text
stringlengths 18
152k
| meta
dict |
|---|---|
Please find attached the EGM Management Summary and Hot List as of 11/16.
Please contact me if you have any questions/comments.
Thanks,
Jeff
---------------------- Forwarded by Jeff Smith/HOU/ECT on 11/17/2000 04:37 PM
---------------------------
From: Patricia Anderson 11/17/2000 11:00 AM
To: Jeff Smith/HOU/ECT@ECT
cc:
Subject: 11/16 Mgmt Summary & Hot List REVISED
For distribution
Patricia | {
"pile_set_name": "Enron Emails"
} |
From dissipative dynamics to studies of heat transfer at the nanoscale: analysis of the spin-boson model.
We study in a unified manner the dissipative dynamics and the transfer of heat in the two-bath spin-boson model. We use the Bloch-Redfield (BR) formalism, valid in the very weak system-bath coupling limit, the noninteracting-blip approximation (NIBA), applicable in the nonadiabatic limit, and iterative, numerically exact path integral tools. These methodologies were originally developed for the description of the dissipative dynamics of a quantum system, and here they are applied to explore the problem of quantum energy transport in a nonequilibrium setting. Specifically, we study the weak-to-intermediate system-bath coupling regime at high temperatures kBT/ħ > ε, with ε as the characteristic frequency of the two-state system. The BR formalism and NIBA can lead to close results for the dynamics of the reduced density matrix (RDM) in a certain range of parameters. However, relatively small deviations in the RDM dynamics propagate into significant qualitative discrepancies in the transport behavior. Similarly, beyond the strict nonadiabatic limit NIBA's prediction for the heat current is qualitatively incorrect: It fails to capture the turnover behavior of the current with tunneling energy and temperature. Thus, techniques that proved meaningful for describing the RDM dynamics, to some extent even beyond their rigorous range of validity, should be used with great caution in heat transfer calculations, because qualitative-serious failures develop once parameters are mildly stretched beyond the techniques' working assumptions. | {
"pile_set_name": "PubMed Abstracts"
} |
The Best Books - All The Best Books You Need
Stay with Me: A novel
Yejide and Akin have been married since they met and fell in love at university. Though many expected Akin to take several wives, he and Yejide have always agreed: polygamy is not for them. But four years into their marriage–after consulting fertility doctors and healers, trying strange teas and unlikely cures–Yejide is still not pregnant. She assumes she still has time–until her family arrives on her doorstep with a young woman they introduce as Akin’s second wife. Furious, shocked, and livid with jealousy, Yejide knows the only way to save her marriage is to get pregnant. Which, finally, she does–but at a cost far greater than she could have dared to imagine. An electrifying novel of enormous emotional power, Stay With Me asks how much we can sacrifice for the sake of family. | {
"pile_set_name": "Pile-CC"
} |
The conventional method for attaching hardware, such as support brackets and rings for alternate path shunt tubes and bladed centralizers, to oilfield sand screen tubulars and other downhole equipment involves welding such components directly to the production tubular. Welding creates residual stresses in the tubular that can eventually lead to stress or corrosion cracking, surface cracks, and other defects that can ultimately result in the failure of the tubular. However, most welding procedures generally include a post-weld heat treatment designed to minimize the residual stresses and increase the strength of the tubular near the weld joint by re-homogenizing the crystalline structure of the tubular material. However, with increasingly sophisticated metallurgy, such as 25CR-125ksi material commonly used in downhole applications, regaining vital strength properties of the tubular is simply not possible through post-weld heat treatments. Consequently, in applications using modem metallurgy, welding directly to the production tubular will ultimately result in the tubular having reduced strength characteristics as a result of the residual stresses on the tubular.
Moreover, in order to comply with downhole drilling regulations, the tubular weld must also be thoroughly inspected in an effort to identify any weld defects that could eventually propagate into cracks and lead to tubular failure. This inspection is commonly undertaken via non-destructive weld examination methods, such as liquid penetrant inspection. Like many other non-destructive weld inspection methods, liquid penetrant inspection requires an in-depth system of quality control documents, traceability, and personnel training which are inherently time consuming and cost prohibitive for many applications.
There is a need, therefore, for a system and method of attaching downhole equipment hardware to production tubulars without welding such equipment thereto and thereby compromising the structural integrity of the tubular and requiring costly post-weld treatments or inspections. | {
"pile_set_name": "USPTO Backgrounds"
} |
Introduction
============
Diabetes mellitus is a common endocrine metabolic disease estimated to affect 629 million individuals in 2045 according to the International Diabetes Federation. T2DM is the extremely prevalent form of diabetes that accounts for 90% of diagnosed cases and is associated with insulin resistance and chronic hyperglycemia ([@B13]). Many clinical studies reported a broad spectrum of lower urinary tract symptoms in diabetic patients ([@B16]), accounting for 90--95% of all diabetes cases ([@B17]). DBD is a major lower urinary tract complication of diabetes and was first described by [@B26]. Such complication is traditionally described as a triad of increased capacity, decreased sensation, and poor emptying ([@B11]) and has affected over 50% of diabetic patients ([@B12]; [@B28]). DBD development is divided into two phases: the compensated phase, which occurs in the early phase and is characterized by an OAB; and the decompensated phase, which occurs in the late phase and is characterized by an atonic bladder ([@B36]; [@B24]).
The pathogenesis of DBD is multifactorial and accompanied by the structural and functional impairments of the bladder ([@B37]). The bladder structural remodeling of DBD, such as the increase in bladder capacity, total BWT, and smooth muscle content, was observed in STZ-induced diabetic mice. Such remodeling may be a physical alteration to increase the urine volume ([@B22]). The two major functions of bladder are urine storage and urine disposal, and the uncoordinated contraction in the OAB of a diabetic greatly affects the urine storage ability of this organ ([@B10]). Bladder contraction is mainly mediated by purinergic and cholinergic pathways ([@B23]). In particular, ATP is the purinergic messenger released from varicosities or bulbous nerve endings of neurons, and the contractile responses mediated by ATP play a key role in DBD ([@B44]). Solute carrier family 17 member 9 (SLC17A9) is a member of the solute-carrier protein family that plays an indispensable role in the vesicular storage of ATP ([@B31]; [@B20]). The translocation of neurotransmitter-filled vesicles to the varicose terminal is the first step in the release of vesicular neurotransmitters, followed by the merger of vesicles with the membrane of the varicose terminal and the precise and rapid release of their contents into the synaptic cleft ([@B33]). In addition, the motor of vesicles for transportation to the varicose membrane in the cells is mainly provided by myosin motors, particularly myosin Va ([@B2]). Several studies found that the purinergic inhibitory neurotransmission was impaired in myosin Va-deficient mice ([@B6]). Such finding suggested that myosin Va played an important role in purinergic neurotransmission ([@B3]).
Diabetic bladder dysfunction, particularly OAB, is not life threatening to humans. However, this dysfunction seriously affects the quality of the life of patients ([@B24]). The treatment methods for DBD changed when the phase progresses. Anticholinergic drugs, such as tolterodine and solifenacin, are the main treatment options for DBD patients with OAB. However, many side effects, including dry mouth, dry eyes, and memory loss, occurs after the treatment with anticholinergic drugs, thus rendering poor life quality for the patients. In the late phase, surgical intervention was the only therapeutic method for patients who did not benefit from pharmacological and behavioral treatments ([@B45]). However, pharmacological and surgical interventions were largely ineffective in clinics ([@B12]; [@B40]). Therefore, new effective treatments for DBD are urgently needed.
In the treatment of diabetic OAB, traditional Chinese medicine and natural plant components have recently attracted increasing attention due to their safeness, few side effects, and excellent activity ([@B41]). SQW is a traditional Chinese herbal formula that was first recorded on *Fu Ren Liang Fang* in the Southern Song Dynasty (between 1127 and 1279 CE). This medicine is a mixture of three Chinese medicines: *roots of Lindera aggregata (Sims) Kosterm. (Lauraceae), roots of Alpinia oxyphylla Miq., (Zingiberaceae), and rhizomes of Dioscorea oppositifolia L. (Dioscoreaceae)* at a 1:1:1 ratio ([@B14]). SQW has been used to treat lower urinary tract symptoms, such as nocturia, urgency, and child bedwetting for hundreds of years ([@B4]). We have recently reported that SQW had therapeutic effects on the OAB of bladder outlet obstruction rat models by modulating the TRPV1 expression ([@B18]). In China, SQW is often used in the clinical treatment of diabetic OAB. However, its mechanism remains unclear, and its therapeutic effect has not been investigated in animal studies. Therefore, we designed experiments to explore the effects and therapeutic mechanisms of SQW in diabetic OAB mouse model.
Materials and Methods {#s1}
=====================
Reagents and Materials
----------------------
Suo Quan Wan was purchased from Hunan Hansen Pharmaceutical Co., Ltd. (China), and the quality control was provided by the company based on Chinese Pharmacopeia employing by high performance liquid chromatography (HPLC) technology from SQW samples ([@B9]). Three Chinese herbals were ground and mixed evenly at a 1:1:1 ratio and appropriate volumes of distilled water were used to make these powders to SQW compound. The doses were adopted according to the Experimental Methodology of Pharmacology, based on clinical usage, the Bios method ([@B39]). SQW H was 2.208 g/kg, SQW M was 1.104 g/kg, and SQW L was 0.552 g/kg. The tolterodine dose for the positive group was 0.82 mg/kg.
Streptozotocin was purchased from TOKU-E Co., Ltd. (Japan). HFD (45% fat) and control diet were purchased from Guangdong Medical Laboratory Animal Center (China). Tolterodine was purchased from Chengdu Dikang Pharmaceutical Co., Ltd. (China). Roche dynamic Bg meter was purchased from Hoffmann-La Roche Inc. (Switzerland), and carbachol was obtained from Shandong Bausch & Lomb Freda Pharmaceutical Co., Ltd. (China). α,β-methylene ATP was purchased from Tocris Bio-Techne Ltd. (United Kingdom). FastQuant RT Kit (with gDNAse) and Talent qPCR PreMix (SYBR Green) were purchased from TIANGEN Biotech (Beijing) Co., Ltd. (China). TRIzol reagent was purchased from Thermo Fisher Scientific (United States). RIPA lysis buffer and protease inhibitor cocktail (100×) were obtained from CoWin Biosciences (China). All other reagents used were of analytical grade.
Preparation and HPLC Conditions of SQW
--------------------------------------
Suo Quan Wan samples were weighted 0.3 g and extracted with 25 mL of methanol-hydrochloric acid solution using heating reflux method and then cool the solution. Finally, the solution was filtered through 0.45 μm nylon membranes before injection.
According to the Chinese pharmacopoeia 2015, the content of norisoboldine should be more than 0.4 mg/0.3 g, and the content of allantoin is more than 0.48 mg/0.3 g. The HPLC conditions and gradient elution were shown as [Tables 1](#T1){ref-type="table"}, [2](#T2){ref-type="table"}.
######
Chromatographic condition for norisoboldine.
Column C18 (25°C)
------------ ----------------------------------------- -------
Solvent A Acetonitrile
Solvent B 0.5% formic acid and 0.1% triethylamine
Flow rate 1.0 mL/min
Wavelength 280 nm
Time (min) A (%) B (%)
0 10 90
13 22 78
30 22 78
######
Chromatographic condition for allantoin.
Column C18 (25°C)
------------ ------------ -------
Solvent A Methanol
Solvent B H~2~O
Flow rate 1.0 mL/min
Wavelength 191 nm
Time (min) A (%) B (%)
0 8 92
10 10 90
20 10 90
Animal Model and Treatment
--------------------------
All experimental protocols and animal procedures complied with the ethical principle guidelines of the National Research Council. A total of 100 male C57BL/6J mice (18--22 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and housed in the Experimental Animal Center of Guangzhou University of Chinese Medicine (No. S2017051, Guangzhou, China) under room temperature and exposed to a 12 h/12 h light--dark cycle, with free access to food and water. The animals were fed with normal diet for 3 days and then divided into two groups, namely, diabetic (*n* = 85) and control (*n* = 15) groups. The mice in the diabetic group were fed with HFD, whereas those in the control group received normal diet. After 4-week feeding, the mice in the diabetic group were injected with STZ at 100 mg/kg dissolved in citrate buffer for four times (0.05 M, pH 4.3--4.5). The mice in the control group were treated with an equal volume of vehicle (0.05 M citric acid, pH 4.3--4.5). Fasting Bg (FBG) was measured using an ACCU-CHEK advantage Bg monitoring system (Roche, Indianapolis, IN, United States) through the tail vein 72 h after the last injection. The mice with FBG levels above 11.1 mmol/L were considered diabetic and selected for subsequent experiments. The mice in the diabetic group were divided into five groups: model (*n* = 13), positive (tolterodine, 0.82 mg/kg, *n* = 13), high-dose (SQW H, 2.208 g/kg, *n* = 13), medium-dose (SQW M, 1.104 g/kg, *n* = 13), and low-dose (SQW L, 0.552 g/kg, *n* = 13) groups. After 3-week feeding, the six mouse groups individually received oral gavage of distilled water (control and model group mice), tolterodine, SQW H, SQW M, and SQW L for 3 weeks. During the experiment, the mice in the control group were given normal diet, whereas those in the other groups were continually fed with HFD.
FBG Test and Oral Glucose Tolerance Test (OGTT)
-----------------------------------------------
Fasting blood glucose test and OGTT were conducted after the 3-week SQW treatment. All animals were fasted overnight, and the Bg concentration was measured using a glucometer (ACCU-CHEK active) through a drop of tail blood. All the mice were then given with glucose (2 mg/g body weight) by gavage, and tail blood samples were obtained at 0, 15, 30, 60, 90, and 120 min to measure the Bg concentration. The area under the curve of the Bg time course from 0 to 120 min (AUC~0-2~ ~h~) was calculated according to the following formula:
AUC
0
−
2
h
=
\[
(
Bg
0
\+
Bg
15
)
\]
×
0.5
\]
÷
4
\+
\[
(
Bg
15
\+
Bg
30
)
×
0.5
\]
÷
4
\+
\[
(
Bg
30
\+
Bg
60
)
×
0.5
\]
÷
2
\+
\[
(
Bg
60
\+
Bg
120
)
×
0.5
\]
Measurement of Water Intake, Urine Output, and Frequency
--------------------------------------------------------
The mice were placed individually in metabolic cages for 24 h with food and water *ad libitum*. Water intake was measured based on the water consumption for 24 h. Urine output and micturition frequency were analyzed through the VSOP test. Urine output was measured by evaluating the volume of urine in the collector after the mice were placed in the cages for 5 h. Micturition frequency was measured by visualizing and analyzing the collected papers, which were placed under the metabolic cage for 5 h under ultraviolet light to identify the area of urine spots ([@B38]). The sizes of the urine spots were divided into two levels, namely, bigger volume (\>50 μL) and smaller volume (\<50 μL) voids, to measure the micturition frequency.
Urodynamic Test
---------------
The urodynamic test was performed using a micro-injection pump and urodynamic measuring device (Laborite Delphis 94-R01-BT, Canada). All mice were anesthetized by the intraperitoneal injection of 25% urethane (2.0 mg/kg). A ventral midline incision was made to expose the bladder, and a 25-gauge needle was inserted into the bladder dome and fixed with silk suture. The needle was connected through a three-way adapter, which was connected with urodynamics at one end and a micro-injection pump at the other. After the bladder was emptied, 0.9% saline solution was injected into the bladder through the micro-injection pump at a rate of 3 mL/h. Pumping was stopped immediately when urine was observed at the external urethra. The bladder pressure line was automatically recorded with a computer. Urodynamic test parameters included the frequency of NVC (higher than 4 cm H~2~O spontaneous bladder contraction that did not result in urination before first urination) frequency, MBC (the volume of saline pumped before first urination), maximum voiding pressure (MP, the maximum peak pressure reached during micturition), RV (manually drained and measured with 1 mL syringe), MV (calculated as MBC - RV), VE (calculated as \[(MBC - RV)/MBC\] × 100%), and BC \[calculated as (MBC/MP) × 100%\]. The mice were euthanized at the end of the experiment through cervical dislocation ([@B19]).
Histological Test
-----------------
After the mice were euthanized, the bladders were excised and fixed using 4% paraformaldehyde solution for approximately 24 h at room temperature. After fixation, the bladders were conventionally dehydrated and embedded in paraffin. The tissues were cut into 6 μm thickness and stained with hematoxylin and eosin (HE) and Masson's trichrome. The color segmentation of Masson's trichrome was used to identify the whole cross-sectional area and the tissue areas that were stained "pink" (urothelium), "blue" (collagen), and "red" (smooth muscle). The HE images (100×) were used to determine the BWT, whereas the Masson's trichrome stained images (100×) to measure the smooth-muscle-to-collagen ratio. The stained bladder sections were examined under a light microscope, and representative images were photographed with a digital camera mounted on the microscope. All the images were analyzed using image analysis software (Image Pro 6.0).
Assessment of Detrusor Smooth Muscle Contractility Study *in vitro*
-------------------------------------------------------------------
The mice were executed, and the bladders were excised at the bladder neck. Full-thickness longitudinal DSM strips (0.7--1 mm × 5 mm) were obtained and mounted in a 5 mL organ bath filled with Krebs-Henseleit solution (NaCl, 118 mM; KCl, 4.75 mM; MgSO~4~, 1.18 mM; NaHCO~3~, 24.8 mM; KH~2~PO~3~, 1.18 mM; CaCl~2~ 2.5 mM; and C~6~H~12~O~6~⋅H~2~O, 10 mM; pH = 7.4) bubbled with a mixture of 5% carbon dioxide and 95% oxygen at 37°C. One side of the strip was attached to the hook with silk suture, and the other side was connected to the force signal transducer ([@B38]). The passive tension was loaded at 0.5 g, and the tissues were equilibrated for 60 min before the experiments. The forced change signals of the DSM strips were recorded with a PowerLab recorder. Purinergic agonist, α,β-methylene ATP (100 μM) was added to the organ bath twice (30 min between each assay) to measure the difference in the contractile responses. The contraction of bladder tissue to electrical field stimulation (EFS, 1, 2, 4, 8, 16, 32, and 64 Hz; 40 V; and 0.5 ms pulse duration for 10 s) was also measured. Furthermore, tests for dose--response curve to carbachol (10^-8^--10^-5^ M) and the contractile response to KCl (120 mM) were performed in the DMS strips. At the end of the experiments, the weight and length of each detrusor strip were recorded.
Real-Time RT-PCR
----------------
The total RNA from the whole bladder samples were extracted using TRIzol Reagent (Invitrogen, United States). The absorption of the samples at 260 and 280 nm was used to estimate the RNA quality. A260/A280 was used to check the purity, and A260 values confirmed the concentration of RNA (Shimadzu BioSpec-nano, Japan). The total RNA was reverse transcribed into cDNA using a PrimeScript RT Reagent Kit with gDNA eraser (TIANGEN, China). Real-time PCR analysis was performed using SYBR Green (TIANGEN, China) according to the manufacturer's instructions. Synthetic oligonucleotide primers were designed to amplify the cDNA for the genes encoding the myosin Va, SLC17A9, and β-actin. [Table 3](#T3){ref-type="table"} shows the primer pairs. The reaction program was presented as follows: 95°C for 3 min, followed by 39 cycles at 95°C for 5 s and 55°C for 10 s. Results were recorded and analyzed using complementary software, and the gene expression levels were calculated by 2^-ΔΔCt^ method. The target gene expression levels were individually normalized according to the β-actin expression.
######
Primer sequences of myosin Va, SLC17A9, and β-actin.
Gene Primers (5′--3′)
----------------- ------------------------
*myosin Va - F* AGCTCAACTCCTTCCACTC
*myosin Va - R* ACACACCCCTTTATCCTTCC
*SLC17A9 - F* GCTTCCTCAAGGCTATGATCTT
*SLC17A9 - R* AGGTCCTGAATGTTGACTGAAA
*β-actin - F* CTACCTCATGAAGATCCTGACC
*β-actin - R* CACAGCTTCTCTTTGATGTCAC
Western Blot Analysis
---------------------
The bladder tissues were homogenized using tissue grinders (Shanghai Jingxin, Shanghai, China) at 65 Hz for 2 min to extract the total protein. BCA protein assay Kit (Beyotime Biotechnology, China) was used to measure the protein concentration. Equivalent proteins (20 μg) were subjected to 10% or 8% SDS-PAGE at 80 V for 30 min or 120 V for 60 min, respectively, to separate the proteins of different molecular weights and transfer to the PVDF membranes using the transblotting apparatus (Bio-Rad Laboratories, Hercules, CA, United States) for 55 or 110 min, respectively, at 300 mA. The PVDF membranes were blocked with 5% (w/v) non-fat milk buffer at room temperature for 2 h and incubated with a primary antibody in TBST \[Myosin Va (1:1000, Santa Cruz), SLC17A9 (1:1000, MBL), or β-actin (1:1000, 4A Biotech)\] overnight at 4°C. The immune-labeled membranes were washed three times with TBST for 15 min each time, and then conjugated with a secondary antibody (1:5000, 4A Biotech) at room temperature for 2 h. After the non-binding secondary antibodies were washed away, the target protein bands were visualized using a chemiluminescent reagent (Millipore, United States). Data were processed using ImageJ, and the immunoblot protein expression levels of myosin Va and SLC17A9 were normalized using β-actin. The antibodies used in the present study are listed in [Supplementary Table 1](#SM1){ref-type="supplementary-material"}.
Statistical Analysis
--------------------
All data were expressed as mean ± SD. Statistical analyses were performed using SPSS 19.0 (SPSS, United States). The amplitude of contractile responses to stimulus was recorded in tension (Newton) and normalized by the weight (g) of the detrusor strips ([@B5]). Western blot analysis data were processed using ImageJ. Histological test images were analyzed using Image-Pro Plus 6.0, and one-way ANOVA was used for data analysis. *P* \< 0.05 was considered statistically significant.
Results
=======
HPLC Analysis of SQW
--------------------
For quality assessment of SQW, HPLC analysis was conducted. The detection wavelength of norisoboldine was set at 280 nm and the allantoin was set at 191 nm. The retention times of norisoboldine and allantoin were detected at approximately 17.960 and 11.632 min, respectively ([Figure 1A](#F1){ref-type="fig"}--[D](#F1){ref-type="fig"}). According to the chromatograms results, the contents of norisoboldine and allantoin in SQW sample were 0.72 mg/0.3 g and 0.73 mg/0.3 g, respectively, indicating that the SQW samples meet the requirement.
{#F1}
General Characteristics of the Diabetic Model
---------------------------------------------
Compared with the mice in the control group, the T2DM mice exhibited diabetes characteristics, including significantly reduced weight (*P* \< 0.01) and increased water intake (*P* \< 0.01), urine volume (*P* \< 0.01), Bg levels \[high FBG (*P* \< 0.01), OGTT (*P* \< 0.01), and AUC~0-2h~ (*P* \< 0.01)\]. No considerable differences in these parameters were observed among the mice in SQW and model groups ([Figure 2A](#F2){ref-type="fig"}--[F](#F2){ref-type="fig"}).
![Effects of SQW on the general characteristics of diabetic model after the 3-week treatment (*n* = 8). **(A)** Weight, **(B)** water intake, **(C)** 5 h urine volume, **(D)** FBG, **(E)** OGTT, and **(F)** area under the curve of AUC~0-2~ ~h~ (calculated according to the following formula: AUC~0-2h~ = \[(Bg0 + Bg15) × 0.5\] ÷ 4+ \[(Bg15 + Bg30) × 0.5\] ÷ 4+\[(Bg30 + Bg60) × 0.5\] ÷ 2+\[(Bg60 + Bg120) × 0.5\]). Data represent the means ± SD (model vs. control group, ^∗∗^*P* \< 0.01 or ^∗^*P* \< 0.05).](fphar-10-00552-g002){#F2}
VSOP and Urodynamic Tests
-------------------------
The representative urodynamic response curves of each group are presented in [Figure 3](#F3){ref-type="fig"}. The urinary voiding patterns showed that the frequencies of bigger volume voids (\>50 μL) and smaller volume voids (\<50 μL) were higher in diabetic mice than in the controls [Figure 4A](#F4){ref-type="fig"}. Treatment with SQW M markedly decreased both frequencies (*P* \< 0.05), whereas treatments with SQW H and SQW L reduced the frequencies of smaller volume and bigger volume voids, respectively. In addition, urodynamic test revealed that compared with the controls, the diabetic mice had significantly increased NVC, MBC, RV, and BC (*P* \< 0.01) but markedly decreased VE (*P* \< 0.01), thereby showing typical DBD in the early compensated phase ([Figure 4B](#F4){ref-type="fig"}--[F](#F4){ref-type="fig"}). SQW M treatment remarkably decreased the NVC, MBC, RV, and BC (*P* \< 0.01 or *P* \< 0.05) but significantly increased the VE of the mice (*P* \< 0.01). Furthermore, treatments with SQW H and SQW L remarkably decreased the NVC of the mice (*P* \< 0.05). No significant differences in MP were found among the control, SQW-treated, and model mice ([Figure 4G](#F4){ref-type="fig"}).
{#F3}
{#F4}
Morphometric Analysis
---------------------
The bladder weight (absolute and relative to body weight) was increased in the diabetic mice (*P* \< 0.01) but decreased in the SQW M- and SQW L-treated mice (*P* \< 0.05) compared with that in the controls ([Figure 5A,B](#F5){ref-type="fig"}). The results of the morphometric analysis were consistent with the bladder weight. The BWT was significantly increased in diabetic mice (*P* \< 0.01), but SQW treatment effectively inhibited this alteration ([Figure 5C](#F5){ref-type="fig"}). No substantial differences in the smooth-muscle-to-collagen ratio were observed among the control, SQW-treated, and model mice ([Figure 5D](#F5){ref-type="fig"}).
{#F5}
Contractility Studies *in vitro*
--------------------------------
We found that the DMS strips of diabetic mice exhibited significantly higher amplitudes of spontaneous activity that those of the controls (*P* \< 0.01). SQW H and SQW M treatments markedly decreased this alteration (*P* \< 0.01) ([Figure 6A](#F6){ref-type="fig"}--[C](#F6){ref-type="fig"}). α,β-methylene ATP (100 μM), which is the P2X receptor agonist, caused higher contractions in the DMS strips of diabetic mice compared with those of the controls (*P* \< 0.01). α,β-methylene ATP (100 μM) was added twice to activate the bladder strip. The responses evidently increased in the first reaction but markedly decreased in the second response in the diabetic mice compared with those in the controls (*P* \< 0.05). SQW H treatment markedly reverted all these alterations (*P* \< 0.01 or *P* \< 0.05), and SQW M treatment decreased the ATP-induced contractions ([Figure 6D,E](#F6){ref-type="fig"}). In addition, the contractions caused by KCl (120 mM), EFS (1--64 Hz) were higher in the diabetic mice than in the controls (*P* \< 0.01 or *P* \< 0.05). The cumulative concentration -response curve of carbachol (10^-8^--10^-5^ M) was also higher in the diabetic mice than in the controls (*P* \< 0.01 or *P* \< 0.05). The contractions of the DSM strips were markedly decreased due to the treatment with SQW (*P* \< 0.01 or *P* \< 0.05) ([Figure 6F](#F6){ref-type="fig"}--[I](#F6){ref-type="fig"}). No significant differences in pEC50 were found among the control, SQW-treated, and model mice. The Emax of diabetic mice exhibited significantly higher than the controls (*P* \< 0.01). Positive and SQW-M treatments markedly decreased (*P* \< 0.01) ([Table 4](#T4){ref-type="table"}).
![DSM strips of diabetic mice exhibited high amplitudes of spontaneous activity and increased bladder contractions to stimuli, and SQW treatment inhibited the changes (*n* = 5). **(A)** Representative spontaneous contractions of the bladder detrusor strips from the mice in the six groups. Quantification of the **(B)** amplitude and **(C)** frequency of spontaneous contraction; **(D)** DSM strip contractions induced by α,β-methylene ATP (100 μM). **(E)** ATP ratio (calculated as \[before-cons -- after-cons\]/pro-cons), α,β-methylene ATP (100 μM)-induced contractions (two times added α,β-methylene ATP); **(F)** DSM strip contractions induced by KCl (120 mmol/L); and **(G)** DSM strip contractions induced by EFS (1--64 Hz); and **(H)** carbachol (10^-8^--10^-5^ M); **(I)** The cumulative concentration--response curves of carbachol. Data represent the means ± SD (model vs. control group, ^∗^*P* \< 0.05 or ^∗∗^*P* \< 0.01; treatment vs. model group, ^\#^*P* \< 0.05 or ^\#\#^*P* \< 0.01).](fphar-10-00552-g006){#F6}
######
The pEC50 and Emax of carbachol (means ± SD, *n* = 5).
Group Dose pEC50 Emax
---------- ------------ ------------- --------------------
Control -- 5.68 ± 0.38 15.07 ± 4.51
Model -- 5.93 ± 0.20 27.58 ± 7.76^∗∗^
Positive 0.82 mg/kg 6.23 ± 0.21 18.14 ± 8.11^\#\#^
SQW-H 2.208 g/kg 5.97 ± 0.65 22.95 ± 7.78
SQW-M 1.104 g/kg 5.94 ± 0.32 16.86 ± 4.68^\#\#^
SQW-L 0.552 g/kg 6.15 ± 0.24 24.59 ± 6.60
Model vs. control group,
∗∗
P \< 0.01; treatment vs. model group
\#\#
P \< 0.01.
Real-Time RT-PCR Analysis
-------------------------
According to the results of RT-PCR analysis, the mRNA expression levels of myosin Va and SLC17A9 were significantly increased in the diabetic mice compared with those in the control mice (*P* \< 0.01 or *P* \< 0.05). The 3-week SQW M treatment, markedly decreased the mRNA expression levels of myosin Va and SLC17A9 (*P* \< 0.01 or *P* \< 0.05), whereas the SQW H and SQW L treatments reduced the myosin Va mRNA expression level only (*P* \< 0.01 or *P* \< 0.05) ([Figure 7A,B](#F7){ref-type="fig"}).
{#F7}
Western Blot Analysis
---------------------
The protein expression levels of myosin Va, SLC17A9, and β-actin were evaluated through Western blotting. The results showed that the protein expression levels of myosin Va and SLC17A9 were significantly increased in the bladder tissues of diabetic mice compared with those in the controls (*P* \< 0.01). After the 3-week SQW treatment, SQW M treatment markedly decreased the protein expression levels of myosin Va and SLC17A9, whereas SQW H and SQW L treatments significantly reduced the protein expression of myosin Va only (*P* \< 0.01) ([Figure 8A,B](#F8){ref-type="fig"}).
{#F8}
Discussion
==========
Diabetic bladder dysfunction is a major lower urinary tract complication of diabetes, but its molecular mechanism remains unknown. Several studies reported that rat models with STZ-induced T2DM usually exhibited major clinical urodynamic alterations ([@B11]; [@B22]; [@B38]). We have previously reported that TCM, namely SQW, had therapeutic effects on many lower urinary tract diseases, including operation-induced OAB and outlet obstruction ([@B18]). Two components (norisoboldine and allantoin) were detected as quality standards in SQW, and the results of HPLC showed that the active ingredient content met the standard. SQW is an oral traditional Chinese formula for the treatment of lower urinary tract diseases, and the oral dose is 5.4 g/day. The high dose in our study was double the clinical dose, and the middle dose was equation, while the low dose was half. Also, we calculated the equivalent doses of mice administration according to the equation ([@B39]). In the present study, we explored the effects and potential mechanism of SQW on diabetic OAB by using STZ-induced T2DM mouse model.
The results of our research showed that the model mice were characterized by a range of T2DM symptoms, including abnormal fat, carbohydrate metabolism, and high Bg levels, thereby indicating the successful establishment of the T2DM model. Our VSOP and urodynamic tests showed significant alternations in the micturition of diabetic mice as characterized by increased frequency of voids (smaller micturition was apparent), NVCs, MBC, BC, and RV and markedly reduced VE after 6 weeks of hyperglycemia status. These results indicated that the diabetic mice entered the stage of OAB, which is consistent with those of previous studies ([@B22]; [@B38]). SQW treatment effectively improved the bladder function of the T2DM mice but did not change the high Bg status.
In healthy bladders, the contractions caused by ATP were limited ([@B22]). However, in the early phase of DBD, the purinergic-induced contractions account for up to 150% compared with those in healthy individuals ([@B1]). The transfer of ATP-filled vesicles to the varicose membranes and the effects of DBD on the transfer mechanism were poorly explored. Recent studies have provided key information about the contributions of SLC17A9 and myosin Va in the storage and exocytosis of ATP in secretory vesicles ([@B31]; [@B6]). SLC17A9 is a vesicular nucleotide transporter that plays an essential role in the specific transport of ATP inside purinergic vesicles ([@B30]). This transporter was discovered in various invertebrates and vertebrates, indicating that the molecular mechanisms of purinergic transmission are common in animals ([@B31]). Accurate localization of the neurotransmitter-filled vesicles in varicose membranes is indispensable for exocytosis ([@B29]). The local transport of organelles, including purinergic vesicles, requires energy that is provided by molecular motors, such as myosin Va. Myosin Va is a subtype of the unconventional myosin V and is primarily expressed in the central and peripheral nervous systems and melanocytes ([@B35]). The structure of myosin Va is provided for the continuous forward transport of intracellular cargoes ([@B32]), and its movement changes with cargo binding ([@B15]). Recent studies reported that myosin Va played a key role in purinergic vesicular transport and was closely associated with ATP-containing vesicles by binding directly to SLC17A9 ([@B6]). These findings provided us the research direction to explore the effects of SQW and the alterations in purinergic vesicular transport in DBD mice.
The results *in vitro* contractility study on the bladder were in accordance with the "temporal theory" of DBD. In the early phase, the DSM of diabetic mice exhibited markedly high amplitudes of spontaneous activity and increased responsiveness to stimuli, such as α,β-methylene ATP, KCL, EFS, and carbachol ([@B11]). *In vitro* studies the results showed that the DMS of diabetic mice exhibited markedly high amplitudes of spontaneous activity compared with those of the controls, and the waves were disordered. The frequency of spontaneous activity remained stable, which was consistent with a previous report ([@B38]). Compared with those of the controls, the contractile responses of the DSM strips of diabetic mice to α,β-methylene ATP were substantially increased during the first response but markedly decreased during the second time. These results suggested that the DSM strips of diabetics exhibited increased responsiveness to exogenous purinergic agonists, and the bladder remained high responsiveness after the first stimulate in diabetic mice. In agreement with the above findings, the contractions of DSM strips to KCL, EFS, and carbachol were high in the diabetic mice. After the 3-week SQW treatment, the mice in the SQW treatment groups displayed varying degrees of reduction for their contractile responses to all stimulus, especially to α,β-methylene ATP, as compared with the models. This result was consistent with those of VSOP and urodynamic test, thus further confirming the therapeutic effects of SQW in the OAB of diabetic mice.
The hyper-responsiveness of diabetic DSM to α,β-methylene ATP, KCL, EFS, and carbachol reflects the changes at the neurotransmitter level and/or beyond the neurotransmitters related to the alterations in the upstream vesicular nucleotide transporters. Therefore, we evaluated the expression levels of protein and mRNA for myosin Va and SLC17A9. In the bladders of the models, we found high expression levels of protein and mRNA for myosin Va and SLC17A9, indicating that the increased expression of these genes is the potential pathogenic mechanism of diabetic OAB. Moreover, we found that the expression of levels of proteins and mRNA of myosin Va and SLC17A9 were significantly decreased after SQW treatment, suggesting that the downregulation of expression levels of myosin Va and SLC17A9 contributes to the therapeutic effect of SQW in DBD.
In this study, SQW was demonstrated to have effective treatment on DBD, and the possible mechanisms were also explored. However, the active ingredients of SQW are unclear, since the complexity of its component. To further explore the major effective ingredient in SQW is our goal in the future.
We want to explore weather a single herbal has effects in DBD. In the present study, we explored the effects and potential mechanism of SQW on diabetic OAB by using STZ-induced T2DM mouse model. SQW is one of the most commonly traditional Chinese formula to treat various urinary system diseases in China for thousands of years ([@B18]), such as urinary incontinence, nocturnal enuresis and OAB symptom syndrome ([@B19]; [@B21]). And diabetic OAB has the same symptom like nocturia and urgency, SQW also was used to treat DBD or combined with other drugs in clinical ([@B25]; [@B8]). Studies has already found some mechanisms, such as β receptor, P2X, TRPV1 ([@B19]; [@B42]), but its complicated. We intend to conduct further research, learn its potential herbal components. Study found that radix linderae extracts have effects on OAB and diabetic bladder ([@B34]; [@B43]). The main components in radix linderae is norisoboldine and ursolide ([@B7]; [@B27]). We intend to conduct further research on efficacy and mechanism using the component in radix linderae.
Conclusion
==========
In summary, our study revealed that HFD with STZ-induced T2DM model mice showed OAB symptoms after 6 weeks of hyperglycemia status. In addition, the traditional Chinese formula, SQW, exhibited therapeutic effects on the OAB of model mice. SQW directly targeted the bladder, rather than improving the Bg levels. The mechanism was related to the inhibition of the transmission of purinergic neurotransmitters in the bladder of diabetic mice by downregulating the expression levels of myosin Va and SLC17A9.
Ethics Statement
================
This study was carried out in accordance with the ethical principle guidelines of the National Research Council. The experimental protocol was approved by the Committee on Ethics of Guangzhou University of Chinese Medicine.
Author Contributions
====================
H-yC conceived and designed the study. PH directed the experiments. JW, X-fY, W-jL, RW, L-yT, W-kR, L-jF, F-jC, and D-wL constructed the animal model. JW, X-fY, and Y-fX analyzed the data and drafted the manuscript. D-wL made a great contribution in the revision of the later articles. All authors read and approved the final manuscript.
Conflict of Interest Statement
==============================
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
**Funding.** This study was supported by the National Natural Science Foundation of China (Grant No. 81673676) entitled "Effect and Mechanism of SQW on Neurotransmission Abnormality in the Treatment Recovery of Diabetic Cystopathy" and the Science and Technology Bureau (Grant No. 2019622101002).
The authors thank the School of Fundamental Medical Science, Guangzhou University of Chinese Medicine for technical support and the Hunan Hansen Pharmaceutical Co., Ltd. for providing quality control materials.
Supplementary Material
======================
The Supplementary Material for this article can be found online at: <https://www.frontiersin.org/articles/10.3389/fphar.2019.00552/full#supplementary-material>
######
Click here for additional data file.
ANOVA
: analysis of variance
BC
: bladder compliance
Bg
: blood glucose
BWT
: bladder wall thickness
DBD
: diabetic bladder dysfunction
DSM
: detrusor smooth muscle
EFS
: electrical-field stimulation
FBG
: fasting blood glucose
HFD
: high-fat diet
MBC
: maximum bladder capacity
MV
: micturition volume
NVC
: non-voiding contraction
OAB
: overactive bladder
OGTT
: oral glucose tolerance test
RV
: residual volume
SD
: standard deviation
SQW
: Suo Quan Wan
SQW H
: high-dose SQW
SQW L
: low-dose SQW
SQW M
: medium-dose SQW
STZ
: streptozotocin
T2DM
: type 2 diabetes mellitus
VSOP
: voided stain on paper
VE
: voided efficiency
[^1]: Edited by: Adolfo Andrade-Cetto, National Autonomous University of Mexico, Mexico
[^2]: Reviewed by: Geng Wenye, Fudan University, China; Fabiola Zakia Mónica, Campinas State University, Brazil
[^3]: ^†^These authors have contributed equally to this work
[^4]: This article was submitted to Ethnopharmacology, a section of the journal Frontiers in Pharmacology
| {
"pile_set_name": "PubMed Central"
} |
Elena Cuza
Elena Cuza (17 June 1825 – 2 April 1909), also known under her semi-official title Elena Doamna, was a Moldavian, later Romanian noblewoman and philanthropist. She was princess consort of the United Principalities and the wife of Alexander John Cuza.
Biography
The daughter of postelnic Iordache Rosetti, a high-ranking boyar of the Rosetti family, she was also closely related to the Sturdzas and other families of boyars. Born in Iaşi, she married Cuza in 1844 — their relationship soured soon after, as Elena was not able to bear a child. However, she later raised as her own children his two sons by his mistress, Elena Maria Catargiu-Obrenović.
She remained, however, very devoted to her husband in their public life, and was responsible for securing his flight from the country in 1848, after Prince Mihail Sturdza began arresting participants in the Moldavian revolutionary movement. They returned after the start of Grigore Alexandru Ghica's rule, but Elena suffered from depression after Cuza began engaging in adulterous affairs and left for Paris, France until 1853. After her return, she became almost completely estranged from her husband, who kept as his mistress Elena Maria Catargiu-Obrenović, the mother of Milan Obrenović (future Prince of Serbia).
Elena left for Paris and remained there until 1862, long after the ad hoc Divan had elected Cuza ruler; she had been persuaded to do so by the writer and political figure Vasile Alecsandri, who tried to extinguish the scandal provoked by Cuza's marital neglect. As wife of the head of state, she became noted for her charity work (the building of the Elena Doamna Asylum in Cotroceni, Bucharest) and adopted orphans, including the illegitimate children of her husband — Alexandru Al. Ioan Cuza and Dimitrie Cuza; Elena Cuza took over, furnished, and maintained the private residence in Ruginoasa, Iaşi County, and was responsible for the Neo-gothic style of its decorations.
During the coup d'état against her husband (22 February 1866), she was isolated in her apartments by the conspirators, who burst in on Cuza as he was spending the night with Maria Catargi-Obrenović. Both she and Maria joined Cuza in his European exile. After her husband's death in 1873, she took care of their children, and lived to see the death of her two adoptive sons (Alexandru, was the husband of Maria Moruzi - she was later married, for just one day, with the National Liberal leader Ion I. C. Brătianu, and gave birth to the historian and politician Gheorghe I. Brătianu).
References
Radu R. Florescu, "Elena Cuza - dincolo de legendă", in Magazin Istoric, January 1998
Petre Otu,"«Adevărul rămâne oricare ar fi soarta celor care l-au servit». Gh.I.Brătianu — un istoric printre politicieni", in Dosarele Istoriei, 1/VI, 2001
External links
Category:1825 births
Category:1909 deaths
Category:People from Iași
Elena
Category:Members of the Romanian Orthodox Church
Category:Romanian philanthropists
Category:Romanian royalty
Category:Spouses of national leaders
Category:Royal consorts of Wallachia
Category:Royal consorts of Moldavia
Category:19th-century philanthropists | {
"pile_set_name": "Wikipedia (en)"
} |
1844 United States presidential election in North Carolina
The 1844 United States presidential election in North Carolina took place between November 1 and December 4, 1844, as part of the 1844 United States presidential election. Voters chose 11 representatives, or electors to the Electoral College, who voted for President and Vice President.
North Carolina voted for the Whig candidate, Henry Clay, over Democratic candidate James K. Polk. Clay won North Carolina by a margin of 4.63%.
With 52.39% of the popular vote, North Carolina would be Henry Clay's fourth strongest state after Rhode Island, Vermont and Kentucky. This was also the last presidential election until 1992 when a Democrat would win without carrying the state of North Carolina.
Results
References
North Carolina
1844
Category:1844 North Carolina elections | {
"pile_set_name": "Wikipedia (en)"
} |
Introduction {#Sec1}
============
Coronary heart disease is one of the leading causes of mortality in the world today (MacKay & Mensah, [@CR27]; Murray & Lopez, [@CR31]), and although new cardiac treatments have helped fight coronary heart disease in recent years, an estimated 1/3 of coronary heart disease risk factors remain elusive (Gudnason, [@CR22]). The addition of psychological factors to standard biomedical risk factors may enhance the prediction of patients at risk. Initial research on the Type A behavior pattern suggested that psychological factors were related to increased risk of heart attacks, but further investigations on Type A behavior were inconclusive (Rozanski et al., [@CR44]). Subsequently, researchers turned their focus towards isolated factors such as hostility, depression, anxiety, social isolation, and chronic stress (Matthews, [@CR29]; Rozanski et al., [@CR44], [@CR43]; Strike & Steptoe, [@CR51]) to document a relationship between psychological factors and poor cardiac prognosis (Rozanski et al., [@CR43]).
Clustering of psychological factors within individuals enhances the risk of adverse health outcomes (Rozanski et al., [@CR43]; Strike & Steptoe, [@CR51]), and this clustering may partly be attributed to a specific vulnerability in the realm of personality (Dimsdale, [@CR16]). The distressed (Type D) personality construct was originally developed to identify cardiac patients who are vulnerable to emotional and interpersonal difficulties (Denollet, [@CR6]; Denollet et al., [@CR15]). Type D individuals tend to experience negative emotions (elevated score on negative affectivity) while not discussing them with others due to fear of rejection (elevated score on social inhibition) (Denollet et al., [@CR15]). Type D personality has been associated with poor quality of life and increased morbidity and mortality in cardiac patients (Denollet et al., 1996, [@CR11]; Kupper & Denollet, [@CR26]; Pedersen & Denollet, [@CR34]). The prevalence of Type D ranges from 28 to 32% across different cardiovascular conditions, including ischemic heart disease, chronic heart failure, and peripheral artery disease. The mortality risk incurred by Type D is 3-fold, with this risk being independent of disease severity, such as left ventricular dysfunction, and mood states such as anxiety and depression, and despite appropriate medical treatment (Pedersen & Denollet, [@CR34]).
The mechanisms relating Type D personality with adverse prognosis in cardiac patients are generally not thought to derive from worse disease severity (de Jonge et al., [@CR5]; Nicholson et al., [@CR32]). Rather, negative health-related behaviors, such as smoking and poor treatment adherence (Kirkcaldy et al., [@CR25]; Pedersen et al., [@CR35]; Schiffer et al., [@CR47]), and dynamic physiological processes such as elevated cortisol levels (Molloy et al., [@CR30]; Whitehead et al., [@CR54]) and pro-inflammatory cytokines (Denollet et al., [@CR12]) have been suggested as possible contributing factors. Importantly, recent findings have casted doubt on the utility of using extent of coronary atherosclerosis as a surrogate means for inferring associations between psychological risk factors and adverse cardiovascular outcomes in cross-sectional data (Rozanski et al., [@CR45]). In the present study, we included assessment of extent of coronary artery disease to rule out the possibility of reverse causation, whereby disease severity can contribute to greater psychological distress and, in turn, may confound the assessment of Type D personality traits.
In clinical and epidemiological research, Type D can be assessed with the standardized 14-item Type D Scale (DS14) that measures negative affectivity and social inhibition (7 items for each domain) (Denollet, [@CR7]). The DS14 scale has been validated in Belgian (Denollet, [@CR7]), Chinese (Yu et al., [@CR57]), Danish (Pedersen & Denollet, [@CR33]; Spindler et al., [@CR50]), Dutch (Denollet, [@CR7]), German (Grande et al., [@CR20]), Italian (Gremigni & Sommaruga, [@CR21]) and Ukrainian (Pedersen et al., [@CR37]) cardiac patients and healthy controls. However, only a few studies have examined how the Type D construct fits within the five-factor model of personality, and no study to date has tested how the social inhibition factor relates to emotional control. Hence, the objectives of the current study were (a) to evaluate the psychometric properties of the DS14 in Icelandic cardiac patients with a specific focus on the construct validity of Type D, (b) to examine whether assessment of Type D personality is confounded by worse disease severity in these patients and (c) to explore the association between Type D and health-related risk markers.
Method {#Sec2}
======
Participants {#Sec3}
------------
This study included two cardiac patient samples. The first sample (cardiac sample I) consisted of 1,291 patients hospitalized for coronary angiography and/or percutaneous coronary intervention at Landspitali-university hospital in Reykjavik (May 2007--June 2008), the only hospital in Iceland where such operations are performed. These patients were approached when hospitalized to the coronary care unit, upon arrival to the emergency ward or by mail if they were on the waiting list for a coronary catheterization. Patients were eligible for participation only if they (a) underwent a coronary angiography or percutaneous coronary intervention during their current hospitalization; and (b) spoke and read Icelandic fluently. Forty-four patients were excluded because they either did not complete the DS14 (*n* = 34) or did not undergo coronary angiography (*n* = 10). The remaining 1,247 patients (875 men and 372 women) had a mean age of 64.8 years (SD 10.8), with women being significantly older than men (*M* = 63.3 (SD 11.0) vs. *M* = 68.2 (SD 9.5), *t*~(1,245)~ = 7.57, *P* \< 0.001). This patient sample was included in the study to (a) estimate the factor structure of the DS14 scale, and (b) examine whether the assessment of Type D personality is confounded by the severity of underlying coronary artery disease.
The second sample (cardiac sample II) consisted of 161 patients from the coronary care unit, and from the heart failure clinic of the Landspitali-university hospital (February--March 2006 and November 2006--April 2007). This sample was included in the study to examine more extensively the validity of the Type D personality construct in Iceland, and how it is related to health-related risk markers. To this end, these patients completed additional measurements that were not administered in the larger cardiac sample I. Four patients were excluded from analysis due to incomplete questionnaire data. The final sample included 157 participants (118 males and 39 females) with an average age of 61.7 years (SD 11.3), and again women tended to be older than men (*M* = 60.2 (SD 11.1) vs. *M* = 66.4 (SD 11.0), *t*~(150)~ = 3.03, *P* \< 0.01).
Baseline characteristics for the two participant samples are presented in Table [1](#Tab1){ref-type="table"}. Patients in cardiac sample I were older on average compared to patients in cardiac sample II (*t*~(1,397)~ = 3.24; *P* ≤ 0.001), but gender distribution was similar in the two samples ($\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ \chi_{(1,n\,=\,1,404)}^{2} $$\end{document}$ = 1.68, *P* = 0.20). The majority of patients in cardiac sample I had coronary artery disease (55%) or had experienced one or more heart attacks (23%), while patients with a history of one or more heart attacks (41%) and heart failure (24%) were more prominent in cardiac sample II.Table 1Baseline characteristicsCardiac sample I (*n* = 1,247)Cardiac sample II (*n* = 157)*Age (years)*Mean (SD)64.8 (10.8)61.7 (11.3)*Gender*Males70% (875)75% (118)*Heart disease*Heart failure2% (22)24% (38)Pacemaker and cardiac arrhythmia7% (89)11% (17)≥1 heart attacks23% (290)41% (64)Coronary artery disease55% (678)10% (16)Hypertension7% (92)11% (17)No disease6% (73)0 (0%)Unknown0.2% (3)3% (5)Data are presented as percentages (*n*) unless otherwise specified
The study protocol was approved by the medical ethics committee of the National Bioethics Committee in Iceland. The study was conducted to conform to the ethical tenets developed by the World Medical Association, as espoused in the Declaration of Helsinki. All patients provided written informed consent.
The DS14 scale {#Sec4}
--------------
The DS14 is a 14-item questionnaire comprised of two seven-item subscales (Denollet, [@CR7]), measuring the tendency to (a) experience negative emotions (negative affectivity) and (b) inhibit self-expression in social interactions (social inhibition). The answering format is on a five-point Likert scale, ranging from 0 (*false*) to 4 (*true*), with total scores ranging from 0 to 28 for each subscale. Items include "I am often irritated" (negative affectivity) and "I am a closed kind of person" (social inhibition). The original Dutch DS14 was translated into Icelandic by four researchers. They received aid from two fluent Dutch speakers who independently translated the DS14 items from Dutch to Icelandic; a translation group examined the two independent translations, and one final version was constructed. Subsequently, the final Icelandic version was back-translated and compared to the original Dutch version to ensure accuracy.
Participants were defined as having a Type D personality if they scored ≥10 on both negative affectivity and social inhibition. This cut-off value has been used in previous research (Denollet, [@CR7]; Emons et al., [@CR17]), and is derived from the median split on negative affectivity and social inhibition scores of participants in those studies. A recent study using item-response theory has shown the cut-off ≥10 on both subscales to be the best to distinguish between Type D and non-Type D individuals, as all items had the highest measurement accuracy around that cut-off (Emons et al., [@CR17]).
Construct validity {#Sec5}
------------------
To evaluate the construct validity of the Icelandic DS14 scale, the NEO-five-factor inventory (NEO-FFI) (Costa & McCrae, [@CR3]), emotional control questionnaire (ECQ) (Roger & Najarian, [@CR41]; Roger & Nesshoever, [@CR42]), hospital anxiety depression scale (HADS) (Zigmond & Snaith, [@CR58]) and perceived stress scale (PSS) (Cohen et al., [@CR1]) were administered in Cardiac sample II.
The NEO-FFI is a 60-item self-report scale which assesses five broad personality traits from the five-factor model of personality, that is neuroticism (e.g. anxiety, impulsiveness, vulnerability), extraversion (e.g. sociability, activity, positive emotions), openness (e.g. fantasy, feelings, artistic), agreeableness (e.g. trust, straightforwardness, altruism) and conscientiousness (e.g. achievement striving, dutifulness, self-discipline) (Costa & McCrae, [@CR3]). The scale contains 12 statements for each trait, and respondents answer on a five-point Likert scale (ranging from *strongly disagree* (0) to *strongly agree* (4)) how each statement refers to them. The psychometric properties of the Icelandic version of the NEO-FFI are acceptable and the test--retest reliability and internal consistency deemed sufficient (Jónsson, [@CR24]), with Cronbach's alpha ranging from 0.71 to 0.88 for the five traits (Svansdóttir, [@CR53]).
The emotional control questionnaire or ECQ measures how easily people express and control their emotions (Roger & Najarian, [@CR41]; Roger & Nesshoever, [@CR42]). The scale includes 56 items which are divided into four factors (emotional inhibition, aggression control, benign control and rehearsal), but in this study a shorter 20-item version measuring rehearsal and emotional inhibition only was used (Roger et al., [@CR40]). Rehearsal refers to the tendency of individuals to ruminate over emotionally distressing events while emotional inhibition assesses to what extent people express their emotions. The response format for each item ranges from *strongly disagree* (1) to *strongly agree* (4). The Icelandic version of this scale has adequate psychometric properties with Cronbach's alpha reliability coefficients of α = 0.83 for rehearsal and α = 0.74 for emotional inhibition (Ingibergsdóttir, [@CR23]).
The HADS is a 14-item questionnaire that measures symptoms of depression and anxiety in physically ill people (Zigmond & Snaith, [@CR58]). The questionnaire contains seven statements for each mood status. Participants rate on a four-point scale (0--3) how well each statement refers to them. Total scores range from 0 to 21 for each domain. The Icelandic version of the HADS identifies symptoms of depression and anxiety sufficiently well (Schaaber et al., [@CR46]), with reliability estimates ranging from α = 0.78--0.86 for anxiety and α = 0.65--0.85 for depression (Smari et al., [@CR49]).
The PSS or perceived stress scale is a 14-item measure of self-appraised stress (Cohen et al., [@CR1]). Items include for instance "In the last month, how often have you felt that you were unable to control the important things in your life?" The response format is on a five-point Likert scale ranging from *never* (0) to *very often* (4), and total scores range from 0 to 56. The scale has good psychometric properties (Cohen et al., [@CR1]; Cohen & Williamson, [@CR2]) and correlates with social anxiety and depression symptoms (Cohen et al., [@CR1]). The Icelandic version of PSS has comparable psychometric properties to the original language version (Davíðsdóttir & Bachman, [@CR4]) with Cronbach's alpha = 0.89 in a university student sample (Svansdóttir, [@CR53]).
Disease severity {#Sec6}
----------------
Disease severity, defined by how many coronary arteries were affected by coronary artery disease (i.e. normal arteries, 1, 2, or 3 arteries affected, and main stem narrowing) was derived from results of the coronary angiography in cardiac sample I. Angiography results were inconclusive for one person, which was excluded from this analysis. Information on disease classification, categorized as hypertension, coronary artery disease, previous heart attacks, pacemaker/arrhythmias and heart failure, was obtained from medical staff and/or retrieved from medical records. Information concerning disease classification was missing for three patients in cardiac sample I (0.2%) and five patients in cardiac sample II (3.2%).
Health-related risk markers {#Sec7}
---------------------------
Participants in cardiac sample II provided information by self-report regarding certain health-related risk markers. These included (a) smoking status (*never, ex*-*smoker, current smoker*); (b) amount of smoking per day (*0*--*10 cigarettes, 10*--*20 cigarettes, 20*--*30 cigarettes, and* \>*30 cigarettes a day*); (c) duration of smoking (*0*--*5* *years, 5*--*10* *years, 10*--*20* *years,* \>*20* *years*); (d) previous mental problems, i.e. "Have you experienced any significant mental problems in the past?" (*yes, no*); and (e) psychopharmacological medication use, i.e. "Have you used one or more of the following medications for more than two weeks in the past 12 months: sleeping pills, anxiety-reducing medications, antidepressants and sedatives?" (*no, sleeping pills, anxiety-reducing medication, antidepressants, sedatives*). Of note, due to a low incidence rate for each medication category, answers were recoded post-hoc to a binary variable containing the following distinction: *no, I have not used any of these medications; yes, I have used one or more of these medications*.
Statistical analysis {#Sec8}
--------------------
Principal axis factor analysis with direct oblimin rotation (delta = 0) was used to explore the factor structure of the DS14, using the scree plot and criterion of eigenvalues \> 1 to determine the number of factors to extract. A confirmatory factor analysis of the scale was performed to confirm the two-factor structure of the scale, using structural equation modeling (SEM) and the maximum likelihood method in AMOS 17 (Analysis of Moment Structures, Chicago, IL, USA). In the construction of the model, the theoretical foundation of the scale was taken into account. As the negative affectivity and social inhibition subscales each cover three different facets of negative affectivity and social inhibition, respectively, error covariance was added to items representing each facet, i.e. for items measuring the negative affectivity facets dysphoria (items 4, 7 and 13), worry (items 2 and 12) and irritability (items 5 and 9), and for items measuring the social inhibition facets discomfort in social interactions (6, 8 and 14), reticence (10 and 11) and social poise (items 1 and 3). Goodness of fit indexes used in the analysis included the Chi-square, the Comparative fit index (CIF) and the Root mean square error of approximation (RMSEA). For Chi-square, a value ≥ 0.05 indicates good fit (agreement with the null hypotheses that residuals are minimal and the data fit the model well). The Chi-square is influenced by sample size, which can lead to inflated Chi-square values and thus statistical significance, indicating bad fit (Schumacker & Lomax, [@CR48]). For the CFI, values close to 1 indicate a very good fit and values above 0.90 or close to 0.95 good fit. The RMSEA index should be ≤0.05 to indicate good fit, but levels ≤0.08 are considered to indicate adequate fit. Internal consistency of the scale was assessed with Mean inter-item correlation and Cronbach's alpha.
Validity of the DS14 was estimated by exploring the Pearson's correlation between the negative affectivity and social inhibition subscales and similar constructs, i.e. neuroticism and extraversion, emotional inhibition and rehearsal, anxiety and depression and perceived stress. A factor analysis of scale scores on the DS14 scale, NEO-FFI, ECQ, HADS and PSS was executed to verify that (a) negative affectivity, neuroticism and rehearsal, and (b) social inhibition, introversion and emotional inhibition measure related constructs, and to test how anxiety, depression and stress would relate to the negative affectivity and social inhibition factors. Differences in disease classification by Type D personality were assessed with Kendall's Tau-*c* calculations, but patients with arrhythmias and pacemakers were excluded from the analysis due to the different nature of their disease. The Kendall's Tau-*c* was also employed to estimate differences in disease severity by Type D personality in cardiac sample I, in both the entire sample and among patients who had established coronary artery disease. Finally, Type D and non-Type D patients in cardiac sample II were compared on smoking behavior, prevalence of previous mental problems, and medication use with Chi-square tests for nominal variables and Tau-*c* for ordinal variables. Association strength was estimated with Cohen's D calculations for quantitative variables and odds ratios for categorical variables. The SPSS 17 statistical software for Windows was used for all main analysis (Statistical Package for Social Sciences, Chicago, IL, USA).
Results {#Sec9}
=======
Factor structure of the DS14 {#Sec10}
----------------------------
A principal axis factor analysis (direct oblimin rotation, delta = 0) in a combined sample of cardiac patients (*n* = 1,404) indicated a two-factor solution, which explained 46% of variance in the patient sample. These two factors clearly reflected the negative affectivity and social inhibition subscales, with satisfactory factor loadings (ranging from 0.47 to 0.75) and good internal consistency (negative affectivity: Cronbach's alpha = 0.85 and Mean inter-item correlation = 0.45; social inhibition: Cronbach's alpha = 0.84, Mean inter-item correlation = 0.43) (Table [2](#Tab2){ref-type="table"}).Table 2Factor analysis and reliability of the DS14 scale in a combined cardiac sample (*n* = 1,404)FactorsIII*Negative affectivity items*2. I often make a fuss about unimportant things**0.61**0.104. I often feel unhappy**0.74**0.075. I am often irritated**0.73**0.047. I take a gloomy view of things**0.63**−0.149. I am often in a bad mood**0.58**−0.1312. I often worry about something**0.60**0.0213. I am often down in the dumps**0.73**−0.12Cronbach's alpha**0.85**Mean inter-item correlation**0.45***Social inhibition items*1. I make contact easily when I meet people0.14**0.72**3. I often talk to strangers0.16**0.61**6. I often feel inhibited in social interactions0.29−**0.50**8. I find it hard to start a conversation0.10−**0.75**10. I am a closed kind of person0.12−**0.66**11. I would rather keep other people at a distance0.16−**0.47**14. When socializing I don't find the right things to talk about0.15−**0.69**Cronbach's alpha**0.84**Mean inter-item correlation**0.43**The highest loadings on the corresponding factor, Cronbach's alpha and mean inter-item correlations are presented in bold
A confirmatory factor analysis of the two-factor structure of the Icelandic DS14 in the same sample indicated a good to adequate model fit for the unconstrained model (χ^2^ = 435.63, *P* ≤ 0.001; CFI = 0.953 and RMSEA = 0.063, 90% CI 0.058--0.069). Standardized regressional weights of items to factor ranged from 0.52 to 0.79 for negative affectivity and 0.44--0.80 for social inhibition (Fig. [1](#Fig1){ref-type="fig"}).Fig. 1Standardized regression weights for the 2-factor model of the DS14, representing negative affectivity (*NA*) and social inhibition (SI)
Construct validity {#Sec11}
------------------
The convergent and construct validity of the Icelandic DS14 scale was evaluated by examining correlations of negative affectivity and social inhibition with similar construct measurements in cardiac sample II. The negative affectivity subscale had a high positive correlation with neuroticism (*r* = 0.80) and rehearsal (*r* = 0.58), while social inhibition was negatively correlated with extraversion (*r* = −0.65) and positively with emotional inhibition (*r* = 0.50), which further supports the divergent validity of the Type D factors and their individual attributes. Negative affectivity had a high correlation with anxiety, depression and stress scores, indicating that it clearly measures increased negative affect. An axis factor analysis (direct oblimin rotation, delta = 0) of scale scores confirmed that the negative affectivity and social inhibition subscales were differentially related to the five-factor model of personality; negative affectivity (loading = 0.79), neuroticism (0.78) and rehearsal (0.64) loaded on a single negative affectivity/neuroticism factor. Social inhibition (−0.95), extraversion (0.57) and emotional inhibition (−0.44) loaded together on a separate inhibition factor. Neither DS14 subscale was related to agreeableness, conscientiousness or openness of the five-factor model of personality. Anxiety (−0.50), depression (−0.73) and stress (−0.60) loaded together on a single factor termed "psychological well-being", but anxiety also had a considerable loading on the negative affectivity/neuroticism factor (0.49) (Table [3](#Tab3){ref-type="table"}).Table 3Correlations and results of a factor analysis of scale scores for the DS14, NEO-FFI, ECQ and HADS subscales and PSS scaleCorrelationNegative affectivitySocial inhibitionPattern matrixCardiac sample II (*n* = 157)IIIIIIIVVNegative affectivity--0.47\***0.79**−0.14−0.09−0.070.04Social inhibition----0.11**−0.95**0.11−0.050.05Neuroticism0.80\*0.47\***0.78**−0.12−0.06−0.14−0.13Extraversion−0.48\*−0.65\*−0.09**0.57**0.12−0.020.17Agreeableness−0.33\*−0.21\*−0.28−0.030.07−0.350.17Conscientiousness−0.20\*−0.25\*−0.010.060.050.12**0.72**Openness−0.02−0.07−0.020.060.01**−0.45**−0.09Rehearsal0.58\*0.35\***0.64**−0.050.010.23−0.02Emotional inhibition0.25\*0.50\*−0.08**−0.44**−0.190.25−0.10Anxiety0.67\*0.26\*0.490.01**−0.50**−0.250.20Depression0.55\*0.35\*0.04−0.15**−0.73**−0.11−0.09Perceived stress0.38\*0.18\*0.040.05**−0.60**0.23−0.09The highest loadings on the corresponding factor are presented in bold*NEO*-*FFI* NEO-five-factor inventory, *ECQ* Emotional control questionnaire, *HADS* Hospital anxiety and depression scale, *PSS* Perceived stress scale\* *P* \< 0.001
Prevalence of Type D personality {#Sec12}
--------------------------------
Average scores on negative affectivity and social inhibition were equivalent in the two patient samples (negative affectivity: *M* = 8.6 (SD 5.6) vs. *M* = 8.8 (SD 5.9), *t*~(1,402)~ = 0.46, *P* = 0.65; social inhibition: *M* = 9.3 (SD 5.8) vs. *M* = 9.3 (SD 6.1), *t*~(1,402)~ = 0.11, *P* = 0.91; for cardiac sample I and II, respectively). Using the cut-off ≥ 10 for both subscales (Denollet, [@CR7]; Emons et al., [@CR17]), 26% of patients in cardiac sample I and 29% of patients in cardiac sample II, were classified as Type D individuals.
Confounding effect of disease severity {#Sec13}
--------------------------------------
Assessment of Type D personality was not confounded by severity of underlying coronary artery disease in cardiac sample I, as estimated by number of arteries affected by coronary artery disease from the coronary angiography results (Tau-*c* = 0.010, *n* = 1,237, *P* = 0.72; Fig. [2](#Fig2){ref-type="fig"}). About 1/3 of both non-Type D and Type D patients had normal arteries or atheroma with no significant occlusions, and with those individuals excluded from the analysis, Type D personality was still not associated with worse disease severity (Tau-*c* = −0.001, *n* = 838, *P* = 0.98).Fig. 2Coronary artery disease severity, stratified by Type D personality
Assessment of Type D personality was also not related to disease classification in cardiac sample I (Tau-*c* = −0.02, *n* = 1,155, *P* = 0.45) nor cardiac sample II (Tau-*c* = −0.15, *n* = 135, *P* = 0.068). In both cases, disease classification was categorized as: no disease, hypertension, coronary artery disease, ≥1 heart attacks and heart failure.
Association with health-related risk markers {#Sec14}
--------------------------------------------
As a final step, we explored the relationship of Type D personality with psychopharmacological medication use, previous mental problems and smoking in cardiac sample II. Type D patients reported more psychopharmacological medication use (Fig. [3](#Fig3){ref-type="fig"}). When asked about use of sleeping pills, anxiety-reducing medication, antidepressants and sedatives, half of the cardiac patients with a Type D personality (51%) reported having used one or more of these medications compared to 29% of their non-Type D counterparts ($\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ \chi_{(1,n\,=\,154)}^{2} $$\end{document}$ = 6.79, *P* = 0.009; OR 2.59, 95% CI 1.25--5.34, *P* = 0.010). Prevalence of previous mental problems did however not differ between Type D (19%) and non-Type D (14%) patients ($\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ \chi_{(1,n = 149)}^{2} $$\end{document}$ = 0.584, *P* = 0.45). Type D patients were significantly more likely to smoke as compared with non-Type D patients (Fig. [3](#Fig3){ref-type="fig"}); i.e., 22% versus 6% ($\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ \chi_{(1,n = 156)}^{2} $$\end{document}$ = 8.35, *P* = 0.004; OR 4.25, 95% CI 1.50--12.00, *P* = 0.006). In patients with a history of smoking, no differences were found between Type Ds and non-Type Ds regarding how many cigarettes they smoked per day (Tau-*c* = 0.11, *n* = 115, *P* = 0.26). However, a trend towards a longer history of smoking was noted in Type Ds (Tau-*c* = 0.15, *n* = 120; *P* = 0.056), but 76% of Type D smokers (former or current) reported having smoked for 20 years or more compared to 59% of non-Type D smokers.Fig. 3Prevalence of psychopharmacological medication use and smoking, stratified by Type D personality
Discussion {#Sec15}
==========
The objectives of the current study were to evaluate the psychometric properties and construct validity of the Icelandic DS14 scale, to test whether Type D assessment is confounded by disease severity in Icelandic angiography patients, and to explore the relationship between Type D and health-related risk markers. The findings supported the two-factor structure of the Icelandic DS14, and its validity and reliability in this sample of Icelandic heart patients. Principal axis factor analysis revealed internally consistent negative affectivity and social inhibition factors, and a confirmatory factor analysis confirmed the two-factor structure of the original scale (Denollet, [@CR7]) in a large sample of Icelandic cardiac patients.
The current results supported the convergent and divergent validity of the Type D construct in the Icelandic setting. An exploratory factor analysis of scale scores showed that negative affectivity, neuroticism and rehearsal loaded on the same factor, while social inhibition, extraversion, and emotional inhibition loaded together on another factor, supporting the construct validity of the two factors of the DS14 (Denollet, [@CR7]; Fruyt & Denollet, [@CR18]) whilst also strengthening its cross-cultural validity. Furthermore, negative affectivity correlated strongly with anxiety, depression and moderately with perceived stress, confirming the presence of increased negative mood states within the negative affectivity trait. In addition, social inhibition was clearly associated with emotional inhibition as measured by the emotional control scale. In a recent study, Grande et al. ([@CR19]) advocated more testing of the construct validity of the social inhibition dimension, especially since it is the combination of social inhibition with negative affectivity that seems to make Type D personality a stronger predictor of adverse cardiac events compared with other single-dimensional negative affect factors, such as depression. In the context of Type D personality, the inhibition of emotions in social interaction is believed to play a key part in the association with adverse cardiac prognosis, by modulating the effect negative emotions have on cardiac prognosis (Denollet et al., [@CR10]). Others have also linked social inhibition with social avoidance (Yu et al., [@CR57]), lack of social boldness (Grande et al., [@CR19]) and suppressed anger (Denollet et al., [@CR9]).
The prevalence of Type D personality of twenty-six and twenty-nine percent in the cardiac samples was comparable to that found in European and Chinese samples (Denollet, [@CR7]; Grande et al., [@CR20]; Gremigni & Sommaruga, [@CR21]; Pedersen & Denollet, [@CR33]; Pedersen et al., [@CR37]; Spindler et al., [@CR50]; Yu et al., [@CR57]). Assessment of Type D personality was not confounded by disease severity, as estimated by the number of coronary arteries affected with coronary artery disease and/or presence of significant narrowing at the main stem. This finding is in accordance with previous results in coronary artery disease and congestive heart failure patients, where no association has been found between Type D personality and indicators of disease severity, such as multivessel disease (Martens et al., [@CR28]), left ventricular ejection fraction (Denollet & Brutsaert, [@CR8]; de Jonge et al. [@CR5]) and biomedical markers (i.e. brain natriuretic peptide) (Pelle et al., [@CR39]). Similarly, Type D personality was not related to disease classification in either of the cardiac samples. The majority of former findings have generally also revealed that Type D personality is stable across time, and does not seem to be affected by changes in mood status or severity of cardiac disease (Martens et al., [@CR28]).
The lack of association between Type D personality and extent of coronary artery disease does not necessarily diminish the status of Type D personality as a predictor for adverse cardiac prognosis. Conversely, these findings may merely indicate that the mechanisms relating Type D personality with adverse prognosis do not stem from worse disease severity, but through other pathways. Furthermore, if disease severity were in fact the pathway through which Type D personality affects cardiac prognosis, then the association between Type D and prognosis should diminish in strength or disappear altogether when multivariate adjustments for disease severity markers are conducted. This has however not been the case in previous studies, as is evident in the recent review by Denollet et al. ([@CR13]). Mediating mechanisms linking Type D with adverse cardiac prognosis reside more likely in behavioral and physiological processes. Potential behavioral factors include unhealthy lifestyle behaviors (Williams et al., [@CR56]), more smoking (Pedersen et al., [@CR35]), poor treatment adherence (Rozanski et al., [@CR43]; Williams et al., [@CR55]) and inadequate consultation behavior (Schiffer et al., [@CR47]), while physiological and biological processes may include elevated cortisol (Molloy et al., [@CR30]; Whitehead et al., [@CR54]), pro-inflammatory cytokines (Denollet et al., [@CR12]) and cardiovascular stress reactivity (Denollet et al., [@CR13]) to name a few. Type D patients may thus be less likely to follow their doctors recommendations regarding medications or changing unhealthy lifestyle behaviors, and perhaps less efficient in presenting their symptoms to their doctor, due to their high social inhibition. Such factors could possibly explain why these patients develop or experience a more adverse prognosis compared to their non-Type D counterparts.
A recent study by Rozanski et al. ([@CR45]) has also reported that psychological risk factors (depression, hostility, social support, perceived stress, job strain, and optimism) were not associated with the extent of coronary atherosclerosis. This further supports the lack of association between Type D and extent of coronary artery disease in the current study, as the Type D construct generally summarizes such psychological risk factors in the general negative emotional distress it encompasses (Suls & Bunde, [@CR52]). Finally, even as some researchers have disputed that the relation of psychological factors with cardiovascular prognosis is confounded by worse somatic health, findings from a recent study have indicated that the Type D personality construct is less confounded by somatic health compared with depression (de Jonge et al. [@CR5]).
Type D personality had strong ties to health-related risk markers in cardiac patients. Although no association was found between Type D personality and prevalence of reported previous mental problems in the current study, psychopharmacological medication use was higher among Type D patients compared to their non-Type D counterparts, and a high correlation emerged between negative affectivity and anxiety and depression. Previously, researchers have also found that post-myocardial infarction patients with a Type D personality were significantly more likely to use benzodiazepines as compared to non-Type D patients (Denollet et al., [@CR14]). The lack of association with former mental problems seems contradictory with the high correlation noted between negative affectivity and anxiety and depression. The assessment of previous mental problems may not adequately portray the number of previously diagnosed mental problems, due to the simplistic one question format assessment.
We also found a relationship between Type D personality and smoking among cardiac patients. Incidence of current smoking was higher in the Type D patient group, and there were some indications that Type D smokers had a longer history of smoking compared to non-Type D smokers. Previously, it has been reported that cardiac patients with a Type D personality may be more likely to smoke (Pedersen et al., [@CR36]), and that Type D individuals are less likely to engage in healthy lifestyle behaviors (Williams et al., [@CR56]). These findings suggest that cardiac patients with Type D personality may struggle more with the lifestyle changes recommended by doctors to decrease likelihood of further cardiac events. In addition, previous results have indicated that heart failure patients with Type D personality are more likely to show inadequate consultation behavior compared to non-Type D patients (Pelle et al., [@CR38]; Schiffer et al., [@CR47]), which implies that self-management and medical adherence in these patients may be impaired as well. Nevertheless, research results have indicated that the adverse effect of Type D on cardiac prognosis (Pedersen et al., [@CR36]) and poor health status (Pedersen et al., [@CR35]) remains significant despite statistical adjustment for smoking and other mechanisms that may mediate the relationship between Type D and health outcomes. More research needs to be conducted to clarify which mediating mechanisms are behind Type D's association with adverse prognosis in cardiac patients, and to determine whether health-behavior and/or poor medical adherence play a significant role.
Certain limitations restrict the interpretation of the present findings. First of all, the participant samples were not randomly selected. Yet, cardiac sample I included consecutive patients nationwide in Iceland, which diminished greatly the risk of selection bias in that sample. Another limitation is the self-report of psychopharmacological medication use, previous mental health problems and smoking, and the unavailability of these measures from cardiac sample I.
Overall, the results of the present study indicated that the Icelandic DS14 is a psychometrically sound assessment tool that can be readily applied in epidemiological and clinical research. The Type D personality construct was prevalent in Icelandic cardiac patients, not confounded by disease severity, and related to certain health-related risk markers in this clinical population.
The present research was supported by Rannís, The Icelandic Centre for Research (Reykjavík, Iceland) by a grant to Dr. Hrobjartur D. Karlsson, the Landspitali-University Hospital Research found, Iceland, with a grant to the project, and by the Netherlands Organisation for Scientific Research (The Hague, The Netherlands) with a VICI grant (453-04-004) to Dr. Johan Denollet and a VENI grant (451-05-001) to Dr. Susanne S. Pedersen.
Conflict of interest {#d28e1901}
====================
There is no conflict of interest related to this study.
Open Access {#d28e1906}
===========
This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.
| {
"pile_set_name": "PubMed Central"
} |
Tuamie - Masta Killa drops 9/17. Pre-order the limited cassette at www.grandgardenrecords.com
‘Masta Killa’ is Grand Garden’s first release and a look into the mind of producer Tuamie. Hailing from Richmond, VA Tuamie is one of the beat scene’s brightest young talents. A true “head” and lover of records Tuamie pride’s himself on making beats with unidentifiable samples.
‘Masta Killa’ is no generic beat tape mind you. The album is full of house, soul, and African rhythms generating a feeling of mid 90’s nostalgia while maintaining a contemporary sound.
Tuamie has performed alongside Knxwldge, Ohbliv, P.U.D.G.E. and many more. Stay tuned for Tuamie's production on Vol. 4 of DJ House Shoes' "The Gift" series.
This limited edition cassette release comes with a "plantable" download card that will grow flowers after planted in soil. | {
"pile_set_name": "Pile-CC"
} |
Cheater Payback-Chapter Seven
Cathy told Bill to get her another towel, there was no need to say why because the old one was getting pretty soggy, to say the least. She folded it once and then got back into position. With open legs she reached over and grabbed hold of Rick’s pecker and pulled him with it, placing it at her cunt’s entrance. When Bill plunged into the very wet, well-lubricated, private place, her vaginal walls fluttered around it as he slid in, balls deep. It felt wonderful, and he could feel Cathy’s flesh spread while at the same time she was squeezing him with it. Cathy gave out a little laugh and asked, “Do you like that?” He answered her with a slap, slap, slap, slap noise of a dick and a wet pussy banging together. After a good long minute or so he was still going at her with his body. Cathy said “Rick, honey, take it easy, you aren’t going to wear my pussy out, you are just wearing yourself out. But, oh God your cock feels so good in there.” Bill was watching everything and did exactly what Cathy was hoping he would do, that being taking one of her legs and holding it up, pointing towards the ceiling. This allowed Rick better access and provided Bill a better scene for his perverted eyes. Cathy opened her legs wider and did what she had just been taught, that being pulling Rick into him hard and allowing his cock more penetration to squirt her deep inside her eggbox. She was also going to do this with her husband next chance he got. Anyway, Cathy was squirming and bouncing around, her tits jammed into his chest and her nails digging into his back like some sort of wildcat in heat. She was also cussing worse than a sailor with a lot of F, C, S, and P words. The nasty woman was an exciting and talented fuck. She had years of experience screwing and making babies in the marriage bed. As well as a few other places. She was nearing climax so she told Rick, “Don’t stop fucking me you S.O.B., faster, faster, fuck me hard, honey!” Slamming her naked body at him violently working on her orgasm. Bill was also helping her by pulling on her leg to meet their crotch slamming lewdness. Poor Rick was just along for the ride as he tried to keep his cum inside his balls for her. Cathy became limp as her body shivered and shuttered in pleasure as her jets inside released a load of girl cum soaking Rick’s already wet dick. With a smile of a satisfied woman on Cathy’s beautiful face she gave Rick a sexy kiss on the lips, and like a high school kid also gave him a hickey on his neck as her whole body continued to rock with sexual satisfaction. She said weakly, Go ahead Rick shoot your load in me now.” Rick went stiff as he shot off, he felt his cock going fwt fwt fwt fwt fwt, as five bolts of sperm went into her. He lied atop her as the two sweaty bodies hugged each other, exhausted and spent. Bill slowly eased Cathy’s leg down onto Rick and she rested it on his bottom. Bill had to wait patiently for Cathy to regurgitate so he could fuck her again. End of chapter seven. | {
"pile_set_name": "Pile-CC"
} |
Added with that hat, Twilight looks so dang adorable. Also, love the new battle outfit, hope we'll see it more often. | {
"pile_set_name": "OpenWebText2"
} |
<div class="subblock">
<h3><%= t('.owner_tools') %></h3>
<div>
<%= link_to t('.force_update'), act_content_path(action_name: 'manual_refresh'), method: :put, class: "btn info" %>
<%= link_to t('.purge_children'), act_content_path(action_name: 'delete_children'), method: :put, class: "btn info" %>
</div>
</div> | {
"pile_set_name": "Github"
} |
How do I edit my profile?
You have a profile on this site. It was created for you on registration. Having a profile means other users can recognize you when you leave a reply or like a comment. Please keep it up to date and all the fields filled.
To edit your profile simply click on your name in the top right corner.
Fill in any missing fields and make sure to click ‘Save Changes’ when you are finished. | {
"pile_set_name": "Pile-CC"
} |
Work It
Work It
But it was Melissa Fleis' royal-blue cowl-neck frock that earned her the win. Rightfully so. "I want to do away with typical 'office clothes,'" Fleis says, echoing a popular sentiment among so many busy ladies. "Working women today are looking for that edge in life and the workplace. I want to help them achieve it." Fleis, however, who had yet to win a challenge in the season, was shocked to have landed on top.
Alex Wynne in top by Raul Osorio and skirt by Sonjia Williams; Lacee Teel in the winning dress by Melissa Fleis. | {
"pile_set_name": "Pile-CC"
} |
SO whose idea was it to play twister in the vineyards on a Sunday afternoon?
Certainly not the staff and visitors at Keith Tulloch Wine in Pokolbin in the Hunter Valley yesterday, who were caught unawares when a tornado descended on the vines about 4.30pm.
Cellar door saleswoman Jackie Goodman said the sun was out and everything appeared normal when the twister touched down and started to wreak havoc.
“We didn’t even see it coming. It was so sunny outside and then a huge dark cloud came over the top with this enormous twister coming out of it down to the ground,” she said.
media_camera An image from a video which captured the moment a weak tornado struck a winery in the Hunter Valley.
“It lasted maybe half an hour. There was stuff flying through the air everywhere. It tore down one of our sheds so there were massive bits of roof flying around, there were sheets of metal, there were branches – it was crazy.”
The vineyard lost a shed and about 100 vines, but no-one was injured.
media_camera The aftermath following a tornado which hit Keith Tulloch winery at Pokolbin on Sunday. Photo courtesy of www.emmajanepitschphotography.com.au
media_camera Metal from a shed roof at Keith Tulloch Wine at Pokolbin in Hunter Valley after a weak tornado ripped through the site on Sunday afternoon. Picture: Keith Tulloch Wine
Weather Watch meteorologist Don White said tornadoes were rare but not unheard of in NSW.
“Just don’t call it a mini-tornado. There’s no such thing as a mini-tornado, except maybe what you get when you stir a cup of tea with a spoon,” he said.
Instead, Mr White described it as a “weak” tornado.
“Tornadoes are rated on a scale of zero to five and this one would barely be a zero,” he said.
“But it still did some damage.”
media_camera Pictured is the Keith Tulloch winery at Cessnock which yesterday was severely damaged by a tornado. Photo courtesy of www.emmajanepitschphotography.com.au
He explained that, in very basic terms, tornadoes formed when updrafts and downdrafts from a storm opposed each other to such an extent that they started to rotate.
Yesterday’s was the result of a single severe storm cell passing over Pokolbin, dropping more than 20mm of rain on the area, while the nearby town of Cessnock got just 1mm.
Tornado hits Pokolbin | {
"pile_set_name": "OpenWebText2"
} |
Q:
How to add exception in SELinux?
When SELinux is disabled, I have no issues,
but when it's Enforced then I'm facing this
[systemd] failed to get d-bus session: Failed to connect to socket /run/dbus/system_bus_socket: Permission denied
Audit.log
sealert -a /var/log/audit/audit.log
100% done
found 2 alerts in /var/log/audit/audit.log
--------------------------------------------------------------------------------
SELinux is preventing /usr/sbin/zabbix_agentd from connectto access on the unix_stream_socket /run/dbus/system_bus_socket.
***** Plugin catchall (100. confidence) suggests **************************
If you believe that zabbix_agentd should be allowed connectto access on the system_bus_socket unix_stream_socket by default.
Then you should report this as a bug.
You can generate a local policy module to allow this access.
Do
allow this access for now by executing:
# ausearch -c 'zabbix_agentd' --raw | audit2allow -M my-zabbixagentd
# semodule -i my-zabbixagentd.pp
i created a policy as suggested above,restarted zabbix-agent, now from zabbix agent log getting
[systemd] failed to get d-bus session: An SELinux policy prevents this sender from sending this message to this recipient, 0 matched rules; type="method_call", sender="(null)" (inactive) interface="org.freedesktop.DBus" member="Hello" error name="(unset)" requested_reply="0" destination="org.freedesktop.DBus" (bus)
sealert -a /var/log/audit/audit.log
39% donetype=AVC msg=audit(1534885076.573:250): avc: denied { connectto } for pid=10654 comm="zabbix_agentd" path="/run/dbus/system_bus_socket" scontext=system_u:system_r:zabbix_agent_t:s0 tcontext=system_u:system_r:system_dbusd_t:s0-s0:c0.c1023 tclass=unix_stream_socket
**** Invalid AVC allowed in current policy ***
A:
Well, first you have to identify the denial you are getting from SELinux. The easiest (in my opinion) way to do that is via the sealert utility.
First install the setroubleshoot-server package with:
yum install setroubleshoot-server
Then run:
sealert -a /var/log/audit/audit.log
You will probably get a lot of output, look for your specific denial, and follow the recommendations. But be sure to NOT allow things that shouldn't be allowed!
Here is an exmple of a denial, and the suggested woraround from sealert (my emphasis):
SELinux is preventing /usr/libexec/postfix/qmgr from using the rlimitinh access on a process.
***** Plugin catchall (100. confidence) suggests **************************
you believe that qmgr should be allowed rlimitinh access on processes labeled postfix_qmgr_t by default.
Then you should report this as a bug.
You can generate a local policy module to allow this access.
Do
allow this access for now by executing:
# ausearch -c 'qmgr' --raw | audit2allow -M my-qmgr
# semodule -i my-qmgr.pp
Additional Information:
Source Context system_u:system_r:postfix_master_t:s0
Target Context system_u:system_r:postfix_qmgr_t:s0
Target Objects Unknown [ process ]
Source qmgr
Source Path /usr/libexec/postfix/qmgr
Port
Host
Source RPM Packages postfix-2.10.1-6.el7.x86_64
Target RPM Packages
Policy RPM selinux-policy-3.13.1-102.el7_3.16.noarch
Selinux Enabled True
Policy Type targeted
Enforcing Mode Enforcing
Host Name centos
Platform Linux centos 3.10.0-514.26.2.el7.x86_64 #1 SMP Tue
Jul 4 15:04:05 UTC 2017 x86_64 x86_64
Alert Count 5
First Seen 2018-04-18 18:02:32 CEST
Last Seen 2018-08-22 09:11:22 CEST
Local ID 855f168c-1e47-4c6b-8a1e-f8fddce5d426
The example above concerns Postfix, again; look for your denial, and insert a local policy.
| {
"pile_set_name": "StackExchange"
} |
{include file="orderforms/standard_cart/common.tpl"}
<script>
var _localLang = {
'addToCart': '{$LANG.orderForm.addToCart|escape}',
'addedToCartRemove': '{$LANG.orderForm.addedToCartRemove|escape}'
}
</script>
<div id="order-standard_cart">
<div class="row">
<div class="pull-md-right col-md-9">
<div class="header-lined">
<h1>{$LANG.cartdomainsconfig}</h1>
</div>
</div>
<div class="col-md-3 pull-md-left sidebar hidden-xs hidden-sm">
{include file="orderforms/standard_cart/sidebar-categories.tpl"}
</div>
<div class="col-md-9 pull-md-right">
{include file="orderforms/standard_cart/sidebar-categories-collapsed.tpl"}
<form method="post" action="{$smarty.server.PHP_SELF}?a=confdomains" id="frmConfigureDomains">
<input type="hidden" name="update" value="true" />
<p>{$LANG.orderForm.reviewDomainAndAddons}</p>
{if $errormessage}
<div class="alert alert-danger" role="alert">
<p>{$LANG.orderForm.correctErrors}:</p>
<ul>
{$errormessage}
</ul>
</div>
{/if}
{foreach $domains as $num => $domain}
<div class="sub-heading">
<span>{$domain.domain}</span>
</div>
<div class="row">
<div class="col-sm-6">
<div class="form-group">
<label>{$LANG.orderregperiod}</label>
<br />
{$domain.regperiod} {$LANG.orderyears}
</div>
</div>
<div class="col-sm-6">
<div class="form-group">
<label>{$LANG.hosting}</label>
<br />
{if $domain.hosting}<span style="color:#009900;">[{$LANG.cartdomainshashosting}]</span>{else}<a href="cart.php" style="color:#cc0000;">[{$LANG.cartdomainsnohosting}]</a>{/if}
</div>
</div>
{if $domain.eppenabled}
<div class="col-sm-12">
<div class="form-group prepend-icon">
<input type="text" name="epp[{$num}]" id="inputEppcode{$num}" value="{$domain.eppvalue}" class="field" placeholder="{$LANG.domaineppcode}" />
<label for="inputEppcode{$num}" class="field-icon">
<i class="fa fa-lock"></i>
</label>
<span class="field-help-text">
{$LANG.domaineppcodedesc}
</span>
</div>
</div>
{/if}
</div>
{if $domain.dnsmanagement || $domain.emailforwarding || $domain.idprotection}
<div class="row addon-products">
{if $domain.dnsmanagement}
<div class="col-sm-{math equation="12 / numAddons" numAddons=$domain.addonsCount}">
<div class="panel panel-default panel-addon{if $domain.dnsmanagementselected} panel-addon-selected{/if}">
<div class="panel-body">
<label>
<input type="checkbox" name="dnsmanagement[{$num}]"{if $domain.dnsmanagementselected} checked{/if} />
{$LANG.domaindnsmanagement}
</label><br />
{$LANG.domainaddonsdnsmanagementinfo}
</div>
<div class="panel-price">
{$domain.dnsmanagementprice} / {$domain.regperiod} {$LANG.orderyears}
</div>
<div class="panel-add">
<i class="fa fa-plus"></i>
{$LANG.orderForm.addToCart}
</div>
</div>
</div>
{/if}
{if $domain.idprotection}
<div class="col-sm-{math equation="12 / numAddons" numAddons=$domain.addonsCount}">
<div class="panel panel-default panel-addon{if $domain.idprotectionselected} panel-addon-selected{/if}">
<div class="panel-body">
<label>
<input type="checkbox" name="idprotection[{$num}]"{if $domain.idprotectionselected} checked{/if} />
{$LANG.domainidprotection}
</label><br />
{$LANG.domainaddonsidprotectioninfo}
</div>
<div class="panel-price">
{$domain.idprotectionprice} / {$domain.regperiod} {$LANG.orderyears}
</div>
<div class="panel-add">
<i class="fa fa-plus"></i>
{$LANG.orderForm.addToCart}
</div>
</div>
</div>
{/if}
{if $domain.emailforwarding}
<div class="col-sm-{math equation="12 / numAddons" numAddons=$domain.addonsCount}">
<div class="panel panel-default panel-addon{if $domain.emailforwardingselected} panel-addon-selected{/if}">
<div class="panel-body">
<label>
<input type="checkbox" name="emailforwarding[{$num}]"{if $domain.emailforwardingselected} checked{/if} />
{$LANG.domainemailforwarding}
</label><br />
{$LANG.domainaddonsemailforwardinginfo}
</div>
<div class="panel-price">
{$domain.emailforwardingprice} / {$domain.regperiod} {$LANG.orderyears}
</div>
<div class="panel-add">
<i class="fa fa-plus"></i>
{$LANG.orderForm.addToCart}
</div>
</div>
</div>
{/if}
</div>
{/if}
{foreach from=$domain.fields key=domainfieldname item=domainfield}
<div class="row">
<div class="col-sm-4">{$domainfieldname}:</div>
<div class="col-sm-8">{$domainfield}</div>
</div>
{/foreach}
{/foreach}
{if $atleastonenohosting}
<div class="sub-heading">
<span>{$LANG.domainnameservers}</span>
</div>
<p>{$LANG.cartnameserversdesc}</p>
<div class="row">
<div class="col-sm-4">
<div class="form-group">
<label for="inputNs1">{$LANG.domainnameserver1}</label>
<input type="text" class="form-control" id="inputNs1" name="domainns1" value="{$domainns1}" />
</div>
</div>
<div class="col-sm-4">
<div class="form-group">
<label for="inputNs2">{$LANG.domainnameserver2}</label>
<input type="text" class="form-control" id="inputNs2" name="domainns2" value="{$domainns2}" />
</div>
</div>
<div class="col-sm-4">
<div class="form-group">
<label for="inputNs3">{$LANG.domainnameserver3}</label>
<input type="text" class="form-control" id="inputNs3" name="domainns3" value="{$domainns3}" />
</div>
</div>
<div class="col-sm-4">
<div class="form-group">
<label for="inputNs1">{$LANG.domainnameserver4}</label>
<input type="text" class="form-control" id="inputNs4" name="domainns4" value="{$domainns4}" />
</div>
</div>
<div class="col-sm-4">
<div class="form-group">
<label for="inputNs5">{$LANG.domainnameserver5}</label>
<input type="text" class="form-control" id="inputNs5" name="domainns5" value="{$domainns5}" />
</div>
</div>
</div>
{/if}
<div class="text-center">
<button type="submit" class="btn btn-primary btn-lg">
{$LANG.continue}
<i class="fa fa-arrow-circle-right"></i>
</button>
</div>
</form>
</div>
</div>
</div>
| {
"pile_set_name": "Github"
} |
1. Introduction {#sec1-cancers-12-00185}
===============
Diffuse large B-cell lymphoma (DLBCL) comprises about 40% of all lymphomas, constituting the most prevalent type of non-Hodgkin lymphoma. It can arise de novo or result from the malignant transformation of a more indolent lymphoma. According to *The 2016 revision of the World Health Organization (WHO) classification of lymphoid neoplasms* there are 13 subtypes of lymphoma defined as specific entities, designating the rest as DLBCL not otherwise specified (NOS), which account for the vast majority of DLBCLs \[[@B1-cancers-12-00185]\]. The standard treatment approach consists of immunochemotherapy (rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone---R-CHOP), which guarantees an overall survival (OS) of more than 60% for DLBCL-NOS cases. In particular, a subgroup of young patients with favourable-prognosis disease can even achieve the same clinical benefit with fewer cycles of R-CHOP \[[@B2-cancers-12-00185]\]. However, up to 40% of patients suffer relapse or refractory (R/R) disease \[[@B3-cancers-12-00185]\] and for them the standard salvage approach consists of autologous stem cell transplantation, even if long-term disease control is achieved in fewer than 50% of cases \[[@B4-cancers-12-00185]\]. Survival is particularly poor for patients relapsing within one year after R-CHOP with fewer than 15% of patients achieving a durable remission \[[@B5-cancers-12-00185],[@B6-cancers-12-00185],[@B7-cancers-12-00185]\]. Recently chimeric antigen receptor (CAR) T-cell therapies have been approved as alternative curative options for patients with relapsing or refractory disease. CAR T cells represent a new class of cellular immunotherapy involving ex vivo genetic modification of patients' T cells, triggering T-cell activation and cytotoxicity \[[@B8-cancers-12-00185]\], that demonstrated good efficacy in B-cell malignancies treatment, including DLBCL \[[@B9-cancers-12-00185],[@B10-cancers-12-00185]\]. In this context, a prevision of poor OS is attributed to relapsing cases and to patients with refractory disease \[[@B6-cancers-12-00185]\] for which even CAR T-cell therapy fails \[[@B11-cancers-12-00185]\].
Therefore, it is essential to search for clinical parameters and biomarkers that could help to better DLBCL patients' characterization and stratification. Nowadays, thanks to the availability of comprehensive genomic and transcriptomic analyses a wealth of information is generated, rendering the concept of personalized therapy more realistic. In the attempt to put some order in the most recent discoveries on DLBCL research, we reviewed the latest experimental studies in this field, focusing on the most important findings helping in the management of lymphoma patients from the perspective of personalized medicine.
1.1. Standard Prognosticators for DLBCL {#sec1dot1-cancers-12-00185}
---------------------------------------
One of the most commonly used prognostic tools is the *International Prognostic Index* (IPI) \[[@B12-cancers-12-00185]\], whose validity and reliability has been enhanced by several upgrades \[[@B13-cancers-12-00185]\]. However, it evaluates only five clinical parameters (age, lactate dehydrogenase, performance status, number of extranodal sites, and Ann Arbor stage), without considering the biologic characteristics of the tumour.
The first and nowadays most commonly used biologic prognosticator of DLBCL tumours is the cell-of-origin (COO) determination based on gene expression profiling (GEP), which subdivides most DLBCL-NOS patients into two main categories, namely germinal center B-cell-like (GCB), if presenting with expression features similar to germinal center cells, and activated B-cell-like (ABC) DLBCL \[[@B14-cancers-12-00185]\], when presenting features similar to activated B-lymphocytes. This subdivision is relevant for therapy and prognosis, as ABC cases show a worse outcome as regards progression-free survival (PFS) and OS after treatment with R-CHOP standard therapy \[[@B14-cancers-12-00185],[@B15-cancers-12-00185],[@B16-cancers-12-00185]\] in comparison to GCB patients.
However, GEP through microarrays poses a challenge because it is available only for a small fraction of patients whose mRNA can be extracted from fresh or frozen tissues. The attempts to substitute GEP with immunohistochemistry (IHC) applicable to formalin-fixed, paraffin-embedded (FFPE) tissue samples \[[@B17-cancers-12-00185],[@B18-cancers-12-00185],[@B19-cancers-12-00185],[@B20-cancers-12-00185],[@B21-cancers-12-00185],[@B22-cancers-12-00185]\] evidenced another series of inherent difficulties linked to the extreme variability of results, even when the same algorithm (Hans, Choi, Colomo, Muris, Pileri, or Tally) was applied \[[@B23-cancers-12-00185]\]. Indeed, when the two techniques were compared, it was evident that the classification of DLBCL based on the COO was different.
Five years ago a new approach named Lymph2Cx was proposed for GCB/ABC COO classification; based on a panel of 20 genes and applicable to mRNA extracted from FFPE tissue samples, it is conducted on the NanoString platform and replicates the results of conventional GEP, demonstrating its superiority to IHC algorithms in various series of DLBCL cases \[[@B24-cancers-12-00185],[@B25-cancers-12-00185],[@B26-cancers-12-00185],[@B27-cancers-12-00185]\].
In the context of GEP, a German research group recently analysed data generated from expression microarray analyses of 873 different types of lymphoma, including DLBCL, with the purpose of clarifying their phenotypic characteristics \[[@B28-cancers-12-00185]\]. Through this approach, the investigators demonstrated that the transcriptome panorama of B-cell lymphomas consists more in a continuum of expression states than of clearly separated phenotypes, and in which every layer represents a different lymphoma and individual cases \[[@B28-cancers-12-00185]\]. Focusing on DLBCL, a series of models employed GEP for classifying patients: Monti et al. subdivided cases into three groups that were identified in oxidative phosphorylation, B-cell receptor/proliferation, and host response \[[@B29-cancers-12-00185]\]; Dybkaer et al. isolated B cells from reactive tonsils and identified B-cell-associated gene signatures (BAGS), highlighting for each an association with molecular findings \[[@B30-cancers-12-00185]\]. Other researchers instead focused their efforts applying GEP in the study of the microenvironment of lymphoma cells \[[@B31-cancers-12-00185],[@B32-cancers-12-00185]\] and in the search of specific immune signatures \[[@B33-cancers-12-00185]\]. Indeed, over time a series of NanoString-based expression assays has been suggested; for example, the Michaelsen group recently proposed a new NanoString-based assay for BAGS classification to overcome the difficulty of microarray-based GEP, in order to better categorize DLBCL in diverse B-cell subtypes \[[@B34-cancers-12-00185]\]. Analysing microarray data from 970 patients belonging to four different cohorts, they first selected genes and then created and tested a new NanoString-based BAGS2Clinic assay for quick and easy-to-use BAGS profiling. Then, they tested the assay in an independent cohort of 88 lymph node biopsies and confirmed that it showed a good correspondence with the original BAGS classifier, having an overall accuracy of 84% and a subtype-specific accuracy ranging between 80% and 99%. It seems that BAGS classification could highlight important features of tumour biology and aspects about resistance to immuno- and chemotherapy that can be employed when choosing novel treatment strategies for DLBCL patients \[[@B34-cancers-12-00185]\].
However, albeit meticulous, even COO classification through GEP reserves diverse exceptions, and variation in patient outcome persists even within each COO subtype, posing the main difficulty in management of patients and raising the question of the deep study of the extreme molecular heterogeneity that features DLBCL \[[@B35-cancers-12-00185]\]. Consequently, several studies in the last years attempted to discover further stratification parameters serving to make a better patient categorization, and additional to the existing ones that presented some critical issues. Many prognostic markers have been considered, such as MYC gene alterations, which characterize from 5% to 15% of de novo DLBCL and confer a worse prognosis and higher risk of central nervous system involvement \[[@B36-cancers-12-00185]\], as well as TP53 mutation, Epstein--Barr virus infection, CD5 expression, CD30 expression, BCL2 rearrangement or expression, MHC class II expression, and others \[[@B37-cancers-12-00185],[@B38-cancers-12-00185],[@B39-cancers-12-00185],[@B40-cancers-12-00185],[@B41-cancers-12-00185],[@B42-cancers-12-00185],[@B43-cancers-12-00185],[@B44-cancers-12-00185],[@B45-cancers-12-00185],[@B46-cancers-12-00185],[@B47-cancers-12-00185],[@B48-cancers-12-00185]\], each presenting with contradicting data regarding their prognostic relevance. All things considered, at the current moment, genomic and transcriptomic profiling through next-generation sequencing (NGS) is surely the most powerful tool to investigate the molecular heterogeneity, as well as to find new potential biomarkers useful for diagnosis, risk determination, and treatment choice in DLBCL. However, in clinical practice, most investigations are conducted through the so-called "low-throughput techniques" (e.g., fluorescence in situ hybridization---FISH) and microarrays. Such approaches are acceptable if considering the old classification procedures that restricted the analyses to the search for a limited number of alterations, but now that fine molecular profiling of each individual case is possible, the implementation of NGS is becoming necessary also in the daily clinical workflow, maybe restricting the analyses to the search for specific molecular alterations.
1.2. Discovering New Prognostic Biomarkers and Models {#sec1dot2-cancers-12-00185}
-----------------------------------------------------
In the last years a series of discovery NGS researches was conducted trying to collect sequencing-derived information and to find focal alterations predicting prognosis, or in some cases, to elaborate models for DLBCL classification and prognostication ([Table 1](#cancers-12-00185-t001){ref-type="table"}).
In a large comprehensive exome and transcriptome sequencing of 1001 DLBCL cases \[[@B49-cancers-12-00185]\] Reddy and colleagues identified a set of 150 driver genes, most of which were then functionally characterized with an unbiased CRISPR screen of DLBCL cell lines to define oncogenes promoting cell growth. Through this information they drew up a prognostic model based on the presence of genetic alterations that was found to be better than current prognostic methods such as COO determination, IPI, and dual MYC and BCL2 expression. According to this model, genetic and/or expression aberrations of MYC defined the patient group with the worst prognosis; on the contrary, CD70 alterations in GCB-DLBCLs characterized the group with the better outcome \[[@B49-cancers-12-00185]\].
In a similar work by Schmitz and colleagues, NGS was adopted to unveil driver genes with recurrent alterations \[[@B50-cancers-12-00185]\]. They performed whole-exome sequencing (WES), RNA-seq, gene copy number analysis and targeted resequencing of 372 genes of 574 DLBCL cases, mostly pre-treated (96.5%), of which 51.4% were ABC and 20% unclassified (non-ABC, non-GCB). They developed a specific algorithm to identify genetic subtypes on the basis of the co-occurrence of genetic aberrations, and defined four prevalent subtypes that they termed MCD (co-occurrence of MYD88L265P and CD79B mutations), BN2 (BCL6 fusions and NOTCH2 mutations), N1 (NOTCH1 mutations), and EZB (EZH2 mutations and BCL2 translocations). Each subtype featured differences in gene-expression signatures, sensitivity to immunochemotherapy and outcome, BN2 and EZB subtypes being associated with favourable survival, and MCD and N1 subtypes to inferior outcomes. Indeed, MCD and BN2 subtypes seemed to depend on a chronic active BCR signalling pathway, opening an option for targeted therapeutic inhibition \[[@B50-cancers-12-00185]\].
Another similar 2018 research by Chapuy et al. analysed 304 samples from DLBCL patients to find recurrent mutations, low-frequency alterations, somatic copy number alterations, and structural variants \[[@B51-cancers-12-00185]\] identifying a series of genetic drivers that led to another new molecular classification. Through consensus clustering they characterized five DLBCL subsets, which included a novel group of ABC-DLBCL lymphomas of extrafollicular/marginal zone origin with low-risk and associated to NOTCH2 mutations (C1); a group of ABC-DLBCL with gains in BCL2 and/or mutations in MYD88L265P, CD79B, PIM1, and PRDM1, and associated with an unfavourable outcome (C5); two distinct subsets of GCB-DLBCL with different outcomes and targetable alterations (C3 group with aberrations affecting PTEN and epigenetic mediators such as KMT2D, CREBBP, and EZH2 and poor outcomes; and C4 group with alterations of signal transducers such as BCR--PI3K, NF-κB, or RAS--JAK, of transcription activators such as BRAF and STAT3, in histone genes, and genes involved in immune evasion (CD83, CD70, and CD58), and with favourable outcomes); and an ABC/GCB-independent group with biallelic inactivation of TP53, CDKN2A loss, and genomic instability, associated with poor outcomes (C2). The characteristics of the five subgroups identified also correlate with outcome in an independent manner in regard to IPI, suggesting new chances of therapeutic options and providing a roadmap for the identification of actionable DLBCLs \[[@B51-cancers-12-00185]\].
Comparing the last two proposed molecular classifications it seems that the C1, C3, and C5 groups overlap with the BN2, EZB, and MCD groups of the work by Schmitz et al \[[@B50-cancers-12-00185]\]. However, there are also differences, such as the C2 and C4 groups that did not present similarities with those in the other research. Indeed, both classifications differed from the molecular classification by Reddy and colleagues, in which MYC status was correlated with clinical outcome \[[@B49-cancers-12-00185]\]. Indeed, each model presents some critical issues: the model by Reddy et al. gives a prognostic value to each individual marker assessed, but, given the lack of clear clusters, it is hard to use for therapeutic purposes. The drawback of the study by Schmitz is that is only focuses on ABC type; the study of Chapuy et al. instead encompasses all DLBCL, however conformational studies are still lacking.
The utility of investigating only MYD88/CD79B mutations to improve DLBCL classification and prognostication was explored in a set of 250 DLBCL cases \[[@B52-cancers-12-00185]\]. The authors analyzed MYD88/CD79B mutations through NGS or allele-specific PCR, MYC/BCL2/BCL6 rearrangements by FISH, and EBV infections by EBER-ISH, identifying MYD88 and CD79B mutations in 29.6% and 12.3%, MYC, BCL2, and BCL6 rearrangements in 10.6%, 13.6%, and 20.3%, and EBV in 11.7% of cases, respectively. This study revealed that MYD88-mutated cases presented a significantly inferior five-year OS compared to wild-type; indeed, patients without any of the analysed alterations showed a superior OS compared to others carrying at least one aberrancy. In multivariable analysis, evaluating clinical-pathologic characteristics, outcome, and prognosis according to IPI, MYD88 mutations retained the adverse prognostic impact. Thus, investigating MYD88 mutations in DLBCL presents clinical utility as they feature a distinct molecular subtype with adverse prognosis \[[@B52-cancers-12-00185]\].
Further, MYD88 mutations, together with CD79A, CD79B, and CARD11 aberrations, are known to trigger chronic activation of the B-cell receptor (BCR) signalling pathway \[[@B65-cancers-12-00185],[@B66-cancers-12-00185],[@B67-cancers-12-00185],[@B68-cancers-12-00185]\]. Immunoglobulin M (IgM) is expressed in 90% of the ABC-like DLBCL subtype, and together with CD79A and CD79B, constitutes the BCR signalling complex, another mechanism of BCR aberrant chronic activation \[[@B69-cancers-12-00185]\]. A recent DNA copy number analysis of 1000 DLBCL cases identified gains of 18q21.2 as the most frequent genetic alteration in the ABC-like group, and recognized the TCF4 (E2-2) transcription factor gene as the main target of the genomic aberrations \[[@B53-cancers-12-00185]\]. With in vitro and in vivo experiments the effects of TCF4 overexpression were studied, observing its binding to IGHM and MYC gene enhancers and the augmented expression of the corresponding transcripts and proteins. Indeed, it was demonstrated that inhibition of TCF4 activity through the BET inhibitor ARV771 triggered death of the ABC-like DLBCL cells. Thus, this information represents a rationale for the employment of BET inhibitors for the subset of patients carrying this alteration \[[@B53-cancers-12-00185]\].
All the above-mentioned studies allowed the use of genomic aberrations to identify subgroups associated with distinct clinical outcomes, but it is not always possible offer a genetic classification to all DLBCL patients. In the attempt to solve this problem a series of other researches have been carried out. A 2019 study by Wang et al. employed WES data to establish mutant-allele tumour heterogeneity (MATH) \[[@B57-cancers-12-00185]\]. Based on the median expression level, patients were divided into low and high MATH score classes in which the higher MATH score group was associated with a higher risk of progression as compared to a lower MATH score, both in the discovery and in the validation set. The authors conclude that MATH has a prognostic value that could be considered in the management of DLBCL patients; a higher score of MATH has proven to be an independent risk prognostic factor in predicting recurrence \[[@B57-cancers-12-00185]\].
Another recent work instead studied the somatic hypermutation (SHM) mutational activities showing that they delineated the COO in DLBCL \[[@B55-cancers-12-00185]\]. Normally SHM acts during B-cell development targeting an immunoglobulin variable region \[[@B70-cancers-12-00185]\]; altered SHM hits several of the DLBCL driver genes \[[@B70-cancers-12-00185],[@B71-cancers-12-00185],[@B72-cancers-12-00185]\]. Alkodsi et al. found that the expression of 36 SHM target genes featured four novel SHM subtypes, strongly associated and overlapping with genetic subtypes already characterized by Schmitz et al., and that were significantly associated with OS and PFS of DLBCL patients treated with immunochemotherapy \[[@B55-cancers-12-00185]\]. Their stratification separates the GCB-DLBCL class into two major subtypes: SHM1, characterized by a high frequency of not always concurrent BCL2 and MYC aberrations and mutations in chromatin modifying genes, and including cases with poor outcome after standard R-CHOP therapy, that could be directed to alternative therapies; and SHM3, featuring mutations in the JAK-STAT pathway and a better outcome to standard cure. The ABC class was divided into SHM4, presenting with BCL6 fusions and mutations in CD70 and BCL10; and SHM2, presenting with the worst outcome and characterized by mutations in the BCR signalling pathway, that could be treated with kinase inhibitors. Through multivariate analysis of survival, they revealed that the SHM subtypes conferred a prognostic impact independently from the COO classification and IPI. Moreover, a distinct clinical outcome was observed for the SHM subtypes in the same COO subtype, and interestingly, even within unclassified DLBCL. Furthermore, they identified associations of each SHM subtype with driver mutations and oncogenic signalling pathways, proposing the possibility of choosing targeted therapy. Thus, SHM pattern represents a marker for the molecular and clinical classification of DLBCL \[[@B55-cancers-12-00185]\].
Also Arthur et al. in 2018 focused on SHM activity and analysed through WGS a discovery cohort of 153 DLBCL tumour/normal pairs, and performed data validation on an internal validation cohort of 338 cases and on an external validation cohort of over 1000 additional cases to find frequently mutated coding and non-coding loci, likely targeted by aberrant SHM \[[@B56-cancers-12-00185],[@B73-cancers-12-00185]\]. Through further analysis of matched RNA sequencing (RNA-seq) data, they suggested the potential cis-regulatory effects on coding genes of the alterations found \[[@B71-cancers-12-00185],[@B74-cancers-12-00185]\]. These analyses revealed recurrent mutations in the 3'UTR of NFKBIZ, responsible for oncogene deregulation, and NF-κB pathway activation in the ABC subclass; instead, in the GCB subgroup they evidenced small amplifications accompanied by over-expression of FCGR2B (the Fcγ receptor protein IIB), associated with poor outcomes \[[@B56-cancers-12-00185]\].
1.3. Discovering Causes of Transformation and Chemoresistence {#sec1dot3-cancers-12-00185}
-------------------------------------------------------------
In 2014 Pasqualucci and researchers through WES and copy-number analysis performed a pioneering work highlighting aberrations of CDKN2A/B, MYC and TP53 as major drivers of transformation of follicular lymphoma (FL) to an aggressive malignancy, typically DLBCL \[[@B58-cancers-12-00185]\] ([Table 1](#cancers-12-00185-t001){ref-type="table"}). Further, a subsequent work showed that one third of transformed FL harbor a MYC rearrangement \[[@B75-cancers-12-00185]\]. More recently, Gonzalez-Rincon et al. performed targeted NGS on 22 matched samples of pre-transformed FL/transformed DLBCL patients and on 20 non-transformed FL patients \[[@B59-cancers-12-00185]\]. Through this approach they identified several recurrently mutated genes with roles in B-cell differentiation, GC architecture and migration that were enriched at transformation, such as LRP1B, GNA13, and, in particular, POU2AF1, whose mutations seemed to characterize transformed forms rather than de novo DLBCL cases. Overall, they observed that pre-transformed FLs samples were more mutated and presented greater subclonal heterogeneity than non-transformed forms. Specifically, four genes differed between patients who did and did not show transformation: NOTCH2, DTX1, UBE2A and HIST1H1E; the mutation of these genes was related to a shorter time to transformation. With this information, the authors conclude, it could be easier to identify patients at higher risk of transformation \[[@B59-cancers-12-00185]\].
With the purpose of investigating the pathogenic causes of chemoresistance and relapse in DLBCL, a 2014 work sequenced VDJ junctions in 14 pairs of matched diagnosis--relapse tumours \[[@B60-cancers-12-00185]\]. The results of this study proposed two mechanisms of clonal evolution in which the early-divergent mode found two distinct clones, the diagnostic one and the relapsing one, that diverged early; and the late-divergent mode, in which relapse clones descended directly from diagnostic clones with minor divergence. Indeed, they identified in epigenetic modifiers such as KMT2D the potential early driving mutation targets, and in immune escape alterations the relapse-associated events \[[@B60-cancers-12-00185]\]. A following research analyzed 38 R/R DLBCL biopsies obtained at the time of progression after immunochemotherapy with WES and compared the obtained mutation frequencies to an unrelated cohort of 138 diagnostic DLBCLs, with the aim of identifying relapse-associated genes. Through this approach they evidenced TP53, FOXO1, MLL3 (KMT2C), CCND3, NFKBIZ, and STAT6 as top candidate genes implicated in therapeutic resistance. Indeed, they detected mutations that may affect sensitivity to novel therapeutics, such as MYD88 and CD79B mutations in a portion of R/R ABC patients, and STAT6 mutations in one third of R/R GCB patients that were associated with activated JAK/STAT signaling, increased phospho-STAT6 protein expression, and increased expression of STAT6 target genes \[[@B61-cancers-12-00185]\]. Another research highlighted JAK-STAT pathway involvement in the relapsed samples; the authors performed WES on 14 matched primary/relapse samples from six DLBCL patients and recorded a mild increase of mutations in relapsed samples as compared to primary tumour specimens; 264 genes possibly related to therapy resistance were identified, such as tyrosine kinases, glycoproteins, and JAK-STAT pathway genes, as well as PIM1, SOCS1, and MYC, already known to be related to a risk for treatment failure \[[@B62-cancers-12-00185]\].
Furthermore, recently two other large-scale differential multi-omics studies were conducted on R/R DLBCL patients \[[@B63-cancers-12-00185]\]. In the former, Fornecher et al. integrated quantitative proteomics and targeted RNA-seq data obtained from a cohort of R/R versus chemosensitive DLBCL patients and listed a set of 22 transcripts/proteins pairs, whose expression levels significantly differed between the two groups. In this list appeared genes involved in metabolism such as Hexokinase 3, in the microenvironment such as IDO1, CXCL13, in cancer cells proliferation, migration and invasion or the BCR signalling pathway such as CD79B \[[@B63-cancers-12-00185]\]. In the latter research, Rushton et al. collected samples from 134 R/R patients enrolled in three clinical trials and performed a combination of exome sequencing and target panel sequencing of lymphoma-associated genes on circulating tumour DNA (ctDNA) extracted from plasma samples and tissue biopsies \[[@B64-cancers-12-00185]\]. They found that R/R patients were enriched for mutations in five genes; TP53, IL4R, HVCN1, RB1, and MS4A1. Apart from TP53, already described in R/R cases \[[@B54-cancers-12-00185]\], they focused on the others showing that IL4R mutations may trigger constitutively activation of JAK/STAT signalling and were associated to inferior OS; HVCN1 modulates the B-cell receptor (BCR) function, and truncated HVCN1 isoforms have been demonstrated to enhance BCR signaling; MS4A1 encodes CD20, the target of Rituximab, and its mutations either truncate CD20, or destabilize a common transmembrane helix. Collectively, they found that DLBCL patients with such mutations present a higher risk of treatment failure \[[@B64-cancers-12-00185]\].
1.4. Double Hit or Triple Hit B-Cell Lymphomas {#sec1dot4-cancers-12-00185}
----------------------------------------------
The debate about research into aggressive mature B-cell lymphomas with MYC, BCL2 and/or BLC6 aberrations, defined as high-grade B-cell lymphoma with double or triple hit (HGBL-DH/TH), deserves a special section as their detection constitutes a principal goal according to the last WHO classification \[[@B76-cancers-12-00185]\]. Quite recently, two research groups tried independently to recognize HGBL-DH/TH cases using gene expression signatures. Applying a gene expression--based classifier to a cohort of 928 DLBCL patients, Sha et al. identified a molecular high-grade (MHG) subgroup comprising 83 patients (9%), 75 of which were afferent to the GCB subtype \[[@B77-cancers-12-00185]\]. They revealed a subcategory of DH lymphomas and MYC rearrangement in one half of the total. GEP analysis identified proliferative features similar to centroblasts. PFS analysis at 36 months was 37% for the MHG subgroup after R-CHOP compared with 72% for others. Indeed, DH lymphomas not afferent to the MHG subgroup showed no evidence of a worse outcome than other GCB-like patients. Furthermore, they analysed the benefits of the addition of bortezomib to standard R-CHOP therapy; the collected data suggested a possible positive response to bortezomib \[[@B77-cancers-12-00185]\].
In another work, Ennishi et al. studied RNA-seq data deriving from 157 GCB-DLBCL cases, including 25 HGBL-DH/TH-BCL2 cases, to elaborate a gene expression signature identifying HGBL-DH/TH-BCL2 from other GCB-DLBCLs \[[@B78-cancers-12-00185]\]. Through this approach they elaborated a 104-gene panel with which 27% of all GCB-DLBCLs were grouped by the same expression signature, even if only one half harbored MYC and BCL2 rearrangements (HGBL-DH/TH-BCL2). They evidenced that, regardless of the HGBL-DH/TH-BCL2 status, the so-called double-hit signature-positive (DHITsig+) patients were characterized by inferior outcomes after immunochemotherapy as compared to negative patients. Indeed, they projected a new NanoString assay (DLBCL90) that should be useful in routine diagnostics to easily identify DHIT-positive cases \[[@B78-cancers-12-00185]\]. Later, Hilton et al evaluated through WES 20 DHITsig+GCB-DLBCL cases apparently lacking MYC and/or BCL2 rearrangements and revealed six tumours with cryptic MYC or BCL2 rearrangements that were FISH negative \[[@B79-cancers-12-00185]\]. Copy-number analysis revealed MYC and MIR17HG gains or amplifications, and focal deletions of the PVT1 promoter, both of which may contribute to dysregulation of MYC and its downstream pathways. These results support the role of the GEP signature for identifying GCB-DLBCL with poor outcomes \[[@B79-cancers-12-00185]\].
Through the expression signatures found, most HGBL-DH/TH were identified, emphasizing that, regardless of genetic or epigenetic aberrations, these patients present similar gene expression features. This observation highlights the concept that the mechanisms of alteration of the physiologic function of MYC and/or BCL2 are diverse and still emerging. Apart from structural aberrations such as translocation or gene amplification, the MYC role can be altered by transcriptional and post-transcriptional modifications, by the activation of enhancer/superenhancer elements \[[@B80-cancers-12-00185],[@B81-cancers-12-00185]\] as well as by mutations \[[@B82-cancers-12-00185]\]. So, it is well known that there are diverse MYC alteration mechanisms, and other new ones are being discovered. For example, very recently Gallardo et al. showed a novel mechanism of MYC signalling aberrant activation \[[@B83-cancers-12-00185]\]. They explored the biological consequences of overexpression of hnRNP K, an RNA-binding protein, whose expression is altered in cancer. They analysed the clinical implications of hnRNP K overexpression in 75 DLBCL patients without MYC alterations, observing hnRNP K overexpression in DLBCL patients even without MYC aberrations and its association with a short OS and PFS. Furthermore, hnRNP K overexpression in transgenic mice induced the development of lymphomas and reduced survival. Indeed, through global screening experiments and biochemical assays, they showed that hnRNP K is capable of post-transcriptionally and translationally regulating MYC. This aspect renders hnRNP K overexpressing-cells sensitive to BET-bromodomain-inhibition both in vitro and in transplantation models, opening out a new treatment strategy for DLBCL patients \[[@B83-cancers-12-00185]\].
From a diagnostic point of view, because sometimes HGBL-DH/TH DLBCL lacks aggressive morphological and/or immunohistochemical characteristics, the doubt arises whether FISH testing for MYC, BCL2, and BCL6 genes should be performed for every DLBCL case to detect DH status. A limitation to FISH testing was proposed only for GCB and double-protein expressor (DPE) (i.e., cases with MYC and BCL2 protein overexpression) DLBCL cases, thus reducing the analyses to 15% of patients \[[@B84-cancers-12-00185]\], but until now studies on large cohorts of patients are lacking. In their report, Scott et al. evaluated the prevalence of HGBL-DH/TH and the data resulting from FISH, COO (Lymph2Cx gene expression assay and/or Hans algorithm), and IHC testing in a large cohort of 1128 DLBCL cases deriving from three clinical trials and a population-based registry \[[@B85-cancers-12-00185]\]. Overall, 8% of the DLBCL analysed cases were HGBL-DH/TH and mostly GCB (13.3%) rather than ABC (1.7%). They demonstrated that the MYC rearrangement (MYC-R) featured 12.2% of cases that were mostly, but not totally, GCB DLBCLs: MYC-R alone and MYC/BCL6 HGBL-DH were observed in both ABC and GCB DLBCLs; instead, MYC/BCL2 and MYC/BCL2/BCL6 HGBL-DH/TH characterized only GCB. The data collected by the authors suggested that the best method for identifying all HGBL-DH/TH tumours is to perform FISH for the MYC rearrangement for all cases; when FISH testing is positive, BCL2 and BCL6 gene aberrations should be investigated \[[@B85-cancers-12-00185]\]. Another option is limiting FISH screening to GCB DLBCLs, thus reducing FISH experiments to half of DLBCL patients, still allowing the detection of about 99% HGBL-DH/TH with BCL2 rearrangements. However, this approach would prevent identifying rare MYC/BCL6 HGBL-DH \[[@B36-cancers-12-00185],[@B86-cancers-12-00185]\] and ABC/non-GCB cases with isolated MYC rearrangements. Indeed, the selection of DLBCL cases based on DPE status and/or COO did not allow about 35% of all HGBL-DH to be detected. Thus, FISH screening for MYC, BCL2, and BCL6 should be performed in routine diagnostics, together with gene expression assays and NGS; alternatively, the optimum is testing for MYC rearrangements, followed by BCL2 and BCL6 analyses if the former is positive \[[@B85-cancers-12-00185]\].
However, FISH testing for MYC rearrangements frequently does not allow breakpoint characterization and MYC-partner gene identification. In an interesting study conducted by Chong et al., targeted sequencing of MYC, BCL2, BCL6 and the immunoglobulin (IG) loci was applied in 112 DLBCL cases with a MYC aberration to explore the rearrangement at base pair resolution and to identify the partner gene identity \[[@B87-cancers-12-00185]\]. They characterized the partner gene in 88 cases and identified a breakpoint cluster region upstream of the MYC coding region and in intron 1. In this region, mostly breaks for translocations involving IGH (80%) occurred, whereas breaks involving non genic rearrangements were located downstream of the gene locus with different partners such as IGL and IGK. They identified BCL6, ZCCHC7, and RFTN1 as recurrent MYC partners, never previously described. Indeed, they tested two commercially available FISH break-apart assays for the search of MYC rearrangements, and found discordant data in 32% of the examined patients. In HGBL-DH cases most (65%) of the MYC rearrangements presented non-IG partners and the breakpoints were located outside the genic cluster region in 72% of cases. Furthermore, patients with de novo HGBL-DH and MYC-IG aberrations featured a trend toward progression and to shorter OS as compared to patients with MYC--non-IG rearrangements, thus associating MYC rearrangement architecture to the clinical outcome \[[@B87-cancers-12-00185]\]. More recently, another work confirmed these data: by analyzing a large cohort of 2383 DLBCL patients, Rosenwald et al. identified MYC-R in 264 (11%) cases, and evidenced that the negative prognostic impact of MYC-R is largely observed in patients with MYC DH/TH disease in which MYC is translocated to an IG partner \[[@B88-cancers-12-00185]\].
HGBL-DH/TH lymphomas are a specific subcategory according to the WHO classification, owing to their particular worse outcome \[[@B89-cancers-12-00185]\]. As regards DH lymphomas, MYC and BCL2 rearrangements frequently trigger the corresponding protein overexpression, characterizing a specific group called DPE lymphomas \[[@B90-cancers-12-00185],[@B91-cancers-12-00185]\], clinically featuring rapid progression and poor outcome. Recently, a study by Uchida et al. showed the positive effect of the BCL2 inhibitor venetoclax for the therapy of this subgroup of lymphomas \[[@B92-cancers-12-00185]\]. In vitro studies on DH and DPE lymphoma-derived cell lines revealed that the survival of neoplastic cells seems to depend on BCL2 activity rather than that of MCL1, a protein with a pro-survival function. In this context, they demonstrated that venetoclax interrupts the interaction between BCL2 and BIM, a pro-apoptotic protein, induces dephosphorylation of BCL2, and represses MCL1 protein expression. In primary lymphoma cell cultures, venetoclax was able to induce apoptosis even at low doses \[[@B92-cancers-12-00185]\], showing venetoclax as a promising strategy for the treatment of DH-DPE lymphomas. Nonetheless, the first clinical studies showed that as monotherapy it probably has no room, and even when combined with a trail inhibitor doesn't seem effective in relapsed DLBCL \[[@B93-cancers-12-00185]\]. However, further investigations are needed before coming to definitive conclusions.
1.5. NGS Application in Clinical Practice: Liquid Biopsy {#sec1dot5-cancers-12-00185}
--------------------------------------------------------
In the future liquid biopsy will likely be the tool that can render NGS investigations more feasible and realistic. Analyzing circulating cell-free DNA (cfDNA) containing DNA released by the tumour cells (ctDNA), liquid biopsy is a non-invasive investigation that, joined to NGS sensitivity and specificity, will probably revolutionize cancer diagnosis, prognosis, and treatment. ctDNA has been demonstrated to be as accurate as genotyping of the diagnostic biopsy to detect somatic mutations in DLBCL \[[@B94-cancers-12-00185]\]; indeed, ctDNA analysis has proven able to define tumour burden \[[@B95-cancers-12-00185],[@B96-cancers-12-00185]\] and identify prognostic and actionable biomarkers \[[@B95-cancers-12-00185],[@B96-cancers-12-00185],[@B97-cancers-12-00185],[@B98-cancers-12-00185],[@B99-cancers-12-00185],[@B100-cancers-12-00185]\]. Indeed, it reflects the real tumour genomic heterogeneity, as demonstrated by the observation of varies mutations maybe originating from different tumour-associated localizations. Further, through liquid biopsy the response to therapy and minimal residual disease can be monitored, as well as transformation or chemoresistance emerging by tracking genetic evolution through ctDNA analysis over time \[[@B94-cancers-12-00185],[@B96-cancers-12-00185]\]. A 2019 work conducted liquid biopsy through targeted-NGS on a set of 390 lymphoma- and cancer-relevant genes in 50 lymphoma patients in order to establish the mutation profiles of different lymphoma subtypes and evaluate the correlation between the cfDNA concentration and other clinical indexes such as serum LDH and IPI \[[@B101-cancers-12-00185]\]. The cfDNA concentration in the plasma was significantly correlated with the clinical indices in DLBCL; indeed, the differences between GCB-DLBCL, non-GCB-DLBCL and natural killer/T-cell lymphoma were evident, confirming that NGS-based cfDNA mutation profiling is capable of discriminating different lymphoma subtypes as well as performing COO classification \[[@B96-cancers-12-00185],[@B101-cancers-12-00185]\], thus helping to direct precision medicine actions \[[@B101-cancers-12-00185]\].
Recently, ctDNA level measurement has recently been integrated in a new risk assessment method called CIRI (Continuous Individualized Risk Index), that dynamically evaluates individual outcome probabilities employing risk predictors obtained over time, producing real-time risk assessments during the patient's disease course. CIRI for monitoring DLBCL patients considers a total of six risk factors, including the IPI, COO, interim imaging (iPET), along with ctDNA measurements prior to cycles one, two, and three of therapy, and has been demonstrated to improve outcome prediction compared to conventional risk models, thus enabling therapy selection in the perspective of personalized medicine \[[@B102-cancers-12-00185]\].
1.6. Discovering Personalized Treatment Approaches {#sec1dot6-cancers-12-00185}
--------------------------------------------------
In the last years, the clinical management of patients with malignant lymphoma has benefited from research on tumour genomics and biology, particularly in the context of monoclonal antibodies and small molecule inhibitors \[[@B53-cancers-12-00185],[@B103-cancers-12-00185],[@B104-cancers-12-00185],[@B105-cancers-12-00185],[@B106-cancers-12-00185]\], despite some disappointing results of phase II/III trials on some promising agents (e.g., obinutuzumab and bortezomib) \[[@B107-cancers-12-00185]\] for which the underlying mechanisms are not well understood. Moreover, a problem of the first line studies is that in relapsed setting drugs have a short duration of responses and no plateau. Hence, any benefit seen in relapse setting does not necessarily translate in a durable increase in cure/remission in first line. Indeed, the efficacy of some drugs could be reduced because of incorrect combination with chemotherapeutic agents or insufficient dosage, as well as because of tumour-specific peculiarities \[[@B108-cancers-12-00185]\].
In the future, NGS implementation in the routine clinical diagnostics will render tumour genetic profiling within everyone's reach, offering the chance of a choice of tailored treatment strategies. However, despite the enormous excitement about the hypothesis of using targeted agents for patient personalized treatment, there are a series of inherent difficulties to be surmounted. Randomized trials on the addition of targeted drugs (ibrutinib, everolimus, bortezomib, and lenalidomide) to standard chemotherapy did not demonstrate a clear advantage \[[@B109-cancers-12-00185],[@B110-cancers-12-00185],[@B111-cancers-12-00185],[@B112-cancers-12-00185]\], and in some circumstances the use of targeted agents alone has been hypothesized. In other cases, the opportunity of drug combinations has been discussed \[[@B113-cancers-12-00185]\], as a better response can be obtained than with each drug alone. Indeed, although nowadays a number of new potent drugs are available, it is equally true that there could be a wide list of drug combinations that could be employed for patient treatment. The opportunity of using drug combinations that attack important cancer-signalling pathways at the same time from multiple fronts raises the chance of therapeutic success, especially in the treatment of tumours such as DLBCL that present with complex genetic heterogeneity. Indeed, this approach can reduce treatment resistance, which can frequently be due to pathway redundancies, cancer cell heterogeneity, and disease evolution \[[@B114-cancers-12-00185],[@B115-cancers-12-00185]\]. A clear example that confirms this concept is R-CHOP, which has recently been demonstrated to be effective and curative thanks to low cross-resistance, rather than synergy among drugs \[[@B116-cancers-12-00185]\].
However, today only a narrow list of approved drug combinations is available; indeed, they mostly derive from empirical clinical experience rather than rational design. To meet this need, some computational models have been developed that integrate the tumour genomic signatures with pharmacological profiles of drugs. In 2018, Preuer et al. developed a deep neural network model, DeepSynergy, to elaborate drug combinations integrating the data deriving from gene expression analysis of 39 cancer cell lines with the chemical peculiarities of 38 anti-cancer drugs \[[@B117-cancers-12-00185]\]. However, some authors observed that this method uses large numbers of known synergistic drug combinations, frequently not providing a hypothesis of the potential mechanism of a specific drug combination synergy. Other approaches were then developed in order to identify the underlying molecular mechanisms of disease; one example is Combinatorial Drug Assembler (CDA) \[[@B118-cancers-12-00185]\], a pathway-based model elaborated to discover drug combinations targeting pathways that overlap with tumour-enriched signalling pathways using differentially expressed genes. Another model is TIMMA \[[@B119-cancers-12-00185]\], which identifies drugs targeting multiple driver pathways by elaborating and combining drug screening data and drug target interactions into a target inhibition network framework. However, the survival pathways to be targeted were identified based on empirical selection, not considering genomic data.
Recently, some investigators proposed a new computational system biology tool that they called DrugComboExplorer, which combines specific genomic characteristics of cancer types (i.e., signalling pathways, interactome and pharmacological data) with pharmacogenomic profiles of 5585 drugs and bioactive compounds from the NIH LINCS program (Library of Integrated Network-based Cellular Signatures) \[[@B120-cancers-12-00185]\]. Indeed, by adopting a data-driven strategy and by combining multi-omics data (DNA seq, gene copy number, DNA methylation, and RNA-seq data) of individual cancer patients, this tool unveils new regulatory signalling pathway mechanisms (i.e., driver signalling networks) and is able to perform large-scale drug combination prediction (15,593,320 available drug combinations). In vitro validation experiments on DLBCL and prostate cancer cell lines, in order to evaluate the reliability and the predictive power of their bioinformatics tool, confirmed its utility in identifying targetable cancer driver pathways and prioritizing potential drug combinations useful to attack them \[[@B120-cancers-12-00185]\].
Surely, this kind of approach is still in its infancy as the authors admit, but further investigations are ongoing to try to apply these models to specific cancer cases in clinical practice in order to identify personalized drug combinations and more efficient treatment plans for individual patients \[[@B120-cancers-12-00185]\]. Then, large scale collaborations should be scheduled integrating mulit-omics data, Bayesian trial design, and early shared endpoints based on, for example, CIRI or any interim guided models to test in vivo the reliability of these drug combination-predicting models ([Figure 1](#cancers-12-00185-f001){ref-type="fig"}).
2. Conclusions {#sec2-cancers-12-00185}
==============
The attentive observer has surely realized that there is currently a dichotomy between the potentialities deriving from the recent discoveries for DLBCL diagnosis, prognosis, and treatment, and patient management in real clinical life. Despite discoveries of new drugs, R-CHOP remains the standard treatment approach, and targeted therapy is considered mostly for R/R patients. This circumstance will probably persist for a while, but when the biological background becomes clearer, when genome-wide screening has become within everyone's reach, and when targeted drugs have demonstrated their real benefits, personalized medicine will become feasible also for DLBCL.
In this panorama, a great improvement in clinical management of patients will certainly derive from the synergy of data obtained from liquid biopsy, providing information about therapy options stitched onto the patient's specific disease. Probably, today we are still far from this goal, as standardizations and clinical trial designs are still needed to render molecularly driven approaches really achievable. In any case, the bases are there, allowing us to pursue the goal of realizing targeted therapy for DLBCL.
The authors would like to thank Mary Victoria Pragnell, B.A., for language revision of the manuscript. This work was supported by the 'Il sorriso di Antonio' Association (Corato, Italy) and Associazione Italiana contro le Leucemie (AIL)-BARI.
The authors declare no conflict of interest.
{#cancers-12-00185-f001}
cancers-12-00185-t001_Table 1
######
Summary of the most relevant recent studies about DLBCL molecular classification and prognostication.
Reference Kind of Study Main Molecular Findings Clinical Implications
--------------------------------------------------------------------- ----------------------------------------------------------------------------------------------------------------------------- -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
New Prognostic Biomarkers and Models
Reddy et al., *Cell* 2017 \[[@B49-cancers-12-00185]\] Exome and transcriptome sequencing of 1001 DLBCL cases Identification of 150 driver genes set, definition of a prognostic model better than current ones -MYC mutations or aberrant expression: worst prognosis-CD70 alterations: better outcome
Schmitz et al., *NEJM* 2018 \[[@B50-cancers-12-00185]\] WES, RNA-seq, gene copy number analysis and targeted sequencing of 372 genes in 574 DLBCL cases Development of a specific algorithm identifying four genetic subtypes: -MCD (MYD88L265P and CD79B mutations),-BN2 (BCL6 fusions and NOTCH2 mutations),-N1 (NOTCH1 mutations),-EZB (EZH2 mutations and BCL2 translocations) -BN2 and EZB: favourable outcome-MCD and N1: inferior outcome-MCD and BN2 subtypes depend on BCR signalling pathway activation (targeted therapeutic option)
Chapuy et al., *Nat Med* 2018 \[[@B51-cancers-12-00185]\] WES and targeted sequencing on 304 DLBCL patients Identification of five DLBCL subsets:-C1 (NOTCH2 mutations)-C2 (TP53 and CDKN2A alterations, genomic instability)-C3 (PTEN, KMT2D, CREBBP, and EZH2 aberrations)-C4 (BCR--PI3K, NF-κB, or RAS--JAK pathway alterations, BRAF, STAT3, CD83, CD70, and CD58 mutations)-C5 (BCL2, MYD88L265P, CD79B, PIM1, and PRDM1 alterations) -C1: low-risk-C2: poor outcome-C3: poor outcome-C4: favourable outcome-C5: unfavourable outcome
Vermaat et al., *Haematologica* 2019 \[[@B52-cancers-12-00185]\] NGS, allele-specific PCR and FISH on 250 DLBCL cases Identification of:-MYD88 and CD79B mutations in 29.6% and 12.3%-MYC, BCL2, and BCL6 rearrangements in 10.6%, 13.6%, and 20.3%, respectively MYD88 mutations: adverse prognostic impact
Jain et al., *Sci. Transl. Med* 2019 \[[@B53-cancers-12-00185]\] DNA copy number analysis of 1000 DLBCL cases Identification of 18q21.2 gains as the most frequent genetic alteration in the ABC-like group, with involvement of TCF4 (E2-2) transcription factor gene The inhibition of TCF4 activity through BET inhibitors could be employed in the treatment of this patient subset
Intlekofer et al., *Blood Cancer* 2018 \[[@B54-cancers-12-00185]\] Targeted NGS on 198 DLBCL cases Identification of a median number of six genetic aberrations per case, with 97% of patients presenting at least one alteration and 54% of cases more than one (e.g., MYD88, CREBBP, CD79B, EZH2) -Less common aberrations (BRAF, CD274 (PD-L1), IDH2, and JAK1/2) could be employed as potential therapeutic targets-TP53 alterations: more frequently associated to lack of response to first-line chemotherapy and involved in R/R DLBCL
Alkodsi et al., *Leukemia* 2019 \[[@B55-cancers-12-00185]\] WGS, RNA-seq, and gene expression from literature DLBCL cohorts The expression of 36 SHM target genes identifies four SHM subtypes:-SHM1 (BCL2, MYC, and chromatin modifying genes aberrations)-SHM2 (BCR signalling pathway mutations)-SHM3 (JAK-STAT pathway mutations)-SHM4 (BCL6 fusions and mutations in CD70 and BCL10) -SHM1: poor outcome after standard R-CHOP therapy-SHM2: worst outcome, could be treated with kinase inhibitors-SHM3: better outcome to standard cure-SHM4: worst outcome, similar to SHM2
Arthur et al., *Nat. Commun.* 2018 \[[@B56-cancers-12-00185]\] Integrative analysis of whole genomes, exomes, and transcriptomes on thousands of DLBCL cases Identification of:-recurrent NFKBIZ 3' UTR mutations causing NF-κB pathway activation in the ABC subgroup-Small amplifications associated with over-expression of FCGR2B, in the GCB subgroup These results revealed new driver DLBCL mutations, improving diagnostic assays and offering new possibilities for the development of targeted therapeutics
Wang et al., *Carcinogenesis* 2019 \[[@B57-cancers-12-00185]\] WES on 22 early stage DLBCL and validation on 35 primary DLBCL cases Identification of two MATH score classes: low and high MATH score groups according to the median expression level -The higher MATH score group was associated with a higher risk of progression-The MATH score has a prognostic value that could be considered in the management of DLBCL patients
Causes of Transformation and Chemoresistance
Pasqualucci et al., *Cell Rep.* 2014 \[[@B58-cancers-12-00185]\] WES and SNP array analysis on 12 FL samples at diagnosis and on 39 transformed FL Identification of CDKN2A/B, MYC and TP53 as major drivers of transformation of FL to an aggressive malignancy, typically DLBCL The genomic profile of transformed FL shares similarities with de novo DLBCL-GCB but also displays unique gene mutations with diagnostic and therapeutic implications
González-Rincón et al., *PLoS One* 2019 \[[@B59-cancers-12-00185]\] Targeted NGS on 22 pre-transformed /transformed and on 20 non-transformed FL cases Transformed FL are characterized by several recurrently mutated genes with roles in B-cell differentiation, GC architecture and migration (LRP1B, GNA13 and POU2AF1) -Four genes differed between patients who did and did not show transformation (NOTCH2, DTX1, UBE2A and HIST1H1E)-the mutation of these genes was related to a higher risk of transformation
Jiang et al., *Genome Biol.* 2014 \[[@B60-cancers-12-00185]\] High-throughput sequencing of rearranged VDJ junctions in 14 pairs of matched diagnosis-relapse DLBCL Two proposed mechanisms of clonal evolution:-the early-divergent mode with two distinct clones (the diagnostic and the relapsing one) that early diverged;-the late-divergent mode, in which relapse clones descended directly from diagnostic clones with minor divergence Although DLBCL relapse may result from multiple tumour evolutionary mechanisms, each mechanism could provide rationale for therapies
Morin et al., *Clin. Cancer Res.* 2016 \[[@B61-cancers-12-00185]\] WES on 38 R/R DLBCL biopsies and on an unrelated cohort of 138 diagnostic DLBCLs Identification of TP53, FOXO1, MLL3 (KMT2C), CCND3, NFKBIZ, and STAT6 as top candidate genes implicated in therapeutic resistance Detection of mutations (MYD88 and CD79B) that may affect sensitivity to novel therapeutics
Nijland et al., *Cancers (Basel)*. 2018 \[[@B62-cancers-12-00185]\] WES on 14 matched primary/relapse samples from six DLBCL patients Identification of 264 genes possibly related to therapy resistance, including tyrosine kinases, transmembrane glycoproteins, and genes involved in the JAK-STAT pathway Identification of resistance-related genes such as PIM1, SOCS1, and MYC, that confer a risk for treatment failure
Fornecker et al., *Sci. Rep.* 2019 \[[@B63-cancers-12-00185]\] Integrated quantitative proteomics and targeted RNA-sequencing in 8 R/R DLBCL cases versus 12 chemosensitive DLBCL patients Identification of a set of 22 transcripts/proteins pairs, whose expression levels significantly differed between the two analysed groups Identification of new biomarkers related to chemoresistance, new potential drug targets: Hexokinase 3, IDO1, CXCL13, S100 proteins, CD79B
Rushton et al., *Hematol. Oncol.* 2019 \[[@B64-cancers-12-00185]\] WES and targeted NGS on plasma samples and tissue biopsies from 134 R/R patients R/R patients were enriched for mutations in five genes: TP53, IL4R, HVCN1, RB1 and MS4A1 DLBCL patients with mutations in these five genes present a higher risk of treatment failure
Abbreviations: WES, whole-exome sequencing; RNA-seq, transcriptome sequencing; NGS, next-generation sequencing; R/R, relapse or refractory; MATH, mutant-allele tumour heterogeneity; SNP, single nucleotide polymorphism; FL, follicular lymphoma; VDJ, Variable Diversity Joining.
| {
"pile_set_name": "PubMed Central"
} |
describe Wordmove::Doctor::Mysql do
let(:movefile_name) { 'multi_environments' }
let(:movefile_dir) { "spec/fixtures/movefiles" }
let(:doctor) { described_class.new(movefile_name, movefile_dir) }
context ".new" do
it "implements #check! method" do
expect_any_instance_of(described_class).to receive(:check!)
silence_stream(STDOUT) { doctor.check! }
end
it "calls mysql client check" do
expect(doctor).to receive(:mysql_client_doctor)
silence_stream(STDOUT) { doctor.check! }
end
it "calls mysqldump check" do
expect(doctor).to receive(:mysqldump_doctor)
silence_stream(STDOUT) { doctor.check! }
end
it "calls mysql server check" do
expect(doctor).to receive(:mysql_server_doctor)
silence_stream(STDOUT) { doctor.check! }
end
it "calls mysql database check" do
# expect(doctor).to receive(:mysql_database_doctor)
silence_stream(STDOUT) { doctor.check! }
end
end
end
| {
"pile_set_name": "Github"
} |
The invention relates generally to Internet Protocol (IP) packet communication methods and apparatus and more particularly to point to point protocol (PPP) packet communication methods and apparatus.
Internet Protocol (IP) based wireless communication architectures are known. As shown in FIG. 1, in the future the link between a base transceiver station (BTS) 100 and a selection/distribution unit (SDU) 102 will be based on IP that communicates point to point protocol (PPP) packets 101. The SDU may be part of a base site controller (BSC) or other suitable network element. The TIA/EIA/IS-634 standard (e.g., Part 4. Revision A xe2x80x9cCore Protocol Detailsxe2x80x9d) defines the application protocols and the messages shared between the SDU and the BTS 100. These messages between applications 103 will be transported over an IP network 104. In the IS-634 standard, the interface between the SDU and the BTS is called the A3 interface. For the user traffic exchanged between the SDU and the BTS, IS-634 assumes that the transport layer provides the call-context information. This information is not included in the IS-634 message itself. Since the current system is circuit switched, the slot position in the connection between the BTS and the SDU provides this information and in the proposed packetized system, an AAL2 header provides the call-context information. In the IP based system, the unique call-context reference will be specified by using user datagram protocol (UDP) between the SDU and the BTS. A mobile station 105 communicates with the BTS 100 as known. The UDP port number along with the IP address will provide the unique call-context information. The protocol stack 106 between the SDU and the BTS is shown in FIG. 1. An SDU consists of multiple SDU elements. Each SDU element terminates one call. The following four tuple: (IP address of the SDU 108, Port number of the SDU 110, IP address of the BTS 112, Port number on the BTS 114), provides a unique call context for each leg of a call. The IP address and UDP port numbers provide the unique call-context for each IS-634 frames 116. A point to point protocol (PPP) header 118 and PPP CRC information 120 is also used.
In most of the current systems and systems which will be deployed for the next few years, a T1 1.544 Mbps link 122 forms the backhaul link from the BTS 100 to the core network. This link 122 is very expensive and should be able to carry data for as many calls as possible. Hence, the key problem is to compress the data and decrease the header overhead as much as possible. As known in the art, link 122 is terminated using Channel Service Units/Data Service Units (CSU/DSU) 124 and 126.
A standard way to carry IP packets over T1 links is to use point to point protocol (PPP) as a link layer protocol over the T1 link. In the default mode, PPP prepends 5 bytes of header and 2 bytes of trailer to each IP packet; thus the default PPP overhead is 7 bytes. When the two ends of the link negotiate to reduce the header of PPP, the PPP overhead can be reduced to 5 bytes: Flag byte+2-Protocol type bytes+2-CRC bytes. (it cannot be assumed that the protocol type field could be reduced to 1 byte, as the protocol byte field for compressed TCP and UDP payloads occupy 2 bytes). In addition UDP header compression is described by RFC 2508. In this case, the compressed UDP header is 2 bytes. Thus the overhead per IS-634 frame is 7 bytesxe2x80x942 bytes compressed UDP header and 5 bytes PPP overhead. There is also a checksum feature of the UDP header. However, this PPP overhead can be unnecessarily large and can unnecessarily reduce the available bandwidth over the T1.
Another type of multiplexing scheme is described in ITU-T I.363.2, B-ISDN ATM Adaptation Layer: Type AAL2. This is a multiplexing scheme for point to point asynchronous transfer mode (ATM) virtual connections, whereby voice packets from multiple users may be contained in a single ATM cell payload 200. Each AAL2 user packet 202, 204, 206 that is multiplexed onto a given AAL2 virtual connection has a unique call-context reference, a Connection Identifier (CID). An example protocol stack 208 for this scheme is shown in FIG. 2.
Also, there have been several proposals for multiplexing real time transfer protocol (RTP) streams in the Internet. In the proposed designs, interest has also been expressed for reusing the RTP multiplexing scheme for improving the efficiency of transporting data on the BTS backhaul link. In the Internet, RTP multiplexing schemes have been proposed as methods to multiplex a number of low bit rate audio streams into a single RTP/UDP/IP connection between IP telephony gateways 300 and 302. The telephony gateways 300 and 302 may couple to Public telephone Networks (PTNs) 304.
The deployment scenario for these multiplexing schemes is shown in FIG. 3. The RTP multiplexing schemes are used to multiplex traffic between the two gateways 300 and 302 to transport data efficiently over the Internet. A requirement for the multiplexing schemes is that all the RTP streams 306, 308 being multiplexed originate and terminate at the same end-points, i.e. the IP address in the IP/UDP headers 310, 312 are the same. In all the proposals, each multiplexed stream is identified by a channel identifier 314 which is used to identify the payload belonging to that stream. The format and placement of the channel identifier differs between the different scenarios. A lookup table 316 can be used as a mechanism to multiplex or demultiplex IP packets.
One possible case of reusing the RTP multiplexing scheme for the BTS backhaul link is shown in FIG. 4. Much like in the AAL2 multiplexing case, there is an initial level of signaling which involves the SDU, packet control unit 400 PCU and the BTS (BTS includes the network interface board (NIB). This signaling sets up the two maps 402, 404 as shown in FIG. 4. In the upstream direction, the map 404 at the NIB enables the NIB to map from the multi-channel carrier card (MCC) (signal processor and channel coding card) device address that it receives in the packet from the BTS to the C_ID. At the packet control unit (PCU), a mapping is used to the SDU device address from the C_ID received on the link from the BTS. A router 406 suitably routes IS-634 packets to the appropriate SDU. The opposite occurs for downstream traffic. If the SDU sits on an IP network, this would mean recreating the UDP/IP header for the SDU device. This is very different from the process occurring in the Internet RTP multiplexing scheme. Recreating IP/UDP headers is a more complicated task than using the C_ID to identify one stream in a multiplexed RTP stream.
Another possibility of using RTP Multiplexing is shown in FIG. 5. In this scheme the SDU multiplexes the user information destined to one BTS into one multiplexed RTP stream 500 using routers 502 and 504. The disadvantages of this scheme are that the scheme cannot multiplex traffic destined to one BTS from different SDUs. In addition, the multiplexing gain may not be very high at the SDU. Typically there are two or three SDU serving 100 BTSs. Also, unless an RTP header is used for achieving synchronization between the SDU and the BTS, the RTP header is useless and one might have to implement real-time transfer control protocol (RTCP) at the SDU and the BTS to be able to use RTP.
Accordingly a need exists for a method and apparatus for reducing PPP packet sizes communicated over a communication link. | {
"pile_set_name": "USPTO Backgrounds"
} |
Q:
Normal subgroup question/example
Give an example(s) of a group $G$ and $H\leq G$ (i.e., $H$ is a subgroup of $G$) where $H$ is not normal in $G$.
What about $S_3$ and $\langle(1\;2)\rangle=\{(1),(1\;2)\}$? [Since $(1\;2\;3)(1\;2)(1\;3\;2)=(2\;3)\not\in\langle(1\;2)\rangle$] Does this work? Any other ideas?
A:
It is not rare to see examples of subgroups of a given group, which are not normal subgroups. I'll give you one from finite groups.
Consider this finite group of order $8$, call it $G$. Then $2\in G$ and $H=\{0,1\}$ is a subgroup of $G$. But $H$ is not normal, since
$$2H=\{2,4\}\ne\{2,3\}=H2.$$
| {
"pile_set_name": "StackExchange"
} |
(AP Photo/Mary Altaffer)
On Thursday, the National Academies of Sciences, Engineering, and Medicine will release its report on “The Economic and Fiscal Consequences of Immigration.” According to the report, first generation immigrants as a group increase the nation’s fiscal deficit. In other words, the government benefits they receive exceed the taxes paid.
The National Academies’ report provides 75-year fiscal projections for new immigrants and their descendants. The fiscal impact varies greatly according to the education level of the immigrant. Low-skill immigrants are shown to impose substantial fiscal costs that extend far into the future. The future government benefits they will receive greatly exceed the taxes they will pay.
On average, a nonelderly adult immigrant without a high school diploma entering the U.S. will create a net fiscal cost (benefits received will exceed taxes paid) in both the current generation and second generation. The average net present value of the fiscal cost of such an immigrant is estimated at $231,000, a cost that must be paid by U.S. taxpayers.
The concept of “net present value” is complex: it places a much lower value on future expenditures than on current expenditures.
One way to grasp net present value is that it represents the total amount of money that government would have to raise today and put in a bank account earning interest at 3 percent above the inflation rate in order to cover future costs.
Thus, as each adult immigrant without a high school diploma enters the country, the government would need to immediately put aside and invest $231,000 to cover the future net fiscal cost (total benefits minus total taxes) of that immigrant.
Converting a net present value figure into future outlays requires information on the exact distribution of costs over time. That data is not provided by the National Academies.
However, a rough estimate of the future net outlays to be paid by taxpayers (in constant 2012 dollars) for immigrants without a high school diploma appears to be around $640,000 per immigrant over 75 years. The average fiscal loss is around $7,551 per year (in constant 2012 dollars).
Slightly more than 4 million adult immigrants without a high school diploma have entered the U.S. since 2000 and continue to reside here. According to the estimates in the National Academies report, the net present value of the future fiscal costs of those immigrants is $920 billion.
This means government would have to immediately raise taxes by $920 billion and put that sum into a bank account earning 3 percent plus inflation per year to cover the future fiscal losses that will be generated by those immigrants.
To cover the future cost, each taxpaying U.S. household, on average, would have to pay an immediate lump sum of over $10,000. Costs would go up in the future as more than 200,000 additional adult immigrants without a high school diploma arrive in the country each year.
Again, converting a net present value figure into future outlays requires information on the exact timing of future costs that are not provided by the National Academies. However, a rough estimate of the future net outlays (benefits minus taxes) for the 4 million adult immigrants without a high school degree who have entered the U.S. since 2000 is perhaps $2.6 trillion.
One might argue that these estimates are exaggerated because many immigrants may return to their country of origin. But the report estimates already have a re-emigration rate of 31 percent built in.
A surge of low-skill immigrant workers may push down wages and thereby reduce consumer costs. But the National Academies report indicates such consumer gains would be modest, and if the wages of less-educated immigrants are driven down, the wages of less-educated U.S. workers will fall as well. Any consumer gains would come at the cost of wage losses for the most vulnerable American workers.
One might also argue that is it misleading to assign the costs of government “public goods” such as defense and interest of the national debt to recent immigrants. But the National Academies estimates exclude such public goods costs.
Advocates of ongoing, massive low-skill immigration have suggested that low-skill immigrants generate large-scale economic externalities that benefit U.S. workers. The National Academies report finds minimal evidence of such effects.
The continuing inflow of low-skill immigrants into the U.S. creates large fiscal burdens for U.S. taxpayers in both the present and the future.
Robert Rector, a leading authority on poverty, welfare programs and immigration in America for three decades, is The Heritage Foundation’s senior research fellow in domestic policy.
Jamie Bryan Hall is a senior policy analyst in the Center for Data Analysis at The Heritage Foundation. His research focuses on immigration and other issues in support of the Institute for Family, Community, and Opportunity. | {
"pile_set_name": "OpenWebText2"
} |
Q:
powershell script to add text to existing aspx file
I'm trying to find resources to help me write a powershell script to add text to an existing aspx file but can't seem to find anything. Does anybody have any suggestions or is there anybody that can help me some other way?
Update: So it's out there, I'm using version 1.0.
I have:
$lines = Get-Content foo.aspx
$lines = "<head>asfdsfsafd</head>" + $lines
$lines | Out-File "c:\documents and settings\...\foo.aspx" -Encoding utf8
but it wipes out everything originally in foo.aspx and creates <head>asfdsfsafd</head><head>asfdsfsafd</head>. How do I fix it so it keeps the original stuff in foo and add stuff to the beginning of the file rather than end?
Update:
I've figured out how to add text with:
$lines = add-content -path "C:\Documents and Settings\..\foo.aspx" -value "Warning...."
but want the text to go at the beginning of the aspx file
Update: I found a function that does what I want and I'm all set.
A:
You can get the content (array of strings) of the ASPX file using Get-Content:
$lines = Get-Content foo.aspx
Or you can get the content as a single string which is sometimes more useful if you want to use a regex that spans lines:
$content = Get-Content foo.aspx -raw
As far as changing the content, you have all sorts of options:
$content = "text before " + $content
$content += "text after"
$content = $content -replace 'regex pattern','replacement text'
And then to write back out to the file:
$content | Out-File foo.aspx -Encoding <UTF8 or ASCII or UNICODE>
| {
"pile_set_name": "StackExchange"
} |
Caffeic acid-assisted cross-linking catalyzed by polyphenol oxidase decreases the allergenicity of ovalbumin in a Balb/c mouse model.
Ovalbumin (OVA) is the most abundant egg white protein, but is also a major egg allergen. Desensitization of OVA may be a good way to control an egg allergy. In this study, caffeic acid-assisted cross-linked OVA catalyzed by polyphenol oxidase (PPO) was prepared, the effect of cross-linking on the allergenicity of OVA was tested in a Balb/c mouse model. Mice were orally sensitized with OVA or cross-linked OVA using cholera toxin as adjuvant. Clinical signs of allergy, specific antibody levels, serum histamine levels, mast cell protease-1 (mMCP-1) concentrations, morphological structure of duodenum, and cytokines were determined after mice were challenged with OVA or cross-linked OVA. Both OVA and cross-linked OVA induced allergic diarrhea in Balb/c mice, however, histological symptoms of small intestine were much milder in mice fed with cross-linked OVA than in those fed with OVA. A tendency toward decreased allergen-specific IgE, IgG, IgG1 and IgG2a levels, as well as serum histamine and mMCP-1 concentration were observed in cross-linked OVA group, accompanied by an inhibition of IL-4, IL-5, IL-13 and IFN-γ production in the stimulated spleen cell. It could be concluded that caffeic acid-assisted PPO-catalyzed cross-linking significantly reduced the potential allergenicity of OVA, but may not completely eliminate it. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
How to approach animations and OpenGL
There are tons of tools and instructions for making 3d models and animations in various software products. My question is: in video-game engines, when would you use a pre-rendered animation, and when would you use armature data in the model to manipulate your model in to the desired action?
Secondary questions:
Are there any games that even use the model's rigging, in-game, or is everything pre-rendered?
Are there any human-readable file formats that contain armature data?
Lastly, from a OpenGL-level and up perspective, how would you implement a system for animating something like walking?
I am building an OpenGL graphics engine from scratch as a personal project, so if answers can cater to that context, it would be fantastic.
A:
Yeah, most games use a model's rigging and apply animation tracks to the bones in real time based on things happening in the game or player input. Animations can also be blended between to make new animations or transition from one animation to another. Animations can also be combined such that the lower half of a body is playing one animation and the upper half is playing a different animation. There is also something called parametric animation where a lot more of the animations are derived from a smaller set of animated bone data. There is also various levels of physics based animation such as ragdoll and inverse kinematics. I've specialized as an animation programmer at previous employers, check out this more detailed info based on my experiences and observations: http://blog.demofox.org/2012/09/21/anatomy-of-a-skeletal-animation-system-part-1/
| {
"pile_set_name": "StackExchange"
} |
Google is completely redesigning AdWords - uptown
http://searchengineland.com/adwords-redesign-first-look-246074
======
eggy
In Dart and Angular 2. I have to take a look at Dart again. I thought it was
going to be left to wither and die, but with Flutter and now this, I have to
go back and take another look. The tooling was fun, and they are developing or
have developed a 'strong mode' for stronger typing.
------
rylest14
Love the new interface - going to make Adwords much more user friendly!
| {
"pile_set_name": "HackerNews"
} |
End of preview. Expand
in Dataset Viewer.
- Downloads last month
- 33