and we could not perform a colonoscopy to confirm the diagnosis. Empirical broad-spectrum antibiotic therapy with imipenem, vancomycin, and gentamycin was administered. He eventually died in the Intensive Care unit in a state of multiple organ dysfunction due to the septic shock. |
pmc-6019590-1 | A 54 yr old man from Southwest of Iran (Yasuj) presented to the Emergency Ward with a 3-wk history of headache (continuous, throbbing, and general), fever, chills, weakness, anorexia, and weight loss. He also had a history of benign prostatic hyperplasia, gastroesophageal reflux disease, and hemorrhoid. Medications were tamsulosin, propranolol, rabeprazole, and cathartic syrup. His parents had no any congenital or infectious diseases.
On examination, the body temperature and blood pressure were 38 °C and 130/82 mm Hg, respectively. Abdominal examination revealed mild tenderness in right upper quadrant and moderate splenomegaly. All other examinations were normal.
The hemoglobin was 8.1 (gr/dl), the white blood cell count 1900, retic count 0.5%, and the platelet count 20000. The ESR was 56 (mm/h), alanine aminotransferase 84 (Iu/l), aspartate aminotransferase 67 (Iu/l), alkaline phosphatase 401 (Iu/l), albumin 3.4 (gr/dl), conjugated bilirubin 0.6 (mg/dl), ferritin 658.6 (mcg/dl), serum iron 23 (mcg/dl), total iron binding capacity (TIBC) 116 (mcg/dl). Other laboratory tests such as creatinine, blood sugar, partial thromboplastin time, prothrombin time, urinalysis, stool exam, sputum exam, wright test, 2ME, calcium, phosphorus, magnesium, and prostate-specific antigen were normal. Serologic tests for HBV, HCV, and HIV were negative.
Abdominal ultrasonography revealed mild hepatomegaly and moderate splenomegaly. Doppler ultrasound of abdomen showed dilation of splenic veins such as superior mesenteric vein (15 mm) and portal vein (15 mm).
A computerized tomography (CT) scan of brain revealed no abnormal finding. Axial fluid-attenuated inversion recovery MRI image (FLAIR) revealed an increase in signal intensity of central part of right side of pons (). Bone marrow aspiration and biopsy revealed macrophages with numerous Leishmania amastigotes (). Treatment with amphotericin B was initiated and the patient symptoms resolved completely. In second bone marrow exam, no amastigote was observed.
Five months after initial presentation and treatment with amphotericin B our patient has no any neurological morbidity and disability. |
pmc-6019596-1 | A 78 yr old man from a rural area at the western of Iran referred to Razi Hospital Dermatology Clinic, Tehran for multiple ulcerative and exudative lesions on mid face, dorsal aspect of hands and the posterior aspect of heels (, ).
Informed consent was taken from the patient.
Lesions initiated three years before with papules on the dorsal aspect of the hands then progressively enlarged above the upper lip, anterior portion of the nasal fossa, above the eyebrows and heels and became ulcerative.
During the past 3 yr, the lesions of hands were so developed that destroyed the tendons and soft tissue of fifth finger in the right hand so led to amputation of this finger. There was no history of comorbid condition, drug consumption, systemic symptoms, weight loss, fever, lymphadenopathy, hepatosplenomegaly or any signs of systemic involvement in physical examination and laboratory survey.
Multiple treatments in order to some heterogenic diagnosis such as pyoderma gangrenosum, sarcoidosis, and leishmaniasis were tried without any improvement in lesions.
In Razi Hospital Dermatology Clinic, initial Skin biopsy revealed necrotizing and palisading granulomatous tissue pattern that suggested infections etiology but the smear of lesions for fungal and mycobacteria and Leishmania was negative. In order to result of PPD test with 27 mm induration, anti-tuberculosis treatment including isoniazid, rifampin, ethambutol, and pyrazinamide was started.
A month after initiating drugs for tuberculosis, the smear of leishmaniasis repeated that was positive this time, the second biopsy revealed pseudoepitheliomatous hyperplasia and infiltration of the dermis by mixed inflammatory cells and Leishman bodies compatible with leishmaniasis.
Restriction fragment length polymorphism (RFLP) PCR was carried out on DNA extraction was carried out with QIAGEN Kit according to the manufacturer’s instruction using two primers, LITSR (5-GTG CAG GAT CAT TTT CCG ATG) and L5.8s: 5-TGA TAC CAC TTA TCG CAC TT was designed for LTS1–PCR and cutting with and HaeIII enzyme. Positive controls containing DNA of L. major, L. tropica and a negative control containing distilled water were included. The PCR–RFLP on specimens of lesions proved L. major as the pathogenic agent (, )().
From the left side, the 2 bands show L. major, the second 2 bands show L. tropica, the 5th one is the specimens of lesions that compatibles with L. major and the last one show L. tropica.
Treatment initiated with 3 gr per day of meglumine antimoniate (Glucantime®) until 1 wk followed by 4.5 gr per day for another week, in spite of good response to meglumine antimoniate after 2 wk of treatment we forced to discontinue of drug because of cardiac toxicity (, ).
The patient was informed about publishing his figures whit covering eyes. |
pmc-6019650-1 | A 24-year-old male presented with photophobia since birth. No family history for colour vision defects or retinal dystrophies was reported. Myopia with an refractive error of − 5.50 D (right eye) and − 6.50 D (left eye) and astigmatism were found in the patient (III:2) at the age of 8 months along with nystagmus but devoid of strabismus. Glasses were given at the age of 1 year. Difficulties distinguishing colours were noticed by his parents at the age of 3 years. Achromatopsia was the first suspected diagnosis. At the age of 4 years occlusion therapy alternating in both eyes for 2 months was attempted to treat amblyopia but was unsuccessfull. A best-corrected visual acuity of 20/200 was measured with Snellen charts at the age of 6 years. No brain injuries were detected by magnetic resonance imaging. Visual evoked potential flash and B-scan ultrasonography performed normal for both eyes. At the age of 11 years a visual acuity of 20/250 was measured. At the latest exam at the age of 24 years, full-field light- and dark-adapted electroretinogram (ERG) recordings were performed according to the International Society for Clinical Electrophysiology of Vision (ISCEV) standard protocol []. Subnormal amplitudes under scotopic conditions and extinct responses under photopic conditions were observed in both eyes of the patient (III:2) in comparison to normal controls (Fig. ). A visual acuity of 20/400 was measured for both eyes with a myopic correction of − 12.00 D (right eye) and − 11.50 D (left eye). Anterior segment, pupillary reflexes and intraocular pressure revealed no abnormalities. Eye fundus examination revealed normal retinal vessels, optic nerve heads showing tilted optic discs with myopic conus and the maculae had elapsed reflex without waxy reflex (Fig. ). Spectral domain optical coherence tomography (SD-OCT) performed with Spectralis OCT (Heidelberg Engineering) showed normal retinal architecture with thinned photoreceptor layer (Fig. ). Colour vision test evaluated with the Farnsworth D-15 Colour Test revealed protan-deutan confusion errors (Fig. ).
Mutation screening of OPN1LW/OPN1MW gene cluster in the patient (III:2) was performed as previously described []. Genotyping PCRs with genomic DNA from the patient (III:2, see Fig. for a pedigree of the genetically investigated family members) revealed absence of the LCR and promoter regions of both OPN1LW and OPN1MW genes – indicative for a large deletion – but presence of the 3′ parts of the OPN1MW gene, namely exons 4, 5 and 6. Upon fine sequence tag site content mapping, the deletion was finally bridged with a PCR amplicon performed with primers BCM#27_F (5′- TCGACCCAGAATTAACCTCTCT -3′) and BCM#27BPR (5’-TCTAAAAATGGACAAGGATTAACCA -3′) which was sequenced with Sanger to determine the exact breakpoints in patient III:2 (Fig. and Fig. ). The deletion, NC_000023.11:g.154,118,184_154,191,311del, encompasses 73,128 bp with the centromeric breakpoint located in the intergenic region between MECP2 and OPN1LW and the telomeric breakpoint within intron 3 of OPN1MW (Fig. ).
A sequence alignment of the breakpoint junction sequence in the patient (III:2) with the corresponding non-mutant sequence sections from his grandfather (I:1) revealed an overlapping stretch of 13 bp between the centromeric and the telomeric breakpoint sequences (Fig. ) shared by two Alu elements. The sequence remnants embedded within the deletion breakpoints resembled the junction of two Alu elements; (1) a fossil right Alu momomer (FRAM) element at the centromeric breakpoint of the deletion, and (2) an AluJo element in intron 3 of OPN1MW at the telomeric breakpoint of the deletion (Fig. ). Microsatellite marker analysis revealed that the X-chromosome present in the patient (III:2) had been transmitted from his maternal grandfather (I:1, Fig. ). Segregation analysis performed by means of breakpoint PCR amplification showed that neither the patient’s grandfather (I:1) nor the mother (II:1) carry the deletion (Fig. ). The CARE guidelines were followed in reporting this case. |
pmc-6019664-1 | A 52-year-old Japanese man with lower abdominal pain underwent lower endoscopy, revealing a type 2 lesion with the entire circumference raised in the rectosigmoid colon. He was diagnosed with rectosigmoid colon cancer and underwent endoscopic stent placement as a bridge to surgery for large bowel obstruction. He was found to have multiple lung metastases and a horseshoe kidney on CT scan (Fig. ). 3D-CT angiography showed an aberrant renal artery at the isthmus from 3 cm under the inferior mesenteric artery (IMA) branch of the aorta (Fig. ). Laparoscopic anterior rectal resection was performed with a five-port conventional technique in which sigmoid colon and upper rectum were mobilized via a medial approach. During the operation, the IMA, left ureter, left gonadal vessels, and hypogastric nerve plexus were identified and preserved (Fig. , ). The root of aberrant renal artery was not visualized. The root of the IMA was located considerably cephalad to the renal isthmus, and the left branch of aberrant renal artery that was close to IMA was detected and preserved (Fig. ). The specimen was removed through a small laparotomy wound, and intraperitoneal reconstruction was performed according to the standard double stapling technique. The patient recovered uneventfully and was discharged on postoperative day 16. Pathological examination demonstrated no metastasis of the lymph node.
Horseshoe kidney is rare, with an incidence of 0.25%, and the incidence is higher in males than in females at a ratio of 2:1. Horseshoe kidneys are fused at the lower pole in 95% of cases, and the isthmus is composed of fibrous tissue alone or contains parenchyma. The horseshoe kidney is located at a level lower than the normal kidneys because elevation of the kidneys interferes with the isthmus at the origin of the IMA.
A literature search revealed 23 patients who underwent surgery for colon cancer with concomitant horseshoe kidney including our patient, from 1983 to 2017 [–]. There were 14 men and 9 women, and the affected region was the sigmoid colon in 12, rectum in 8, descending colon in 2, and ascending colon in 1. Surgery was performed under laparoscopy in 20 patients. The positions of the anatomical structures necessary for surgery are summarized in Table .
Regarding the ureteral distribution, it was present on the ventral side of the horseshoe kidney, i.e., almost the same as that in patients with normal kidneys, in all cases in which the distribution was described. The ureters were present on the ventral side of the horseshoe kidney in many reported cases, suggesting that it was conserved on dissection similarly in patients with normal kidneys. However, there were some cases where the ureters were present on the dorsal side of the isthmus of the horseshoe kidney, where a ureter other than the bilateral ureters independently came out from the isthmus of the horseshoe kidney, where two ureters each came out from the bilateral sides, or where the ureters ectopically opened in regions other than the urinary bladder [], suggesting the necessity of preoperative imaging diagnosis and careful surgery.
In the cases described in the literature, the distribution of the gonadal artery and vein were usually normal. However, variations have been reported, such as the presence of two left ovarian veins and branching of the testicular artery from the renal artery and renal sinus [], again suggesting the necessity of preoperative imaging diagnosis and careful surgery.
The bilateral lumbar splanchnic and superior hypogastric nerves were distributed on the ventral side of the horseshoe kidney in six patients reported, including in our patient, but superior hypogastric nerves distributed from the dorsal side of the horseshoe kidney into the pelvis were noted in one patient. Although there were only a few reports on the distribution of the bilateral splanchnic and superior hypogastric nerves in patients with horseshoe kidney, the second lumbar splanchnic nerves were present on the ventral side of the kidneys and the third lumbar splanchnic nerves were present on the dorsal side of the kidneys, and both nerves formed superior hypogastric plexuses in a report of an autopsied patient [].
Arterial anomalies are reported in more than 70% of patients with horseshoe kidney, due to remain of branches from the common iliac artery, median sacral artery, and IMA. Excess renal arteries were observed in 16 of 23 patients, including patients with unclear details. Kölln classified the vascular supply in the horseshoe kidney into the following three types: (1) direct single branching from the aorta on the bilateral sides (15%), (2) several blood vessels on the bilateral sides and in the isthmus all directly branching from the aorta (65%), and (3) several blood vessels on the bilateral sides and in the isthmus that branch from common iliac artery, internal iliac artery, inferior mesenteric artery, or median sacral artery (20%) []. The second pattern was noted in our patient. 3D-CT angiography is useful in these cases [, ]. As the resolution of CT increased, the positional relationship among the IMA, kidneys, and excess renal arteries may be sufficiently identified using 3D-CT angiography.
In our patient, the IMA was easily detected during usual mobilization via median approach. We usually dissected the layers preserving the plexus, and the left branch of aberrant renal artery that was close to IMA was detected and preserved uneventfully, because the locations of the excess renal arteries and IMA were sufficiently identified using 3D-CT angiography. Injury to excess renal arteries by laparoscopic colectomy may be avoided by retaining accurate dissection layers, because they are present in the retroperitoneum. Even when an accurate dissection layer cannot be retained, laparoscopic colectomy may be safely performed by sufficiently evaluating images and confirming the anatomical structures before surgery. |
pmc-6019666-1 | A 69-year-old man developed a sudden epigastric pain. He was presented at this hospital as an emergency outpatient. Six years earlier, he underwent laryngoesophagopharyngectomy, bilateral lymph node dissection for hypopharyngeal cancer, and esophageal reconstruction with a free jejunum flap. On physical examination, the abdomen was flat and soft with tenderness in the epigastric region, but no sign of peritoneal irritation. Blood biochemistry findings revealed elevated values: creatinine, 1.16 mg/dl; lactate dehydrogenase, 364 U/l; and creatine phosphokinase, 622 U/l.
Abdominal contrast computed tomography (CT) revealed twisted mesentery with the small intestine around the point of torsion (whirl sign) and the superior mesenteric artery as the axis. Contrast enhancement was weakened in the same area of the small bowel (Fig. ). Given this information, we suspected small bowel volvulus and performed emergency surgery on the same day.
A 5-mm camera port was placed in the umbilicus and 5-mm ports in the lower and right lower abdomen. During laparoscopic examination, the upper jejunum adhered to the small bowel close to the terminal ileum with overlapping of the small bowel. The entire part from the upper jejunum to the terminal ileum was twisted clockwise with the superior mesenteric artery and vein as the axes and the adhesion site as the starting point. There were areas of poor color enhancement throughout the twisted section of the small bowel (Fig. ). We laparoscopically separated the adhesion between different sections of the intestinal tract and traced the bowel from the small bowel in the region of the ligament of Treitz toward the anus to confirm the absence of adhesions or torsion up to the terminal ileum. The color of the small bowel improved; hence, the surgery was completed without resecting any part of the intestine.
Postoperatively, the patient made good postoperative recovery, resumed oral intake on day 2, and was discharged on day 5 after surgery. No recurrence has been reported 1 year postoperatively. |
pmc-6019829-1 | A 7-month-old male, neutered Maine Coon cat was presented to the Small Animal Teaching Hospital at the University of Bern with acute neurological signs consistent with unilateral otitis media/interna. Six weeks earlier an inflammatory aural polyp had been removed by traction and flushing of the ear canal. The cat had fully recovered after three weeks of treatment with oral and topical glucocorticoids and topical ofloxacin (Floxal, Bausch & Lomb Swiss AG). Otoscopic and cytologic examinations revealed brown-colored fluid in the external canal with numerous extra- and intracellular rod-shaped bacteria and neutrophils. A deep ear swab was submitted for culture and subsequent antimicrobial susceptibility testing.
The ear swab was cultured on sheep blood agar at 37 °C for 2 days, yielding a pure culture of small white colonies (strain number 17KM38). Gram staining showed Gram-positive, polymorphic rods and the bacteria were catalase positive. Thus, the bacteria were classified as belonging to the genus Corynebacterium, however species identification was not possible with either Maldi-Tof MS (MALDI Biotyper, Bruker using the in-house database and MBT 6903 MSP Library, Bruker) or VITEK® 2 Compact (Biomérieux) (cards GP and CBC). Therefore, the 16S rRNA gene was amplified and Sanger sequenced using universal primers []. Sequence analysis and sequence comparison using the BLAST program (NCBI, ‘rRNA_typestrains/prokaryotic_16S_ribosomal_RNA’ database) revealed 98.6% identity to Corynebacterium variabile (NR_025314.1), 98.0% to Corynebacterium terpenotabidum (NR_121699.1) and 97.8% to Corynebacterium glyciniphilum (NR_121782.1), thus the strain 17KM38 could not be assigned to any species present in the database. However, the 16S rRNA sequence showed a 100% identity with the whole genome shotgun sequence of the recently described Corynebacterium provencense SN15 (GenBank accession no.: NZ_LT160593.1) isolated from faeces of an obesity patient [].
In order to select the appropriate antimicrobial therapy, the isolate was tested for antimicrobial resistance using broth microdilution (Sensititre EUST, Thermo Fisher Scientific) initially following in-house guidelines. Minimum inhibitory concentration (MIC) testing was however repeated according to the most recent EUCAST (European Committee on Antimicrobial Susceptibility Testing) guidelines [] using Streptococcus pneumoniae ATCC 49619 as a quality control. Briefly, the bacteria were grown on sheep blood agar at 37 °C for 24 h. They were then suspended in Mueller-Hinton broth with 5% lysed horse blood (Thermo Fisher Scientific) and 20 mg/l β-NAD to a concentration of 5 × 105 CFU/ml and used for plate inoculation. Our strain tested resistant to clindamycin, penicillin and ciprofloxacin but susceptible to tetracycline, gentamicin and vancomycin. In addition, high MIC values were found for cefoxitin (8 mg/l), mupirocin (≥256 mg/l) and trimethoprim (≥32 mg/l) while the MIC for chloramphenicol was low (≤4 mg/l) (Table ).
To better characterize the strain, whole genome sequencing was performed using the PacBio method. The strain was grown on sheep blood agar at 37 °C for 24 h and the harvested cells were used to extract gDNA according to a protocol published earlier []. Sequencing was performed by the Lausanne Genomic Technologies Facility (University of Lausanne, Switzerland). The genome was assembled from PacBio reads using Canu 1.4 []. A single contig was built after assembly of the obtained reads, and circularized using amos 3.1.0 []. Subsequently the genome was annotated using Prokka 1.12 [] and submitted to GenBank (Accession No. CP024988). The genome of 17KM38 has a size of 3.11 Mb and 2682 coding sequences were detected. Of these, 862 out of 2682 were annotated as hypothetical proteins. In order to confirm that 17KM38 belongs to the same species as SN15 and is indeed distinct from its closest relatives, average nucleotide identity (ANI) was calculated according to Goris et al. [] using an online tool (ANI calculator) developed by Rodriguez-R and Konstantinidis [] with default settings. The ANI of 17KM38 was found to be 81.5% with C. variabile (NC_015859.1), 81.0% with C. terpenotabidum (NC_021663.1), 79.1% with C. glyciniphilum (CP006842.1) and 99.1% with SN15 (FIZC01). Since the recommended cutoff point for species delineation is 95% ANI [], these results confirm that SN15 [] and 17KM38 indeed belong to the same species which is distinct from related species. Furthermore, a phylogenetic tree was constructed from the theoretical proteome according to Qi et al. [] applying the online tool CVTree [] (Fig. ).
The genome of 17KM38 was compared to the genome of the strain SN15 using mauve []. Gap regions were extracted and annotated resulting in 280 coding sequences (CDS), 113 of which could be assigned a putative function (Additional file ). Interestingly, 12 CDS unique to 17KM38 are related to iron acquisition (Fig. ), which is important for bacterial survival in the host and thus for virulence []. Most interesting is an approximately 17kbp region containing nine genes for siderophore synthesis and transport organized in two presumptive operons (Fig. ) []. Genes dhbBCEF are related to the corresponding genes in Bacillus subtilis (between 36 and 52% identity in blastx) where they form the biosynthetic pathway for the catecholic siderophore bacillibactin []. The whole gene cluster has similarity to the enterobactin gene cluster in E. coli which also includes fep genes and the fes gene []. A gene corresponding to dhbA/entA is missing from this cluster in 17KM38, but is located elsewhere on the genome (1,026,704 - > 1,027,528). C. variabile, the closest relative to C. provencense, also possesses a repertoire of iron acquisition genes, since its habitat is the iron-restricted environment found in cheese []. Interestingly the genome of C. variabile also encodes a pathway similar to that for bacillibactin. However, the dhbBCEF genes in 17KM38 are no closer related to those in C. variabile than those in B. subtilis.
In terms of virulence factors 17KM38 encodes a candidate adhesin (Csp1_16740) related to (82% query cover, 51% identity in blastx) a cell wall-associated hydrolase of C. resistens (encoded by cwlH) []. The exact function of this protein is unknown, however knockout of the homologous gene DIP1621 in C. diphtheriae led to reduced adherence to epithelial cells []. This gene is also present in strain SN15.
As mentioned above, 17KM38 showed resistance to several antibiotics. Quinolone resistance in corynebacteria has been described to rely on mutations in the quinolone resistance determining region (QRDR) of gyrA leading to changes in the SAIYD (aa 87–91 in C. glutamicum) motif of susceptible strains []. Mutations of Ser-87 to Arg in C. amycolatum and to Val in C. striatum have been shown to confer quinolone resistance []. 17KM38 showed a mutation in this region changing Ser to Ala, which could explain the quinolone resistance. A mechanism for resistance to ß-lactams in corynebacteria has been demonstrated for C. jeikeium where acquisition of the gene pbp2C encoding the low-affinity class B penicillin binding protein 2C was shown to confer resistance []. 17KM38 has four genes encoding penicillin binding proteins one of which is related to pbp2C (Csp1_14570, 96% query cover, 44% identity), however, if this gene is actually related to penicillin resistance remains to be shown.
Following sensitivity testing results, the cat was treated with oral chloramphenicol palmitate solution (Cloropal, Dr. E. Gräub AG) 20 mg/kg twice daily for three weeks and an ear cleaner containing chlorhexidine digluconate (Otodine®, Ufamed AG) twice daily for two weeks. Re-examination after three weeks of therapy revealed that the head tilt was much improved and the cat was no longer ataxic and cytology of the ear canal did not show any bacteria or neutrophils. |
pmc-6020089-1 | A 70-year-old man underwent an endoscopic examination owing to epigastric pain and was diagnosed with esophageal cancer. The endoscopic examination revealed an irregular mucosa in the lower esophagus, and biopsies confirmed squamous cell carcinoma. Contrast-enhanced CT did not depict the esophageal lesion but showed enlarged lymph nodes in the tracheal bifurcation and bilateral hilum of the lung. FDG-PET/CT revealed abnormal accumulation in the main tumor in the lower esophagus (maximum standardized uptake value [SUV max]: 4.06) and higher accumulation in the hilar-mediastinal lymph nodes (SUV max: 15.0) and enlarged mediastinum lymph nodes (SUV max: 6.94) (Fig. ). The primary lesion of the esophagus was staged T1; nevertheless, it was still difficult to rule out metastasis in the lymph nodes. We selected chemotherapy as the first-line treatment. The patient was administered 2 cycles of 140 mg cisplatin and 1400 mg 5-fluorouracil over 2 months. In each cycle, 9.9 mg dexamethasone was administered to prevent side effects of chemotherapy. Subsequently, we observed a disappearance of the FDG uptake in the primary lesion, and a slightly reduced FDG uptake in the mediastinal and bilateral hilar lymph nodes (Fig. ). These non-identical responses to chemotherapy did not indicate cancer metastasis, but most likely a sarcoid-like reaction of the lymph nodes associated with squamous cell carcinoma of the esophagus. Therefore, the patient underwent video-assisted thoracoscopic surgery esophagectomy (VATSE) with gastric tube reconstruction via the retrosternal route. The pathological diagnosis was moderately to poorly differentiated squamous cell carcinoma of the lower thoracic esophagus. The resected lymph nodes demonstrated no tumor metastasis. However, some lymph nodes (#8a, #106RecR, #107, #108, #109) showed granulomatous reactions, histiocytes, multinucleated giant cells, and scar-like fibrosis (Fig. ), suggesting the presence of sarcoidosis or sarcoid-like reactions. In accordance with the Union for International Cancer Control (UICC) TNM staging system (7th edition), the tumor was classified as pT1N0M0, pStage IA. The patient was discharged 49 days after surgery. FDG-PET/CT performed 15 months after surgery showed bilateral FDG accumulation in the hilar lymph nodes without tumor recurrence. |
pmc-6020089-2 | A 72-year-old woman with a past medical history of sarcoidosis underwent an endoscopic examination owing to dysphagia. The endoscopic examination revealed a circumferential tumor with ulceration in the cervical esophagus. Biopsies obtained during the endoscopy indicated squamous cell carcinoma. Contrast-enhanced CT showed extensive tumor growth with suspected tracheal invasion and enlarged lymph nodes extending from the cervical region to the upper mediastinum. FDG-PET/CT revealed abnormal FDG accumulation in the primary lesion (SUV max: 23.1) and lymph nodes (SUV max: 5.45) from the cervical to upper mediastinal region (Fig. ). However, it was difficult to determine whether the multiple lymphadenopathy was benign or metastatic because of her past medical history of sarcoidosis. Therefore, and also for the purpose of preserving the larynx, we initiated definitive chemoradiotherapy. The patient was administered 2 cycles of 45 mg cisplatin and 700 mg 5-fluorouracil with 60 Gy/30 fr radiation therapy over 2 months. In each cycle, 8 mg dexamethasone was administered to prevent side effects of chemotherapy. After completing the chemoradiotherapy, we observed complete disappearance of FDG uptake in the primary cancer in the esophagus, and only a slight reduction in FDG uptake in the mediastinal lymph nodes (SUV max: 3.26; Fig. ), which indicated that the lymph nodes were affected by sarcoidosis. The primary lesion of the esophagus relapsed 3 months later. Then, the patient underwent thoracoscopic and laparoscopic total laryngopharyngoesophagectomy with gastric tube reconstruction via the posterior mediastinal route. The pathological diagnosis was moderately differentiated squamous cell carcinoma in the cervical esophagus. The resected lymph nodes demonstrated no tumor metastasis. However, some lymph nodes showed granulomatous reactions and contained several small epithelioid cell granulomas (Fig. ), suggesting the presence of sarcoidosis. The final stage was determined as pT2N0M0, pStage IB (UICC 7th). The patient was discharged 27 days after surgery. Contrast-enhanced CT performed 6 months after surgery showed no tumor recurrence. However, the patient died of myocardial infarction 1 year after surgery. |
pmc-6020090-1 | A 75-year-old woman was admitted to our hospital complaining of itching around her anus. She had a history of sigmoidectomy for diverticulitis 6 years prior and a past history of Sjögren’s syndrome. She had noted a reddish skin lesion around her anus over the past several years. She reported no change in bowel habits, no gastrointestinal symptoms, no weight loss, and no family history of malignancy.
Physical examination revealed an erythematous, inflamed skin lesion in the perianal region (Fig. ), but a normal vagina and rectum. Neither colposcopy, cystoscopy, nor colonoscopy showed evidence of a visible lesion or any abnormality of the cervix, bladder, or rectum (Fig. a, b). Computed tomography and magnetic resonance imaging showed no evidence of malignancy in the genitourinary or gastrointestinal tracts. Histopathological examination of biopsy specimens showed many Paget’s cells within intraepithelial lesions of the perianal skin but no malignant cells in the rectal or vaginal mucosa. Therefore, primary extramammary Paget’s disease (EMPD) of the anogenital region was suspected. We performed anal-preserving wide local excision deep to the subcutaneous fat with 1-cm negative margin from the positive sites confirmed by frozen section examination and mucosal resection of the anal canal that was extended 1 cm proximal to the dentate line of the anal canal. Reconstruction was performed using a bilobed gluteal fold flap (Fig. a, b).
Histopathological examination of the resected specimen showed Paget’s cells, characterized by clear cytoplasm and large pleomorphic nuclei, within the epidermis. Immunohistochemical analysis revealed that the Paget’s cells were positive for cytokeratin (CK) 7, CK20, and caudal-related homeobox gene nuclear transcription factor (CDX) 2 and negative for gross cystic disease fluid protein (GCDFP) 15 (Fig. a–e). These data suggested that her perianal skin lesion was secondary EMPD arising from the rectum, although there was no lesion found in the rectum. Additional histopathological examination of the resected specimen revealed well-differentiated adenocarcinoma in an anal gland, continuous with the Paget’s cells in the anoderm, but limited in the basement membrane without a desmoplastic change (Figs. a, b and a–e). Immunohistochemical staining of the resected specimen revealed secondary EMPD due to adenocarcinoma arising from the anal gland.
Because of the possibility of residual adenocarcinoma in the anal gland, possibly extending to the sphincter, we performed a radical laparoscopy-assisted abdominoperineal resection. Any reconstructive plastic surgery was not needed. Histopathological examination revealed no residual cancer cells in the resected specimen and no lymph node metastasis. The final diagnosis was anal gland adenocarcinoma in situ with pagetoid spread in the perianal skin. |
pmc-6020092-1 | A 67-year-old man was admitted to our hospital because of liver dysfunction during a screening examination. Enhanced abdominal computed tomography (CT) revealed a hypervascular mass of 35 mm in diameter in the descending portion of the duodenum (Fig. ), and the left three sections of the liver were occupied by multiple cystic tumors with contrast enhancement of the cystic wall, 13 cm in diameter (Fig. ). A duodenal tumor was identified on gastrointestinal endoscopy (Fig. ), and a biopsy revealed a NET. The serum levels of insulin, gastrin, and glucagon were within normal ranges. CT did not initially reveal evidence of pancreatic invasion between the tumor and the pancreas; however, irregularities of the duodenal wall and swelling of the lymph nodes around the pancreatic parenchyma were observed. Thus, the patient was diagnosed with non-functional duodenal NET with multiple liver metastases, T2N1M1 stage IV (UICC 8th). In addition, CT revealed the anatomical variation of the CHA, which branched from the SMA and ran fully through the head of the pancreatic parenchyma (Fig. , Additional file Figure S1). The CHA branches into the left hepatic artery (LHA), the middle hepatic artery (MHA), and the right hepatic artery (RHA) (Fig. a, b). Furthermore, a developed gastric arterial arcade, 4 mm in diameter, was found between the left gastric artery (LGA) and the right gastric artery (RGA). The RGA was branched from a distal portion at a distance of 10 mm from the root of the LHA (Fig. ). Incidentally, we did not observe stenosis of the celiac axis due to compression by the median arcuate ligament. We planned PD and left trisectionectomy with caudate lobectomy combined resection of the tp-CHA with the preservation of the gastric arterial arcade in order to maintain arterial flow of the remnant liver, preserving the route of the celiac artery to the right posterior hepatic artery (RPHA) via the gastric arterial arcade from the LGA to the RGA, LHA, and RHA. If the hepatic arterial flow could not be maintained by this route, the preservation of the tp-CHA by separating from pancreatic parenchyma or arterial reconstruction using radial artery graft between CHA and RHA was planned. Four weeks after percutaneous transhepatic portal embolization, surgery was carried out.
After laparotomy, the gastric arterial arcade was exposed and encircled, and the LHA, RHA, and proper hepatic artery (PHA) were encircled (Fig. ). The LHA was divided at the distal side of the origin of the RGA. The MHA and the right anterior hepatic artery (RAHA) were also divided. The left portal branch and the right anterior portal branch were divided (Fig. ). The liver was transected, and the left hepatic duct and right anterior hepatic duct were divided. The left trisections and caudate lobe were anatomically resected. After clamping the PHA, the hepatic arterial signals of the RPHA via the gastric arterial arcade were confirmed by intraoperative Doppler ultrasonography (Fig. ). After trisectionectomy and caudate lobectomy, PD was performed. The pancreatic head was dissected from the SMA after the upper jejunum was divided. The pancreas was divided in front of the SMV. Finally, the specimen was only connected by the tp-CHA and the common hepatic duct (CHD) (Fig. ). The hepatic arterial signals of the RPHA was maintained after clamping the PHA. The PHA and the origin of CHA were divided, and the tp-CHA was taken out with the pancreatic head (Fig. ). The CHD was divided, and the specimen was removed (Fig. ). Reconstruction was performed via modified Child’s method. The operative time was 1072 min and the intraoperative blood loss was 3052 ml, and red blood cell transfusion was performed (1680 ml).
Postoperatively, the patient developed pancreatic fistula (Clavien-Dindo IIIa) and biliary leak (Clavien-Dindo IIIa), and these complications were treated conservatively. There were no signs of hepatic ischemia. The patient was discharged on postoperative day 39. The pathological diagnosis was duodenal neuroendocrine tumor G2 with multiple liver metastases. The Ki-67 labeling index was < 20%, and staining for chromogranin A and synaptophysin were positive. There was no evidence of invasion of the pancreatic parenchyma; however, the duodenal tumor was confined to the MP layer, and one of the 25 examined lymph nodes was positive, and moderate lymphovascular invasion was observed. The final diagnosis was pMP, med, INFa, ly1, v2, pPM0, pDM0, and pEM0. The patient has shown no recurrence in the 22 months since the operation. Enhanced abdominal CT at 4 months after surgery revealed the blood flow of the RPHA via the gastric arcade (Fig. ).
Over the years, several authors have described variations in the hepatic arterial anatomy; a CHA arising from the SMA—called the hepatomesenteric type—is a rare clinical entity. Yang et al. and Hiatt et al. reported that this condition was observed in only 31 of 1324 patients and 15 of 1000 patients, respectively [, ]. A CHA passing through the pancreatic head parenchyma, tp-CHA, is even rarer; Yang et al. [] reported that among 31 patients with the hepatomesenteric type, only 3 had this condition.
When PD is scheduled in such patients with tp-CHA, it is important to maintain the arterial supply to the liver. Surgeons should preoperatively determine whether to preserve or perform combined resection of the tp-CHA. Tp-CHA preservation was selected in several previous reports [, , ]. This surgical procedure is technically feasible; however, there is a risk of a positive surgical margin or insufficient lymph node dissection and a tendency for increased intraoperative blood loss during the separation of the pancreatic parenchyma. If the tp-CHA is resected, reconstruction is usually necessary in order to maintain the hepatic arterial flow. Previous reports [, , ] have described successful arterial reconstruction after CHA resection during PD; however, such procedures are associated with an increased risk of thromboembolism, which can lead to a fatal outcome, especially in HPD []. In contrast, when collateral circulation develops, surgeons can perform combined resection of the tp-CHA, preserving the collateral circulation without arterial reconstruction. Several reports have recommended preoperative embolization of CHA in order to maintain the hepatic arterial flow through enlarged collateral arteries []. Although preoperative embolization can increase the liver arterial flow through collateral arteries, it is not routinely recommended because of the risk of complications, which includes the migration of embolic material [, ].
A developed gastric arcade or pancreaticoduodenal arcade is frequently seen in patients with the stenosis of the CHA due to factors such as compression by the median arcuate ligament []. There are only a few cases in which the hepatomesenteric trunk and the tp-CHA and the association between the tp-CHA and the development of a gastric arterial arcade have not been reported. On the other hand, Miyamoto et al. reported the case of a patient with pancreatic head cancer with a CHA arising from the SMA who underwent radical PD combined with the resection of the CHA, in which the hepatic arterial flow was maintained via the gastric arterial arcade []. In this report, the patient did not have a developed gastric arterial arcade; however, the hepatic arterial flow via the gastric arterial arcade was sufficient and hepatic ischemia was not detected after the operation. Considering this case, even if the patients with tp-CHA do not have a developed gastric arterial arcade, surgeons may be able to preserve hepatic arterial flow via the gastric arterial arcade alone. If the hepatic arterial flow via the gastric arterial arcade alone is adequate after clamping the PHA, the combined resection of the tp-CHA can be considered, even if the gastric arcade is not developed before surgery. In cases in which the hepatic arterial flow is not adequate, the preservation of the tp-CHA or arterial reconstruction should be considered.
When performing HPD, a PD-first procedure before hepatectomy is generally performed, as this approach is anatomically rational []. However, in the present case, performing hepatectomy after PD carried a risk of the arterial supply to the liver being reduced during hepatectomy. Had we chosen a PD-first procedure and the hepatic arterial flow not been maintained after CHA resection, it would have been necessary to perform arterial reconstruction before liver transection. This method is associated with a risk of injury to the reconstructed artery and thrombosis during liver transection. Given the above, we opted to perform hepatectomy before PD in our patient with a tp-CHA undergoing HPD.
In the procedure for separating the tp-CHA from the pancreatic parenchyma entirely, the surgeon should be concerned about the increasing rate of hemorrhage, surgery time, and the risk of injury to the tp-CHA. The surgical reconstruction of the hepatic artery when performing HPD is also associated with a high degree of risk. The association between tp-CHA and gastric arterial arcade was recognized on preoperative CT scans; the development of this collateral circulation may have the potential to prevent ischemia-related liver complications. From these points of view, the preoperative identification of the developed arcade of the gastric arteries helps in planning an appropriate operative procedure, and this procedure seems to be a viable and simple option. To our knowledge, this is the first report of PD combined with resection of a tp-CHA without preoperative embolization. Furthermore, this is also the first report of HPD for a patient with a tp-CHA. The preoperative identification of the developed arcade of the gastric arteries helps in planning the appropriate operative procedure when PD is scheduled for patients with a tp-CHA. |
pmc-6020204-1 | A 39-year-old Japanese man presented with a 3-month history of numbness on the left side of his face. His symptoms had gradually progressed and had become painful in the month before the initial visit. He also complained that sometimes he could not chew on the left side. An examination revealed decreased sensation over the distribution of the left trigeminal nerve that did not respond to nonsteroidal anti-inflammatory drugs or muscle relaxants and was only slightly responsive to carbamazepine. His symptoms were associated with dyskinesia of the left masticatory muscles but there was no clicking sound. His facial expression was symmetrical at rest.
His past medical history was significant for acute gastritis, duodenal ulcer, and depression, for which brotizolam, flunitrazepam, and paroxetine had been prescribed, respectively. He was reticent and had difficulty communicating his feelings and wishes, which appeared to be related to his history of depression. Panoramic radiography revealed no specific findings relevant to his symptoms (Fig. ) but did identify slight restriction of movement of the temporomandibular joint on the left (Fig. ). MRI of the temporomandibular joint region was inconclusive for temporomandibular disorder and his symptoms were nonspecific for trigeminal neuralgia. Therefore, we extended the scanning range into the brain region and found a tumor measuring 10 mm in diameter and a homogeneously high signal intensity on axial T1-weighted images compared with gray matter (Fig. ) and low signal on axial T2-weighted images (Fig. ) in Meckel’s cave. The tumor appeared to be exerting pressure on his trigeminal nerve. He was referred to the neurosurgery department where unenhanced computed tomography (CT) images demonstrated a localized well-defined mass lesion in Meckel’s cave, which was homogeneously hyperdense compared with gray matter. No calcification was present (Fig. ).
En bloc excision was subsequently performed. Immunohistochemistry was positive for melanocytic features of Melan A (MART1; melanoma antigen recognized by T cells-1), human melanoma black-45, vimentin, and S-100 protein and negative for cytokeratin AE1/AE3 and glia fibrillary acidic protein (Fig. ). Cellular proliferation was assessed by staining for Ki-67, which was positive, but the index was as low as 1–5%. These findings were associated with proliferation of tumor cells that contained abundant melanin pigment. Based on the above pathology results, a definitive diagnosis of melanocytoma was made.
Following excision of the intracranial tumor, our patient underwent adjuvant gamma knife radiosurgery with 24 Gy in two fractions to the tumor bed in the epidural space of the middle cranial fossa. No chemotherapy was administered. His postoperative course was uneventful with progressive resolution of the neurologic deficits. At follow-up 6.5 years later, he remains well with no signs of recurrence. |
pmc-6020209-1 | An 84-year old man with chronic hepatitis C and liver cirrhosis was referred to our outpatient clinic for the evaluation of HCC, previously treated with transarterial chemoembolization (TACE) and radiofrequency ablation (RFA). Following disease relapse, a wedge resection of two nodules in hepatic segments VI and VII was performed in December 2008. Histological examination confirmed HCC grade III (Edmondson scoring), with necrosis and microscopic vascular thrombosis.
In September 2009, magnetic resonance imaging (MRI) showed millimetric disease relapse in hepatic segments V, II, III, and I, and a 21 × 9 mm adenopathy at the hepatic hilum (Fig. a, b). A new resection was scheduled but was not carried out following the detection by intra-operative ultrasound (US) of a right portal branch neoplastic thrombosis. In December 2009, serum alpha-fetoprotein (AFP) was 1504 ng/mL. In January 2010, as a consequence of disease metastasis, systemic treatment with metronomic capecitabine (500 mg twice daily) was continuously administered according to a previously described protocol []. The therapy was well tolerated. After 1 month, serum AFP decreased to 643 ng/mL, and 3 months later, had drastically decreased to 7 ng/mL. At the same time, a marked reduction in liver lesion size was observed by MRI, evaluated as a partial response according to Modified Response Evaluation Criteria in Solid Tumors (mRECIST) []. In August 2010, computer tomography (CT) scanning showed a single hypodense lesion of 13 mm in hepatic segment II without any other liver lesions, and that enlarged abdominal lymph nodes were stable and neoplastic thrombosis was not detected. Given the presence of a single lesion, the possibility of residual disease ablation was explored using hepatic contrast-enhanced ultrasound. Two suspicious lesions for HCC were detected in hepatic segments II and III, without a typical contrastographic appearance. The lesions were submitted to needle biopsy, and histological analysis identified a nodule of low-grade dysplasia in segment II and micro and macronodular cirrhosis with light activity in segment III. The patient underwent metronomic capecitabine until July 2013 when, considering the sustained CR, treatment was discontinued and the patient entered a follow-up program. The final MRI (February 2017, Fig. c, d) confirmed the CR. To date, the patient is alive and in good health. |
pmc-6020209-2 | A 66-year old man had multiple liver lesions involving approximately 70% of the right liver, multiple nodules in the left lobe, and a right portal thrombosis in the setting of non-alcoholic steatohepatitis (CT scan in August 2012, Fig. a, b). Positron emission tomography (PET) with 2-(fluorine-18)-fluoro-2-deoxy-d-glucose (FDG-PET) identified bone metastases in the proximal portion of the right femur, in the right ischial tuberosity, in the left acetabulum, in the left scapula, and in the third left costal arch. Moreover, a PET with (11)C-choline confirmed the hepatic and skeletal lesions and identified other metastases in the pelvic bones, rachis, and ribs. In October 2012, serum AFP was 1909 ng/mL. Considering the typical contrastographic pattern of the liver lesion by CT scanning and the elevated AFP level, a diagnosis of HCC was made according to European Association for the Study of the Liver (EASL) guidelines [].
In December 2012, the patient started systemic treatment with sorafenib 800 mg/bid. Ten days later, the treatment was discontinued because of G3 skin toxicity (Stevens–Johnson syndrome). In January 2013, the patient started metronomic capecitabine (500 mg twice daily, continuous administration), which was well-tolerated. In March 2013, a new CT scan showed a reduction in the number and size of the liver lesions with significant intralesional necrotic areas. Subsequent FDG-PET scanning (April 2013) showed the complete absence of pathological areas and, in parallel, AFP level had fallen to 3.3 ng/mL. In July 2013, a needle biopsy of the principal hepatic lesion evidenced fibrous connective tissue with histiocytic inflammation without tumour cells. An abdominal US scan (January 2014) revealed the presence of a single hypoechoic lesion of 1.4 × 1.3 cm. In December 2014, CT scanning showed a further size reduction of the hypodense hepatic lesion without vascular components, and it was therefore decided to discontinue treatment in the same month. CT and US images, supported by histological patterns, showed a necrotic lesion with gradual resolution (Fig. c, d). In the most recent US scan (September 2017), no hepatic lesion was detected and serum AFP was 3.6 ng/mL. The patient is currently alive and in excellent health. |
pmc-6020209-3 | A 70-year-old man with hepatitis C virus cirrhosis was diagnosed with binodular HCC in Jul 2006 and treated with RFA and percutaneous ethanol injection (PEI). From March 2008 to March 2015, the patient experienced multiple tumour recurrences, which were managed using locoregional techniques (RFA, PEI, and one course of TACE). The patient came to our attention in October 2015 following HCC progression in the VIII segment associated with an invasion of the inferior vena cava and neoplastic pulmonary embolization. Serum AFP was 18,622 ng/mL. Systemic therapy with sorafenib was started at dosage of 400 mg/die, given the patient’s poor clinical condition, and increased to 600 mg/die after 10 days. The patient started experiencing severe fatigue, diarrhoea, and dizziness, which prompted a reduction in dosage to 400 mg/die in November 2015. In February 2016, following radiological progression (tumoural invasion of the right and median hepatic veins and enlargement of the neoplastic thrombus in the inferior cava vein) and a sharp increase in serum AFP (47,137 ng/mL), the patient was switched to capecitabine therapy (500 mg twice daily, continuous administration). CT scanning performed every 3 months showed the progressive reduction of pulmonary metastases, recanalization of the median hepatic vein, and progressive improvement in inferior cava vein invasion. Moreover, the tumour mass showed a complete devascularisation (Fig. a, b). Serum AFP levels decreased to 4583 ng/mL in May 2016, 5.5 ng/mL in September 2016, 2.5 ng/mL in November 2016, and 1.5 ng/mL in October 2017.
At the time of writing, the patient is in good clinical condition and continues to receive capecitabine treatment (500 mg bid), complaining only of modest fatigue. |
pmc-6020227-1 | A 32-year-old male was referred to our hospital for elevated level of serum creatinine (Scr) (3.71 mg/dl) and proteinuria (3+) following a previous deceased cardiac donor-derived KT due to an unidentified cause of end-stage renal disease (ESRD). Laboratory workups and results of diagnostic procedures performed are summarized in Table . He underwent a successful KT 26 months ago with Scr at discharge 0.9 mg/dl with an immunosuppressive protocol consisting of prednisone, mycophenolate mofetil and tacrolimus. Renal allograft function remained stable and urine analyses were always normal from discharge to 24 months after operation. Two months prior to this admission, he was hospitalized for fever and cough at another hospital. He was diagnosed with mild pulmonary infection and treated with azithromycin and ceftazidime. His pulmonary symptoms abated after a week antibiotic treatment while his serum Scr increased and proteinuria (3+) occurred. Furthermore, his blood platelet count also decreased to 34 × 109/L. Forty days prior to this admission, a renal allograft biopsy was performed. He was managed with intravenous antibiotics and immunosuppression enhancement by increasing the dosage of mycophenolate mofetil. His Scr level decreased initially with a nadir of 1.58 mg/dl, but elevated progressively with increased proteinuria (11.38 g/24 h). He denied family history of any kidney diseases or inheritable illnesses. A repeat kidney biopsy was performed in our hospital. Written informed consent to publish this case was obtained from this patient.
Light microscopy showed multiple periodic acid-Sciff stain (PAS)-positive materials in the capillary lumens (Fig. ). Capillary wall duplication was obvious and diffuse (Fig. ). Masson trichrome stain revealed extensive fuchsinophilic deposits in the subepithelial, subendothelial and mesangial spaces (Fig. ). There were no peritubular capillaritis, endotheliatis, tubulitis nor glomerulitis, excluding the possibility of antibody and T-cell-mediated rejection. Histological signs of calcineurin-inhibitor toxicity, such as band-like fibrosis, isometric vacuolization of the tubules and hyaline deposits in the arterioles were not present.
Immunofluorescence study indicated prominent C3 positivity (3+) along the basement membrane and in the mesangium (Fig. ) in all the 6 glomeruli examined, while IgA, IgG, IgM and C1q and C4d staining were all negative.
Electron microscopy examination of 2 glomeruli showed widespread foot process effacement and electron-dense deposits in the subendothelial and subepithelial spaces (Fig. ). Furthermore, mesangial proliferation which protruded into capillary basement membrane caused the double contours observed in PAS staining. Subendothelial lucency, which is characteristic of TMA, was also present (Fig. ). No signs of chronic antibody-mediated rejection (ie. peritubular capillary multilayering), Based on these findings, a diagnosis of C3GN combined with TMA was rendered.
Retrospective review of the 1st biopsy slides (X.F.) indicated similar light microscopy findings (Fig. ). Immunofluorescence showed only prominent C3 staining with negative staining for other immunoglobulins and C4d. No electron microscopy study of the first allograft biopsy was performed.
Genetic testing for the major genes in complement pathway related with renal disease (C3, CFB, CFH, CFHR1, CFHR3, CFHR4, CFHR5, CFI, DGKE) [, ] were performed. We found two rare missense variants in compound heterozygous form, c.848A > G (p.Asp283Gly) and c.1339C > T (p.Pro447Ser) in the CFI gene (NM_000204.3) in the patient while his father and mother were found to harbor only the c.848A > G and c.1339C > T respectively (Fig. ). Both parents were phenotypically normal. This patient’s unaffected sister had neither of the 2 variants. No variants were identified in the other complement cascade protein genes commonly screened. Nevertheless, quantitative measurement of plasma CFI of the patient and his unaffected family members showed that their plasma CFI levels were all in normal range (Table ).
Our patient was treated with 2 sessions of plasma exchange, but no clinical improvement was achieved as indicated by persistent nephrotic-range proteinuria and progressive elevation of Scr. After approximately one-year follow-up, this patient was in dialysis. |
pmc-6020266-1 | Patient 1 was an 11-year old boy, the second child of non-consanguineous parents. There was no family history of bone fragility or autism. The pregnancy was normal, and the patient was delivered by caesarean section post term after failure of labour progression. He was treated in the Special Care Baby Unit for two days after delivery due to pyrexia. He was born with left-sided calcaneus talipes equinovarus and right-sided developmental dysplasia of the hip. His undescended testes were operated on successfully.
Patient 1 is developmentally delayed. He walked at 2.5 years of age and had delayed onset of speech. He had difficulties with fine motor skills and attended a school for children with special needs. This patient had a clinical diagnosis of ASD made at 5-years of age. His parents also reported ritualistic behaviours, resulting in a referral to Child and Adolescent Mental Health Services for an assessment of possible obsessive compulsive disorder.
He was noted to have previously suffered finger fractures and a decrease in vertebral height. A DXA scan to measure his bone mineral density (BMD) undertaken before commencement of bisphosphonate treatment demonstrated a reduced BMD with Z-scores of −3.4 at the lumbar vertebrae and a total body score of −2.5 when adjusted for age and gender. A bone biopsy had demonstrated low turnover trabecular osteopenia consistent with osteoporosis.
Also of note, he had diagnoses of asthma and idiopathic generalised epilepsy. He suffered from intermittent neutropenia thought to be the result of sodium valproate therapy. He received 3-monthly pamidronate infusions, remained on melatonin daily and had been prescribed midazolam, to be given in the event of a prolonged seizure.
On examination, he had bilateral low-set ears, blue sclerae and glasses due to hyperopia.
Trio whole exome sequencing (WES) in him identified a de novo missense variant in NRXN1 which is known to be associated with neurodevelopmental disorders/autism and being further investigated as it is known to interact with COL1A1. |
pmc-6020266-2 | Patient 2 was an 11-year old boy, the second child to healthy, non-consanguineous parents. There is no family history of bone fragility and autism. He was born in the breech position spontaneously at 32-weeks gestation after the pregnancy was complicated by placental abruption, causing severe abdominal pain and heavy bleeding. At birth, he weighed 1.76 kg (9th centile); he required continuous positive airway pressure for 24 h and phototherapy to treat his neonatal jaundice. He was fed via a nasogastric tube for the first week of life.
He failed to thrive throughout childhood with height and weight below the 0.4th centile and head circumference 0.4th-2nd centile, with insufficient weight gain resulting in the insertion of a percutaneous gastrostomy for nutritional support. He suffered frequent infections including bronchiolitis, pneumonia and urinary tract infections. A micturating cystourethrogram identified bilateral vesicoureteric reflux. He had consistent hypogammaglobulinaemia and lymphopenia throughout childhood with poor vaccine responses. This patient received 3-weekly immunoglobulin replacement therapy. Also of note, he had bilateral optic atrophy and consistently abnormal liver function tests.
Patient 2 had severe intellectual disability. He had delayed speech and suffers from gross and fine motor delay: he first walked at 19 months. He demonstrated significant echolalia and restricted interests; the patient had received a clinical diagnosis of ASD at 6-years of age.
He had suffered several fractures of the vertebrae, metatarsals and tibias. A bone biopsy at 7-years of age demonstrated a high rate of bone turnover and osteopenia, with marked subperiosteal bone resorption. DXA scans showed reduced bone mineral density, however it was difficult to determine the degree of reduction due to his small size. He received 3-monthly pamidronate infusions.
The patient had undergone numerous investigations throughout his life to provide an explanation for his clinical features. Trio WES identified that patient 2 is compound heterozygous for c.3010C>T and c.5741G>A pathogenic mutations in the NBAS gene (). He had been diagnosed with SOPH syndrome (Short Stature, Optic Atrophy, Pelger-Huet anomaly), which largely explains the patient's clinical picture. On examination, he had short stature and high pitched voice. Facial dysmorphism included a prominent forehead, low set ears, hypertelorism, proptosis, progeric appearance to his skin and up-slanted palpebral fissures. |
pmc-6020266-3 | Patient 3 was a 4-year old boy, the third child of healthy, non-consanguineous parents. There was no family history of bone fragility or autism. Bowing of the lower limbs observed on the anomaly scan raised antenatal suspicion of a campomelic dysplasia. The patient was born by normal vaginal delivery at term. He weighed 3.74 kg (50th centile) with a head circumference of 34 cm (25th centile). He suffered mild respiratory distress at birth but did not require ventilatory support.
A skeletal survey performed after birth demonstrated a normal thoracic cage volume, bowing of the long bones with abnormal metaphyses and a fractured ulna. The patient suffered fractures to his left humerus and right forearm. He was subsequently diagnosed with severe osteogenesis imperfecta.
By 4-years of age, he had suffered multiple fractures of his ulnas and humeri, a femoral fracture and multiple vertebral wedge fractures. He has undergone bilateral osteotomies and rodding of his femurs and tibias at 2 and 3 years of age, respectively. He received 3-monthly pamidronate infusions.
This patient was developmentally delayed, sat independently from 2 years and walked with aids from 2.5 years of age. He had delayed speech and required intervention from speech and language therapists at age 21 months. He has demonstrated “rocking” behaviour from 2.5 years of age but did not have a clinical diagnosis of ASD before recruitment to the study.
On genetic assessment, he was noted to have a ‘triangular’ face, blue sclerae, high-pitched voice in keeping with a diagnosis of ‘Classical OI’. He went on to have testing for COL1A1/A2 and was found to have a pathogenic c.902G>A variant in COL1A2. This pathogenic mutation is predicted to replace glycine at position 301 with a glutamic acid. Glycine substitutions are well-recognised as a cause of OI. This confirmed his clinical diagnosis of OI. |
pmc-6020266-4 | Patient 4 was a 14-year old male, the only child born to non-consanguineous parents. His younger half-brother (through same mother) had learning difficulties but there was no other family history of autism. The pregnancy was normal with delivery by caesarean section at 39 weeks due to a breech presentation. He had a birth weight of 3.54 kg (65th centile). He needed oxygen shortly after delivery but was not admitted to the Special Care Baby Unit. He had global developmental delay: no head control was evident at 4 months; sitting was achieved at 2 years of age; the patient walked at 4.5 years and currently uses a wheelchair. He spoke his first words aged 7 years. He was doubly incontinent and has learning difficulties; he attended a school for children with special needs. He was diagnosed with ASD at 5-years of age, before recruitment to the study after demonstrating little eye contact and having restricted interests. He had previously engaged in self-harm behaviour such as head banging and biting.
Patient 4 had suffered from a fractured forearm and vertebral wedge fractures. He had been given a diagnosis of probable primary osteoporosis, suffering discomfort in his back and lower limbs. DXA scanning undertaken before commencing 3-monthly pamidronate infusions demonstrated a reduced BMD when adjusted for age and gender of −2.6 at lumbar vertebrae 2–4 and a total body measurement of −2.7. He had joint hypermobility and brittle nails.
This patient was diagnosed with bilateral femoral proximal anteversion, which was operated on with a derotation osteotomy. He demonstrated ligamentous laxity and suffered a leg length discrepancy. The patient had a small scrotum and incomplete descended testes. He also had left sided choroidal coloboma and myopia.
On examination, he was not dysmorphic. So far WES in him has not identified any variants of significance and further genetic analysis is ongoing. |
pmc-6020266-5 | Patient 5 was a 13-year old male, the first child to healthy, non-consanguineous parents. There was a family history of osteoporosis in his maternal grandfather but no family history of autism. The pregnancy was not planned and was not detected until approximately 25 weeks. No scans were performed. He was born at term and was immediately well after birth.
His initial development was normal, with gross motor milestones being achieved as expected: he sat up aged 6 months and walked at age 8 months. His speech was delayed; he started speaking at 5 years of age after receiving speech therapy. He was diagnosed with ASD at 3-years of age after concerns were raised at his toddler group. The patient attended a school for children with special needs.
He had suffered three fractures: two of his forearm and one of his wrists. Additionally, he had suffered from multiple crush fractures of his thoracic and lumbar vertebrae. The small joints of the fingers were hypermobile, but there was little evidence of hypermobility elsewhere. DXA scans undertaken before commencing bisphosphonate treatment demonstrated reduced BMD, with Z-scores of −2.7 at the lumbar vertebrae and − 2.6 total body measurement when adjusted for age and gender. He had a diagnosis of idiopathic osteoporosis with a bone biopsy at 12-years of age demonstrating severe low turnover cortical and trabecular osteopenia. The patient received 3-monthly infusions of pamidronate.
On examination, this patient was not dysmorphic. WES identified a maternally inherited PLS3 pathogenic variant which explained his bone fragility. |
pmc-6020266-6 | Patient 6 was an eight year old boy, the second child of healthy, non-consanguineous parents. There was no family history of bone fragility or autism. Shortened long bones were identified on the 16-week scan and the child was delivered by caesarean section at 37-weeks. At birth, he needed ventilation with a bag and mask. He was born with fractures of all the long bones and multiple ribs: he was diagnosed with severe OI antenatally. The patient was treated in the special care baby unit for three months; he was fed via a nasogastric tube and suffered from gastroesophageal reflux.
He developed a right sided inguinal hernia shortly after birth which was surgically corrected at one month of age. He also suffered from fusion between the base of his skull and top of his spinal column. Throughout his life, he had suffered multiple long bone fractures, including several femoral fractures and fractures of his radii. He had undergone several surgical procedures, with bilateral femoral and tibial rodding procedures undertaken at 4 and 5 years of age, respectively. His bone fragility was managed with 3-monthly infusions of pamidronate.
He was developmentally delayed: he started talking between two and a half and three years of age and started to “commando crawl” at 3 years of age. He had never walked. The patient attended a mainstream school after starting a year later than his peers. He did not have a previous diagnosis of ASD.
On examination, he had short stature, blue sclerae, triangular face and dentinogenesis imperfecta. There were marked deformities of his long bones, resulting in a pes cavus appearance. Genetic testing showed that he carried a de novo pathogenic variant in COL1A1 c.2282G>A in exon 33/34 confirming his clinical diagnosis of OI. |
pmc-6020266-7 | Patient 7 was a 6-year old boy, second child of healthy, non-consanguineous parents with no significant family history. His sister was said to have a seizure disorder of unknown aetiology but there was no family history of autism. Antenatally, there were concerns with short long bones and bowed femur and he was born at term with a normal birth weight. He was noted to have multiple fractures and commenced on treatment with pamidronate with a good response. He was noted by the therapy team to have autistic traits and recruited to the study. He fulfilled the criteria for a diagnosis of autism. On examination, he had a triangular face, blueish sclerae, high-pitched voice, dentinogenesis imperfecta, significant limb deformities and scoliosis. Genetics analyses revealed normal microarrays and a pathogenic variant was identified in COL1A2 confirming his clinical diagnosis of OI. c.2533G>A mutation in exon 37 of COL1A2 gene, this pathogenic mutation is predicted to replace glycine at position 845 with an arginine and has previously been reported in individuals with OI confirming his diagnosis. |
pmc-6020284-1 | We describe the case of a female infant. She was the second child born to a 33-year-old, gravida 3, para 2 mother. The patient was born polyhydramnios by cesarean section at 37 + 4 weeks of gestation with a birth weight of 2440 g (− 1.1 S.D.), a length of 50 cm (+ 0.80 S.D.) and an occipitofrontal circumference of 36 cm (+ 2.0 S.D.). The 1- and 5-min Apgar scores were 8 and 8, respectively. Shortly after birth, she required nasal continuous positive airway pressure (nCPAP) and presented with dyspnea. During the following days, she developed dyspnea continually and needed oxygen to maintain 90–95% saturation. Parenteral nutrition was started on day 1 and breast milk was given 12 h after birth by oral tube. Her parents were nonconsanguineous and her mother had a healthy 13-year-old child. She denied any family history of neonatal disease. Prenatal examination was not found abnormal. Additionally, she denied that she had consumed alcohol, drugs, tobacco, or any other toxic substances during her pregnancy.
On admission to our unit, the patient was 3 days old and weighed 2400 g. Clinical examination showed choanal atresia, bilateral low-set ears, triple restriction and systolic murmur, but coloboma was not observed. Her motor development was almost normal. The patient presents feeding difficulties by nasogastric tube. Her white blood cell count was 12.07 × 109/L (neutrophils, 0.50; lymphocytes, 0.24), and her platelet count was 160.00 × 109/L and CRP < 1 mg/L. The alanine aminotransferase level was 14 U/L, aspartate aminotransferase level was 43 U/L, and gamma-glutamyltransferase level was 68 U/L. On the seventh day of age, her thyroid functional parameters were TSH 5 mIU/L, T3 1.83 nmol/L and T4 123.94 nmol/L, and at the first month of age, thyroid functional parameters were TSH > 100 mIU/L, T3 1.57 nmol/L and T4 35.93 nmol/L. Thus, oral Euthyrox (Levothyroxine sodium tablets) was administered. Newborn screening for metabolic disorders and severe combined immunodeficiency was normal. A chest radiograph showed haziness in both lung fields suggestive of wet lung (Fig. ). Two-dimensional and color-Doppler assessment was revealed an atrioventricular septal defect (6.8 mm + 2.2 mm), patent ductus arteriosus (3.6 mm) and pulmonary hypertension (Fig. ). A craniocerebral ultrasound showed bilateral lateral ventricle dilatation (Fig. ). The auditory brainstem response (ABR) test showed bilateral severe hearing impairment (ABR > 99 dBnHL). Following radiologic testing by computed tomography showed bilateral choanal atresia and insufficient inflatable structure of both semi-circular canals. (Fig. ). No clinical characteristics of CHARGE syndrome were detected in the patient’s parents. Chromosomal analysis indicated a 46 XX normal female karyotype.
The patient required mechanical ventilation with endotracheal intubation at 4 days of age. On 17 days of age, she was extubated to nCPAP with FiO2 < 25%. On 20 days of age, she needed an oxygen mask. Ampicillin was discontinued when the blood culture from birth was sterile at 72 h. At the first month of age, the patient had a posterior nostril plasty operation by nasal endoscope and had a silicone tube in one month for transition the postoperative (Fig. ). At the second month of age, she had patent ductus arteriosus ligation surgery. At the 4th month of age, she was discharged from the hospital. Clinical features summarized in Table .
Molecular analysis of the disease-associated genes CHD7 and EFTUD2 were performed using the Illumina TruSigt One sequencing panel (Illumina, San Diego, CA, USA) on the MiSeq NGS platform for mutation screening methods (Sinopath Diagnosis, Beijing, China) []. Genomic DNA was extracted from peripheral venous blood and informed consent was obtained from the parents. The study was approved by the ethics committee of Zhejiang University Children’s Hospital. To identify presumably pathogenic single-nucleotide variants, we used NextGene V2.3.4 (Softgenetics, State College, PA, USA) compared with the UCSC database. We excluded sequence variants with a minor allele frequency > 0.05, in the Human Genetic Variation Database () and the NHLBI Grand Opportunity Exome Sequencing Project (ESP6500, ). This analyses identified a monoallelic (thymine) insertion in CHD7, NM_017780.3 (CHD7 c.4656dupT), which was confirmed by Sanger sequencing. This mutation leads to a reading frameshift mutation starting from isoleucine, with the new reading frame ending p.(Ile1553fs) (Fig. ). As shown in Fig. , the mutation is located in exon 20, and this mutation was not present in the Human Gene Mutation Database (/) or ClinVar (),[] suggesting that it is novel. This heterozygous frameshift mutation was not detected in the patient’s parents, suggesting that it is a de novo mutation. |
pmc-6020304-1 | A 71-year-old Caucasian woman was treated in our Gamma Knife center for a meningioma of the sphenoid jugum. The treatment was performed with Leksell Gamma Knife Icon® (Elekta Instruments, Stockholm, Sweden) and was planned as a hypofractionated irradiation including five daily fractions of 5 Gy. The restraint method chosen was the use of a thermoplastic mask Orfit® (Orfit Industries, Wijnegem, Belgium) [, ]. The mask was made 5 days before the first irradiation. During mask making, the mask was warmed by soaking in a water bath and then applied and molded directly on our patient’s face for 20 minutes (Fig. ). At this step of the procedure, she complained of a burning and tingling sensation on her face, especially on her forehead. During the following 4 days, she continued to have a stable cutaneous reaction in the form of redness, tickling, and edematous swelling of her face. She was treated with a local antihistamine cream on her face, with moderate improvement in the symptoms. On the first day of treatment, during the first irradiation session, she complained again of a major sensation of burning and edema of the face. A clinical examination showed a serious allergic reaction on her face, associated with an atopic edema. She was treated with 125 mg of intravenously administered corticoids, followed by high doses of orally administered antihistamines and corticoids during the following 5 days. With this medication, the allergic reaction was controlled until the end of treatment 4 days later. During all irradiation fractions we kept using the thermoplastic mask but we inserted a thin sheet of paper between the internal surface of the mask and our patient’s forehead to reduce the surface area of contact between the mask and our patient’s skin. |
pmc-6020350-1 | A 43-year old, asymptomatic woman was admitted to our hospital by her family doctor after receiving a chest-x-ray during routine clinical examination. The x-ray showed a mediastinal mass overlapping the aortic arch region (Fig. ). For verification a computed tomography (CT) was performed and revealed incidentally a type B dissection, which was most likely chronic without information of the index date, originating from an aneurysm of a left cervical arch with a maximum diameter of 6 cm (Fig. ). The left renal artery, the coeliac trunc and the main part of the superior mesenteric artery branched from the false lumen without a sign of malperfusion of the organs. Because of the huge diameter and the potential risk of rupture, an urgent surgical repair was planned. Before intervention the patient got a blood pressure adjustment by ACE inhibitor. Betablocker was not necessary because of a resting pulse under 60 beats per minute. For neurological online monitoring, sensitive and motor evoked potentials were monitored. Spinal drainage was installed 1 day before the procedure. Surgical access was carried out through median sternotomy and an additional left lateral thoracic incision through the fourth intercostal space (Hemi-Clemshell). Simultaneously to the preparation of the aneurysm, partial cardiopulmonary bypass was installed in the left groin by cannulation of the femoral artery and vein under echocardiographic guidance. During selective ventilation of the right side, the left lung was mobilized by transsection of the Ligamentum pulmonale and preparation of the perianeurysmatic tissue and adhesions. After identification and preparation of the recurrent and phrenic nerve and the supraaortal branches, the descending aorta was clamped and a distal anastomosis performed with a straight graft (20 mm). The visceral arteries partially branched from the false and true lumen without a sign of malperfusion. Before the final distal anastomosis, we performed a fenestration of the dissection membrane about a length of 5 cm to keep the perfusion of both lumina. The left carotid artery originated from the aortic arch with a distance of only 1 cm from the aneurysm. The left axillary artery branched directly from the aneurysm and was dissected and reimplanted with a separate 8 mm sidegraft to the 20 mm straight graft between the distal arch and proximal descending aorta. (Fig. ). The procedure was performed with partial cardiopulmonary bypass (CPB) of 87 min, aortic clamp time of 62 min under normothermic condition. The patient was extubated on first postoperative day and recovered well.
Biopsy of aortic tissue showed a picture consistent with arteriosclerosis and loss of smooth muscle cells, rupture of the elastic fibres and fibrosis of the media. The intima could not be visualized in detail.
The patient was discharged to cardiac rehabilitation at 13th postoperative day and recovered well. Last follow up with computed tomography was performed 3, 5 years after initial operation with a good and stable result of the dissection membrane and a perfusion of both lumina. The patient is able to resume a normal life without limitations. |
pmc-6020361-1 | A 29-year-old Asian man who had undergone surgical debridement at another hospital for a perianal abscess 5 days earlier was referred to the emergency room of Xiamen Chang Gung Hospital. The patient presented with continuous severe perianal and scrotal pain, scrotal swelling, and high fever (39.2 °C) of 3 days’ duration that had been aggravated for 1 hour. The patient was mildly obese, described himself as otherwise quite healthy, and had never been admitted to a hospital previously. He reported no significant chronic medical history, such as primary hypertension, any type of heart disease, disturbed microcirculation, peripheral neuropathy, diabetes mellitus, an impaired immune system, malignancies, leukemia, long-term administration of corticosteroids, liver cirrhosis, renal failure, urinary tract infection, or hemodialysis. The patient also reported no history of infectious diseases, such as tuberculosis, any type of hepatitis, or acquired immunodeficiency syndrome (AIDS). The patient’s medical history revealed no trauma, blood transfusion, other surgical procedures, or other serious event. He had not lived in an epidemic area and had no contact history of toxicity or radioactive exposure. The patient denied a family history of any inherited cancer. He did not smoke or consume alcohol and reported no other unhealthy lifestyle behaviors. The patient was a businessman by occupation and traveled for business most of the time.
A general physical examination on admission revealed that the patient was hypotensive (blood pressure, 92/63 mmHg) and tachycardic (heart rate, 117 beats/minute). No positive signs were found during the neurological, cardiopulmonary, and abdominal examinations. Neither pain around the kidney area with percussion nor tenderness along the bilateral ureteral approach was found. No bulging, tenderness, or mass was evident in the bladder area. A genital examination revealed a normal distribution of pubic hair and normal penile development without deformity, prepuce, penile ulceration, tenderness, induration, or neoplasms. No ectopia or secretions were found at the urethral orifice. A perianal abscess and hemorrhoids were identified upon full perineal examination (a previous surgical wound with obviously inflammatory secretions was detected 2.0 cm from the anal edge and approximately 1.5 × 2.5 cm in size), and the patient’s rectum was noted to be very tender. Furthermore, the scrotum was gangrenous with extensive cellulitis of the perineum and bilateral inguinal area and an increased skin temperature. No clear findings were obtained by palpation of the bilateral testis and epididymis.
Following a rectal examination, the patient rapidly became sweaty and unwell, and his scrotum became blue, swollen, and tense, with erythema extending into both groins. Crepitations between the skin and fascia were palpable. The patient noted a concomitant deterioration in his urinary stream and a degree of hesitancy. His white blood cell, red blood cell, and platelet counts were 23.1 × 109/L, 4.11 × 1012/L, and 112 × 109/L, respectively. Upon admission, his hemoglobin was 123 g/L, his ST-segment elevation was 84.0%, and his C-reactive protein level was 275.55 mg/L. The results of serology for both liver and renal function were normal. His coagulation and electrolyte profiles were normal. Computed tomography of the lower abdomen and pelvis (Additional files and ) revealed extensive emphysema around the testicles, epididymis, and perineal subcutaneous tissues. A diagnosis of FG complicating a perianal abscess was made.
The patient underwent aggressive fluid administration, hemodynamic support, and intravenous antibiotic therapy. He was treated with immediate surgical debridement under general anesthesia (Fig. ). Tissue cultures were obtained to isolate the responsible microorganisms. The necrotic skin in the scrotum and the perianal region was evacuated into an open drainage area using three incisions, leaving both testes exposed (Fig. ). There was no damage to the testicles, spermatic cords, or external sphincter.
Blood and aerobic and anaerobic bacterial cultures were performed. Microorganisms were not found in the blood cultures. Tissue samples taken during the first two debridements revealed that the microbiological etiology of FG was polymicrobial. Aerobic Streptococcus agalactiae, Staphylococcus haemolyticus, and Escherichia coli as well as anaerobic peptostreptococci and Prevotella corporis were detected. Preoperative antibiotic treatment with combined broad-spectrum antibiotics (metronidazole 0.5 g every 8 hours and ceftriaxone 1 g every 12 hours for 6 days) was initiated and later adjusted to the culture sensitivity of the microbial isolates. The patient was therefore intravenously administered levofloxacin (0.3 g every 12 hours for 5 days).
The patient’s white blood cell count and C-reactive protein level gradually decreased. On the third postoperative day, his white blood cell, red blood cell, and platelet counts were 6.6 × 109/L, 4.54 × 1012/L, and 190 × 109/L, respectively. His hemoglobin was 135 g/L, his ST-segment elevation was 64.0%, and his C-reactive protein level was 100.24 mg/L. He had no fever thereafter.
Local wound care was administered using moist gauze dressing (i.e., normal saline) and was changed three times per day until healthy granulation tissue was observed. The patient underwent two subsequent surgical debridements. His infection gradually subsided, his gas gangrene resolved completely, and good granulation was present 1 week after surgery. Because both testicles were severely exposed, they were transpositioned into the scrotum on the eighth postoperative day. Split-skin closures (3-0 nylon suture) and open drainage from the scrotum and perianal area were subsequently performed (Fig. ). The patient was discharged on the 11th postoperative day (with antibiotics adjusted to oral administration of levofloxacin 0.1 g twice daily).
The patient attended the outpatient department four times for follow-up. The bilateral scrotal wounds healed, and the stiches were removed on the 18th postoperative day (the first follow-up). The viability of both testicles was confirmed using Doppler ultrasound on the 21st postoperative day (the second follow-up) and at 3 and 10 months after discharge (the third and fourth follow-up examinations). The open drainage area from the scrotum and perianal area had healed at 10 months after discharge. The patient was healthy as usual, with no complaints or illness. His complete cell count and serum parameters of liver and kidney function were normal. |
pmc-6020389-1 | A 24-year-old Sri Lankan man developed fever, profuse vomiting and diarrhoea followed by reduced level of consciousness over a 12-h duration. He had myalgia, arthralgia and frontal headache. He did not have photophobia, phonophobia, skin rash, fits, cough or urinary symptoms. He did not have any bleeding manifestations. He did not smoke tobacco or consume alcohol. There was no history of illicit drug abuse or high risk sexual behavior. He had been previously diagnosed with mild intermittent bronchial asthma.
On examination, he was febrile (101.3 °F), drowsy with a Glasgow coma scale of 11/15. There were no skin rashes or lymphadenopathy. No focal signs were noted in the neurological examination and fundoscopic examination was normal. His Pulse rate was 112 bpm; blood pressure was 100/60 mmHg with no postural hypotension; respiratory rate was 14/min. Rest of the general and systems examinations were normal.
His full blood count on admission showed white blood cells of 6 × 109/L (Normal range [NR] 4.0–11.0 × 109/L) with neutrophils of 59%; haemoglobin 14.3 g/dL (NR 13.5–16.5 g/dL) and platelet count of 74 × 109/L (NR 150–450 × 109/L). Erythrocyte sedimentation rate was 13 mm in first hour and C-reactive protein was 63 mg/l (NR < 5 mg/L). Serum electrolytes were normal with mild impaired renal function. Liver enzymes were elevated, alanine aminotransferase was 303 U/l (NR < 50 U/L) and aspartate aminotransferase was 482 U/l (NR < 50 U/L) with a total bilirubin of 10.6 µmol/L (NR 5–21 µmol/L). His urine analysis and coagulation profile were normal. Non-contrast CT brain demonstrated cerebral oedema. Lumbar puncture was precluded by a low platelet count.
Based on a working diagnosis of encephalitis, he was commenced on intravenous meropenem, vancomycin, aciclovir and dexamethasone, but were subsequently omitted once the diagnosis became evident.
On further investigation, dengue IgM antibody in serum was positive on day 6 of fever. Blood and urine cultures did not yield any microbial growth. Electroencephalography showed generalized slow wave activity. The cranial MRI showed an isolated ovoid hyperintensity in the splenium of the corpus callosum with homogeneous hyperintense signal on diffusion-weighted imaging (DWI) (Fig. ). A diagnosis of reversible splenial lesion syndrome (RESLES) was suspected based on the MRI appearance.
Standard dengue monitoring of vitals, urine output, haematocrit and platelet count were done. His platelet count dropped to a nadir of 31 × 109/L, but subsequently increased. The white cell count steadily increased to 14 × 109/L and then stabilized around 7 × 109/L. Fluid leakage was not detected on repeated ultrasound scanning during the acute phase of illness.
He was discharged from hospital on the tenth day of illness with complete clinical, heamatological and biochemical recovery. Follow–up cranial MRI done 1 month later showed complete resolution of the splenial lesion (Fig. ). |
pmc-6020456-1 | A 26-year-old woman presented to a local dentist due to right mandible pain. She did not complain of any other manifestations, and she had no pertinent past medical history. She was diagnosed with periapical periodontitis, which is an infection of the dental pulp with an apical lesion, of the right lower first molar. She subsequently underwent a root canal therapy. However, she also complained of swelling of the right mandibular region. Since her symptoms had been worsening for 4 months, she was referred to our hospital for further examination and treatment. At our hospital, facial conditions revealed right mandibular swelling and tenderness. Oral conditions showed no percussion and occlusal pain of teeth in the swelling region, and tooth mobility, gum swelling, and gum redness were not seen. Hence, there was no dental infection that could cause osteomyelitis/osteitis. Blood samples were unremarkable with no signs of inflammation.
Orthopantomogram showed sclerotic change at the right body of the mandible with periosteal reaction (). Plain computed tomography (CT) showed sclerotic change at the right body of the mandible with periosteal reaction and spotted osteolysis was seen in the cortex of the mandible (). On magnetic resonance imaging (MRI), the right body of the mandible showed low signal intensity on T1-weighted images and high signal intensity on short tau inversion recovery (STIR) images with perilesional soft tissue swelling (). Bilateral palatine tonsils and reactive lymphadenopathy were also seen. These findings indicated active mandibular osteomyelitis/osteitis without odontogenic infection. At this time, the possibility of SAPHO syndrome was considered. Detailed medical interview found that she had a history of palmoplantar pustulosis (PPP) for about 1 year, which was treated at a local dermatology clinic. To investigate the presence of other osteoarticular involvement, technetium-99m hydroxymethylene diphosphonate (99mTc-HMDP) scintigraphy was performed, which demonstrated diffuse increased uptake at the right mandible, as well as in the sternum and the sternocostoclavicular joints (). These characteristics of clinical and radiological manifestations led to the diagnosis of SAPHO syndrome.
Tonsillectomy was performed for PPP, and bone biopsy of the right mandible was simultaneously performed. Histopathological examination showed enlarged and sclerotic bone trabeculae with little inflammatory cell infiltration, which was compatible with SAPHO syndrome ().
She was treated with salazosulfapyridine 1000 mg/day and nonsteroidal anti-inflammatory drugs as needed, and the pain resolved. Thus far, after a 5-month follow-up period, she has not experienced recurrence of pain. |
pmc-6020462-1 | We present a 30-year-old female patient, who was admitted with low back pain and generalized body ache for 2 months prior to presentation; it was excruciating pain especially during nighttime and not much relieved by simple analgesics. The patient has a history of poor appetite with weight loss of about 4-5 kg in a span of 3 months, otherwise had no pulmonary symptoms. She is a nonsmoker and has no past medical illnesses.
Upon physical examination, the patient had bilateral discrete small cervical and axillary lymphadenopathy, and the breast examination was normal. Other systemic examination was not significant.
During routine workup in emergency, a chest X-ray was done, which was suggestive of bilateral fluffy hilar opacities (), and a CT thorax was done (Figures and ), which was suggestive of scattered areas of multifocal consolidation noted in the left lung and areas of scattered mosaic perfusion noted in the subpleural region, small nodules are also noted in the right lung, and both hila are prominent. The bone window shows multiple sclerotic bony lesions in the vertebra of variable sizes. There is no evidence of any collapse of the vertebra. The spinal canal diameter is normal. No spinal canal stenosis was seen.
Blood investigation showed normal CBC, electrolytes, urea, creatinine, and calcium, ESR was elevated 50 mm/hr, and high alkaline phosphatase (ALK) (224 U/L; normal 40–150 U/L), and other bone tumor markers were not done as not available.
Ultrasound (US) neck showed bilateral cervical lymphadenopathy; right-side nodes are noted, the largest of which measures 21 × 10 mm in size. Left-side nodes are noted, the largest of which measures 12 × 9 mm in size, and US breast examination was normal.
Whole-body PET scan () showed progressing pulmonary consolidations and nodules compared to the CT, multiple osseous involvements, generalized, metabolically active lymphadenopathy involving supra- and infradiaphragmatic regions, and hepatomegaly with solitary hepatic lesion.
Axillary lymph node biopsy was done, and the histopathology finding is most consistent with metastatic lung adenocarcinoma. The immunohistochemical (IHC) profile is most consistent with lung primary. Breast, ovary, and biliary tract are excluded by additional IHC with appropriate controls, which is positive for Napsin A and is negative for GATA-3.
Patient was referred to Cancer Centre for further plan of management. Patient started on chemotherapy with crizotinib 200 mg BID and denosumab 120 mg·q 4 weekly subcutaneous with good response according to the new PET scan (). As compared to the previous PET scan 7 months before, there is favorable treatment response, metabolic resolution of previously seen left lung uptakes and lymph nodes above and below the diaphragm and metabolic resolution of bone metastases with increasing sclerosis also denoting favorable response. |
pmc-6020476-1 | A 51-year-old female had an injured left foot by falling down from home stairs. The next day, she was admitted to our hospital and was diagnosed with closed tongue-type calcaneal fracture (). Operation was performed using 2 pins of the Steinmann pin by the Westhues method (). A fixed cast and 2 pins were removed at the same time on the 37th postoperative day, and there was no potential for infection at that time. Nevertheless, she was admitted to our hospital with a complaint about heel pain and fever exceeding up to 40 degrees centigrade, after 9 days from the pin removal.
On the examination, skin redness, swelling, and pus-like discharge were observed around the surgical site (). Plain X-ray showed hyperpermeability of the calcaneus, and magnetic resonance images confirmed a diagnosis of osteomyelitis of the calcaneus as well as an abscess formation (). White blood cell count (WBC: 9.9 × 103/μl) and C-reactive protein (CRP: 10.06 mg/dl) were elevated. And methicillin-sensitive Staphylococcus aureus (MSSA) was cultured from the discharge.
Intravenous antibiotic therapy was administrated immediately (cefazolin 2 g × 3/day), and the next day, the patient underwent irrigation of the surgical site and surgical pus drainage. Fever fell down, and inflammatory aspects disappeared within few days; however, the discharge from the drainage continued on 7 postoperative days. MSSA was cultured again from the discharge, so that we can diagnose whether calcaneal osteomyelitis was not cured completely. 12 days after the 2nd surgery, the patient underwent radical debridement of the calcaneal bone marrow using Ollier's lateral approach and irrigation with natural saline was performed. Subsequently, calcium phosphate cement (CPC) (Hoya Medical, Tokyo, Japan) with vancomycin was implanted at the defected site of the calcaneus (). MSSA was also cultured positive from the bone marrow of the calcaneus. Intravenous antibiotic therapy was continued for 7 days, and it was changed to antibiotics per oral (minomycin 200 mg × 2, rifampicin 450 mg × 1) and continued for 30 days. CRP turned negative on the 10th postoperative day, and the pin tract's fistula was completely closed on the 14th postoperative day. Osteomyelitis seemed to be controllable, and 1/3 partial weight bearing was started from 14 postoperative days. Weight bearing was raised every 1 week as 1/2 and 2/3, and full weight bearing had been completed on the 35th postoperative day. On the 6th postoperative month, fistula was completely closed and there was no recurrence of infection (). The patient could walk normally without a cane, and we considered that complete remission of osteomyelitis was obtained. |
pmc-6020478-1 | This 72-year-old gentleman presented with a 6-week history of haematuria and underwent a computed tomography (CT) scan that revealed a left renal tumour suggestive of RCC. His comorbidities included type 2 diabetes mellitus and hypertension. He had no family history of any malignancy. He was a life-long nonsmoker and his Eastern Cooperative Oncology Group (ECOG) performance status was 1. He underwent left partial nephrectomy and histology revealed this to be a locally advanced clear cell RCC, Fuhrman grade 2, with involvement of 3 out of 20 lymph nodes (pT3A N1 M0). Postoperatively, he developed ESRD and was started on dialysis 3 times/week. Two years later, he developed a local recurrence in the left kidney and underwent left radical nephrectomy. Histopathology revealed a 5 cm, clear cell carcinoma, Fuhrman grade 2 with invasion of the perinephric fat and renal vessels. He remained on regular follow-up and unfortunately 2 years later he developed further disease progression with a renal bed recurrence along with multiple bone and lung metastases. He received high-dose palliative radiotherapy to the renal bed 40 Gray in 20 fractions followed by commencement of systemic treatment with dose-reduced pazopanib. The dose of pazopanib was reduced to 200 mg daily due to his poor ECOG performance status of 3 and ongoing renal dialysis. Unfortunately, follow-up CT scan 3 months later showed significant disease progression in the renal bed, bone, and lung metastases. He also developed significant pain (score 8 out of 10) over his left loin secondary to the renal bed metastatic deposit.
He was started on nivolumab 3 mg/kg initially and later switched to 240 mg flat dose intravenously every 2 weeks. He tolerated the treatment extremely well with no grade 2-4 toxicities. Clinically, there was a significant improvement in his pain control with a reduction in his pain score from 8/10 to 3/10 and his ECOG performance status improved to 2. Follow-up CT scans showed a partial response as per response evaluation criteria in solid tumours (RECIST) version 1.1. There was a significant reduction in the size of lung and renal bed metastases (Figures and ). He remains on nivolumab 22 months from initiation of treatment with serial imaging showing ongoing response. |
pmc-6020480-1 | At the 30th gestational week, a 41-year-old (gravida 2, para 1 [normal vaginal delivery]) woman with no remarkable medical/family histories was referred to us because of fetal cardiomegaly detected on routine prenatal ultrasound. Fetal ultrasound revealed the absence of ductus venosus (DV) with the UV directly draining into the right atrium (), consistent with the extrahepatic drainage type of ADV. The cardiothoracic area ratio was 36.5%, within the normal range of <40% () and heart valve regurgitation was absent. No cardiac structural abnormalities were detected, and cardiac functional parameters were normal. The parents did not desire fetal karyotyping, and, thus, amniocentesis was not performed. Direct UV flow into the systemic venous circulation (the right atrium) usually causes volume overload of the right heart, and thereby right heart failure, whose signs were carefully monitored, but they were not observed.
At 38+3 weeks, she showed the spontaneous onset of labor and vaginally gave birth to a 3,096-gram male infant (Apgar score 7/8 [1/5 min]). Neonatal cardiac ultrasound revealed mild aortic valve regurgitation and a slightly decreased ejection fraction, which were transient and disappeared on day 7. Detailed ultrasound examination revealed a defect of the hepatic rectangular leaf (S4: one of the largest liver leaves) at half a month postnatally. No findings indicative of liver dysfunction were observed throughout his course. Computed tomography at 1 year of age revealed atypical liver rotation with a Morgagni hernia in the liver (). He showed normal development at 1.5 years of age. |
pmc-6020481-1 | A 4-year-old boy was transferred to our pediatric intensive care unit from an outside hospital for further management of a persistent seizure disorder of unknown etiology. A right femoral triple lumen central venous line (CVL) had been placed prior to transfer. Five days after arrival, the patient began to exhibit increased swelling in his right lower extremity, and ultrasonography revealed a catheter-related, acute occlusive deep venous thrombosis in the right common femoral vein. He was started on LMWH (enoxaparin) at 1 mg/kg for a planned course of 3 months. Five days after initiating treatment, the CVL was removed. The patient had no personal or family history of thrombophilia or bleeding diathesis. His anti-Xa level, checked after the second dose, was within the therapeutic range.
His hospital course was complicated by multisystem organ failure in the setting of drug reaction with eosinophilia and systemic symptoms (DRESS) syndrome secondary to anticonvulsive therapy. One week after starting LMWH heparin, the patient experienced gross hematuria. The next day, the injection sites were noted to be slightly oozy, and, in the setting of his anti-Xa levels continuing to rise (0.87), LMWH heparin was held. He required continuous venovenous hemofiltration, during which time anticoagulation was switched to unfractionated heparin. After renal recovery, LMWH therapy was restarted at a lower dose (70% of original dose), but his anti-Xa levels continued to be labile and difficult to control. Eventually, a steady regimen was found with consistently stable and therapeutic anti-Xa levels ().
On the 15th day of this regimen, however, he developed signs of bowel obstruction with new onset of copious bilious vomiting. An abdominal ultrasound found a small amount of fluid in the pelvis. A CT of the abdomen and pelvis showed a high-grade small bowel obstruction, with 2 areas of small bowel, suspicious for intussusception (Figures and ). The patient's hemoglobin was found to have dropped from 9.9 to 6.2.
He was brought to the operating room for exploratory laparotomy. Intraoperatively, bloody ascites and multiple dilated loops of small bowel were found. Approximately 30 cm of the distal jejunum was found to be tense, heavy, firm, and discolored with a blue hue, with a hematoma that had dissected through the layers of the bowel (). A serosal defect was found on the antimesenteric border of the involved bowel, likely causing the bloody ascites. As the bowel was severely compromised, a resection of the involved segment was performed.
Pathologic analysis of the resected bowel showed an extensive, 35 cm submucosal hematoma causing internal bulging of the mucosa and submucosa, causing attenuation and focal pressure necrosis of the muscularis propria. The serosa was noted to be diffusely purple-red, with a small ovoid defect that was presumably caused by the hematoma. At both ends of the resected bowel, there was evidence of the mucosa and submucosa bulging into the lumen of the bowel as a result of the hematoma.
The patient recovered from the operation in the pediatric ICU with no further episodes of emesis or signs of bowel obstruction. He was restarted on LMWH 5 days later and completed his 3-month course without any further signs of bleeding. He was discharged from the hospital 3 weeks later with resolution of his seizures to a rehabilitation facility, without any further complications of bleeding or bowel obstruction. |
pmc-6020486-1 | 40-year-old male patient was referred to our department with two-month history of ocular focusing deficit without any signs or symptoms suggestive of thyroid dysfunction. Past illness or family history did not reveal any presence of thyroid-related diseases. He has not been taking any medication but has consumed 20 cigarettes a day for 20 years.
Ophthalmological examination has revealed double vision on upward gaze with disturbance in upward movement of the left eye, eyelid retraction, and exophthalmos of the left eye. Intraocular pressure and visual acuity were normal. The exophthalmoses on the right and left sides were 15mm and 19mm by Hertel exophthalmometer (normal range: 10~15mm with laterality of less than 3mm for the Japanese). Clinical activity score (CAS) of the ophthalmopathy was 2 with redness and swelling of the eyelid.
Although no physical sign of thyroid dysfunction was observed, thyroid function tests were performed since Graves' ophthalmopathy was suspected. Plasma FT3, FT4, and TSH levels were as 2.75pg/mL, 1.38ng/dL, and 0.934μIU/mL, respectively, and were within the normal range (). Thyroid peroxidase antibodies (TPOAb), thyroglobulin antibodies (TgAb), and TSH receptor autoantibodies (TRAb) were all negative. Only TSAb was slightly positive: 146% (normal range ≦120%) (). Rheumatoid factor was negative and Immunoglobulin (Ig) G, IgA, and IgM levels were all within normal range. Although C3 or C4 levels were also within normal range, CH50 was slightly higher (59.4 U/mL) than the normal range (32-48 U/mL). Kidney and liver functions were within normal limit. HBV, HCV, HTLV-1, and HIV were negative.
Ultrasonography of the thyroid gland was performed. It showed normal-sized gland with slightly enhanced blood flow (). To directly measure thyroid activity in vivo, 99mTc scintigraphy was then performed. The result was again negative with 99mTc uptake of 0.50% for the right gland, 0.39% for the left gland, and total 0.89% (normal <5% in total) (). These serological and imaging studies of the thyroid has scarcely given positive evidence for the diagnosis of Graves' disease in this patient.
We next performed imaging analysis of the orbital cavity. CT scan showed obvious enlargement of the inferior rectus muscle of the left eye (). MRI images of the orbit again showed inferior rectus muscle swelling of the left eye (). Fat-suppression T2-weighted images showed a slight increase in the MR intensity of the muscle involved (), suggesting active inflammation of the extraocular muscle. No tumorous lesion was detected within the orbital cavity (Figures and ).
With these findings, the differential diagnosis of this case were (1) euthyroid Graves' ophthalmopathy with a slight increase in TSAb alone or (2) idiopathic inflammation of the extraocular muscle []. Based on the insidious onset, absence of ocular pain, predominance of inferior rectus muscle swelling, and apparent muscular swelling with minimally swollen tendons [–], we diagnosed this case as TRAb-negative euthyroid Graves' ophthalmopathy.
Under the diagnosis, he was hospitalized and treated with the combination of corticosteroid pulse therapy and radiation therapy of the orbit (). Intravenous administration of methylprednisolone 1000mg/day for 3 days followed by oral prescription of prednisolone 30mg/day for 4 days were undertaken as the first cycle of the medical therapy. He underwent this medical therapy for consecutive three cycles with a slight modification of decreased methylprednisolone dose (500mg/day) in the third cycle due to a slight elevation of the liver function tests. After the third cycle of the therapy, he was given oral prednisolone as an out-clinic patient. The corticosteroid doses were decreased by 5mg every two weeks until cessation. On the second day of the first cycle of the corticosteroid pulse therapy, daily orbital radiation therapy of 2Gy/day was initiated and performed for ten days (20Gy total). Although the swelling of the left eyelid disappeared on day 3 (), proptosis, abnormality in ocular movement, and diplopia were all unchanged until discharge. Examination by the exophthalmometer revealed the remaining of the exophthalmoses of 16mm on the right and 18mm on the left when he left hospital on day 18 (). Thyroid function remained within the normal range throughout the clinical course and TSAb turned negative (113%) four months after the initiation of corticosteroid therapy. |
pmc-6020493-1 | A 40-year-old African American male presented with complaints of generalized weakness, unintentional weight loss (60 pounds over one-month period), cough, night sweats, and nonbloody, watery diarrhea of approximately four weeks' duration. The patient's medical history was additionally significant for hypertension and polysubstance abuse including tobacco (10 pack/year smoking history) and marijuana. He reported prior history of incarceration. He denied recent travel or animal exposures at home. He resided with his mother, for whom he was the primary caregiver. He denied having sexual activity within the past 6 months. Initial vitals in the emergency department were significant for tachycardia with HR in the 120's. Physical examination at the time of admission revealed a thin, nontoxic appearing male. Cardiac exam revealed tachycardia, with no murmurs or rub. Lung exam revealed decreased breath sounds in the bilateral lower lung fields with tubulovesicular sound emanating from right upper lung field. His abdomen was soft and nontender. He had no focal neurologic deficits. Initial laboratory workup was significant for absolute CD4 count of 26 (3%). Urinalysis showed cloudy urine with 1+ blood, positive nitrite, 3+ leukocyte esterase, WBC >50/HPF, RBC 3-9/HPF, and many bacteria. Chest X-ray (CXR) (PA and lateral views) in the emergency department revealed a cavitary lesion with an air-fluid level within the anterior medial right hemithorax and a loculated hydropneumothorax along the right lateral lung base (). CT chest with contrast demonstrated two large, thick-walled cavitary lesions originating within the right lung parenchyma that appeared to communicate. The smaller lesion measured up to 5 cm and the larger lesion contained an air-fluid level. This was interpreted as demonstrating a complex bronchopleural fistula and associated empyema (). His treatment was initiated with intravenous Ceftriaxone and Metronidazole. The patient's stool PCR isolated a Salmonella species. Diagnostic thoracentesis yielded purulent fluid with WBC 505,000 (73% segmented neutrophils, 8% lymphocytes, and 19% macrophages), RBC 0, pH 6.0, protein 3.7, LDH 41,239, and glucose 12. Pleural fluid culture was positive for Salmonella species. Due to presence of empyema, a right-sided chest tube was placed followed by instillation of tissue plasminogen activator (r-tPA) and DNase twice daily for three consecutive days. His urine culture yielded nontyphi Salmonella. CT abdomen and pelvis with contrast demonstrated two rim-enhancing hypodense lesions (measuring 2.9 x 3.8 cm transverse and 3.2 x 4.5 cm transverse) within the central mesentery of the abdomen (). Intra-abdominal drains were placed under CT guidance into the mesenteric abscesses, from which nontyphi Salmonella eventually grew late in hospital course. Due to immunocompromised status with cavitary lesions on imaging, acid fast bacilli (AFB) smears were obtained along with interferon gamma release assay which were negative. On hospital day #4 the patient's right-sided chest tube was noted to have persistent air leak. CT chest without contrast confirmed persistent right-sided hydropneumothorax with centrilobular ground glass opacities with lung entrapment. On hospital day #10, the patient underwent right video-assisted thoracoscopic surgery (VATS) with decortication. Pleural peel pathology revealed pleural fibrosis, focal chronic inflammation, and mild anthracosis. The patient completed an additional two weeks of antibiotic therapy with intravenous Ceftriaxone from the date of decortication. On follow-up at four-months, CT chest demonstrated improved but persistent loculated right pneumothorax with resolution of the right lung cavitary lesions. At seven months, the CT demonstrated complete resolution of the right-sided pneumothorax (). |
pmc-6020495-1 | This was a 13 days old baby boy, who was born via spontaneous vaginal delivery at term in our tertiary care hospital without any postnatal complications. He was discharged 24 hours after delivery. He was brought back to our ER with left eye purulent discharge, which was noticed since birth, and swelling of his left upper eyelid of 2 days duration.
There was no associated fever or history of decreased level of activity or feeding. There was no history of rashes or seizures.
The pregnancy course was remarkable only for gestational diabetes and the fact that the mother had a history of vaginal discharges, which was treated as vaginal candidiasis during the last trimester. Group B streprococcus screening on the 37th week of gestation was negative. Similarly, HIV and hepatitis B serology were negative one day prior to delivery. There was no maternal history of genital lesions, vesicles, or ulcers.
Examination was normal apart from the purulent eye discharge & swelling of the left eye upper eyelid. The eye secretions were yellowish sticky, copious, and profound. Fontanelles were soft & primitive reflexes were present and normal.
Due to suspicion of gonococcal ophthalmia neonatorum, a full septic workup was obtained including CBC, blood culture, urine analysis and culture, CSF analysis and culture, and left eye swab for culture and Chlamydia antigen (). He was subsequently started on meningitis dose of Cefotaxime, in addition to Gentamycin ophthalmic drops while waiting for the previous cultures' results. Azithromycin was added as well to cover the possibility of an associated chlamydial infection.
The eye swab culture revealed Neisseria gonorrhea, which was sensitive to Cefotaxime, so the antibiotic was continued while waiting for the results of the CSF culture.
Blood and urine cultures were negative. The CSF culture revealed Gram-negative rods after one day, which was identified as S. maltophilia on day 5 of admission. The organism was sensitive to Trimethoprim-Sulfamethoxazole (TMP-SMX).
Once the diagnosis of S. maltophilia meningitis was identified, Cefotaxime was stopped and the baby was started on TMP-SMX and Ciprofloxacin. Since there are no clear guidelines on how to treat S. maltophilia meningitis in neonates, we extrapolated our management plan from that of other Gram-negative meningitis. Therefore, CSF was repeated at 2 days of antibiotics to confirm sterility. Because S. maltophilia meningitis is very rare and there are no clear guidelines on the duration of therapy, the treating team decided to repeat CSF studies one more time toward the end of the third week of antibiotics. The last CSF studies were completely normal, and the culture was negative.
The baby's head circumference was measured daily during the hospital stay and remained normal. Cranial ultrasound scan was normal.
The little boy recovered from the infection uneventfully and a follow-up visit of the baby 1 week after discharge was reassuring. His parents received treatment for gonorrhea and they were screened for other sexually transmitted diseases. |
pmc-6020502-1 | A 33-year-old male taxi driver with past medical history significant only for alcoholism, presented to his family physician's office with the chief complaint of left knee pain and swelling for nine months. He denied any specific injury, puncture wound, or any systemic symptoms. He denied contact with animals. Examination of his left knee demonstrated a moderate-to-severe effusion. He was not tender to palpation across his bony prominences. He had no medial or lateral joint line tenderness. He had a range of motion that was full and symmetric with that of the contralateral side. He had a negative McMurray's sign. His knee was stable to ligamentous examination. There was no erythema or lymphadenopathy. X-ray of the left knee showed a joint effusion. MRI of his left knee also demonstrated a joint effusion with a popliteal cyst and synovial thickening ().
He subsequently underwent aspiration of the effusion in the office. Synovial fluid was cloudy yellow and blood-tinged. Fluid analysis showed the following: RBC: 50,200 cells/mcL, WBC: 4900 cells/mcL (ref range < 150/mcL), PMN: 34% (ref range 0–25%), lymphocytes: 54%, and monocyte: 10%; no crystals were observed, and pathological exam was consistent with hemorrhagic fluid with acute and chronic inflammation. Bacterial culture did not demonstrate any growth, but fungal cultures grew branching narrow hyphae with septations and conidia in a bouquet-like appearance leading to a presumptive diagnosis of Sporothrix schenkii (). The patient was admitted to the University of Kansas Hospital for further management.
The patient underwent diagnostic left knee arthroscopy, irrigation, debridement, and major synovectomy. There was no internal derangement of the knee. There was no chondral injury. He had no evidence of a medial-lateral meniscus tear. His anterior cruciate ligament was intact. There was significant synovial thickening throughout. Blood counts, liver biochemistry, coagulation parameters, and renal and thyroid functions were normal except for elevated liver function tests consistent with his history of alcohol use. ESR and CRP were within normal limits, HIV test was negative, and immunodeficiency workup (humoral immunodeficiency, phagocytic disorders, and T-cell immunodeficiencies) was unrevealing. Abdominal CT done to evaluate for disseminated disease showed marked diffuse hepatic steatosis. After the debridement, the patient was started on oral itraconazole 200 mg twice daily with a plan to treat for 12 months.
Synovial biopsies obtained during debridement from the suprapatellar pouch were sent for both microbiology and pathology. Surgical cultures on Sabouraud dextrose agar grew Sporothrix schenkii within four days confirming the initial diagnosis. The identification was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry—MALDI-TOF MS (Bruker Daltonics Biotyper Microflex LT).
All other microbiological investigations of effusion samples including routine bacterial cultures, acid-fast bacilli (AFB) cultures, were ultimately negative for any growth. Blood cultures multiple times did not reveal any growth. Pathology of the synovial tissue showed prominent mixed chronic inflammation composed of plasma cells and lymphocytes. There were scattered granulomas with central necrosis. Fite's acid-fast staining was negative for acid-fast bacilli. GMS stain was negative for fungal organisms ().
Antifungal susceptibility assays were performed by the broth microdilution method according to the guidelines recommended by the Clinical Laboratory Standards Institute (CLSI): documents M38-A2 (CLSI, 2002b) ().
During his subsequent follow-up visits, he reported that all his symptoms (knee swelling and pain) had improved with itraconazole, but unfortunately, he continued to drink excessive amounts of alcohol. |
pmc-6020505-1 | A 32-year-old man was referred to the Lithuanian University of Health Sciences Kaunas Clinics Hospital with the symptoms of throat discomfort on the left side and dysphagia. The symptoms persisted for approximately 2 months. At arrival, the patient had no fever and there were no other signs of acute infection. Anamnestically, the patient was treated with antibiotics due to a suspected peritonsillar abscess on the left side for a period of 1 month. His left peritonsillar area was repeatedly punctured. However, only blood was obtained with a puncture. The prescribed antimicrobial therapy was not effective—dysphagia progressed, the patient started to report more speech difficulties, his lower jaw became numb, and taste dysfunction appeared. During pharyngoscopy, a dislocated lateral pharyngeal wall with mild inflammatory changes of the oropharyngeal mucosa was observed. The palate tonsil was displaced towards the uvula ()
The fibronasolaryngoscopic investigation revealed that the left side of the nasopharynx was narrowed by a large mass covered with an intact smooth mucous membrane. No pathology was observed in the larynx—the color of mucosa was normal, and the vocal cords were mobile and smooth. No additional structures were seen. Neck lymph nodes could not be palpated.
Due to the suspected pharyngeal tumor, the patient underwent a contrast-enhanced computed tomography (CT) study, which showed a clearly limited, oval-shaped lesion in the left parapharyngeal space ().
The size of the tumor was 4.2 × 3.3 × 6.7 cm. It was characterized by a nonhomogeneous structure with multifocal intratumoral hemorrhages of varying ages. The tumor encased the carotid arteries and the styloid process, while it stretched the pterygoid muscles on the left side and remodeled the pterygoid processes of the sphenoid bone. The medial part of the tumor pushed the palatal tonsil and uvula towards the centerline, as well as the root of the tongue to the front and the middle. Moreover, it significantly deformed the oropharyngeal and nasopharyngeal cavities. The upper part of the tumor ascended and tapered to the bone surface of the base of the skull and extracranial oval foramen. The lower pole of the tumor reached the submandibular salivary gland level and dislocated it slightly laterally.
To clarify the diagnosis, the patient underwent a magnetic resonance imaging (MRI) study. The study showed that due to its localization and tumor-specific features, the most likely diagnosis was schwannoma of the small branch of the mandibular nerve (V3) since a limited formation of specific localization with a component of cystic degeneration was found. Deformed from the medial part, the lateral pterygoid muscle with the V3 is shown in .
To determine a final diagnosis and plan a further treatment, a biopsy with histological verification of the tumor was performed. Under local anesthesia, a punch biopsy was carried out. A histological examination confirmed the diagnosis of schwannoma. Transoral removal of the tumor was planned. During an angiographic study prior to the surgery, the tumor-feeding blood vessels, of which the main vessel was the left ascending pharyngeal artery, were identified and embolized ().
After the preparation of the patient, the schwannoma extirpation through a 5 cm incision at the left wall of the pharynx from the hard palate to the root of the tongue was performed under general anesthesia, while the widening of the oropharynx was done with a throat gag. The tissues were bluntly separated and the tumor capsule was reached, while the bloodstream of the surrounding area was externally disconnected. The tumor was removed in parts, thus reducing its volume. Later, it was totally removed with a capsule. No postoperative complications were observed. The wound healed by primary intention. The patient was discharged for further outpatient treatment on the sixth postoperative day. Antibiotic therapy with penicillin and painkillers was prescribed postoperatively.
Histological examination of the operating material revealed a tumor that formed by monomorphic, mitotically inactive spindle-shaped cells with oval nuclei and an eosinophilic cytoplasm, which were positive for S100 calcium-binding protein P ().
Cells were either fascicular or palisade in structure. Larger individual cells with large and irregularly shaped nuclei were found. Furthermore, thick-walled blood vessels, xanthoma accumulations of macrophages, and abundant groups of hemosiderophages with several foci of necrosis were also visible. The diagnosis of schwannoma was confirmed.
Six months postoperatively, no tumor relapse was observed during either physical examination or the repeated CT study ().
Currently, the patient has been observed for a period of two years. There are no signs of schwannoma relapse. |
pmc-6020506-1 | A 62-year-old Columbian female was diagnosed in 2008 with multiple myeloma (MM). Flow cytometry revealed an IgG kappa monotypic plasma cell population, expressing CD33, CD38, CD45, CD56, CD117, CD138, and kappa light chains. The plasma cells were CD19 negative. IgG was measured at 6390 mg/dL, and immunoglobulins of all other types were decreased. Hematopathology revealed extensive bone marrow involvement (90%) by plasma cells, nearly absent iron stores, moderate normocytic normochromic anemia, reticulocytopenia with prominent rouleaux formation, moderate thrombocytopenia, and absolute lymphopenia. Cytogenetics revealed an abnormal hyperdiploid karyotype including a der(19)t(1q;1p) chromosome with additional copies of CCND1, RB1, and LAMP1, loss of chromosome 17 centromere, and p53 gene disomy. The patient was first started on lenalidomide and dexamethasone and progressed despite multiple chemotherapeutic regimens including bortezomib and dexamethasone, additional cycles of lenalidomide and dexamethasone, melphalan with thalidomide and prednisone (MPT), and bortezomib and dexamethasone. The patient reported complete adherence to treatment.
Throughout the course of treatment, the patient was admitted several times with right flank pain, hematuria, and persistent hypercalcemia. The patient also had a notable past medical history of CKD secondary to myeloma kidney, and asthma.
The patient was admitted for severe hematuria and epistaxis in February 2011. The patient was also hypercalcemic and hyperkalemic and received both zoledronic acid and kayexalate. At that time, the patient underwent an extensive coagulation profile including screening for lupus anticoagulant, antiphospholipid syndrome, paraproteins, and factor levels. Ristocetin cofactor assay revealed a level of 46% (normal 50%–150%), indicating the absence of a Von Willebrand Factor deficiency. Von Willebrand Factor Antigen was >300 IU/dL (normal 60–150 IU/dL). Notably, thrombin time (TT) was elevated to 32.3 sec (normal 15–19 sec). The etiologies considered included increased fibrin split products, dysfibrinogenemia or a deficiency of fibrinogen, heparin treatment, and heparin-like molecules, to name a few. Fibrinogen was 228 mg/dL (normal 175–400 mg/dL), and fibrin split products were <10 mcg/mL (normal <10 mcg/mL), which also suggested the presence of another inhibitor. Factor Xa screen was 0.1 U/mL (normal 0.3–0.7 U/mL), which indicated the absence of UFH and LMWH leading to coagulopathy. Abnormalities of fibrinogen were also ruled out with a normal reptilase time of 22 sec, and control measured during reptilase time testing was 21 sec. PT was 12.0 sec (normal 9.6–11.5 sec), and INR was 1.1 (normal < 1.2). A mixing study was conducted to investigate for the presence of inhibitors; PTT (patient) was 44.3 sec (normal 25–32 sec) and was only partially corrected with mixing; PTT of control plasma was 27.8 sec, PTT Mix 1 : 1 control and patient was 34.2 sec, PTT control following 2 hour incubation was 29.4 sec, and PTT Mix 1 : 1 with 2 hour incubation was 36.5 sec (25–32 sec). Notably also, factor VIII activity was elevated at 273% (normal 45–150%), which indicated an increased risk for venous thrombosis. Continuous protamine sulfate IV of 2–7 mg/hour was given, which led to notable improvement and subsequent resolution of our patients' epistaxis and hematuria. A hematoma formed after a bone marrow biopsy was performed on the same admission, for which surgical consultation was requested. No intervention was done, and resolution of the hematoma occurred spontaneously. |
pmc-6020510-1 | A 25-year-old female with no prior medical history presented to the emergency department due to high fever (up to 39°C) since 3 days. She complained of left flank pain and gross hematuria. On physical examination, left costovertebral angle tenderness was noted. The urinalysis confirmed the hematuria (2055 red blood cells per high-power field). The urinary dipstick was negative for leukocyte esterase and for nitrites, but significantly positive for albuminuria (2+). On microscopic examination of the urine, pyuria was minimal (6 white blood cells per high-power field) and no bacteriuria was noted. She denied having taken antibiotics before presentation. Urine and blood cultures were obtained. The laboratory tests revealed a significantly elevated C-reactive protein (CRP = 28 mg/dl), a high erythrocyte sedimentation rate (107 mm/h), and an elevated creatinine (1.21 mg/dl) with normal blood urea nitrogen (16 mg/dl).
She was admitted to the internal medicine ward with a preliminary diagnosis of acute pyelonephritis, and she was started on intravenous ceftriaxone. A contrast-enhanced computed tomography the next day revealed a hypoenhancing region in the upper pole of the left kidney, suggestive of pyelonephritis (). However, considering the significant hematuria in the absence of pyuria and bacteriuria, and the persistently elevated creatinine (1.55 mg/dl on day 3), a nephrologist was consulted. Microscopic evaluation of the urinary sediment revealed dysmorphic red blood cells suggesting glomerular disease (2 red blood cell casts and 60–80 red blood cells per high-power field with >10% of G1 cells and >80% dysmorphic erythrocytes). The spot urine protein to creatinine ratio obtained on the 5th day of hospital stay was also elevated (929 mg/g). Furthermore, both urine and blood cultures came back negative, and no fever was recorded during the hospital stay. Ceftriaxone was discontinued after 7 days of treatment.
A biopsy of the left kidney was performed at the 6th day of hospital stay and confirmed a diagnosis of IgA nephropathy (immunofluorescence was strongly positive for mesangial IgA deposition, complement component C3, and lambda light chains and moderately positive for IgM). The patient denied any recent respiratory tract infection symptoms. Other lab tests sent during her hospital stay were normal (lactate dehydrogenase, anti-neutrophil cytoplasmic antibodies, antinuclear antibodies, anticardiolipin IgG and IgM, anti-beta-2 glycoprotein I IgG and IgM, protein electrophoresis, serum complement C3c and C4 level, rheumatoid factor, and transesophageal echocardiography). She was started on lisinopril 5 mg daily. Furthermore, considering the significant proteinuria, the elevated creatinine and the negative prognostic features of the biopsy, (M1E1S1T0C1 according to the Oxford classification []) she was started on glucocorticoids (three-day pulse of methylprednisolone 1g in months 1, 3, and 5 in addition to oral prednisolone 0.5 mg/kg every other day for 6 months) []. At follow-up at 2 months, both creatine (0.86 mg/dl) and the spot urine protein to creatinine (114 mg/g) were normal. CRP at follow-up was 0.4 mg/dl. |
pmc-6020512-1 | The body of an 84-year-old man was received under the Saint Louis University (SLU) Gift Body Program of the Center for Anatomical Science and Education (CASE) with an informed consent from the donor. Records indicate this man's cause of death was a gastric carcinoma. During routine dissection, a bifid penis was observed. At first glance the phallus resembled that of epispadias, but there were no defects or repair in the external abdominal wall. The pubic hair was sparse and fine. The phallus was 9.2 cm. long, divided longitudinally into right and left parts (). Each part had its own glans and prepuce. There was no urethra in the phallus. Rather, a urethral meatus was located at the base of the divided phallus () which is indicative of proximal penoscrotal hypospadias [, ]. The urethra continued into the normally developed urinary bladder. The epithelial lining of the urinary bladder extended to 3.9 cm. on the ventral surface of each phallus and histologically it resembled stratified squamous epithelium. The scrotum was large with redundant skin and contained left and right testes, from which extended a normally routed spermatic cord. The right testis was 3.0 long and 2.3 cm wide and the left testis was 1.4 cm long and 0.8 cm wide. The spermatic cord on both sides was 1.2 cm in thickness, continued from each testis and passed through the external and internal inguinal rings and took a normal course to end in well-developed seminal vesicles. The seminal vesicles opened into the urethra. The spermatic cord was of normal thickness and size, contained all of the general coverings, but there was no epididymis. The vas deferens continued directly from each testis to the seminal vesicle of the same side. A small mass, measuring 0.5 cm by 0.5 cm, of hard tissue was found only on the left side and was located at the site of the prostate gland but histologically it did not resemble prostatic glandular tissue. It did not have any connection with the vas deferens or seminal vesicle. Dissection of the phallus revealed a corpus cavernosum and corpus spongiosum in each half of the penis and the corpora spongiosa were well developed as in females (). No other abnormalities were observed.
In summary, the anatomical examination of the human cadaver described above characterizes the respective case as a complete bifid penis, a subset of human diphallia, which was accompanied by proximal penoscrotal hypospadias. The lack in this case of additional malformations often associated with diphallia (see above) makes it a perfect model for correct assessment of its etiology. |
pmc-6020517-1 | The patient is a 55-year-old man with past medical history significant for two-year history of umbilical hernia, diabetes mellitus type 2, hypertension, gout, chronic kidney disease with proteinuria, diverticulosis, obesity, and osteoarthritis. The patient presented to the clinic because of umbilical hernia pain, which developed over the two months. The pain localized to the periumbilical region and left lower back, and it was exacerbated with food intake and sometimes relieved by 5 mg hydrocodone tablet. He also reported nausea and fifteen pounds weight loss over the two months, which he attributed to decreased food intake. The physical examination showed a 1 cm tender and irreducible mass superior to the umbilicus. The patient underwent herniorrhaphy and the gross examination of the surgical specimen did not reveal any masses or lesions.
The microscopic evaluation showed diffuse infiltration of the connective tissue by malignant cells with hyperchromatic nuclei, inconspicuous nucleoli, and abundant eosinophilic cytoplasm (). There were focal areas of gland formation with mucin production, consistent with adenocarcinoma. By immunohistochemistry, the neoplastic cells were strongly positive for pancytokeratin and CK7 () and negative for CK20, CDX2, TTF-1 and PSA.
The laboratory findings showed elevated levels of CA 19-9 (16,590 U/mL) and CEA (14.2 ng/mL). The patient underwent a subsequent computed tomography scan with intravenous contrast, which showed a 5.0 × 2.7 cm ill-defined and hypoattenuating mass located in the pancreatic tail and body (), with peripancreatic fat infiltration and vascular involvement of splenic artery and vein. In addition, the imaging showed peritoneal carcinomatosis, multiple ill-defined hypoattenuating lesions in the liver, and enlarged and hypoattenuating pericecal iliac lymph nodes. The patient had a prior noncontrast computed tomography scan four months earlier, which showed umbilical hernia with fat and no other lesions in the pancreas and abdomen ().
After the diagnosis, the patient refused chemotherapy and decided to undergo palliative care. The patient had rapid progression of the disease and died within two months of the initial histologic diagnosis of malignancy. |
pmc-6020537-1 | A previously healthy 10-year-old Asian girl presented to the emergency department with headache, vomiting, and one week of mild nonproductive cough. Her headache started the evening prior to presentation, was gradual in onset and frontotemporal in location, and improved with acetaminophen but subsequently woke her from sleep. It was accompanied by two episodes of emesis. On presentation to the ED, the patient described her headache pain as 3 out of 10 in severity. She denied photophobia, had no further nausea, and denied abdominal pain. She reported that the headache worsened with standing and improved with lying down. Review of systems was significant only for pallor.
The patient was otherwise healthy with no prior medical issues and taking no regular medications. She was fully vaccinated and had no known allergies. Her family history was significant for frequent headaches in her mother and maternal aunt. She was living with her parents and brother and attending 4th grade.
Vital signs demonstrated blood pressure 111/56, pulse 104, temperature 37.1°C, respiratory rate 22, and oxygen saturation 100% on room air. Initial exam revealed a well-appearing female and was unremarkable including a normal fundoscopic exam and a normal complete neurologic exam.
The patient received ibuprofen and oral rehydration and her headache further improved. A presumptive diagnosis of migraine headache was made and was discharged with primary care follow-up the following day.
Two days after her initial emergency department visit, the patient returned to the ED with worsening headache, myalgia, subjective fever, and diffuse weakness. The patient's mother reported that the patient was unable to stand or walk and as a result her mother had been carrying her, including to and from the bathroom. The patient endorsed nausea but no further vomiting.
Vital signs demonstrated blood pressure 105/49, pulse 123, temperature 36.9°C, respiratory rate 30, and oxygenation saturation of 97% on room air. On exam, the patient was moderately ill appearing, lying in bed responding slowly to questions. Her lips were noted to be cracked and with some oozing blood. No oral lesions were noted in the mouth. Pupils were equal, round, and sluggishly reactive bilaterally. Neck was supple with no adenopathy noted. Cardiovascularly, she was noted to be tachycardic with a regular rhythm and II/VI flow murmur. Her respiratory exam was normal. Her abdominal exam was benign with no organomegaly. Neurologically the patient was noted to be slow to respond to questions and moving slowly but without focal deficits. She was, however, unable to walk without assistance. Skin exam revealed diffuse ecchymoses on the lower extremities bilaterally.
Laboratory studies were ordered along with a rapid brain MRI, and pediatric neurology was consulted.
Laboratory results were as follows: hemoglobin 2.6 g/dL, hematocrit 8.3%, platelets 10K/uL, and WBC 60.5K/uL with 83% blasts in the differential. CRP was 15.7 mg/L, and ESR was 125 mm/h. Electrolytes showed sodium 139 mmol/L, potassium 4.0 mmol/L, chloride 100 mmol/L, carbon dioxide 24 mmol/L, BUN 11mg/dL, creatinine 0.56 mg/dL, glucose 129, magnesium 2.5mg/dL, and phosphorus 3.6 mg/dL. LDH was 359 U/L, uric acid was 2.3mg/dL. PTT was 29.4 seconds, PT was 19.5 seconds, and INR was 1.7. Fibrinogen was 117 mg/dL and D-dimer was >10,000 ng/mL. Review of peripheral blood smear () demonstrated many primitive cells with round and lobated nuclei, numerous cytoplasmic granules with Auer rods readily identified, and some cells with multiple Auer rods.
Rapid MRI Brain () was obtained which demonstrated leptomeningeal enhancement in the supratentorial parenchyma suggestive of leptomeningeal carcinomatosis, a hemorrhagic lesion in the corpus callosum, multiple subdural hematomas with mild mass effect, and petechial hemorrhages throughout the brain.
Pediatric Oncology was consulted and treatment initiated emergently with ATRA, dexamethasone, allopurinol, cefepime, and blood products including packed red blood cells, platelets, and cryoprecipitate. The patient was subsequently admitted to the pediatric intensive care unit.
In the pediatric ICU the patient received several transfusions with platelets, cryoprecipitate, and fresh frozen plasma to manage DIC. She was continued on an induction course of chemotherapy including ATRA, dexamethasone, idarubicin, and arsenic trioxide. Molecular analysis of the peripheral blood was positive for PML-RARA, confirming the diagnosis of APL. After the coagulopathy improved and the patient stabilized, lumbar puncture was performed with administration of intrathecal chemotherapy. The cerebrospinal fluid was notable for the presence of leukemia cells, confirming the involvement of the central nervous system. The patient's encephalopathy gradually improved and she returned to her baseline mental status by day 7 of treatment. The patient was noted to have elevated opening pressure on lumbar punctures, which worsened over the course of induction, attributed to pseudotumor cerebri secondary to ATRA.
Upon completion of the first 28 days of induction therapy, repeat lumbar puncture and bone marrow studies demonstrated no morphologic evidence of acute promyelocytic leukemia, consistent with remission. |
pmc-6020648-1 | A 56-year-old man was admitted to our hospital after resection of a lymph node in his groin revealed adenocarcinoma. Contrast-enhanced computed tomography (CT) showed a 9-cm mass extending from the bladder to the umbilicus, along with intraperitoneal nodules suggesting peritoneal dissemination (Figures , , and ). Cystoscopy showed an extrinsic mass located on the dome. Serum assays showed high levels of carcinoembryonic antigen (CEA), to 16.3 ng/mL, and carbohydrate antigen 19-9 (CA19-9), to 230.9 U/mL. The patient was diagnosed with urachal carcinoma with suspected peritoneal dissemination and was started on systemic chemotherapy with intravenous gemcitabine (1000 mg/m2 on days 1 and 8 of each 21-day cycle) plus cisplatin (70 mg/m2 on day 2 of each cycle). After two cycles, a CT scan showed no marked changes in the lesion; after four cycles, his serum CEA and CA19-9 concentrations had decreased to 4.2 ng/mL and 76.1 U/mL, respectively. However, after five cycles, his CEA concentration had increased to 8.3 ng/mL and his CA19-9 concentration had also increased to 304.1 ng/mL with a CT scan showing changes in the tumor and the appearance of abdominal fluid (). Because of the considered histological and clinical similarities between colorectal and urachal carcinoma, his treatment was changed to FOLFIRI (i.v. infusion of 180 mg/m2 irinotecan, 200 mg/m2 ℓ-leucovorin, and 400 mg/m2 5-fluorouracil (5-FU) on day 1 of each 14-day cycle, followed by continuous infusion of 2400 mg/m2 5-FU for 46 hours) after receiving informed consent. After 11 cycles of FOLFIRI, serum tumor marker levels had not changed markedly, but a CT scan showed a reduction in tumor size to 7 cm () and no new distant metastases. Because chemotherapy was able to suppress tumor progression, a surgical approach was chosen, and complete resection of the tumor, along with partial cystectomy and pelvic lymph node dissection, was performed. The tumor was found to adhere to surrounding organs with mucinous fluid, with disseminated nodules present in the greater omentum. The tumor was removed, along with surrounding adherent organs, including the bladder dome, omentum, peritoneum, abdominal rectus muscle, and vermiform appendix. Cytology showed that the mucinous fluid in the abdominal cavity was class V and the final pathological diagnosis was urachal mucinous adenocarcinoma with invasion of the omentum and peritoneal dissemination (). There were no lymph node metastases, and surgical margins were negative. The patient was discharged from the hospital 14 days after surgery with no complications. Soon after surgery, his serum tumor markers had normalized. Tumor marker levels were measured every month and CT scans performed periodically until six months after surgery. Subsequent follow-up included CT scans and tumor marker level measurement every three months for the first three years and every six months thereafter. At the time of writing this report, i.e., 62 months after surgery and without any adjuvant chemotherapy, the patient remains alive. Although he showed a slight increase in serum CEA level to 6.3 ng/mL, his serum CA19-9 level remained within normal limits (), and no radiological recurrence has been detected. |
pmc-6020766-1 | A 5-year-old girl was referred to our hospital for the investigation of urinary incontinence. The patient had continuous low volume urine leakage requiring 4–5 daily pads. The parents could not specify whether there was any connection with standing, coughing, or effort and she had no urge to void.
She was constantly wet but had normal voiding habits. On initial physical examination the external genitalia appeared normal with no vaginal pooling of urine or ectopic ureteral orifice. However, a long-term external genitalia examination revealed normal urethral and vaginal openings, with an intermittent urine leakage through the vaginal orifice, which slightly increased in abdominal pressure.
In her past history she had recurrent febrile urinary tract infections (UTIs) since her infancy. At the age of 3 she underwent an abdominal ultrasound that suspected a double left kidney. A voiding cystourethrogram (VCUG) was performed and a vesicoureteral reflux (VUR) grade III on the right kidney was found. She was given chronic chemoprophylaxis without any UTI recurrence. She had a good toilet training and gave up daytime diapers around the age of 3. At this moment parents noticed the urinary incontinence, but this didn't bother them. At the age of 4 parents asked a urologist for help, who considered the symptoms to be the result of an overactive bladder and anticholinergic treatment was recommended. No improvement was noticed, and for this reason the little girl was sent to our department for further investigation.
Complete blood count, biochemical tests, and urinalysis were all normal and the urine culture was negative.
An abdominal ultrasound was performed and both kidneys had normal parenchyma and size, with a duplex-system suspicion on left side; the bladder was normal in appearance. The VCUG was repeated but no VUR was visualized. As we had a high suspicion of an ectopic ureter a contrast-enhanced computed tomography (CT) of the abdomen and pelvis was performed to visualize the entire urinary tract. The CT scan was performed with a 64 row MDCT system (Siemens Somatom Definition AS). The 3D images revealed important data about the entire collecting system and the ureters, namely a duplicated collecting system on the left side and subsequently both ureters extending from the kidney to the point of extravesical insertion into the vagina. The ectopic ureters were in very close vicinity (Figures –).
In the evaluation of urinary incontinence in children of this age a differential diagnosis should be considered with the following: UTI, chronic kidney disease, diabetes, overactive bladder, ectopic ureter and vesico-vaginal fistula in case of a history of pelvic surgery. |
pmc-6021183-1 | A 41-year-old man with a past surgical history of uncomplicated cholecystectomy two years ago (and no other significant medical history) presented to emergency department with worsening fatigue, shortness of breath, and chest pain. He reported a one-week history of flu-like symptoms i.e. subjective fevers, cough, rhinorrhea, muscle aches, and two days history of pleuritic chest pain worsened by lying flat and improved by leaning forward. On day of presentation, he was feeling more fatigued and also had an episode of presyncope with chills and rigors. On arrival, physical examination revealed tachycardia to 106/minute, hypotension to 62/48 mmHg, and oral temperature of 97.9 °F.
On cardiac auscultation, no gallops or murmurs were appreciated. Lung auscultation revealed decreased air entry at right lung base and bibasilar crackles. No pathological findings were noted on abdominal exam.
Electrocardiogram (ECG) showed sinus tachycardia and diffuse ST segment elevations and PR segment depressions except in lead aVR consistent with acute pericarditis (Figure ).
The patient was given 3 l of normal saline without significant improvement in hemodynamics. He was then started on vasopressors through the central line. Initial labs were significant for troponin I elevation to 2.39 ng/ml (ref 0.00-0.04), CK-MB 12.8 ng/ml (ref 0.6-6.3) CRP 2.637 mg/dl (ref 0.02-2.0), Ferritin 1473.9 ng/ml (ref 3.1-110.9). Chest X-ray showed pulmonary vascular congestion and right mid- and lower-lung opacity/effusion (Figure ).
Bedside echocardiogram (ECHO) revealed severely reduced ejection fraction (EF) to 16%-20% and moderate pericardial effusion, which was later confirmed with the official echocardiogram as shown in Video .
The patient was taken to cardiac intensive care unit for close hemodynamic monitoring. He was started on milrinone drip in addition to norepinephrine. Anti-inflammatory therapy with aspirin and colchicine were initiated. He was also started on Oseltamivir after rapid diagnostic test came back positive for Influenza B. The patient was able to be tapered off vasopressors and inotropes on day three. Repeat ECHO on day three of admission showed improved ejection fraction (EF) to 31 % and worsening pericardial effusion without tamponade effect. The hospital stay was complicated by paroxysmal atrial fibrillation and the patient was started on amiodarone for rhythm control. He was also started on heart failure medications i.e. lisinopril, metoprolol. Anticoagulation was not started due to low CHADS-Vasc score and risk of hemorrhagic conversion of pericardial effusion.
The patient remained in sinus rhythm afterward and was transferred from intensive care unit to telemetry floor. Follow-up ECG showed normalization of ST and PR segments (Figure ).
Repeat Echocardiogram on day nine showed improved EF to 51% and resolution of pericardial effusion as shown in Video .
His symptoms resolved completely and he was discharged on day 10 in stable condition from the hospital to follow up with cardiology outpatient. |
pmc-6021184-1 | A 22-year-old male, known case of hepatitis B for one year, developed a low-grade intermittent fever (100°F-101°F) with chills and rigors, associated with nausea and vomiting related to food intake. A week of this predicament was followed by altered mentation, whereby the patient complained of drowsiness as well as a concomitant decrease in urine output. In our emergency room, he was found to be delirious but had a Glasgow coma scale (GCS) of 15/15. Initial assessment revealed a heart rate (HR) of 110/minute, respiratory rate (RR) of 20/minute, a temperature of 101°F and blood pressure (BP) of 150/100 mm Hg. The patient also had scleral icterus. Rest of the physical examination was unremarkable. Initial investigations at the time of the presentation are shown in Table .
The patient was started on broad-spectrum antibiotics (1 gram (g) intravenous vancomycin + 500 milligrams (mg) intravenous imipenem/cilastatin). Figures - show investigations and their trends over the course of the next few days.
Based on his clinical presentation and an elevated serum creatinine, the patient underwent hemodialysis on day two of his admission. A tentative diagnosis of thrombotic thrombocytopenic purpura (TTP) was ruled out based on a low reticulocyte count with a high direct bilirubin value and a positive direct Coombs test. An abdominal ultrasound showed mild abdominopelvic ascites with mild splenomegaly. A head computed tomography (CT) scan was negative for any pathology and CT scan of the chest, abdomen, and pelvis showed bilateral basal consolidation and atelectasis in the lungs, swollen and enlarged pancreas, diffuse thickening of the walls of the ascending, transverse and descending colon, hepatosplenomegaly, swollen and globular appearing kidneys, and intramural hemorrhages with peritoneal hemorrhagic fluid (Figure ).
Additional investigations showed a serum fibrinogen level of 292 mg/dL, serum triglyceride level of 496 mg/dL, and a serum ferritin level of 30,304 ng/mL. C-reactive protein level (CRP) was 105 mg/L while serum lactate dehydrogenase (LDH) was 3,965 U/L. A hepatitis panel blood test was only positive for hepatitis B surface antigen (HBsAg). Antinuclear antibody (ANA) was negative, thus ruling out systemic lupus erythematosus (SLE) and other autoimmune etiologies. Blood cultures assessed after five days were unrevealing for any microbial growth. Considering a lack of clinical improvement, a bone marrow biopsy was performed on the 10th day of admission which showed 80% cellularity with increased hemophagocytic activity. Immunohistochemistry revealed increased histiocytes on CD68, and Iron stain revealed 2+ stainable iron (Figures -).
According to the HLH-2004 trial, this patient fulfilled six features out of the eight-point diagnostic criteria for HLH, including a persistent fever >101 F, bicytopenia, splenomegaly on an abdominal CT scan, hypertriglyceridemia and/or hypofibrinogenemia, hyperferritinemia and a histiocytic activity on a bone marrow aspirate. In this case, the underlying cause of HLH was suspected to be a chronic hepatitis B infection. He was started on etoposide (100 mg/m²) along with dexamethasone as per the HLH treatment protocol. |
pmc-6021184-2 | A 44-year-old male presented to our outpatient department with complaints of a continuous fever (100°F-102°F), loss of appetite, undocumented weight loss and fatigue for two weeks. The fever was not associated with chills and responded to acetaminophen. He also complained of occasional gum bleeds. A review of systems was otherwise unremarkable. Initial assessment revealed a heart rate of 110/minute, respiratory rate of 17/minute, a temperature of 102°F and blood pressure of 140/90 mm Hg. The rest of the physical exam was unremarkable. Initial investigations at the time of presentation are shown in Table .
The patient was then started on a combination of 1 g intravenous vancomycin and 500 mg intravenous imipenem/cilastatin. Figures - show the investigation results and their trends over the course of the next few days while the patient was admitted to our setting.
An abdominal CT scan showed moderate hepatosplenomegaly with multiple hypodense lesions in the spleen. There was a mild enlargement of the left inguinal, paracardiac and subdiaphragmatic lymph nodes. Diffuse omento-mesenteric congestion and pelvic ascites were also noted (Figure ).
Despite broad-spectrum antibiotic therapy, the patient remained febrile. Additional investigations showed a serum fibrinogen level of 132 mg/dL, serum triglycerides level of 257 mg/dL, serum ferritin was 5,092 ng/mL, serum LDH was 4,85 U/L and CRP was 20 mg/dL. Prothrombin time/international normalized ratio (PT/INR), serum vitamin B12, and serum folic acid levels were normal. A suspicion of autoimmune hepatitis was ruled out based on a negative anti-liver-kidney microsomal antibody (anti-LKM-1) test. Viral serologies revealed that the patient was negative for cytomegalovirus (CMV), herpes simplex virus (HSV), hepatitis B virus and hepatitis C virus. Blood cultures assessed after five days were negative.
Considering a lack of clinical improvement, a bone marrow biopsy was performed on the sixth day of admission which revealed normocellular marrow with an increase in dysplastic megakaryocytes. Hyperplastic erythropoiesis with nuclear cytoplasm asynchrony was also noted. Moderate hemophagocytic activity was evident with prominent histiocytes and plasma cells. Based on his abdominal CT report, he later underwent a left inguinal lymph node biopsy on the seventh day of his admission, which revealed reactive hyperplasia but was negative for malignancy.
According to the HLH-2004 trial, this patient fulfilled six out of the eight-point diagnostic criteria for HLH including a fever of >101°F, bicytopenia, splenomegaly on abdominal CT scan, hypertriglyceridemia and/or hypofibrinogenemia, hyperferritinemia and a histiocytic activity on a bone marrow aspirate. However, the underlying etiology remained unclear. He was started on etoposide (100 mg/m²) along with dexamethasone as per the HLH treatment protocol. After completing eight sessions of etoposide, the patient was admitted again with complaints of abdominal pain. Hepatomegaly was noted and liver enzymes were found to be elevated, which prompted a liver biopsy that revealed a T-cell rich, histiocytic B-cell lymphoma. The patient was subsequently started on chemotherapy with rituximab, cyclophosphamide, vincristine, prednisone, and doxorubicin. A good response to the treatment was noted, and a complete remission was ultimately achieved on positron emission tomography (PET)/CT scans. |
pmc-6021185-1 | A 67-year-old Caucasian man with a significant history of recently diagnosed type 2 diabetes mellitus (T2DM) and essential hypertension presented to the hospital with chief concerns of diplopia with an extreme gaze, right eye pain, and sinus congestion for about two weeks.
At the time of admission, the patient was afebrile, had a blood pressure of 160/67 mmHg and pulse of 64/minute but had a white blood cell count of 14,540/µL. The patient’s blood glucose was 469 mg/dL, anion gap levels were within reference range, and his glycosylated hemoglobin (HbA1c) was 12.4%. Computed tomography (CT) and magnetic resonance imaging (MRI) of the orbit and face revealed severe sinusitis with possible orbital cellulitis and optic nerve compression (Figure ).
On the day of admission, the patient was started on an IV ampicillin and sulbactam combination (3000 mg/mL every six hours) and IV vancomycin (1500 mg/mL loading dose; 1250 mg/mL every 12 hours maintenance dose; target vancomycin trough of 10 to 20 mg/mL due to the severity of the infection). The patient was seen by the infectious disease (ID) team on day two of admission. The ID team recommended continuing vancomycin, switched the ampicillin/sulbactam combination medication to piperacillin/tazobactam (3375 mg/mL every six hours) and started the patient on empiric IV liposomal amphotericin B (400 mg/mL daily) given the concerns for invasive fungal infection. The patient was seen by ophthalmology team, and they recommended no acute surgical intervention. However, the otorhinolaryngology (ENT) team performed an endoscopy of the nasal sinuses on the second hospital day, and the patient required extensive debridement of the necrotic tissue of the right sinuses.
Biopsy results from the nasal sinuses showed broad hyphae with infrequent septations, haphazard branching, and numerous bizarre forms. These morphologic features were consistent with mucormycosis. Given this finding, the patient was continued on IV liposomal amphotericin B.
A second MRI of the orbit and face was repeated on the fourth hospital day and showed the progression of the disease including involvement of right retrobulbar fat and right optic nerve, persistent non-enhancing, and likely necrotic tissue extending from the right pterygopalatine fossa into the right masticator space (Figure ). Suspected osteomyelitis was noted at the base of the skull, and we noted asymmetric right frontotemporal pachymeningeal enhancement with wispy leptomeningeal enhancement along the middle cranial fossa, which was suggestive of meningitis.
The neurosurgery team was consulted as the patient had meningeal spread as well. The neurosurgery team deemed the patient inoperable.
Given the progression of the disease despite the standard-of-care treatment (i.e., surgical debridement, IV amphotericin B, and control of blood glucose), a literature search was done to find the next best step. Isavuconazole has been used, according to a few case reports [-], as salvage treatment in patients whose condition either failed the IV amphotericin B or were intolerant to it. Therefore, our patient was started on IV isavuconazole (372 mg/mL every eight hours) on the fifth hospital day, and IV amphotericin B (400 mg/mL daily) was continued. Since patient tissue aerobic and anaerobic cultures as well as blood cultures remained negative, piperacillin/tazobactam and vancomycin were discontinued on the fifth hospital day.
An MRI of the orbit and face was repeated 48 hours after the patient was started on isavuconazole and revealed a stable disease. The patient’s IV isavuconazole dose was reduced to 372 mg/mL daily (after receiving IV isavuconazole every eight hours for 48 hours). An MRI was obtained one week later, and it also showed stable disease with no further progression. The patient was switched to oral isavuconazole (372 mg daily), and IV amphotericin B (400 mg/mL daily) was continued. As the patient continued to improve, he was ultimately discharged after 19 hospital days on this regimen with a plan for outpatient follow-up evaluations with the ID, ENT, and ophthalmology teams. The patient was blind in his right eye with cranial nerves III, IV and VI palsies at the time of discharge. However, his left eye was completely intact with normal vision and movement.
During outpatient care, he continued to receive IV amphotericin B (400 mg/mL daily) and oral isavuconazole (372 mg daily). An MRI of the orbit and face after five weeks of this therapy showed some interval improvement of the infectious process (Figure ). After receiving IV amphotericin B (400 mg/mL daily) for 50 days, the medication was stopped, and the patient was continued on oral isavuconazole (372 mg daily). The patient's renal function was checked weekly as the patient was on IV amphotericin B. The patient had baseline creatinine of 1.0 mg/dL, it peaked at 1.8 mg/dL and returned to 1.4 mg/dL once the IV amphotericin B was stopped. Fungal cultures and blood samples were monitored for six weeks, and they remained negative.
An MRI of the orbit and face was obtained two months later while the patient was treated with oral isavuconazole (372 mg daily), and the imaging continued to show stable disease. Therefore, oral isavuconazole was stopped. By this time, the patient had isavuconazole for a total of four months (both via IV and oral doses). Besides headaches, the patient tolerated the isavuconazole well without any other significant side effects.
An MRI of the orbit and face was obtained again nine months after stopping oral isavuconazole, and his disease process has remained stable. Imaging at this time showed some improvement in the condition. The ID team stated the patient was cured. The ENT team still monitors the patient periodically, and, as of this writing, the patient has been over one year off of antifungal medications.
Regarding the patient’s diagnosis of uncontrolled T2DM, the patient was initially started on basal insulin while as an inpatient, but he was discharged on oral antihyperglycemic agents (metformin, 500 mg twice daily with meals and sitagliptin, 100 mg daily) given better control with oral agents at the time of discharge. His HbA1c improved to 5.0% from 12.4% in three months. The patient’s metformin has been stopped, and his sitagliptin dose has been reduced to 50 mg daily and is the only diabetic medication for the patient as of this writing. |
pmc-6021337-1 | The patient is a 58-year-old non-smoking female with a history of recurrent papillary thyroid cancer first detected in the 1970s, who throughout her course underwent several surgical resections, repeated therapy with radioactive-iodine, and external beam radiation therapy (EBRT) (original history, cumulative radioiodine dose and EBRT dose unavailable). She presented again in 2015 with recurrent thyroid cancer as well as newly diagnosed breast cancer and liver metastases of unknown origin. She was hospitalized for unexplained fevers, failure to thrive, and symptomatic management of disease progression. Prior to this hospitalization, she had undergone an extensive infectious disease workup with an attempt to isolate the cause of her fevers up to 104 degrees Fahrenheit over the preceding three months. No clear etiology was identified. Empiric antibiotics were eventually discontinued, and the presumed diagnosis of tumor fever was made. On discharge, she followed up in the oncology clinic to start lenvatinib, a TKI approved for radioiodine-refractory thyroid cancer. Hours after her first dose of lenvatinib, she was taken to the hospital due to two witnessed generalized tonic-clonic seizures. At home she was noted to have shaking of her arms with repetitive movements of her head, lasting about three minutes and followed by post-ictal confusion, with no tongue biting or incontinence noted. She was taken to the emergency department where she had another witnessed seizure that resolved under therapy with lorazepam. The patient was then transferred from the emergency department to a different medical center. Although her presenting blood pressure was not available for review, her blood pressure was noted to be 158/99 mmHg immediately prior to her transfer.
The patient was admitted to the medical intensive care unit, and given persistent seizures, required intubation for airway protection. Physical exam was limited due to sedation. Brain MRI revealed multifocal white matter edema affecting the occipital and parietal lobes with patchy gadolinium enhancement, in a predominantly posterior distribution, but also with frontal lobe lesions with associated vasogenic edema and patchy enhancement (Figure ). A small, acute infarct in the left centrum semiovale on diffusion weighted imaging was also noted. She developed a fever early in this hospitalization and extensive work up for infectious causes revealed right lower lobe pneumonia that was treated with vancomycin and cefepime. Given her fevers and altered mental status, as well as small acute stroke seen on MRI, patient underwent lumbar puncture on hospital day 1 to evaluate for signs of meningitis or systemic vasculitis. Her CSF studies were not consistent with those diagnoses, with 1–4 white blood cells per UL, 0–1 red blood cells per UL, glucose of 65 mg/dL (normal 40–70 mg/dL), protein of 46 mg/dL (normal 15–45 mg/dL) and gram stain and culture which was negative for growth. CSF was also negative for oligoclonal bands, herpes simplex virus, Ebstein-Barr virus, John Cunningham (JC) virus, cytomegalovirus, varicella zoster virus, and negative for growth of mycobacteria. Additionally, head and neck CT angiogram did not demonstrate any hemodynamically significant stenosis. Based on these clinical findings of confusion and progression to mental status depression, a presumed diagnosis of PRES was made. It was thought that the small stroke seen on MRI was a separate event and was not contributing to her current clinical picture. On hospital day 2, she required norepinephrine due to mixed distributive and cardiogenic shock. A transthoracic echocardiogram (TTE) showed an ejection fraction (EF) of 36%, decreased from 62% one month prior, with regional wall motion abnormalities, moderate to severe hypokinesis in all basal to mid-ventricular segments, and hyperdynamic apical segments. These findings were consistent with stress cardiomyopathy or reverse Takotsubo cardiomyopathy. She was weaned off vasopressors and extubated successfully on day 4. For her stress cardiomyopathy with tachycardia, she was started on captopril and metoprolol.
A repeat MRI one week later showed marked improvement in the size and number of areas of T2/FLAIR signal hyperintensity in the supratentorial cortex and near-complete resolution of the abnormal T2/FLAIR signal in the cerebellar hemispheres, further consistent with PRES. Repeat TTE at that time showed improvement of systolic function with an EF of 56% and no wall-motion abnormalities. She was continued on lacosamide and advised to follow up with neurology for epilepsy management. She was advised to not take lenvatinib. She remained hemodynamically stable on the oncology ward, however she had a non-resolving lactic acidosis without systemic signs of poor organ perfusion that was attributed to her cancer progression. The patient was discharged and ultimately died under hospice-care one week later. |
pmc-6022254-1 | A 57-year-old Thai man from Sa Kaeo, a province in the Eastern region of Thailand referred to a University Teaching Hospital in Bangkok due to swelling and pain at the left side of the neck for one month. One week prior he was admitted to the local hospital due to low-grade fever, difficulty swallowing and hoarseness. He received intravenous ceftriaxone and clindamycin for presumptive diagnosis of deep neck infection. He had history of hypertension treated with amlodipine 10 mg and enalapril 10 mg daily. He had habits of heavy alcohol drinking for 40 years, and smoking. He works at the department of fisheries. He swam, cleaned fish pond and mowed the lawn. Upon admission (day 0), the patient's body weight was 52 kg, body mass index was 19.7 kg/m2. His vital signs were as follows: body temperature, 38.7 °C; blood pressure, 170/100 mmHg, pulse rate, 100 beats/min; respiratory rate, 24 breaths/min. On physical examination, mild pale conjuctivae, anicteric sclerae. The neck exam revealed pulsatile left neck mass size 5 × 5 cm in diameters, mild tender on palpation, no sign of inflammation. No limitation of neck movement. Oropharyngeal exam revealed bulging of left posterior pharyngeal wall and tonsil enlargement causing the narrowing of upper airway. Thyroid gland was not enlarged. Other exams included neurological exam were normal. Skin exam revealed multiple ill-defined scaly mild erythematous patches on both legs and dystrophic nails. Initial laboratory results showed anemia with hemoglobin concentration of 9.6 g/L and Hematocrit of 28%, MCV of 75 fl, white blood cell count of 6800 cells/mm3 with 80% neutrophil 7.7% lymphocytes, platelet count of 574,000 cells/mm3. Hemoglobin typing was normal (HbF 0.2% HbA2 2.9% HbA 85.9%; HbA2A). Liver function test showed AST 87 U/L, ALT 97 U/L, ALP 127 U/L, GGT 936 U/L, TB 0.3 mg/dl, DB 0.1 mg/dl, TP 81.2 g/L, Alb 28.7 g/L. Fasting glucose of 95 mg/dL, HbA1C of 4.74%, BUN 14 mg/dL, Cr 1.05 mg/dL, Anti-HIV test was negative. Viral hepatitis profile were negative. His chest X-ray was normal. He was diagnosed with anemia of chronic disease, alcoholic hepatitis, and xerotic eczema. Computer tomography of the neck showed a concealed ruptured of left external carotid artery 0.9 × 1.9 cm in size with surrounding hematoma (3.6 × 3.6 ×5.8 cm) at medial aspect of an aneurysm resulted in narrowing of the upper airway (A, B). Urgent surgical exploration on day 0 revealed severe adhesion around pseudoaneurysm (size 5 × 6 cm) confined around common carotid artery, carotid bifurcation, extended to the angle of mandible. The diameter of pseudoaneurysm neck was one cm, located at medial wall of common carotid artery just distal to carotid bifurcation. External carotid artery was obliterated. Angiogram and balloon occlusion was performed at the left common carotid artery. External carotid artery and internal carotid artery were ligated at the arterial stump just beneath the angle of mandible. Pseudoaneurysm was resected and internal content show pus and clot. Surgical margins were not free in gross section. The pus was sent for bacterial culture. Blood agar plate revealed rare growth of whitish colony, direct exam from the colony revealed broad rare septate fungal hyphae. Infectious disease was consulted on day 5 of admission. Serum antibodies to pythium antigen using an in-house rapid immunochromatographic test were positive on day 5. Sabouraud's glucose agar (SGA) grew fungal colony which identified as P. insidiosum by the induction of motile zoospore and confirmed by fungal broad-range 18S rDNA gene polymerase chain reaction. Pathology of carotid artery revealed acute suppurative inflammation () with branching broad rare septate hyphae demonstrated by Gomori Methanamine Silver stain and Periodic acid-Shiff stain (A) Immunohistochemistry stain for P. insidiosum was positive (B). Medical therapy with oral itraconazole 200 mg oral twice daily combined with terbinafine 250 mg oral twice daily were started on day 5. Adjunctive immunotherapy with subcutaneous injection of PIA vaccine 500 microliter (4 mg/ml) was given on day 6 and 18 of admission. Day 5, Computer tomography of the aorta shows atherosclerotic change without aneurysm or dissection. Postoperatively, physical exams revealed narrowing of upper airway, hypoglossal nerve palsy on the left side without motor deficit. Neurology was consulted on day 6. He was diagnosed with hypoglossal nerve palsy secondary to compression of carotid artery aneurysm. On Day 6, MRI and MRA of the brain revealed pseudoaneurysm of carotid artery at left carotid-parapharyngeal spaces (2.8 × 2.0 × 3.1 cm) associated with extensive inflammation of the surrounding soft tissue resulting in mild narrowing of upper airway. Left common carotid artery was occluded along the origin to the cavernous part of left internal carotid artery with the evidence of wall enhancement. Multifocal cerebritis consistent with cerebral septic emboli and leptomeningeal enhancement at the left cerebral hemisphere (). The patient underwent second exploration of the left neck on day 9 aiming to remove the residual infected necrotic tissue. Operative findings revealed pus with necrotic soft tissue extended to parapharyngeal space, however artery cannot be defined. The radical neck dissection could not be performed due to the morbidity outweigh the possibility of the cure. Tissue specimen revealed identical findings with the first operation. On day 6, the dosage of terbinafine was increased to 250 mg three times daily, itraconazole was continued. The patient and family decided for palliative care, no aggressive treatment. He was discharged on day 19 of hospitalization. On day 29 after discharge, upon an outpatient visit, his family mentioned that he developed progressive right hemiparesis over the two days after discharge. Physical exams revealed healed surgical wound of the left neck, narrowing of upper airway, neurological exams revealed global aphasia, right facial palsy (upper motor neuron), motor power grade I on the right side. His family denied further investigation. He continued to take combination of oral terbinafine, itraconazole and PIA vaccine. On day 49, upon an outpatient visit, he had flaccid hemiparesis on the right side without other deficit. He received fourth dose of PIA vaccine and continued oral itraconazole and terbinafine. On day 82, he expired at a local hospital due to complication of diseases. |
pmc-6022265-1 | 37-year-old woman presented to the emergency room with headache. Bilateral pelvic sensitivity and a mass painful to touch in a plastic texture that filled the Douglas' pouch were detected during the examination; the mass was evaluated in favor of leiomyoma. ß-hcg was negative, wbc was 9800/mm3, hgb was 12 g/dl, htc was 35%, plt was 282000/mm3, and no unusual characteristics was found in complete urinalysis. Ultrasonography revealed a mass consistent with a degenerated myoma measuring 77x82mm, of which subserous component was greater in the posterior wall and endometrial thickness was 7-8 mm, which was concordant with the cycle. The left ovary of the patient was normal, but since the right ovary could not be fully evaluated, computerized tomography (CT) was requested for possible adnexal pathologies. CT demonstrated a hypodense nodular lesion with a diameter of 75 mm that extended to the right adnexal region and MRI with contrast was performed on the patient. MRI revealed a mass with a hypovascular appearance following a heterogeneous and hypointense IV contrast material with a diameter of 8 mm, which appeared to displace the posterior cervix.
It is seen that myoma included by central necrosis depleted by cervix in the posterior part of the uterus. Also the development of necrosis was seen and myomatosis was evaluated in favor of degeneration ().
In addition, since the patient's pain regressed spontaneously during the follow-up, surgical operation was postponed to perform in elective conditions. After making necessary preparations for the operation, laparoscopic myomectomy was performed. Myoma was not considered suspicious apart from being degenerated. It was removed by morcellating in an isolated bag (Figures , , , and ).
No complication or hemorrhage occurred during surgery. As there was not any problem observed during the post-op follow-up, the patient was discharged from the hospital on condition that the pathology report was brought on the second day of post-op. The subsequent report revealed marked cellularity and pleomorphism, extensive necrosis, mitosis >5/10BBA, KI67 proliferation index >%50, weak positivity for p53, and LMS with no detectable lymphovascular invasion.
The patient was informed about the pathology report and interned again to perform transabdominal hysterectomy and bilateral salphingoopherectomy. The pathology report revealed “atypical pleomorphic fusiform cell proliferation area” measuring 3x2 mm in a focal area within the cavity consistent with residual LMS when evaluated together with laparoscopic myomectomy material.
To follow-up the patient was referred to radiotherapy and medical oncologists. After 3 months from her 1st surgery, positron emission tomographic scan (PET-CT) was performed and fluoro-2-deoxyglucose (FDG) uptake is noted in the area above rectosigmoid mesentery towards the left abdominal wall in pelvic floor ().
She was referred to gynecologic oncologist and 3rd operation was performed. A mass about 4-5 cm of size in defined localization was excised; there were not any other mass and lymphadenopathy detected during the surgery. The pathology result was high grade malign mesenchymal tumor with high cellularity, extensive necrosis, mitosis 40/10 BBA, and moderate atypia. There was no tumor in surgical margin. She is now being followed up by the gynecologic oncologist with appropriate medical treatment. |
pmc-6022268-1 | A 75-year-old Caucasian woman, gravida 5, para 3 with past medical history of hypertension, rheumatoid arthritis, and chronic obstructive pulmonary disease arrived to the emergency department looking for relief from dental pain. Neither initial exam nor maxillary plain film showed evidence of cause for facial pain, and she was admitted for further evaluation and pain control. On reevaluation, she was noted to have diplopia and facial droop, so MRI brain along with MRI/MRA of head and neck with and without contrast was ordered to rule out cerebrovascular accident (CVA). CVA was ruled out; however bone marrow lesions involving the left and the right clivus, right Meckel's cave, and posterior margin of the right cavernous sinus were noted ().
CT scans of chest, abdomen, and pelvis with and without contrast were ordered to search for primary malignancy. These studies revealed homogeneous enhancement of the uterus concerning for diffusely infiltrative endometrial carcinoma with associated relatively bulky retroperitoneal adenopathy of the abdomen and bilateral iliac chain adenopathy. In addition, multiple pulmonary nodules were noted along with L sided neck, mediastinal, and right hilar adenopathy ().
Cervical biopsies were obtained disclosing LCNEC of the cervix (). The tumor cells were immunoreactive for neuroendocrine markers synaptophysin and chromogranin. They were also immunoreactive for pancytokeratin and p16, the latter a surrogate marker for the presence of high-risk HPV often seen in these cervical carcinomas. The tumor cells lacked immunoreactivity for estrogen receptors and p63.
She was diagnosed with stage IV LCNEC with distant metastasis. This patient went on to receive palliative radiation to her brain for symptom control and was scheduled to see oncology as an outpatient to discuss treatments. However, due to decline in functional and mental status, she was no longer a candidate for chemotherapy and comfort care was pursued. She died 2 months after diagnosis. |
pmc-6022271-1 | A 61-year-old female presented to hospital with a 2-week history of profound diarrhea and vomiting. The patient also complained of dull abdominal pain that temporarily resolved with bowel movements. She denied fevers, weight loss, exposure to sick contacts, external food sources, and a travel history. There were no extraintestinal manifestations of inflammatory bowel disease (IBD), such as arthralgias, uveitis, episcleritis, oral ulcers, and aphthous ulcers.
She was admitted with an initial diagnosis of viral gastroenteritis and treated with supportive therapy. Stool testing for Clostridium difficile, ova and parasites, viral PCR, and bacterial cultures were negative. A CT abdomen revealed diffuse edematous changes in the ascending colon, transverse colon, and descending colon, as well as hyperemia in the mesentery—indicating colitis.
On her second day of admission, the patient developed bloody diarrhea, prompting a colonoscopy by the gastroenterology service. The colonoscopy revealed severe inflammation with large (0.5–3 cm) deep punched-out ulcers, spontaneous bleeding, bridging mucosa, and patchy erythema affecting 80–90% of the mucosa from the cecum to the transverse colon, with rectal sparing. Several scattered aphthous ulcers were also noted.
Multiple biopsy samples were taken from the colon—they revealed severe chronic colitis with focal areas of ulceration, focal cryptitis, and architectural distortion. Esophagogastroduodenoscopy (EGD) was normal. The results of the colonoscopy were consistent with Crohn's disease, and the patient was treated with intravenous methylprednisolone 80 mg for seven days.
On day 3 of admission, the patient developed fevers, chills, significant right-sided parotid swelling, erythema, and tenderness. Ultrasound of the right neck revealed parotitis with no abscess. Blood cultures revealed MSSA bacteremia, with parotitis being the presumed source. Transesophogeal echocardiogram was negative, and the patient was subsequently treated with supportive therapy and fourteen days of cefazolin.
The patient had a stable clinical course for the next thirteen days. However, on postadmission day 17, the patient developed severe abdominal pain and hemodynamic instability. On examination, the patient's abdomen was diffusely tender and rigid, suggesting peritonitis. Abdominal X-ray revealed features of colitis complicated by perforation. CT abdomen revealed bowel wall edema, pneumatosis, and focal perforation involving the anterior wall cecum/ascending colon, with extensive pneumoperitoneum. The patient was initially resuscitated and taken to the operating room the next day for a laparotomy. Findings in the operating room revealed microperforations of the cecum, large perforation at the splenic flexure, and fecal peritonitis. A subtotal colectomy was performed, as well as intra-abdominal and subphrenic abscesses were drained. The patient remained intubated postoperatively and was transferred to the intensive care unit (ICU). Concurrent blood cultures revealed Enterobacter cloacae bacteremia from an intra-abdominal source, and the patient was treated with intravenous ciprofloxacin. However, the patient remained intubated and required continued use of vasopressors in the ICU. Upon examination, the surgical wound demonstrated signs of infection, which along with the patient's clinical status suggested persistent intra-abdominal sepsis. On hospital day 25, the patient went to the operating room again for a washout of the abdomen and creation of a rectal stump mucous fistula. Tissue cultures revealed growth of Escherichia coli and Enterococcus faecium. Antimicrobical treatment with intravenous meropenem and intravenous metronidazole was commenced, for broad coverage of intra-abdominal abscess and sepsis.
The surgical biopsy from subtotal colectomy revealed extensive diffuse mucosal inflammation, acute ulceration, and mucosal and transmural ischemic changes from the ileum to the distal colon (). The ulcerated area exhibited granulation tissue that contained cells that diffusely exhibited intranuclear inclusions, morphologically and immunohistochemically consistent with herpes simplex virus (HSV-1 and HSV-2) (Figures –). Immunohistochemistry for CMV was negative. The patient was started on treatment with intravenous acyclovir.
Upon physical examination, the patient had developed lesions on the tongue, with visible dry blood. No lesions were seen on the lips. Furthermore, the patient had vesicular eruptions on the lower abdomen and inner thigh. The fluid from the tongue and abdominal lesions was also positive for HSV-2 DNA on a PCR-based assay, thus suggesting a disseminated HSV-2 infection. Viral PCR was negative for HSV-1 and varicella-zoster. The patient received treatment with intravenous acyclovir 10 mg/kg for three weeks.
The patient had a prolonged stay in the ICU spanning 42 days. She continued to make a recovery on the ward, as her hospital stay was further complicated by catheter- and line-related infections, as well as poor nutrition and muscle atrophy. The patient was discharged from the hospital on day 122. |
pmc-6022295-1 | A 56-year-old man was admitted to the hospital with abdominal distension and diarrhea for several days. Physical examination revealed no abnormality. Routine laboratory examinations, bacterial and parasitic stool examinations and viral serology were negative. Chest and abdomen X-ray showed no obvious abnormality. However, endoscopic examination disclosed scattered bubble-like or cystoid nodules, which distributed in transverse colon (Fig. ). Meantime, narrow band imaging (NBI) showed clear texture of intestinal wall vessels (Fig. ). Considered PCI was idiopathic, we used high frequency electrosurgical resection of the gas cysts, and the cysts were collapsed after the gas was discharged (Fig. ). The patient was treated with Bifidobacterium (420 mg/bid) to improve his intestinal function (Table ). We also advised him to eat less gas-producing foods without using any antibiotic. The patient was symptom-free after one week and the lesions disappeared completely after three months of follow-up (Fig. , ). |
pmc-6022295-2 | A 48-year-old woman complained of constipation for 5 days, and then turned into diarrhea with discontinuous abdominal distension. She was hospitalized because of severe diarrhea (7 times/ d) with muco-bloody stools for one week. The stool frequency was five times a day. Her previous medical history revealed exposure to trichloroethylene (TCE) for one year. (Table ) Physical examination at admission revealed extensive abdominal tenderness. Fecal occult blood tests were positive. Other serological markers for autoimmunity and viral serology were normal, as was stool examination for bacteria and parasites. However, abdominal X-ray showed multiple intraluminal gas pockets in the left colon (Fig. ). Coronal reconstruction confirmed the widespread serosal intestinal air cysts involving long segment of colon (Fig. ). Colonoscopy revealed grape-like or beaded subepithelial lesions, and some with erythematous mucosa distributed in the sigmoid. Given the narrowing of the lumen secondary to these lesions the colonoscopy was incomplete (Fig. ). The endoscopic ultrasonography showed low echo of cystic below the mucosal layer (Fig. ). We used high frequency electrosurgical resection of the gas cysts; But considering that extensive endoscopic therapy might lead to infection, we used only partial treatment. Since the narrow lumen of the patient, we restricted her food intake and used parenteral nutrition. One week later, the patient started to have a half-fluid diet. Ornidazole (500 mg/bid) and vitamin B2 (10 mg/bid) were given to regulate intestinal anaerobes, while bifidobacterium (420 mg/bid) was given at intervals of half an hour. We also advised him to eat less gas-producing foods. The patients’ condition improved after 2 weeks (Table ). One month later the lesions disappeared completely (Fig. ) and NBI demonstrated visible patchy erythema and yellow nodules (Fig. ). After four months of follow up, the patient was still no symptoms, and findings at colonoscopy were normal. |
pmc-6022295-3 | A 66-year-old woman was admitted to the gastroenterology ward because of alternate constipation and diarrhea with muco-bloody stools. She had a history of undifferentiated connective tissue disease (UCTD) for 20 years and aplastic anemia (AA) for 1 year. In the past, she was mainly treated with glucocorticoid, and subsequently developed AA. Recently she presented with a diffuse pain in the abdomen with muco-bloody stools. Physical examination at admission revealed extensive abdominal tenderness. The biochemical tests revealed cytopenia due to AA and no obvious abnormality in stool culture for pathogens. Blood cultures were also negative. Computer tomography (CT) examination showed no portal venous gas embolism (Fig. ). Colonoscopic examination disclosed line or pebble like sessile cysts and irregular forms, which mainly distributed in sigmoid (Fig. , ). Irregular forms of PCI with large bulge should be distinguished from malignant tumor (Fig. ). Given the narrowing of the lumen secondary to these lesions, the colonoscopy was incomplete. The pathologic findings revealed submucosal cystic structure (Fig. ). We used high frequency electrosurgical resection of the gas cysts. Because of the history of AA, she was treated with aluminum phosphate (20 g/bid) and bifidobacterium (420 mg/bid) without any antibiotics. We also advised him to eat less gas-producing foods. Symptoms of diarrhea improved significantly after one month, and gas-filled cysts became flattened (Fig. ). After ten months of follow-up the clinical symptoms were still resolved. |
pmc-6022295-4 | A 72-year-old woman complained of constipation for several days, and then turned to diarrhea for one month. She was hospitalized for muco-bloody stools and severe abdominal distension. She had a history of diabetes for 10 years and was mainly treated with acarbose and insulin. Physical examination at admission revealed extensive abdominal tenderness. Routine laboratory examinations, bacterial and parasitic stool examinations and viral serology were negative. Abdominal X-ray showed multiple intraluminal gas pockets in sigmoid and ascending colon. Computer tomography (CT) examination showed multiple polypoid lesions of the colon (Fig. ). Colonoscopy showed irregular forms of lesions that were covered with mucosa of normal appearance in sigmoid and ascending colon (Fig. ). Irregular forms of PCI and mucosal lesions with erosion should be distinguished from Crohn’s disease. Given the narrowing of the lumen secondary to these lesions, the colonoscopy was incomplete. NBI showed mucosal redness, which appeared as punctate labelling, and the blood vessels of intestine were clear (Fig. ). We used high frequency electrosurgical resection of the gas cysts. She was banned from using acarbose, continued to use insulin treatment for diabetes. The patient was initially treated with ornidazole (500 mg/bid) and bifidobacterium (420 mg/bid). In view of the older age of the patient and a history of diabetes, the antibiotic was changed to rifaximin (200 mg/qid) to avoid antibiotic resistance. We also advised him to eat less gas-producing foods. The patients’ condition was improved after one month and the findings at endoscopy were improved (Fig. ). After 6 months of follow up, the cysts gas disappeared (Fig. ). |
pmc-6022295-5 | A 64-year-old man was admitted to the hospital with wheezes and exertional dyspnea, which he had suffered from for several months, but without abdominal symptoms. He was diagnosed with emphysema pulmonum 1 years ago. Physical examination revealed double diffuse rales. Serological markers for autoimmunity and viral serology were normal, so as was the stool examination. Chest CT showed centrilobular emphysema, pulmonary field scattered in small circular distribution (Fig. ). A chest X-ray and CT examination showed the improvement of emphysema pulmonum. Endoscope showed stenosis due to gas cyst in duodenal descending (Fig. ). Emphysema as the primary disease, it is mainly used seretide for treatment. The PCI was treated successfully with intensive (but not hyperbaric) oxygen therapy and bifidobacterium (420 mg/bid). The findings at endoscopy were improved after eight months of follow-up (Fig. ). |
pmc-6022295-6 | A 27-year-old woman was hospitalized because of ascites and abdominal pain for 3 months. She was diagnosed as Budd-Chiari syndrome (BCS) before admission. Physical examination at admission revealed pronounced abdominal tenderness and abdominal mass. Routine laboratory examinations, bacterial and parasitic stool examinations and viral serology were negative, while the level of serum C125 increased significantly up to 1560 U/ml. Abdominal X-ray and Abdominal CT showed a large presence of ascites in the abdomen (Fig. ). CT showed massive hydrops of abdominal cavity, multiple intraluminal gas pockets in the rectum and ovarian mass (Fig. ), which was limited to the ovarian surface without invasion. Abdominal ultrasonography revealed massive hydrops in the abdominal cavity, and abdominal paracentesis indicated bloody ascites. Colonoscopy showed grape or beaded lesions (Fig. ). Finally, primary peritoneal carcinoma (PPC) was diagnosed by peritoneal biopsy. After this the patient was given nutritional support. Finally, she was transferred to a hospital near her home and unfortunately died. |
pmc-6022300-1 | The patient was a 70-year-old female whose past medical history was significant for arthritis and a right total hip arthroplasty approximately 9 years ago. A laparoscopic cholecystectomy (LC) for acute cholecystitis was performed approximately at another hospital approximately two months prior to presentation. She developed a surgical site infection with Escherichia coli (E. coli) bacteremia following her LC and was treated successfully with intravenous (IV) antibiotics. The postoperative course was also complicated by choledocholithiasis requiring an endoscopic retrograde cholangiopancreatography (ERCP) with stone pulverization and placement of two plastic 10F × 12 cm biliary stents. Two days prior to admission, she was hospitalized at an outside facility in septic shock with fevers, chills, lethargy, altered mental status, and blood and urine cultures positive for E. coli. At that time, she endorsed right hip pain and an inability to move her hip or leg. A computed tomography (CT) scan of her right hip revealed two partly calcified soft tissue masses associated with the right iliopsoas and obturator internus muscles (). A CT-guided fine needle biopsy of the right hip and psoas locules aspirated 100 mL of frank pus notable for a nucleated cell count of 344,000 (98% PMNs) with growth of E. coli. As a result, the patient was transferred to our institution with concerns for an iliopsoas abscess and a periprosthetic infection.
On admission, she was febrile to 102.7 F without any significant distress. Her physical examination was remarkable for a well-healed, right lateral hip incision with no erythema or drainage. She experienced pain with right hip flexion and internal rotation. Laboratory studies showed WBC, hemoglobin and hematocrit, basic metabolic profile, and liver function tests all within normal limits. A 3 cm hepatic abscess was identified on CT scan of the abdomen and pelvis. An MRI of the right hip showed a large air- and fluid-filled collection tracking along the iliopsoas bursa and psoas musculature into the pelvis (). This collection communicated with the hip prosthesis, and on CT imaging, the acetabulum component appeared to be medialized beyond the medial wall of the acetabulum as depicted in . Regarding the hepatic abscess, the patient was managed with IV antibiotics and interventional radiology (IR) placed drainage catheter.
To address the hip periprosthetic infection, the patient was managed in multiple surgical stages. In the first stage, an irrigation and debridement of the right hip and explantation of components were performed through an anterior approach. The femoral and acetabular components were explanted. Purulent material was seen draining from the pelvis through a medial acetabular wall defect into the hip joint. Approximately 1 liter of pus was evacuated from the hip joint. Multiple irregularly shaped granulated pea-sized pieces of hard brown substance were found deep in the acetabulum. A handful of this material was removed which suggested that these were spilled gallstones from the patient's recent LC.
Temporary components were replanted with an antibiotic impregnated cement spacer system [] (Figures and ). An antibiotic cement spacer with gentamicin was placed in the acetabulum defect, and a loosely fitted antibiotic-cemented stem was placed in the proximal femur.
The intrapelvic iliopsoas collection could not be fully debrided through the anterior approach, and IR was consulted for drain placement and serial debridements, which were conducted with a rotating basket Trerotola device over the course of the next four weeks. In , contrast dye can be seen tracking from within the iliopsoas abscess into the hip joint.
Four weeks following her explantation, the patient returned to the operating room for placement of a second temporary weight bearing custom-fitted prosthesis made from methyl methacrylate with gentamicin-impregnated antibiotics [] (Figures and ). For the acetabulum, methyl methacrylate was molded in its doughy state into the cavities and deformities of the acetabulum, and a polyethylene acetabulum was pressed into the cement. The femur was reamed to size of a large diameter chest tube. A femoral stem and a reinforcing wire were cemented into the chest tube, and once the cement was hardened, the femoral stem encased in a solid cylinder of bone cement was removed from the chest tube and malleted into the proximal femur.
Postoperatively, the patient did well. She was made weight bearing as tolerated, ambulated with physical therapy and elected to delay placement of permanent components. She was eventually discharged to a short-term rehabilitation facility with a 6-week course of IV antibiotics.
Approximately 18 months later, she presented to our clinic complaining of hip and thigh pain with ambulation. She was followed by infectious disease as an outpatient with multiple hip aspirations which had negative cultures. X-rays revealed her temporary prosthesis to be stable, but with radiolucencies primarily around the femoral component (). The patient was taken to the operating room, the temporary prosthesis was removed, and a long porous coated system was inserted (). Intraoperative cultures grew vancomycin-resistant enterococcus (VRE), and the patient was eventually discharged to home with a 12-week course of daptomycin and outpatient physical therapy. Now, two years from her initial explantation, she continues to follow up monthly in our clinic and states that she is doing well. Her final construct is shown in . She continues to have a moderate limp but ambulates without assistive devices. Her pain is much improved and she is no longer on chronic antibiotic suppression with no clinical signs or symptoms of recurrent infection. |
pmc-6022304-1 | A 50-year-old female patient presented with a one-week history of decreased vision in her left eye. She had a 15-year history of seropositive RA treated with methotrexate and deflazacort. Because of an unsatisfactory response to those regimens, she was initiated on 25 mg per week of etanercept 8 months prior to presentation.
On presentation, her best-corrected visual acuity (BCVA) was 0.8 OD and 0.1 OS. There were no cells in the anterior chamber of either eye. Funduscopic examination showed granular infiltration at the temporal macula in the right eye and the foveal area in the left eye (Fig. ). Spectral-domain optical coherence tomography showed a swollen ellipsoid zone and retinal pigment epithelium (RPE) irregularities in the right eye and an ellipsoid zone disruption and RPE irregularity in the left eye (Fig. ). Fundus autofluorescence showed parafoveal granular hyperautofluorescence in both eyes (Fig. ).
Based on the negative results of various blood tests, she was diagnosed with noninfectious uveitis and started on oral prednisolone. She noticed mild improvement 1 month after treatment, but 2 months after treatment she showed a visual loss to 0.1 in her right eye. Compared with the initial visit, the swollen ellipsoid zone area extended under the fovea and subRPE yellow-white deposits were newly developed in the inferotemporal area (Fig. ). Also, mild vitreous opacity with haziness was noticed in the right eye. We suspected primary intraocular lymphoma (PIOL), and a 25-gauge microincision vitrectomy in right eye was performed. Vitreous cytology revealed atypical mononuclear cells with positive CD20 immunostaining. PCR of the vitreous fluid was negative for herpes and cytomegalovirus.
The patient was evaluated by an oncologist, and no lymphoma involvement in the brain was found. She was treated with high-dose systemic methotrexate as well as intravitreal methotrexate injections (400 μg/0.1 mL) twice weekly for 4 weeks for induction, once weekly for 8 weeks, and once monthly for 9 months in the right eye. Given the potential causal relationship between PIOL and anti-TNFα agents, etanercept was discontinued.
Three months after treatment, her right eye showed a decrease in subretinal infiltration and subRPE deposits, which further resolved at 6 months following treatment (Fig. ). Over the course, her left eye also showed gradual improvement in funduscopic examination as well as SD-OCT findings without intravitreal methotrexate injection, potentially due to systemic chemotherapy. Because of severe photoreceptor disruption, BCVA was 0.1 OD and 0.4 OS at the final visit. |
pmc-6022308-1 | A 20-year-old African American man was admitted to a psychiatric facility for psychosis. On initial presentation, the patient had an antalgic gait, which he attributed to his history of dopa-responsive dystonia. His mood was depressed and his affect was restricted. He had disorganized thought process and was slow to recall. He endorsed auditory hallucinations, paranoid delusions, depressive symptoms, frequent night awakenings, and persecutory nightmares. Per the ambulance report, the patient was wandering the streets in a confused state, so bystanders called 911. The patient stated that he had been homeless for the past 3 weeks. During this 3-week period, he admitted to not being complaint with his medications. Urine toxicology screen was negative.
Per medical records, he was diagnosed with dopa-responsive dystonia at age 11 after a 2.5-year history of progressive abnormal gait. He was initially misdiagnosed with tight heel cords at age 10 and treated with serial casting that resulted in good improvement on the right but marginal improvement on the left. His toe walking became more pronounced overtime accompanied by worsening left calf pain and stiffness, increasingly frequent falls, and new onset of intermittent torticollis. These symptoms worsened over the course of the day. He was eventually taken to an urban teaching hospital, where he was diagnosed with dopa-responsive dystonia based on clinical presentation and marked improvement on a levodopa trial. Magnetic resonance imaging of the brain and spine was unremarkable at the time.
At age 15, he was diagnosed with schizoaffective disorder bipolar type. His psychiatric history is also significant for multiple psychiatric hospitalizations, history of previous suicide attempts with medication overdose, and history of trauma. He also endorsed marijuana use since age 15 and daily tobacco use since age 18. He denies using any other illicit drugs. Per collateral information from his mother, his schizoaffective disorder has never been well controlled given the conflicting effects of his medications. She also mentioned that he was placed in individualized education programs as a child due to learning disabilities. His family history is significant for bipolar disorder on his maternal side. His family history on his paternal side is unknown. In addition to carbidopa-levodopa, his outpatient medications included sertraline, divalproex sodium, aripiprazole, and benztropine.
On hospital day 1, he was started on carbidopa-levodopa 25/100 mg tablet three times daily for dopa-responsive dystonia. On day 2 of his hospital course, sertraline 50 mg once daily, benztropine 2 mg twice daily, divalproex sodium 500 mg twice daily, and risperidone 0.5 mg twice daily were added to his medication regimen. We started him on a low-dose risperidone to avoid exacerbating his dopa-responsive dystonia symptoms. Physical exams were also performed daily to assess for dystonia and parkinsonian symptoms. His initial physical exam revealed an antalgic gait secondary to left lower extremity dystonia, which improved by hospital day 2 and resolved by hospital day 3. On hospital day 3, he became agitated and aggressive with staff members, which led to intramuscular administrations of haloperidol 10 mg, diphenhydramine 50 mg, and lorazepam 2 mg. He continued to endorse auditory hallucinations, so risperidone was increased to 0.5 mg in the morning and 1 mg at bedtime. His auditory hallucinations resolved and then returned on day 6. He reported hearing “good” voices and “bad” voices. He also continued to endorse depressive symptoms, multiple night awakenings, and persecutory nightmares. As a result, his risperidone dosage was increased to 1 mg twice daily. On hospital day 7, the patient reported hearing “mumbling” voices only and improvement in his sleep and depressive symptoms. On hospital day 8, his auditory hallucinations fully abated. By hospital day 10, he slept throughout the night, no longer had depressive symptoms, and had normal spontaneous speech. His thought process was linear, logical, and goal-oriented. His mood and affect was euthymic and full range. No psychotic symptoms were noted. The patient was compliant with his medications throughout the whole hospital course and his daily physical exams were negative for dystonia or parkinsonian symptoms since day 3 of his hospitalization. He was subsequently discharged on hospital day 14 with appropriate outpatient follow-up. |
pmc-6022317-1 | An 82-year-old Caucasian male was admitted to our hospital in December 2016 with dyspnea, hemoptysis, and impaired general condition. He also presented with pseudoparalysis of his left shoulder due to severe pain. The medical record included ischemic heart disease (coronary artery bypass grafting in 1994), atrial fibrillation, low malignant prostate cancer, gout, and diabetes mellitus type II. Six months prior to admission, the patient had all teeth in his upper mouth removed prior to being fitted with dentures. This dental procedure was complicated with severe inflammation, and the patient was treated several times with oral antibiotics.
On admission, the patient was septic with fever and in a condition with pulmonary congestion and bilateral oedema in his lower limbs. Vital parameters included a blood pressure of 148/62 mmHg, a heart rate of 84 beats/min, oxygen saturation of 81% without oxygen supplementation, respiratory frequency at 26 per minute, and a rectal temperature of 38.8°C. Arterial blood gasses showed a normal pH (7.44), low partial pressure of carbon dioxide (3.5 kPa) and oxygen (7.2 kPa) in arterial blood, and low oxygen saturation (89%). On physical examination, the patient's left shoulder was tender and warm and had an anterior nonerythematous swelling. Cardiac auscultation did not reveal any murmur, and the neurologic examination was normal. The electrocardiogram revealed normofrequent atrial fibrillation and right bundle branch block.
The initial blood samples showed leucocytosis (14.7 × 109/L) with dominance of neutrophilic granulocytes, haemoglobin level of 7.1 mmol/L, and C-reactive protein (CRP) of 216 mg/L.
Chest X-ray showed no infiltrates but was consistent with pulmonary stasis. An X-ray of the left shoulder showed no signs of inflammation.
Blood cultures (three bottles with 10 ml each) and two samples of synovial fluids from the left shoulder were sent to the laboratory. Next day, growth of Gram-positive cocci was seen in one of the three blood culture bottles and in both synovial fluids. Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) was performed on all three isolates using Microflex™ LT MALDI-TOF-System (Bruker, Karlsruhe, Germany; two databases: 1829023 Maldi Biotyper Compass Library and 8254705 Security ref. Library 1.0 for MALDI Biotyper 2.0), and they were diagnosed as S. equi subspecies zooepidemicus with a score between 2.37 and 2.63. Whole-genome sequencing of the blood culture isolate was performed by 251-bp paired-end sequencing (MiSeq; Illumina) and confirmed the species and subspecies type diagnosed by MALDI-TOF MS. The isolate carried a novel sequence type (ST379), and a phylogenetic analysis using FastTree v2.1.5 of the concatenated MLST alleles () found it to cluster in a branch containing ST60, ST135 and ST162. An analysis using the iTOL implementation at revealed that seven related isolates with those ST types were reported in the database from various hosts (cow (n=1), dog (n=1), and horse (n=5)). The sequence data has been uploaded to ENA with the following Study and Read accession IDs: PRJEB24181 and ERR2233447, respectively. Antibiotic susceptibility testing using the Epsilometer test (E-test) (bioMérieux, Marcy-l'Etoile, France) showed that the isolate was susceptible to penicillin (0.016 microgram/ml), ampicillin (0.032 microgram/ml), amoxicillin (0.047 microgram/ml), cefuroxime (0.016 microgram/ml), erythromycin (0.094 microgram/ml), clindamycin (0.38 microgram/ml), vancomycin (0.5 microgram/ml), imipenem (0.012 microgram/ml), and rifampicin (0.012 microgram/ml). The isolate was intermediate susceptible to gentamicin (12 microgram/ml).
Antibiotic treatment the first two days was intravenous cefuroxime 1.5 gram administered three times daily, which was changed to intravenous high-dose benzylpenicillin, initially a dose of 2 million international units (IU) four times a day. The monotherapy with benzylpenicillin was supplemented with intravenous gentamicin in intervals (five days in total). On day three, transthoracic and transesophageal echocardiography (TTE and TEE, resp.) demonstrated a vegetation on the aortic valve () with a minimal aortic insufficiency. There were no signs of paravalvular abscesses and no stenosis of the affected valve. Ejection fraction was normal. The patient was diagnosed with aortic valve endocarditis without indication for acute operation. According to the national Danish guidelines for infective endocarditis, the benzylpenicillin dosage was increased to 5 million IU four times a day.
On day three, CRP levels were increasing as well as the pain and oedema in his left arm. On day five, arthroscopic revision of the left shoulder was performed and three biopsies were taken, but none of these cultures showed further growth of the pathogen. The rotator cuff was almost completely degenerated, and the humeral head was devoid of its hyaline cartilage. Ten days later technetium-99m bone scintigraphy showed intense activity in the left shoulder, suspicious of osteitis (). The bone scintigraphy revealed no other focus of infection. On day 17, control transesophageal echocardiography was performed. At this time, the examination showed no suspicious signs of endocarditis, and the vegetation that was previously seen on the aortic valve could not be visualised.
The patient was sent to a dentist, which did not reveal any oral focus. The patient's clinical condition improved gradually, and he was discharged from our hospital after five weeks (36 days) with oral antibiotics (oral amoxicillin 1 g × 3 pr. day and oral rifampicin 600 mg × 2 pr. day) for further two months. In total, he received antibiotics for almost three months (87 days). During the admission, the patient lost approximately 17 kilograms in weight, primarily fluid associated with his septic condition as well as fluid from some of degree cardiac decompensation and lung stasis.
The patient was followed up in the Out-Patient Clinics for Infectious Diseases and Cardiology, which included blood samples and control transthoracic echocardiography. None of the subsequent examinations indicated signs of recurrence. The patient regained normal function in his left shoulder.
The patient reported that he had daily contact with animals including horses, though he did not recall any illness in the four horses he had taken care of the past year. He denied consuming unpasteurized milk products. |
pmc-6022326-1 | A 34-year-old male was admitted to the hospital with recurrent episodes of retrosternal chest pain, fatigue, and shortness of breath with an elevated troponin T. He had suffered an acute episode of myocarditis four years previously requiring hospital admission. He had no other relevant medical history and no family history of cardiac disease. He is a nonsmoker and consumed alcohol occasionally. Clinical examination was unremarkable and did not show any evidence of heart failure or systemic disease. ECG showed normal sinus rhythm without any ischemic changes, and chest X-ray showed no evidence of infection or heart failure. Routine blood tests including antinuclear antibody, creatinine kinase (CK), rheumatoid factor, and C-reactive protein were all within normal limits apart from an elevated cardiac troponin T with a peak value of 2700 ng/l (<14 ng/l). Further extensive inflammatory, viral, and autoimmune screening was carried out and found to be negative. Subsequent coronary angiogram showed normal coronary arteries, and transthoracic echocardiography demonstrated left ventricular ejection fraction (LVEF) >55% with trace mitral regurgitation. Cardiac magnetic resonance imaging (MRI) demonstrated extensive subepicardial and midwall late enhancement typical of myocarditis in the anterior, lateral, and inferior walls along with extensive fibrosis with normal LVEF ().
A short course of steroids and anti-inflammatory medication as an inpatient resulted in the resolution of his myocarditis symptoms. The troponin T level normalized and the patient was discharged with a plan to repeat cardiac MRI in six months. On follow-up as an outpatient, it was decided to refer the patient to rheumatology for an opinion regarding ongoing immunomodulatory therapy. At this juncture, the patient stated that he also had symptoms of stiffness and aching in his calf muscles for quite some time but he did not consider it to be relevant. Despite persistently normal skeletal muscle enzyme levels, an MRI of the lower legs was performed and this showed active myositis involving the gastrocnemius muscles bilaterally (). As the patient was demonstrated to have ongoing myositis despite minimal symptoms, and as he had accrued significant myocardial scarring from previous episodes of myocarditis, it was decided to commence long-term immunomodulatory therapy in the form of methotrexate and prednisolone. Clinically, the patient reported a significant improvement in his symptoms and a repeat of the lower limb MRI demonstrated a significant interval improvement in his skeletal muscle myositis. Six months later, a repeat of the cardiac MRI demonstrated resolution of myocarditis along with persistent, stable, and extensive myocardial fibrosis and preserved LVEF (). The patient is tolerating the immunomodulatory therapy well without major side effects, and he has returned to full-time work. |
pmc-6022338-1 | A 36-year-old woman with a history of obesity, hypertension, anxiety, and recurrent urinary tract infections (UTI) was admitted to the hospital with history of dyspnea, fever, cough, and abdominal pain for 4 days.
Prior to this admission, the patient presented to urology with recurrent UTIs and was determined to have a left staghorn renal calculus. Recommendations were for the patient to undergo surgical removal of the stone; however the patient refused due to risk of complications associated with her obesity. Up until this admission, the patient had experienced numerous UTIs, most with multidrug resistant bacteria, and had undergone multiple courses of antibiotics.
On examination, the patient was dyspneic. The temperature was 100.6 F, the pulse 105 beats per minute, the blood pressure 107/57 mmHg, the respiratory rate 20 per minute, and the oxygen saturation 100% on room air. Complete blood count was significant for a white cell count of 5.8 x 103 per μL. Comprehensive metabolic panel was significant for creatinine 0.76 mg/dL, lactate dehydrogenase 249 IU/L, albumin 3.3 g/dL, and total protein 6.7 g/dL. Chest X-ray (CXR) showed a large left sided pleural effusion with no consolidation (Figures and ). Computed tomography (CT) of the abdomen and pelvis showed an enlarged left kidney with left staghorn calculus in the middle and lower portions of the kidney with an appearance suggestive of xanthogranulomatous pyelonephritis (Figures and ). At this time, a diagnostic thoracentesis was performed yielding lactate dehydrogenase 656 IU/L, total protein 4.5 g/dL, amylase 30 U/L, triglycerides 50 mg/dL,, glucose 105 mg/dL, pH 7.56, and creatinine 0.8 mg/dL. Cultures and cytology of pleural fluid were negative. Pleural fluid was determined to be exudative by Light's criteria as the lactate dehydrogenase was found to be greater than two-thirds the upper limits of our laboratory's normal value []. Urine cultures obtained grew extended spectrum beta-lactamase Escherichia coli and the patient was started on appropriate antibiotic treatment. Urology service was consulted.
After obtaining a nuclear medicine renal scan with intravenous technetium 99m MAG3 showing significant decrease in left kidney function, the urology consultant recommended and performed a robot-assisted nephrectomy. There was no fistula into the hemithorax identified at the time of nephrectomy. Following this, the patient had a complete resolution of the urinothorax with no evidence of recurrence on follow-up CXR. |
pmc-6022339-1 | A healthy 39-year-old Japanese man presented to a local clinic with a 1-month history of a painless mass in his left neck. A needle biopsy was performed, and the results indicated the possibility of an atypical lipomatous tumor. Subsequently, he was referred to our hospital. Physical examination revealed a hard and mobile mass in the left neck, measuring approximately 10 × 10 cm. Plain X-ray radiographs showed a soft tissue mass with no calcification in the left neck (Fig. ). MR images showed a well-defined and lobulated mass (Fig. a–d). On T1-weighted images, the mass had heterogeneity, with a higher signal intensity than that of muscle (Fig. a). On T2-weighted images, the septum had low-signal intensity (Fig. b). On T2-weighted fat-suppressed images, the signal of the mass was completely suppressed (Fig. c). On gadolinium-enhanced T1-weighted images, the signal from the mass was enhanced (Fig. d). The SUVmax value of the mass on FDG PET was 1.84, with no abnormal uptake except in the mass (Fig. ). An additional needle biopsy was performed in our hospital, and evaluation of the results resulted in a diagnosis of well-differentiated liposarcoma. The mass was resected marginally because it was considered a low-grade tumor. Macroscopically, the mass was encapsulated and markedly harder than a well-differentiated liposarcoma (Fig. a). The cut surface of the mass was yellowish and lobulated. Histologically, the tumor was composed of myxoid and cartilaginous matrix, and mature fat cells and lipoblast-like cells were present (Fig. b, c). Immunohistochemical analysis showed that the tumor cells were negative for CDK4, MDM2, MIB1, and Sox9. On the basis of these findings, we arrived at a final diagnosis of chondroid lipoma. There was no recurrence at 1 year after surgery. |
pmc-6022350-1 | A 20 year old gravida 1, para 0, female of Salvadoran descent was referred to nephrology for deteriorating kidney function and the nephrotic syndrome at 22 weeks gestational age (GA). Past medical history included a diagnosis of juvenile rheumatoid arthritis at age 12 treated with nonsteroidal anti-inflammatory drugs (NSAIDs) with resolution of symptoms into adulthood without therapy. The patient also endorsed pre-conception use of intranasal cocaine and cigarettes with no use (documented on urine drug screen) post conception. Medication use included prenatal vitamins, diclectin and acetaminophen. The patient reported a family history of rheumatoid arthritis diagnosed in her mother and maternal grandmother.
At presentation the patient’s serum creatinine was 177 μmol/L compared to a previous creatinine of 82 μmol/L three months earlier and a pre-pregnancy value of 56 μmol/L. She endorsed progressive lower limb edema beginning in early pregnancy. A history of tea coloured urine, epistaxis and sinus pressure was elicited. She did not have hemoptysis or rash but endorsed arthralgias in her shoulders, wrists, distal interphalangeal joints and ankles.
On examination her blood pressure was 116/60 mmHg. Relevant examination findings included pitting edema to the knees bilaterally. There were no active joints or rash.
24-h urine for protein yielded 9.81 g with > 100 RBC/hpf seen on microscopy. Urine albumin to creatinine ratio was 450 mg/mmol. Urine drug screen was negative for cocaine. Serum albumin was 20 g/L, antinuclear antibody 1:80, double stranded DNA negative, extractable nuclear antigen negative, C3, C4, normal and rheumatoid factor, cyclic citrullinated peptide negative, C-reactive protein 13 (normal < 10). HIV, Hepatitis B and C serology were negative. ANCA serology was positive with MPO antibody tire of 107.7 Antibody Index (AI) (normal < 20).
Renal ultrasound revealed structurally normal kidneys. Obstetrical ultrasound revealed mild intrauterine growth restriction (IUGR). Chest x-ray was unremarkable.
Renal biopsy was performed urgently with a diagnosis of pauci immune glomerulonephritis. Three of 14 glomeruli on light microscopy contained cellular crescents, 4 glomeruli fibrous crescents, 1 globally sclerosed. Up to six glomeruli contained segmental sclerosis with only five to 10 % interstitial fibrosis and tubular atrophy.
The patient was counselled regarding the maternal and fetal risks associated with her diagnosis and her therapeutic options including termination and elected to continue with the pregnancy. In particular, the risk of progression of renal impairment and potential requirement of dialysis during pregnancy were discussed, in addition to the high risk of preeclampsia and preterm labour if the pregnancy was continued. The patient was treated with methylprednisolone 1 g IV daily × 3 followed by oral prednisone 70 mg daily dosed by ideal weight and then Rituximab 650 mg IV weekly for four weeks. No infusion reactions to Rituximab were noted. The patient developed diffuse striae distensae which may have been a result of the high dose prednisone in the context of pregnancy and weight gain. Serum creatinine continued to rise throughout pregnancy to 250 μmol/L, despite a reduction in proteinuria to a urine albumin creatinine ratio of 125 mg/mmol and improvement in symptoms. At 27 weeks GA, the patient became hypertensive necessitating use of labetalol therapy. She was initiated on erythropoietin for anemia. The patient developed thrombocytopenia which was felt to be immune mediated in nature with a nadir of 64. Repeat obstetrical ultrasounds revealed normalization of fetal growth.
Delivery occurred at 29 weeks GA via caesarean section for worsening maternal headache and visual disturbance concerning for preeclampsia and worsening renal function with serum creatinine of 275 μmol/L. Maternal CD19+ cells were depleted at time of delivery. Neonatal birth weight was 1010 g and the neonate spent 10 weeks in the neonatal intensive care unit before discharge in healthy condition. Neonatal CD19+ cell levels were depleted at birth with associated transient lymphopenia without infectious complications. After delivery, the patient’s creatinine rose to a value of 375 μmol/L (eGFR 14 ml/min) at 11 weeks post partum. Prednisone was tapered slowly to 10 mg daily and the patient was initiated on azathioprine maintenance therapy four months after Rituximab induction and titrated up to a dose of 2 mg/kg/day. At the time of maintenance therapy initiation, the MPO titer was 5.8 Units (normal < 1). |