Datasets:

rntc

/

pubmed-preprocessed-quality-clinical

like 0

The results of the core biopsies and details of surgery were explained to the patient as well as further adjuvant treatments by a male breast oncoplastic surgeon and female breast care nurse. The patient was extremely reluctant to accept the diagnosis of breast cancer. He requested copies of all the results including his imaging and histopathology report. He understood the information that he was given but struggled to come to terms with it and declared he did not believe the diagnosis of breast cancer. He stated he would seek a second and possibly third opinion and that he would not consent to any treatment at this stage. He also informed the consultant that he would refuse any further appointments to the Breast Clinic but may contact his physician at a later date to discuss his diagnosis. The consultant contacted the patient’s physician by telephone and informed the physician about the consultation. The physician kindly agreed to see the patient and discuss things further. A further out-patient appointment was also offered to the patient.

CT scan was performed on the patient to be assessed for any sinus disease and showed mucosal thickening in bilateral maxillary sinuses and sinus orifice obstruction consistent with chronic sinusitis. Additionally CT scan showed bony nasal septal deviation to the right.

Group II women were seen in the recurrent miscarriage clinic within a week of positive home urine pregnancy test. They all received pregnancy support through the early pregnancy clinic. Follow-up was similar to Group I with serial Beta HCG assays and transvaginal scan at 6 weeks. None of these patients received any empirical treatment in the form of progesterone support or aspirin.

A 54-year-old woman presented with a 1-month history of right eye vision loss with progressive proptosis. Her visual acuity at the first visit was 20/400 in the right eye and 20/20 in the left eye. Her intraocular pressure was 19/19 mmHg. Right proptosis of 6 mm was noted.

Patient 4 (75-year-old man). (a) Preoperative computed tomography (CT) scan. (b) CT scan obtained after neoadjuvant intra-arterial chemotherapy (NAIC). Note the reduction in tumour size after NAIC. (c) CT scan obtained after tumour resection with adjacent bone removal.

Contrast-enhanced CT images obtained in a patient with 6-cm single HCC before TACE treatment. (A-C) show a patient with hepatitis B-induced liver cirrhosis and a 6-cm solitary HCC tumor in the hepatic segment VI. The contrast-enhanced CT scan before TACE revealed arterial enhancement of the HCC lesion.

Radiofrequency ablation after transarterial chemoembolization was performed on the same patient with 6-cm HCC after initial TACE treatment. (A) CT scan after TACE treatment shows lipiodol uptake in the central aspect of the lesion. (B) Contrast-enhanced MRI scan at 4 weeks after RFA shows complete tumor necrosis without arterial enhancement within the lesion. (C) Contrast-enhanced MRI scan at 6 months after combination treatment shows no tumor recurrence in the liver.

A 9.7-year-old girl with a juxta-articular osteoid osteoma of the proximal femur with involvement of the hip joint. (A) Axial CT image of the right femoral neck shows a prominent bony hypertrophy (arrowheads) around the nidus (arrow). (B) Coronal CT image demonstrates a nidus just above the lesser trochanter of the femur (arrow). Note the widening of the femoral neck and hypertrophy of the femoral head compared with the contralateral normal side. (C) Axial contrast-enhanced T1-weighted MR image with fat suppression shows synovial hypertrophy with effusion. The head-neck offset is not clear.

Epithelioid angiosarcoma is an uncommon tumor that can present in a variety of locations and occurs with higher frequency in patients who have had exposure to ionizing radiation. The following is a case of a patient who developed epithelioid angiosarcoma in the omentum after radiation treatment for cervical cancer.

Other intra-abdominal cases of this highly malignant sarcoma have been reported in patients who have received prior radiation. A case of small intestinal epithelioid angiosarcoma was identified in a patient with a history of thirty years of occupational exposure to radiation and polyvinyl chloride and developed gastrointestinal bleeding . This patient was readmitted one month after resection with malignant ascites and peritoneal studding and expired from respiratory failure soon after reoperation . Radiation-Associated Angiosarcoma (RAAS) occurs most commonly after treatment for breast cancer and is on average diagnosed seven years after radiation therapy . Sarcomas associated with radiation appear to have a worse prognosis compared with sporadic soft tissue sarcomas (17–41% 5-year survival) .

Over the past 18 years we have treated 14 adult patients who have ingested caustic agents. This report assesses our methods of handling patients referred to our centers (Ghaem and Omid hospitals Mashhad University of Medical Sciences) who have sustained caustic injuries to the upper gastrointestinal tract and development of stricture formation.

Findings of the first anal canal tumor. a Endoscopic appearance. b Histological appearance of a low magnification (original magnification: 20 ×). The border between adenoma and normal epithelium is indicated by a pair of arrowheads. Bar indicates 1 mm. The inset shows a higher-magnification view (original magnification: 200 ×)

Findings of the second anal canal tumor. a Endoscopic appearance. b Histological appearance of a low magnification (original magnification: 40 ×). The border between adenoma and normal epithelium is indicated by an arrowhead. Bar indicates 1 mm. The inset shows a higher-magnification view (original magnification: 200 ×). c Immunohistochemical staining of p16 in the second anal canal tumor (original magnification: 200 ×). Only 4 % of tumor cells were positive for p16. Bar indicates 100 μm

A Magnetic Resonance Imaging (MRI) scan of the brain showed diffusion restriction in the left insula and parietal cortex suggestive of acute/subacute ischemic stroke (Figure 2). Magnetic Resonance Angiography (MRA) revealed occlusion of distal left middle cerebral artery branch with possible stenosis in the left posterior cerebral artery (Figure 3). Medication history revealed recent use of oral contraceptive pills (OCPs) containing combination estrogen/progesterone which were started in the preceding month. Drug screen was negative. Prothrombotic workup was normal. Vascular ultrasounds showed no evidence of deep vein thrombosis. Transthoracic echocardiogram with bubble study showed a small patent foramen ovale (PFO).

We present two cases of Japanese patients with PSP and relapsing aspiration pneumonia and bronchopneumonia despite receiving total enteral feeding and conventional medication. We describe the successful treatment of their recurrent respiratory infections by qing fei tang.

The patient was managed postoperatively on anticoagulation and given nutritional support with intravenous nutrition until able to tolerate oral intake. She ultimately recovered from the operation and was discharged in a stable condition on postoperative day 20.

Our case report presents a patient with MCC metastatic to colon. The jejunal mass and lymphadenopathy seen on the initial abdominal CT before the colonoscopy were most likely metastasis of MCC but not confirmed by tissue biopsy. The patient responded well to chemotherapy.

There are more cases that report MCC metastatic to other parts of GI tract. One of them describes a patient with acute upper GI bleeding from a gastric metastasis . Krasagakis s. presented the case of a patient who had widely spread metastatic disease including the stomach . Another case presented the recurrence of MCC at ileocecal valve 18 months after resection of a tumor on the neck .

WU polyomavirus antigen in bronchoalveolar lavage specimens from lungs transplanted into a recipient (28-year-old woman) with Job syndrome. Immunohistochemical analysis of 293T cells transfected with pDEST26-WU–virus protein 1 and stained as follows. A) WU virus protein 1 monoclonal antibody (NN-Ab06). B) Isotype control. C) Mock transfected 293T cells stained with NN-Ab06. D) Bronchoalveolar lavage specimen stained with NN-Ab06 showing prominent dark staining of cells with enlarged nuclei and a ground glass appearance characteristic of viral cytopathic changes (arrows). E) Isotype control. Original magnifications ×400 in panels A–C and ×600 in panels D and E.

Tumors from two patients were subjected to small RNA deep sequencing. Patient 1; grade IA tumor (Table 1) was a 71 year-old man admitted due to limb ataxia. Examinations disclosed lack of smelling function (anosmia) and the MRI showed a tumor (meningioma) attached to the skull floor between the two frontal cerebral lobes (Figure 1A). The tumor was removed without any further neurological deficits. Patient 2; grade II tumor (Table 1) was a 74 year-old man that suffered from progressive hemiparesis and dementia over the last few years. The tumor (Figure 1B) located in the motor region was removed completely without any further neurological deficits.

Pedunculated exostosis: a Frontal X-ray of the left knee demonstrates the typical features of exostosis (arrow); also note the cortical defect on the lateral femoral metaphysis (arrowhead). b Ultrasound measurement of the hypointense cartilage cap (between calipers)

Respiratory distress in our patient was particularly severe leading to intubation and mechanical ventilation. Little is known about need for ventilatory support in pediatric patients with severe IPH. Rabe and coworkers report a series of 37 adult patients with DAH admitted to ICU for severe respiratory distress. Eighty-six percent of them (32 patients) were mechanically ventilated . Sun and coworkers described a 11-year-old case of pediatric IPH leading to ARDS and ventilatory support . In their case conventional ventilatory support failed to maintain adequate respiratory gas exchanges so extracorporeal membrane oxygenation (ECMO) was started. Another case of extracorporeal life support in a 5-week-old infant with IPH has been described with good clinical outcome . Our case did not require ECMO given the fact that respiratory gas exchanges rapidly ameliorated after starting corticosteroid therapy.

A 3-month old caucasian boy was referred to the dental clinic at a major children’s hospital by a physician in the emergency department (ED). His young parents had several concerns: (1) "Swollen gums" in the upper anterior area; (2) A loose upper left incisor (#F) that had erupted quickly in just a few weeks; (3) Feeding disturbances caused by the tooth; (4) Fear that it might be aspirated.

Screw fixation was performed according to the manufacturer’s recommended surgical technique. The anterior screw was inserted at a trajectory that was superior and towards the middle of the baseplate. The posterior screw was inserted at a trajectory that was inferior and towards the middle of the baseplate. The inferior screw was positioned into the pillar of the scapula and was generally situated downwards in the vertical axis of the glenoid at an angle of ~20°. The superior screw was positioned into the base of the coracoid process and was generally situated superiorly in the vertical axis of the glenoid at an angle of ~20° and anteriorly in the transverse axis of the glenoid at an angle of ~10°. We attempted to fix the 25- and 29-mm baseplates in the same directions as the screws.

A 51-year-old female presented with one day of copious vomiting and intermittent abdominal pain. Her clinical history was significant for hypertension treated with Losartan and Hydrochlorothiazide. Physical examination revealed mild dehydration and diffuse abdominal pain with no peritoneal irritation signs. CBC showed normal leucocyte count 4.58 × 103/μL (5–10 × 103/μL) with neutrophilia 84% (30–40%); CT scan of the abdomen (Figure 1) revealed an adynamic ileus with jejunal loop thickening and inflammatory changes suggestive of foreign body obstruction. The patient was taken to diagnostic laparoscopy which revealed two strictures at the jejunum. Small bowel resection with anastomosis was performed and the adherences were liberated. The patient had an uneventful recovery.

There is no consensus about how to process melanocytic lesions. The AJCC Cancer Staging Manual does not discuss this topic . The Royal College of Pathologists recommended the examination of the whole lesion . Only some studies have made a thorough histological examination of the entire lesion after complete surgical excisions . The case presented here is an example of a large AML with focal invasiveness which could only be identified by complete histological analyses.

Histology of the skin biopsy. Image (1) depicts wade fite stain demonstrating the presence of (red) bacilli (indicated by arrow) within foamy cells and endothelial cells. Image (2) demonstrates blood vessels (indicated by arrow) with associated endothelial swelling. Image (3) shows presence of necrosis and ulceration of epidermis without panniculitis. Image (4) depicts endothelial proliferation and capillary thrombosis (indicated by arrow)

The line of treatment was same for all the patients. MacLennan splint (acrylic cap splint) was planned because they were easy to fabricate and are frequently used in children as it is difficult to place circumferential mandibular stainless steel (SS) wires on the deciduous teeth due to their anatomic structure.

All the six patients were treated under general anesthesia. The mandibular arch was reduced and stabilized with prefabricated MacLennan splints and circum mandibular wiring (Figs 1 to 4) was done by placing small stab incision on the inferior border of the mandible on right-and left-side 4 to 5 mm from the midline. Mandibular awl was used to with first entry lingually along the body of the mandible by piercing lingual mucosa; after which the wire was passed onto buccal sulcus along the body of the mandible. Then the wire was held together and splint was stabilized by winding wire along the fractured segment. These splints were removed after 3 weeks in all the cases.

Immediately after suture of the skin closed castration of the contra-lateral side was performed. The spermatic cord was ligated using a transfixed ligature (Vetafil® 0.4 mm). The castration was performed without intermission. The wound was left for second intention healing.

Hematoxylin and eosin staining of a glioblastoma multiforme. (A) The interface between tumor cells and the area of necrosis. The necrotic area (arrows) show greatly reduced nuclear staining. (B) Proliferation of the endothelial cells (arrows) within a microvessel. (C) Palisading cells (arrows) around the necrotic area. Original magnification: 200×.

(A-B) Sagittal and coronal T1 weighted scans showing the lesion before being removed. The colloid has an isointense signal. (C-D) Sagittal and coronal post-gad scans after three months showing the cyst removal. It is possible to identify the optic chiasm the pituitary stalk and the normal pituitary gland.

The patients in group B were in the lateral decubitus position after administration of general anesthesia with single lung ventilation. The designated side was located on the more severely affected side. Anterior debridement and reconstruction was performed with mini-open approach (a small incision of 3–4cm) assisted by thoracoscopy .

At clinical examination our patient had a normal skull shape and there was no evidence of untreated craniosynostosis on examination or on 3D cranial CT. However we do not have adequate documentation from her childhood to exclude the possibility of premature fusion of her cranial sutures.

Both elderly subjects received EBS stimulation daily after undressing and washing procedure. The intervention was conducted in a supine position with the knee fully extended. The lower leg and foot were supported with a foot stand so the ankle was kept in a neutral ankle position throughout the intervention. Each treatment session lasted for 25 minutes and was repeated daily until the wound healed (Figure 1).

Polypoidal CNV. Both feeder and draining vessels were observed in the early phase of indocyanine green angiography. Large numbers of network vessels were seen to be fluorescing in an umbrella-like configuration. Several of the polypoidal lesions were dilatations of marginal tortuous vessels.

The novel p.G409R substitution in PINK1 was identified in a homozygous state in two affected siblings form an AR family (FM 49) (Fig 1A and 1B) (for detailed clinical features see S1 File) and was absent in more than 700 Saudi normal controls. While p.G189R substitution was identified in one sporadic case and two controls (Table 2).

(A) The two affected siblings of FM 19 share a reported mutation (p.T240M) and a polymorphism (p.V380L) in PARKIN. (B) FM 6 proband and affected father are both compound heterozygous for a novel variant (p.T240A) and a reported mutation (p.Q34R) in PARKIN. (C) Two affected siblings and their healthy father share two reported heterozygous variants; (p.R98Q) in PARK7/DJ1 and (p.I723V) in LRRK2. (D) Pedigree shows a sporadic occurrence of LOPD in patient (SP-7) harboring two heterozygous variants; p.E195Q in PARKIN and p.N551K in LRRK2. DNA from unaffected family members is not available. The asterisk denotes novel variant. AAO: age at onset. y: years. # variant with unknown clinical significance.

a Transesophageal echocardiography demonstrating the shunt between the left ventricle and right atrium. b Transthoracic echocardiography demonstrating the vegetation inserted above the septal leaflet of the tricuspid valve. c Cardiac magnetic resonance demonstrating a communication between the left ventricle and right atrium and right ventricle according to (d). C-type acquired Gerbode defect representing a supravalvular combined with n infravalvular communication between the left and right side of the heart

a Intraoperative view demonstrating the acquired Gerbode defect after removing the septal leaflet and part of the anterior leaflet of the tricuspid valve. b A diagram representing the extension of the destructed valvular tissue. c Hydraulic maneuver after closure of the acquired Gerbode defect and reconstruction of the septal leaflet of the tricuspid valve. d A diagram demonstrating the final view of the operation

We present a case of malignant melanoma of unknown primary presenting in an unusual place which is the inguinal lymph node. Theories try to explain the pathway of development of such tumors and one of the theories mentions that it could be a spontaneous regression of the primary cutaneous lesion. Another theory is that it could be from transformation of aberrant melanocyte within the lymph node. Prognosis is postulated to be better in this case than in melanoma with a known primary.

Several sources have found an association of myopic shift ranging from −2.5 to −8 diopters because of anterior displacement of the lens-iris diaphragm during an attack of malignant glaucoma . Sii and Shah reported an extreme myopic shift of −8.0 diopters in a healthy hyperopic male with a history of chronic angle closure glaucoma requiring prior Nd:YAG laser peripheral iridotomies and trabeculectomy. The patient developed malignant glaucoma after laser suture lysis and was treated medically with successful reduction of IOP.

Figure 2Clinical findings in parents of two families with Pfeiffer syndrome (PS). (IA and IIA) Anterior view of craniofacial features of PS parents; (IB and IIB) Showing lateral view of craniofacial features. (C) Feet. Mother of the Family 3 was submitted to surgical correction to great toes (IC). Note broad medially deviated/great toes in the father of family 5 (IIC). (D) Hands. Observe the broad thumb in ID; Note clinodactyly in father of the family 5 (IID).

Clinical findings in parents of two families with Pfeiffer syndrome (PS). (IA and IIA) Anterior view of craniofacial features of PS parents; (IB and IIB) Showing lateral view of craniofacial features. (C) Feet. Mother of the Family 3 was submitted to surgical correction to great toes (IC). Note broad medially deviated/great toes in the father of family 5 (IIC). (D) Hands. Observe the broad thumb in ID; Note clinodactyly in father of the family 5 (IID).

A 60-year-old female with a history of metastatic lung cancer treated with chemotherapy and radiotherapy was referred for significant left hip pain (Visual Analogue Scale score 90/100 mm). It was attributed to an osteolytic bone metastasis involving the left anterior acetabulum and considered at high risk for pathologic fracture.

Magnetic resonance imaging (MRI) scans from a 29-year-old male patient who presented with a five-week history of numbness and uncoordinated right upper limb activity for one week. The patient had a nodular cervical spinal cord lesion. (A) T2-weighted imaging showed hyperintense and (B) enhanced MRI images identified uniform nodular lesions.

Patient 3 was a 20-year-old woman. She was negative for HBsAg and HBV-DNA when she donated blood in 1998. She was HBsAg-positive and had an elevated ALT level when she donated again in 1999. She had a history of sexual contact with a man a few months before the donation in 1999. She and her sexual partner were found to be infected with HBV genotype D. She was HBsAg- and HBeAg-positive. IgM-type anti-HBc was positive (cutoff index value 5.4) and anti-HBc was also positive with a high titer (98% in 200-fold diluted serum). Liver biopsy prompted a histological diagnosis of chronic hepatitis with stage 1 and grade 2. She was treated with interferon for 1 month in 2000. She became HBsAg- and HBeAg-negative after the treatment. This patient was also suspected to have had unapparent acute HBV infection.

His bone age was 10 years according to the Greulich and Pyle method as was shown by his X-rays. A magnetic resonance imaging (MRI) scan of his pituitary showed T1 hyperintense focus in the midline at the median eminence with non-visualization of pituitary stalk. Posterior pituitary was not seen in relation to the anterior pituitary in the pituitary fossa. Anterior pituitary was seen in pituitary fossa at its normal location and was returning a normal signal. This represented ectopic posterior pituitary with absent pituitary stalk (Figure 1).Figure 1 T1 weighted magnetic resonance image of the pituitary. Pituitary stalk is absent (long arrow). Posterior pituitary is not seen in relation to the anterior pituitary in the pituitary fossa and is seen as hyperintense focus at the median eminence (short arrow). Anterior pituitary is seen in pituitary fossa at its normal location and returning a normal signal.

We report the case of a young man who presented with short stature and ultimately was found to have a rare congenital syndrome called PSIS. Despite the fact that PSIS is a rare disorder it should always be kept in the differential diagnosis of a patient presenting with short stature. Patients with this disease have an excellent opportunity to reach their normal height if they present before the joining of epiphyses.

Six‐year overall and event‐free survival rates are 46% (±0.10) and 45% (±0.09) resp. (Fig. 2). The latest relapse was 37 months following diagnosis. This patient (no. 11) succumbed 5 years after initial diagnosis from relapse despite having achieved a CR to initial therapy. The latest death thus far occurred 72 months from diagnosis (no. 31).

Confirmatory FISH result. Confirmatory FISH of this sSMC using centromere probe 14/22 (red) and TelVysion 16p (green) specific for 16pter revealed five distinct red signals and three distinct green signals confirming the origins of the sSMC. The marker is highlighted by a white arrow.

A 75-year-old man was referred to our head and neck oncology service with a 2 × 2 cm left-sided preauricular lump (Figure 1). The lump was firm to palpation. There was no fixation to the overlying skin or underlying tissue. There was no palpable cervical lymphadenopathy. There were no associated cranial nerve palsies.

The patient had a skin lesion excised from his left temporal region 6 months prior to this presentation. This initial skin lesion was described as “granuloma-like” and grew quickly over a period of 2 months to a size of 1.7 cm. The histopathology of the left temporal lesion showed a carcinosarcoma. It contained islands of malignant squamous epithelium surrounded by sheets of large undifferentiated cells (Figures 2 and 3). Cytokeratin AE1/3 marked the squamous epithelial islands and occasional undifferentiated cells (Figure 4). The tumour was confined to the deep reticular dermis with a measured depth from the epidermal granular layer of 3.5 mm. No vascular or perineural invasion was seen. The tumour was excised with a margin of at least 1 mm. The patient subsequently underwent superficial radiotherapy to the tumour bed at a dose of 51 Gy in 17 fractions.

A) A panoramic image of a patient complaining of dull pain two years after root canal therapy (RCT) of the right maxillary first molar. Note the apical periodontitis around the apex of the MB root; B) Axial CBCT scanning of the maxillary right quadrant showing the undetected and untreated second mesiobuccal canal (MB2) (arrow head)

A) Cross-sectional CBCT view showing the extrusion of sealer after root canal therapy (RCT) of the left maxillary first molar. This image also represents the anatomical relation of roots and maxillary sinus; B) Note the extrusion of the sealer through the periapical lesion into the maxillary sinus. C) Anatomical relation of roots and buccal/palatal cortical plates D) Three-dimensional reconstruction

A) CBCT view shows a tiny horizontal root fracture on the buccal surface of the maxillary left central incisor caused by impact trauma; B and C) Note the two separate periradicular lesions in the apical area (arrow) and adjacent to the fracture line (arrow head) due to tooth necrosis; D) Three-dimensional reconstruction of the lesion in the periradicular buccal area

A) Panoramic view of a patient complaining of pain in the upper left quadrant: the second molar has a normal appearance. B) The axial view showing the abnormal anatomy of the second molar with four roots. C) Three dimensional reconstruction of the alveoli showing the two separate palatal roots of maxillary left second molar

Images were taken 21 days post-operatively and 2 days before radiotherapy. a. T1-weighted MRI with contrast enhancement. b. 18F-FLT PET images. c. CT image of PET-CT scan. Residual tumor regions defined by T1-MRI (red line) and 18F-FLT PET (yellow line) are superimposed on the CT image.

Images were taken 21 days post-operatively and 2 days before radiotherapy. a. T2-weighted MRI. b. 18F-FLT PET image. c. CT image of PET-CT scan. Residual tumor regions defined by T2-MRI (blue line) and 18F-FLT PET (yellow line) are superimposed on the CT image.

Seven-year-old boy who presented with ventriculomegaly associated with aqueductal stenosis. He moved his head during the scan. The cerebrospinal fluid (CSF) in the body of the lateral ventricle was agitated by head movement (arrows). Supplementary video 5.

One patient had haemodynamic instability but did not require surgical intervention. This patient had not only sustained a liver injury but also lung contusions and bilateral haemothoraces which were managed by intercostal chest drainage. Haemodynamic stability was regained after transfusion of 4 units of packed red cells. No contrast extravasation was noted on CT hence no embolization was performed. The patient required 10 days of intensive care support and suffered no sequelae from the hepatic injury.

Equestrian accidents are a known cause of abdominal injuries yet there is little literature surrounding this. Our study is the largest published series of liver injuries following equestrian accidents and is the first to focus on hepatic injuries following equine-related accidents and the management and outcome of these patients. Our findings suggest that conservative management of these liver injuries is a safe and viable option and highlight the importance of early cross-sectional imaging to aid diagnosis and determine the extent of injury.

The patient underwent APOL1 genotyping using targeted PCR amplification and sequencing as previously described . Total genomic DNA was extracted from blood samples using the Nucleon Genomic DNA Extraction Kit (GE Healthcare). PCR was used to amplify the APOL1 gene using the primers F-5′ AGCCACCACACCGAGCCAAAACTGC and R-5′ AGCACAAGAAAGAAGCTTACAGGGG to amplify a 783-bp region of APOL1 on chromosome 22q13.1. PCR amplicons were cloned into pCR2.1R Topo and sequenced in both directions using BigDye sequencing on an ABI3700XL DNA sequencer (Applied Biosystems). Quantitative Sandwich ELISAs (USCN Life Sciences) were performed in duplicate according to the manufacturer's instructions to measure the concentration of APOL1 in patient serum and the serum of 12 healthy anonymous Vietnamese volunteers.

Pre-operative MRI of patient diagnosed as TN. a Routine MRI sequences displayed the nerve and vascular conflicting on the right side. b Diffusion tensor images and the region of interest measured of bilateral TGN. c The reconstruction of TGN fibers is shown

Rupture of a splenic artery aneurysm (SAA) is a rare condition that occurs predominantly in pregnancy. It is associated with a maternal mortality rate of 75% and fetal mortality rate of 95% . We report a case of ruptured splenic artery aneurysm during the third trimester of pregnancy with both maternal and fetal survival.

The patient started induction treatment and Imatinib. The bone marrow aspirate on day 34 confirmed progressive disease with 30 % blast and persistence of BCR/ABL. After a second line of intensive ALL-type induction therapy the patient finally died due to toxicity (gastrointestinal bleeding). No SCT had been planned due to age and unfit status. It is noteworthy that the blood counts in a regular check-up 4 months before the diagnosis had a slight leukocytosis that was not studied.

Overall only a few cases with the e1a3 BCRABL fusion proteins have been reported. This rare variant has mostly been described with an indolent clinical course in the setting of CML and its role in B-ALL is still unclear. We report two new cases of e1a3 Ph+ ALL patients in where we highlight the finding of the myeloid CD33+ marker expression by immunophenotype (biphenotypic and bilineal blast population were discarded by EGIL classification). This means that both cases could be defined as acute lymphoblastic leukemia with aberrant myeloid markers (ALL My+). We previously speculated that B-ALL e1a3 cases could represent CML in lymphoid blast crisis that underwent an under diagnosed chronic phase. In one of our cases we do not have any blood counts prior to the B-ALL diagnosis. However the other presented a non-evaluated leukocytosis in the blood count available before diagnosis.

Computed tomography with intravenous and oral contrast from case 2. Coronal section of the abdomen and pelvis. Arrow points to 14.0 × 9.8 × 10.8 cm heterogeneous mass in the right upper quadrant abutting the ascending colon and duodenum. Oral contrast is seen within the mass. The fat plane between the mass and the second segment of the duodenum is obscured

Pachydermodactyly is a rare disease with noninflammatory swelling around the proximal interphalangeal (PIP) joints of digits II–IV. The thumb or digit V is sometimes affected. X-ray investigation demonstrates no bony or articular changes. Several papers reported that the affected lesion was histologically composed of hyperkeratosis and that increased collagen was present in dermal tissues [1–6].

The scrotal incision of donkeys in group I was rinsed to remove excessive crusted exudates and then digitally reopened and explored. The drained scrotal cavity was then rinsed massively. The changes in donkey behavior and the size of the swelling at the site of surgery were monitored daily. In group II and III the drain was changed daily for the first week post castration.

Two case reports describe the successful use of haloperidol. A 70-year-old man who presented with excessive masturbation following a frontal lobe injury showed a marked reduction of symptoms with haloperidol 3 mg . A 90-year-old man with Alzheimer’s disease and an array of behavioral symptoms including urethral masturbation with foreign bodies and sexual disinhibition had a good response to haloperidol 1.5 mg .

This case report will discuss the delayed neuropathic complications that may occur in a woman who experienced female circumcision without evidence of any neuromas. Our goal is to educate health professionals to be aware of these complications in addition to their investigations and treatment in order to find a solution to relieve the patients' symptoms.

Axial magnetic resonance imaging at the level of the cavernous sinuses. A. Thin-slice axial T2-weighted images obtained by three-dimensional driven equilibrium sequence revealed edematous right trigeminal ganglion (arrow). B. Postgadolinium-pentetic acid spin echo T1-weighted with fat suppression magnetic resonance imaging of temporal bone. Edematous right trigeminal ganglion within right Meckel’s cave (arrow) surrounded by abnormal prominent enhancement in right Meckel’s cave and cavernous sinus (arrowhead).

We demonstrated a rare case of GS in spite of the clinical history of previous radical mastoidectomy and nonpneumatization of the petrous apex and the successful conservative treatment. A long-term follow-up program should always be encouraged in patients who have undergone radical mastoidectomy.

The MCAL surgery was performed as described previously with minor modifications . A 2 – 3 mm burr hole was drilled at the junction of the zygomatic arch and the squamous bone. The main trunk of left MCA was exposed and electrocauterized distal to the lenticulostriate branches. The treatments were injected intra-peritoneal (IP) immediately after occlusion and repeated at 24 hours post-stroke. Animals were euthanized and tissue collected at 48 hours post-stroke as previously described .

Figure 2 illustrates a series of coronal sections through the extent of the neurotoxic prefrontal lesion in each case. Higher power photomicrographs taken at the midpoint of the lesion are shown in Fig. 3. This also illustrates the lack of damage to prefrontal cortex produced by vehicle injections in case S4. The inferotemporal lesions were as intended in all four cases and are illustrated in Fig. 4.

Brain MRI (T1-weighted imaging) showing an avidly enhancing extra-axial dural-based solid mass lesion (3.8×3.5×2.5 cm) in the anterior-inferior aspect of frontal lobes in the midline just above the cribriform plate (olfactory groove) suggestive of meningioma (blue arrow).

Bilateral shoulder radiographs obtained 1 month before cryoneurolysis show right sided moderately severe degenerative change and left moderate to severe arthritic change with flattening of the humeral head and prominent inferior osteophytes. (A) Frontal plane view of the left shoulder. (B) Axillary view of the right shoulder. (C) Frontal plane view of the right shoulder.

(a) Aortic segment involvement: Cases presenting with TAA divided by thoracic aortic segment involvement. (b) Presenting symptoms: Reported patient symptoms at presentation. (c) Presenting medications: Medications pre-prescribed at the time of presentation. (d) Past medical history: Previous medical history relevant to aortic disease.

Slit-lamp examination. a Corneal ulcer with a central fluorescein stain and hypopyon. b Increased hypopyon level and persisting stromal ulcer. c Decreased hypopyon on the 3rd day of intracameral cefuroxime injection. d The hypopyon was disappeared and the stromal infiltrates was regressing on the 7th day of cefuroxime + moxifloxacin. e Residual central stromal opacification remained at 3rd month

A 73-year-old Caucasian female presented to the neurosurgical office with complaints of radicular left leg pain along with characteristic dermatome findings. She had a previous relevant medical history of well-controlled beta thalassemia minor for two years. The patient's baseline hemoglobin level was approximately 10 g/dL due to her beta thalassemia minor diagnosis.

Timeline of treatments for each patient. (A) The patient 1 received 9 months of Regorafenib personalized treatment. (B) The patient 2 was still receiving personalized schedule of Regorafenib at the moment of the analysis. (C) The patient 3 received 8 months of Regorafenib personalized schedule.

A 35-year-old primigravida was treated with one cycle of in vitro fertilization (IVF) for primary infertility of one and a half years. She reportedly received ovarian stimulation therapy with gonadotropins followed by oocyte cryopreservation five months ago. She was subsequently diagnosed with bilateral ovarian enlargement due to hyperstimulation which was managed with a high-protein diet and cabergoline. She reportedly recovered completely as evidenced by an ultrasound scan done before embryo transfer.

The patient was on a transatlantic trip when she developed severe acute spasmodic abdominal pain in the left iliac fossa and nausea at the transit airport. She was transferred to a women’s specialty hospital after the administration of parenteral analgesia.

The only case associated with a negative clinical impact resulted in unnecessary antiviral therapy. This patient presented with fever of unknown origin during hospitalization for lymphoma. Cytomegalovirus (SMRN = 159) was identified by plasma mNGS testing and treatment with foscarnet sodium but was ineffective. The patient finally improved after switching to voriconazole based on the result of subsequent fecal culture that was positive for Candida parapsilosis (see Table S2).

Allogeneic haematopoietic stem cell transplantation (allo-HSCT) is the only available curative treatment for FHL at present. The success of HSCT is dependent on complete control of the disease prior to transplantation (15). Case 2 describes a patient with FHL successfully treated in first intention by a combination of RUX and DXM. Our observation suggests that this less toxic and effective treatment regimen could be used as a first-line therapy for FHL and help bridge eligible patients to HSCT even if Case 2 abandoned HSCT for personal reasons.

Here we present a case of a wooden foreign body in a forehead wound which went undetected during two separate emergency department visits. The case information is based on a review of the electronic medical record as well as interview of the patient’s mother and the clinicians responsible for providing care over the three emergency department contacts. Written informed consent was provided by the patient’s mother to permit disclosure of the case and the associated images.

This initial reduction was attributed to the acute reduction in PCWP after implantation. The authors suggested that the gradual reduction after the 3 months is probably related to favorable structural remodeling of pulmonary vasculature due to lower pulmonary pressures .

Adam's experience in HYIP is used to illustrate the 4-step intervention model. Adam is a 15-year-old living with his aunts and older cousin. He was referred to HYIP by his school for concerns about long-term absenteeism. Please refer to Figure 3 for Adam's case study and his journey through HYIP.

A) Horizontal section sinus CT. The mass in the right maxillary sinus is infiltrating into the maxillary sinus (arrow). B) Coronal section sinus CT. The mass shadow in the right maxillary sinus is infiltrating outside the maxillary sinus bone (arrow). C) Coronal MRI T2-weighted image. The low-signal mass shadow extends into the right orbit. There is a slightly high-signal shadow in the right middle nasal canal that appears to be secondary inflammatory tissue (arrow).

Fig. 2(A) Cross section of brain demonstrating architectural disruption with necrosis and intraparenchymal hemorrhage (red arrow) as well as multiple cystic spaces within the cerebellar parenchyma (white arrows). (B) Multiple cystic spaces within brain parenchyma (20x). (C) Hypoxic-ischemic injury with diffuse hyper-eosinophilic necrotic neurons (400x). (D) Gram stain of brain tissue demonstrate gram positive rods with terminal and subterminal spores consistent with C. septicum (1000x; inset shows digital zoom of a single organism). (E) Moderately differentiated adenocarcinoma of the cecum with areas of acute inflammation and necrosis (20x). (F) Gram stain of necrotic colonic adenocarcinoma demonstrating gram positive rods consistent with C. septicum (1000x)

(A) Cross section of brain demonstrating architectural disruption with necrosis and intraparenchymal hemorrhage (red arrow) as well as multiple cystic spaces within the cerebellar parenchyma (white arrows). (B) Multiple cystic spaces within brain parenchyma (20x). (C) Hypoxic-ischemic injury with diffuse hyper-eosinophilic necrotic neurons (400x). (D) Gram stain of brain tissue demonstrate gram positive rods with terminal and subterminal spores consistent with C. septicum (1000x; inset shows digital zoom of a single organism). (E) Moderately differentiated adenocarcinoma of the cecum with areas of acute inflammation and necrosis (20x). (F) Gram stain of necrotic colonic adenocarcinoma demonstrating gram positive rods consistent with C. septicum (1000x)

Abbreviations: m months; y years; F female; M male. Clinical and neuropathological details for the patients with Alpers’ syndrome (Pt.01 – Pt.10) and adult patients with POLG-related encephalopathy (Pt.11 – P13) are summarised in . Historical patients (†) remain without a molecular diagnosis since they precede identification of pathogenic POLG variants known to cause Alpers’ syndrome and extraction of DNA from FFPE tissues to sequence POLG was unsuccessful. POLG RefSeq: NM_002693

Echocardiography at the initial visit revealed pericardial effusion. (A) Parasternal long axis. (B) Parasternal short axis. Red arrows point to pericardial effusion. Echocardiography after pericardial drainage. Pericardial effusion remained low without excessive reaccumulation. (C) Parasternal long axis. (D) Parasternal short axis.

(A) 2D preoperative transesophageal echocardiography (TEE) showing the presence of a mass (arrow) attached to the aortic prosthesis and floating in the aortic root. (B) 2D preoperative TEE showing a mass (arrow) attached to the mitral prosthesis on the atrial side. (C) postoperative 2D TEE showing no residual mass on the aortic prosthesis. (D) postoperative 2D TEE showing a residual minimal stump (arrow) on the mitral prosthesis.

There have been no published case reports regarding anorexia nervosa or other eating disorders in paediatric SMA. Here we report a rare clinical case of AN in SMA and the complex interactions between both disorders that contributed to delayed diagnosis and impacted management.

A T2- weighted -magnetic resonance image of sagittal view from the lower lumbar spine to the sacrum. Solid arrows show the defect of the normal bony structures from the L5 level to the sacrum. The dashed arrow shows a spinal lipoma at the level of the sacrum. Two black arrows show the soft tissue continuity from the skin to the lipoma. Two white arrows show the segmented frontal sacrum. B Ultrasonographic image of sagittal view from the lower lumbar spine to the sacrum. Solid arrows show the defect of the normal bony structures of the sacrum. The dashed arrow shows a spinal lipoma at the level of the sacrum. Two black arrows show the soft tissue continuity from the skin to the lipoma

A Radiographical image of the lumbar spine on AP view. Large bone defects from L5 to the sacrum are indicated. B Ultrasonographic image of sagittal view from lower lumbar spine to sacrum. Large bone defects and lipoma beyond the bone defects are shown. The spinous process of the lower lumbar spine is hypoplastic and the vertebra fusion is incomplete. Two black arrows show the soft tissue continuity from the skin to the lipoma. Two white arrows show the cessation of tissue continuity from the lipoma to the cephalad soft tissue

A Radiographical image of the lumbar spine on AP view. The solid arrow shows the partial defect of the vertebral arch of at the L5 level. The dashed arrow shows incomplete fusion of the spinous process at L5; higher lumbar levels are unaffected. B Ultrasonographic image of axial view at the level of L4/5. The solid arrow shows incomplete fusion of the vertebral arch at L5. The dashed arrow shows the incomplete fusion of the spinous process of the L5 vertebra

Additional file 1. T2- weighted -magnetic resonance image of transverse view at the level of to the sacrum. Solid arrows show the soft tissue mass which continue from skin to a lipoma. The dashed arrow shows a spinal lipoma at the level of the sacrum.Additional file 2. Radiographical image from the lumbar spine to the scrum on AP view. A black arrow indicates large bone defect of sacrum.