input
stringlengths 172
751k
| output
stringlengths 222
4.36k
|
|---|---|
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: it is estimated that drugs cause approximately 15% of untoward effect in the hospitalized patients . among these
drug fever is diagnosed by revealing the temporality between fever onset and the initiation of drug treatment together with its disappearance after cessation of the drug .
therefore , it is crucial to doubt drugs as a reason of unknown origin fever for clinicians .
fever induced by piperacillin / tazobactam has not been described in scoliosis correction surgery . here , we showed a case of drug fever associated with piperacillin / tazobactam in a scoliosis patient .
written informed consent was obtained from the patient for publication of this case report and any accompanying images .
a copy of the written consent is available for review by the editor of this journal .
her preoperative spine plain radiographs showed a thoracic scoliosis with a cobb angle of 48 , a lumbar scoliosis with a cobb angle of 55 , and a lumbar kyphosis with a cobb angle of 65 ( fig .
computed tomography revealed that the vertebra of lumbar 2 and 3 was wedge shaped ( fig .
smith - petersen osteotomy at l2 and l3 levels and a posterior correction and fusion at t7-l5 levels was performed using the moss - si spinal system ( johnson & johnson , nj ) .
the total surgery time was approximately 5 hours with an estimated perioperative blood loss of 800 ml.intraoperative spinal cord monitoring did not detect any injury to the spinal cord .
cobb angles of thoracic correction from 48 to 30 ( correction rate 37.5% ) , lumbar correction from 55 to 31 ( correction rate 43.6% ) and lumbar kyphosis from 65 to 30 ( correction rate 53.8% ) were demonstrated by the postoperative plain x - ray film ( fig .
six days after the surgery , the incision was slightly red with leakage and swelling .
the patient , however , began to develop a fever 3 days later ( fig .
eosinophil count , erythrocyte sedimentation rate , and c - reactive protein level were increased ( figs . 5 and 6 ) .
thorough history , chest radiography , blood cultures , physical examination , and urinalysis , however , revealed no evidences of fever .
finally , the diagnosis of drug fever was confirmed and all systemic antibiotics were stopped .
the fever lasts for a total of 2 weeks while body temperature comes back to normal 4 days after piperacillin / tazobactam cessation .
she was asymptomatic and well balanced in both the sagittal and coronal planes with solid fusion in the 24th postoperative month .
written informed consent was obtained from the patient for publication of this case report and any accompanying images .
a copy of the written consent is available for review by the editor of this journal .
her preoperative spine plain radiographs showed a thoracic scoliosis with a cobb angle of 48 , a lumbar scoliosis with a cobb angle of 55 , and a lumbar kyphosis with a cobb angle of 65 ( fig .
computed tomography revealed that the vertebra of lumbar 2 and 3 was wedge shaped ( fig .
smith - petersen osteotomy at l2 and l3 levels and a posterior correction and fusion at t7-l5 levels was performed using the moss - si spinal system ( johnson & johnson , nj ) .
the total surgery time was approximately 5 hours with an estimated perioperative blood loss of 800 ml.intraoperative spinal cord monitoring did not detect any injury to the spinal cord .
cobb angles of thoracic correction from 48 to 30 ( correction rate 37.5% ) , lumbar correction from 55 to 31 ( correction rate 43.6% ) and lumbar kyphosis from 65 to 30 ( correction rate 53.8% ) were demonstrated by the postoperative plain x - ray film ( fig .
six days after the surgery , the incision was slightly red with leakage and swelling .
the patient , however , began to develop a fever 3 days later ( fig .
eosinophil count , erythrocyte sedimentation rate , and c - reactive protein level were increased ( figs . 5 and 6 ) .
thorough history , chest radiography , blood cultures , physical examination , and urinalysis , however , revealed no evidences of fever .
finally , the diagnosis of drug fever was confirmed and all systemic antibiotics were stopped .
the fever lasts for a total of 2 weeks while body temperature comes back to normal 4 days after piperacillin / tazobactam cessation .
she was asymptomatic and well balanced in both the sagittal and coronal planes with solid fusion in the 24th postoperative month .
in our case , fever developed 3 days after intravenous piperacillin / tazobactam administration and there is a strong temporal relationship between the cessation of piperacillin / tazobactam and the subsidence of fever . to the best of our knowledge ,
there have been only 2 detailed reports in the literature on an acute drug - induced central fever because of piperacillin / tazobactam . here ,
we present a case of drug fever associated with piperacillin / tazobactam in a scoliosis patient . despite its common occurrence
the diagnosis of drug fever is often made by exclusion , when no other cause of fever can be identified .
in particular , its diagnosis could be difficult when it overlays with the course of an infection and should only be made after scrutinizing clinical presentation , medication history , and laboratory results of the patient .
our patient developed a fever 3 days after intravenous administration of piperacillin / tazobactam and gradually returned to normal within 4 days of cessation of the drug .
increases in eosinophil count , erythrocyte sedimentation rate , and c - reactive protein levels were demonstrated .
other causes of fever were excluded through history , physical examination , and radiologic and laboratory investigations in the current case .
the mechanisms underlying drug fever include the formation of circulating immune complexes or cell - mediated immune responses . other mechanisms of drug fever have also been identified , including the drug 's effects on thermoregulation , administration - related reactions , the drug 's pharmacological action , idiosyncratic response , and hypersensitivity reactions ; the latter is the most common mechanism of drug fever . in conclusion
when it overlaps with the course of an infection , drug fever may deceive the clinician into believing that the antimicrobial therapy is unsuccessful .
therefore , clinicians should suspect drugs as a cause when a fever of unknown origin develops . | ### Summary:
: abstractdrug fever is frequently underrecognized by clinicians despite its common occurrence .
fever induced by piperacillin / tazobactam has not been reported in scoliosis correction surgery.drug fever caused by piperacillin / tazobactam in a scoliosis patient was described.a 36-year - old woman with adult scoliosis undergoing correction surgery was reported .
she developed a fever after an intake of piperacillin / tazobactam for 3 days .
eosinophil count , erythrocyte sedimentation rate , and c - reactive proteins were increased in her blood examination .
thorough history , chest radiography , blood cultures , physical examination , and urinalysis revealed no evidences of fever .
a drug fever is therefore considered .
the fever lasted for 2 weeks and her body temperature come back to normal 4 days after piperacillin / tazobactam cessation.fever could be caused by piperacillin / tazobactam .
the drug fever 's diagnosis is easily confounded by a co - occurring infection .
therefore , it is crucial for clinicians to doubt drugs as a reason when no other origin of fever could be identified in a patient . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: low birth weight infants due to intrauterine growth restriction or preterm birth are known to have a low nephron number .
a low nephron number leads to hyperfiltration and hypertrophy of the remaining nephrons resulting in glomerulosclerosis .
although many studies investigated glomerular function in subjects born at low birth weight , little attention has been paid to tubular function .
we report 2 preterm infants born at extremely low birth weight who presented with generalized tubular dysfunction mimicking dent 's disease , a form of fanconi syndrome characterized by proximal tubular dysfunction , hypercalciuria , nephrolithiasis , and nephrocalcinosis .
her weight was 741 g ( 90th percentile ) , apgar was 1 at 1 min and 5 at 5 min .
the neonatal period was complicated by acute respiratory distress , patent ductus arteriosus that was closed with indomethacin , anemia , retinopathy of prematurity , rickets , and chronic lung disease . during her stay in the neonatal intensive care unit ,
urine protein was found to be up to 3 + , blood up to 1 + , glucose up to 1 + , the calcium to creatinine ratio 0.561.0 g / g , 2 microglobulin 29927,950
g / l , the n - acetyl--d - glucosaminidase ( nag ) to creatinine ratio 34.6 u / g ( < 5 ) , the microalbumin to creatinine ratio 29.6 mg / g , and percent tubular reabsorption of phosphate 94% .
serum creatinine was 0.2 mg / dl , urea nitrogen 8.0 mg / dl , sodium 137.7 meq / l , potassium 4.3 meq / l , chloride 100 meq / l , bicarbonate 25.8 meq / l , calcium 10 mg / dl , phosphorus 6.6 mg / dl , uric acid 1.1 mg / dl , and normal glucose .
mutation analysis for clcn5 and ocrl1 by direct sequencing was negative . at the age of 9 years , serum uric acid was 2.0 mg / dl with serum creatinine of 0.29 mg / dl .
g / l , the nag to creatinine ratio 4.2 u / g , the microalbumin to creatinine ratio 16.4 mg / g , and panaminoaciduria was resolved .
patient 2 was born at the gestational age of 24 weeks by cesarean section for maternal hypertension .
birth weight was 335 g ( < 10th percentile ) , and apgar was 2 at 1 min and 4 at 5 min .
his course was complicated by acute respiratory distress , rickets , and chronic lung disease . at the age of 4 months , right renal calcification was noted by echosonography .
serum creatinine was 0.4 mg / dl , urea nitrogen 3.9 mg / dl , sodium 137 meq / l , potassium 3.4 meq / l , chloride 103 meq / l , bicarbonate 25.8 meq / l , calcium 9.3 mg / dl , phosphorus 3.4 mg / dl , and uric acid 5.1 mg / dl .
urinalysis showed protein 1 + , blood - , glucose 2 + , protein to creatinine ratio 1.92 g / g , calcium to creatinine ratio up to 0.5
g / g , 2 microglobulin 65,500 g / l , nag to creatinine ratio 96.0 u / g , and percent tubular reabsorption of phosphate 64% . at the age of 2.5 years
serum creatinine was 0.4 mg / dl , urea nitrogen 20.8 mg / dl , uric acid 4.7 mg / dl with normal electrolytes and bicarbonate .
urinalysis showed protein 1 + , blood , glucose - , with no cells or casts . the urine protein to creatinine ratio was 0.11 g / g , calcium to creatinine ratio 0.17 g / g , percent tubular reabsorption of phosphorus 93% , 2 microglobulin 8,410 g /
l , the nag to creatinine ratio 11.8 u / g , and the microalbumin to creatinine ratio 34.1 mg / g .
because of hypertension and proteinuria , salt intake was restricted to 3 g per day and losartan was initiated .
blood pressure and the urine microalbumin to creatinine ratio fell to 81/57 mm hg and 16.7 mg / g , respectively . at the age of 5 years
, serum creatinine was 0.5 mg / dl and uric acid 5.2 mg / dl .
the urine protein to creatinine ratio was 0.14 g / g , the calcium to creatinine ratio 0.06 g / g , 2 microglobulin 298 g / l , and the nag to creatinine ratio 2.4 u / g .
echosonography revealed increased echogenicity and small kidneys ( right 52 mm , left 45 mm ) but no obvious calcification .
both patients did not have symptoms or laboratory abnormalities suggesting glycogen storage disease , lowe syndrome , wilson disease , tyrosinemia , and other diseases characterized by fanconi syndrome .
her weight was 741 g ( 90th percentile ) , apgar was 1 at 1 min and 5 at 5 min .
the neonatal period was complicated by acute respiratory distress , patent ductus arteriosus that was closed with indomethacin , anemia , retinopathy of prematurity , rickets , and chronic lung disease . during her stay in the neonatal intensive care unit ,
urine protein was found to be up to 3 + , blood up to 1 + , glucose up to 1 + , the calcium to creatinine ratio 0.561.0 g / g , 2 microglobulin 29927,950
g / l , the n - acetyl--d - glucosaminidase ( nag ) to creatinine ratio 34.6 u / g ( < 5 ) , the microalbumin to creatinine ratio 29.6 mg / g , and percent tubular reabsorption of phosphate 94% .
serum creatinine was 0.2 mg / dl , urea nitrogen 8.0 mg / dl , sodium 137.7 meq / l , potassium 4.3 meq / l , chloride 100 meq / l , bicarbonate 25.8 meq / l , calcium 10 mg / dl , phosphorus 6.6 mg / dl , uric acid 1.1 mg / dl , and normal glucose .
mutation analysis for clcn5 and ocrl1 by direct sequencing was negative . at the age of 9 years , serum uric acid was 2.0 mg / dl with serum creatinine of 0.29 mg / dl .
g / l , the nag to creatinine ratio 4.2 u / g , the microalbumin to creatinine ratio 16.4 mg / g , and panaminoaciduria was resolved .
patient 2 was born at the gestational age of 24 weeks by cesarean section for maternal hypertension .
birth weight was 335 g ( < 10th percentile ) , and apgar was 2 at 1 min and 4 at 5 min .
his course was complicated by acute respiratory distress , rickets , and chronic lung disease . at the age of 4 months , right renal calcification was noted by echosonography . he had no history of furosemide use .
serum creatinine was 0.4 mg / dl , urea nitrogen 3.9 mg / dl , sodium 137 meq / l , potassium 3.4 meq / l , chloride 103 meq / l , bicarbonate 25.8 meq / l , calcium 9.3 mg / dl , phosphorus 3.4 mg / dl , and uric acid 5.1 mg / dl .
urinalysis showed protein 1 + , blood - , glucose 2 + , protein to creatinine ratio 1.92 g / g , calcium to creatinine ratio up to 0.5 g / g , 2 microglobulin 65,500 g / l , nag to creatinine ratio 96.0 u / g , and percent tubular reabsorption of phosphate 64% . at the age of 2.5 years
serum creatinine was 0.4 mg / dl , urea nitrogen 20.8 mg / dl , uric acid 4.7 mg / dl with normal electrolytes and bicarbonate .
urinalysis showed protein 1 + , blood , glucose - , with no cells or casts .
the urine protein to creatinine ratio was 0.11 g / g , calcium to creatinine ratio 0.17 g / g , percent tubular reabsorption of phosphorus 93% , 2 microglobulin 8,410
g / l , the nag to creatinine ratio 11.8 u / g , and the microalbumin to creatinine ratio 34.1 mg / g .
because of hypertension and proteinuria , salt intake was restricted to 3 g per day and losartan was initiated .
blood pressure and the urine microalbumin to creatinine ratio fell to 81/57 mm hg and 16.7 mg / g , respectively . at the age of 5 years
, serum creatinine was 0.5 mg / dl and uric acid 5.2 mg / dl .
the urine protein to creatinine ratio was 0.14 g / g , the calcium to creatinine ratio 0.06 g / g , 2 microglobulin 298
echosonography revealed increased echogenicity and small kidneys ( right 52 mm , left 45 mm ) but no obvious calcification .
both patients did not have symptoms or laboratory abnormalities suggesting glycogen storage disease , lowe syndrome , wilson disease , tyrosinemia , and other diseases characterized by fanconi syndrome .
we report 2 patients who were born preterm at extremely low birth weight and had proximal tubular dysfunction along with renal calcification .
subjects with low birth weight are known to have a low nephron number , a decreased glomerular filtration rate , and proteinuria or albuminuria resulting in focal segmental glomerulosclerosis [ 3 , 4 ] . as for tubular function in low birth weight infants , increased calcium and phosphorus excretion has been reported .
our patients also had glucosuria , low molecular weight proteinuria , enzymuria , uricosuria , and panaminoaciduria .
renal calcification along with these tubular abnormalities is the characteristic of dent 's disease , a form of fanconi syndrome .
approximately 84% of dent 's disease is caused by mutations of the chloride channel clcn5 or ocrl1 , the causative gene for lowe syndrome .
patient 1 was examined for the mutation of these genes , which turned out to be negative .
although the possibility remains that patient 1 has yet an unidentified gene mutation for dent 's disease , her laboratory findings mostly improved except for hypercalciuria and renal calcification .
the reported patients , however , were much older than patient 2 and not preterm suggesting that the low glomerular filtration in patient 2 was due to preterm and or low birth weight .
both patients had rickets during the neonatal period , which could be the cause of the tubular dysfunction .
it is noteworthy that the tubular dysfunction partially resolved as the patients grew older which may suggest delayed maturation .
therefore , the tubular abnormality is most likely secondary to extreme low birth weight and/or prematurity , although the possibility remains that some unknown gene mutation may be the cause of a dent - like phenotype in patient 1 .
urine 2 microglobulin and nag are known to be elevated in the neonatal period , especially in preterm infants .
mitochondrial function , important in atp production , and na - k - atpase activity , a driving force in the reabsorption , can be altered by oxygen availability , and are reported to be immature in neonates , especially in preterm neonates [ 10 , 11 ] .
inhibition of mitochondrial function or na - k - atpase is known to cause fanconi syndrome . of interest , in the offspring of low - protein diet - fed rats , a model of low birth weight , urine sodium , and calcium excretion
risk factors for developing nephrocalcinosis besides prematurity or low birth weight are acidosis , calciuria , phosphaturia , hypocituria , and furosemide use [ 9 , 15 ] . of interest , 1 study reported increased urine nag in infants with nephrocalcinosis raising a possibility that other tubular dysfunction such as low molecular weight proteinuria , glucosuria , and panaminoaciduria may also be present if investigated .
spontaneous resolution of nephrocalcinosis is reported to occur in 7590% patients around the age of 7 years . in patient 2 ,
it is reported that the renal length was reduced even after 20 years in subjects with very preterm birth .
we have reported generalized proximal tubular dysfunction in 2 preterm patients with extreme low birth weight .
these patients may be extreme examples , but tubular dysfunction may not be uncommon in extreme low birth weight infants . in our preliminary study examining the tubular function in subjects born with extremely low birth weight , as much as 90% had at least 1 proximal tubular dysfunction , such as calciuria , low molecular weight proteinuria , enzymuria , glucosuria , or uricosuria .
attention should be paid to tubules as well as glomeruli in subjects born preterm or at low birth weight .
| ### Summary:
: two preterm infants , with extremely low birth weight born at gestational weeks 24 and 25 , showed generalized proximal tubular dysfunction during their stay in the neonatal intensive care unit , including glucosuria , low molecular weight proteinuria , phosphaturia , uricosuria , enzymuria ( elevated urine n - acetyl--d - glucosaminidase ) , panaminoaciduria , and hypercalciuria , associated with renal calcification .
renal tubular acidosis was not present in either patient .
dna mutation analysis for dent 's disease , performed in patient 1 , was negative .
although both patients had rickets of prematurity , tubular dysfunction persisted after its resolution .
patient 2 , who had severe chronic lung disease , also had elevated serum creatinine , proteinuria , and hypertension , suggesting glomerular damage . in patient 1 ,
low molecular weight proteinuria , enzymuria , panaminoaciduria , hypercalciuria , and renal calcification were still present at the age of 8 years . in patient 2 , tubular dysfunction resolved except for 2 microglobulinuria at the age of 5 years .
while a reduced nephron number resulting in focal segmental glomerulosclerosis is well - known , generalized proximal tubular dysfunction can also occur in infants born preterm and/or with extremely low birth weight . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: preconception care ( pcc ) is a critical component of maternal and child health that does not currently have a strong foothold in our health care delivery system [ 13 ] .
a more detailed discussion of how preconception care supports preconception health ( pch ) and ultimately healthy pregnancies and babies is found in the introduction of this volume . in order to market a health product or service ,
it is important to understand what people want or need before it is developed , and then to provide them with the opportunity to meet those needs in a way that is compelling to them and also improves a mutually beneficial outcome for patients and their providers : a healthy baby . of course
, unlike commercial products , the outcome of preconception care services ( a healthy pregnancy and a healthy baby ) , can not be guaranteed ; there are many factors that influence pregnancy and birth outcomes that are outside a mother or healthcare provider s realm of control . despite the risk of adverse outcomes ,
there is much a woman , her partner , and her health care provider can do together preconceptionally to optimize pregnancy and birth outcomes .
the application of commercial marketing technologies to the analysis , planning , execution , and evaluation of programs designed to influence voluntary behavior of target audiences in order to improve their personal welfare and that of society ( 4 ) .
the social marketing process involves identifying an effective marketing mix of product , price , promotion , and place with the goal of offering an exchange that has clear and compelling benefits , minimal barriers , and an advantage over the competition . in plain language ,
that means setting up a situation so that future parents , health care professionals , and health insurers can all benefit and support a common goal of healthy women , healthy pregnancies , and healthy babies . to accomplish this
, resources first need to be dedicated to conducting audience and market research using a systematic approach at all levels .
often , health behavior theories can be used to shape the development of new products or services as well as to evaluate their effectiveness in achieving intended outcomes .
table 1 lists some of the theories and frameworks that can be applied to addressing the 4 p s of preconception care services ( 5 ) .
table 1theories and frameworks applicable to guiding research on the 4 p s of social marketing preconception care servicesmarketing componenttheory or frameworkfocus of the theory or frameworkrelevant constructs or conceptsproductsocial marketingthe application of marketing techniques to the design , implementation , and evaluation of programs designed to facilitate voluntary exchanges of mutual benefit and improved personal well - being and societal welfareformative research ; market segmentation ; competitive analysisdiffusion of innovationthe spread of new ideas , products , or services within a society or from one society to another ; focus on innovationrelative advantage ; compatibility ; complexity ; trialability ; observabilitypricesocial cognitive theorythe interaction between personal factors , environmental factors , and human behaviorreciprocal determinism ; behavioral capability ; expectations ; self - efficacy ; observational learning ; reinforcementshealth belief modelthe perceptions of threat posed by a health problem , the benefits of avoiding the threat , and factors influencing the decision to actperceived benefits ; perceived barriers ; cues to action ; self - efficacypromotiondiffusion of innovationthe spread of new ideas , products , or services within a society or from one society to another ; focus on diffusioncommunication channels ; social systems / networksprecaution adoption process modelthe journey from lack of awareness to action and maintenance in dealing with hazards ; acknowledge inherent riskunawareness ; unengaged ; decision - making ; actingplacecommunication theorythe different types of communication that affect health behaviormedia exposure ; media effects ; agenda setting ; framingnote . for easy - to - understand information about the theories ,
frameworks , constructs , and concepts listed in this table , go to http://www.nci.nih.gov/theory/pdf for a downloadable copy of nci s theory at a glance a guide for health promotion practice theories and frameworks applicable to guiding research on the 4 p s of social marketing preconception care services note .
for easy - to - understand information about the theories , frameworks , constructs , and concepts listed in this table , go to http://www.nci.nih.gov/theory/pdf for a downloadable copy of nci s theory at a glance a guide for health promotion practice viewing health care services as a business , and using language such as marketing and sales , may be uncomfortable to some who prefer to view the process of having a baby as a natural , emotional and deeply personal part of the human experience .
however , the notion of providing preconception care as a service could very well benefit from a well - conceived and constructed social marketing research plan and execution that acknowledges and embraces the emotions of the patient and her partner . thus , thinking about developing a social marketing plan to support preconceptional health care could help to ensure that babies are born with the best start in life .
one example of how the business market has taken advantage of this type of opportunity is the development of a bank that preserves umbilical cord blood ( ucb ) .
the original idea in 1988 was a not - for - profit resource bank of donated cord blood for those who might need it for transplantation purposes ( 6 ) .
however , since that time , enterprising companies have created a market and generated the need for cord blood storage for a couple s own child even though the chances they will personally need it are roughly 1 in 10,000 . companies who forecast a profit in this service use direct marketing strategies to expectant couples through diaper companies and magazine subscriptions .
attempts to patent the cryopreservation processes and limit competition have raised legal , ethical and clinical questions but the market to sell the idea of cord blood collection and preservation is lucrative and the demand is increasing ( 7 ) .
advocates of preconception care can learn important lessons from the ubc preservation business marketing executives who market , sell and provide services to a similar audience .
preconception care ( pcc ) is the product or concept we are trying to sell as a precursor for assuring pch : the need for pcc is well - supported by research in the health field ( 1 , 8 , 9 ) . the product has been described in a number of publications as including a
bundle of services most often including screening of the following elements : reproductive history ; medications and potential teratogens ; environmental exposures ; age , family medical and genetic history ; infections and immunizations ; social habits and risk behaviors ; diet and exercise ; and any chronic medical conditions ( 10 , 11 ) .
preconception care is supported by a number of practitioner specialties ( 1 , 12 , 13 ) and was related to a healthy people 2000 goal ( 14 ) . whereas some aspects of pcc have more evidence linking them to improved outcomes ( e.g. , folic acid for ntds and glycemic control for diabetes ) and others have less evidence
( e.g. , genetic counseling and smoking cessation ) , the need for a more integrated approach to health prior to conception enjoys a broad range of support ( 1518 ) .
nevertheless , there has been little support of pcc in a systematic manner in the us or other countries as a standard of care ( 2 , 1921 ) .
a social marketing approach can provide an important support for that uptake by beginning with a critical first step defining the attributes of the product we are selling from a potential consumer s point of view which involves formative research with consumers .
key questions for the research may include : what do women and their partners want , when are pcc services optimally delivered , and what needs would have to be met in order for women or couples to value pcc services ?
this approach dictates that it is important to understand the perspective of the patient ( and her partner ) as more than just as consumers of health care services , but also by understanding their other perceived needs and desires in order to provide a satisfactory exchange .
couples may not view the decision to start a family as a medical decision , so this may be one reason the health care delivery system is more likely to be engaged some time after conception .
in fact , couples may assess their financial readiness to start a family before their physical , emotional , or relationship readiness for this life - altering decision .
the research that is an integral part of the social marketing process can help us to understand the decision - making dynamic ( or lack thereof ) that couples may engage in prior to conception . while only 50% of pregnancies are planned in the u.s .
frishman suggests other windows of opportunity that could be explored among women including when women inquire about birth control , obtain negative pregnancy tests , or have recently delivered a baby ( 22 ) .
suggest that preconceptional health promotion and interconceptional counseling may be even more beneficial for parents who have had previous perinatal or infant loss ( 23 ) .
social marketing research can help provide an understanding of the motivations and barriers for and against preconception care .
a social ecological perspective ( 24 ) encourages program planners to look at multiple levels of influence : 1 ) intrapersonal or individual level ; 2 ) interpersonal or social level ; 2 ) institutional or organizational level ; 4 ) community level ; 5 ) and public policy or societal level .
a major corporation preparing to launch a new product for women who might become pregnant ( e.g. , a new home pregnancy test ) would never begin without spending substantial time and resources on understanding the target market and identifying the product attributes that will appeal to that market , while also knowing what the competitive environment is before they make investments in product development that might not have a profitable return .
product attributes can have a major impact on both the speed and extent of a product s uptake by a target population .
rogers diffusion of innovation theory ( 25 ) identified a number of product attributes including relative advantage ( is the product better than what it will replace ? ) , compatibility ( does the product fit with the intended audience ? ) , complexity ( is the product easy to use ? ) , trialability ( can the product be tried out before making a decision to purchase it ? ) , and observability ( are the results of the product visible and measurable ? )
. program planners can position their products effectively in the marketplace if they maximize their product s appeal by addressing these important product attributes .
the next aspect of social marketing research to increase the supply of and demand for preconception care is price defining the costs to patients , providers and insurers , measured in time and/or money , in order to have quality and timely preconception care .
once the product attributes have been defined and developed to address pcc services in a mutually satisfactory way for women , health care professionals and insurers , then appropriate pricing is vital to allow for uptake . lowering the intangible ( non - financial ) costs to patients
can be facilitated by using some common standards of social marketing : the most effective health messages often incorporate emotional connections and values to make behavior change more appealing . also , the best social marketing approaches make it easy for people to make changes that the service providers want them to in this case in order to be healthy , and have a healthy pregnancy and baby . in addition to appeal and ease , some marketers would say that a new product would have to have relative advantage over products currently in the marketplace . new and improved labeling
can often be framed as more appealing and/or easier , but at its core it must meet a customer need or desire .
appealing and easy actions to improve health are perceived as less costly by the patient or customer .
social cognitive theory ( 26 ) which addresses the interaction between personal , environmental , and behavioral factors is commonly used to understand many facets of a person s expectations of outcomes from performing a behavior , environmental contexts ( helps and hindrances ) related to the behavior , experiences in performing the behavior ( positive or negative ) , and efficacy ( ability / confidence ) in performing the behavior .
these are just a few of the ways in which the pricing can build on the positive product attributes developed in the first step .
it also helps that the outcome a healthy pregnancy and baby is a highly valued and very tangible benefit for those who want it .
cost - effectiveness studies and business case studies need to document how the organization s pcc service costs compare with treatment of preventable health conditions .
balancing financial overhead and time pressures in these times of managed care may be a real challenge and particularly so for reaching women who may have unplanned pregnancies .
the greatest challenge may be weighing the intangible costs and benefits against the financial costs : how much preconceptional folic acid counseling is worth a child being born without a lifelong disability like spina bifida ?
how many smoking cessation sessions balance out the costs of a premature / low birth weight baby who might spend his first months of life in the nicu ? how many fewer patients might a health care professional have time to see and bill for when pregnancy counseling they do for people with genetic conditions takes up more time ? and what additional patient education messages , addressing chronic or acute health issues , are not being delivered during a regular well visit because the health care professional s time is being used discussing preconception health issues ?
the health care provider medical office may well not be the best and/or most efficient way to market preconception care services to consumers in many cases .
the practicing physician may also not be the first or best person to deliver the preconception care message .
the goal of a good pricing strategy is to find an effective and innovative way to reach the target market while reducing the costs to both the health care delivery system and the consumer .
after the product has been defined as a generally acceptable package of pcc services , and the price to individual and organization is determined to be mutually beneficial , how can a social marketing approach diffuse it into common practice and social norms ?
this is where the promotion comes into play among two key audiences : 1 ) people who would like to be providers ( or sellers ) of the product and 2 ) people who would be consumers ( or buyers ) of the product .
often , promotion is thought to focus solely on creating demand among consumers for a particular product , and the promotion process is what most people typically think of as marketing or advertising .
however , whereas most businesses prefer to have products on the shelf to meet the needs of consumers proactively , consumers are more influential than ever before in demanding that a product appears on their vendor s shelves .
pcc could very well become a product that consumers themselves create demand for especially since the health care industry already sees the value of preconception care services but has not built a product offering that delivers what they believe to be important .
once the product and pricing attributes are developed , then promoting the product among potential buyers and sellers could be done using a number of communication theories that provide guidance on what types of communication messages and media vehicles ( e.g. communication channels ) can achieve in terms of exposure and effects .
in fact , trade shows and product expositions are a major venue for new products to be introduced to businesses who sell products .
health care provider / insurer conferences , continuing medical education efforts , and medical school training could be venues for promoting pcc services among potential providers ( 27 ) .
because the product attributes have already been defined as a benefit , and pricing has been addressed in the previous step , promotion should be a matter of convincing both buyers and sellers that they are acting in their own best interests .
after promotion has helped to generate consumer demand for the product , pcc is an opportunity for current health care professionals , insurers and those in the business of health to expand their services as in a classic new product offering .
an important way for organizations to justify offering these services is to demonstrate an immediate benefit ( perhaps in sales of other products and services ) in addition to longer term benefits ( perhaps fewer complicated pregnancies , lower malpractice premiums , fewer patients who need life - long care ) . and of course , the actual benefits would be determined through a process of market research with stakeholders such as patients , health professionals and insurers ( table 2 ) .
addressing current barriers and how to overcome them is a major contribution of the promotion activities .
using innovative ways to promote preconception care services not only can be modified from general market promotions but also by taking advantage of existing opportunities to deliver tailored
gateways / pathways to pcc services . these could vary from fertility treatment centers to other family planning arenas . whether a woman is seeking to become pregnant or trying to avoid becoming pregnant ( but preserving her options for the future ) ,
she is a consumer who may be fertile ground , so to speak , for preconception care services .
a challenging part of promoting pcc services will be figuring out how to move the thinking of a now - oriented
consumer towards more future - oriented events ; especially because future outcomes could happen earlier than planned / anticipated .
this promotion could take advantage of additional opportunities such as involving male partners and other influential people in women s lives and also taking a lifelong approach to health ( 13 , 28 ) .
another challenge to promoting pcc services will be addressing the ethical aspects of promoting a product that can not guarantee outcomes : not every woman who chooses and uses preconception care services will be able to have a healthy pregnancy or a healthy baby .
in fact , it might even be the case that unhealthy women ( e.g. those with chronic diseases or other medical conditions ) are the first to want and use preconception care services because they know that their poor health status makes pregnancy a hazardous situation for themselves and their baby .
the importance of recognizing hazards and taking precautionary actions to protect health , which are addressed in the precaution adoption process model ( 29 ) , may be relevant in promoting pcc services in a manner that acknowledges pregnancy as having inherent risk for both the mother and the unborn baby .
what action must be taken by each audience ( e.g. , product , behavior , or policy)what does pcc services need to look and feel like for consumers to want / use / demand them?what does pcc services need to look and feel like for busy health care providers to want to offer them?what does pcc services need to look and feel like for health insurers to want to cover this service?pricing why would they want to do it?what is the value of pcc services and what would they be willing to pay for them?what is the value for offering pcc services to patients and what would it cost to offer them?what is the return on investment for including pcc services as a covered service?promotion how will each audience be told about the what , why , where , and how?how will pcc services be publicized and made available to consumers in a way that they are attractive , affordable , and accessible?how will pcc services be presented to health care providers so that they are willing and able to offer them?how will pcc services be presented to insurers so that they are willing and able to reimburse for them?place where can they do the action needed?what settings / locations are most acceptable , appropriate , and accessible for providing pcc services?what settings / locations are most acceptable , appropriate , and accessible for offering pcc services?what forums or conferences can instigate productive discussions about including pcc services as a covered expense ?
it is useful to ask how pcc services could be placed , or distributed , to women across their reproductive lifespan in a manner that addresses social marketing s call toward mutually satisfactory exchanges , and how the placement of pcc services could affect their delivery .
what components of pcc might change across the life span ( e.g. early health promotion / contraception / std infection / vaccinations / others ) ?
( 30)is also a concern , because any approach that requires a self - selection into the audience will miss about half of the pregnancies .
some authorities have suggested a lifelong approach to preconceptional health throughout the lifespan of a women s potential fertility ( say , 1050 years of age ) and an approach that may move women from one set of services and questions into another ( 2 , 31 ) .
social marketing can help by determining in the early phases what women and health care professionals want , and thus ensuring that supply can be ready when the demand is articulated .
health care professionals need to be involved in the design of those pcc services that they would deliver , and must do so in the context of what they would want to deliver and those they would benefit from .
women report that one of their most influential sources of health information is their own health care professional , who knows them , their medical history and their concerns ( 32 ) .
sales people for preconceptional care ; if doctors never offer their patients the opportunity to buy this product , it will go nowhere .
medical professionals who are trained on the benefits of the product ( e.g. , by inclusion in medical school training and on medical board exams ) and rewarded for using it ( by reducing malpractice premiums for example ) will find it more acceptable and worthwhile to integrate the practice into the time pressures of the busy medical office .
once a physician selection is made , patients visit for an acute problem , management of a chronic condition , and for routine checkups .
placement market research will help to define how pcc services may fit into each of these areas .
this integrated vision of pcc could become part of the core training curricula for various medical professionals more than an option during continuing education .
this strategic preparation for placement also ensures that when the increased demand from the consumer begins to be evident at the health care provider office , the medical professionals in that office will know how to respond to that demand , and have the knowledge and systems in place to do so . existing
bundles of services that can be prepackaged to respond to this demand have in some cases been developed ( 33 , 34 ) .
if the research in the first phase shows that the busy medical office is not the best location for providing pcc services , then alternate placement sites must be identified .
the best marketing and sales happen when the product has the qualities that a consumer wants and that a seller wants to provide .
pcc must meet the needs and desires of patients , health professionals and insurers in order to be successfully adopted in the united states . for women and their families , that may mean believing that a healthy
, wanted baby is in their future . for doctors , that may mean finding a way to give healthy women the preventive services they want and need while still dealing with the urgent care of their sick patients . for insurers it may mean a balance in service provision to meet both short and long term financial goals . but
market research is needed to actually define exactly what the benefits are to each of those groups . and it is likely to be that the satisfactory exchange is more than just a purely medical application of clinical services .
consumers across the us are willing to spend $ 3.00 to drink what is essentially a 50 cent cup of coffee , but they are experiencing something more than the product s primary attributes ( e.g. , flavor , caffeine ) but also the positive associations with the product ( e.g. , funky , cool ) . in the same way
, consumers can tell us how they would like to experience preconception health care services ( 35 ) .
all of us need to understand that if we market and sell it as the best experience possible , pcc could contribute to healthier babies , fewer medical treatment costs , and a healthy next generation that thinks about pregnancy in a whole different way . | ### Summary:
: social marketing approaches can help to shape the formation of and to create demand for preconception care services .
this article describes four components of social marketing , often referred to as the 4 p s , that should be carefully researched and set in place before a national effort to launch and sustain preconception care services is pursued .
first , the product or package of services must be defined and adapted using the latest in scientific and health care standards and must be based on consumer needs and desires .
second , the pricing of the services in financial or opportunity costs must be acceptable to the consumer , insurers , and health care service providers .
third , the promotion of benefits must be carefully crafted to reach and appeal to both consumers and providers .
fourth , the placement and availability of services in the marketplace must be researched and planned . with the application of market research practices that incorporate health behavior theories in their exploration of each component
, consumer demand for preconception care can be generated , and providers can take preconception care to the market with confidence . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: liposarcomas are usually reported in the extremities and retroperitoneum whereas it has been rarely seen in the gastrointestinal tract , and colon is extremely uncommon site . here , a case of ddls which arising from transverse colon
71 year old female patient was admitted to outside hospital with complaints of abdominal pain and swelling lasting for three months was referred to our clinic with the diagnosis of intraabdominal mass .
there was no change in bowel movements , no sign for bowel obstruction and no weight loss .
triphasic computed tomography ( ct ) revealed a large macrolobulated peripherally enhancing mass compatible with gastrointestinal stromal tumor , approximately 23 cm 19 cm 18 cm in size starting from the neighborhood of left liver lobe and extending toward pelvic floor ( fig .
while not invading main vascular structures it was occupying most of the area adjacent to bowel loops and the tumor was invading gastric wall in a small portion at the greater curvature .
these findings were accepted as sufficient for preoperative diagnosis and no additional investigation was performed in order not to delay surgery .
since neoadjuvant therapy has been found to be inefficacious in such cases , patient was booked for operation . at laparotomy , a multilobulated , soft and yellowish mass approximately 25 cm 18 cm 18 cm in size was encountered ( fig .
the cut section showed a large grayish yellow nodular mass with few mucoid areas , along with a variegated appearance . at places
, it appeared to be fleshy with focal areas of hemorrhage and necrosis ( fig .
the tumor center was located in the colon wall and invasion to stomach was minimal .
thus macroscopic image had a significant role in identifying the primary origin of the tumor which was accepted as colon . on microscopic examination there were areas with fibrosarcomatous , myxofibrosarcomatous , hemangioperistomatous , gastrointestinal stromal tumor like appearance adjacent to a lipogenic component that was composed of fat cells of varying sizes , which were separated by slender connective tissue septae . in these areas
the neoplastic cells were uni or multivacuolated ( lipoblasts ) with moderately pleomorphic hyperchromatic nuclei , with a multivacuolated , clear cytoplasm ( fig .
ema , c - kit , cd34 , cd31 , cd1a , sma , s-100 , nf , gfap , hmb-45 , nse , alk , cd99 , bcl-2 , caldesmon , -cathenin , myosin , desmin and fxiii was negative .
two months later , follow up ct studies revealed multiple peritoneal implants ; 6 cm 5 cm at most .
the tumor followed an aggressive course with widespread metastatic disease and patient died within about 3 months of operation .
liposarcoma is the most common type of soft tissue sarcomas . about 24% of liposarcomas originate from limbs and 45% originate from retroperitoneal area .
liposarcomas have five histological subtypes ; well - differentiated liposarcoma ( wdls ) , dedifferentiated liposarcoma ( ddls ) , pleomorphic , myxoid and round cell liposarcoma .
previously , only ten cases of primary liposarcoma of the colon have been reported worldwide but these reports were focusing on other locations of the colon and most histological subtypes were different from our case ( table 1 ) . also to our knowledge ddls of transverse colon is the first case reported in literature .
since ddls is a high - grade sarcoma that originates in a background of a preexisting well - differentiated liposarcoma , it is considered a variant of well - differentiated liposarcoma .
histological subtype of the tumor is very important during the course of the disease . while dedifferentiated , round - cell and pleomorphic liposarcomas are high - grade aggressive tumors carrying the ability to metastasize , well - differentiated and myxoid liposarcomas are low - grade tumors and progressing more slowly .
ddls may occur when well - differentiated liposarcoma transforms into non - lipogenic sarcoma areas .
dedifferentiation develops in 20% of the first local recurrence and 44% of the second local recurrence , and this has been shown to be related to poor progression and metastasis . when ddls develops inside the abdominal cavity it presents with a space occupying mass lesion .
the pathognomonic finding in computed tomography ( ct ) and magnetic resonance imaging is a heterogeneous and nonlipogenic encapsulated mass .
ddls sometimes invade adjacent structures . in such cases , when safe dissection plan can not be obtained , en bloc resection can be done .
where total resection can not be achieved , debulking surgery has not been demonstrated to contribute to the overall disease - free survival rates .
the targeted chemotherapeutic agents and radiation therapy are being investigated for these unresectable cases . in our case ,
en - bloc resection including colon segmental and gastric wedge resection was performed to the mass arising from transverse colon invading gastric greater curvature . even though tumor size , histologic subtype , dissemination are important prognostic factors , it is still difficult to predict prognosis of colonic liposarcoma . as in our case ,
there are studies recommending chemotherapy as the initial course of action in ddls exhibiting local recurrence where tumor growing faster than 1 cm / month in ct imaging .
therefore , neoadjuvant therapy was abandoned in our case considering that it does not provide an additive affect on overall disease - free survival rates .
in ddls , local recurrence , distant metastasis , and disease - related mortality rates are 52% , 15% and 30% , respectively . in general
, it should be kept in mind that ddls follows a dreadful course in terms of treatment and prognosis as the tumor exhibits rapid progression characteristics despite chemoradiotherapy .
surgery is still the most effective treatment option , but relying on this approach alone is not sufficient for disease - free survival .
written informed consent was obtained from the patient 's relatives for publication of this case report and accompanying images .
a copy of the written consent is available for review by the editor - in - chief of this journal on request .
mehmet akif trkolu contributed to study design , data collections , data analysis , writing . | ### Summary:
: introductionin this paper , we present a rare case of primary dedifferantiated liposarcoma ( ddls ) of the colon , management of which is unclear and difficult to cope with.presentation of case71 year old female patient with complaints of abdominal pain and swelling was referred to our clinic with the diagnosis of intraabdominal mass .
23 cm 19 cm 18 cm tumor starting from the neighborhood of left liver lobe and extending toward pelvic floor was detected on computed tomography . at laparotomy , a multilobulated , soft and yellowish
mass was arising from transvers colon and invading greater curvature of stomach .
en - bloc removal of the tumor including segmental colon and gastric wedge resection was performed .
postoperative histopathological diagnosis was consistent with dedifferentiated liposarcoma.discussionliposarcomas are rarely encountered in the gastrointestinal tract .
previously , only ten cases of primary liposarcoma of the colon have been reported worldwide and to our knowledge ddls of transverse colon is the first case reported in the literature .
ddls is a high - grade aggressive tumor carrying the ability to metastasize . despite complete removal of tumor recurrence
is common in ddls.conclusionthe constellation of findings in our patient demonstrates that liposarcomas which histologically exhibit dedifferentiation are associated with a poor clinical prognosis and advocating surgery alone is not recommended . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: in higher plants , cell - to - cell polar auxin transport ( pat ) of the phytohormone auxin , indole-3-acetic acid ( iaa ) , generates maxima and minima that direct growth and development ( boutte et al . , 2007 ; zazimalova et al . , 2007 ;
vanneste and friml , 2009 ; grunewald and friml , 2010 ; peer et al . , 2011 ) .
; galvan - ampudia and offringa , 2007 ) , including members of the charophyta such as nitella species ( ross and reid , 2010 ) , pat has only been detected in land plants , the earliest being the bryophytes ( fujita et al . , 2008 ) and
these studies indicate that , in angiosperms , auxin is produced in the young developing aerial organs and in shoot apical and root meristems , and also that iaa is transported from shoots to roots by files of specialized parenchyma cells in the vasculature .
these transport cells express several classes of auxin influx- and efflux - supporting proteins ( vieten et al .
are members of the auxin resistant1/like aux ( aux1/lax ) proteins , while members of the pin - formed ( pin ) and multidrug resistance / p - glycoprotein abcd ( abcb / pgp ) class are involved in auxin flux out of cells .
auxin efflux can be impaired by specific pat inhibitors such as 1-n - naphthylphthalamic acid ( npa ) . in the chlorophyta unicellular green algae ,
abcb / pgp members have been identified by genome analysis , but these algae have no sequence homology to pin orthologues ( galvan - ampudia and offringa , 2007 ) .
the earliest pin orthologues , based on sequence data , were found in multicellular green algae spirogyra pratensis expressed sequence tag libraries ( de smet et al . , 2011 ) .
polar iaa transport could be measured in elongating rachis from osmunda cinnamomea fern leaves ( steeves and briggs , 1960 ) .
pat was also detected in sporophytes of the mosses bartrania pomiformis , physcomitrella patens , and dawsonia superba , but not in the gametophores of p. patens ( galvan - ampudia and offringa , 2007 ; fujita et al . , 2008 ; fujita and hasebe , 2009 ; lau et al . , 2009 ) .
although iaa occurs in members of the charophyta ( sztein et al . , 2000 ) and
charophyta have a plant - like morphology i.e. they have rhizoids , a stem , and branches ( fig .
1 ) , the role of iaa in its growth and development is unresolved . in chara ,
one study concluded that iaa uptake was not affected by npa ( dibb - fuller and morris , 1992 ) , whereas another reported an enhanced iaa accumulation after addition of npa to chara explants ( klmbt et al . , 1992 ) .
these data suggest that proteins involved in iaa transport are present in chara ; however , polar cell - to - cell transport of auxin has not been demonstrated in these multicellular algae .
1 ) , which was originally obtained from dr . r. j. reid ( university of adelaide , australia ) .
c. corallina was grown at room temperature in aquaria filled with deionized water and forest soil , under 8/16 light / dark conditions as previously described ( berecki et al . , 1999 ) .
longibracteata was taken from a pond in the botanical garden of leiden university , leiden , the netherlands .
measurements were performed in petri dishes filled with molten paraffin in which grooves between two wells were cut .
the grooves were sealed at the donor and receiver ends by embedding the internode just before the nodes in a small amount of silicon grease , covered by a small amount of grafting wax , thus obtaining a water - tight seal ( fig .
the wells and bridge compartment were filled with ma medium ( half - strength ms macro i and ii , fena edta , b5 microelements , 1% sucrose , masson and paszkowski , 1992 ) supplemented with 50 mm mes ( ph 4.8 ) .
h - labelled iaa ( specific activity 23 ci / mmol ) was added at a final concentration of 2 10 m to either the bridge compartment or the donor well .
1 ) , which was originally obtained from dr . r. j. reid ( university of adelaide , australia ) .
c. corallina was grown at room temperature in aquaria filled with deionized water and forest soil , under 8/16 light / dark conditions as previously described ( berecki et al . , 1999 ) .
longibracteata was taken from a pond in the botanical garden of leiden university , leiden , the netherlands .
measurements were performed in petri dishes filled with molten paraffin in which grooves between two wells were cut .
the grooves were sealed at the donor and receiver ends by embedding the internode just before the nodes in a small amount of silicon grease , covered by a small amount of grafting wax , thus obtaining a water - tight seal ( fig .
the wells and bridge compartment were filled with ma medium ( half - strength ms macro i and ii , fena edta , b5 microelements , 1% sucrose , masson and paszkowski , 1992 ) supplemented with 50 mm mes ( ph 4.8 ) .
h - labelled iaa ( specific activity 23 ci / mmol ) was added at a final concentration of 2 10 m to either the bridge compartment or the donor well .
to explore auxin transport properties of c. corallina internodes , we measured auxin transport through single and coupled internodal cells placed in a donor receiver compartment set up ( fig .
h - iaa could be added to any of the three compartments ( donor , receiver , or bridge ) and the appearance of the radio - labelled iaa could be measured in samples from the other compartments .
( b ) a chara internode node boundary with attached peripheral cells : bar , 5 m . ( c ) detailed schematic representation of a seal at the receiver
well . to determine the transport polarity , radio - labelled auxin was added to the bridge compartment and the amount of iaa secreted into either the donor or receiver compartment was measured .
the basal side of the thallus internode ( directed towards the rhizoid ) exported about 50-times more iaa after 1 h than the distal side ( fig .
after incubation with the pat inhibitor npa , iaa export was similar in the basal and distal direction ( fig .
although the results were highly reproducible , the amount of iaa accumulating in the receiver wells differed between experiments , with the accumulation ratio between donor and receiver wells ranging from 18 2.5 pmol ( n = 2 ) to 64 19 pmol ( n = 2 ) .
( a ) a typical example showing h - indole-3-acetic acid ( iaa ) added to the bridge compartment and the efflux into the donor and receiver wells was monitored for 1 h. the cumulative accumulation of auxin is plotted against time for the apical side ( donor compartment , filled square ) and the basal side ( receiver compartment , filled circle ) of the internode .
besides untreated controls , internodes of chara were pre - incubated for 30 min with 5 10 m naphthylphthalamic acid .
subsequently , h - iaa was added to the bridge compartment and the efflux of iaa in donor ( filled triangle ) and receiver ( ) compartments was determined .
( b ) a representative example of h - iaa added to the donor well , then the receiver well was sampled and h - iaa determined by lsc . cumulative iaa accumulation in the receiver well was only observed in internodes placed in a polar orientation ( filled circle ) .
reversion of the internode in a non - polar orientation displayed no transport of auxin through the internode ( filled triangle ) .
measurements of iaa accumulation in the receiver were performed as described in ( b ) . in a classical donor receiver experiment , iaa accumulation in the receiver compartment was measured after h - iaa addition to the donor compartment . to confirm the presence of pat in chara , internode cells were oriented in both directions within the experimental set up .
iaa accumulation was only observed with the basal side of the internode in the receiver compartment ( fig .
3b ) , clearly demonstrating that auxin is polarly transported in internodal cells of c. corallina .
similar to land plant stems , auxin was transported from the tip towards the rhizoid .
h - iaa could be detected in the receiver compartment 45 min after addition of h - iaa to the donor well .
the amount of iaa that was polarly transported in different chara internodes ranged from 1 0.4 fmol / min ( n = 5 ) to 5.4 2.8 fmol / min ( n = 4 ) .
the same experimental set up was used to measure pat in two internodes interconnected by a nodium cell .
h - iaa was first detected in the receiver wells 120 min after its application to the donor wells , which was approximately twice as long as the 45 min taken for single cells ( fig .
these results demonstrate that nodium cells support cell - to - cell pat through the chara thallus . interestingly ,
h - iaa taken up from the donor compartment by the chara internode was not only transported to the receiver compartment , but was also significantly lost to the bridge compartment ( fig .
this leaking of iaa may indicate that chara does not possess auxin - influx carrier proteins as observed in higher plants .
this is in good agreement with the observation that addition of 2-naphthoxyacetic acid , an auxin influx inhibitor ( lankova et al . , 2010 ) , had no effect on the uptake of iaa in chara internode cells ( data not shown ) .
longibracteata ( filled square ) , which contains cortex cells surrounding its internode cell , and in chara corallina ( filled circle ) , without a cortex .
inset shows the amount of indole-3-acetic acid ( iaa ) accumulated in the bridge compartments for c. corallina and c. vulgaris after 270 min .
addition of the cytoplasmic streaming inhibitor cytochalasin h ( 30 m ) to chara internodes after 270 min ( arrow ) did not inhibit auxin transport ( filled circle ) .
pre - incubation ( 30 min ) with cytochalasin h ( 30 m ) before h - iaa was added in continued presence of this inhibitor did not alter polar auxin transport ( filled square ) . blasting the available expressed sequence tag data from spirogyra and coleochaete ( timme and delwiche , 2010 ) for aux1/lax13 influx carriers did not result in any significant homology .
the aux1/lax auxin influx carriers in land plants are believed to play an important role as drivers of pat by taking up leaked auxin and thereby preventing leakage to surrounding cells ( reinhardt et al . , 2003 ) .
this system may not be very efficient in the aquatic habitat of c. corallina where internode cells are in direct contact with a large extracellular volume of water .
to test the possibility of iaa loss due to a large extracellular volume , the present study used c. vulgaris var .
longibracteata , in which cortex cells around the large internode cell limit the free space around the cell .
this variety had comparable pat and iaa accumulation in the bridge compartment compared to c. corallina ( fig .
hence , the extra cortical cell layer surrounding the internode cell could not reduce the amount of iaa leakage into the medium , suggesting the lack of influx carriers along the internode cell .
auxin transport velocity in chara internodes varied between 45 cm / h , which was higher than the 12 cm / h that is routinely measured in arabidopsis inflorescence stems .
this 45 cm / h is probably a minimum estimate taking into account the detection level of the first iaa molecules arriving in the receiver , the loss of auxin into the bridge compartment , and the passage of auxin from the internode through the node into the receiver well . in the bridge experiments , the distance from the bridge compartment to the node into the receiver well was typically 5 mm ( including the seal ) . within 1 min
assuming an arrival time of auxin of 30 seconds , the transport velocity would be 57 cm / h .
therefore , the velocity of pat in the internode is estimated to be somewhere between 3.6 and 36 cm / h .
internode cell lengths varied between 3.55.0 cm , making it unlikely that auxin is transported intracellularly by simple diffusion
. for diffusion the expected transport time of an iaa molecule between the donor and receiver end is at best l
/2d , where l is the length of the internode and d is the diffusion constant of a molecule diffusing in a very thin hollow cylindrical region of the internode cell .
the diffusion rate of iaa in agar ( d = 7 10 m s ) ( mitchison , 1980 ) is a reasonable estimation for diffusion of a 175-da molecule in a cell ( mika and poolman , 2011 ) .
an iaa molecule would therefore be expected to traverse a 4-cm - long cell in at least 317 h. hence it is unlikely that , the pat velocities measured are caused by diffusion .
cytoplasmic streaming could be an alternative candidate mechanism for the transport of intracellular auxin in chara internodes ( verchot - lubicz and goldstein , 2010 ) .
the present study measured velocities of 1220 cm / h ( data not shown ) for cytoplasmic streaming in chara .
cytochalasin h , a cytoplasmic streaming inhibitor , has been extensively studied in chara ( foissner and wasteneys , 2007 ) . in the present experiments , cytochalasin h inhibited cytoplasmic streaming in chara internodes within 5 min , and replacement with buffer reinitiated cytoplasmic streaming after 15 min , with initial velocity regained after 30 min .
the effect of cytochalasin h on pat in chara internodes was investigated by either pre - incubating the internodes with cytochalasin h within the bridge compartment or adding the inhibitor to the bridge compartment after pat had been ongoing for 270 min . in both cases ,
4b ) , which is in agreement with the slightly reduced pat rates using cytochalasin b in oat and maize coleoptiles ( cande et al . , 1973 ) .
however , cytochalasin h in chara has been reported to only inhibit vesicle transport at the cortical part of the cytoplasm .
inhibition of cytoplasmic streaming of the subcortical cytoplasm takes several days of treatment with cytochalasin h before any effects can be measured ( foissner and wasteneys , 2007 ) .
this subcortical cytoplasmic streaming can reach velocities of 1836 cm / h , making it a good candidate for the observed intracellular auxin transport .
the present study also tested the effect of cytochalasin h on the subcortical cytoplasmic streaming and found that it could be completely and reversibly inhibited by the addition of the inhibitor .
therefore , cytoplasmic streaming is an unlikely mechanism for intracellular auxin transport in chara cells .
it remains an intriguing question as to what the driving force for this transport in chara is .
the accumulation curve of iaa in the receiver in a classical donor receiver transport experiment ( fig .
3b ) can be described by the solution to a system of convection diffusion equations with physiologically feasible values for the parameters . the corresponding accumulation curve for a bridge experiment ( fig
the flux into the receiver was as high as 73 mol / s on average , which within a few minutes levelled off to a steady - state value of 2.5 fmol / s .
up till now , this dynamic behaviour could not be reconciled with the system of convection diffusion equations describing the classical donor receiver experiments .
one interpretation of the data could be that there is a rapid downregulation of the transporters themselves or the activity of the proteins that are involved in the polar efflux of auxin .
a systematic mathematical analysis of the transport data from specifically designed experiments is in progress .
here we show that pat is present in charophyta , an evolutionary ancestor of higher plants ( finet et al . , 2010 ; timme et al . ,
the ability to measure pat at the cellular level provides a unique opportunity to further analyse pat - related parameters such as membrane potential , cytosolic calcium , and ph levels that drive iaa transport inside the cell
. it will be important to determine the proteins responsible for pat in chara and their relationship to the well - known pin and abcd / pgp classes of pat efflux proteins found in higher plants .
it will also be interesting to test the hypothesis that chara lacks aux1/lax auxin influx proteins .
understanding the dynamics of pat in an experimental unicellular system is easier than in a complex cell system such as arabidopsis inflorescence stems .
the former is better suited for mathematical modelling and analysis . moreover , the extreme proportions of the chara internode cell and the experimental set up reveal details of iaa transport that are relevant in reconstructing the transport mechanism and that are hard to observe in arabidopsis .
the similarity in pat between chara and arabidopsis inflorescence stems indicates that pat is a critical evolutionary early invention of multicellular plants that enables intercellular communication and directional growth . | ### Summary:
: in higher plants , cell - to - cell polar auxin transport ( pat ) of the phytohormone auxin , indole-3-acetic acid ( iaa ) , generates maxima and minima that direct growth and development .
although iaa is present in all plant phyla , pat has only been detected in land plants , the earliest being the bryophytes .
charophyta , a group of freshwater green algae , are among the first multicellular algae with a land plant - like phenotype and are ancestors to land plants .
iaa has been detected in members of charophyta , but its developmental role and the occurrence of pat are unknown . we show that naphthylphthalamic acid ( npa)-sensitive pat occurs in internodal cells of chara corallina . the relatively high velocity ( at least 45 cm / h ) of auxin transport through the giant ( 35 cm ) chara cells does not occur by simple diffusion and is not sensitive to a specific cytoplasmic streaming inhibitor .
the results demonstrate that pat evolved early in multicellular plant life .
the giant chara cells provide a unique new model system to study pat , as chara allows the combining of real - time measurements and mathematical modelling with molecular , developmental , cellular , and electrophysiological studies . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: alzheimer 's disease is a common age - associated dementia characterized by pathological , progressive loss of neurons and synapses , accumulation of intra- and extracellular protein deposits , and gliosis .
the amyloid hypothesis of ad postulates that amyloid - beta ( a ) deposition and neurotoxicity play a causative role in ad .
although the mechanisms through which a exerts its toxicity are numerous , it appears that oxidative injury is central in the pathogenesis of ad [ 35 ] .
oxidative stress results from an imbalance between the production and removal of physiologically important molecules collectively called reactive oxygen species ( ros ) [ 68 ] .
oxidative stress damages all cellular macromolecules and when uncontrolled , leads to irreparable oxidative injury and cell death .
the imbalance between the production and removal of ros occurs when endogenous defence systems are overwhelmed or exhausted , usually due to disease or as part of normal aging .
it is thus not surprising that oxidative stress is involved in the pathogenesis of several neurodegenerative disorders , including ad .
oxidative stress is a central feature of ad , and , in fact , it may even be one of the first pathogenic events during disease progression .
markers of oxidative damage such as protein carbonyls [ 9 , 10 ] and elevated lipid peroxidation [ 11 , 12 ] precede pathological changes and are found in the brains of ad patients .
importantly , antioxidant defence is impaired in mouse models of ad ; the levels and activities of protective enzymes including superoxide dismutase ( sod ) and glutathione peroxidase are altered .
gsk-3 is a serine / threonine kinase that regulates diverse cellular functions ranging from glycogen metabolism to gene transcription and cell survival [ 14 , 15 ] .
several lines of evidence directly link gsk-3 to the neuropathology of ad [ 14 , 16 , 17 ] .
in fact , the recently described gsk hypothesis of ad depicts how overactivation of gsk-3 accounts for the pathology of ad .
gsk-3 expression is elevated in the brain of ad patients and is implicated with at least three major pathological hallmarks of the disease [ 18 , 19 ] .
first , overactivity of gsk-3 accounts , at least in part , for tau hyperphosphorylation . in human brain ,
active gsk-3 has been detected in neurons loaded with neurofibrillary tangles , and in vitro evidence link increased gsk-3 activation to tau hyperphosphorylation .
in fact , a can activate gsk-3 , leading eventually to increased tau phosphorylation and loss of microtubule binding . in agreement with the in vitro evidence , mice overexpressing gsk-3 display prominent tau hyperphosphorylation .
secondly , acetylcholine synthesis is suppressed by gsk-3 , thus implicating the kinase in the cholinergic deficit characteristic of the disease .
this effect has been shown to be mediated by gsk-3-dependent inactivation of pyruvate dehydrogenase ( pdh ) , leading to the depletion of acetyl coenzyme a , an important precursor in acetylcholine synthesis .
thirdly , overactivity of the kinase causes increased production of toxic a. gsk-3 has been shown to interact with presenilin , thus increasing the production of the amyloid precursor protein ( app ) and subsequently toxic a. the increased production of a then leads to synaptic deficits and memory impairment [ 2427 ] .
gsk-3 can also directly phosphorylate app in vitro , and , interestingly , ad - related mutated presenilin-1 is able to both directly and indirectly activate gsk-3 [ 29 , 30 ] .
not surprisingly , the inhibition of gsk-3 blocks the accumulation of a and reduces plaque burden in transgenic mice modelling ad , while the overexpression of gsk-3 causes memory deficits [ 31 , 32 ] .
certain antibodies that reduce brain a burden also mediate their protective effect by inhibiting gsk-3 activation .
finally , gsk-3 is an important mediator of apoptosis , thus its dysregulation may also directly contribute to ad - associated neuronal loss .
gsk-3 phosphorylates a diverse group of substrates , including over 20 transcription factors [ 14 , 35 ] .
it is hypothesized that gsk-3-mediated impaired activation of transcription factors compromises the ability of cells to respond adequately to stressful conditions .
indeed , gsk-3 is inhibitory towards the activation of transcription factors such as heat shock factor-1 [ 36 , 37 ] and cyclic amp response element - binding protein [ 14 , 38 ] , which are important in cell survival mechanisms after potentially toxic insults [ 3941 ] .
however , it is important to note that gsk-3 activation may also affect cell survival by other mechanisms .
for example , activated gsk-3 can inactivate an important mediator in the citric acid cycle , pdh , and may thus impair the energy supply in neurons .
as the majority of the transcription factors controlled by gsk-3 are involved in cellular survival pathways , the modulation of transcription factors by gsk-3 is likely an important survival mechanism against various stresses , including oxidative stress .
it is interesting to note that oxidative stress itself may also be related to gsk-3 activation .
for example , oxidative stress induces overactivation of gsk-3 in neuronal cells , while the inhibition of gsk-3 is involved in the control of oxidative stress in neuronal hippocampal cell lines .
under normal conditions , oxidative stress leads to the activation of a battery of defensive gene expression that leads to detoxification , prevention of free radical generation and cell survival . at the forefront of defence against oxidative stress
human nrf2 was first isolated in 1994 from a hemin - induced k562 erythroid cell line and showed high sequence specificity to the known p45 subunit of nf - e2 [ 45 , 46 ] .
nrf2 regulates a broad spectrum of enzymes and proteins involved in the disposition of harmful compounds causing oxidative stress .
the classes of genes regulated by nrf2 affect such diverse functions as detoxification of electrophiles , free radical metabolism , glutathione metabolism , proteasome function , and calcium homeostasis .
microarray analyses have revealed numerous nrf2-dependent genes that confer protection against oxidative stress in vitro [ 48 , 49 , 49 , 50 ] .
some of the well - characterized cytoprotective genes controlled by nrf2 include heme oxygenases ( hos ) , nad(p)h : quinone oxidoreductases , superoxide dismutases ( sods ) and the rate - limiting enzymes of glutathione synthesis consisting of catalytic ( gclc ) and modifier ( gclm ) subunits [ 5153 ] .
transcription factors such as nrf2 are considered key targets of numerous signalling pathways because they have the critical role of transferring information from the extracellular environment to the nucleus to regulate multiple functions .
the induction of the nrf2-controlled protective response requires at least three essential components ; antioxidant response elements ( ares ) , nrf2 , and kelch ech - associating protein 1 ( keap1 ) .
ares are enhancer sequences that control the basal and inducible expression of protective genes in response to oxidative stress , xenobiotics , heavy metals and ultraviolet light [ 44 , 54 , 55 ] .
nrf2 is the principal transcription factor that binds to the are and induces the expression of are - driven cytoprotective genes .
keap1 is a cytosolic , actin - associated protein that suppresses the activity of nrf2 by sequestering it in the cytoplasm and by targeting it for proteasomal degradation .
the abundance of nrf2 inside the nucleus is constantly regulated by positive and negative stimuli that affect nuclear import and export , binding to the are , as well as the degradation of nrf2 .
it is well known that keap1 is an inhibitor of nrf2 that targets nrf2 for degradation and thus promotes low , basal expression of cytoprotective genes under normal physiological conditions .
previously , it was thought that oxidative stimuli activate nrf2 by promoting its dissociation from keap1 ; however , as the binding affinity between the two proteins is not affected by oxidative stress [ 5759 ] , it is now understood that the main function of keap1 is to serve as an adapter for the cullin3/ring box 1 e3 ubiquitin ligase complex [ 60 , 61 ] .
keap1 binding to cullin3 and nrf2 leads to the ubiquitination and degradation of nrf2 through the 26s proteasome [ 62 , 63 ] .
keap1 also functions as ros sensor molecule , the cysteine residues of which are modified upon conditions of oxidative stress [ 64 , 65 ] .
oxidative stress impairs the ability of keap1 to target nrf2 for degradation , most likely by triggering an alteration in keap1 conformation .
the activation of the nrf2-are pathway is beneficial in animal models of various diseases of the central nervous system , including chronic neurodegenerative diseases such as parkinson 's disease and acute insults such as brain ischemia and brain trauma [ 6669 ] .
however , in comparison to other neurodegenerative disorders , the role of nrf2 in ad has received relatively little attention .
currently , it is known that while nrf2 is not a susceptibility gene for ad , common variants of the gene encoding nrf2 may affect disease progression . in the human ad brain , the amount of nuclear nrf2 is reduced in the hippocampus .
histochemical analyses demonstrate that nrf2 predominantly localizes to the cytoplasm of ad - affected hippocampal neurons , suggesting that despite oxidative stress , nrf2-mediated transcription is not induced in ad patients .
however , this study utilized brain tissue demonstrating full - blown ad pathology ; it is not clear whether the finding is a cause or consequence of the ongoing pathological events and cell death .
in fact , it has been suggested that the induction of nrf2 , and levels and activity of its cytoprotective target enzymes may display a time - dependent alteration in ad .
we recently showed that attenuation of the nrf2-are pathway coincides with disease progression in the apde9 transgenic mice modelling ad .
the nrf2-pathway was impaired in transgenic ad mice concomitantly with increased brain a burden . this ad - associated reduction in nrf2
was recently confirmed by choudry et al . , who described a 50% reduction in nrf2 levels in transgenic ad mice .
induction of the nrf2-are pathway by small therapeutic molecules protects against neuronal dysfunction and toxicity mediated by ain vitro [ 72 , 7476 ] .
interestingly , nrf2 can also exert its protective effects by suppressing oxidative stress - induced a formation [ 74 , 77 ] and by inducing the 26s proteasome , thus facilitating the removal of toxic a .
protection against a toxicity by coffee extract has also been shown to occur via the induction of the nrf2-are pathway in caenorhabditis elegans .
in addition to assessing the effect of small molecule inducers of the nrf2-are pathway on a toxicity , we recently studied therapeutic and disease - modifying properties of nrf2-are induction by gene transfer in transgenic mice modelling ad .
the long - term effect of nrf2-are activation was studied in vivo by employing a gene therapy approach where human nrf2 was directly injected into the hippocampi of transgenic ad mice , an area of the brain important for learning and memory that is directly affected by ad pathology .
evident improvement in cognitive abilities was achieved when transgenic ad mice were treated with the nrf2 vector at the age of 9 months and assessed in the morris water maze 6 months later .
this effect was associated with the induction of the nrf2-pathway , suggesting that strategies aimed at boosting the nrf2-are pathway constitute a potential therapeutic approach for ad .
as gsk-3 controls a variety of targets in several cellular pathways , it is not surprising that the kinase is also implicated in the regulation of nrf2 .
gsk-3 exerts a negative form of regulation on nrf2 by controlling it is subcellular distribution ( figure 1 ) .
long - term exposure to hydrogen peroxide causes downregulation of akt , activation of gsk-3 , and translocation of nrf2 from the nucleus to the cytosol , thus limiting the antioxidant response of cells .
this is particularly important in conditions of prolonged oxidative stress , such as ad , and highlights the importance of this kinase in chronic neurodegenerative disorders . the inhibition of gsk-3 results in nuclear accumulation and the elevation of transcriptional activity of nrf2 , indicating that gsk-3 is a fundamental element of nrf2-are downregulation after oxidative injury .
the mechanism of gsk-3-mediated nrf2 inhibition appears to involve the tyrosine kinase fyn , which is phosphorylated by activated gsk-3 and leads to nuclear localization of fyn .
activated fyn phosphorylates tyrosine 568 of nrf2 in the nucleus , leading to nrf2 export and dampening of protective gene transcription [ 83 , 84 ] .
very recently , it was shown that transfection with a constitutively active genetic variant of gsk-3 completely inhibits nuclear accumulation of nrf2 , providing further support for the role of gsk-3 in controlling nrf2 activation .
further evidence for the importance of gsk-3 in the regulation of nrf2 is demonstrated by the finding that activation of the muscarinic m1 receptor induces nrf2 through a signalling cascade involving protein kinase c - mediated inhibition of gsk-3 .
moreover , gsk-3 is known to regulate oxidative stress protein skn-1 , the functional counterpart of nrf2 , in caenorhabditis elegans . taken together ,
these data suggest that increased activation of gsk-3 leads to a dampening of the protective nrf2-are pathway .
stimulation of the nrf2-are pathway by small - molecule activators represents an appealing strategy to upregulate the endogenous defence mechanism of cells against oxidative stress .
at least nine classes of nrf2 inducers have been described and several of these are protective in models of neurodegenerative diseases .
however , more potent , safe , and specific activators of the nrf2-are pathway that cross the blood brain barrier ( bbb ) need to be explored in relevant models of ad .
dithiocarbamates are attractive drug candidates for many diseases as they are bbb permeant metal chelating compounds that possess antioxidant and anti - inflammatory properties and are clinically approved for treatment of alcohol addiction ( antabus ) and heavy metal poisoning .
in addition to its well - characterized role in the inhibition of nuclear factor-b [ 90 , 91 ] , pyrrolidine dithiocarbamate ( pdtc ) has potent antioxidant properties and is able to scavenge ros [ 9093 ] .
it is becoming increasingly evident that pdtc also has the potential to activate endogenous antioxidant gene expression . in vitro studies
suggest that pdtc treatment results in the activation and nuclear translocation of nrf2 [ 94 , 95 ] . moreover , the cytoprotective , nrf2-controlled proteins , ho-1 , gclm , and sod , are potently induced in response to pdtc in vitro [ 94 , 9698 ] .
interestingly , it has also been shown that pdtc can act as a pro - oxidant .
indeed , pdtc induces apoptosis in several in vitro models [ 100 , 101 , 101 , 102 ] and may also be toxic to neurons in vivo .
whether the action of pdtc is anti- or pro - oxidant has been reported to depend on the dose of pdtc and the presence of metal ions .
it may well be that pdtc can exert its effects on nrf2-mediated gene transcription by mimicking an oxidative insult ( and thus acting as a pro - oxidant ) that triggers nrf2 activation .
we also showed that while the activity of gsk-3 is increased in the brains of transgenic ad mice , a 7-month treatment with pdtc reduces the amount of active gsk-3 with concomitant improvement in the spatial learning of the treated mice .
it is known that pdtc can transport extracellular copper into cells and depending on the situation at hand , this may have different effects . for example , copper transport into cells is most likely beneficial in ad animal models [ 108110 ] , where pools of intracellular copper are depleted or unevenly or inefficiently distributed within the brain parenchyma . in contrast , under normal conditions , an increase in cellular copper levels may cause an increase in free radical production and apoptosis [ 111 , 112 ] . as copper can induce the akt pathway , we hypothesize that the pdtc - mediated increase in intracellular copper could trigger the phosphorylation of akt , leading to reduced gsk-3 activity . to analyze the association of nrf2 with the beneficial effect of pdtc treatment , we assessed the potential of pdtc in protection against a toxicity in primary cultures prepared from nrf2 knockout mice . while pdtc protected against a toxicity in wild - type neuronal cultures , the beneficial effect was abolished in cultures prepared from knock - out mice ( kanninen , k et al . , unpublished data ) .
moreover , pdtc treatment of neuronal cultures induced nrf2 target genes ( kanninen , k et al . , unpublished data ) . taken together , these data indicate that nrf2 is required for the beneficial effect of pdtc against a toxicity in vitro and suggest that nrf2-are induction may be associated with the beneficial effect of pdtc in ad
. however , further studies are required to clarify and specify the involvement of gsk-3 in aberrant regulation of nrf2 in ad .
while the detailed mechanisms behind the impairment of the nrf2-are pathway in transgenic ad mice remain unresolved , it is possible that it involves gsk-3. considering that gsk-3 can inactivate nrf2 [ 81 , 86 ] , it is conceivable that the nrf2-are pathway is dampened in the aged ad transgenic mouse brain through the increased activity of gsk-3. in fact , long - term oxidative stress causes gsk-3 activation and reduces nuclear nrf2 , suggestive of downregulation of the nrf2-are pathway .
this hypothesis is further supported by the finding that pharmacological treatments , which inhibit gsk-3 , have been reported to reduce a pathology and cognitive impairment in ad mice .
moreover , lithium , a gsk-3 inhibitor , has been shown to promote the transcriptional activity of nrf2 .
while modulating the activity of gsk-3 is known to be beneficial in models of ad , studying the mechanism of action of modulators of the kinase is important in understanding the diverse pathways gsk-3 is involved in and the numerous effects modulation may have .
for example , treatment with small molecules such as pdtc prevents cognitive impairment in transgenic ad mice , not only by the inhibition of gsk-3 , but also potentially via the activation of the nrf2-are pathway .
due to the major social and economical burden caused by the aging of populations and the subsequent increase in the incidences of neurodegenerative diseases , potential novel targets for effective ad therapeutics are urgently needed . despite extensive
research and knowledge that oxidative stress is a central pathological feature of ad , several therapeutic approaches targeted to this aspect of disease have failed , most likely because they have targeted only one aspect such as the decline of a single antioxidant .
considering the complexity of the antioxidant system , it seems reasonable to consider that the induction of endogenous protective pathways , such as the nrf2-are pathway against oxidative stress , is a viable strategy for delaying the progression of injury and cell death .
it is clear that understanding the mechanisms of regulation of the nrf2-are pathway and how these mechanisms are impaired in disease is central in deciphering how we can modulate this protective pathway against oxidative stress associated with ad .
while several other regulatory pathways of nrf2-are have been described and gsk-3 modulation in ad is also known to be beneficial in several ways , studying the influence of gsk-3 on nrf2-are is certainly an important path to pursue in order to better understand how to combat the oxidative stress associated with ad . | ### Summary:
: specific regions of the alzheimer 's disease ( ad ) brain are burdened with extracellular protein deposits , the accumulation of which is concomitant with a complex cascade of overlapping events .
many of these pathological processes produce oxidative stress . under normal conditions ,
oxidative stress leads to the activation of defensive gene expression that promotes cell survival . at the forefront of defence
is the nuclear factor erythroid 2-related factor 2 ( nrf2 ) , a transcription factor that regulates a broad spectrum of protective genes .
glycogen synthase kinase-3 ( gsk-3 ) regulates nrf2 , thus making this kinase a potential target for therapeutic intervention aiming to boost the protective activation of nrf2 .
this paper aims to review the neuroprotective role of nrf2 in ad , with special emphasis on the role of gsk-3 in the regulation of the nrf2 pathway .
we also examine the potential of inducing gsk-3 by small - molecule activators , dithiocarbamates , which potentially exert their beneficial therapeutic effects via the activation of the nrf2 pathway . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: lung cancer is the most commonly diagnosed cancer worldwide and the leading cause of all cancer deaths .
the disease is diagnosed mostly at an advanced stage , when surgical resection is unlikely to be a treatment option , thus leading to poor survival rates .
the 5-year survival rate for all stages of lung cancer ranges from 6% in the uk to 15% in the us , in contrast to a survival rate of about 70% for stage i lung cancer , suggesting that early diagnosis and treatment of the disease would vastly improve outcome and reduce mortality .
computed tomography ( ct ) screening has been highlighted as one of the potential strategies for early diagnosis of lung cancer [ 6 - 9 ] .
however , the lung cancer research community is eagerly awaiting results of various ongoing screening trials ( table 1 ) evaluating the potential benefit of ct screening .
for optimum cost - effectiveness , a population of individuals at sufficiently high risk of the disease needs to be identified so that the benefit - to - harm ratio of the screening can be maximized .
the need for the selection of a high - risk population for lung cancer screening has renewed international interest in developing methods for the prediction of an individual s risk of developing lung cancer . planned recruitment .
pack years ( pks ) = ( packs smoked per day ) ( years as a smoker ) .
dante , randomized study on lung cancer screening with low - dose spiral computed tomography ; dpiscan , pilot study to evaluate low dose spiral ct scanning as a screening method for bronchial carcinoma ; italung - ct , multicentric randomised clinical trial for lung cancer screening with low - dose ct ; ldct , low - dose computed tomography ; lss , lung screening study ; nelson , dutch - belgian randomised lung cancer screening trial ; nlst , national lung screening trial .
. there are now a number of lung cancer risk prediction models , including those of peto and colleagues , bach and colleagues , spitz and colleagues , and the liverpool lung project ( llp ) .
these models use a selection of data which includes the patient s self - reported information on epidemiological and clinical risk factors with local lung cancer incidence data to predict the individual s risk within a specified period .
for example , the llp risk model included information on the patient s smoking duration , prior diagnosis of pneumonia , asbestos exposure , previous diagnosis of a non - melanoma malignant tumour , and family history of lung cancer ( using age of diagnosis in first - degree relatives ) .
the individual s 5-year absolute risk of lung cancer was then estimated by combining the relative risk model with age- and gender - specific lung cancer incidence rates .
risk prediction models could be incorporated into the design , recruitment , and analysis of studies of lung cancer prevention programmes , potentially reducing the sample size required to achieve the desired statistical power for outcome benefit .
we recently discussed the potential use of the llp risk model in the design of a ct screening trial and a population screening intervention programme in the event of positive results from the trial .
the results reveal that increasing the minimum 5-year absolute risk criterion of individuals to be selected in a screening trial from 1.5% to 2.5% reduces the required sample size by approximately one - third .
ideally , the lung cancer community needs to be developing risk prediction models that embrace not only epidemiological parameters but also emerging genetic and molecular biomarkers ( figure 1 ) .
recently , three major genome - wide association studies in lung cancer identified genetic susceptibility genes strongly associated with lung cancer [ 17 - 19 ] .
the promise of the expansion of genomic research is that many more biomarkers will be identified and validated in case control studies with specimens such as serum , plasma , bronchial lavage , induced sputum , or tissue .
it is anticipated that the addition of these biomarkers or their combinations into existing risk models would improve the precision and accuracy of the predicted risks .
this has led to the recent quest to identify the best methodology for assessing improvements in risk models , which incorporate additional risk factors such as genetic biomarkers .
the recent emergence of new methodologies such as decision curve analysis and relative utility of risk models has put assessment of risk model performance in clinical perspective rather than using pure statistical measure [ 21 - 24 ] .
mirror images of shared aspects of the cascades of lung cancer risk assessment ( left ) and early detection ( right ) are shown .
these cascades move from clinical and epidemiological assessments to molecular epidemiological assessments to biomarker assessments in non - lung samples and finally to biomarker assessments in lung samples .
they merge in the middle with the identification of the highest - risk individuals who need computed tomography ( ct ) screening .
individuals with a positive ct scan will be entered into clinical workup and treatment protocols .
those with a negative ct scan are clearly at a high risk and should be considered for prevention research studies .
recently , two specific respiratory risk factors have been highlighted in the development of lung cancer , that of pre - existing tuberculosis and chronic obstructive pulmonary disease ( copd ) .
the inclusion of these risk factors , particularly an objective copd measurement ( ratio of forced expiratory volume in 1 second to forced expiratory capacity , or fev1/fec ) and other validated clinical information , in place of self - reported responses to questionnaire data would alleviate the impact of recall bias on the estimated risks .
in recognizing the impact of late diagnosis of cancer , the cancer reform strategy recently established a national awareness and early diagnosis initiative ( naedi ) with a view to continuously promote early diagnosis in the large majority of patients who present with symptoms . the naedi - hypothesized pathways for late presentation include low awareness of the signs and symptoms of cancer among the public as well as delay occurring within primary care , which may be due to inadequate access to a decision tool that may assist general practices ( gps ) to reassure or observe patients , request further investigations , or refer patients to specialist services . as a result , there are now plans to equip every gp within a period of 5 years with a computerized algorithm to predict cancer risk
. meanwhile , risk models need to be validated in different populations and demonstrated to be clinically useful for making decisions regarding patient treatment or clinical interventions before they can be acceptable as decision tools by clinicians .
this is rarely undertaken as only a few existing models , including those for lung cancer , have been validated in independent populations .
the validation of the llp risk model in data from three independent studies revealed promising results ( unpublished data ) ; the model displayed good clinical utility by performing better than all other alternative approaches for making decisions about whom to screen or not to screen for lung cancer .
the llp risk model has been implemented in a feasibility study ( funded by the knowsley primary care trust , uk ) in the primary care setting and is being evaluated in other high - risk gp locations .
the outcome of this study will provide important public health guidance as to how to identify individuals who are at risk of developing lung cancer prior to developing symptoms .
also , an assessment of the model in the uk lung cancer ct screening study ( ukls ) trial was successful ; therefore , it has been recommended as a major tool in stratification of patients to be screened in the general population . in conclusion , screening and other clinical interventions for prevention and early diagnosis of lung cancer
risk models provide useful tools to stratify patients into high or low risk and provide counselling regarding level of risks , motivating changes in personal lifestyle .
| ### Summary:
: computed tomography screening for early diagnosis of lung cancer is one of the more potentially useful strategies , aside from smoking cessation programmes , for reducing mortality and improving the current poor survival from this disease .
the long - term success of lung cancer screening will be dependent upon identifying populations at sufficient risk in order to maximise the benefit - to - harm ratio of the intervention .
risk prediction models could potentially play a major role in the selection of high - risk individuals who would benefit most from screening intervention programmes for the early detection of lung cancer .
improvements of developed lung cancer risk prediction models ( through incorporation of objective clinical factors and genetic and molecular biomarkers for precise and accurate estimation of risks ) , demonstration of their clinical usefulness in decision making , and their use in future screening programmes are the focus of current research . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: ectopic teeth are those that are impacted in unusual positions , or that have been displaced and are at a distance from their normal anatomic location .
ectopic eruption can be associated with developmental disturbances , pathologic processes , or iatrogenic activity . in many cases
the presence of supernumerary or ectopic tooth is not uncommon , and it is estimated to occur in 1% of the general population , especially in children and involving the first dentition.[46 ] these ectopic teeth may be permanent , deciduous , or supernumerary .
ectopic eruption of teeth into regions other than the oral cavity has been rarely reported . here
we describe a unique case of ectopic supernumerary tooth in the oropharynx and what we believe is the first reported case of this rare kind in the english literature .
a 4-year old boy was referred to the department of oral and maxillofacial surgery , sjm dental college and hospital , chitradurga , with a complaint of pain and discomfort during swallowing since a week .
intra - oral clinical examination of the patient revealed a tooth - like structure resembling a molar posterior to soft palate , and soft tissue surrounding was reddish in color and inflamed [ figure 1 ] .
patient 's dental examination revealed one complete set of deciduous teeth [ figure 2 ] without any oral disease or history of maxillofacial trauma or surgery .
computed tomography ( ct ) scan was advised to evaluate any lesion associated and to plan further treatment . due to financial constraints , ct was not affordable for the patient .
intra - oral clinical photograph showing a tooth - like structure posterior to soft palate , with inflamed red surrounding soft tissue intra - oral clinical photograph showing complete set of deciduous teeth in both arches a diagnosis of supernumerary ectopic tooth was consistent with the clinical finding in the oro - pharyngeal region .
after 1 month of initial visit , the parents of the patient reported back that the tooth fell off on its own within 10 days and the healing was uneventful .
tooth development results from a complicated multistep interaction between the oral epithelium and the underlying mesenchymal tissue . a series of complex tissue interactions result in the formation of mature teeth .
the tooth may be asymptomatic at the time of diagnosis and may be noticed on routine clinical or radiological examination .
ectopic eruption of teeth into regions other than the oral cavity has been rarely reported in a variety of locations such as maxillary sinus , mandibular condyle , coronoid process , orbit , palate and nasal cavity.[479 ] not a single case of ectopic tooth in oropharynx has been reported in the english - language literature and was searched from pubmed and medline databases . a case of tooth in the nasopharynx in a 36 year - old man due to trauma
ectopic teeth are rare dental anomaly and more likely managed by medical practitioners than their dental counterparts . in addition
, this report also addresses a young patient with a tooth in the oropharynx with the objective of emphasizing the fact that the etiology is non - traumatic and such clinical presentation is extremely rare .
we strongly suggest that the treatment must aim at the dental extraction , whether for the symptoms are recurrent and the location of the ectopic tooth , in many instances , a potential region of complications .
treatment should be carefully planned based on the position of the ectopic tooth and the potential for surgical trauma .
if a conservative approach is decided on , periodic monitoring of the patient will be necessary . | ### Summary:
: the incidence of ectopic teeth has increased . in many cases , the etiology of ectopic teeth can not be identified .
ectopic tooth in deciduous dentition period is very rare and information is limited about its causes and characteristics .
the conditions commonly associated with an increased prevalence of ectopic teeth include cleft lip and palate , cleidocranial dysplasia , and gardner syndrome .
the diagnosis is made by the clinical and radiological examinations .
the indication for extraction in ectopic teeth cases is in general determined by the presence of symptomatology , or by the need for preventing future complications .
we present a case of an ectopic maxillary tooth in a 4 year - old boy .
in addition , this report also addresses a young patient with a tooth in the oropharynx with the objective of non traumatic etiology , and such a clinical presentation is extremely rare .
the authors believe the case presented here is the first documented case of an ectopic supernumerary tooth seen in the oropharynx . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: the concept of surrogacy is not new to chinese society because it can be traced back to ancient china , when a man might
borrow a woman 's belly to produce offspring ( ) for the purpose of carrying on his family line .
different from surrogacy in old days , modern surrogacy does not necessarily involve sexual intercourse between the surrogate mother and the intended father , and the surrogate mother may become pregnant through artificial insemination or in vitro fertilization .
one is traditional or partial surrogacy , where the intended father normally fertilizes the surrogate mother 's egg through sexual intercourse or artificial insemination .
the other is gestational or full surrogacy , where the intended mother 's or donated egg is normally fertilized with the intended father 's sperm through in vitro fertilization in a laboratory and then the embryo is implanted in the surrogate mother uterus .
the essential difference between these two types of surrogacy lies in that the surrogate mother in traditional surrogacy shares the biological connection with the surrogate child , which is not the case in gestational surrogacy .
in addition , surrogacy may be divided into commercial and altruistic surrogacy , depending on whether the surrogate mother is paid a service fee for conceiving , carrying , and giving birth to the child .
the first chinese test - tube baby was born at the third hospital of peking university in beijing in 1988 , and the first test - tube surrogate baby was born at the same hospital in 1996 . since then , surrogacy has become an increasingly popular solution to infertility in the country . with the prevalence of the internet and wireless communications ,
numerous commercial surrogacy advertisements are posted on the internet and on the streets . according to the insiders in the underground surrogacy industry , there were around 400 to 500 commercial surrogacy agencies across the country in 2012 , one - tenth located in guangzhou .
it was roughly estimated that 25,000 surrogate children had been born in the country up to 2009 . a wealthy couple in guangzhou
had even spent one million yuan on the performance of in vitro fertilization and hired two surrogate mothers , who totally gave birth to five surrogate children for the couple .
there are no specific rules governing surrogacy except four relevant provisions set forth in three sets of departmental rules made by the ministry of health .
specifically , article 3 of the 2001 administrative measures for assisted human reproductive technology ( ) prohibits medical institutions and medical staff from performing any form of surrogacy procedures ; article 22 states that any violating medical institution shall be warned and fined no more than 30,000 yuan and the relevant responsible personnel shall be subject to administrative sanctions , and when committing a crime , shall be subject to criminal liabilities .
article 3 of the 2003 norms of assisted human reproductive technology ( ) and article 3(5 ) of the 2003 ethical principles of assisted human reproductive technology and human sperm bank ( ) reiterate the prohibition on medical staff from performing surrogacy procedures .
it is worth noting that , though the ministry of health 's departmental rules show the government 's disfavor against surrogacy that involves assisted human reproductive technology , these departmental rules only impose administrative liabilities on the violating medical institutions and medical staff but not others , and they have not made a general prohibition on surrogacy .
although chinese law lacks specific rules governing surrogacy , surrogacy disputes have been submitted to the courts from time to time .
the courts are called to decide a number of disputed issues regarding validity of surrogacy contract , parenthood of the surrogate child , and sole care and control and visitation of the surrogate child .
judicial decisions on these issues have far - reaching implications for all parties including the surrogate mother , the intended parents , and the surrogate child .
to date , there have been few studies on surrogacy litigation in china either in chinese or english literature .
little has been known about how chinese courts have decided surrogacy cases and whether they have adopted appropriate approaches in applying the existing law , and how chinese law needs to better adapt to the social demand of surrogacy .
this article aims to answer these enquiries through a case study on surrogacy litigation in china , presenting the chinese perspective in international debates about the regulation of surrogacy .
part ii of this article presents the sample surrogate lawsuits and the findings on the judicial views on three major legal issues .
they include validity of surrogacy contract , parenthood of the surrogate child , and sole care and control of the surrogate child .
part iii analyses the relevant existing legal rules and assesses the appropriateness of those judicial views .
and part iv explores the inadequacies in chinese law in solving surrogacy disputes and regulating the practice of surrogacy , and recommends a set of suggestions for improvement .
although the supreme people 's court has required that lower courts must upload judgments for publication to an official central website ( www.court.gov.cn/zgcpwsw ) from january 1 , 2014 , there is no judgment of surrogacy case published in the website at the time of writing this article . after searching a variety of sources including the case database of pkulaw ( ) , the case database of legaldaily ( ) , and various online and print media reports ,
these ten sample surrogacy lawsuits occurred between 2004 and 2012 , eight occurring after 2009 . among them , three cases were adjudicated in guangxi zhuang minority autonomous region , two cases each in guangdong province and henan province , and one case each in jiangxi province , hunan province , and fujian province .
nine of the ten sample cases involved commercial surrogacy , and one case involved altruistic surrogacy .
eight of the ten sample cases involved traditional surrogacy , and two cases involved gestational surrogacy .
it is found that the common cause of action of the traditional surrogacy cases was sole care and control ( and maintenance ) of the surrogate child , while that in the gestational surrogacy cases was parenthood of the surrogate child .
case 1 : the defendant 's wife was infertile and the couple agreed to have a child through surrogacy .
they then cohabited in the premise of the defendant 's factory . on december 14 , 2003 ,
the plaintiff gave birth to a male child for the defendant . on january 3 , 2004 , the defendant paid 70,000 yuan to the plaintiff , who returned a receipt of the surrogacy fee payment .
the family of the defendant had taken care of the surrogate child since his birth .
later the plaintiff sued the defendant , claiming sole care and control of the child .
case 2 : the defendant 's wife was infertile and the couple agreed to have a child through surrogacy . in 2004 , a third party introduced the plaintiff to the defendant .
they orally made a traditional surrogacy contract and agreed on a surrogacy fee of 150,000 yuan .
the defendant provided an accommodation for the plaintiff for the purpose of surrogacy . in 2005 ,
the plaintiff gave birth to a male child for the defendant . in december 2007 , the plaintiff entered into a written surrogacy contract with the defendant and his wife .
the written contract stated that the plaintiff voluntarily carried a child for the couple and the defendant promised to pay a surrogacy fee of 150,000 yuan .
it further prescribes that the defendant should pay 100,000 yuan at the time of making the contract and pay the outstanding balance 50,000 yuan within five months from the date of the contract , and that the plaintiff should hand the child and his medical birth certificate ( ) issued by the hospital over to the defendant and move out of the defendant 's premise after receiving the payment of 100,000 yuan . however , the plaintiff brought the child back to her hometown with an excuse in april 2008 and completed the household registration for the child at her hometown , which led to the defendant 's suspicion in the plaintiff 's attempt to keep the child .
the defendant thus brought the child back to nanning , the city where he lived , after paying off 50,000 yuan to the plaintiff .
later the plaintiff initiated an action against the defendant , claiming sole care and control of the child .
case 3 : the plaintiff and his wife lived abroad and could not have their own child for years .
the plaintiff paid over 200,000 yuan to a surrogacy agency , which arranged a gestational surrogacy by the twenty - three - year - old defendant in guangdong province .
the embryo was created with the plaintiff 's sperm and a donor 's egg . in may 2009 ,
the defendant gave birth to a male child and handed the child over to the plaintiff .
the plaintiff planned to bring the child abroad ; however , he had no official document to prove his parenthood of the child . therefore , the plaintiff initiated an action , requesting the court to confirm his parenthood and sole care and control of the child , so that he could use the judgment as the child 's identity evidence to support the immigration application on behalf of the child .
, the plaintiff gave birth to a male child but she refused to relinquish the surrogate child to the defendant . in may 2007
they continuously quarreled over this matter until the plaintiff sued the defendant to claim sole care and control of the child and request the defendant to pay maintenance fees for the child .
the twenty - five - year - old plaintiff , as surrogate mother , was introduced to the defendant by a third party . according to their surrogacy contract
, the plaintiff agreed to bear a child for the defendant , and in return , the defendant would pay the plaintiff a service fee of 60,000 yuan .
the defendant and his wife surreptitiously took the child away and disappeared after successfully applying the child 's medical birth certificate in their own names as biological parents , using their own birth permit .
therefore , the plaintiff sued the defendant and claimed the service fee of 60,000 yuan promised by the defendant under the surrogacy contract .
the plaintiff later changed the cause of action to a claim of sole care and control of the child .
case 6 : the plaintiff 's son had prematurely died years ago and his wife was no longer fertile . on september 8 , 2006 , the plaintiff got to know the defendant and they entered into a surrogacy contract , under which the plaintiff promised to pay 40,000 yuan as consideration for the defendant 's carrying a child for the plaintiff within one year . on september 29 , 2006 , the plaintiff paid the defendant 20,000 yuan . because the defendant had not become pregnant within six months , the plaintiff requested her to return the paid 20,000 yuan . the defendant rejected .
case 7 : the plaintiff and his wife had had no child for years and decided to have a child through gestational surrogacy . in may 2008 ,
the plaintiff got to know the thirty - year - old defendant after posting a surrogacy advertisement on a chinese website .
they immediately met and signed a surrogacy contract , which prescribed that the plaintiff would assume all of the defendant 's expenses associated with surrogacy and additionally pay the defendant a surrogacy fee of 100,000 yuan , and that the defendant agreed to relinquish the surrogate child to the plaintiff after birth .
the plaintiff fertilized a donor 's egg through in vitro fertilization and the embryo was placed into the uterus of the defendant in a hospital . in march 2009 ,
the defendant gave birth to a male child but she refused to hand the child over to the plaintiff .
after unsuccessful negotiation , the plaintiff sued the defendant in july 2010 , claiming parenthood and sole care and control of the child .
case 8 : the defendant signed a surrogacy contract with the plaintiff introduced by a surrogacy agency on january 1 , 2010 .
they agreed that the plaintiff would undertake traditional surrogacy , and in return , the defendant would pay her a remuneration of 160,000 yuan . on may 25 , 2011 ,
the defendant paid off the remuneration as well as the reimbursement of the associated expenses , which were totally 180,000 yuan as of june 3 , 2011 , and then took the child away on the same day .
although she had no dispute over the defendant 's sole care and control of the child , she requested the court to allow her to visit the child for two days every month .
case 9 : the plaintiff and the defendant got to know each other in 2001 .
the plaintiff gave birth to male twins for the defendant on june 5 , 2004 .
the defendant had been awarded sole care and control of the twins in another separate lawsuit .
however , they disputed over the plaintiff 's visitation right for many times . in july 2012 ,
the plaintiff sued the defendant , requesting the court to order the defendant to assist her visit to the twins .
case 10 : the child of the defendant was seriously injured in a car accident in 2004 and died prematurely after three - year treatments . because the defendant 's wife was too old to bear a child , the defendant entered into a surrogacy contract with the plaintiff introduced by a surrogacy agency .
the contract stated that the defendant would pay the plaintiff her living expenses 5,000 yuan per month during the course of traditional surrogacy and would additionally pay her 200,000 yuan after she handed the surrogate child over to the defendant .
the defendant subsequently increased the payment of living expenses to 15,000 yuan per month and totally paid living expenses of more than 200,000 yuan . in march 2012 ,
after several times of unsuccessful negotiation , the defendant stopped paying maintenance fees for the child .
the plaintiff sued the defendant , claiming a lump sum maintenance fee of 640,000 yuan .
the first legal issue addressed by the courts in the sample surrogacy lawsuits is concerned with validity of surrogacy contract .
most courts held the first view that a surrogacy contract was invalid either because it breached social morality ( eg case 10 ) or because it involved illegal cohabitation ( eg case 4 ) , and therefore both contracting parties could not rely on the surrogacy contract to claim any right or interest arising from it ( eg case 5 ) .
although a surrogacy contract was held to be void , the courts neither ordered the surrogate mother to return the received surrogacy fee to the intended parent nor ordered a party with fault to compensate the other 's losses to the extent that his fault had contributed to , except in one sample case ( ie case 6 ) . in that case , the court held that the intended father should assume a major share of accountability for the invalidity of the surrogacy contract in question , and therefore ordered the surrogate mother to return 80 per cent of the received surrogacy fee . despite agreeing that a surrogacy contract breached social morality and should be denounced by law and social morality , some courts held the second view that a surrogacy contract was only partially invalid , and the contractual clause on sole care and control of the surrogate child remained valid and sufficiently showed that the parties had reached an agreement on the sole care and control issue ( eg cases 1 and 2 ) .
only the court in case 7 held the third view that a surrogacy contract showed the true intention of both contracting parties and it did not breach compulsory provisions of the law ; therefore , it should legally bind both parties .
the second legal issue considered by the courts in the sample surrogacy lawsuits is about parenthood of the surrogate child .
it seems that both the disputing parties and the courts implicitly agreed that the surrogate mother was the legal mother and the intended father was the legal father of the surrogate child in traditional surrogacy .
none of the parties in the sample traditional surrogacy lawsuits had dispute over the parenthood issue , and the courts did not explicitly address the issue either , even in the case where the intended mother was also one contracting party to the surrogacy contract ( eg case 2 ) . in the sample gestational surrogacy lawsuits , one court ( ie case 7 ) held that the surrogate mother was merely the gestational mother rather than the biological mother of the surrogate child and she had no parenthood right , let alone the right of sole care and control .
nevertheless , the courts hesitated to explicitly state that the intended mother was the legal mother of the child born of gestational surrogacy .
the third legal issue decided by the courts in the sample surrogacy lawsuits is concerned with sole care and control and visitation of the surrogate child .
the courts were called to decide which legal parent of the surrogate child in traditional surrogacy cases was entitled to sole care and control , the surrogate mother or the intended father .
they determined the issue of sole care and control of the surrogate child by analogy to that of the child in divorce cases , referring to the 1993 specific opinions of the supreme people 's court on the people 's courts handling the issue of care and control of the child in hearing divorce cases ( , hereinafter opinions on the issue of care and control of the child ) .
the sample surrogacy lawsuits present two judicial approaches in deciding sole care and control of the surrogate child .
the courts adopting the first approach constructed the clause of the surrogacy contract , which stated that the surrogate mother agreed to accept a surrogacy fee and meanwhile promised to hand the surrogate child over to the intended father after birth , as an agreement reached between the surrogate mother and the intended father that the surrogate child would live under sole care and control of the intended father . according to article 2 of the opinions on the issue of care and control of the child ,
when the parents agreed that their child under two years old will live under sole care and control of the father , the court will endorse the agreement if it has no detrimental effect on the child .
the courts thus compared the conditions for upbringing the surrogate child offered by the surrogate mother and the intended father , including the income , the housing condition , and the length of the time period that each parent lived with the child , and then decided that it would meet the best interest of the surrogate child to award the intended father sole care and control , and the surrogate mother nevertheless did not need to pay maintenance fees for the child ( eg cases 1 , 2 and 8) .
in contrast , the courts adopting the second approach refused to accept that the surrogate mother and the intended father had reached an agreement on the issue of sole care and control of the surrogate child in their surrogacy contract .
instead , the courts held that the case should apply article 1 of the opinions on the issue of care and control of the child , which establishes that a child under two years old will in principle live with the mother , unless ( i ) the mother suffers a persistent infectious disease or other serious disease , or ( ii ) the mother , though being able to bring up the child , fails to discharge her duty and meanwhile the father requests the child to live with him , or ( iii ) the child can not live with the mother for other reasons . by applying this provision , the courts held that the surrogate child in question should live under sole care and control of the surrogate mother and the intended father should pay maintenance fees for the child ( eg cases 4 and 10 ) . in two of the sample surrogacy lawsuits ,
the surrogate mother , who did not have sole care and control of the surrogate child , claimed for regular visitation of the child .
for instance , the court in case 8 permitted the surrogate mother to visit the surrogate child three times per year and ordered the disputing parties to reach an agreement on the specific time and location of the visits ; the court in case 9 held that the surrogate mother could visit the surrogate child on a five - day basis at the home of the intended father every february and august .
although chinese law has not provided specific rules governing surrogacy , the general civil legal rules remain applicable to surrogacy litigation , which basically involves civil disputes concerning the property and personal relationships between equal civil parties , such as the surrogate mother , the intended parents , and the surrogate child .
as found above , chinese courts have inconsistently applied the existing law in surrogacy litigation .
few courts have given clear legal reasoning to uphold their views . whether the courts have appropriately applied the law in surrogacy litigation deserves careful examination .
a surrogacy contract is an agreement made between the surrogate mother and the intended parent(s ) primarily concerning the details of a surrogacy arrangement and the issue of sole care and control of the surrogate child .
article 2(2 ) of the 1999 contract law ( ) provides that an agreement on the personal status relationship ( ) , such as marriage , adoption and guardian , and so on , should apply other laws .
therefore , the 1999 contract law does not govern a surrogacy contract , as it is an agreement on the personal status of the surrogate child . instead , a surrogacy contract should govern the 1986 general principles of civil law ( ) , which is seen as a quasi - civil code of china and generally regulates the civil relationship between equal civil parties .
articles 55 and 58 of the general principles of civil law respectively set out the legal elements for a valid juristic act and the circumstances of an invalid juristic act .
( not ) violating the law or public interest. if a surrogacy contract violates the law or public interest , it will become invalid . however , whether a surrogacy contract violates the law or public interest in chinese law is open for consideration .
article 52 of the contract law sets out the circumstances of an invalid contract , one of which is violation of compulsory provisions of laws or administrative regulations. different from the wordings in the contract law , articles 55 and 58 of the general principles of civil law adopt the term
the law , which refers to all sources of law , but not limited to laws made by the national people 's congress and its standing committee .
chinese law does not generally prohibit surrogacy , and the ministry of health 's three sets of departmental rules only prohibit medical institutions and medical staff from performing surrogacy procedure , rather than penalizing the surrogate mother and the intended parents .
therefore , a surrogacy contract between the surrogate mother and the intended parents in itself does not violate the relevant departmental rules , no matter whether fertility procedures have been employed in the surrogacy arrangement .
although the court in one sample surrogacy lawsuit ( ie case 4 ) held that surrogacy involved illegal cohabitation , the surrogate mother and the intended father who cohabit for the purpose of traditional surrogacy do not violate the existing law , because their temporary cohabitation does not amount to de facto marriage , and the current law no longer treats extramarital sexual intercourse as an illegal act and has actually abandoned the term
illegal cohabitation. does surrogacy contract violate public interest ? there is no statutory definition of the term
it is understood to broadly cover social morality . to date , no consensus has been reached in chinese society on whether a surrogacy contract violates social morality .
the ministry of health has informally expressed that surrogacy might disturb the social morality order and cause the surrogate mother and the surrogate child to suffer psychical and psychological harm . in sum
first , a woman 's full experiences of conception , pregnancy , birth , and raising a child reflect her inherent features as woman .
surrogacy unnaturally deprives the surrogate mother 's experience of upbringing the surrogate child after she gives birth to him , as she has to relinquish the child to others . as a consequence ,
second , the surrogate child is likely to have confusion over his identity due to the unnatural way he was conceived and born . he may be perceived as mere property by the intended parents .
third , commercial surrogacy , which is equal to the sale of the surrogate child and the rental of the surrogate mother 's uterus , not only blasphemes the sanctity of the surrogate child 's life but also treats the surrogate mother 's body as an instrument of others reproduction . in particular , commercial surrogacy facilitates exploitation of those financially vulnerable women . on the one hand ,
the surrogate mother voluntarily agrees to carry a child for others by employing assisted human reproductive technology , which does not undermine her inherent features as a woman , but exactly manifests her gender identity and value .
the surrogate mother 's relinquishing the surrogate child to the intended parents is similar to the biological parents transferring parenthood of the adoptive child to the adoptive parents .
surrogacy is no more unnatural than adoption , and the surrogate mother does not necessarily suffer more psychological harm than the biological parents in adoption cases .
for instance , one study has found that the surrogate mothers do not appear to experience psychological problems as a result of the surrogacy arrangement .
the surrogate child may have confusion over his identity , but a child conceived and born through any assisted human reproductive technologymay encounter the same problem .
such identity confusion is not fatal to a child conceived unnaturally because the law can solve it by granting him with a right to know his identity provided that certain conditions are fulfilled .
in addition , the intended parents would not likely treat the surrogate child merely as their property or provide less love and care to him because he was born of surrogacy .
on the contrary , the intended parents are usually more caring and concerning about him as they are unable to bear a child by themselves and are desperate to be parents . on the other hand ,
women in a vulnerable economic position generally have more incentive to make use of their body to earn money , undertaking to be a surrogate mother , which is essentially similar in the nature of sexual workers and egg sellers .
the 2003 ethical principles of assisted human reproductive technology and human sperm bank explicitly establish a principle of prohibition of commercialization .
commercial dealings of sperm , egg or embryo , and other commercial arrangements in the application of assisted human reproductive technology violate the established ethical principles in china .
moreover , the fee that the surrogate mother receives in traditional surrogacy is paid for her egg and service for pregnancy and birth , which may include both sale of eggs and commercial surrogacy .
therefore , commercial surrogacy no doubt violates social morality and public interest according to the 2003 ethical principles of assisted human reproductive technology and human sperm bank . to sum up , whether a surrogacy contract violates public interest and thus becomes invalid in chinese law depends on the type of surrogacy concerned . in altruistic surrogacy ,
the surrogate mother voluntarily and altruistically carries a child to help the infertile intended parents fulfill their wish of having a biological child .
the surrogate child is expected to live in a family environment , being loved and cared by the intended parents .
altruistic surrogacy in fact promotes the intended parents interest in reproduction , which is equally part of public interest .
therefore , an altruistic surrogacy contract is valid in chinese law ; except the agreement on sole care and control of the surrogate child , the surrogacy arrangements specified in the contract have enforceability .
however , a commercial surrogacy contract is invalid due to its violation of public interest ; all agreements specified in the contract , including that on sole care and control of the surrogate child , are null and can not be relied on by any contracting party as legal basis .
moreover , according to article 61(1 ) of the general principles of civil law , the surrogate mother should return the paid surrogacy fee to the intended parents , and the party with fault should compensate the other 's losses to the extent that his fault had contributed to , and if both parties have fault , they should bear liability for compensation proportionately . turning to the judicial views on validity of surrogacy contract in the sample surrogacy lawsuits , it is inappropriate for chinese courts to entirely ignore the nature of the surrogacy contract when addressing the issue of public interest and drawing a decision .
meanwhile , it is highly problematic for the courts to brush off the legal consequences of an invalid surrogacy contract in their judgments , leaving the surrogate mother keeping the paid service fee , which ironically has a de facto effect of judicial endorsement of an invalid surrogacy contract .
there are two types of parenthood in chinese law : natural parenthood and fictional parenthood .
the former is established through a natural event of childbirth and the latter through a juristic act of adoption .
different from fictional parenthood , natural parenthood is determined by the operation of law rather than by the will of the parties .
thus , any agreement on natural parenthood of the surrogate child in a surrogacy contract does not have any legal effect , regardless of the validity of the contract .
although chinese law provides legal rules on specific rights and obligations of parenthood , such as articles 21 to 25 of the 2001 marriage law ( ) , there are neither general legal rules in determining natural parenthood nor specific legal rules on how to determine parenthood of the surrogate child . to solve the issue of parenthood of the surrogate child , it is necessary to explore the implicit test used to determine parenthood in china .
the underlying basis for legal motherhood in chinese law seems to be the biological connection between the legal mother and the child , which is implied by two legal provisions .
the first is article 25(2 ) of the 2001 marriage law , which states that the biological parent who does not have sole care and control of an illegitimate child should pay the living and education expenses for the child until he becomes financially independent .
this provision implies that the biological link is critical in determining parenthood and the parental responsibilities including maintenance of the child .
the second provision is article 2(1 ) of the 2001 ethical principles for the application of assisted human reproductive technology ( ) , which sets out an exception that donors of sperm , egg , or embryo have no legal rights and obligations , though biologically connected , towards the consequent child . in normal cases where a woman carrying a child is also the biological mother , parturition serves as prima facie evidence of the biological connection between the gestational mother and the newborn child . in other words , the fact of parturition , evidenced by the medical birth certificate issued by the hospital , sufficiently establishes a presumption of the biological connection between the gestational mother and the newborn child .
thus in practice , the gestational mother is entitled to apply to the government for the household registration of the newborn child , and subsequently receives a household booklet documenting the gestational mother 's parenthood of the child .
different from normal cases where a child 's biological mother , gestational mother , and intended mother is the same person , thus being the legal mother of the child , in surrogacy cases , these three types of mother are no longer the same person .
specifically , in traditional surrogacy , the surrogate mother is both the biological mother and the gestational mother , but not the intended mother of the surrogate child . in gestational surrogacy ,
the surrogate mother is only the gestational mother of the surrogate child , and his biological mother may be the intended mother if the egg that conceived him comes from the intended mother or may be an anonymous donor if the egg is donated .
understandably , a dispute on legal motherhood of the surrogate child may easily occur in practice .
it needs to be discussed by considering the exact type of surrogacy concerned . in traditional surrogacy ,
the gestational mother is the biological mother of the surrogate child and the presumption of the biological connection evidenced by the hospital 's medical birth certificate remains valid .
the gestational mother is the legal mother of the surrogate child and she does not have any difficulty in making the household registration for the child .
meanwhile , the intended mother is not entitled to parenthood of the surrogate child according to the implicit biological connection test , unless the surrogate mother transfers parenthood to her through adoption in accordance with the 1998 adoption law ( ) . in gestational surrogacy , since the gestational mother is not the biological mother of the surrogate child , the presumption of their biological connection evidenced by the hospital 's medical birth certificate is no longer valid and can be rebutted .
the gestational mother does not have parenthood of the child due to the lack of the biological connection .
if the intended mother provides the egg to conceive the surrogate child , she will be the legal mother of the child .
if the egg comes from a donor , the intended mother remains the legal mother because article 2(2 ) of the 2001 ethical principles for the application of assisted human reproductive technology provides that the receiving couple , but not the donor , will have parenthood of the consequent child and bear the legal responsibilities to care and educate him .
however , the intended mother is likely to experience practical difficulties in applying for the household registration of the surrogate child , as she is unable to submit the hospital 's medical birth certificate proving that she is the gestational mother .
what she can do is to sue the surrogate mother , applying for judicial confirmation of parenthood of the surrogate child by relying on article 2(2 ) of the 2011 interpretations iii of the supreme people 's court on issues in the application of the marriage law ( ( ) , hereinafter
interpretations iii of the marriage law ) , which provides that the party who initiates an action to apply for confirming parenthood of a child shall submit necessary supporting evidence , and the court may infer the alleged parenthood if the other party fails to submit evidence otherwise and meanwhile refuses to conduct a dna parentage testing .
the issue of fatherhood in traditional surrogacy relates to the marital status of the surrogate mother .
if she is married and bears the surrogate child during the course of the marriage , the child is a legitimate child and the surrogate mother 's husband will be presumed to be the biological father and the legal father of the child . when the surrogate mother 's husband is unwilling to be the legal father
, he may sue his wife for judicial renouncement of fatherhood of the surrogate child according to article 2(1 ) of the interpretations iii of the marriage law , which provides that one spouse sues the other to apply for the renouncement of parenthood of the child in question ; with the necessary supporting evidence , the court may infer the alleged renouncement of parenthood if the other spouse fails to submit evidence otherwise and meanwhile refuses to conduct a dna parentage testing .
if the surrogate mother is unmarried when she bears the surrogate child , the child will not have legal father at the time of birth .
when the surrogate mother 's husband has denied fatherhood of the surrogate child or the surrogate mother is unmarried , because the intended father is normally the biological father of the surrogate child , both the intended father and the surrogate mother may initiate an action against each other for judicial confirmation of fatherhood of the surrogate child by relying on article 2(2 ) of the interpretations iii of the marriage law . the issue of legal fatherhood in gestational surrogacy seems simpler than that in traditional surrogacy .
although the intended mother is the legal mother of the surrogate child , as analyzed above , her husband ( ie the intended father ) can not be presumed to be the legal father of the child because the intended mother did not conceive and bear the child during the course of her marriage .
however , the intended father can still rely on article 2(2 ) of the interpretations iii of the marriage law to claim fatherhood of the surrogate child on the grounds of his biological connection to the child . turning to the judicial views on parenthood of the surrogate child ,
chinese courts have adopted the implicit biological connection test and there are three major problems in their judicial practice .
first , the courts have not clearly addressed the issue of parenthood of the surrogate child , which is logically inevitable before determining the issue of sole care and control of the child .
second , the courts have been silent about the applicable legal rules in determining parenthood of the surrogate child , let alone have provided clear legal reasoning in applying them .
third , the courts have failed to acknowledge and analyze the complexity of the parenthood issue in the different situations of surrogacy .
the issue regarding sole care and control of the surrogate child arises in the case where the surrogate mother and the intended father are respectively the legal mother and the legal father of the surrogate child .
the surrogate child in this situation may be treated as an illegitimate child because his legal parents have no martial relationship when he is conceived or born .
chinese law only provides that either biological parent of an illegitimate child equally has the right of sole care and control but it has not provided any rules in determining which parent can obtain that right .
chinese courts may apply by analogy the opinions on the issue of care and control of the child when they determine which parent may enjoy sole care and control of the surrogate child .
however , the sample surrogate lawsuits contain inconsistent judicial views , which are arguably problematic in three aspects .
first of all , chinese courts failed to clarify that the issue of sole care and control of the surrogate child should be determined in accordance with the best interest of the child principle . despite the lack of specific legal rules on how to determine which parent can have sole care and control of an illegitimate child , the preamble of the opinions on the issue of care and control of the child spells out a general principle that the issue of sole care and control of a child should be properly solved based on the child 's interest in physical and psychological health and other legal rights and interests , and in the circumstances of the specific conditions for upbringing the child that each parent offers .
in other words , the preamble has established that the interest of the child is paramount in determining the issue of sole care and control of the child .
second , some courts ( eg cases 1 and 2 ) were in error when they treated the agreement on sole care and control in the surrogacy contract as evidence to conclude that both parents have already agreed that the surrogate child would live under sole care and control of the legal father , even though the surrogate mother as legal mother later changed her mind and sued for sole care and control of the child . whether the intended father and the surrogate mother have agreed on the issue of sole care and control of the surrogate child should depend on their will at the time of litigation .
third , the principle established in article 1 of the opinions on the issue of care and control of the child that a child under two years old will live with the mother should not be applied in surrogate litigation mechanically , because the fundamental difference between a divorce case and a surrogacy case lies in that , in addition to the legal / intended father , there is an intended mother who is eager to offer a mother 's love to the surrogate child , which is absent in a divorce case . as the intended parents can provide a complete family environment to the child and
the intended mother will take a mother 's responsibilities to love and care him , the courts need to carefully consider the best interest of the surrogate child rather than mechanically applying the principle set forth in article 1 of the opinions on the issue of care and control of the child . to sum up
, the courts should take the interest of the surrogate child as the paramount consideration and comprehensively consider all relevant factors relating to his interest , such as the age of the child , the capabilities of the surrogate mother and the intended father to meet the child 's physical , emotional , and educational needs , their willingness to raise the child , their attitude to the child and to the parental responsibilities , the length of time that each parent has lived with the child , and the child 's wishes in the light of his age and understanding , and so on , to determine which parent is more suitable to exercise sole care and control of the surrogate child in accordance with the best interest of the child .
meanwhile , the courts may decide whether , how much , and how the parent who does not have sole care and control of the child should pay maintenance fees and how he or she can exercise the visitation right in specified time , location , and manner .
although chinese courts may apply , often by analogy , the relevant legal rules dispersing in different enactments in order to decide the issues of validity of surrogacy contract , parenthood of the surrogate child , and sole care and control and visitation of the surrogate child arising from surrogacy litigation , these rules are far from satisfactory to properly solve surrogacy disputes and adequately regulate the practice of surrogacy . specifically , there are three major inadequacies in current chinese law .
first , chinese law has failed to address the legality of surrogacy and to clearly define the scope of permitted surrogacy in the light of social morality and public policy .
the existing three sets of departmental rules made by the ministry of health , though prohibiting medical institutions and medical staff from performing any form of surrogacy procedure , neither have impact on surrogacy that does not make use of surrogacy procedures nor regulate the parties taking part in surrogacy arrangements other than medical professionals . despite denying the validity of commercial surrogacy contract ,
the 1986 general principles of civil law have little deterrence to the third parties who make profit by exploiting financially vulnerable surrogate mother and child - desperate intended parents , including but not limited to surrogacy agencies and the individuals managing and controlling them . as a result
, there is a massive underground surrogacy market and commercial surrogacy arrangements are not uncommon in the country , although the law disfavors it because of its violation of social morality . by and large ,
second , chinese law has failed to provide specific legal rules in determining parenthood of the surrogate child .
the existing implicit biological connection test is based on the presumption that a child 's biological mother , gestational mother , and intended mother are the same person , where parturition is taken as prima facie evidence of the biological connection between the gestational mother and the newborn child .
however , the gestational mother in surrogacy is no longer the intended mother of the surrogate child , and the intended parents face significant legal barriers to obtain parenthood in the existing law . in traditional surrogacy , the intended mother can not become the legal mother of the surrogate child due to the lack of biological connection to the surrogate child , unless the surrogate mother transfers the parenthood to her through the legal route of adoption . as article 4(3 ) of the 1998 adoption law
provides that only the parents who are unable to bring up their child due to special difficulties can place the child for adoption , without fulfilling this requirement , the intended mother remains unable to become the legal mother of the surrogate child .
the intended mother in gestational surrogacy and the intended father , no matter in traditional or gestational surrogacy , are normally the biological parents of the surrogate child
. they may apply for judicial confirmation of parenthood , which is primarily based on the biological connection test .
however , they can hardly obtain parenthood if they have not provided egg or sperm to conceive the surrogate child and can not pass a dna parentage testing , or if they do not know the identity of the surrogate mother and thus can not identify her as the defendant for the purpose of initiating an action to apply for judicial confirmation of parenthood . on the other hand , the existing implicit biological connection test allows the intended parents who have biological connection to the surrogate child to obtain parenthood , no matter whether the surrogacy arrangement in question is commercial or not .
thus , the biological connection test likely serves as the back door for commercial surrogacy arrangements .
third , chinese law has failed to address and protect the rights of two vulnerable parties in surrogacy arrangements , that is , the surrogate child and the surrogate mother . above all , the existing law has not provided certainty regarding parenthood and/or sole care and control for the surrogate child , which may make him unable to have a certain and stable family relationship and environment .
it is also unclear whether the surrogate child is entitled to access to the medical information concerning his identity , in particular the information regarding his biological origin , when he reaches a certain age . as for the surrogate mother who has entered into an altruistic surrogacy contract , it is unknown whether she is entitled to body integrity and autonomy like other pregnant women and whether she is allowed to unilaterally terminate pregnancy under certain conditions , and if yes , what are the legal consequences of the termination . additionally , the existing law contains no rules to particularly protect privacy of the surrogate child and the surrogate mother , such as preventing the publication of any fact that may reveal their identity . at the international level
some jurisdictions completely prohibit any form of surrogacy , such as germany , france ; some jurisdictions outlaw commercial surrogacy but allow and closely oversee altruistic surrogacy , such as the united kingdom , new zealand , virginia of the united states ; some jurisdictions legalize both altruistic surrogacy and commercial surrogacy , such as ukraine , russia , california of the united states . among those jurisdictions that disallow commercial surrogacy , they differ in terms of legal consequences of commercial surrogacy arrangements .
some jurisdictions criminalize the entry into a commercial surrogacy contract , with all parties to the contract subject to criminal penalties ; some jurisdictions only criminalize the receipt of payment in excess of reasonable reimbursement by the surrogate mother ; some jurisdictions do not impose criminal penalties on the parties to the commercial surrogacy contract , but only declare the contract illegal and void .
in some jurisdictions that allow altruistic surrogacy , the law sets out various substantive and procedural limitations to provide paternalistic protection to the surrogate mother , the surrogate child , and the intended parents , and to prevent the misuse of altruistic surrogacy .
because the regulation of surrogacy involves complex ethical , social , and legal concerns of the particular jurisdiction , it is understandable to have such a diverse range of regulatory models existing at the international level . by the same token , it is necessary to consider the relevant ethical , social , and legal factors regarding the practice of surrogacy in current china when presenting suggestions for improving chinese law on surrogacy . to remedy the inadequacies in chinese law noted above
, china needs to end the current chaotic practice of surrogacy by establishing a set of systematic regulations to closely regulate surrogacy arrangements .
first of all , chinese law needs to explicitly prohibit commercial surrogacy . as analyzed above , the 2003 ethical principles of assisted human reproductive technology and human sperm bank issued by the ministry of health articulate a principle of prohibition of commercialization , which represents the social morality and public interest of the country .
although the government has taken a clear decision that commercial surrogacy is in violation of the social morality and public interest and thus should be banned , it has failed to adopt effective legal rules to implement the decision . in reality , there is a massive underground surrogacy market hosted by around 400 to 500 commercial surrogacy agencies across the country .
the intended parents have to pay on average 500,000 to 600,000 yuan to the surrogacy agency in a commercial surrogacy arrangement . after paying the surrogate mother a service fee of 150,000 to 200,000 yuan
, the surrogacy agencies will normally have a net profit of 200,000 to 300,000 yuan per transaction .
surrogacy agencies thus have a very strong financial incentive to procure commercial surrogacy , taking advantage of financially voluntary surrogate mother and child - desperate intended parents .
some surrogacy agencies even induced and organized a large number of women from poor rural families to travel to big cities ( such as guangzhou ) to undertake surrogacy .
therefore , to deter profit - oriented surrogacy agencies and effectively ban commercial surrogacy , chinese law needs to have teeth through imposing criminal punishments and administrative sanctions on the third parties involved in procuring , advertising , providing assistance in achieving a pregnancy in commercial surrogacy arrangements .
however , chinese law may exempt the surrogate mother and the intended parents from criminal and administrative liabilities , because the invalidation of commercial surrogacy contracts by the 1986 general principles of civil law has properly disproved their entry into commercial surrogacy contracts , and their motive for surrogacy can be more or less justified on moral and legal basis .
second , though altruistic surrogacy does not violate social morality and the 1986 general principles of civil law recognize the validity of altruistic surrogacy contract , it remains necessary for chinese law to limit altruistic surrogacy by incorporating reasonable requirements so as to strike a balance of interests of the surrogate child , the surrogate mother , and the intended parents .
specifically , statutory requirements for altruistic surrogacy may be concerned with the eligibility of the surrogate mother ( eg the minimum age , the experiences of pregnancy and parturition , the physical and psychological health of the surrogate mother , receiving consultation and information about the implications of surrogacy arrangements , and the consent of her husband to surrogacy ) , the eligibility of the intended parents ( eg the medical needs for surrogacy , the marital status , and the maximum age ) , the manner of surrogacy ( eg surrogacy must adopt fertility procedures , at least one intended parent must be the biological parent of the surrogate child , and the surrogate mother and the intended parents must receive consultation and information about the implications of surrogacy arrangements ) , the scope of reasonable expenses associated with surrogacy and recoverable by the surrogate mother , and the formality of surrogacy contract ( eg in writing form ) .
third , chinese law needs to introduce a mandatory approval procedure in order to ensure that surrogacy arrangements specified in the surrogacy contract have complied with the statutory requirements for altruistic surrogacy , and
have well concerned the interests of the surrogate child , such as his potential risk of physical abuse , emotional or psychological abuse , or neglect likely caused by the intended parents or the surrogate mother , and his position in the event of the death of the intended parent who is his biological parent before his birth .
a local public agency may be authorized to review , approve , and make records of the proposed surrogacy arrangements .
the prior approval , as a procedural safeguard , will function as a pre - condition for the execution of surrogacy contract , the surrogate mother 's claim for the reimbursement of the reasonable expenses , and the intended parents obtainment of parenthood of the surrogate child at the moment of his birth .
fourth , chinese law needs to provide the legal rules for determining parenthood of the surrogate child . to provide the certainty regarding parenthood to the surrogate child
, the intended parents may automatically be the child 's legal parents upon his birth , provided that the surrogacy arrangement has been approved in advance .
if the surrogate child is born with disability , the intended parents must exercise their parental responsibilities as legal parents .
however , when there is any violation of the statutory requirements for altruistic surrogacy , the surrogate mother may challenge the intended parents parenthood of the surrogate child if she wishes to be the legal mother of the child . in that case , the courts need to determine which party should obtain parenthood of the surrogate child according to the best interest of the child .
fifth , chinese law needs to give special concern and protection to the surrogate child and the surrogate mother .
no matter whether the surrogate child is conceived and born of an approved surrogacy arrangement , he has the right to identity and the right to access to the information about his parentage and circumstance of his birth after he reaches a certain age and receives proper counseling .
the law also needs to protect the surrogate mother 's body integrity , and autonomy , and exempt her from contractual liabilities if she decides to legally terminate the pregnancy ; although she may be required to return the payment of expenses to the intended parents if she terminates the pregnancy on non - medical grounds .
as the above case study showed , the legal issues in surrogacy litigation mainly include validity of surrogacy contract , parenthood of the surrogate child , and sole care and control and visitation of the surrogate child .
as chinese law has no specific rules governing surrogacy , the courts have applied the relevant general rules to them .
however , the courts have presented different views on these issues and seldom provided clear reasoning .
some of the judicial views are arguably inconsistent with the existing law . at the moment
, it is necessary for the courts to better understand the issues involved in surrogacy lawsuits , and correctly and consistently apply the existing rules to them , thus providing the certainty and consistency of law to all interested parties in surrogacy . in the long run , chinese law needs to establish a set of systematic regulations governing surrogacy because surrogacy is never a question of freedom of will and should not be governed merely by the rules of contract law .
therefore , chinese law needs not only to provide certain and consistent legal solutions to the disputed issues arising from surrogacy , but also incorporate both substantive and procedural legal safeguards to protect the paramount interests of the surrogate child and better balance those of the surrogate mother and the intended parents .
a satisfactory regulation of surrogacy will minimize the potential for surrogacy disputes and enhance the confidence of the public in the law of surrogacy in china . | ### Summary:
: chinese law neither generally prohibits nor expressly permits surrogacy .
as there has been a massive underground surrogacy market in the country , surrogacy lawsuits have occurred from time to time .
chinese courts are called to decide a number of disputed issues regarding validity of surrogacy contract , parenthood of the surrogate child , and sole care and control of the surrogate child .
this article examines the judicial solutions to these disputes through a case study , and analyses whether chinese courts have adopted appropriate approaches in applying the existing law to surrogacy lawsuits .
the article further discusses the inadequacies of chinese law in solving surrogacy disputes and regulating surrogacy , and recommends a set of suggestions for improvement so that chinese law may better adapt to the social demand of surrogacy . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: unilateral movement was continuous , choreoathetotic , purposeless , non - stereotyped , and involved the face ( twitching ) and upper and lower extremities .
the movement was distressful to the patient and interfered with her activities of daily living and gait , causing recurrent falls .
she had poorly controlled diabetes for approximately 20 years , and was maintained on oral hypoglycemic agents .
she was not on hormone replacement therapy or any other medications to which these symptoms could be attributed .
there was no family history of movement disorders , and no clinical features suggestive of connective tissue diseases .
apart from the hemichorea involving the left side of the face and upper and lower extremities , her neurological examination was unremarkable ; with normal higher mental function , and normal cranial and sensory nerve examination . on admission , she was hyperglycemic with a random serum glucose of 30.3 mmol / l , ( normal level < 6.5 mmol / l ) ; and her glycosylated hemoglobin was 13.5% , normal level=4 - 6% .
mmol / l , ( normal level=135 - 145 mmol / l ) , but other electrolytes were normal .
her blood count , coagulation profile , liver function tests , vitamin b12 , and thyroid - stimulating hormone were all within normal .
lipid profile showed dyslipidemia ( cholesterol 9.81 mmol / l , triglycerides 4.61 mmol / l , high - density lipoprotein 1.1 mmol / l , and low - density lipoprotein 6.61 mmol / l ) .
further workup reinforced the evidence of poor diabetic control ; her ophthalmologic examination revealed moderate to severe nonproliferative diabetic retinopathy , and her protein to creatinine ratio was 2000 .
non - enhanced brain mri ( figure 1 ) was obtained the next day and demonstrated an area of hyperintensity on t1 weighted images ; involving the left caudate , putamen , and internal globus pallidus .
there was no restriction on diffusion - weighted images ( dwi ) and the apparent diffusion coefficient ( adc ) map was normal . for glycemic control ,
she was started on an insulin regimen ( bedtime insulin glargine and preprandial insulin aspart ) with sitagliptin .
axial mri of the brain a ) axial t1-weighted mri of the brain showing right striatal increased signal intensity including right putamen , globus pallidus , and head of caudate .
initially she was treated with lorazepam ( 2 - 6 mg / day ) to control her hh .
while lorazepam improved the quality of her sleep , it had no effect on the chorea in her waking hours .
valproic acid ( 400 mg / day ) had no clear effect on chorea and was discontinued due to intolerance .
she was then given haloperidol ( gradually titrated from 1 mg / day to 8 mg / day ) and clonazepam ( titrated from 1.5 mg / day to 6 mg / day ) .
she showed clinical improvement after a few days with improvement in her daily activities and gait .
initially , there was more improvement in her lower extremities than upper extremities and the face over a period of 2 weeks .
however , she achieved a satisfactory glycemic control , with a fasting serum glucose ranging from 6 to 7.8 mmol / l . with the initiation of neuroleptics and the glycemic control ,
three months later , she was in stable condition and had no recurrence of chorea .
several studies2,3,5,6 investigated the triad of hemichorea or hemichorea / hemiballism , non - ketotic hyperglycemia , and striatal hyperintensity , and have suggested a new syndrome.3 patients suffering from hh share common clinicoradiologic features . in examining this saudi patient , we regarded this as a case of hh due to the unilateral choreoathetotic movement , hyperglycemia on presentation with poor glycemic control , and absent urine ketones , contralateral ti hyperintensity in the basal ganglia with no restriction on the adc map , and the absence of other metabolic derangements .
the average age of onset ranges from 64 to 82 years.3 earlier case reports of hh suggested prevalence in females,4 but literature reviews indicate equal male to female incidence,3,5 which emphasizes the importance of accumulating case reports to better understand epidemiological characteristics .
the patient in this study falls into the typical gender and age group for hh .
abnormal movements usually involve one side of the body , but a few patients with bilateral movements were reported.6,7 some patients were newly diagnosed diabetics , and their hh was the first manifestation of the disorder.3,4 others , as in our patient , had longstanding diabetes.3,5,8,9 hyperglycemic hemichorea has a good prognosis and hemichorea rapidly ceases over a few days to weeks , after restoring glycemic levels with insulin only.3,5,8 there is enough evidence to speculate that radiological changes are also reversible .
patients who had follow - up imaging studies showed resolution of changes on ct within 2 - 3 months and on mri within 6 - 11 months.3 however , a minority of cases had a different course .
some patients did not improve on insulin alone , and required either short or long courses of additional pharmacologic therapies .
ahlskog et al,4 and others reported cases with hyperglycemic dyskinesia that persisted as long as the patients were followed , 6 months up to 5 years , with patients showing no or slight improvement .
these persisted despite the normalization of blood glucose and the use of pharmacologic agents.4,7 recurrence of symptoms after drug discontinuation was also reported in the literature.7 a few patients responded very poorly to all therapeutic measures and eventually died of secondary medical complications.6,10 several neuroleptic and anti - epileptic agents were cited in the literature to control hh .
haloperidol ( 1 - 15 mg / day ) frequently showed good efficacy in managing hh,2 - 4,9 but dose escalation in refractory patients can be limited by side effects , such as tardive dyskinesia or hemiparkinsonism.7 moreover , risperidone ( 3 mg / day ) may be effective.4 the response to valproic acid was inconsistent .
trials of lorazepam,10 chlorpromazine ( 12.5 mg / day ) , clonazepam ( 5 mg / day ) , reserpine ( 1.5 mg / day),8 and tetrabenazine ( 50 mg / day)2 lacked sufficient evidence of their effectiveness .
trihexyphenidyl ( 6 mg / day ) , olanzapine , perphenazine , and biperiden were of no benefit.7,9 our experience supports the effectiveness of haloperidol , and the potential effectiveness of clonazepam while discouraging the use of lorazepam .
in addition to the distinctive clinical features of hh , it has characteristic findings on brain imaging .
brain mri gives a high - signal intensity on t1 images and normal- to low - signal intensity on t2 images.4 these observations align with the imaging findings in our patient .
gradient echo images , dwi , and adc maps are usually normal,4,5 susceptibility weighted imaging ( swi ) is sensitive to blood products similar to blood oxygen level - dependent imaging . in cases of hypo perfusion of brain tissue ,
local vasodilation occurs in the ischemic tissues , which leads to increased extraction of oxygen and increased amount of deoxyhemoglobin in venous blood in that region .
as deoxyhemoglobin is paramagnetic , it shows prominent hypointense signal on swi , and can be detected as hypointense venous vessels in the affected area.2 additional insights are gained by more sophisticated imagining modalities .
magnetic resonance spectroscopy shows a decreased n - acetyl aspartate peak , which indicates a neuronal dysfunction or loss resulting from metabolic failure or hypoperfusion.6 positron emission tomography demonstrates reduced fluorodeoxyglucose ( fdg ) uptake in the corresponding basal ganglia , especially when performed later in the course of the illness,8 while showing increased fdg metabolism when performed earlier.9 similarly , single photon emission computed tomography ( spect ) studies show either increased8 or decreased cerebral perfusion of the affected stratum .
this discrepancy , as noted by hsu et al,8 may be secondary to changes of cerebral vascular autoregulation or to the different stages of the pathological process at which the spect studies were carried out .
several sound hypotheses have been proposed to explain the neuroimaging findings of such cases : mineralization , hyperosmolar insult , petechial hemorrhages , gliosis , transient ischemia , manganese accumulation , and gamma - amino butyric acid ( gaba ) transmission alteration .
the reversibility of neuroimaging findings on follow - up studies rules out calcification as a possible cause .
gamma - amino butyric acid deficiency in the basal ganglia as a result of its consumption as an energy substrate during hyperglycemia has been suggested.9 this fails to explain the unilaterality of symptoms and its persistence in some patients , as in this case study , beyond the hyperglycemic episode.7 several authors6,10 suggested that striatal petechial hemorrhage is the etiologic mechanism for hh and its t1 hyperintensity .
only one histopathological autopsy report6 mentions hemosiderin deposits in a patient with hh , whereas another report10 describes microhemorrhages .
these microhemorrhages supposedly result from hyperglycemia - induced blood brain barrier dysfunction . however , several observations are difficult to reconcile with this hypothesis : lesions frequently respected anatomic borders , t2 images are not hyperintense , and imaging evolution over time is not typical for bleeds.7 histopathological studies of cases with hh have heterogenous results , demonstrating infarcts , microhemorrhages , gliosis , and mineralization.10 nevertheless , they all have gemistocytic gliosis as a common findings .
fujioka et al,5 experimentally reproduced similar striatal t1 hyperintensities and t2 hypointensities in rats by means of brief focal ischemia , which showed matching histological finding to cases of hh : selective neuronal death and astrocytosis rather than infarcts or bleeds . while the definite mechanism is still debated , it is fair to assume that a combination of the aforementioned processes is responsible for hh.7 due to microangiopathy , diabetics , especially poorly controlled diabetics , are predisposed to vascular ischemia , especially during a hyperglycemic crisis .
a partial ischemic injury may cause selective neuronal death and gemistocytosis , interrupting striatal gabaergic transmission , disinhibiting the thalamus , and leading to abnormally excessive movement . in conclusion , diabetics are susceptible to hh , which is associated with t1 mri hyperintensity .
clinicians should recognize this unique syndrome early as it is treatable with normalization of blood glucose . for patients who do not improve on insulin alone ,
we see a good therapeutic role for haloperidol , and a potential role for clonazepam . further research is needed to elucidate the underlying pathophysiology of hh . | ### Summary:
: hemichorea is a disorder characterized by abnormal , continuous , nonrhythmic , jerky , and distal movement involving one side of the body .
it may result from cerebrovascular insult to basal ganglia , or from other causes including neoplasm , infection , and non - ketotic hyperglycemia .
we report the clinical , laboratory , and neuroimaging data with treatment response of a saudi woman who has diabetes with left side hemichorea , involving the face , and upper and lower extremities , with unilateral right striatal hyperintense signal changes in t1 weighted mri , and a hyperglycemic state of longstanding uncontrolled diabetes .
literature review suggested a syndrome with a triad of symptoms : non - ketotic hyperglycemia , hemichorea , and t1 mri striatal hyperintensities .
as the number of internationally reported cases is still modest , reporting more patients will highlight aspects pertaining to the diagnosis and treatment of this condition .
we present a patient who had a sustained therapeutic result from haloperidol and clonazepam . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: bacterial infectious keratitis is a sight - threatening disease and one of the leading causes of blindness throughout the world.1 due to the large spectrum of possible microorganisms , its treatment requires a combination of topical fortified antibiotics.2 fluoroquinolones , mainly the 8-methoxyfluoroquinolones , gatifloxacin and moxifloxacin , have shown effectiveness as monotherapy.2 however , the eminent risk of widespread resistance3,4 induced by inappropriate treatment has stimulated a growing interest in new antibacterial strategies .
nitric oxide ( no ) is an endogenous molecule that gained notoriety at the end of the 1980s after the discovery of its effects on smooth muscle relaxation , vasodilatation , and vascular pressure flow control.5 in the eye , no has been shown to be a key regulator of vascular tone in the ophthalmic arteries6 involved with increasing blood flow to the retina , choroid , and the optic nerve head.7,8 beyond control of vascular tone , no was shown to be involved in several bioregulatory systems in the human body , including modulation of the immune response9 and toxicity of macrophages toward neoplastic cells10 and pathogens.9,11 under physiologic conditions , no reacts with thiol - containing molecules such as glutathione to form s - nitrosothiols ( rsnos ) , which are considered to be no carriers and donors in humans.12 the no - mediated antimicrobial activity of rsnos has been demonstrated against several pathogens , including protozoa and bacteria.1315 s - nitrosoglutathione ( gsno ) and s - nitroso - n - acetylcysteine ( snac ) have also been shown to have potent antimicrobial activity against trophozoites of acanthamoeba castellanii , the etiological agent responsible for devastating sight - threatening keratitis.16 these data suggest that no donors are important candidates for treating infectious eye diseases .
although many studies have carried out microbiological tests with bacteria at neutral ph,14,15 the bactericidal activity of reactive nitrogen intermediates seems to be remarkable in lower ph environments.17,18 the aim of the present study was to evaluate the antimicrobial activity of two rsnos , ie , gsno and snac , against clinical bacterial strains isolated from patients with infectious keratitis .
glutathione ( -glu - cys - glu ) , n - acetyl - cysteine , sodium nitrite ( nano2 ) , hydrochloric acid ( hcl ) , sodium hydroxide ( naoh ) , phosphate buffer , and acetone were purchased from sigma ( st louis , mo ) and used as received .
cation - adjusted mueller - hinton broth ( camhb ) and tryptic soy agar were purchased from oxoid ( basingstoke , england ) .
gsno and snac were synthesized as previously described.13 gsno was stored at freezer temperature ( 20c ) and protected from light . freshly prepared stock acidic snac solution was diluted in phosphate - buffered saline ( ph 7.4 ) in order to obtain 80.0 mm solutions and was used immediately .
the final ph values of both solutions were adjusted to 5.0 , 6.0 , and 7.0 by titration with diluted hcl and naoh solutions and measured using a ph meter ( hanna instruments , ann arbor , mi ) .
decomposition levels for gsno and snac incubated in camhb at 37c and at phs 5.0 , 6.0 , and 7.0 were characterized by monitoring the absorption band of gsno and snac at 336 nm assigned to the sno moiety with a diode - array spectrophotometer ( hp-8453 , hewlett - packard , palo alto , ca ) in a 1 mm optical path cuvette .
gsno and snac solutions , previously dissolved in phosphate - buffered saline at ph 7.4 , were added to the culture medium to achieve a final concentration of 40.0 mm .
the ph of the medium was further adjusted to the desired values by addition of 1 m naoh or hcl solutions .
spectra of the solutions in the culture medium were taken at 2 , 3 , 5 , 7 , and 24 hours .
the remaining concentrations of the gsno and snac solutions were calculated on the basis of their molar absorption coefficients .
the bacteria used in this study were randomly selected from 222 clinical isolates from patients with infectious keratitis seen at the department of ophthalmology of federal university of so paulo and enrolled from january to december 2009 .
fifty - two ( 23.4% ) clinical isolates , including 14 ( 26.9% ) pseudomonas species , 13 ( 25.0% ) coagulase - negative staphylococci , 10 ( 19.2% ) staphylococcus aureus , nine ( 17.3% ) serratia marcescens , and six ( 11.5% ) enterobacter aerogenes were recovered twice on blood sheep agar ( 5% ) from the ocular microbiology laboratory culture collection ( tryptic soy broth , 15% glycerol ) .
american type culture collection ( atcc ) s. aureus 29213 , staphylococcus epidermidis 12228 , pseudomonas aeruginosa 27853 , and e. aerogenes 13048 strains were also included .
harvested colonies ( 35 ) from fresh and pure cultures were inoculated in 5 ml of camhb and incubated at 37c for 34 hours .
the bacterial suspension was adjusted to a 0.5 mcfarland standard ( about 1.5 10 cfu / ml ) using a baxter digital turbidimeter ( sacramento , ca ) . in order to investigate the influence of ph on the antibacterial activity of gsno and snac , four atcc strains , s. aureus 29213 , s. epidermidis 12228 , p. aeruginosa 27853 , and
e. aerogenes 13048 , were tested by broth microdilution using camhb with adjusted ph values of 5.0 , 6.0 , and 7.0 .
the minimum inhibitory concentrations ( mic ) of both compounds were determined by reference broth microdilution , according to the clinical laboratory standard institute.19 the final concentrations of gsno and snac tested ranged from 40.0 mm to 0.31 mm .
each experiment was carried out using properly sterile broth controls and controls for bacterial growth in camhb without drug .
after incubation , the wells were examined and the mic values ( the lowest concentration without visible growth ) were assessed .
reference broth microdilution assays were performed to determine the mic of gsno and snac against 52 keratitis isolates as previously described,19 using camhb adjusted at a final ph of 5.0 ( based on the results of the preliminary test against atcc strains ) .
the final concentrations of gsno and snac tested ranged from 40.0 mm to 0.31 mm .
sterile broth controls and controls for bacterial growth in camhb without drug were also included .
in addition , glutathione and n - acetyl - cysteine were also incubated with the atcc strains in order to determine their possible antibacterial activity .
minimum bactericidal concentration ( mbc ) values were determined for both the atcc strains ( tested at three ph values ) and clinical isolates .
the contents of each well showing an inhibitory effect on the broth microdilution assay were assessed for viable bacteria by plating the contents of the wells onto tryptic soy agar plates .
after overnight incubation , the bacterial colony was counted to determine the mbc ( the lowest concentration showing 99.9% killing ) .
the mic and mbc values of each genus of bacterium were expressed as the mean standard deviation , mic and mbc 50% and 90% , and mbc : mic ratio .
the kruskal - wallis test was used to identify differences in the percentage of molecular remnants after 24 hours at the three different ph levels .
analysis of variance was used to compare the means of mic and mbc at the three different ph values , and the tukey - kramer statistical test was used in conjunction with analysis of variance for pairwise comparisons .
comparisons between mic or mbc for gsno and snac against the clinical isolates were analyzed using the paired - samples t - test .
glutathione ( -glu - cys - glu ) , n - acetyl - cysteine , sodium nitrite ( nano2 ) , hydrochloric acid ( hcl ) , sodium hydroxide ( naoh ) , phosphate buffer , and acetone were purchased from sigma ( st louis , mo ) and used as received .
cation - adjusted mueller - hinton broth ( camhb ) and tryptic soy agar were purchased from oxoid ( basingstoke , england ) .
gsno and snac were synthesized as previously described.13 gsno was stored at freezer temperature ( 20c ) and protected from light . freshly prepared stock acidic snac solution was diluted in phosphate - buffered saline ( ph 7.4 ) in order to obtain 80.0 mm solutions and was used immediately .
the final ph values of both solutions were adjusted to 5.0 , 6.0 , and 7.0 by titration with diluted hcl and naoh solutions and measured using a ph meter ( hanna instruments , ann arbor , mi ) .
decomposition levels for gsno and snac incubated in camhb at 37c and at phs 5.0 , 6.0 , and 7.0 were characterized by monitoring the absorption band of gsno and snac at 336 nm assigned to the sno moiety with a diode - array spectrophotometer ( hp-8453 , hewlett - packard , palo alto , ca ) in a 1 mm optical path cuvette .
gsno and snac solutions , previously dissolved in phosphate - buffered saline at ph 7.4 , were added to the culture medium to achieve a final concentration of 40.0 mm .
the ph of the medium was further adjusted to the desired values by addition of 1 m naoh or hcl solutions .
spectra of the solutions in the culture medium were taken at 2 , 3 , 5 , 7 , and 24 hours .
the remaining concentrations of the gsno and snac solutions were calculated on the basis of their molar absorption coefficients .
the bacteria used in this study were randomly selected from 222 clinical isolates from patients with infectious keratitis seen at the department of ophthalmology of federal university of so paulo and enrolled from january to december 2009 .
fifty - two ( 23.4% ) clinical isolates , including 14 ( 26.9% ) pseudomonas species , 13 ( 25.0% ) coagulase - negative staphylococci , 10 ( 19.2% ) staphylococcus aureus , nine ( 17.3% ) serratia marcescens , and six ( 11.5% ) enterobacter aerogenes were recovered twice on blood sheep agar ( 5% ) from the ocular microbiology laboratory culture collection ( tryptic soy broth , 15% glycerol ) .
american type culture collection ( atcc ) s. aureus 29213 , staphylococcus epidermidis 12228 , pseudomonas aeruginosa 27853 , and e. aerogenes 13048 strains were also included .
harvested colonies ( 35 ) from fresh and pure cultures were inoculated in 5 ml of camhb and incubated at 37c for 34 hours .
the bacterial suspension was adjusted to a 0.5 mcfarland standard ( about 1.5 10 cfu / ml ) using a baxter digital turbidimeter ( sacramento , ca ) .
in order to investigate the influence of ph on the antibacterial activity of gsno and snac , four atcc strains , s. aureus 29213 , s. epidermidis 12228 , p. aeruginosa 27853 , and e. aerogenes 13048 , were tested by broth microdilution using camhb with adjusted ph values of 5.0 , 6.0 , and 7.0 .
the minimum inhibitory concentrations ( mic ) of both compounds were determined by reference broth microdilution , according to the clinical laboratory standard institute.19 the final concentrations of gsno and snac tested ranged from 40.0 mm to 0.31 mm . the plates were sealed and incubated at 37c for 24 hours .
each experiment was carried out using properly sterile broth controls and controls for bacterial growth in camhb without drug .
after incubation , the wells were examined and the mic values ( the lowest concentration without visible growth ) were assessed .
reference broth microdilution assays were performed to determine the mic of gsno and snac against 52 keratitis isolates as previously described,19 using camhb adjusted at a final ph of 5.0 ( based on the results of the preliminary test against atcc strains ) .
the final concentrations of gsno and snac tested ranged from 40.0 mm to 0.31 mm .
sterile broth controls and controls for bacterial growth in camhb without drug were also included .
in addition , glutathione and n - acetyl - cysteine were also incubated with the atcc strains in order to determine their possible antibacterial activity .
minimum bactericidal concentration ( mbc ) values were determined for both the atcc strains ( tested at three ph values ) and clinical isolates .
the contents of each well showing an inhibitory effect on the broth microdilution assay were assessed for viable bacteria by plating the contents of the wells onto tryptic soy agar plates .
, the bacterial colony was counted to determine the mbc ( the lowest concentration showing 99.9% killing ) .
the mic and mbc values of each genus of bacterium were expressed as the mean standard deviation , mic and mbc 50% and 90% , and mbc : mic ratio .
the kruskal - wallis test was used to identify differences in the percentage of molecular remnants after 24 hours at the three different ph levels .
analysis of variance was used to compare the means of mic and mbc at the three different ph values , and the tukey - kramer statistical test was used in conjunction with analysis of variance for pairwise comparisons .
comparisons between mic or mbc for gsno and snac against the clinical isolates were analyzed using the paired - samples t - test .
figure 1 shows the kinetic curves for gsno and snac decomposition in camhb at 37c and at phs 5.0 , 6.0 , and 7.0 over 24 hours in a normalized arbitrary unity scale , based on their absorption bands .
after 24 hours , variation of ph in the range 57 did not lead to significant changes in the extent of decomposition of either gsno ( 22.9% 2.3% , p = 0.964 ) or snac ( 17.2% 2.9% , p = 0.115 ) .
the graph bars of the inset show the quantification of the remaining amounts of gsno and snac after their incubation in these conditions for 24 hours .
gsno and snac had significantly more antibacterial activity against atcc strains when tested at ph 5.0 in comparison with phs 6.0 and 7.0 ( p < 0.05 ) . however , there was no difference between the results obtained at phs 6.0 and 7.0 ( p > 0.05 ) .
table 1 shows the mic and mbc values for gsno and snac against the atcc strains at the three different ph levels .
snac showed lower mic and mbc values than gsno for all the different clinical isolates from patients with infectious keratitis .
mic values for snac ranged from < 0.3 to 5.0 mm , with mic50 and mic90 values of 2.5 and 5.0 mm , respectively , while mic values for gsno ranged from < 0.3 to 20.0 mm , with mic50 and mic90 values of 10.0 and 20.0 mm , respectively .
mbc values for snac ranged from 1.25 to 20.0 mm , with mbc50 and mbc90 values of 5.0 and 10.0 mm , respectively , while mbc values for gsno ranged from 0.6 to 40.0 mm , with mbc50 and mbc90 values of 40.0 and 40.0 mm , respectively .
these figures imply mean mic values of 2.8 1.5 mm for snac and 9.0 6.0 mm for gsno ( p < 0.01 ) , and mean mbc values of 7.2 3.8 mm for snac and 24.3 11.4 mm for gsno ( p < 0.01 , tables 2 and 3 ) .
the same higher bactericidal efficacy of snac relative to gsno was observed when analyzing the mic and mbc values on the basis of gram staining . for gram - positive bacteria ,
the mic mean values for snac and gsno were 2.1 1.3 and 4.6 3.2 mm and the mbc mean values were 8.6 3.8 and 21.5 12.5 mm , respectively ( p < 0.01 ) .
for gram - negative bacteria , the mean mic values of snac and gsno were 3.3 1.4 and 12.4 5.4 mm and the mbc mean values were 6.1 3.4 and 26.5 10.1 mm , respectively ( p < 0.01 , tables 2 and 3 ) . the overall mbc : mic ratio was 8 in 100% of all isolates tested for snac and 94.2% for gsno .
the mbc : mic ratio for snac was 4 in 65.2% and 8 in 100% of gram - positive isolates and 4 in 100% of gram - negative isolates .
the mbc : mic ratio for gsno was 4 in 52.2% and 8 in 87% of gram - positive isolates and 4 in 93.1% and 8 in 100% of gram - negative isolates . only one s. aureus isolate showed an mbc : mic ratio of 32 for gsno , indicating tolerance .
snac also led to lower mic and mbc values against atcc s. aureus , p. aeruginosa , and e. aerogenes strains at ph 5.0 compared with gsno . on the other hand , gsno but not snac , displayed lower mic and mbc values against the atcc s. epidermidis strain ( table 1 ) .
glutathione and n - acetyl - cysteine did not show any inhibitory or bactericidal effect for any of the atcc strains tested , demonstrating that the antimicrobial effect observed is mediated by free no released from the rsno molecules or by the sno moiety of these molecules in their intact forms .
sterility control wells showed no contamination ( all wells showing no visible growth and no colony was examined on the tryptic soy agar plates ) and bacterial growth control wells showed adequate growth conditions ( all wells showing visible turbidity and full colony formation were examined on the tryptic soy agar plates ) .
figure 1 shows the kinetic curves for gsno and snac decomposition in camhb at 37c and at phs 5.0 , 6.0 , and 7.0 over 24 hours in a normalized arbitrary unity scale , based on their absorption bands .
after 24 hours , variation of ph in the range 57 did not lead to significant changes in the extent of decomposition of either gsno ( 22.9% 2.3% , p = 0.964 ) or snac ( 17.2% 2.9% , p = 0.115 ) .
the graph bars of the inset show the quantification of the remaining amounts of gsno and snac after their incubation in these conditions for 24 hours .
gsno and snac had significantly more antibacterial activity against atcc strains when tested at ph 5.0 in comparison with phs 6.0 and 7.0 ( p < 0.05 ) . however , there was no difference between the results obtained at phs 6.0 and 7.0 ( p > 0.05 ) .
table 1 shows the mic and mbc values for gsno and snac against the atcc strains at the three different ph levels .
snac showed lower mic and mbc values than gsno for all the different clinical isolates from patients with infectious keratitis .
mic values for snac ranged from < 0.3 to 5.0 mm , with mic50 and mic90 values of 2.5 and 5.0 mm , respectively , while mic values for gsno ranged from < 0.3 to 20.0 mm , with mic50 and mic90 values of 10.0 and 20.0 mm , respectively .
mbc values for snac ranged from 1.25 to 20.0 mm , with mbc50 and mbc90 values of 5.0 and 10.0 mm , respectively , while mbc values for gsno ranged from 0.6 to 40.0 mm , with mbc50 and mbc90 values of 40.0 and 40.0 mm , respectively .
these figures imply mean mic values of 2.8 1.5 mm for snac and 9.0 6.0 mm for gsno ( p < 0.01 ) , and mean mbc values of 7.2 3.8 mm for snac and 24.3 11.4 mm for gsno ( p < 0.01 , tables 2 and 3 ) . the same higher bactericidal efficacy of snac relative to gsno was observed when analyzing the mic and mbc values on the basis of gram staining . for gram - positive bacteria ,
the mic mean values for snac and gsno were 2.1 1.3 and 4.6 3.2 mm and the mbc mean values were 8.6 3.8 and 21.5 12.5 mm , respectively ( p < 0.01 ) .
for gram - negative bacteria , the mean mic values of snac and gsno were 3.3 1.4 and 12.4 5.4 mm and the mbc mean values were 6.1 3.4 and 26.5 10.1 mm , respectively ( p < 0.01 , tables 2 and 3 ) . the overall mbc : mic ratio was 8 in 100% of all isolates tested for snac and 94.2% for gsno .
the mbc : mic ratio for snac was 4 in 65.2% and 8 in 100% of gram - positive isolates and 4 in 100% of gram - negative isolates .
the mbc : mic ratio for gsno was 4 in 52.2% and 8 in 87% of gram - positive isolates and 4 in 93.1% and 8 in 100% of gram - negative isolates . only one s. aureus isolate showed an mbc : mic ratio of 32 for gsno , indicating tolerance .
snac also led to lower mic and mbc values against atcc s. aureus , p. aeruginosa , and e. aerogenes strains at ph 5.0 compared with gsno . on the other hand , gsno but not snac , displayed lower mic and mbc values against the atcc s. epidermidis strain ( table 1 ) .
glutathione and n - acetyl - cysteine did not show any inhibitory or bactericidal effect for any of the atcc strains tested , demonstrating that the antimicrobial effect observed is mediated by free no released from the rsno molecules or by the sno moiety of these molecules in their intact forms .
sterility control wells showed no contamination ( all wells showing no visible growth and no colony was examined on the tryptic soy agar plates ) and bacterial growth control wells showed adequate growth conditions ( all wells showing visible turbidity and full colony formation were examined on the tryptic soy agar plates ) .
although numerous studies have documented the bactericidal action of rsnos against several bacteria responsible for gastrointestinal,14 urinary,15 and respiratory17,18 diseases , each microorganism has a particular pathogenic mechanism and tissue relationship .
the present study involving specific causative agents of keratitis confirmed the antimicrobial action of snac and gsno against bacteria responsible for this pathologic condition , indicating that such no donors might be useful for the topical treatment of ocular infections .
previous studies have demonstrated that no , a transitory free radical , can directly inhibit bacterial respiratory chain proteins20,21 and disrupt iron - sulfur clusters in bacterial proteins , forming free iron radicals that catalyze toxic oxidative reactions.22,23 iron depletion can also be induced by interaction of no with metalloenzymes .
moreover , nitrosylation of free thiol groups may result in inactivation of metabolic enzymes.24 reactive nitrogen intermediates can also react with heme groups , phenol , or aromatic amino acid residues , thereby inactivating the actions of proteins.25 additionally , reactive nitrogen intermediates can react with a tyrosyl radical in the ribonucleotide reductase enzyme or with metalloproteins , leading to inhibition of bacterial dna replication.26,27 deamination , strand breaks , and basic sites are other dna alterations induced by no - mediated oxidative damage.28 considering that many targets of no - mediated antimicrobial actions are intracellular , it is possible that the outer lipopolysaccharide bilayer membrane of gram - negative bacteria works as a barrier , avoiding the penetration of reactive nitrogen intermediates and protecting them from the inhibitory and bactericidal effect of no donors in lower concentrations . in spite of their potential therapeutic applications ,
previous studies performed to evaluate the ocular hypotensive effect of other topical no donors , like sodium nitroprusside and s - nitroso - n - acetylpenicillamine , have reported no adverse effects in the concentration range 12 mm.29,30 our laboratory undertook a preliminary study to investigate the ocular toxicity of topical instillation of gsno and snac at concentrations up to 10.0 mm ( based initially on results for acanthamoeba16 ) , which did not show signs of ocular toxicity in either ex vivo and in vivo assays.31 except for mild and transient conjunctival hyperemia , no other adverse effects were observed .
although the toxic effects in higher concentrations are not known , it is interesting to note that in the present study the inhibitory and bactericidal effect of snac against all clinical isolates and the inhibitory effect of gsno against all gram - positive and pseudomonas isolates were obtained in concentations under 10 mm .
previous studies have observed greater bactericidal activity of reactive nitrogen intermediates at ph 5.0 compared with ph 7.0.17,18 similarly , the present study shows remarkable antibacterial activity of gsno and snac at ph 5.0 in comparison with phs 6.0 and 7.0 .
it has been suggested that , in acidic conditions , bactericidal actions due to no may be associated with its oxidation to nitrite ( no2 ) followed by nitrous acid formation and other reactive nitrogen intermediates.17,18 this might be the situation found inside phagosomes of activated macrophages which are supposed to be critical for the antibacterial action of reactive nitrogen intermediates . in order to ensure the bactericidal effect of rsnos in a possible clinical setting , a weak acid , such as citric or boric acid ,
since the 1960s , 2% boric acid ( orthoboric acid , h3bo3 ) solution has been recommended as a general ophthalmic vehicle , with a ph of about 4.7,32 and it has been used as a preservative or drug enhancer for various eye drops , including antiglaucomatous and ocular decongestant drugs.33,34 moreover , it has been shown that boric acid has a mild antiseptic action35 and can improve the corneal penetration of some ophthalmic agents.36 the thermal stability of primary rsnos is a common concern regarding their clinical application .
measurements of spontaneous thermal decomposition of gsno and snac under the same incubation conditions as those used for the control strains at phs 5.0 , 6.0 , and 7.0 over 24 hours ( figure 1 ) showed that both rsnos undergo decomposition of 22.9% 2.7% ( gsno ) and 17.2% 1.0% ( snac ) after 24 hours .
therefore , the remaining concentrations of gsno and snac after 24 hours are still very high and in the millimolar range , what is well above the cytotoxic levels previously observed to kill leishmania major and leishmania amazonensis13 ( ic50 in the range 54.6161 m ) and trophozoites of acanthamoeba castellanii16 ( 5001000 m ) in vitro . therefore , if the bactericidal actions are due to intact rsno molecules , we can assume that the incubation media were exposed to high rsno concentrations over the 24-hour incubation period .
on the other hand , free no release due to 17.2%22.9% decomposition rate is also a possible factor contributing to the bactericidal action observed . in this sense
, a combined action of intact gsno and snac and free no may operate to promote the observed antimicrobial actions .
in addition to therapeutic topical ocular instillation of gsno and snac , the antimicrobial effect of these compounds could be helpful as a component of contact lens care systems and medical disinfection solutions .
however , further studies are necessary to characterize the ocular toxicity , the in vivo effect in infectious keratitis , and the possible mechanisms involved in the bactericidal actions of these rsnos .
gram - positive bacteria were more susceptible to the inhibitory and bactericidal effects of the s - nitrosothiols . | ### Summary:
: backgroundthe purpose of this study was to evaluate the antimicrobial activity of two nitric oxide donors , ie , s - nitrosoglutathione ( gsno ) and s - nitroso - n - acetylcysteine ( snac ) , against clinical isolates from patients with infectious keratitis.methodsreference broth microdilution assays were performed to determine the minimum inhibitory and bactericidal concentrations for gsno and snac against four american type culture collection strains and 52 clinical isolates from patients with infectious keratitis as follows : 14 ( 26.9% ) pseudomonas species ; 13 ( 25.0% ) coagulase - negative staphylococci ; 10 ( 19.2% ) staphylococcus aureus ; nine ( 17.3% ) serratia marcescens ; and six ( 11.5% ) enterobacter aerogenes .
sterility control and bacterial growth control were also performed.resultssnac showed lower minimum inhibitory and bactericidal concentrations than gsno for all clinical isolates from patients with infectious keratitis . for gram - positive bacteria , mean
minimum inhibitory and bactericidal concentrations were 2.1 1.3 and 8.6 3.8 mm for snac and 4.6 3.2 and 21.5 12.5 mm for gsno ( p < 0.01 ) . for gram - negative bacteria , mean
minimum inhibitory and bactericidal concentrations were 3.3 1.4 and 6.1 3.4 mm for snac and 12.4 5.4 and 26.5 10.1 mm for gsno ( p < 0.01 ) .
the minimum bactericidal to inhibitory concentration ratio was 8 in 100% of all isolates tested for snac and in 94.2% tested for gsno.conclusionssnac and gsno had effective inhibitory and bactericidal effects against bacterial isolates from keratitis .
snac showed greater antimicrobial activity than gsno against all bacteria .
gram - positive bacteria were more susceptible to the inhibitory and bactericidal effects of the s - nitrosothiols . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: orotracheal and nasotracheal intubations are the preferred procedures for airway maintenance in maxillofacial trauma patients .
panfacial trauma , which involves occlusion or nasoethmoidal complex fracture with or without skull base fractures , needs to be attended to simultaneously .
however , when there is a nasal bone fracture , nasotracheal intubation might not be ideal .
orotracheal intubation is also not suitable when surgeons must determine or correct the occlusion intraoperatively . in the above situations that might require intraoperative change from a nasotracheal tube to an orotracheal one
, it also has significant complications . in 1986 , hernndez altemir1 proposed submental intubation as a simple method of airway maintenance that facilitates the simultaneous treatment of all maxillofacial fractures without any interference to the tube during the operation .
this procedure permits intraoperative occlusal corrections and also allows the surgery to address any associated nasoethmoid fractures .
submental intubation is one of the safest and simplest procedures , unlike tracheostomy , that requires technical expertise .
it can also be executed within a short time with minimal complications and is the most cost - effective technique for complex maxillofacial injury patients2 . here , we present our experience of submental intubation in five cases of panfacial trauma with fractures of the mandible , maxilla , or zygomatic bone with occlusal derangement , requiring intraoperative occlusal adjustments and corrections , and also with nasal bone fracture that needed to be addressed simultaneously .
patients who were anticipated to be difficult intubations and those with problems opening their mouths were not included in our study .
our aim is to evaluate the safety and usefulness of a submental intubation technique for panfacial trauma surgery , to present our experience , and to advocate this technique as an ideal alternate procedure to classic tracheostomy for certain indicated panfacial trauma patients .
all patients with a history of road traffic accident were referred to our department of dentistry at esic medical college and postgraduates institute of medical sciences and research ( pgimsr ) ( chennai , india ) from the regular outpatient department . after a thorough history was taken and clinical and radiographic examinations were performed , patients with more than one bone fracture were classified as having panfacial trauma .
patients with occlusal derangement and nasal bone fracture were scheduled for open reduction and internal fixation under general anesthesia using submental intubation .
a flexometallic endotracheal tube with a detachable universal connector was used . the necessary airway with adjuncts , crash cart , intubation aids were readied prior to induction .
the tube and connectors were disconnected and verified in order to help us easily remove them when changing the tube from intra - oral to extra - oral through the submental route .
the landmarks for the skin incisions were placed below the commissure of the mouth and directly below the lower border of the mandible at the para - median region . local anesthetic ( 2 ml of 2% lignocaine with adrenalin 1:200,000 )
blunt dissection was carried out through the subcutaneous tissue , platysma with heavy artery forceps , and passed through the mylohyoid muscles.(fig .
2 ) while traversing these muscles , the forceps should always be in contact with the lingual surface of the mandible .
one finger was kept inside the oral cavity to feel the tip of the artery forceps .
when the forceps reached the mucosa , we could feel the tip of the artery forceps and noticed blanching of the mucosa in the floor of the mouth .
the tip of the artery forceps was positioned away from the sublingual duct and its opening .
an incision was made on the tip . while performing this incision over the mucosa , caution was taken not to injure the submandibular duct and its orifice or the lingual nerve .
the tip of the forceps was opened widely to create a tunnel through which the tube would be passed from the intra - oral to the extraoral side . here , we modified altair 's technique by passing an additional smaller artery forceps along with the main artery forceps .
the patients were ventilated with 100% oxygen for two minutes before disconnecting the endotracheal tube from the connector .
the endotracheal tube was immediately and carefully disconnected from the connector , and the pilot balloon was deflated by the anesthetist and then removed to the extra - oral side using a small artery forceps.(fig .
3 ) next , the proximal end of the tube was removed through the tunnel using a pair of stout artery forceps . with this technique ,
blood or secretions in the pilot balloon were cleaned , and the tube was reconnected with the connector and with the circuit and properly secured with skin sutures.(fig .
separate kits were used for submental intubation and for the main surgical procedure . at this time , the surgeons scrubbed in again and prepared for the main surgery , which was performed without disturbing the tube .
nasal bone fractures were also reduced using closed reduction . the maximum duration for the submental procedure was around 8 to 10 minutes .
the duration of the trauma surgeries was roughly 3 to 5 hours ; the mean duration of surgery was 4 hours and 10 minutes .
the proximal end of the tube was reintroduced into the oral cavity and extubated through the mouth in two patients . for the other three patients ,
the skin wound was sutured with 3 - 0 ethilon ( ethicon , somerville , nj , usa ) .
patients were reviewed on the first , second , and third postoperative days and after one week .
patients were reviewed on the first , second , and third postoperative days and after one week .
in maxillofacial trauma surgery , surgeons have to seek different methods of intubation when surgical access is needed in both the nasal and oral cavities .
nasotracheal and orotracheal intubations are the most frequently used techniques for many maxillofacial trauma surgeries .
maxillofacial trauma patients generally have occlusal derangements , associated nasal bone fractures , and base of the skull bone fractures .
patients with associated nasoethmoid complex fractures might require surgical intervention , such as reduction and fixation , when nasotracheal intubation is contraindicated or poses a significant problem3 .
an alternative technique to managing these types of situations is classical tracheostomy , which also has iatrogenic complications , such as internal emphysema , tracheal stenosis , damage to the laryngeal nerves , tracheoesophagal fistula , and scarring45 .
hernndez altemir1 proposed submental intubation as an alternative method to classic tracheostomy because it facilitates simultaneous access for all maxillofacial fractures without intraoperative interference to the tube .
macinnis and baig6 and agrawal and kang7 advocated for midline intubation as a modification of this technique .
in contrast , rungta8 suggested the technique of retromolar submental intubation for maxillofacial trauma patients .
franco et al.9 reported that submental intubation is an alternative to tracheostomy when nasoendotracheal intubation is unsuccessful .
there are certain indications for submental intubation ; 1 ) the presence of cerebrospinal fluid , rhinorrhea , epistaxis , or nasal bone fracture where nasal intubation is contraindicated , 2 ) panfacial trauma that requires intraoperative occlusal adjustment along with nasoethmoid fracture reduction and fixation , 3 ) basal bone fracture along with any of the above fractures , 4 ) craniomaxillary surgery / orthognathic surgery patient with nasal pathology , 5 ) orthognathic surgery+rhinoplasty / nasal bone corrective surgery , and 6 ) patient with neurological deficit . in addition
, some contraindications are also present ; 1 ) trauma patient who might require a long period of assisted ventilation , 2 ) poly trauma with severe neurological deficits , 3 ) major thoracic trauma , which might require multiple repeated surgeries , 4 ) patient with multiple fractures of the mandible or injury to the floor of the mouth , and 5 ) patient who might require ventilator support during the postoperative period .
all our patients had panfacial trauma ( fig . 6 ; patients computed tomography ) with the involvement and combination of at least any two of the mandible , maxilla , nasal bone , zygomatic maxillary complex , or frontal bone involving occlusion .
for all cases of fractures that were reduced by open reduction , intraoperative occlusal correction was carried out , and internal fixation was performed by miniplate osteosynthesis .
nasal bone fracture was reduced , intranasal packing was placed , and external plaster of paris splinting was applied .
( table 1 ) oral intubation was initially established , and then patients were changed to submental intubation as described earlier .
we required an average of 8 minutes ( 8 - 10 minutes ) to perform the procedure ; the duration of the surgery was 3 to 5 hours ( mean , 4 hours and 10 minutes ) .
postoperatively , the patients were followed - up on the first , third , and seventh days , after two weeks , and after one month . wound healing was satisfactory and resulted in minimal scarring .
skin incisions were made in a low - visibility area where a small scar might be more cosmetically acceptable than a regular tracheostomy scar .
since this procedure allows for the simultaneous manipulation of nasal and facial fractures , we were able to avoid the complications of tracheostomy .
no special equipment was required to execute this procedure , and it was technically very simple .
any oral surgeon could easily and safely perform this technique without expecting the same major complications that are currently associated with tracheostomy .
reported complications of this approach include damage to adjacent structures , such as sublingual and submandibular ducts , sublingual gland , and lingual nerve8 .
meyer et al.10 reported an 8% occurrence of oral floor abscesses and a 4% incidence of hypertrophic scar formation .
risk of postoperative salivary fistula has been reported in the literature in cases of prolonged ventilation .
macinnis and baig6 detailed a patient who remained intubated in the intensive care unit for three days and experienced no complications .
the risk of sepsis in the submental tunnel could be related to a contaminated endotracheal tube during extubation .
the endotracheal tube is routinely reintroduced intra - orally , which helps the surgeon with suturing the skin wound while the patient is still under anesthesia and the anesthetist with extubation .
the other three patients also had parasymphysis fractures , and open reduction and internal fixation was performed .
there was a risk of infection through the submental tunnel due to the possibility of a contaminated endotracheal tube using the above method .
to avoid such complications , the tube was extubated directly without reintroducing it intra - orally .
the skin incision was sutured under local anesthesia while the patient was conscious . in the postoperative review ,
all patients were examined for submandibular and sublingual salivary gland function by measuring the salivary flow intra - orally or identifying salivary fistula , swelling , obstruction , or infection of the salivary glands .
lingual nerve function was also assessed using both an objective method ( tongue pin prick test ) and a subjective method by asking the patients whether they had any altered sensation of the tongue or loss of taste sensations on the side of the operation .
all patients had normal salivary flow , and they all reported normal tongue sensation . however , the sample size in our study was small ( n=5 ) .
submental intubation is a simple , safe , and ideal procedure to maintain the airway during maxillofacial trauma surgery , particularly in patients with panfacial fracture who require occlusal correction and simultaneous management of all fractures .
maxillofacial surgeons who deal with panfacial trauma surgery should consider this procedure before opting for tracheostomy . | ### Summary:
: objectivessubmental intubation has been advocated as an alternative to classical tracheostomy for certain indicated panfacial trauma surgeries .
surgeons should have various options for airway management in maxillofacial trauma patients .
most maxillofacial injuries involve occlusal derangements , which might require intraoperative occlusal corrections ; hence , orotracheal intubation is not ideal .
maxillofacial surgeons generally prefer nasotracheal intubation ; however , in cases with concomitant skull base fracture or nasal bone fracture , nasotracheal intubation might not be suitable ; in these situations , tracheostomy is typically performed .
however , the possible complications of tracheostomy are well known .
due to trauma situations and to avoid the complications of tracheostomy , submental intubation would be an ideal alternative procedure in selected maxillofacial trauma surgery patients .
this study aimed to evaluate the safety and usefulness of a submental intubation technique for panfacial trauma surgery .
moreover , we intended to share our experience of submental intubation and to recommend this simple , safe procedure for certain panfacial trauma surgeries.materials and methodsin five panfacial trauma patients , we performed submental intubation for airway management ; the mean time required for the procedure was only eight minutes.resultswe were able to execute this procedure safely in a short time without any intraoperative or postoperative complications.conclusionsubmental intubation is a safe and simple technique for airway management in indicated panfacial trauma surgery patients . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: an estimated 3.7 million people in the uk have chronic obstructive pulmonary disease ( copd),1 with acute exacerbations of copd ( aecopd ) being the commonest cause for emergency medical admissions .
inpatient mortality rates can reach 25% and may be as high as 50% within 12 months of admission for aecopd.2,3 patients with acute hypercapnic respiratory failure ( ahrf ) and acidosis have the highest mortality rate and need for invasive mechanical ventilation ( imv ) .
several controlled clinical trials have shown that noninvasive ventilation ( niv ) in ahrf significantly reduces both mortality and the need for imv.4 ward - based niv is now standard practice in the management of ahrf in the uk , but mortality rate remains high .
a recent uk national audit of copd admissions reported inpatient and 90-day mortality rates of 25% and 33% , respectively , for patients receiving niv.5 furthermore , only 5% of patients with respiratory acidosis received imv , and only 4% of those who died following niv administration were given imv .
this lack of escalation of care suggests that patient selection for niv in clinical practice is problematic and needs improvement . whilst imv may be appropriate for some patients with severe acidosis
several prognostic indicators for patients admitted to hospital with ahrf due to aecopd have been identified .
these include age , severity of acidosis ( particularly ph < 7.25 ) , impaired consciousness , a high acute physiology and chronic health evaluation ( apache ) ii score , hyperglycemia , and the development of concurrent nonrespiratory organ failure.2,611 identification of high - risk patients may enable appropriate stratification of treatment , including niv and imv .
however , identifying patients at the terminal stages of their disease is difficult and is usually a matter of clinical judgment . in a previous study
, we showed that performance status in combination with bedside physiological measurements from routine clinical assessment were highly predictive of mortality in patients admitted to hospital with aecopd.12 the aim of this study was to identify factors associated with inpatient mortality for ahrf with respiratory acidosis due to copd .
this prospective cohort study was performed in the respiratory unit at the sunderland royal hospital , uk .
patients admitted and treated with niv for ahrf due to aecopd , between september 2009 and july 2010 , were included if a diagnosis of copd had been previously confirmed by clinical symptoms and spirometry .
aecopd was defined by the presence of two or more of the following features : worsening dyspnea , cough , increased sputum production , and change in sputum color .
exclusion criteria included : ( 1 ) a history of asthma , bronchiectasis or other concomitant respiratory diseases ; ( 2 ) a diagnosis of advanced malignancy ; and ( 3 ) pulmonary edema or pneumonia on admission .
niv was initiated if there was evidence of ahrf and acidosis ( ph < 7.35 and partial pressure of co2 ( pco2 ) > 45 mmhg ) on arterial blood gases ( abgs ) .
niv was delivered by nurses experienced in niv , using bilevel positive airway pressure ventilators ( bipap vision ; royal philips electronics , amsterdam , the netherlands ) with full face masks .
initial settings of inspiratory positive airways pressure ( ipap ) and expiratory positive airways pressure ( epap ) were 12 and 4 cm h20 , respectively .
ipap was adjusted upwards by 2 cm h2o increments according to the response and patient tolerance .
oxygen was entrained through the mask to maintain peripheral oxygen saturation ( spo2 ) in the range of 88%92% .
the response to niv was assessed by abgs between 12 hours after commencing treatment and as clinically indicated thereafter .
the end points of the study were inpatient mortality and mortality at 30 days and 12 months after admission .
the severity of copd was determined by the most recent spirometry reading taken when the patient was clinically stable .
this was graded according to the global initiative for chronic obstructive lung disease ( gold ) staging classification.13 other clinical data collected included the use of long - term oxygen therapy , number of hospital admissions for aecopd in the preceding year , and previous documented episodes of ahrf .
patients comorbidities were recorded and quantified using the index of charlson et al.14 an assessment of patients functional status was made using the world health organization performance status scale ( who - ps ) ( 0 = asymptomatic with normal activity ; 1 = symptomatic on physically strenuous activity but able to carry out work of a light or sedentary nature ; 2 = symptomatic : some limitation of normal activity but up and about > 50% of time during day , self - caring ; 3 = symptomatic : in bed / chair > 50% of time during the day , requires some help with self - care ; and 4 = chair / bedbound , can not carry out any self - care).15 the glasgow coma scale and a composite score of physiological impairment , the early warning score ( ews ) , were recorded upon admission.16 the ews is derived from heart rate , systolic blood pressure , respiratory rate , temperature , and avpu score ( consciousness level , based on patients being alert , responding to voice , responding to pain , or being unresponsive ) ( table 1 ) .
laboratory measurements included the worst ( lowest ph ) abgs prior to commencement of niv , full blood count , albumin , urea , and c - reactive protein ( crp ) .
data was analyzed using spss software ( spss inc , chicago , il , usa ) .
numeric data are presented as means and standard deviation ( sd ) , unless otherwise stated .
continuous variables were compared by t - test and analysis of variance ( anova ) .
receiver operating characteristic ( roc ) analysis was used to identify the cutoff values for continuous variables significantly associated with mortality .
variables significant on univariate analysis ( p < 0.05 ) were included in a stepwise ( forward conditional ) logistic regression analysis , and association with death was expressed as the odds ratio ( or ) ( 95% confidence interval ) .
the 12-month survival was analyzed using the kaplan meier method and groups compared by log rank test .
this prospective cohort study was performed in the respiratory unit at the sunderland royal hospital , uk .
patients admitted and treated with niv for ahrf due to aecopd , between september 2009 and july 2010 , were included if a diagnosis of copd had been previously confirmed by clinical symptoms and spirometry .
aecopd was defined by the presence of two or more of the following features : worsening dyspnea , cough , increased sputum production , and change in sputum color .
exclusion criteria included : ( 1 ) a history of asthma , bronchiectasis or other concomitant respiratory diseases ; ( 2 ) a diagnosis of advanced malignancy ; and ( 3 ) pulmonary edema or pneumonia on admission .
niv was initiated if there was evidence of ahrf and acidosis ( ph < 7.35 and partial pressure of co2 ( pco2 ) > 45 mmhg ) on arterial blood gases ( abgs ) .
niv was delivered by nurses experienced in niv , using bilevel positive airway pressure ventilators ( bipap vision ; royal philips electronics , amsterdam , the netherlands ) with full face masks .
initial settings of inspiratory positive airways pressure ( ipap ) and expiratory positive airways pressure ( epap ) were 12 and 4 cm h20 , respectively .
ipap was adjusted upwards by 2 cm h2o increments according to the response and patient tolerance .
oxygen was entrained through the mask to maintain peripheral oxygen saturation ( spo2 ) in the range of 88%92% .
the response to niv was assessed by abgs between 12 hours after commencing treatment and as clinically indicated thereafter .
the end points of the study were inpatient mortality and mortality at 30 days and 12 months after admission .
the severity of copd was determined by the most recent spirometry reading taken when the patient was clinically stable .
this was graded according to the global initiative for chronic obstructive lung disease ( gold ) staging classification.13 other clinical data collected included the use of long - term oxygen therapy , number of hospital admissions for aecopd in the preceding year , and previous documented episodes of ahrf .
patients comorbidities were recorded and quantified using the index of charlson et al.14 an assessment of patients functional status was made using the world health organization performance status scale ( who - ps ) ( 0 = asymptomatic with normal activity ; 1 = symptomatic on physically strenuous activity but able to carry out work of a light or sedentary nature ; 2 = symptomatic : some limitation of normal activity but up and about > 50% of time during day , self - caring ; 3 = symptomatic : in bed / chair > 50% of time during the day , requires some help with self - care ; and 4 = chair / bedbound , can not carry out any self - care).15 the glasgow coma scale and a composite score of physiological impairment , the early warning score ( ews ) , were recorded upon admission.16 the ews is derived from heart rate , systolic blood pressure , respiratory rate , temperature , and avpu score ( consciousness level , based on patients being alert , responding to voice , responding to pain , or being unresponsive ) ( table 1 ) .
laboratory measurements included the worst ( lowest ph ) abgs prior to commencement of niv , full blood count , albumin , urea , and c - reactive protein ( crp ) .
data was analyzed using spss software ( spss inc , chicago , il , usa ) .
numeric data are presented as means and standard deviation ( sd ) , unless otherwise stated .
continuous variables were compared by t - test and analysis of variance ( anova ) .
receiver operating characteristic ( roc ) analysis was used to identify the cutoff values for continuous variables significantly associated with mortality .
variables significant on univariate analysis ( p < 0.05 ) were included in a stepwise ( forward conditional ) logistic regression analysis , and association with death was expressed as the odds ratio ( or ) ( 95% confidence interval ) .
the 12-month survival was analyzed using the kaplan meier method and groups compared by log rank test .
mortality was greater in males compared with females ( 41.4% versus 27.8% ) but this was not statistically significant ( p = 0.18 ) .
the mortality rates at 30 days and at 12 months after admission were 38.5% and 58.5% , respectively .
mortality was associated with the severity of copd , longterm oxygen therapy use , and performance status ( table 2 ) .
the frequency of hospital admissions for aecopd and previous episodes of ahrf were not associated with an increased risk of death .
nonsurvivors had significantly greater perturbations of respiratory rate , diastolic blood pressure , and the glasgow coma scale .
several laboratory variables were associated with increased inpatient mortality , including severity of acidosis and degree of hypercapnia ( table 4 ) .
dichotomous variables were determined as described above , for the who - ps score , ews score , diastolic blood pressure , and ph . the univariate analysis of variables associated with inpatient death is shown in table 5 .
anemia was associated with increased in - hospital mortality , particularly in female patients : mortality if anemic was 57.1% vs 9.1% ( p = 0.003 ) for females and was 53.8% vs 31.3% ( p = 0.18 ) for males .
multivariate analysis of factors associated with inpatient death showed that only who - ps 3 ( or 39.0 [ 6.832 23.6 ] ) ( p < 0.0001 ) and anemia ( or 5.86 [ 1.2826.8 ] ) ( p < 0.03 ) were significant .
the presence of both predicted 68% of inpatient deaths , with a specificity of 98% .
figure 1 illustrates the effect of combining the who - ps and anemia on survival up to 12 months after hospital admission ( log rank test p < 0.001 ) .
in routine clinical practice , the mortality from ahrf with respiratory acidosis due to copd is considerable despite treatment with niv .
this study shows that patients who are unlikely to respond to niv may be identified by a combination of poor performance status ( who - ps 3 ) and anemia .
the inpatient mortality rate in this study is comparable to that of the uk national copd audit of patients receiving niv ( which showed an inpatient mortality rate of 25%).5 in another study , comparing intensive care delivered niv with imv , the inpatient mortality was similar ( niv 26%).17 but these compare unfavorably with mortality rates observed in other studies of niv for ahrf.8,9,11 in particular , the inpatient mortality in the yoniv study was only 10% for patients on niv.8 the differences in mortality rates are probably a reflection of patient selection . although the yoniv trial was described as a real world
study , inclusion required ph in the range of 7.257.34 . in the present study ,
50.8% of our patients had ph < 7.25 , similar to that of the uk national copd audit.5 patients in the studies of chakrabarti et al9 and confalonieri et al11 were also significantly less acidotic .
as with previous studies , inpatient mortality was associated with more severe acidosis on admission .
similar observations were reported by chakrabarti et al.9 one explanation may be that abgs on admission do not necessarily reflect disease severity .
furthermore , some patients may initially respond to treatment , only to later deteriorate.18 in the uk national copd audit , the highest mortality was seen in patients who were nonacidotic on admission but who became acidotic later.5 in a previous study , we showed that inpatient deaths from copd exhibit a bimodal distribution , with early deaths ( within 7 days of admission ) being related to admission acidosis , whereas later deaths were not.12 combinations of routine physiological observations have been shown to be of value in predicting survival for patients requiring niv .
one score chart , that includes the glasgow coma scale , apache ii score , respiratory rate , and ph , identified patients at > 50% risk of niv failure.11 in another study , a combination of baseline respiratory rate , random glucose , and admission apache ii score was highly ( 100% ) predictive of niv success.9 however , the apache ii score is rarely used outside the intensive care unit , and a more straightforward assessment tool is required for routine clinical use .
simple measurements of functional limitation alone may be more useful in this respect . in the present study ,
performance status was highly predictive of inpatient death ( mortality if who - ps 3 was 69% vs 5.6% ) and concurs with our previous observations.12 a uk copd audit of outcomes for aecopd showed that performance status was the best predictor of mortality ( 38% if bed / chairbound vs 2% if normal activity).19 morretti et al demonstrated that late niv failure was associated with worse activities of daily living scores.18 patients with a 6-minute walking distance of < 100 m have a 1-year mortality of up to 60%.20 in the study by chu et al,21 only the mrc dyspnea score was independently predictive of death .
our observation that anemia is a significantly important predictor of inpatient mortality is also of particular interest .
although copd is traditionally associated with polycythemia , the prognostic importance of anemia in this population is increasingly recognized .
cote et al22 demonstrated that anemic copd patients had significantly shorter median survival ( 49 versus 74 months ) compared with nonanemics . in a study of patients requiring imv ,
the overall 90-day mortality among anemic copd patients was 57.1% versus 25% for nonanemics.23 the mechanism of anemia in copd and its impact on survival are unclear , but it has been suggested that the prognostic importance of copd - related anemia may be its association with systemic inflammation in severe disease.24 there is increasing evidence of the importance of systemic inflammation in copd.25 a relationship between mortality and the magnitude of crp rise during exacerbations has been reported.12,26 our findings in the present study , of an association between crp level and death in ahrf due to copd , were similar .
patients with copd that have frequent exacerbations have an increased risk of death.27 however , the frequency of admissions or previous episodes of ahrf were of no prognostic significance in this study .
the presence of comorbidities is also of prognostic importance in copd in a study of 71,130 patients admitted to hospital with aecopd , a charlson score of 5 was associated with a fivefold increase in death in hospital . in our previous study ,
the charlson score was significantly higher in patients that died , but it was not an independent predictor of mortality.12 it is therefore likely that the differences in performance status between survivors and those that died reflect copd severity and its systemic effects rather than additional comorbidity .
follow up of patients surviving an episode of ahrf requiring niv indicates poor long - term prognosis . in this study
, 37% of patients who survived admission died within 12 months . in a similar study of survivors of ahrf treated with niv ,
49% had died within 12 months of discharge from hospital.21 thus , the probability of medium - term survival needs to be considered prior to commencing niv .
the bode index , that comprises markers of disease severity in stable copd , including forced expiratory volume in 1 second ( fev1 ) , body mass index , exercise capacity , and dyspnea , has been found to be helpful in predicting long - term prognosis.28 however a bode score in the upper quartile is associated with a 12-month mortality of only 5% and is therefore of little utility in predicting short- to medium - term survival .
we have deliberately included only variables that are measured in routine clinical practice and are therefore easily replicable and of potential clinical utility .
who - ps 3 and anemia are prognostic factors in ahrf with respiratory acidosis due to copd .
a combination of the two provides a simple method of identifying patients unlikely to benefit from niv .
this study showed that mortality remained high despite treatment with niv , a reflection of the fact that ahrf with respiratory acidosis can be a manifestation of the terminal stage of disease for patients with copd . whilst niv is undoubtedly effective in the majority of patients with ahrf , a substantial proportion
are subjected to a futile intervention that may be unpleasant and distressing , when end of life care may be more appropriate .
our study indicates that patients who are unlikely to respond to niv may be identified by routine clinical assessment , but further studies are required to validate these findings .
all authors had full access to the original data and take responsibility for the integrity of the data and the accuracy of the analysis . | ### Summary:
: backgroundin patients with acute hypercapnic respiratory failure ( ahrf ) during exacerbations of copd , mortality can be high despite noninvasive ventilation ( niv ) . for some
, ahrf is terminal and niv is inappropriate .
however there is no definitive method of identifying patients who are unlikely to survive .
the aim of this study was to identify factors associated with inpatient mortality from ahrf with respiratory acidosis due to copd.methodscopd patients presenting with ahrf and who were treated with niv were studied prospectively .
the forced expiratory volume in 1 second ( fev1 ) , world health organization performance status ( who - ps ) , clinical observations , a composite physiological score ( early warning score ) , routine hematology and biochemistry , and arterial blood gases prior to commencing niv , were recorded.resultsin total , 65 patients were included for study , 29 males and 36 females , with a mean age of 71 10.5 years .
inpatient mortality in the group was 33.8% .
mortality at 30 days and 12 months after admission were 38.5% and 58.5% , respectively .
on univariate analysis , the variables associated with inpatient death were : who - ps 3 , long - term oxygen therapy , anemia , diastolic blood pressure < 70 mmhg , early warning score 3 , severe acidosis ( ph < 7.20 ) , and serum albumin < 35 g / l . on multivariate analysis , only anemia and who - ps 3 were significant .
the presence of both predicted 68% of inpatient deaths , with a specificity of 98%.conclusionwho - ps 3 and anemia are prognostic factors in ahrf with respiratory acidosis due to copd . a combination of the two provides a simple method of identifying patients unlikely to benefit from niv . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: according to world health organization ( who ) ( 2012 ) more than 347 million people worldwide suffer from diabetes mellitus ( dm ) , of which 90% have type 2 diabetes ( t2d ) .
both the prevalence and morbidity , especially of t2d , continue to grow globally , especially in developing countries .
this growth has led to strains on healthcare systems worldwide as t2d remains one of the leading causes of cardiovascular disorders , blindness , renal failure , amputations , and hospitalizations .
adiponectin is a circulating protein produced by adipose tissue that is a versatile regulator of energy homeostasis , insulin sensitisation , inflammation / atherosclerotic processes , and anti - ischemic cardioprotection .
it is well established that adiponectin plays an important role in t2d , hypertension , multiple sclerosis , and dyslipidaemias .
particularly , there is a strong association between hypoadiponectinemia and t2d : both adipose adiponectin mrna expression and circulating adiponectin levels are significantly reduced in most rodent models of t2d , as well as t2d patients ; the degree of glycosylated adiponectin and high - molecular weight / total adiponectin ratio , which correlates with insulin sensitivity , were significantly decreased in t2d patients compared to healthy controls ; high adiponectin levels are associated with reduced risk of developing diabetes .
the most significant role adiponectin may play is that of sensitizing the liver and muscles to the action of insulin in both humans and rodents .
adiponectin has an ameliorating function on glucose metabolism apart from insulin signalling . in animal models of obesity and diabetes ,
adiponectin affected both skeletal muscle and liver , promoting fatty acid oxidation in muscle and inhibiting glucose production from the liver , thereby leading to decreases in circulating free fatty acids ( ffas ) , triglyceride , and glucose levels [ 7 , 8 ] .
ffas as well as tumor necrosis factor alpha ( tnf ) are factors released from adipose tissue that contribute to insulin resistance .
in addition , lipid accumulation in beta - cells might lead to reductions in insulin secretion . in individuals with visceral obesity
, there is a decrease in the insulin - mediated suppression of lipolysis , leading to increases in circulating ffas concentrations that contribute to both peripheral and hepatic insulin resistance either by impairing insulin signalling pathways , by competitive inhibition of muscle glucose uptake , by stimulation of endogenous glucose production , thus contributing to hepatic insulin resistance , or by combination of mentioned mechanisms [ 6 , 7 , 9 , 10 ] .
also it was shown that adiponectin regulates the expression of several pro- and anti - inflammatory cytokines .
its main anti - inflammatory function might be related to its capacity to suppress the synthesis of tnf and interferon gamma ( ifng ) and to induce the production of anti - inflammatory cytokines such as interleukin-10 ( il-10 ) and il-1 receptor antagonist ( il-1ra ) .
tnf is a key modulator of adipocyte metabolism , with a direct role in several insulin - mediated processes , including glucose homeostasis and lipid metabolism [ 6 , 7 , 12 ] .
the net effect of tnf is to decrease lipogenesis ( ffa uptake and triglyceride synthesis ) and to increase lipolysis .
finally , there is substantial evidence of adiponectin effects on beta - cell function and survival , which are well known as key factors in the development of t2d along with insulin resistance . taking into consideration
the above mentioned it could be conclude that adiponectin - targeted pharmaceutical strategies increasing circulating adiponectin levels may be therapeutic against t2d .
subetta is drug containing release - active dilutions of antibodies to the beta subunit of the insulin receptor and antibodies to endothelial nitric oxide ( no ) synthase .
this novel class of drug was demonstrated to have a fundamentally new proantigen ( cotargeted with antigen ) targeted activity .
for the first time in the study of the repeated dilution process , it was found that the resulting ultra - dilution generates a novel activity absent in the starting material , called a release - activity .
a distinctive feature of the release - active antibodies is their ability not to suppress , and to modify the activity of the antigen against which they were raised . in two dm animal models ,
streptozotocin - induced dm and spontaneous t2d in goto kakizaki rats , subetta showed antidiabetic effects similar to that of rosiglitazone .
additionally , subetta has shown promising results in its first clinical use in both type 1 diabetes ( t1d ) patients with poor glycemic control receiving intensive insulinotherapy and t2d patients receiving metformin / combination of basal insulin with metformin ( unpublished data ) .
subetta treatment led to a significant decrease in fasting plasma glucose and glycated haemoglobin ( hba1c ) levels , exerted a normalizing effect on the daily glycemic levels ( self - control of blood glucose and daily glucose monitoring ) , significantly lowered insulin resistance and plasma insulin levels , as well as lowering total cholesterol and low - density lipoproteins .
the aim of this work is to investigate the ability of subetta to affect adiponectin secretion by mature human adipocytes .
human preadipocytes ( lot sl0047 ) were provided by zen - bio , inc .
human preadipocytes were mixture of subcutaneous depots ( abdomen , thigh , hip , flank , and breast ) obtained from 5 healthy donors ( sex : female ; age : 47.0 5.4 ) undergoing elective surgery that have signed informed consent , under existing institutional review board ( irb ) .
the cells were pooled and grown together , then harvested and cryopreserved as the superlot ( multidonor ) that was used in the current study . prior to use the cells undergo quality control in a number of functional assays ( differentiation ( measured by total triglyceride ) , lipolysis , insulin - induced glucose uptake ) and also the results of the quality control have shown that there were not any differences between the depots .
preadipocyte medium ( catalog number pm-1 ) , adipocyte differentiation medium ( catalog number dm-2 ) , and adipocyte maintenance medium ( catalog number am-1 ) were provided by zen - bio , inc .
enzyme - linked immunosorbent assay ( elisa ) kit ( catalog number adip-1 ) was the product of zen - bio , inc .
subetta , release - active dilutions ( rad ) of antibodies ( abs ) to the beta subunit of insulin receptor and abs to endothelial no synthase , rad of abs to cannabinoid receptor type i ( r - cbi ) , rad of rabbit nonimmune serum ( rbs ) , rad of purified water ( placebo ) , and purified water were manufactured and supplied by ooo npf
all of ooo npf materia medica holding compounds , except for purified water , were manufactured using the method described previously using routine methods described in the european pharmacopoeia ( 6th edition , 2007 ) .
starting substances were mixed with a solvent ( ethanol - water solution ) and shaken for 1 min to produce c1 dilution .
all subsequent dilutions consisted of one part of the previous dilution to 99 parts of solvent ( ethanol - water solution for intermediate dilutions and distilled water for preparation of the final dilution ) , with succession between each dilution .
solutions were prepared in sterile conditions , avoiding direct intense light , and were stored at room temperature .
rabbit polyclonal antibodies to the beta subunit of insulin receptor and to endothelial no synthase were used as starting substances for subetta , rabbit polyclonal antibodies to cannabinoid receptor type i for rad of abs to r - cbi , rabbit nonimmune serum for rad of rbs . in case of placebo ,
human preadipocytes were plated at 40625 cells / cm in 150 l of preadipocyte medium .
the cells were allowed to attach overnight in a 37c humidified incubator at 5% co2 .
the following day , the plating medium was removed and replaced with 150 l of adipocyte differentiation medium and the cells allowed to incubate in a 37c humidified incubator at 5% co2 for 1 week .
after 1 week , 90 l of the differentiation medium was removed from each well and 120 l of adipocyte maintenance medium was added .
the cells were then allowed to incubate in a 37c humidified incubator at 5% co2 for 7 more days .
prior to the assay , the cells were incubated in the absence of serum and hormones for three days . after starvation , test compounds ( 75 l ) were added and the cells were incubated at 37c in a humidified incubator at 5% co2 for three days .
conditioned media was collected after 72 hours and either frozen for later evaluation or measured immediately . for the elisa , 20 l of the conditioned medium was added to 80 l of pretreatment solution and heated to 100c for 5 minutes .
once the samples were cooled to room temperature , 50 l of each sample was added to 200 l diluent buffer to generate a 5-fold dilution .
samples were mixed and 100 l was transferred to the coated wells of the elisa plate .
samples were incubated at room temperature for 1 hour after which the plate was washed and secondary antibody applied and incubated at room temperature for 1 hour .
the plate was washed again and detection antibody was added and allowed to incubate for 1 hour at room temperature .
detection reagents were added and absorbance at 450 nm ( spectramax 250 : molecular devices ) was determined .
the data are presented as mean value per group ( m ) standard deviation ( sd ) .
one - way analysis of variance ( anova ) followed by tukey hsd test was used for statistical analysis and p values less than 0.05 were regarded as significant ( statistica 6.1 software ) .
incubation of mature human adipocytes with subetta for 72 hours resulted in a statistically significant increase in adiponectin concentration in the culture medium ( table 1 ) .
nonspecific controls , rad of abs to r - cbi and rad of rbs , did not significantly affect adiponectin secretion , resulting in adiponectin levels comparable to background values of the negative controls , placebo , purified water , and 0.1% dimethyl sulfoxide ( dmso ) .
the reference drug rosiglitazone stimulated adiponectin secretion but to a lower level compared to that of subetta and its effect was not significant in comparison with dmso value .
previously , subetta demonstrated the ability to reduce hyperglycemia and improve glucose tolerance in various experimental models of diabetes mellitus and its effects were similar to that of rosiglitazone [ 14 , 15 ] .
subetta was given by oral gavage , when it was studied in vivo but in the current study the direct action of subetta on mature human adipocytes was estimated in vitro .
based on the activity demonstrated for the whole class of novel drugs and on data from previous studies , we may conclude that the complex drug mainly exerts a modulating effect on the beta subunit of the insulin receptor regulating the insulin receptor 's kinase activity and consequently activating receptor - associated signal pathways .
the ability of direct activation of insulin receptor and activate receptor - associated signal pathways in the absence of insulin was shown for l7 ( merck ) [ 17 , 18 ] . according to shehzad et al .
specifically , insulin enhances adiponectin regulation and secretion selectively in adipocytes . while the exact mechanism of action of insulin on adiponectin biosynthesis remains unclear ,
it has been suggested that insulin binding to its receptor activates a cell cascade inhibiting the activity of foxo1 , a suppressor of peroxisome proliferator - activated receptor gamma ( ppar gamma ) , which in turn results in the induction of adiponectin biosynthesis .
it is important that adiponectin has an ameliorating function on glucose metabolism apart from insulin signalling . taking into consideration the above mentioned , it could be assumed that subetta via direct effect on beta subunit of the insulin receptor of mature human adipocytes activates insulin receptor in the absence of insulin in culture medium , which in its turn exerts activating receptor - associated signal pathways . as a result activity of foxo1
is inhibited and thus adiponectin biosynthesis is inducted . to confirm this suggestion , further studies ( both in vitro and in vivo )
should be conducted in order to provide a detailed investigation of the mechanism of subetta influence on the production of adiponectin and also to assess the involvement of this process and its role in the mechanism of drug action .
in summary , the novel complex drug subetta , containing rad of antibodies to the beta subunit of insulin receptor and antibodies to endothelial no synthase , stimulates adiponectin production by mature human adipocytes .
this effect on adiponectin production is specific ; neither rad of abs to r - cbi nor rad of rbs affected adiponectin secretion by mature human adipocytes .
therefore , the ability of subetta to exert its modulating effect on the insulin receptor even in absence of insulin might be the basis for stimulating adiponectin secretion and might serve as one of the mechanisms of the antidiabetic effect of this drug .
the results of the current in vitro study give first insight on possible mechanism of action of subetta and serve as a background for further studies . | ### Summary:
: purpose . to investigate the mechanism of action in peripheral tissues of novel complex drug containing release - active dilutions of antibodies to the beta subunit of the insulin receptor and antibodies to endothelial nitric oxide synthase ( subetta ) , which has shown efficacy in animal models of diabetes
. methods .
human mature adipocytes were incubated either with subetta , with one of negative controls ( placebo or vehicle ) , with one of nonspecific controls ( release - active dilutions of antibodies to cannabinoid receptor type i or release - active dilutions of rabbit nonimmune serum ) , or with dimethyl sulfoxide ( dmso ) at 37c in a humidified incubator at 5% co2 for three days .
rosiglitazone was used as reference drug .
secretion of adiponectin was measured by quantitative enzyme - linked immunosorbent assay ( elisa ) .
results .
only subetta significantly stimulates adiponectin production by mature human adipocytes .
nonspecific controls did not significantly affect adiponectin secretion , resulting in adiponectin levels comparable to background values of the negative controls and dmso .
conclusion .
increasing adiponectin production in absence of insulin by subetta probably via modulating effect on the beta subunit of the insulin receptor might serve as one of the mechanisms of the antidiabetic effect of this drug .
these in vitro results give first insight on possible mechanism of action of subetta and serve as a background for further studies . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: disseminated intravascular coagulation ( dic ) is characterized by the systemic intravascular activation of coagulation ( 1 ) .
dic can contribute to acute kidney injury ( aki ) and other multiorgan failures due to the widespread deposition of fibrin in the circulation and the consequent compromise of blood supply to various organs .
dic is associated with various gyneco - obstetric conditions , such as , uterine leiomyoma and abruptio placenta . however
a literature review revealed only one report of dic development during menstruation in an adenomyosis patient ( 2 ) .
however , in this previously reported case , aki and other organ failures were not observed .
we here present a case of aki which resulting from menstruation - related dic that was probably provoked by gonadotropin administration .
a 40-yr - old woman who had experience of primary infertility with diffuse adenomyosis ( fig .
1 ) presented with anuria and an elevated serum creatinine ( scr ) level at the emergency medicine department on may 28 , 2008 . she had a history of two cycles of in vitro fertilization ( ivf ) at an infertility clinic , and the second cycle was performed 3 weeks prior to admission .
each cycle of ivf was treated with long protocol of gonadotropin - releasing hormone ( gnrh ) agonist . for ovulation induction ,
daily 500 iu of human menopausal gonadotropin was administered on menstrual cycle days 3 - 15 and 5,000 iu of human chorionic gonadotropin ( hcg ) was administered on day 16 , at 18 mm of leading follicles size .
daily 50 mg of progesterone and once every three days 1,000 iu of hcg were administered for luteal support .
the objective evidences of ovarian hyperstimulation syndrome were not present on the day of ovum collection and 7 days later . on admission ,
her blood urea nitrogen ( bun ) level was 41.1 mg / dl , and her scr level was 3.5 md / dl .
an examination of medical records revealed a baseline scr level of 0.8 mg / dl , and a physical examination revealed an extremely enlarged uterus , which was palpable at the level of the umbilicus .
her pregnancy test was negative and her menstrual cycle had started 1 day before admission .
laboratory testing showed the following : white blood cell ( wbc ) count 30.0710/l , hemoglobin level ( hb ) 10.0 g / dl , hematocrit ( hct ) 29.6% , platelet count 3910/l , lactate dehydrogenase ( ldh ) 7,914 iu / l , aspartate aminotransferase ( ast ) 329 iu / l , alanine aminotransferase ( alt ) 92
iu / l , alkaline phosphatase ( alp ) 180 iu / l , total bilirubin 2.72 mg / dl , and cancer antigen 125 ( ca125 ) 16,684 u / ml .
her laboratory values were as follows : prothrombin time ( pt ) 24.6 sec ( normally 11.0 to 14.1 sec ) , prothrombin time - internationalized ratio ( pt - inr ) 2.25 , activated partial thromboplastin time ( aptt ) 58.2 sec ( normally 30 to 44 sec ) , fibrinogen level 88 mg / dl , d - dimer level 19.3 g / ml , and antithrombin iii level 74% .
she had no known factor predisposing dic , such as , infection or a malignancy .
urinalysis revealed numerous red and white blood cells , but her urine and blood cultures were negative .
serologies for antinuclear antibodies ( ana ) , antineutrophil cytoplasmic antibodies ( anca ) , cryoglobulins , hepatitis b surface antigen ( hbsag ) , anti - glomerular basement membrane antibodies ( anti - gbm ) , and antistreptococcal antibodies were all negative .
furthermore , both serum and urine protein electrophoresis failed to demonstrate a monoclonal component , and her computed tomographic renal scan was unremarkable . under a diagnosis of aki resulting from unexplained dic ,
the patient was treated with 0.9% sodium chloride solution , fresh frozen plasma , and platelet concentrates . however , despite treatment , the patient required continuous renal replacement therapy and therapeutic plasmapheresis due to progressive aki and multiorgan failures .
the menstrual phase was terminated on the fourth hospital day , and coagulation test findings then gradually improved .
her scr level peaked on the 14th hospital day , and reached a nadir of 1.1 mg / dl on 30th hospital day .
the patient was treated with gnrh agonist for 3 months , and then underwent hysterectomy on september 28 , 2008 .
adenomyosis is a benign gynecological condition that is characterized by the presence of endometrial glands and stroma within the myometrium ( 3 ) . in adenomyosis patients
furthermore , an uterus affected by adenomyosis can enlarge to that expected on the 12th gestational week .
in addition , adenomyosis is frequently associated with other uterine conditions , such as , leiomyoma ( 35 - 55% ) or pelvic endometriosis ( 5 - 20% ) .
thus , the differential diagnosis of aki should include obstructive uropathy , either caused by adenomyosis per se or by coexisting conditions , such as , a bulky leiomyoma or ureteral endometriosis . in our case ,
renal ultrasonography excluded obstructive uropathy and laboratory data were consistent with aki resulting from unexplained dic . accordingly , because she had no known factor predisposing dic , menstruation - related dic was suspected .
nakamura et al . reported the first case of dic development during menstruation in an adenomyosis patient , and proposed a myometrial injury mechanism ( 2 ) .
we agree that myometrial injury resulting from heavy intramyometrial menstrual flow might activate the tissue factor coagulation pathway .
however , fulminant dic with aki and other organ failures was not observed in their case .
we believe that gonadotropin played an important role in the development of fulminant dic in our patient .
adenomyosis is often accompanied by adjacent myometrial smooth muscle hyperplasia , and adenomyotic tissue and myometrium are known to express estrogen and progesterone receptors ( 4 , 5 ) .
therefore , gonadotropin , which stimulates ovarian steroidogenesis , can promote the proliferation of adenomyotic tissue and adjacent myometrium , and thus , contribute to extensive myometrial injury during menstruation .
the myometrium is a significant source of tissue factor , which plays a key role in the initiation of coagulation ( 6 ) .
furthermore , because tissue factor expression is also under the control of ovarian steroids ( 7 ) , gonadotropin might contribute to the overexpression of tissue factor and activation of the coagulation cascade .
however , recent studies have shown that mri can accurately diagnose adenomyosis , and that it has a sensitivity and specificity that range from 86 to 100% ( 8) .
furthermore , it appears that non - enhanced t2-weighted imaging is useful in the setting of aki because of the risk of nephrogenic systemic fibrosis . like endometriosis
moreover , because the growth of adenomyotic tissue is associated with a hyperestrogenic state , hormonal therapy based on progesterones , oral contraceptive pills , anti - estrogens , or gnrh agonists could be useful .
our patient did not experience recurrent dic after gnrh agonist treatment , which creates a hypoestrogenic environment .
thus , hormonal therapy might prevent further dic aggravation , especially when hysterectomy is contraindicated in patients with multiple organ failures .
adenomyosis is a common disorder that present in 20 - 35% of women undergoing hysterectomy for benign gynecological disorders . presenting symptoms include an enlarged uterus , menorrhagia , and dysmenorrhea .
infertility is a less frequent complaint because the majority of cases are diagnosed in their fourth and fifth decades of life .
however , because an increasing number of women now postpone their first pregnancy until the late thirties , adenomyosis is being encountered more frequently in infertility clinics ( 10 ) . summarizing , we experienced a case of adenomyosis in a 40-yr - old woman who developed aki due to menstruation - related dic development after gonadotropin administration
. physicians should be aware that gonadotropin can provoke fulminant dic in women with adenomyosis . | ### Summary:
: the authors report a case of acute kidney injury ( aki ) resulting from menstruation - related disseminated intravascular coagulation ( dic ) in an adenomyosis patient .
a 40-yr - old woman who had received gonadotropin for ovulation induction therapy presented with anuria and an elevated serum creatinine level .
her medical history showed primary infertility with diffuse adenomyosis . on admission , her pregnancy test was negative and her menstrual cycle had started 1 day previously .
laboratory data were consistent with dic , and it was believed to be related to myometrial injury resulting from heavy intramyometrial menstrual flow .
gonadotropin is considered to play an important role in the development of fulminant dic .
this rare case suggests that physicians should be aware that gonadotropin may provoke fulminant dic in women with adenomyosis . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: valvular heart disease is responsible for more than 22 000 deaths each year in the united states . in particular ,
aortic stenosis is a progressive condition known to carry a high shortterm mortality once patients become symptomatic .
risk factors have been described previously and include male sex , smoking , hypertension , elevated lowdensity lipoprotein cholesterol ( ldl ) , coronary atherosclerosis , congenital bicuspid valve , and advanced age . until recently , surgical replacement of the aortic valve was the only treatment proven to alter prognosis .
this left a large number of elderly patients with multiple comorbidities without a viable treatment option due to excessive surgical risk ; however , the recent introduction of transcatheter aortic valve replacement ( tavr ) has offered an effective alternative for these patients . as the population of treatment candidates expands , attention will be directed appropriately to assure equity in delivery of therapy . in several surgical series of aortic valve stenosis
it is unknown , however , whether this underrepresentation reflects racial differences in the prevalence of severe aortic valve stenosis by race or difference in intervention rate of those diagnosed with severe aortic valve stenosis .
therefore , we compared the prevalence of severe aortic stenosis in african americans and caucasians at a large , tertiary care medical center .
the synthetic derivative is a database of 2.1 million deidentified records from all patients in the electronic medical record at vanderbilt university medical center , a large tertiary care center in nashville , tennessee .
all documented patient encounters at the medical center are stripped of identifying information and uploaded via a oneway hash to the synthetic derivative where they can be searched based on structured ( laboratory values , id9/cpt codes , demographics , etc . ) and unstructured ( text strings in narrative documents and reports ) data . as patient data
does not contain any identifying information , use of synthetic derivative is classified as nonhuman research by vanderbilt university 's institutional review board and approval was given for this study .
all records in the synthetic derivative were queried for documentation of an echocardiogram and race .
patients were then screened and individually reviewed for diagnosis of severe aortic stenosis , age at diagnosis , aortic valve area at diagnosis , and underlying etiology of disease .
criteria for documentation of an echocardiogram and confirmation of severe aortic stenosis are detailed in table 1 .
records that fulfilled search criteria for echocardiogram had a greater than 75% rate of having true documentation of an echocardiogram and approximately 90% of the 3500 patients with mention of severe aortic stenosis in their chart were identified using this search criteria .
race was classified using observerreported determination , which has been shown to have > 92% concordance with selfreported race and ancestry based on genetic biomarkers .
criteria for inclusion in study populations search criteria for identification of patients in the study population is shown . a combination of keyword search , demographics qualifiers , and manual review was used .
any clinical document includes clinical notes , procedure reports , radiology reports , problem lists , clinical communications , discharge summaries , patient letters , pathology reports or rehabilitation reports . to address the possibility that caucasians with severe valvular disease were more likely to be referred for echocardiogram compared with african americans with severe valvular disease , another valvular condition , severe mitral regurgitation ,
multiple traditional risk factors for aortic stenosis including sex , race , age , body mass index ( bmi ) , ldl , creatinine , diabetes , hypertension , coronary artery disease , and statin use were assessed .
criteria for determination of each condition are shown in table 2 with details of synthetic derivative search criteria for diabetes , hypertension , coronary artery disease , and statin use available in table 3 .
manual review of 500 patients with each definitive classification of a categorical variable was done ( eg , 500 patients who were classified as having diabetes , 500 patients who were classified as not having diabetes , etc . ) with accuracy ranging from 95% to 100% for each risk factor classification tested .
clinical judgment , shown in table 4 , was used to exclude incorrectly documented values .
each risk factor was then categorized based on percent of patients with definitive diagnosis or laboratory measure available , shown in table 5 .
method for determination of each demographic or risk factor the method of determining the demographic group or presence of a risk factor is shown .
a combination of direct data export , export of laboratory or clinical measurement , and synthetic derivative queries was used in collecting risk factor data .
details of synthetic derivative queries for coronary artery disease , hypertension , and diabetes are shown in table 3 .
bmi indicates body mass index ; ldl , lowdensity lipoprotein . defined as outpatient clinic visit , inpatient consultation , or documentation of vital signs .
synthetic derivative search criteria for risk factor determination full synthetic derivative search criteria for hypertension , diabetes coronary artery disease and statin use are shown below .
a combination of keyword search within problem lists and clinical charts , icd9 codes , cpt codes and medication searches was used for each risk factor .
clinical documents includes clinical notes , procedure reports , radiology reports , problem lists , clinical communications , discharge summaries , patient letters , pathology reports or rehabilitation reports .
data exclusion criteria for inaccurately reported data clinical criteria shown here was used to exclude incorrectly documented measurements .
classification of comorbidities based on data available comorbidities were classified based on percent of patients with data available for that comorbidity .
multiple imputation incorporating severe aortic stenosis and all complete risk factors was used to predict the seldommissed risk factors to allow for their inclusion in final analysis .
binary logistic regression was used to predict diabetes , hypertension , and coronary artery disease with random draws under fitted probability models used for imputation .
the age effect was nonlinear in all models while creatinine was imputed using a linear model with random residuals added to mean predicted values .
the absolute number of complete cases was sizeable so the coefficients for imputed variables and race did not vary significantly across trials ( table 6 ) .
variation in coefficients for race and imputed risk factor between different draws of imputation model coefficients for the association between race and imputed risk factors are shown below for 5 consecutive draws .
the coefficients do not vary significantly between draws indicating variations due to random draw do not significantly affect the output of the model .
cad indicates coronary artery disease . a binary logistic model based on the complete and seldommissed comorbidities
age and creatinine were modeled as continuous variables and fitted using a restricted cubic spline as to not assume linear relationships between them and severe aortic stenosis .
the interaction between race and all other comorbidities was assessed to determine if race significantly affected any other comorbidities ' prediction of severe aortic stenosis and no significant interactions were found .
this entire analysis was repeated for specific etiologies of severe aortic stenosis calcific degeneration and bicuspid valve to determine if the race relationship was present with common etiologies of severe aortic stenosis .
all analyses were done using the statistical programming language r , version 3.0.1 and the r rms package .
the synthetic derivative is a database of 2.1 million deidentified records from all patients in the electronic medical record at vanderbilt university medical center , a large tertiary care center in nashville , tennessee .
all documented patient encounters at the medical center are stripped of identifying information and uploaded via a oneway hash to the synthetic derivative where they can be searched based on structured ( laboratory values , id9/cpt codes , demographics , etc . ) and unstructured ( text strings in narrative documents and reports ) data . as patient data
does not contain any identifying information , use of synthetic derivative is classified as nonhuman research by vanderbilt university 's institutional review board and approval was given for this study .
all records in the synthetic derivative were queried for documentation of an echocardiogram and race .
patients were then screened and individually reviewed for diagnosis of severe aortic stenosis , age at diagnosis , aortic valve area at diagnosis , and underlying etiology of disease .
criteria for documentation of an echocardiogram and confirmation of severe aortic stenosis are detailed in table 1 .
records that fulfilled search criteria for echocardiogram had a greater than 75% rate of having true documentation of an echocardiogram and approximately 90% of the 3500 patients with mention of severe aortic stenosis in their chart were identified using this search criteria .
race was classified using observerreported determination , which has been shown to have > 92% concordance with selfreported race and ancestry based on genetic biomarkers .
criteria for inclusion in study populations search criteria for identification of patients in the study population is shown . a combination of keyword search , demographics qualifiers , and manual review was used .
any clinical document includes clinical notes , procedure reports , radiology reports , problem lists , clinical communications , discharge summaries , patient letters , pathology reports or rehabilitation reports . to address the possibility that caucasians with severe valvular disease were more likely to be referred for echocardiogram compared with african americans with severe valvular disease , another valvular condition , severe mitral regurgitation ,
multiple traditional risk factors for aortic stenosis including sex , race , age , body mass index ( bmi ) , ldl , creatinine , diabetes , hypertension , coronary artery disease , and statin use were assessed .
criteria for determination of each condition are shown in table 2 with details of synthetic derivative search criteria for diabetes , hypertension , coronary artery disease , and statin use available in table 3 .
manual review of 500 patients with each definitive classification of a categorical variable was done ( eg , 500 patients who were classified as having diabetes , 500 patients who were classified as not having diabetes , etc . ) with accuracy ranging from 95% to 100% for each risk factor classification tested .
clinical judgment , shown in table 4 , was used to exclude incorrectly documented values .
each risk factor was then categorized based on percent of patients with definitive diagnosis or laboratory measure available , shown in table 5 .
method for determination of each demographic or risk factor the method of determining the demographic group or presence of a risk factor is shown .
a combination of direct data export , export of laboratory or clinical measurement , and synthetic derivative queries was used in collecting risk factor data .
details of synthetic derivative queries for coronary artery disease , hypertension , and diabetes are shown in table 3 .
bmi indicates body mass index ; ldl , lowdensity lipoprotein . defined as outpatient clinic visit , inpatient consultation , or documentation of vital signs .
synthetic derivative search criteria for risk factor determination full synthetic derivative search criteria for hypertension , diabetes coronary artery disease and statin use are shown below . a combination of keyword search within problem lists and clinical charts , icd9 codes , cpt codes and medication searches was used for each risk factor .
clinical documents includes clinical notes , procedure reports , radiology reports , problem lists , clinical communications , discharge summaries , patient letters , pathology reports or rehabilitation reports .
data exclusion criteria for inaccurately reported data clinical criteria shown here was used to exclude incorrectly documented measurements .
classification of comorbidities based on data available comorbidities were classified based on percent of patients with data available for that comorbidity .
multiple imputation incorporating severe aortic stenosis and all complete risk factors was used to predict the seldommissed risk factors to allow for their inclusion in final analysis .
binary logistic regression was used to predict diabetes , hypertension , and coronary artery disease with random draws under fitted probability models used for imputation .
the age effect was nonlinear in all models while creatinine was imputed using a linear model with random residuals added to mean predicted values .
the absolute number of complete cases was sizeable so the coefficients for imputed variables and race did not vary significantly across trials ( table 6 ) .
variation in coefficients for race and imputed risk factor between different draws of imputation model coefficients for the association between race and imputed risk factors are shown below for 5 consecutive draws .
the coefficients do not vary significantly between draws indicating variations due to random draw do not significantly affect the output of the model .
a binary logistic model based on the complete and seldommissed comorbidities was used to model the probability of severe aortic stenosis .
age and creatinine were modeled as continuous variables and fitted using a restricted cubic spline as to not assume linear relationships between them and severe aortic stenosis .
the interaction between race and all other comorbidities was assessed to determine if race significantly affected any other comorbidities ' prediction of severe aortic stenosis and no significant interactions were found .
this entire analysis was repeated for specific etiologies of severe aortic stenosis calcific degeneration and bicuspid valve to determine if the race relationship was present with common etiologies of severe aortic stenosis .
all analyses were done using the statistical programming language r , version 3.0.1 and the r rms package .
347 126 of the 2 163 553 patients in the synthetic derivative had documentation of an echocardiogram , of which 272 525 patients including 222 976 caucasians ( 81.8% ) and 36 681 african americans ( 13.5% ) had race denoted .
of these patients , 2598 patients including 2030 ( 0.91% ) caucasians and 106 ( 0.29% ) african americans had severe aortic stenosis and 3614 including 3013 ( 1.35% ) caucasian and 532 ( 1.45% ) african americans had severe mitral regurgitation .
baseline characteristics of the echocardiogram population by race are shown in figure 1 and table 7 .
the mean age of africanamerican patients was slightly lower than caucasian and a larger proportion of africanamerican patients were female . significantly more african americans had hypertension and diabetes while the mean creatinine and bmi were slightly higher for africanamerican patients .
african americans and caucasians had similar ldl cholesterol levels while caucasians were taking statins and had coronary artery disease more often .
baseline characteristic for the echocardiogram population are shown , stratified by race , for continuous risk factors .
baseline characteristic of echocardiogram population by race for categorical characteristics baseline characteristic for the echocardiogram population are shown , stratified by race , for categorical risk factors .
caucasian subjects were more likely to be male , have coronary artery disease and be prescribed statins while african americans are more likely to have diabetes and hypertension .
cad indicates coronary artery disease ; dm , diabetes mellitus ; htn , hypertension . table 8 and figure 2 show the likelihood of severe aortic stenosis for each demographic group and based on presence of each risk factor .
correlates of severe aortic stenosis included caucasian race , male sex , statin use , increased creatinine , extremes in age , presence of diabetes , presence of hypertension , and presence of coronary artery disease .
these relationships were also seen in etiologyspecific analysis looking specifically at severe calcific degenerative disease and bicuspid valve disease . the likelihood of severe aortic stenosis , severe aortic stenosis due to calcific degeneration of tricuspid aortic valve , and severe aortic stenosis due to bicuspid valve disease given each categorical risk factor the overall and etiologyspecific probability of severe aortic stenosis based on presence of each risk factor or demographic is shown . among patient with a given risk factor classification
, the proportion of patients with severe aortic stenosis , severe aortic stenosis due to calcific degeneration of a native tricuspid valve , and severe aortic stenosis due to a bicuspid aortic valve are shown with the overall odds ratio for the difference .
group with higher probability of severe aortic stenosis included males , caucasians , those with hypertension , diabetes mellitus , or coronary artery disease , and those prescribed statins .
bvd indicates proportion with severe aortic stenosis due to bicuspid valve disease ; cdt , proportion with severe aortic stenosis due to calcific degeneration of tricuspid aortic valve ; sas , proportion with severe aortic stenosis . or : crude odd ratio for developing severe aortic stenosis given a demographic or presence of a risk factor unadjusted for any other factors .
the overall and etiologyspecific probability of severe aortic stenosis as a function of age , creatinine , and bmi , unadjusted for other risk factors , is shown .
older patients and patients with higher creatinine had a higher probability of having severe aortic stenosis .
adjusted for sex , statin use , diabetes , hypertension , age , coronary artery disease , and creatinine , the association of africanamerican race with lower risk for severe aortic stenosis remained significant ( or 0.41 , 95% ci [ 0.33 , 0.50 ] ) .
the effect of race and age on prevalence of severe aortic stenosis is shown in figure 3 .
the decreased prevalence of severe aortic stenosis in african americans was present and consistent at all ages .
the probability of severe aortic stenosis with 95% confidence interval as a function of age for african americans and caucasians , adjusted for other risk factors , is shown here with distribution of patient ages noted at top .
the difference in probability of severe aortic stenosis between the two races is present and significant at all ages .
the partial effects of each risk factor and demographic group on the probability of severe aortic stenosis are shown in figure 4 .
odds ratios with confidence intervals for categorical risk factors and p values for continuous risk factors are shown .
age was the most significant risk factor while coronary artery disease , diabetes , race , and creatinine were also significant predictors .
the partial effect of each risk factor and demographic group on the probability of severe aortic stenosis is shown below .
odds ratios with 95% confidence intervals are shown for categorical values and p values are shown for continuous variable .
age had the greatest effect followed by coronary artery disease , diabetes , race , and creatinine .
etiologyspecific analyses shown in figures 5 and 6 revealed that the association of africanamerican race with lower risk of severe aortic stenosis persisted for both bicuspid aortic valve ( or 0.13 [ 0.02 , 0.80 ] ) and calcific degeneration of native tricuspid aortic valve ( or 0.47 [ 0.36 , 0.61 ] ) .
the probability of bicuspid aortic valve appeared to have an agedependent relationship with africanamericans children spared and the peak probability of severe aortic stenosis due to bicuspid valve occurring at a younger age in african americans ; however , only a small number of african americans had bicuspid severe aortic stenosis and the age relationship in african americans may be artifact .
still , african americans who developed severe aortic stenosis were significantly less likely to have congenitally bicuspid valve as their underlying etiology ( or 0.49 [ 0.29 , 0.85 ] ) .
probability of senile calcific severe aortic stenosis by race and age . the probability of senile calcific severe aortic stenosis with 95% confidence interval as a function of age for african americans and caucasians
the difference in probability of senile calcific severe aortic stenosis between the two races is present and significant at all ages .
the probability of bicuspid severe aortic stenosis with 95% confidence interval as a function of age for african americans and caucasians is shown here with distribution of patient ages noted at top .
the difference in probability of bicuspid severe aortic stenosis between the two races is present at all ages .
in summary , this study shows that african americans are significantly less likely to have severe aortic stenosis than caucasian individuals .
the difference can not be explained by traditional risk factors , age , or etiology of aortic valve disease .
a few smaller studies have commented on the relationship between race and aortic valve disease .
novaro and colleagues found that , among individuals referred for cardiac surgery , african americans had significantly less aortic stenosis , aortic valve calcification , degenerative aortic valve disease , and bicuspid aortic valves and more pathologically normal aortic valves than caucasian individuals .
likewise , yeung and colleagues reported that 10% of patients evaluated for aortic valve replacement in their hospital were african american , despite the fact that 37% of individuals in their overall population were african american .
unlike prior studies that have focused on surgical populations , this study assessed the overall and etiologyspecific prevalence of severe aortic stenosis in all patients undergoing echocardiography .
racial differences in comorbid medical conditions including traditional risk factors for aortic stenosis were extensively analyzed and controlled for using multivariable statistical analysis .
not surprisingly , many known risk factors ( age , statin use , diabetes , hypertension , and coronary artery disease ) were risk factors for severe aortic stenosis in this study sample ; however , none of these factors could explain the lower prevalence of severe aortic stenosis in african americans , and caucasian race remained an independent risk factor for severe aortic stenosis .
individual analysis of the two most common etiologies of severe aortic stenosis degenerative calcification of a tricuspid aortic valve and stenosis of a congenitally bicuspid aortic valve
moreover , african americans with severe aortic stenosis were less likely to have bicuspid valve as their underlying etiology .
this is consistent with the previously reported findings that african americans have a drastically lower risk of bicuspid aortic valves .
criteria were set to ensure that the diagnosis of severe aortic stenosis had high specificity .
singlereviewer manual chart review was used for each patient with severe aortic stenosis to ensure the diagnosis was made based on established guidelines on minimal valve area ( < 1 cm ) or that the stenosis was severe enough to necessitate valve replacement .
previously documented racial differences in prevalence of comorbid conditions were again identified in the overall echocardiogram population . to further test for unforeseen bias against african americans with severe valvular disease ,
the rate of severe mitral regurgitation in the study population was similar ( 1.45% for african americans , 1.35% for caucasians ) indicating that baseline valvular pathologies were diagnosed at equal rates .
the cohort included only patients with clinically indicated echocardiograms at a large academic referral center and may be biased toward patients with more severe disease .
also , risk factors were classified through chart review and thus subject to providerbyprovider variations in definition and documentation of comorbid conditions , although there is no reason to believe one race would be affected more than another .
while numerous studies have identified single nucleotide polymorphisms associated with aortic valve calcification , no studies have noted racial differences in genetic risk factors for the disease .
previous studies have assessed racial difference in aortic valve calcification and thickness but no differences between african americans and caucasians were identified .
differences , however , have been noted in coronary artery calcification with african americans significantly less likely to have calcification than whites , although this difference has not been associated with decreased risk of coronary heart disease .
further understanding of the genetics and environmental factors underlying the racial difference in prevalence of severe aortic stenosis may result in novel preventative measures , early detection strategies , and therapeutic targets for the condition .
this study utilized a large research medical record to show that african americans have a significantly lower prevalence of severe aortic stenosis than caucasians .
this difference can not be explained by traditional risk factors and is present at all ages and for both common etiologies .
further genetic and laboratory investigation is warranted to determine the underlying mechanism for the lower prevalence .
the dataset used for the analyses described were obtained from vanderbilt university medical center 's synthetic derivative , which is supported by institutional funding and by the vanderbilt ctsa grant ultr000445 from ncats / nih . | ### Summary:
: backgroundin an era of expanded treatment options for severe aortic stenosis , it is important to understand risk factors for the condition .
it has been suggested that severe aortic stenosis is less common in african americans , but there are limited data from large studies.methods and resultsthe synthetic derivative at vanderbilt university medical center , a database of over 2.1 million deidentified patient records , was used to identify individuals who had undergone echocardiography .
the association of race with severe aortic stenosis was examined using multivariable logistic regression analyses adjusting for conventional risk factors .
of the 272 429 eligible patients ( mean age 45 years , 44% male ) with echocardiography , 14% were african american and 82% were caucasian .
severe aortic stenosis was identified in 106 ( 0.29% ) africanamerican patients and 2030 ( 0.91% ) caucasian patients ( crude or 0.32 , 95% ci [ 0.26 , 0.38 ] ) .
this difference persisted in multivariableadjusted analyses ( or 0.41 [ 0.33 , 0.50 ] , p<0.0001 ) .
africanamerican individuals were also less likely to have severe aortic stenosis due to degenerative calcific disease ( adjusted or 0.47 [ 0.36 , 0.61 ] ) or congenitally bicuspid valve ( crude or 0.13 [ 0.02 , 0.80 ] , adjusted or dependent on age ) .
referral bias against those with severe valvular disease was assessed by comparing the prevalence of severe mitral regurgitation in caucasians and african americans and no difference was found.conclusionsthese findings suggest that african americans are at significantly lower risk of developing severe aortic stenosis than caucasians . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: subependymoma is a rare , benign and slow - growing glial tumor that accounts for just 0.2 - 0.7% of all intracranial tumors and approximately 8% of ependymal neoplasms ( 1 - 3 ) .
matsumura et al . ( 4 ) reported that the frequency of intracerebral subependymomas was 0.4% in 1000 serial routine autopsies .
although these tumors can occur in all age groups and both sexes , they tend to be more common in middle - aged to older individuals with a slight male predilection .
most are clinically silent , and the symptoms depend on tumor location and size . in some cases , especially when the tumors are larger , the symptoms are the result of increased intracranial pressure due to obstructive hydrocephalus ( 1 , 5 ) . subependymomas most frequently arise in the fourth ventricle ( 50 - 60% ) , followed by the lateral ventricle ( 30 - 40% ) , and less frequently in the septum pellucidum and spinal cord ( 3 , 6 ) .
intraparenchymal subependymomas are extremely rare ; only 6 cases have been reported in english literature .
all of them were located in the supratentorial region ( 3 , 7 - 9 ) , and there has been no report of infratentorial subependymoma . here
, we describe the clinical and radiological feature of the first known case of infratentorial and intraparenchymal subependymoma arising in the cerebellum .
a 28-year - old man was referred to our institution for a brain tumor that was detected on brain computed tomography ( ct ) performed at an outside hospital for intermittent headache .
he had other non - neurologic symptoms , other than intermittent headache , for the past 1 year .
pre - contrast ct revealed a well - defined cystic and solid intraaxial mass with internal calcifications in the cerebellum , which measured 4.3 3.5 cm ( fig . 1a ) . magnetic resonance image ( mri ) revealed a mural nodule within the cystic mass .
the mural nodule showed iso - to - hypointensity ( relative to normal white matter ) with multiple nodular high - signal intensities , suggesting calcifications on the t1-weighted image and hyper intensity on the t2-weighted image ( fig .
there was no evidence of peritumoral edema around the mass and no enhancement of the mural nodule or cyst wall on the gadolinium - enhanced t1-weighted image .
diffusion - weighted image showed iso- or low - signal intensity without diffusion restriction while the same lesion was increased adc relative to brain parenchyma ( fig .
the mass was located near and displaced the fourth ventricle ; however , it did not communicate with the ventricle , and normal parenchyma was clearly identified between the mass and the fourth ventricle on the thin - section three - dimensional t1-weighted images ( fig .
cerebral angiograms demonstrated a rather hypovascular mass ; neither feeding vessels nor tumor staining was visualized ( fig .
the cerebellum showed mild bulging , and a yellowish - colored mass was identified via a supracerebellar approach . during the dissection of the mass from the cerebellum ,
fluid gushed out from patchy gray mass , which was composed of a gelatinous material . within the surgical field
, there was a sharp demarcation between the mass and the surrounding normal tissue , and there was no evidence that the mass was connected with the fourth ventricle .
histopathological analysis revealed a clustered cellular neoplastic proliferation with islands of high nuclear density and dense and abundant fibrillary matrices .
the tumor cell nuclei were round and isomorphic , but active mitosis was not observed ( fig .
immunohistochemical analyses were positive for glial fibrillary acidic protein and epithelial membrane antigen and negative for ki-67 , which supported the diagnosis of subependymoma .
the postoperative follow - up mri revealed a total removal of the tumor resection ; the normal cerebellar tissue remained well between the fourth ventricle and the postoperative parenchymal defect .
subependymomas are at the benign end of the tumor spectrum and account for just 0.2 - 0.7% of all intracranial tumors ( 1 ) .
the world health organization classification system recognizes 4 types of ependymal neoplasms , including subependymoma and myxopapillary ependymoma ( grade 1 ) , ependymoma and its variants ( cellular , papillary , clear cell and tanycytic subtypes ) ( grade 2 ) and anaplastic ependymoma ( grade 3 ) ( 9 ) .
these tumors arise most frequently in the fourth ventricle ( 50 - 60% ) , followed by the lateral ventricle ( 30 - 40% ) ; less frequent sites of origin are in the third ventricle , septum pellucidum and spinal cord , which is understandable given their proposed cellular origins ( 3 ) .
numerous cell types have been proposed to be the cell of origin for subependymomas , including ependymal - glial precursor cells or bipotential subependymal cells , with the ability to differentiate into either ependymal cells or astrocytes , astrocytes of the subependymal plate or a mixture of astrocytes and ependymal cells .
other potential hypotheses propose that subependymomas arise from hamartomatous lesions or as a reaction to chronic ependymitis ( 3 , 4 ) .
a review of the english literature identified only 6 case reports of subependymomas , all of which were in intraparenchymal locations ( table 1 ) .
specifically , all 6 were supratentorial subependymomas : 2 parietal ( 8 , 9 ) , 1 parietooccipital ( 3 ) , 1 temporal ( 3 ) and 1 frontal ( 7 ) .
ependymal cell rests , which are frequently found at the angle of the ventricles where ependymal cells extend deep into the adjacent white matter , have been hypothesized as the origin of these neoplasms ( 9 , 10 ) .
however , even if the fourth ventricle is the most common location of subependymomas , the fact that there is no cerebellar subependymoma adjacent to the fourth ventricle suggests other causes .
we speculate that the tumor may have arisen from ependymal - glial precursor or bipotential subependymal cells around the fourth ventricle , and that the relatively scanty white matter supported exophytic growth in the cerebellum .
common imaging findings of subependymomas include observations of a well - demarcated , lobulated mass , which are usually composed of solid or occasionally mixed components , including cystic or microcystic degeneration .
most subependymomas appear as hypo- or isodense masses on unenhanced ct , hypo- to isointense on t1-weighted mri and hyperintense on t2-weighted mri ( 3 ) .
calcification is noted in 32 - 50% of cases , and can be a differentiating feature between the lateral and fourth ventricular subependymomas . in many reports ,
intratumoral calcifications have been reported to be more a frequent finding in infratentorial subependymomas , whereas it is an unusual finding in the lateral ventricle subependymomas ( 11 ) .
contrast - enhanced ct or mri usually show minimal or no enhancement and infrequently reveal a heterogeneous enhancement .
angiography demonstrates an avascular or hypovascular mass that may cause a mass effect on the surrounding cerebrovasculature .
therefore , peritumoral edema , mass effect , dense enhancement , high vascularity and intratumoral hemorrhage are rare findings in subependymomas ( 3 , 11 ) .
the involvement of the cerebellar hemisphere presenting radiologically as a solid and cystic mass , pilocytic astrocytoma , hemagioma , hemangioblastoma , ganglioglioma , ependymoma and subependymoma should be included in differential diagnosis .
slight or lack of enhancement on ct or mri should arouse the suspicion of subependymoma . in our case , mri showed a cystic and solid mass that included multiple dot - like low - signal intensities on t1-weighted and flair images , which was suggestive of a microcystic portion within the solid component .
there was no evidence of mass effect , obstructive hydrocephalus , peritumoral edema or intratumoral hemorrhage .
thus , with the exception of the intraparenchymal location , all imaging findings corresponded with the diagnosis of subependymoma .
the purposes of the surgery are tumor resection , decompression of neural elements , establishment of a pathological diagnosis and restoration of normal cerebrospinal fluid pathways ; however , the extent of the resection does not appear to influence the survival rates .
patient age is the only variable associated with survival ; those older than 50 years have a worse prognosis ( 1 ) .
intraparenchymal subependymoma is extremely rare ; yet , if imaging features are suggestive of subependymoma in a cerebellar tumor , we should not exclude the possibility of subependymoma .
it has distinguishing clinical and radiological features , but they are not pathognomic . although making a preoperative diagnosis was difficult , preoperative suspicion of subependymoma is very important for surgical planning , given its benign nature and good prognosis .
intraparenchymal subependymoma is extremely rare ; yet , if imaging features are suggestive of subependymoma in a cerebellar tumor , we should not exclude the possibility of subependymoma .
it has distinguishing clinical and radiological features , but they are not pathognomic . although making a preoperative diagnosis was difficult , preoperative suspicion of subependymoma is very important for surgical planning , given its benign nature and good prognosis . | ### Summary:
: subependymomas are rare benign tumors located in the ventricular system .
intraparenchymal subependymoma is extremely rare ; only 6 cases have been reported , and all were located in the supratentorial region .
we describe a case of infratentorial , intraparenchymal subependymoma in a 28-year - old man with intermittent headache .
imaging revealed a well - demarcated cystic and solid cerebellar mass near the fourth ventricle .
the mass had a microcystic component and calcification without contrast enhancement .
complete surgical excision was performed , and histopathology confirmed a subependymoma . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: from october 2010 to september 2012 , 100 patients ( mean age 3.87 years ) with biliary atresia were enrolled consecutively who had undergone kasai hepatoportoenterostomy but had not received liver transplantation .
te was not performed for the patients who were experiencing acute cholangitis , hepatic failure , and significant ascites .
patients whose thoracic perimeter was > 75 cm were excluded , because we were to evaluate the characteristics of pediatric patients with small body size .
patients height , weight , and thoracic perimeter were measured , and body mass index was calculated . te and laboratory tests , including complete blood cell count and aspartate aminotransferase assessment , were performed on the same day .
the aspartate aminotransferase - to - platelet ratio index ( apri ) , one of the validated noninvasive markers of liver fibrosis , was calculated and compared with the results of te ( 6 ) .
the present study protocol was approved by the institutional review board of the severance children 's hospital . te ( fibroscan , echosens , paris , france )
was performed by 1 well - trained and experienced nurse who was not informed of patients clinical data ( 7,8 ) .
the m probe has a transducer with a diameter of 7 mm and can measure 35 to 75 mm depth of the liver , whereas the s1 and s2 probes have transducers of 5 mm diameter ( to accommodate the narrow intercostal space of children ) and are designed to measure 15 to 40 and 20 to 50 mm depth of the liver , respectively .
the ultrasonic frequency of m probe is set at 3.5 mhz , and that of s1 and s2 probes is set at 5 mhz because of the thinner tissue between skin and the liver parenchyma .
the measurements were performed by placing a probe tip on the intercostal space at the area of the right lobe of the liver .
the optimal target area was selected by ultrasound examination , avoiding large vascular structures . te measurements were conducted according to the manufacturer 's recommendations without administering sedative drugs .
all of the patients were examined with the 3 types of probes even though the manufacturer had recommended a single suitable probe for the patients thoracic perimeter ( s1 probe for 45 cm , s2 probe for 4575 cm , and m probe for > 75 cm ) .
liver stiffness was measured repeatedly using the s1 , s2 , and m probes in each patient for obtaining > 10 valid measurements per probe .
success rates ( the ratio of valid shots to the total number of shots ) with the probes were recorded and analyzed . for determining reproducibility of measurements , interquartile range
patients were divided into 2 groups based on their thoracic perimeter ( 45 and > 45 cm ) .
liver stiffness measurement ( lsm ) , success rate , and iqr / lsm of each probe in both groups were compared using a mixed model ( post hoc bonferroni correction ) .
intraclass correlation coefficient ( icc ) analyses were performed to evaluate the reliability of lsm between different probes in each patient group .
a bland - altman plot was drawn to determine the reproducibility and reliability of measurements .
all statistical analyses were performed using pasw statistics software ( version 18.0 , spss inc , chicago , il ) .
from october 2010 to september 2012 , 100 patients ( mean age 3.87 years ) with biliary atresia were enrolled consecutively who had undergone kasai hepatoportoenterostomy but had not received liver transplantation .
te was not performed for the patients who were experiencing acute cholangitis , hepatic failure , and significant ascites .
patients whose thoracic perimeter was > 75 cm were excluded , because we were to evaluate the characteristics of pediatric patients with small body size .
patients height , weight , and thoracic perimeter were measured , and body mass index was calculated . te and laboratory tests , including complete blood cell count and aspartate aminotransferase assessment , were performed on the same day .
the aspartate aminotransferase - to - platelet ratio index ( apri ) , one of the validated noninvasive markers of liver fibrosis , was calculated and compared with the results of te ( 6 ) .
the present study protocol was approved by the institutional review board of the severance children 's hospital .
te ( fibroscan , echosens , paris , france ) was performed by 1 well - trained and experienced nurse who was not informed of patients clinical data ( 7,8 ) .
the m probe has a transducer with a diameter of 7 mm and can measure 35 to 75 mm depth of the liver , whereas the s1 and s2 probes have transducers of 5 mm diameter ( to accommodate the narrow intercostal space of children ) and are designed to measure 15 to 40 and 20 to 50 mm depth of the liver , respectively .
the ultrasonic frequency of m probe is set at 3.5 mhz , and that of s1 and s2 probes is set at 5 mhz because of the thinner tissue between skin and the liver parenchyma .
the measurements were performed by placing a probe tip on the intercostal space at the area of the right lobe of the liver .
the optimal target area was selected by ultrasound examination , avoiding large vascular structures . te measurements were conducted according to the manufacturer 's recommendations without administering sedative drugs .
all of the patients were examined with the 3 types of probes even though the manufacturer had recommended a single suitable probe for the patients thoracic perimeter ( s1 probe for 45 cm , s2 probe for 4575 cm , and m probe for > 75 cm ) .
liver stiffness was measured repeatedly using the s1 , s2 , and m probes in each patient for obtaining > 10 valid measurements per probe .
success rates ( the ratio of valid shots to the total number of shots ) with the probes were recorded and analyzed . for determining reproducibility of measurements , interquartile range ( iqr)/median liver stiffness was recorded .
patients were divided into 2 groups based on their thoracic perimeter ( 45 and > 45 cm ) .
liver stiffness measurement ( lsm ) , success rate , and iqr / lsm of each probe in both groups were compared using a mixed model ( post hoc bonferroni correction ) .
intraclass correlation coefficient ( icc ) analyses were performed to evaluate the reliability of lsm between different probes in each patient group .
a bland - altman plot was drawn to determine the reproducibility and reliability of measurements .
all statistical analyses were performed using pasw statistics software ( version 18.0 , spss inc , chicago , il ) .
among the 100 patients , 26 were assigned to the small thoracic perimeter group ( 45 cm ) and 74 were assigned to the large thoracic perimeter group ( > 45 cm ) .
age , height , weight , and body mass index differed among the groups ( p < 0.05 ) , but apri and lsm did not .
success rates of the s1 , s2 , and m probes were 96.9% 4.4% , 93.6% 6.7% , and 91.0% 9.2% , respectively , in patients with a small thoracic perimeter ; the corresponding values were 99.3% 2.7% , 96.8% 5.9% , and 97.0% 5.0% , respectively , in patients with a large thoracic perimeter .
the success rate of the s1 probe was significantly higher than that of the m probe in the small thoracic perimeter group ( p < 0.01 )
. success rates ( a ) and iqr / lsm ratios ( b ) of s1 , s2 , and m probes in the large thoracic perimeter group and the small thoracic perimeter group .
( ) success rate of the s1 probe was significantly higher than that of the m probe in the small thoracic perimeter group ( p = 0.0016 ) .
the iqr / lsm ratios with the s1 , s2 , and m probes were calculated to assess the reliability of the test .
the results were 0.23 0.15 , 0.20 0.13 , and 0.26 0.16 , respectively , in the small thoracic perimeter group and 0.17 0.10 , 0.14 0.09 , and 0.17 0.09 , respectively , in the large thoracic perimeter group .
the mean iqr / lsm was larger in the small thoracic perimeter group ( fig .
icc was used to evaluate the correlation of lsm among the various probes ( table 2 ) . in the small thoracic perimeter group ,
the icc of s1 versus s2 was highest ( 0.98 ) . in the large thoracic perimeter group , the icc of s2 versus m was highest ( 0.88 ) .
regardless of thoracic perimeter , the icc of lsm obtained using every probe showed more than moderate correlation ( icc > 0.50 ) . on the bland - altman plot ,
most points were within 2 standard deviations , thus demonstrating fair consonance between results with the 2 probes ; however , some outliers were noted in patients with large mean lsm ( fig .
2 ) . on a simple scatterplot , s probe seems to show large lsm compared with the m probe ( fig .
3 ) . according to the linear mixed model , lsms ( mean sd ) of the s1 , s2 , and m probes were 20.6 17.9 , 15.4 12.8 , and 12.3 9.8 kpa , respectively ; significant differences were observed among probes : s1 versus s2 ( p < 0.001 ) , s1 versus m ( p < 0.001 ) , and s2 versus m ( p = 0.003 ) .
figure 4 shows distributions of lsm values according to the probe with box - and - whisker plots .
bland - altman plot of the difference in lsm by 2 different probes versus the mean of lsm .
the solid lines indicate mean difference , and dotted lines represent 2 standard deviations between 2 probes . a , s1 and s2 , 5.2 16.8 kpa ; ( b ) s1 and m , 8.3 22.3 kpa ; and ( c ) s2 and m , 3.0 11.8 kpa .
( b ) s2 and m. lsm determined using s1 and s2 probes was higher than that determined using the m probe .
box - and - whisker plot of lsm showing distributions of lsm according to the probe .
the box represents the interquartile range , and the line in the box shows the median value .
the correlation coefficient of apri and lsm measured with the s1 and s2 probes was 0.65 and 0.64 , respectively ; however , the correlation coefficient of apri and lsm measured with m probe in this group showed a relatively low value of 0.49 .
in contrast , in the large thoracic perimeter group , the correlation of apri and lsm was good with all probes ( s1 = 0.68 , s2 = 0.63 , and m = 0.62 ) ( table 3 ) .
among the 100 patients , 26 were assigned to the small thoracic perimeter group ( 45 cm ) and 74 were assigned to the large thoracic perimeter group ( > 45 cm ) .
age , height , weight , and body mass index differed among the groups ( p < 0.05 ) , but apri and lsm did not .
success rates of the s1 , s2 , and m probes were 96.9% 4.4% , 93.6% 6.7% , and 91.0% 9.2% , respectively , in patients with a small thoracic perimeter ; the corresponding values were 99.3% 2.7% , 96.8% 5.9% , and 97.0% 5.0% , respectively , in patients with a large thoracic perimeter .
the success rate of the s1 probe was significantly higher than that of the m probe in the small thoracic perimeter group ( p < 0.01 ) .
success rates ( a ) and iqr / lsm ratios ( b ) of s1 , s2 , and m probes in the large thoracic perimeter group and the small thoracic perimeter group .
( ) success rate of the s1 probe was significantly higher than that of the m probe in the small thoracic perimeter group ( p = 0.0016 ) .
the iqr / lsm ratios with the s1 , s2 , and m probes were calculated to assess the reliability of the test .
the results were 0.23 0.15 , 0.20 0.13 , and 0.26 0.16 , respectively , in the small thoracic perimeter group and 0.17 0.10 , 0.14 0.09 , and 0.17 0.09 , respectively , in the large thoracic perimeter group .
the mean iqr / lsm was larger in the small thoracic perimeter group ( fig .
icc was used to evaluate the correlation of lsm among the various probes ( table 2 ) . in the small thoracic perimeter group ,
the icc of s1 versus s2 was highest ( 0.98 ) . in the large thoracic perimeter group , the icc of s2 versus m was highest ( 0.88 ) .
regardless of thoracic perimeter , the icc of lsm obtained using every probe showed more than moderate correlation ( icc > 0.50 ) . on the bland - altman plot ,
most points were within 2 standard deviations , thus demonstrating fair consonance between results with the 2 probes ; however , some outliers were noted in patients with large mean lsm ( fig .
2 ) . on a simple scatterplot , s probe seems to show large lsm compared with the m probe ( fig .
3 ) . according to the linear mixed model , lsms ( mean sd ) of the s1 , s2 , and m probes were 20.6 17.9 , 15.4 12.8 , and 12.3 9.8 kpa , respectively ; significant differences were observed among probes : s1 versus s2 ( p < 0.001 ) , s1 versus m ( p < 0.001 ) , and s2 versus m ( p = 0.003 ) .
figure 4 shows distributions of lsm values according to the probe with box - and - whisker plots .
bland - altman plot of the difference in lsm by 2 different probes versus the mean of lsm .
the solid lines indicate mean difference , and dotted lines represent 2 standard deviations between 2 probes . a , s1 and s2 , 5.2 16.8 kpa ; ( b ) s1 and m , 8.3 22.3 kpa ; and ( c ) s2 and m , 3.0 11.8 kpa .
correlations among lsms determined using various probes . a , s1 and m ; ( b ) s2 and m. lsm determined using s1 and s2 probes was higher than that determined using the m probe .
box - and - whisker plot of lsm showing distributions of lsm according to the probe .
the box represents the interquartile range , and the line in the box shows the median value .
in the small thoracic perimeter group , the correlation coefficient of apri and lsm measured with the s1 and s2 probes was 0.65 and 0.64 , respectively ; however , the correlation coefficient of apri and lsm measured with m probe in this group showed a relatively low value of 0.49 .
in contrast , in the large thoracic perimeter group , the correlation of apri and lsm was good with all probes ( s1 = 0.68 , s2 = 0.63 , and m = 0.62 ) ( table 3 ) .
determination of the degree of fibrosis in a chronically diseased liver is valuable because it provides physicians the ability to predict the development of liver - related complications .
although histopathologic examination of the liver is regarded as the criterion standard for assessing liver fibrosis ( 9 ) , the invasiveness of the test seriously limits its application .
in particular , repeated examinations on serial follow - up , especially in infants and children , are nearly impossible .
in contrast , te , a physical ( ultrasonographic ) method for evaluating fibrosis , is simple and noninvasive ( 10 ) and has been analyzed in many adults and some pediatric studies ( 2,3,11,12 ) . because of its noninvasiveness , te has already been widely used in children , despite a lack of clinical data . for more valid application ,
studies on normal values have been conducted : a study of a healthy chinese population revealed different normal lsm values , according to sex and age ( 13 ) .
also , engelmann et al reported age - dependent reference values for lsm in children ( 4.405.10 kpa ) that showed high stiffness in older children ( 4 ) . in the present study , we attempted to outline some practical issues when measuring te in small patients . to highlight the impact of small body size ,
patients with biliary atresia of a much younger age than those in previous studies ( 9.11 and 10.7 years vs 3.87 years ) were enrolled ( 2,3 ) .
furthermore , to our knowledge , this is the first direct comparison of s1 , s2 , and m probes .
all of the probes used in both of our thoracic perimeter groups had success rates of > 90% .
this high rate may reflect the skill of our operator , who was well trained and has performed > 15,000 te examinations ( 7,8 ) .
the success rate was higher in the large thoracic perimeter group , which probably illustrates the difficulty of measuring lsm in smaller children .
we also found that in children with a small thoracic perimeter , the success rate of the s1 probe was significantly higher than that of the m probe , thus illustrating that the smaller probe is advantageous for the examination of small children .
the iqr / lsm , the index of reliability and reproducibility ( 14,15 ) , was higher in children with a small thoracic perimeter than in those with a large thoracic perimeter .
although there were no statistically significant differences , the iqr / lsm of the s1 and s2 probes were lower than those of the m probe in children with a small thoracic perimeter , further illustrating the advantage of using the s probes for small patients .
when obtaining lsm in children , irritability or motion can hamper repeated measurement of the same area of the liver , and relatively small structures can make it difficult to identify just the parenchyma of the liver .
furthermore , narrow intercostal space may interrupt the propagation of the elastic shear wave ( 4 ) . in the small thoracic perimeter group ,
the s probes showed better correlation than the m probe with apri , which is known to be correlated with the degree of liver fibrosis ( 6 ) .
although we did not compare the probes with the criterion standard , these findings support the usage of s probe for small children .
for routine application of the s probe , however , there are some issues that need to be clarified . in our study
, lsm tended to decrease with increase in the size of the probes ( s1 > s2 > m ) , as has been reported ( 16,17 ) .
some studies ( 5,18 ) have regarded this phenomenon as overestimation of the s probe ; however , it may reflect underestimation of the m probe on the basis of better correlation between the s probe and apri .
we also found that the tendency toward differences in lsm among the probes used was larger in patients with high lsm , a result similar to that reported previously ( 17 ) .
therefore , caution is needed when interpreting values measured by the s probe and patients with high lsm values .
goldschmidt et al ( 5 ) reported that measuring conditions such as feeding status or general anesthesia can influence the results of te .
one is that we could not keep the same nil per os time before measuring lsm in all of the patients .
, the s probe has distinct merits in its high success rate and good correlation with apri , especially in small children .
therefore , we recommend the use of the s1 probe in patients whose thoracic perimeter is < 45 cm , and if the s probe is not available , the m probe may be acceptable for use in pediatric patients whose thoracic perimeter is > 45 cm .
because of possible differences , lsm values measured with a different probe should not be compared directly . for using lsm as an objective indicator , further clarification of reference ranges or cutoff values for each probe | ### Summary:
: abstractobjectives : with the introduction of smaller probes ( s1 , s2 ) , the use of transient elastography has been expanded to children .
accordingly , we aimed to address points of consideration in probe choice and interpretation of measured liver stiffness by applying and comparing fibroscan s and m probes in biliary atresia.methods:using s1 , s2 , and m probes , 3 liver stiffness measurements , success rates , and interquartile ranges were obtained from 100 patients .
patients were assigned to 2 groups according to thoracic perimeter ( 45 cm vs > 45 cm ) . in both groups ,
obtained values were compared and the relation between liver stiffness measurement and aspartate aminotransferase - to - platelet ratio index was analyzed.results:in the small - thorax group , the success rate was highest with the s1 probe and the intraclass correlation coefficient ( icc ) was highest for s1 versus s2 ( 0.98 ) , compared with that for s1 versus m ( 0.69 ) and s2 versus m ( 0.77 ) . in the large - thorax group
, icc was the highest for s2 versus m ( 0.88 ) , compared with that for s1 versus s2 ( 0.69 ) and s1 versus m ( 0.51 ) . in the small - thorax group ,
correlations between aspartate aminotransferase - to - platelet ratio index and liver stiffness measurement were stronger for s1 ( 0.65 ) and s2 ( 0.64 ) than for m ( 0.49 ) . in the large - thorax group , all probes showed good correlation , s1 ( 0.68 ) , s2 ( 0.62 ) , and m ( 0.62).conclusions : we recommend that the s1 probe is more appropriate for use in small children , especially those with a thorax perimeter of < 45 cm .
if no s probe is available , the m probe may be acceptable in children whose thorax perimeter is > 45 cm . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: a 62-year - old male presented to our out - patient department with history of cataract surgery in the left eye 4 week back , followed by no improvement in vision and onset of floaters after surgery .
now , he was complaining of temporal field defect in the involved eye . on examination ,
best corrected vision at presentation was 20/30 . resolving vitreous hemorrhage was present in the inferior vitreous .
posterior vitreous detachment ( pvd ) was complete as demonstrated by b - scan ultrasonography . as the break was posterior and
the macula was attached , 2-stage pneumatic retinopexy was planned . after achieving hypotony with 350 ml of intravenous mannitol 20% over 45 minutes , the patient was taken up to the operating room .
after cleaning the eye locally with povidone - iodine 10% solution , a sterile surgical drap was applied .
0.3 ml of pure c3f8 was injected intravitreally through pars plana route 3.5 mm from limbus infero - temporally .
( a ) diagram showing superonasal quadrant of the left eye with 2 nasal breaks with nasal retinal detachment ( b ) 2 days after c3f8 injection and laser ( c ) 4 weeks later ( d ) 2 months later at 4 weeks [ fig .
in literature , retinal detachment associated with globe perforation has been associated with a very poor visual outcome .
puri et al . in their article concluded that cases with double perforations , with posterior breaks , or those associated with retinal detachment with pvr require complex surgical procedures and thus have poor visual prognosis .
wearne mj in their retrospective review of 20 patients with block - related perforation concluded that eyes with retinal detachment generally had a poor visual outcome despite vitrectomy with long - acting gas or with silicone oil tamponade . in a series of 7 myopic cases with globe perforation published by modarres
reported 19 cases of globe perforation , out of which 8 patients had retinal detachment , all of them were managed with vitrectomy with an internal tamponade .
we used 2-stage pneumatic retinopexy to repair retinal detachment with a posterior break with double perforation .
scleral buckling and cryotherapy application is difficult in such a case due to location of the break nasally and posterior to the equator . to the best of our knowledge ,
the use of pneumatic retinopexy has never been reported in literature for the management of peribulbar block - related scleral perforation with retinal detachment . above case
demonstrates the importance of using carefully - selected method of retinal detachment repair to help in early visual rehabilitation , better visual outcome , less patient discomfort , lesser cost , and fewer post - operative visit .
a prompt referral of the patient after globe perforation to a retina specialist is a must to achieve good visual prognosis .
the aim is to treat the break before retinal detachment occurs or if detachment has already occurred , then to treat it before proliferative vitreo - retinopathy develops .
pvr is likely to occur as early as 2 weeks of an injury in up to 80% of the eyes , which may necessitate vitreo - retinal surgery with encircling band .
these eyes with pvr usually have poor structural and functional outcome[36910 ] and are difficult to manage . | ### Summary:
: retinal detachment after ocular perforation related to local anesthesia is a common complication , which is usually associated with a poor prognosis despite complex vitreoretinal surgical procedures .
we report a case of 62-year - old male with cataract surgery done 4 weeks back with nasal retinal detachment with a posterior break .
pneumatic retinopexy was performed and laser barrage of the breaks was done the next day when the retina got attached .
a vision of 20/30 was achieved at the end of 2 months . to the best of our knowledge ,
this is a first case report in literature where pneumatic retinopexy was used to manage a retinal detachment caused by block - related perforation . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: hessian fly [ mayetiola destructor ( say ) ] biotypes b , c , d , e , gp , l , o , vh9 , and vh13 were sampled from our laboratory cultures ( table 2 ) . for each biotype ,
48 female flies were collected and stored individually in 100% ethanol before extraction of dna as described by schemerhorn et al .
forty molecular markers were tested for each of the 432 dna samples representing nine biotypes and 48 female flies per biotype .
there were 18 fluorescently labeled ssr primer pairs , hf14 , hf32 , hf55 , hf56 , hf71 , hf101 , hf102 , hf103 , hf104 , hf108 , hf109 , hf112 , hf113 , hf114 , hf116 , hf124 , hf164 , and hf174 .
there were 11 snps , hfsnpa20 , hfsnpa26 , hfsnpa32 , hfsnpa38 , hfsnpa44 , hfsnpa50 , hfsnpa56 , hfsnpa63 , hfsnpa70 , hfsnpa76 , and hfsnpa81 , that we have developed and used previously ( schemerhorn et al .
eleven new snp markers , hfsnps21 , hfsnps26 , hfsnps31 , hfsnps39 , hfsnps45 , hfsnps50 , hfsnps57 , hfsnps62 , hfsnps69 , hfsnps74 , and hfsnps80 , were developed for this study from bac sequences that had been mapped to the sex chromosome by fish ( schemerhorn et al .
each single - base - extension interrogation primer was chosen to end immediately 5 to a snp within a previously amplified product ( table 1 ) .
the polymerase chain reaction provided enough template to allow fluorescent detection of the added base by single - base extension .
the interior primers varied from 20 to 81 bp in length with annealing temperature from 69 to 79c , to allow multiplexed detection ( jiang et al .
, each set of 11 multiplexed snp extension products , together with the genomelab dna size - standard kit 80 , was subjected to capillary electrophoresis on a ceq8000 genetic analysis system ( beckman coulter , brea , ca , fig .
all ssr markers were likewise detected by a single operator on this ceq8000 genetic analysis system .
the polymerase chain reaction ( pcr ) products were mixed for capillary electrophoresis with red size standard ( 13 nt and 80 nt ) .
table 1.characteristics of 11 sex - chromosomal snp loci used in 9 hessian fly biotypesnamegenbankpcr primerstm ( c)snp interrogation primertm ( c)as ( nt)hfsnps21kj917318f : aacagagaaaagatgacccaaatc60r : acggaggatggcatgtggcaa7022r : atgagataatcagttaaatcacgaccag62hfsnps26kj917329f : tggctgctggtattctaaccaaaaacatcg71r : gccaagtaacaattgacccaaaccga6926r : ttctcggcccaatccagactgcttgta73hfsnps31kj917329f : tggctgctggtattctaaccaaaaacatcg71f : ataatgccttggtattttcgaatgctgttga7031r : ttctcggcccaatccagactgcttgta73hfsnps39kj917322f : gcacaggcagtacccacgactaggtca72r : ( a)10gtatcggcccacaacaacactcgatgaag7637r : gtatcggcccacaacaacactcgatga72hfsnps45kj917310f : attttgatggttgatggggccaatgag72f : ( a)14tggtaccaccagacataacgatgttagcgta7545r : ggtaatgaacgtttccgttgcccagaa72hfsnps50kj917318f : cgcacttgactttgaacaagaaatggctacc72f : ( a)19 gaaatgcgatgttgatatccgtaaggacttg7650r : tccttttgcatacgatcagcaatacctgga72hfsnps57kj917318f : cgcacttgactttgaacaagaaatggctacc72r : ( a)21tttcatgattgaattgtagacagtttcgtgaatacc7656r : ccttttgcatacgatcagcaatacctgga72hfsnps62kj917310f : attttgatggttgatggggccaatgag72r : ( a)29catgtatccaggtattgctgatcgtatgcaaaa7863r : ggtaatgaacgtttccgttgcccagaa72hfsnps69kj917310f : attttgatggttgatggggccaatgag72r : ( a)33attgttccaaccatcattcttgggtatggaatcttg7970r : ggtaatgaacgtttccgttgcccagaa72hfsnps74kj917321f : attatgggtcctagaagtcgaaatgaagt65f : ( a)52atgtgacgacattgaaagaact7773r : ttttacgaggaaattcaacttcaagtgttt65hfsnps80kj917330f : tggactatctaattgtgaaaggtaaaaa60r : ( a)44tgtggtcttaattatattcgaaggaattgtaagttt7683r : gccagtaaagagtttaattcccaag61pcr , polymerase chain reaction ; as , apparent size .
table 2.characteristics and sources of the nine studied biotypesbiotypeorigin or prevalent regioncharacteristicsbprevalent in parts of the eastern soft wheat region , particularly in the middle west.can attack wheats that have no genes for resistance or that have resistances similar to those of h7h8 and h3 . can not attack wheats having resistance similar to that of h6 or h5.cselected in a greenhouse experiment from a population of biotype a that prevails in the eastern united states.can attack wheats that have no genes for resistance or that have resistances similar to those of h7h8 and h6 .
it can not attack wheats that have resistances similar to those of h3 or h5 .
it can live on h9.dcollected from a field in indiana in the 1970s.this virulent biotype can attack almost any wheat that lacks h5.efound in a wheat field in georgiaavirulent on h5 , h6 , and h7h8.gpmaybe the original biotype that entered the eastern united states 200 years ago .
collected in kansas.this least virulent of the biotypes can attack only wheats having no genes for resistance , such as the variety turkey.lsouthern indiana fieldattacks wheats with h3 , h6 , h5 , and h7h8 , avirulent h26osouthern georgia fieldattacks wheats with h3 , h6 , h5 , but not h7h8vh9selected out of field population from south georgiavirulent on h3 , h5 , h6 , h7h8 , h9 , but not h13vh13selected from bulk biotype evirulent on h3 and h13 , avirulent on h5 and h9 , segregating for virulence on h6 , h7h8 , and h26 product sizes of 11 multiplexed snp loci .
the polymerase chain reaction ( pcr ) products were mixed for capillary electrophoresis with red size standard ( 13 nt and 80 nt ) .
characteristics of 11 sex - chromosomal snp loci used in 9 hessian fly biotypes pcr , polymerase chain reaction ; as , apparent size .
characteristics and sources of the nine studied biotypes in total , 17,280 lengths or terminal bases were scored from 18 ssr and 22 snp markers , with 48 flies in each of nine biotypes .
all the microsatellite alleles were scored with the aid of a perl script that binned fragment lengths and mapped each fragment length to the nearest sufficiently populated bin ( schemerhorn et al .
2014 ) , and the data were checked with micro - checker ( van oosterhout et al .
the program structure 2.3.3 was used to estimate the co - ancestry among different biotypes .
the most probable number of distinct populations , k , was estimated from simulations in structure harvester ( earl 2009 ) .
for each of 20 runs per trial value of k from 1 to 9 , there were 100,000 burn - in iterations preceding 75,000 monte carlo markov chain replications .
the optimum k was determined by evaluating the likelihood of the posterior probability with the following equations ( pritchard et al .
2007 ) :
thus , k is an ad hoc quantity related to the change in posterior probabilities between runs of consecutively different k values ( evanno et al . 2005 ) .
the ssrs and snp data were analyzed separately in arlequin 3.1 ( excoffier et al .
2005 , excoffier and lischer 2010 ) for linkage disequilibrium , hardy weinberg equilibrium , and pairwise population fst values .
2011 ) for dest values obtained with smogd ( crawford 2010 ) from the combined ssr and snp data .
hessian fly [ mayetiola destructor ( say ) ] biotypes b , c , d , e , gp , l , o , vh9 , and vh13 were sampled from our laboratory cultures ( table 2 ) . for each biotype ,
48 female flies were collected and stored individually in 100% ethanol before extraction of dna as described by schemerhorn et al .
forty molecular markers were tested for each of the 432 dna samples representing nine biotypes and 48 female flies per biotype .
there were 18 fluorescently labeled ssr primer pairs , hf14 , hf32 , hf55 , hf56 , hf71 , hf101 , hf102 , hf103 , hf104 , hf108 , hf109 , hf112 , hf113 , hf114 , hf116 , hf124 , hf164 , and hf174 .
there were 11 snps , hfsnpa20 , hfsnpa26 , hfsnpa32 , hfsnpa38 , hfsnpa44 , hfsnpa50 , hfsnpa56 , hfsnpa63 , hfsnpa70 , hfsnpa76 , and hfsnpa81 , that we have developed and used previously ( schemerhorn et al .
eleven new snp markers , hfsnps21 , hfsnps26 , hfsnps31 , hfsnps39 , hfsnps45 , hfsnps50 , hfsnps57 , hfsnps62 , hfsnps69 , hfsnps74 , and hfsnps80 , were developed for this study from bac sequences that had been mapped to the sex chromosome by fish ( schemerhorn et al .
each single - base - extension interrogation primer was chosen to end immediately 5 to a snp within a previously amplified product ( table 1 ) .
the polymerase chain reaction provided enough template to allow fluorescent detection of the added base by single - base extension .
the interior primers varied from 20 to 81 bp in length with annealing temperature from 69 to 79c , to allow multiplexed detection ( jiang et al .
, each set of 11 multiplexed snp extension products , together with the genomelab dna size - standard kit 80 , was subjected to capillary electrophoresis on a ceq8000 genetic analysis system ( beckman coulter , brea , ca , fig .
all ssr markers were likewise detected by a single operator on this ceq8000 genetic analysis system .
the polymerase chain reaction ( pcr ) products were mixed for capillary electrophoresis with red size standard ( 13 nt and 80 nt ) .
table 1.characteristics of 11 sex - chromosomal snp loci used in 9 hessian fly biotypesnamegenbankpcr primerstm ( c)snp interrogation primertm ( c)as ( nt)hfsnps21kj917318f : aacagagaaaagatgacccaaatc60r : acggaggatggcatgtggcaa7022r : atgagataatcagttaaatcacgaccag62hfsnps26kj917329f : tggctgctggtattctaaccaaaaacatcg71r : gccaagtaacaattgacccaaaccga6926r : ttctcggcccaatccagactgcttgta73hfsnps31kj917329f : tggctgctggtattctaaccaaaaacatcg71f : ataatgccttggtattttcgaatgctgttga7031r : ttctcggcccaatccagactgcttgta73hfsnps39kj917322f : gcacaggcagtacccacgactaggtca72r : ( a)10gtatcggcccacaacaacactcgatgaag7637r : gtatcggcccacaacaacactcgatga72hfsnps45kj917310f : attttgatggttgatggggccaatgag72f : ( a)14tggtaccaccagacataacgatgttagcgta7545r : ggtaatgaacgtttccgttgcccagaa72hfsnps50kj917318f : cgcacttgactttgaacaagaaatggctacc72f : ( a)19 gaaatgcgatgttgatatccgtaaggacttg7650r : tccttttgcatacgatcagcaatacctgga72hfsnps57kj917318f : cgcacttgactttgaacaagaaatggctacc72r : ( a)21tttcatgattgaattgtagacagtttcgtgaatacc7656r : ccttttgcatacgatcagcaatacctgga72hfsnps62kj917310f : attttgatggttgatggggccaatgag72r : ( a)29catgtatccaggtattgctgatcgtatgcaaaa7863r : ggtaatgaacgtttccgttgcccagaa72hfsnps69kj917310f : attttgatggttgatggggccaatgag72r : ( a)33attgttccaaccatcattcttgggtatggaatcttg7970r : ggtaatgaacgtttccgttgcccagaa72hfsnps74kj917321f : attatgggtcctagaagtcgaaatgaagt65f : ( a)52atgtgacgacattgaaagaact7773r : ttttacgaggaaattcaacttcaagtgttt65hfsnps80kj917330f : tggactatctaattgtgaaaggtaaaaa60r : ( a)44tgtggtcttaattatattcgaaggaattgtaagttt7683r : gccagtaaagagtttaattcccaag61pcr , polymerase chain reaction ; as , apparent size .
table 2.characteristics and sources of the nine studied biotypesbiotypeorigin or prevalent regioncharacteristicsbprevalent in parts of the eastern soft wheat region , particularly in the middle west.can attack wheats that have no genes for resistance or that have resistances similar to those of h7h8 and h3 . can not attack wheats having resistance similar to that of h6 or h5.cselected in a greenhouse experiment from a population of biotype a that prevails in the eastern united states.can attack wheats that have no genes for resistance or that have resistances similar to those of h7h8 and h6 .
it can not attack wheats that have resistances similar to those of h3 or h5 .
it can live on h9.dcollected from a field in indiana in the 1970s.this virulent biotype can attack almost any wheat that lacks h5.efound in a wheat field in georgiaavirulent on h5 , h6 , and h7h8.gpmaybe the original biotype that entered the eastern united states 200 years ago .
collected in kansas.this least virulent of the biotypes can attack only wheats having no genes for resistance , such as the variety turkey.lsouthern indiana fieldattacks wheats with h3 , h6 , h5 , and h7h8 , avirulent h26osouthern georgia fieldattacks wheats with h3 , h6 , h5 , but not h7h8vh9selected out of field population from south georgiavirulent on h3 , h5 , h6 , h7h8 , h9 , but not h13vh13selected from bulk biotype evirulent on h3 and h13 , avirulent on h5 and h9 , segregating for virulence on h6 , h7h8 , and h26 product sizes of 11 multiplexed snp loci .
the polymerase chain reaction ( pcr ) products were mixed for capillary electrophoresis with red size standard ( 13 nt and 80 nt ) .
characteristics of 11 sex - chromosomal snp loci used in 9 hessian fly biotypes pcr , polymerase chain reaction ; as , apparent size .
characteristics and sources of the nine studied biotypes in total , 17,280 lengths or terminal bases were scored from 18 ssr and 22 snp markers , with 48 flies in each of nine biotypes .
all the microsatellite alleles were scored with the aid of a perl script that binned fragment lengths and mapped each fragment length to the nearest sufficiently populated bin ( schemerhorn et al .
2014 ) , and the data were checked with micro - checker ( van oosterhout et al .
the program structure 2.3.3 was used to estimate the co - ancestry among different biotypes .
the most probable number of distinct populations , k , was estimated from simulations in structure harvester ( earl 2009 ) .
for each of 20 runs per trial value of k from 1 to 9 , there were 100,000 burn - in iterations preceding 75,000 monte carlo markov chain replications .
the optimum k was determined by evaluating the likelihood of the posterior probability with the following equations ( pritchard et al .
2007 ) :
thus , k is an ad hoc quantity related to the change in posterior probabilities between runs of consecutively different k values ( evanno et al . 2005 ) .
the ssrs and snp data were analyzed separately in arlequin 3.1 ( excoffier et al .
2005 , excoffier and lischer 2010 ) for linkage disequilibrium , hardy weinberg equilibrium , and pairwise population fst values .
2011 ) for dest values obtained with smogd ( crawford 2010 ) from the combined ssr and snp data .
hessian fly [ mayetiola destructor ( say ) ] biotypes b , c , d , e , gp , l , o , vh9 , and vh13 were sampled from our laboratory cultures ( table 2 ) . for each biotype ,
48 female flies were collected and stored individually in 100% ethanol before extraction of dna as described by schemerhorn et al .
forty molecular markers were tested for each of the 432 dna samples representing nine biotypes and 48 female flies per biotype .
there were 18 fluorescently labeled ssr primer pairs , hf14 , hf32 , hf55 , hf56 , hf71 , hf101 , hf102 , hf103 , hf104 , hf108 , hf109 , hf112 , hf113 , hf114 , hf116 , hf124 , hf164 , and hf174 .
there were 11 snps , hfsnpa20 , hfsnpa26 , hfsnpa32 , hfsnpa38 , hfsnpa44 , hfsnpa50 , hfsnpa56 , hfsnpa63 , hfsnpa70 , hfsnpa76 , and hfsnpa81 , that we have developed and used previously ( schemerhorn et al .
eleven new snp markers , hfsnps21 , hfsnps26 , hfsnps31 , hfsnps39 , hfsnps45 , hfsnps50 , hfsnps57 , hfsnps62 , hfsnps69 , hfsnps74 , and hfsnps80 , were developed for this study from bac sequences that had been mapped to the sex chromosome by fish ( schemerhorn et al .
each single - base - extension interrogation primer was chosen to end immediately 5 to a snp within a previously amplified product ( table 1 ) .
the polymerase chain reaction provided enough template to allow fluorescent detection of the added base by single - base extension .
the interior primers varied from 20 to 81 bp in length with annealing temperature from 69 to 79c , to allow multiplexed detection ( jiang et al .
, each set of 11 multiplexed snp extension products , together with the genomelab dna size - standard kit 80 , was subjected to capillary electrophoresis on a ceq8000 genetic analysis system ( beckman coulter , brea , ca , fig .
all ssr markers were likewise detected by a single operator on this ceq8000 genetic analysis system .
the polymerase chain reaction ( pcr ) products were mixed for capillary electrophoresis with red size standard ( 13 nt and 80 nt ) .
table 1.characteristics of 11 sex - chromosomal snp loci used in 9 hessian fly biotypesnamegenbankpcr primerstm ( c)snp interrogation primertm ( c)as ( nt)hfsnps21kj917318f : aacagagaaaagatgacccaaatc60r : acggaggatggcatgtggcaa7022r : atgagataatcagttaaatcacgaccag62hfsnps26kj917329f : tggctgctggtattctaaccaaaaacatcg71r : gccaagtaacaattgacccaaaccga6926r : ttctcggcccaatccagactgcttgta73hfsnps31kj917329f : tggctgctggtattctaaccaaaaacatcg71f : ataatgccttggtattttcgaatgctgttga7031r : ttctcggcccaatccagactgcttgta73hfsnps39kj917322f : gcacaggcagtacccacgactaggtca72r : ( a)10gtatcggcccacaacaacactcgatgaag7637r : gtatcggcccacaacaacactcgatga72hfsnps45kj917310f : attttgatggttgatggggccaatgag72f : ( a)14tggtaccaccagacataacgatgttagcgta7545r : ggtaatgaacgtttccgttgcccagaa72hfsnps50kj917318f : cgcacttgactttgaacaagaaatggctacc72f : ( a)19 gaaatgcgatgttgatatccgtaaggacttg7650r : tccttttgcatacgatcagcaatacctgga72hfsnps57kj917318f : cgcacttgactttgaacaagaaatggctacc72r : ( a)21tttcatgattgaattgtagacagtttcgtgaatacc7656r : ccttttgcatacgatcagcaatacctgga72hfsnps62kj917310f : attttgatggttgatggggccaatgag72r : ( a)29catgtatccaggtattgctgatcgtatgcaaaa7863r : ggtaatgaacgtttccgttgcccagaa72hfsnps69kj917310f : attttgatggttgatggggccaatgag72r : ( a)33attgttccaaccatcattcttgggtatggaatcttg7970r : ggtaatgaacgtttccgttgcccagaa72hfsnps74kj917321f : attatgggtcctagaagtcgaaatgaagt65f : ( a)52atgtgacgacattgaaagaact7773r : ttttacgaggaaattcaacttcaagtgttt65hfsnps80kj917330f : tggactatctaattgtgaaaggtaaaaa60r : ( a)44tgtggtcttaattatattcgaaggaattgtaagttt7683r : gccagtaaagagtttaattcccaag61pcr , polymerase chain reaction ; as , apparent size .
table 2.characteristics and sources of the nine studied biotypesbiotypeorigin or prevalent regioncharacteristicsbprevalent in parts of the eastern soft wheat region , particularly in the middle west.can attack wheats that have no genes for resistance or that have resistances similar to those of h7h8 and h3 . can not attack wheats having resistance similar to that of h6 or h5.cselected in a greenhouse experiment from a population of biotype a that prevails in the eastern united states.can attack wheats that have no genes for resistance or that have resistances similar to those of h7h8 and h6 .
it can not attack wheats that have resistances similar to those of h3 or h5 .
it can live on h9.dcollected from a field in indiana in the 1970s.this virulent biotype can attack almost any wheat that lacks h5.efound in a wheat field in georgiaavirulent on h5 , h6 , and h7h8.gpmaybe the original biotype that entered the eastern united states 200 years ago . collected in kansas.this least virulent of the biotypes
can attack only wheats having no genes for resistance , such as the variety turkey.lsouthern indiana fieldattacks wheats with h3 , h6 , h5 , and h7h8 , avirulent h26osouthern georgia fieldattacks wheats with h3 , h6 , h5 , but not h7h8vh9selected out of field population from south georgiavirulent on h3 , h5 , h6 , h7h8 , h9 , but not h13vh13selected from bulk biotype evirulent on h3 and h13 , avirulent on h5 and h9 , segregating for virulence on h6 , h7h8 , and h26 product sizes of 11 multiplexed snp loci .
the polymerase chain reaction ( pcr ) products were mixed for capillary electrophoresis with red size standard ( 13 nt and 80 nt ) .
characteristics of 11 sex - chromosomal snp loci used in 9 hessian fly biotypes pcr , polymerase chain reaction ; as , apparent size . characteristics and sources of the nine studied biotypes
in total , 17,280 lengths or terminal bases were scored from 18 ssr and 22 snp markers , with 48 flies in each of nine biotypes .
all the microsatellite alleles were scored with the aid of a perl script that binned fragment lengths and mapped each fragment length to the nearest sufficiently populated bin ( schemerhorn et al .
2014 ) , and the data were checked with micro - checker ( van oosterhout et al .
the program structure 2.3.3 was used to estimate the co - ancestry among different biotypes .
the most probable number of distinct populations , k , was estimated from simulations in structure harvester ( earl 2009 ) .
for each of 20 runs per trial value of k from 1 to 9 , there were 100,000 burn - in iterations preceding 75,000 monte carlo markov chain replications .
the optimum k was determined by evaluating the likelihood of the posterior probability with the following equations ( pritchard et al .
2007 ) :
thus , k is an ad hoc quantity related to the change in posterior probabilities between runs of consecutively different k values ( evanno et al .
2005 ) . the ssrs and snp data were analyzed separately in arlequin 3.1 ( excoffier et al .
2005 , excoffier and lischer 2010 ) for linkage disequilibrium , hardy weinberg equilibrium , and pairwise population fst values .
2011 ) for dest values obtained with smogd ( crawford 2010 ) from the combined ssr and snp data .
the 18 ssr and 22 snp loci generated 17,280 unique trace profiles from 432 individual flies .
the 18 polymorphic markers were examined for frequency within the biotypes and usefulness to assess relationships among the biotypes . since
all the biotypes are currently being maintained as laboratory populations , the analysis reflects not only phylogeny of the source populations from which some of the biotypes were obtained but also selection for virulence to certain resistance genes in wheat and the success of the isolation of the biotypes in long - term cultures .
some of the tested loci varied widely in frequency among the biotypes , which indicates the independence of the biotypes as breeding populations .
a case in point is the single snp locus hfsnps69 , whose four alleles summed to the frequency of 1 ( supp table 1 [ online only ] ) . among the nine biotypes , the frequency of a varied from 0.281 to 0.969 , c varied from 0.000 to 0.094 , g varied from 0.000 to 0.719 , and t varied from 0.000 to 0.245 . clearly , there are distinct populations within the collection of biotypes .
figure 2 is a poptree2 dendrogram derived by neighbor joining from fst values based on the ssr loci ; fig .
both of these dendrograms were generated with resampling , and bootstrap support out of 100 runs is shown for each nonbasal node .
4 ) was produced using smogd and mega5 for the combined data using dest instead of fst , and bootstrapping could not be performed for it .
fig . 2.neighbor-joining tree for ssr fst values by poptree2 with 100 bootstrap runs .
fig .
fig . 4.neighbor-joining tree by mega5 from dest from smogd for ssr and snp data together .
neighbor - joining tree by mega5 from dest from smogd for ssr and snp data together .
2 shows a simple and plausible geographic separation of two clades and a sister group .
the first clade consists of biotypes descended from field collections in georgia : o , e , vh9 , and vh13 , and the second clade consists of midwestern biotypes ( b , d , and l from indiana plus gp from kansas ) .
the outlier , c , was derived in the laboratory from biotype a in the eastern united states .
however , the bootstrap support for specific nodes is weak except for the juxtaposition of e with o at 93% .
there is moderate bootstrap support for the juxtaposition of d and o and for the grouping of vh9 and vh13 with d and o , while e becomes nearly basal .
4 , using dest instead of fst , groups the biotypes geographically in a slightly different way than fig .
2 . georgia forms one clade , but the indiana - based biotypes are nearly basal and c and gp push far out in the second clade . both e and l essentially become nodes in their respective branches , thus assuming directly ancestral relationship to o and gp , respectively .
all three dendrograms grouped laboratory - selected biotypes vh9 and vh13 with their wild parents , respectively , biotypes o and e ( table 2 ) , but none of the dendrograms placed vh9 and vh13 in descendent positions from o and e. this accords with the low bootstrap support for most nodes and with the possibility that laboratory selection has reversed the divergence of e and o from more ancestral strains . in analysis of ssrs and snps jointly with the program structure , the value of k peaked at k = 8 , but there was also a clear peak at k = 6 ( fig .
5 ) , indicating that the biotypes represent six to eight distinct populations . to produce fig .
6 , structure plotted q , the posterior estimated fraction of each individual s genotype that came from one of the k populations , across the biotypes . if a total of less than nine populations is accepted , then there must be relatively closer similarities among some of the populations . with k = 8 , at least one pair of biotypes
6 , the georgian biotypes o and e share a common ancestor that has combined with the ancestor of d to produce o and with the ancestor of vh13 to produce e. however , this interpretation does not accord with the documented laboratory selection of vh13 from e ( zantoko and shukle 1997 ) . with k
= 6 , biotypes o , e , and vh13 combine into one population , just like their closest grouping in fig .
4 , while b is merged with d in accord with their basal positions in fig .
biotype o is the most similar to more than one population , as evidenced by its multicolored plotted q values in fig .
5.estimates of k , based on the second order rate of change of the likelihood function with respect to k , the expected number of populations ( clusters ) , to determine k s most likely value for the data set . genetic distance and k
estimates of k , based on the second order rate of change of the likelihood function with respect to k , the expected number of populations ( clusters ) , to determine k s most likely value for the data set . genetic distance and k
overall , the 18 ssr markers were more informative about the relationships among the nine biotypes , and the 22 snp markers were more likely to be fixed within particular biotypes .
the biotypes varied less at most snp loci than at ssr loci ( table 3 ) .
the expected heterozygosity was usually lower for snps ( table 3 , means in last column ) , because there were more alleles per ssr than there were variant nucleotides at a single position , as confirmed in supp table 1 ( online only ) .
table 3.standard diversity indiceslocidogplbnarhohehwenarhohehwenarhohehwenarhohehwenarhohehwehf109260.000.04 * 490.420.66 * 260.000.08**260.130.22 * 4350.000.12**hf1138270.210.50**470.270.54**6390.380.466290.310.55**5460.330.56**hf1014210.000.16**230.130.123100.000.08**10nanana4100.000.12**hf1646130.540.58**5130.690.624130.710.704130.600.593120.650.65hf112260.040.15 * 260.190.49**260.130.36**260.020.02260.150.27*hf1167550.460.72**7390.480.76**11330.560.84**7390.630.77**9440.670.78*hf328560.460.79**9410.270.77**8290.080.68**8290.150.61**10410.170.69**hf103470.380.54 * 230.310.377200.270.64**350.250.32350.440.52hf1085290.670.614120.540.55 * 4120.480.72**4120.730.694120.600.60hf1145270.130.20 * 4240.230.286240.690.706240.210.67**3240.440.49hf102230.150.27 * 390.190.31**330.440.50230.100.14370.290.44*hf14360.350.49 * 490.630.60360.580.59490.710.67360.390.50hf104360.250.46**4100.210.68**6170.330.65**6160.310.64**6250.040.56**hf715190.460.68 * 5190.580.72 * 5190.480.504100.520.70**4100.330.71**hf56490.440.68**6300.400.64**390.580.66490.630.644150.270.31hf1248300.210.37**5140.310.72**390.330.57**5120.290.48 * 360.060.10*hf553160.100.14 * 4200.250.23250.190.21250.250.313180.040.08*hf1745110.400.46 * 6110.100.54**5470.440.65**5110.540.57590.230.46**hfsnpa201cnanana1cnanana1cnanana1cnanana2c , t0.020.02hfsnpa261gnanana1gnanana2a , g0.150.24 * 2a , g0.080.081gnananahfsnpa321ananana1ananana1ananana1ananana1anananahfsnpa381tnanana2c , t0.000.04 * 2c , t0.330.432c , t0.100.17 * 1tnananahfsnpa442a , g0.000.08**2a , g0.000.12**2a , g0.230.39 * 2a , g0.290.402a , g0.080.22**hfsnpa502a , g0.810.50**2a , g0.520.39 * 2a , g0.520.492a , g0.690.47 * 2a , g0.020.14**hfsnpa562c , t0.060.062c , t0.020.022c , t0.150.212c , t0.210.192c , t0.420.45hfsnpa631gnanana2a , g0.060.062a , g0.210.192a , g0.210.191gnananahfsnpa701cnanana1cnanana1cnanana1cnanana1cnananahfsnpa761gnanana2a , g0.000.15**1gnanana2a , g0.020.021gnananahfsnpa811gnanana1gnanana1gnanana1gnanana1gnananahfsnps212a , c0.040.042a , c0.020.021cnanana2a , c0.230.212a , c0.290.25hfsnps262a , c0.270.242a , c0.170.221ananana1ananana2a , c0.040.04hfsnps312a , g0.130.122a , g0.100.101anananana2a , g0.220.272a , g0.790.48**hfsnps391tnanana1tnanana1tnanana3a , c , t0.190.212c , t0.020.02hfsnps453a , c , t0.400.343a , c , t0.350.312c , t0.980.512c , t0.190.182a , c0.040.04hfsnps502a , g0.080.122a , g0.040.082a , g0.070.072a , g0.150.24 * 2a , g0.350.32hfsnps572c , t0.520.412c , t0.150.142c , t0.980.51**2c , t0.850.50**2c , t0.880.50**hfsnps622c , t0.020.021cnanana2c , t0.060.062c , t0.170.19 * 1c0.020.02hfsnps692a , g0.190.212a , g0.330.282a , t0.490.37 * 2a , g0.730.47**2a , g0.190.41**hfsnps742a , g0.040.041ananana2a , g0.150.142a , g0.230.212a , g0.130.12hfsnps802a , c0.650.46 * 2a , c0.830.50**2a , c1.000.51**2a , c0.900.51**1cnananamean3.00.210.262.90.220.303.00.300.342.90.300.332.80.210.27locievh9vh13cmeannshohehwenshohehwenshohehwenshohehwemnaasrhohehf1095410.250.65**3120.210.48**360.290.46 * 230.000.04 * 3.0086 - 1300.140.31hf1136210.290.44**7210.460.71**470.020.14**8460.540.76**6.00173 - 2210.310.52hf101230.290.283100.000.16**230.250.2510nanana2.4495 - 1200.070.13hf1644140.480.49 * 340.170.41**220.020.06 * 3120.210.193.48172 - 1870.450.48hf112260.100.37**260.080.46**260.310.39260.190.39 * 2.00119 - 1250.130.31hf1166260.560.79**8390.810.79**8510.460.75**7330.690.78 *
4120.310.344.22187 - 2140.390.44hf102230.290.31390.460.51370.250.45 * 3190.230.46**2.67150 - 1750.270.38hf145120.730.70230.130.12390.830.59**360.380.383.33237 - 2490.530.52hf1044100.290.53**5370.020.56**6100.230.75**7200.350.78**5.22140 - 1770.230.62hf715190.230.61**4100.330.55**5190.750.745140.130.39**4.67238 - 2610.420.62hf566300.460.523120.440.41**5240.380.375110.460.77**4.44132 - 1620.450.55hf1244140.150.67**8330.520.65 *
* 380.310.363.22183 - 2160.270.32hf174470.000.20**6320.250.60**5390.150.29**4110.060.43**5.00294 - 3450.240.47hfsnpa201cnanana1cnanana1cnanana1c , tnanana1.11c , t0.000.00hfsnpa261gnanana1gnananana1gnanana2a , g0.020.06**1.33a , g0.030.04hfsnpa321ananana1ananana1ananana1ananana1.00ananahfsnpa381tnanana2c , t0.020.021tnanana2c , t0.150.14 * 1.56c , t0.070.09hfsnpa442a , g0.040.19**2a , g0.060.061gnanana2a , g0.060.351.89a , g0.080.20hfsnpa502a , g0.080.082a , g0.330.282a , g0.940.51**2a , g0.040.082.00a , g0.440.33hfsnpa562c , t0.020.021cnanana1cnanana2c , t0.290.251.78c , t0.130.13hfsnpa631gnanana1gnanana1gnanana2a , g0.600.44 * 1.44a , g0.120.10hfsnpa701cnanana1cnanana1cnanana2c , t0.000.04 * 1.11c , t0.000.01locievh9vh13cmeannshohehwenshohehwenshohehwenshohehwemnaasrhohehfsnpa761gnanana1gnanana1gnanana1gnanana1.22a , g0.000.02hfsnpa811gnanana1gnanana1gnanana2a , g0.020.021.11a , g0.000.00hfsnps212a , c0.790.48 * 1cnanana1cnanana2a , c0.150.141.67a , c0.170.13hfsnps263a , t0.940.51 * 1ananana2a , c0.080.121ananana1.67a , c , t0.170.13hfsnps312a , g0.040.15 * 2a , g0.080.082a , g0.170.152a , g0.040.041.89a , g0.170.16hfsnps392c , t0.270.241tnanana2c , t0.020.023a , c , t0.250.221.78a , c , t0.080.08hfsnps453a , c , t0.250.263a , c , t0.940.52**3a , c , t1.000.56**3a , c , t0.290.262.67a , c , t0.490.33hfsnps502a , g0.630.502a , g0.330.482a , g0.330.432a , g0.460.382.00a , g0.270.29hfsnps572c , t0.900.51**2c , t0.290.252c , t0.790.48**2c , t0.670.51 * 2.00c , t0.670.42hfsnps622c , t0.290.252c , t0.170.152c , t0.460.382c , t0.060.061.78c , t0.140.12hfsnps693a , c , g0.040.19**2a , g0.060.062a , g0.210.192a , g0.040.082.11a , c , g , t0.250.25hfsnps742a , g0.210.221ananana2a , g0.080.122a , g0.080.191.78a , c , g0.100.11hfsnps802a , c0.460.36 * 2a , c0.560.41 * 2a , c0.710.46**2a , c0.420.331.89a , c0.610.40mean2.90.270.322.90.210.282.80.280.303.00.220.302.90.250.30n , observed number of alleles ; s , microsatellite allelic size or snp allele ; mna , mean number of alleles ; asr , allelic size range ; ho , observed heterozygosity ; he , expected heterozygosity ; na , monomorphic , no test done.hwe , significantly different from handy weinberg equilibrium at * p = 0.05 and * * p = 0.01 .
n , observed number of alleles ; s , microsatellite allelic size or snp allele ; mna , mean number of alleles ; asr , allelic size range ; ho , observed heterozygosity ; he , expected heterozygosity ; na , monomorphic , no test done .
weinberg equilibrium at * p = 0.05 and * * p = 0.01 .
the mean observed heterozygosity varied from 0.26 to 0.34 among biotypes for all the molecular markers together .
biotypes b and d were more inbred , and gp and e were less inbred ( fig .
about 37% of the combinations of snp locus and biotype were homozygous ( supp table 1 [ online only ] ) .
locus hfsnpa20 is heterozygous only in biotype b , and loci hfsnpa70 and hfsnpa81 are heterozygous only in biotype c. all the biotypes have heterozygous individuals for loci hfsnpa50 , hfsnps45 , hfsnps50 , hfsnp57 , and hfsnps69 . the high frequency of homozygosity affected the use of these genetic markers to understand population structure in hessian fly .
fig .
females were used because male hessian flies are hemizygous for the two sex chromosomes , x1 and x2 ; both sexes are diploid for the two autosomes , a1 and a2 ( benatti et al .
thus , somatic cells of hessian fly have six chromosomes in males and eight in females .
the germline also carries 3245 supernumerary ( e ) chromosomes that are somatically eliminated during embryogenesis ( lobo et al .
the contribution , if any , of the e chromosomes to genotype at the investigated loci is not known . observed heterozygosity was generally less than expected heterozygosity for ssr loci .
the means over biotypes in the last columns of table 3 show this very clearly : observed was less than expected for 17 of the 18 ssr loci .
there was less variation and lower expected heterozygosity for snps than for ssrs ( table 3 ) , but there was less difference between observed and expected heterozygosity .
if the map positions of ssr and snp loci were randomly distributed on the chromosomes , this difference would be unexpected , and it would suggest that the automatic ssr scoring was undercalling heterozygotes .
small population size in culture would decrease expected heterozygosity in comparison with the wild populations from which six of the biotypes were collected , but in the absence of intrapopulation structure , small population size would not depress observed versus expected heterozygosity .
microsatellites evolve new alleles easily by change in the repeat count , but indels are also likely to be tolerated in the flanking sequence of selectively neutral , noncoding ssrs , leading to occasionally observed allelic length differences that were not an integral multiple of the motif length .
thus , the observed multiple allelism of ssr loci reflects length changes anywhere within a stretch of 2050 or more nucleotides . on the other hand , observed variation at a snp locus is limited to substitution or deletion of a single nucleotide .
if it were possible to examine complete sequence over an entire locus for all individuals in the population , much higher numbers of snp alleles would be expected , and expected heterozygosity would rise in the absence of selection .
there also can be bias for high polymorphism during the development of ssr markers ( brandstrom and ellegren 2008 ) .
the lesser snp allele count also raises , though does not answer , the question of whether the sampled ssrs are more selectively neutral than the sampled snps .
selection is likely to occur strongly against nonsynonymous snp mutations within genes , whereas an intergenic ssr is likely to be neutral .
the higher frequency of the most common allele ( supp table 1 [ online only ] ) reduced the usefulness of snp loci to understand population structure and relationships .
thus , the ssr - based neighbor - joining tree is more plausible than the snp - based tree , and the tree from combined data was more similar to the ssr - only tree .
the statistical power of a genetic marker type to document population structure is related to the number and frequency of independent alleles ( kalinowski 2002 ) , and in general , an individual biallelic snp is less powerful than an individual multiply allelic ssr locus . by simulations
( 2009 ) showed that the statistical power of a panel of snp loci to detect population differentiation depended upon the number of individuals sampled and the value of fst . with 20 snp loci , 50 individuals per sample , and fst = 0.01 , the power was 0.72 .
the hessian fly data yielded pairwise fst values in the range 0.030.38 by arlequin , and therefore the power should be greater than 0.72 .
( 2009 ) also cite empirical evidence that 23.5 snp loci match one ssr in discriminatory power , although this evidence comes from fish and mammals that have a longer generation time ( years vs. weeks ) than hessian fly .
heterozygote excess suggests that heterozygotes have a survival advantage , perhaps even linkage to balanced lethals .
microsatellite locus hf124 deviated significantly from hardy weinberg equilibrium in biotype e , even though the heterozygotes were as frequent here as in other biotypes . since these collections have been in culture up to 55 years ( gallun et al .
1961 ) , biotype admixture in the laboratory must be considered as a possible cause of deviation from hardy weinberg equilibrium .
it is impossible to prove that admixture has or has not ever occurred given the available data , but a rapid return to equilibrium would be expected if it had occurred .
hessian fly biotype is defined by virulence on tester wheat varieties , and thus different collections of the same biotype can differ in evolutionary history as alleles conferring particular virulence patterns arise ( perhaps independently ) and spread horizontally among populations ( in response to migration and selection as new resistance genes are deployed in wheat ) .
for example , if virulence requires many incremental changes that each marginally increases survival on the host , then the evolution of a new biotype ( pattern of virulence ) is difficult , and a succession of increasingly virulent forms is expected as new resistance genes are deployed in the host . on the other hand ,
if the interaction depends upon very specific interaction of particular alleles in a few pest virulence genes with particular alleles in a few host genes , there is little reason for any particular ancestor - descendent relationship versus other relationships among the naturally occurring biotypes ; a few correct mutations could convert an avirulent genotype into a highly virulent genotype . the available evidence in hessian fly favors the latter hypothesis ; virulence apparently follows the classic gene - for - gene model from plant pathology .
( 2002 ) found segregation for one or two dominant hessian fly resistance loci in durum wheat lines , and similar findings in breadwheat and related wild species have resulted in the naming of several dozen h resistance genes , through at least h61 .
some of these resistance genes have been mapped onto five chromosomes of wheat , 3a , 3dl , 5bs , 6d , and especially an 11-cm region on 1as , where several named resistance genes are potentially alleles of a single locus ( wang et al .
thus , the apparently close relationship between least virulent biotype gp and most virulent biotype l in figs .
however , the implication that gp has descended from l in fig . 4 is inconsistent with history .
while geographic cohesion of related biotypes is expected if hessian fly has evolved regional adaptation to climate , another cause of cohesion is the regional nature of wheat breeding programs , which might cause different sets of resistance genes to be deployed in different areas .
the wheat varieties differ in drought tolerance , winter hardiness ( for winter wheats ) , heading date , and so on .
there is probably feedback as hessian fly responds to selective pressure from new resistance genes and breeders respond to new patterns of virulence that initially are geographically restricted . in any case , ssr and snp evidence presented here suggests that gp does not occupy the basal evolutionary position expected of a least virulent biotype .
the simple geographic relationship shown with ssrs suggests also that the cultures have been successfully isolated from one another since their establishment .
| ### Summary:
: exploration of the biotype structure of hessian fly , mayetiola destructor ( say ) ( diptera : cecidomyiidae ) , would improve our knowledge regarding variation in virulence phenotypes and difference in genetic background .
microsatellites ( simple sequence repeats ) and single - nucleotide polymorphisms ( snps ) are highly variable genetic markers that are widely used in population genetic studies .
this study developed and tested a panel of 18 microsatellite and 22 snp markers to investigate the genetic structure of nine hessian fly biotypes : b , c , d , e , gp , l , o , vh9 , and vh13 .
the simple sequence repeats were more polymorphic than the snp markers , and their neighbor - joining trees differed in consequence .
microsatellites suggested a simple geographic association of related biotypes that did not progressively gain virulence with increasing genetic distance from a founder type .
use of the k - means clustering algorithm in the structure program shows that the nine biotypes comprise six to eight populations that are related to geography or history within laboratory cultures . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: descemet 's stripping automated endothelial keratoplasty ( dsaek ) is the most popular procedure in endothelial keratoplasty for patients suffering only from corneal endothelial dysfunction .
the advantages of dsaek over penetrating keratoplasty ( pk ) , such as less postoperative astigmatism , faster visual rehabilitation , and avoidance of wound dehiscence or wound infections , can be attributed to a minimally invasive sutureless corneal transplantation technique , which provides better structural integrity for the recipient [ 1 , 2 ] .
ocular trauma after pk is one of the postoperative complications which may cause pk graft dislocation or pk wound dehiscence , possibly leading to serious complications .
ocular trauma after pk has been reported in many previous studies ; however , we are unaware of any previous reports of trauma caused by a blow after dsaek . here
, we describe a case of a blowout fracture in a patient after dsaek whose cornea survived the injury undamaged .
an 86-year - old woman presenting pseudophakic bullous keratopathy in her left eye was referred to our clinic .
the best - corrected visual acuity ( bcva ) of her left eye was 20/1,000 .
a slit - lamp examination of that eye showed diffuse corneal edema with increased corneal thickness ( 0.629 mm ) .
the postoperative bcva of her left eye improved to 20/20 , and she had an uncomplicated postoperative course .
sixteen months after dsaek , the patient suffered a blow to her left eye caused by a fall .
an urgent head computed tomography scan revealed a blowout fracture of the inferior wall of the left orbit with soft tissue prolapsing into the orbit .
bcva of that eye was 20/20 , and neither diplopia nor eye movement disorder was observed . on slit - lamp examination , her operated cornea was intact and clear , and there was no abnormal finding in both the anterior and posterior segments ( fig .
imaging with anterior segment optical coherence tomography showed no graft dislocation or detachment of the graft ( fig .
a classic blowout fracture involves a sudden , forced increase in intraorbital pressure , which , in turn , causes decompression through an orbital wall fracture .
a classic blowout fracture usually saves the eye globe and vision ; however , in eyes with surgical wounds , wound dehiscence may easily occur .
traumatic wound dehiscence after pk is not a rare occurrence and may result in a sight - threatening situation .
many cases of traumatic globe rupture after pk have been previously reported . in a previous literature review , the incidence of traumatic dehiscence after keratoplasty was 1.285.8% , and the average duration between initial keratoplasty and traumatic globe rupture was 61 50.0 months .
damage to an eye caused by a blow due to a fall after pk frequently occurs in elderly patients and results in poor visual outcome [ 3 , 4 ] . in the present case ,
our elderly patient suffered a blunt trauma caused by a fall 16 months after keratoplasty , and in her case this was accompanied by an inferior - blowout fracture .
a previous paper reported that traumatic globe rupture involves the graft - host junction and occurs regardless of the presence of sutures .
if our patient had undergone pk instead of dsaek , wound dehiscence might have occurred , possibly resulting in traumatic pk graft dislocation and globe rupture .
however , she underwent dsaek , a closed - eye surgery which includes smaller wound size and provides more tectonic stability for the eye compared with pk . as a benefit of surgery ,
the finding of our case confirms the tectonic stability of the globe after dsaek , although long - term postoperative data for trauma after dsaek are lacking because of the limited history of this procedure .
graft dislocation is the most frequent complication in dsaek ; further complications can be graft failure , rejection , pupillary block , and retinal detachment [ 2 , 5 , 6 ] .
thus , although wound dehiscence - related complications caused by trauma are rare , slight trauma may cause dsaek graft dislocation during the early postoperative period .
however , this does not usually require emergency correction to preserve vision as in a pk case .
| ### Summary:
: we present the case of an 86-year - old woman who developed a blowout fracture after descemet 's stripping automated endothelial keratoplasty ( dsaek ) .
sixteen months after dsaek , she suffered a blow to her left eye caused by a fall . computed tomography confirmed the presence of a blowout fracture of the inferior wall of the left orbit with soft tissue prolapsing into the orbit .
the patient complained of no abnormal symptoms , and her operated cornea was intact and clear .
there was no abnormal finding in both the anterior and posterior segments .
this case highlights that the dsaek technique provides adequate tectonic stability of the globe throughout the traumatic event in contrast to penetrating keratoplasty , which can lead to devastating vision damage after trauma . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: osseointegration has been defined as the intimate contact between bone tissue and implanted biomaterial in the optical microscopy level , and such phenomenon has rendered dental implantology as one of the most successful treatment modalities in both dentistry and medicine [ 1 , 2 ] . however , while high success rates have been reported ( often higher than 90% over a decade ) , the early failure of the osseointegration has been associated with endogenous factors such as quantity and quality of bone , smoking habits , and host systemic impairment , as well as nutritional status and osteometabolic disorders that may impair bone healing or affect the maintenance of osseointegration . on the other hand , especially in cases where endogenous factors are not present , failure of dental implants has also been attributed to exogenous factors such as implant design ( including macro- and microgeometry ) , surgical technique ( excessive surgical trauma ) , overload , misfit of suprastructures , or surgical site infection [ 3 , 4 ] .
( 1981 ) suggested that there are 6 factors that determine the success of osseointegration , that is , biocompatibility , design , surface , state of the host bed , surgical technique , and loading conditions .
needless to say , the proposal advocated some 3 decades ago still remains the gold standard for success , and a great number of researches have been conducted on these factors .
however , compared to the plethora of studies concerning the implant biocompatibility , design , surface , and loading conditions , the number of studies focusing on the host bed and surgical technique is limited .
especially the effect of surgical procedures such as the drilling protocol has been sparsely explored , and clinicians basically follow the given instructions from the manufacturers . previous research has shown that the osteotomy preparation may result in a region of necrotic bone surrounding the inserted implant and that the extent of this region is potentially influenced by the relationship between the drilling speed and heat generated at these sites [ 68 ] .
thus , it is expected that the amount of damage incurred to bone due to instrumentation , and subsequently its ability to heal around implants may depend on the drill material , design , whether irrigation is external or internal and if at all utilized , the rate which the drilling site diameter is incrementally increased ( the number of iteration from initial drill and final drill diameter prior to implant placement ) .
different drilling parameters have been currently evaluated in laboratory bench studies , where variations in drilling speed have been shown to be potentially beneficial to implant integration [ 9 , 10 ] .
in addition , heat production during drilling has also been evaluated as a function of drill design [ 1114 ] , repeated utilization of drill units , and irrigation method [ 16 , 17 ] . with regard to the determination of drilling efficiency and temperature profile as a function of different variables ,
most investigations are bench studies [ 914 , 16 , 18 ] , and few represent the osseointegration assessment of implants placed in sites drilled under various conditions . while useful when a numeric control temperature reference is given , these bench studies have not been appropriately validated in vivo and such studies are highly desirable .
even though there are studies investigating the effect of different drilling protocols on osseointegration , little or no data is available regarding the rate in which the drilling site diameter is incrementally increased prior to implant placement , as anecdotally , this procedure has been performed in an incremental drill diameter fashion in an attempt to minimize bone damage during its instrumentation .
it is a fact that there is no evidence in the literature whatsoever on the optimal drilling protocol that would result in successful osseointegration in clinical reality . at times , there are drilling protocols that require so many time - consuming steps .
it is of great interest to investigate if reducing the number of drills used would provide comparable results to the conventional drilling sequence .
thus , this study tested the hypothesis that no difference in implant osseointegration occurs by reducing the number of drills used for site preparation ( pilot drill + final diameter drill ) relative to the conventional incremental site preparation .
this study utilized 72 screw root form endosseous ti-6al-4v implants of 3.75 mm ( n = 36 ) and 4.2 mm ( n = 36 ) in diameter and 10 mm in length ( c1 , mis , barlev industrial park , israel ) .
half of the implants of each diameter were placed under a simplified technique ( pilot drill + final diameter drill ) and the other half were placed under the conventional drilling technique where multiple drills of increasing diameter were utilized .
previous atomic force microscopy based texture analysis of the alumina - blasted / acid - etched surface used in the present study were made showing an sa of 0.35 m and sq of 0.5 0.54 m .
eighteen beagle dogs approximately 1.5 years of age in good health were used in this study under approval of the bioethics committee for animal experimentation at the ecole veterinaire d'alfort , france .
the surgical site was the proximal tibia , a region with a type 2 bone density , and two implants were placed per limb .
the right and left limbs provided 3.75 mm and 4.2 mm diameter implants that were placed under the simplified and conventional drilling techniques , respectively ( each limb provided samples from the simplified or conventional drilling techniques ) . the conventional drilling sequence for the 3.75 mm diameter implants started from the pilot drill ( 2.4 mm diameter ) , an intermediate drill ( 3.0 mm diameter ) , and then ended with the final drill ( 3.6 mm maximum diameter provided with each implant ) . the conventional drilling sequence for the 4.2 mm diameter implants started from the pilot drill ( 2.4 mm diameter ) , two intermediate drills ( 3.0 mm and 3.5 mm in diameter ) , and then ended with the final drill ( 4.0 mm in diameter ) . the simplified drilling sequence for the 3.75 mm and 4.2 mm diameter implants started with the pilot and then the final burs ( 3.6 mm and 4.0 mm for the 3.75 mm and 4.2 mm diameter implants , resp . ) .
all surgical procedures were performed under general anesthesia . the preanesthetic procedure comprised of an intramuscular administration of atropine sulfate ( 0.044 mg / kg ) and xylazine chlorate ( 8 mg / kg ) .
general anesthesia was then obtained following an intramuscular injection of ketamine chlorate ( 15 mg / kg ) .
following hair shaving , skin exposure , and antiseptic cleaning with iodine solution at the surgical and surrounding area , a 5 cm incision at the skin level was performed . then , the flap and muscle layers were reflected and the proximal tibia was exposed .
two osteotomies were produced at least 10 mm from each other from proximal to distal , and the implants were placed with a torque wrench .
standard layered suture techniques were utilized for wound closure ( 40 vicryl , internal layers ; 40 nylon , the skin , ethicon , johnson & johnson , somerville , nj ) .
postsurgical medication included antibiotics ( penicillin , 20,000 ui / kg ) and analgesics ( ketoprofen , 1 ml/5 kg ) for a period of 48 h postoperatively .
euthanasia was performed by an anesthesia overdose ( n = 6 animals at 1 , 3 , and 5 weeks after surgery ) . at necropsy ,
the limbs were retrieved by sharp dissection , the soft tissue was removed with surgical blades , and initial clinical evaluation was performed .
the specimens were fixed in 10% buffered formalin solution for 24 h , washed in tap water for 24 h , and gradually dehydrated in a series of alcohol solutions ranging from 70% to 100% ethanol . following dehydration ,
the samples were embedded in a methacrylate - based resin ( technovit 9100 , heraeus kulzer gmbh , wehrheim , germany ) according to the manufacturer 's instructions .
the blocks were then cut aiming at the center of the implant along its long axis with a precision diamond saw ( isomet 2000 , buehler ltd . , lake bluff , il , usa ) , glued to acrylic slides with an acrylate - based resin , and a 24 h setting time was allowed prior to grinding and polishing .
the sections were then reduced to a final thickness of approximately 30 m by means of a series of sic abrasive papers ( buehler ltd . ,
lake bluff , il , usa ) in a grinding / polishing machine ( metaserv 3000 , buehler , lake bluff , il , usa ) under water irrigation .
the sections were then stained in 1% toluidine blue and referred to light microscopy evaluation .
measurements of the percentages of bone - to - implant contact ( bic ) and bone - area - fraction occupancy ( bafo ) between threads were performed at 1001x magnification ( leica dm2500 m , leica microsystems gmbh , wetzlar , germany ) by using the national institutes of health image analyzer software ( imagej 1.41o , national institutes of health , usa ) .
the effects of drilling technique , implant diameter , and time in vivo on bic and bafo were evaluated by a glm anova .
the statistical summary concerning the effects of drilling technique as a function of time for bic is presented in figure 1(a ) .
while a significant increase was observed from 1 to 3 weeks ( p = 0.02 ) , this difference was not significant from 3 to 5 weeks ( p = 0.82 ) . the statistical summary for the effect of drilling technique , implant diameter , and time ( figure 1(b ) ) did not show significant differences in bic as a function of drilling technique and implant diameter for each time point evaluated .
the statistical summary concerning the effects of drilling technique as a function of time for bafo is presented in figure 2(a ) . while a significant increase in bafo was observed from 1 to 3 weeks ( p < 0.01 ) , this difference was not significant from 3 to 5 weeks ( p = 0.85 ) .
the statistical summary concerning the effect of drilling technique , implant diameter , and time ( figure 2(b ) ) did not depict significant differences in bafo as a function of drilling technique and implant diameter for each time point evaluated .
no morphologic differences were observed between implants placed with either conventional or simplified techniques , and initial evaluation of the histologic sections at all time points evaluated showed direct contact between implant and bone in cortical and trabecular regions ( figure 3 ) . in general , the histologic evaluation showed that at 1 week , initial woven bone formation occurred in the regions between threads and in direct contact with the implant surface ( figure 4(a ) ) . at three weeks ( figure 4(b ) ) , an increase in the amounts of bone between threads was evident , and ongoing replacement of woven bone by lamellar bone was observed for all groups evaluated at 5 weeks ( figure 4(c ) ) .
the present study design allowed the evaluation of osseointegration measurable parameters in implants placed in sites that were prepared in an incremental diameter fashion ( conventional ) or in a two - step fashion ( pilot drill + final drill ) to final diameters of 3.6 mm and 4.0 mm at 900 rpm under abundant irrigation .
previous research has pointed that a region of necrotic bone surrounding the implant exists following surgery and that the extent of this region is influenced by drilling speed [ 9 , 10 ] , design [ 1114 ] , and irrigation mode ( or absence of irrigation ) [ 14 , 15 ] . for most of the research concerning drills and drilling technique variations , the most commonly measured outcome concerns the heat generated at these sites as a function of different variables always referenced by a suitable control group .
thus , while useful when a numeric control temperature reference is given , these studies and the present study hypothesized that no difference in implant osseointegration occurs by reducing the number of drills for site preparation ( pilot drill + final diameter drill ) relative to the conventional drilling sequence .
it is known that rises in bone temperature during rotary instrumentation are expected to be higher as a function of diametric differences between drills due to the amount of pressure and cutting necessary for site preparation being proportional to this difference .
in fact , thermal osteonecrosis is inexorable if the temperature rises higher than 47c in the bone , which has been reported clinically to be one of the causes of implant periapical lesions or otherwise of a delay in bone regenerative process .
intriguingly , not only did our results depict no differences in bic and bafo between drilling techniques when implant diameter information was collapsed from statistical analyses , but also showed no difference in bic and bafo as a function of implant diameter and time in vivo .
further , the histological observation presented no visible differences for both groups , showing no signs of excessive inflammation , osteoclastic activity , or noticeable necrosis .
this is an indication that the temperature elevation , if any created by the simplified procedure , did not have any negative effects as compared to the conventional protocol , and the irrigation was probably sufficient enough to keep the temperature below the osteonecrosis threshold of 47c .
if the temperature exceeded 47c , the healing probably would have delayed for the simplified protocol group , which would have been evident in the histology or in the histomorphometry as reported by yoshida et al . .
thus , it is highly desirable that future studies combine methods where correlative statistical inferences between temperature rise and osseointegration / biomechanical measurable parameters are possible in order to allow an informed platform for future surgical drilling protocols . since a simplified surgical drilling procedure did not negatively affect the biological response of the implants placed in these sites and was comparable to the conventional drilling sequence , our initial hypothesis that no difference in implant osseointegration occurs by reducing the number of drills for bone site preparation relative to the conventional drilling sequence was accepted .
the results of this study strongly suggest that the osteotomy preparation may be simplified and be less time consuming ; however , constant irrigation will always be necessary to avoid the deleterious effect of temperature elevation in the bone , specially in high density bone , such as the mandibular anterior region .
lastly , a precise drilling orientation is required in the first drills , as in other techniques , but with fewer opportunities for angulation corrections , which may demand a steeper learning curve for the less experienced professional . | ### Summary:
: objectives . to test the hypothesis that there would be no differences in osseointegration by reducing the number of drills for site preparation relative to conventional drilling sequence . methods .
seventy - two implants were bilaterally placed in the tibia of 18 beagle dogs and remained for 1 , 3 , and 5 weeks .
thirty - six implants were 3.75 mm in diameter and the other 36 were 4.2 mm .
half of the implants of each diameter were placed under a simplified technique ( pilot drill + final diameter drill ) and the other half were placed under conventional drilling where multiple drills of increasing diameter were utilized .
after euthanisation , the bone - implant samples were processed and referred to histological analysis .
bone - to - implant contact ( bic ) and bone - area - fraction occupancy ( bafo ) were assessed .
statistical analyses were performed by glm anova at 95% level of significance considering implant diameter , time in vivo , and drilling procedure as independent variables and bic and bafo as the dependent variables . results . both techniques
led to implant integration .
no differences in bic and bafo were observed between drilling procedures as time elapsed in vivo .
conclusions .
the simplified drilling protocol presented comparable osseointegration outcomes to the conventional protocol , which proved the initial hypothesis . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: scientists and public health officials have observed and mapped the geographical incidence of infectious diseases in relation to weather and climate for hundreds of years , and formally for at least a half century ( reisen , 2010 ) . in recent years , this work has accelerated significantly in the context of predictions for global climate change ( ipcc , 2007b ) .
the development of and response to the ipcc 4 predictions of probable increases of vector - borne and diarrheal diseases during coming decades ( ipcc , 2007a ) has catalyzed a great deal of research , analysis , and speculation regarding the nature , magnitude , and extent of possible changes .
numerous , and in some cases conflicting , predictions have been developed regarding the frequency , severity , and duration of epidemics that may emerge .
with respect to the biogeographical focus of this issue , the central question is whether pathogens and parasites that are currently restricted to tropics and lower latitudes where the world s greatest biodiversity lies move toward poles ( mostly north ) and upward in altitude .
perhaps the more controversial topic today is the corollary to this question how much will future ranges of diseases that that do move be constrained by socioeconomic conditions , including our capacity to control them ( hay et al . , 2002 ;
until very recently , climate projections for the coming decades have been limited to very coarse scale projections using global circulation models ( gcms ) at the level of continents and gross latitudinal and altitudinal changes ( fowler et al . , 2007 ) .
downscaling such climate models is still in its infancy and only beginning to be useful for ecological and public health research at the regional , national , and sub - national scale for which most species distribution studies are conducted and validated ( beaumont et al . , 2008 ) . as such
, epidemiologists , ecologists , geographers , and others are grappling with the implications of global climate projections for infectious diseases using a variety of approaches .
these include biological process models , statistical geospatial analysis of current and historical prevalence and incidence , and macroeconomic demographic models , all coupled with climate analyses and projections .
although we are still at an early stage in our ability to make predictions for these extraordinarily complex phenomena , we are beginning to see some general patterns with regard to the important geophysical factors that govern biological basis for distribution change , the role of transport of disease , vectors and hosts , the biotic assemblages that influence establishment , and the socioeconomic conditions that constrain or enhance these dynamics .
underlying most predictions for climate change effects on parasite and pathogen distribution are the physiological factors that regulate survivorship , reproduction , and transmission , and their interaction with extrinsic environmental changes associated with climate : precipitation , humidity , air and water temperature , principally . under moderate greenhouse gas emission scenarios , gcm models project during the next century
approximately 24c average warming and greater precipitation at higher latitudes , with decreased precipitation at lower latitudes , and increases in heavy precipitation events in many regions ( ipcc , 2007b ) .
biological models estimate the responsiveness and thresholds of parasites , pathogens , and vectors to temperature and precipitation .
these models can be used to estimate survivorship , transmissibility , and reproduction , including estimates of r0the basic reproductive ratio under different climate scenarios ( see lafferty , 2009 for review ) . based largely on studies of vector and/or parasite development , warming and increases in humidity
are predicted to open up new zones for malaria in africa ( epstein et al . , 1998 ; martens , 1999 ) , parasitic nematodes in the arctic ( kutz et al . , 2005
) , west nile virus ( reisen et al . , 2006 ) , lyme disease in north america ( ogden et al . , 2008 ) , and schistosomiasis in china ( zhou et al . , 2008 ) .
historical analyses of climate patterns coupled with these biological process models provide additional explanatory power .
for example , observed altitudinal increases in falciparum malaria in the east african highlands during the past 30 years have been associated with increasing temperatures and are consistent with models of anopheline mosquito vector development ( pascual et al . , 2006 ) .
process models also suggest , as one would expect , that in some cases , the same climate trends may reduce survivorship or transmission of pathogens , parasites , and their vectors at the warmer boundaries of their current ranges ( lafferty , 2009 ) .
that is because future temperatures may exceed the biological thresholds for survival or transmission at these boundaries .
more analysis of biological maxima and minima of pathogens , parasites , and their vectors , including their diurnal fluctuation thresholds , in concert with downscaled climate models or historical records will be helpful in this regard .
( 2009 ) analyzed development time of plasmodium falciparum parasites in relation to that of its vector under a range of diurnal temperature fluctuations .
they found that at the higher mean temperatures ( > 26c ) associated with endemic malaria transmission in africa effects of global warming on malaria dynamics may be overestimated .
however , at lower mean temperatures associated with epidemic outbreaks ( < 20c ) , such as those found in the kenyan highlands , real increases in r0 with a couple degrees of warming are biologically possible , and consistent with epidemiological trends during the past 20 years in that region .
similarly , changes in seasonality , especially intensity of rainfall , has been shown to be important in several diseases ( koelle et al . , 2005 ; altizer et al .
more frequent heavy rainfall events are predicted to occur in some areas , although the confidence levels and scaling of these future precipitation models may still be insufficient to support geographically specific predictions . whereas vector - borne diseases , and to a lesser extent diarrheal diseases , have been the principal focus of discussion , directly transmitted diseases , such as influenza and cold viruses , are likely to change as well .
recent laboratory work ( shaman and kohn , 2009 ) on the persistence and transmission efficiency of influenza has shown the virus to be constrained markedly by absolute humidity .
more recent epidemiological analysis support this finding ( shaman et al . , 2010 ) and suggest that the marked seasonality and generally predictable geographical trajectory of seasonal influenza likely reflect , at least in part , climate variables .
analyses of biological processes in relation to climate - relevant geophysical parameters establish the potential for climate change effects . however , they are insufficient to explain the highly complex dynamics of infectious disease transmission and establishment , including biological , climatological and socioeconomic considerations .
a frequently used alternative approach to predicting biogeographic spread is based on mapping the statistics of current and historical disease or vector prevalence or transmission coupled with climate projections , often based on gcms ( rogers and randolph , 2000 ; mabaso et al . , 2006 ;
more recent statistical mapping ( also called niche modeling ) approaches have been able to use downscaled climate models ( de la rocque , 2008 ) in their projections . several have predicted northward shifting zones of infection with modest impacts on overall extent of distribution ( rogers and randolph , 2000 ; hay et al .
although essential , many of these statistical mapping projects make their own set of assumptions . particularly problematic are those that assume that today s public health and socioeconomic conditions , including surveillance and control capabilities , populations affected , and other ecological and economic conditions , will be similar to future conditions at new locations .
one significant and long - presumed constraint on long - range biogeographical spread of invasive species , including pathogens , parasites , vectors , and hosts , has been the role of spatial distance on the ability to arrive at a new hospitable site ( macarthur and wilson , 1967 ; reperant , 2009 ) .
this is , of course , less of a constraint today and for the foreseeable future due to a diversity of globalized transport opportunities . specifically , agriculture trade ( arzt et al . , 2010 ) , livestock movement ( fevre et al . , 2006 ) , wildlife trade ( karesh et al . , 2005 ) , human travel and migration ( macpherson et al . , 2009 ) , ship ballast water ( aguirre - macedo et al . ,
2008 ) , auto tire trade ( hawley et al . , 1987 ) , and the global transport of desert dust containing microbiota regularly move pathogens , vectors , and infected hosts all around the earth . at small and intermediate scales , distance is still a very important determinant of disease movement .
for example , triatomine vector dispersal of chagas disease in argentina at a scale of meters to a few kilometers ( zu dohna et al . , 2009 ) or movement of african trypanosomiasis at a scale of tens to hundreds of kilometers via animal migrations ( batchelor et al . , 2009 )
of course , if pathogens establish in a new zone and the process is allowed to continue incrementally year after year , diseases can and have moved across countries in a decade without the aid of modern transportation .
however , at continental and intercontinental scales , movement of many diseases in a warming world is unlikely to have a linear relationship to distance because of the numerous means of long distance transport operating today .
because infectious diseases are components of species networks , simply arriving in a new location may be insufficient for establishment and creation of endemic lifecycles .
a number of studies have shown that emerging and reemerging diseases , particularly those in the tropics , are predominantly zoonotic and/or vector - borne diseases ( daszak et al . , 2000 ; woolhouse and gowtage - sequeria , 2005 ; wolfe et al . , 2007 ) .
the principal ecological determinant for successful establishment for zoonotic and vector - borne disease success in a decadal time frame is probably a broad host range ( woolhouse and gowtage - sequeria , 2005 ; daszak et al . , 2000 ) . in recent years
, a number of vector - borne viral diseases have migrated across or between continents through their ability to acquire new vectors ( west nile , chikungunya ) or utilize diverse and widely dispersed domestic ( rift valley ) or native ( west nile ) animal hosts ( gould and higgs , 2009 ) .
importantly , the capacity to acquire new vector and host species often is facilitated by the capacity of the pathogen to evolve mutant strains that are efficiently acquired and transmitted by this new species .
parasitic and infectious diseases with long , specialized , and/or especially complex life cycles involving multiple host species would logically be more challenged to establish themselves in new habitats by the need to find appropriate hosts and vectors .
for example , the highly pathogenic alveolar echinococcosis ( fox tapeworm ) has a northern distribution that is influenced by climate but constrained by landscape variables that determine host availability ( danson et al . , 2003 ; mas - coma et al . ,
egg survival is dependent on ground moisture levels , but intermediate stages survive in rodents , and its definitive hosts are typically foxes , coyotes , and dogs . at large spatial scales across china and inner mongolia , a. echinococcus distribution has become focal due to the interaction of the requirements for a physical environment that is moist and cool enough to allow for egg survival and for the grassland landscapes that support both high densities of small mammals and canine hosts ( giraudoux et al . , 2006 ) .
high levels of forest cover or cleared agricultural landscapes reduce intermediate and/or definitive host densities .
it follows that for long - lived , host - specialized parasites , such as echinococcus , it is likely that long time periods are required for the evolutionary changes required to enable dispersal to zones with insufficient host densities of its original species . however , some historical and paleontological studies of parasites suggest that host - switching behavior in parasites in response to ecological changes has been more common than generally thought and global climate changes are likely to produce broadening of parasite host ranges even for long - lived , nominally specialized parasites ( brooks and hoberg , 2007 ) .
by contrast , water - borne diarrheal diseases often are predicted to increase with climate change .
biogeographically restrictive interaction of diarrhea - causing pathogens with new hosts or other pathogens has received little attention to date in the context of climate change .
an exception is a series of papers by colwell and workers on associations of vibrio cholera with copepods in zooplankton ( gil et al .
, 2004 ; constantin de magny et al . , 2008 ) . for directly transmitted human diseases , the sorts of species network challenges may be even less of a constraint .
we see rapid cross - national and continental movement and invasion by new viruses , such as seasonal influenza , sars , and other coronaviruses .
although much of the climate change and disease discussion has focused on vector - borne diseases ( lafferty , 2009 ) , the biotic simplicity of directly transmitted diseases , in concert with the climate sensitivity of viruses as discussed earlier , might argue that we should pay more attention to them in climate change discussions .
although there has been little serious discussion that climate change will not impact infectious disease distributions , a view expounded by a number of authors ( reiter , 2008 ; zell et al . ,
2008 ; lafferty , 2009 ) discounts the relative role of climate change compared with other major influences on human disease .
these factors include efficacy of control measures , such as vector control , sanitation , vaccination , and chemotherapy ( hay et al . , 2002 ) , as well as land use , urbanization , travel , wealth , and social behavior ( gubler et al . , 2001 ; sumilo et al . ,
statistical mapping analyses ( rogers and randolph , 2000 ; hay et al . , 2004 ) indicate that the spatial extent and number of countries reporting endemic malaria has shrunk toward the tropics from a much wider range during the twentieth century .
the authors attribute this principally to better control of vectors and disease . further support can be seen in the rapid reemergence of tick - borne encephalitis in central and eastern european states after the collapse of the soviet union ( 19702005 ) ( sumilo et al . , 2008 ) .
statistical comparisons of results of extensive socioeconomic surveys and public health data across five former soviet states indicate that various socioeconomic , land use , and public health programs can explain most of the variation across countries in the spread of tick - borne encephalitis during this period . in this analysis ,
climate variables were not assessed , but significant unemployment , reversion of agricultural lands , reduced pesticide use , reduced chemotherapy , and individual exposure through increased field collection of wild foods appear to have contributed to rapid increases during the early 1990s .
the interaction of climate change , infectious diseases , socioeconomic conditions , and behavior is going to be increasingly important in the coming years and represents an exciting and complex area for research ( patz et al . , 2005 ) .
for example , several authors have predicted mass migrations in response to climate change , particularly in response to worsening droughts in sub - saharan africa ( ramin and mcmichael , 2009 ) ( ipcc , 2007a ) .
if borne out , it is likely that many diseases will travel with migrants , and in some cases will establish new infectious species or strains with significant effects on receiver populations ( macpherson et al . , 2009 ) .
similarly , availability of clean water and hygienic behavior are principal determinants of diarrheal disease outbreaks , and clean water will be increasingly in short supply in much of africa and parts of southeast asia in the coming decades due to overexploitation and climate change ( ipcc , 2007a ) . in an analysis of frequency
all cause diarrhea in children younger than age 5 years in low- and middle - income countries , lloyd et al .
( 2007 ) found that low mean monthly rainfall during the course of a year was significantly associated with disease .
surprisingly , neither temperature nor simple measures of socioeconomic development ( gdp or gcp ) were significant in this analysis of a disease type mostly managed by traditional public health measures , such as sanitation and education .
diarrheal diseases are produced by a diversity of bacterial , viral , and protozoan organisms .
strain diversity within a species is high locally ( e.g. , jiang et al . , 2000 ) around the world , and migration to new zones has significant implications for biologically nave host populations .
finally , given the importance and complexity of socioeconomic conditions on diseases , a variety of approaches and disciplines will be necessary to assess their effects on pathogen and parasite biogeography ( parkes et al .
, 2005 ) . macroeconomic and demographic modeling may offer underexploited utility in this regard . a recent paper by tang et al .
( 2009 ) is instructive ; they set out to disentangle the causality of a climate - income trap model for human health by examining national life expectancy statistics ( 45 african , 113 non - african countries ) in a cross - sectional analysis . using a series of regression models and variation partitioning analyses to separate pure and combined effects of income and climate their findings support the hypotheses that : 1 ) income can moderate the adverse effect of climate on life expectancy ( le ) ; 2 ) as income grows climate will have less of an effect on le ; and 3 ) climate has a larger effect on le in african countries than in non - african countries , and further that for african countries , climate has had a larger effect on le than wealth
debates over the impact of climate change on infectious disease emergence and migration are certain to continue in the years to come .
these with statistical and mapping approaches help provide us greater clarity and ensure that we are asking the right questions .
macroeconomic and demographic approaches may help us address some of the big questions related to the role of disease management capability .
critical to a greater understanding of these dynamics and more predictive power is greater availability of downscaled general circulation models to scales that are more relevant to community and landscape biology and public health .
i have not addressed time scales in any depth here , but they are extremely important aspects of biogeographic changes in relation to climate .
longitudinal studies on the multi - decadal time frames that climate change presents are a major challenge . but the time required for evolution of host range , for population dynamics of hosts and parasites to stabilize , and for medical and public health systems to adapt will all have major roles in determining biogeographic patterns of disease , and will all operate relatively independently .
debates about whether socioeconomic conditions or climate will be more important are probably more polarized than is productive .
both of these complex suites of variables are interacting with each other , and may do so in different ways for different diseases in different places .
however , understanding these disease forcing factors and their interactions with each other are crucial to our ability to predict and prevent the most severe health outcomes .
the public health and medical community has made enormous strides in control of infectious diseases during the past half - century .
widespread availability of antimicrobial drugs , vector - control systems , diagnostics , vaccines , and increasingly sophisticated predictive models represent a powerful set of tools to protect public health from emerging diseases . however , it would be unwise to discount the potential importance of climate change , land use impacts , and other ecological determinants of future disease .
historically , ecological factors , including climate , have been extremely important in determining both the range and severity of diseases .
these factors are now aggravated by the near disappearance of antimicrobial drug development in the industrial pharmaceutical sector , dramatic reductions in training and support for vector control scientists and implementers , persistent scientific and financial challenges in developing new drugs and vaccines for even the most widespread diseases ( e.g. , hiv , malaria , tb ) , and medical workforce shortages in the poorest parts of the world .
as our scientific capabilities to describe and model diseases and disease processes expands rapidly , it will be important to ensure that we understand the changing nature of our planet and continually adapt our systems and invest in them to meet the challenges . | ### Summary:
: our ability to predict the effects of climate change on the spread of infectious diseases is in its infancy .
numerous , and in some cases conflicting , predictions have been developed , principally based on models of biological processes or mapping of current and historical disease statistics .
current debates on whether climate change , relative to socioeconomic determinants , will be a major influence on human disease distributions are useful to help identify research needs but are probably artificially polarized .
we have at least identified many of the critical geophysical constraints , transport opportunities , biotic requirements for some disease systems , and some of the socioeconomic factors that govern the process of migration and establishment of parasites and pathogens .
furthermore , we are beginning to develop a mechanistic understanding of many of these variables at specific sites .
better predictive understanding will emerge in the coming years from analyses regarding how these variables interact with each other . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: the model allows comparison of different restorative materials for restoration of abfraction lesions in the presence and absence of occlusal restoration .
the model can be used to validate more sophisticated computational models as well as to conduct various optimization studies .
abfraction lesions present primarily at the cervical region of the dentition and are typically wedge - shaped , with a sharp internal and external line angles .
recently , the finite - element analysis ( fea ) has been extensively used in dentistry because it shows the tooth mechanical behavior in detail .
this method is extremely useful for indicating mechanical aspects of biomaterials and human tissues that can hardly be measured in - vivo .
currently , materials indicated to be used for restoring the cervical lesions include : glass - ionomer cements ( gic ) , resin - modified glass - ionomer cements ( rmgic ) , poly - acid modified resin - based composites ( compomers ) and composite resins .
stress concentration at the cervical region is responsible not only for the development of cervical lesion but for restoration retention failure as well .
combining chemical adhesion and restorative materials of appropriate elastic properties show promise of long - term success . in this study , nano - filled rmgic , micro - hybrid low - shrink resin composites were evaluated .
tyas , recommended that rmgic should be the first preference for restoration of non - carious cervical lesions ( nccls ) and rmgic / gic liner base be laminated with resin composite ; hence , layering technique was also considered .
so , the purpose of this study was two fold.first , to evaluate the mechanical behavior of various restorative materials in abfraction lesion and secondly , stresses generated in the tooth and cervical restoration in the presence and absence of occlusal restoration .
a three - dimensional ( 3d ) finite - element model ( fem ) of a mandibular first premolar was created in the fea software preprocessor ansys rel 9.0 fem software ( ansys inc . ,
as judged by direct vision and radiography the reconstruction was done with comparison of literature data on tooth morphology . according to coolidge ,
the periodontal ligament is of varying thickness in - vivo and has been applied in this study to make the model more precise and realistic .
the alveolar bone ( cancellous and compact ) that supports the tooth was reconstructed with the upper line of the bone 3 mm below the cervical line of the tooth simulating an actual anatomic situation .
first order tetrahedral elements with 3 degree of freedom per node were used for meshing the models which resulted in 67,278 nodes and 357,333 elements of approximately 0.3 mm size .
the exterior nodes of the alveolar bone were fixed in all directions as the boundary conditions .
modulus of elasticity and poisson 's ratio were assigned to the elements [ table 1 ] .
six experimental models were generated and an abfraction wedge shaped lesion was created on the buccal cervical margin of 1.5 mm deep and 2 mm in occluso - cervical direction .
group a models had an additional class - i shaped volume with cavity depth of 2 mm and was given the properties of micro - hybrid composite ( filtek z250 , 3 m espe seefeld , germany ) .
the adhesive layer was modeled in the cervical lesion and the occlusal cavity ( group a ) for composite resin restorations as a shell layer of 50 m wide .
finite element model of tooth , ( a ) details of abfraction lesion , ( b ) direction and location of applied force on tooth all the models were grouped and sub - grouped as follows :
group a : model with abfraction lesion and occlusal restorationgroup b : model with abfraction lesion and without occlusal restorationa1 and b1 : low shrink composite ( filtek ls , 3 m espe , seefeld , germany)a2 and b2 : nano - rmgic ( ketac n100 , 3 m espe , seefeld , germany)a3 and b3 : a layered technique with use of conventional resin - modified glass - ionomer cement ( fuji ii lc , gc , tokyo , japan ) of 0.5 mm thickness veneered by 1 mm thickness of low shrink composite .
polymerization contraction of micro - hybrid composite in the occlusal cavity was modeled as 2% ( group a ) and low shrink composite in the abfraction lesion was modeled as 1% .
group a : model with abfraction lesion and occlusal restoration group b : model with abfraction lesion and without occlusal restoration a1 and b1 : low shrink composite ( filtek ls , 3 m espe , seefeld , germany ) a2 and b2 : nano - rmgic ( ketac n100 , 3 m espe , seefeld , germany ) a3 and b3 : a layered technique with use of conventional resin - modified glass - ionomer cement ( fuji ii lc , gc , tokyo , japan ) of 0.5 mm thickness veneered by 1 mm thickness of low shrink composite .
a load of 90 n , 200 n , and 400 n were applied on the buccal inclines of the buccal cusp and oriented in 45 oblique direction toward the buccal from the long axis of the tooth [ figure 1b ] .
only static loading was considered and the occlusal load of typical magnitude was resolved into vertical ( y - axis ) and horizontal ( x - axis ) components and applied on the tooth [ figure 1b ] .
the failure was decided by the fact that a higher von mises stress value will be an indication of a greater possibility of failure and the resultant stresses were compared with the materials tensile strength . in this study ,
the following assumptions were made :
enamel , dentin , and the restorative materials were assumed to be homogeneous and isotropic.the polymerization of the restoration results in uniform volume shrinkage .
enamel , dentin , and the restorative materials were assumed to be homogeneous and isotropic .
it was noticed that the von mises stress levels increased in direct proportion with increased loading in all the groups .
irrespective of the materials used , maximum stresses occurred at the cervical margin of the restoration [ tables 2 and 3 ] .
the stresses in overall tooth show that , in group a [ figures 24 ] , irrespective of loading condition low - shrink composite showed least stress followed by nano - rmgic and layering technique . in group b [ figures 57 ] , low - shrink composite and nano - rmgic showed similar stresses , which were comparatively more than layering technique .
von mises stresses in tooth ( mpa ) with occlusal cavity ( group a ) von mises stresses in tooth ( mpa ) without occlusal cavity ( group b ) stress distribution in low - shrink micro - hybrid composite with occlusal restoration at different loads .
the value at the lower right hand side ( red color ) is the maximum stress and left hand side ( blue color ) is the least stress stress distribution in nano - ionomer with occlusal restoration at different loads stress distribution in layering technique with occlusal restoration at different loads stress distribution in low - shrink micro - hybrid composite without occlusal restoration at different loads stress distribution in nano - ionomer without occlusal restoration at different loads stress distribution in layering technique without occlusal restoration at different loads the stresses in cervical restoration show that , in group a , both low - shrink composite and nano - rmgic resulted same stresses which were recorded to be marginally lower than layered restoration . in group
b , nano - rmgic revealed the least stress followed by low - shrink composite and layered restoration .
it was observed that the resultant maximum stresses in overall tooth and in the cervical region were higher in group b than in group a.
the scope of this study was to evaluate the mechanical behavior of various restorative materials known to be recommended or used in abfraction lesions under different loading characteristics .
the possible changes in the tooth structure because of occlusal restoration , the utilized restorative material and their consequences were studied in detail .
the lingual orientation of mandibular bicuspids renders them more susceptible to the concentration of tensile stresses at the cervical region , the anatomically smaller cervical cross section may also contribute to the weakness of the teeth . in this study , 3d - fea
3d - fea is preferred to obtain an optical realistic analysis with detailed tooth anatomy and computational process . in this study
modulus of elasticity of periodontal ligament is low ; as a result , it allows the tooth to bottom out allowing tooth movement . modeling periodontal ligament is important for realistic results .
cementum is a very thin layer and has the same physical properties as dentin ; therefore , it seemed unnecessary to define it as a separate layer from the dentin .
our analysis reveals that , all the tooth models restored with different materials showed high resultant stresses concentrated at the cervical margin .
this is in accordance with clinical surveys which showed a higher percentage of marginal defects in restorations of the nccl occurring on the cervical area of the restoration . from an analytical point of view , this study used different loads like 400 n , which was assumed to represent bruxism , 200 n vaguely represents the traumatic load and 90 n load was relatively modest in clinical terms . when a low - shrink composite was taken into consideration , in group a it showed least stresses compared to other materials
the necessity of stress buffering was acknowledged by kemp - scholte and davidson in the case of shrinkage stress reduction .
however , this principle can be extrapolated to other functional load cases as shown by ausiello et al .
the results of this study agree with the findings of kemp - scholte and davidson , who reported an improvement of surface marginal integrity when a layer of adhesive resin was used in a class v composite restoration .
this was attributed to an increase in strain capacity of the adhesive resin so that the restoration could deform under the loading of polymerization shrinkage .
when nano - rmgic was taken into consideration , it developed least stresses in the cervical region of tooth with and without occlusal restoration
. this may be due to the deformation and flexing of the material because of its low modulus , which absorbed the induced stresses and thus reduced the resultant stresses in the tooth .
this is in accordance with van meerbeek et al . who confirmed the correlation of improved clinical results with lower moduli of elasticity .
the restorations with lower modulus of elasticity allow the restoration to flex with the tooth rather than debond . on the contrary
, a study showed that class v lesions restored with materials of higher modulus of elasticity enabled better stress distribution .
when layered restoration was considered , in group a the stresses were more with this technique when compared with other two materials .
but , in group b stresses were equivalent to low - shrink composite . a thick layer of rmgic in the layered restoration acts as a stress breaker compared to the bulk filled technique . in the layering technique a thin layer of a flexible material would fail in the cervical region , mainly because , its limited thickness can not provide sufficient reduction in stress . in the case of thick layer
, failure does not occur but the marginal tensile stresses are close to the failure limit .
the occlusal restoration weakens the integrity of the tooth and allows greater flexing of the cusp under occlusal load . on the contrary , in this study , teeth without occlusal restoration resulted in marginally higher stresses . for the tooth with occlusal restoration
, the limited cuspal flexure may be explained by the perfect simulation of the bond between tooth and restoration , and such cusp reinforcement is achieved by the bonding agent .
failure to consider occlusion will likely lead to restorative failure as clearly demonstrated by previous studies .
lambrechts et al . pointed out that if the occlusion is not corrected , it results in premature loss of the cervical restoration .
elimination of non - axial forces can be achieved by simple occlusal equilibration , which will result in reduction or elimination of stress on the restoration . in this study ,
the resultants of the 90 n force can be compared to the stress obtained on occlusal correction .
the extent of the role of compressive stress versus tensile stress in the retentive failure in - vivo remains uncertain .
finally any conclusions drawn by considering a single stress component will not reflect the true behavior of the tooth and hence will be far from accurate .
the magnitude of stresses reported in this study are likely to be higher , since the polymerization shrinkage was assumed to be applied instantaneously where as , in reality , the shrinkage increases gradually , which may allow an opportunity for stress reduction , which can not be simulated and calculated with computer .
small areas of de - bonding and composite flow during polymerization also may reduce the amount of stress on the tooth , in reality .
studies have proven the anisotropic property of enamel and dentin and intraoral environment gives rise to nonlinearities in the periodontal ligament , residual stresses in restorative materials and inter facial stresses .
such nonlinear simulations of the analysis were not carried out in this study , which will provide more realistic results .
further studies need to be carried out keeping into consideration all these factors accompanied by long - term clinical experiments .
within the limitations of this study :
restorative materials with low modulus of elasticity ( nano - rmgic restorative material ) are successful in abfraction lesions at moderate tensile stresses whereas a higher modulus of elasticity and mechanical properties ( low - shrink composites ) can support higher loads and resist wearirrespective of occlusal restoration , low - shrink micro - hybrid composites showed good results at all the loading conditions without crossing its tensile strength limitsirrespective of occlusal restoration , both nano - ionomer and layered technique performed well at 90 n and 200 n , but both failed at 400 n because of the resultant stresses produced beyond their tensile strength .
restorative materials with low modulus of elasticity ( nano - rmgic restorative material ) are successful in abfraction lesions at moderate tensile stresses whereas a higher modulus of elasticity and mechanical properties ( low - shrink composites ) can support higher loads and resist wear irrespective of occlusal restoration , low - shrink micro - hybrid composites showed good results at all the loading conditions without crossing its tensile strength limits irrespective of occlusal restoration , both nano - ionomer and layered technique performed well at 90 n and 200 n , but both failed at 400 n because of the resultant stresses produced beyond their tensile strength . | ### Summary:
: objectives : the present comparative analysis aimed at evaluating the mechanical behavior of various restorative materials in abfraction lesion in the presence and absence of occlusal restoration.materials and methods : a three - dimensional finite - element analysis was performed .
six experimental models of mandibular first premolar were generated and divided into two groups ( groups a and b ) of three each .
all the groups had cervical abfraction lesion restored with materials and in addition group a had class i occlusal restoration . a load of 90
n , 200 n , and 400 n were applied at 45 loading angle on the buccal inclines of buccal cusp and von mises stresses was chosen for analysis.results:in all the models , the values of stress recorded at the cervical margin of the restorations were at their maxima .
irrespective of the occlusal restoration , all the materials performed well at 90 n and 200 n. at 400 n , only low - shrink composite showed stresses lesser than its tensile strength indicating its success even at higher load.conclusion:irrespective of occlusal restoration , restorative materials with low modulus of elasticity are successful in abfraction lesions at moderate tensile stresses ; whereas materials with higher modulus of elasticity and mechanical properties can support higher loads and resist wear.significance:the model allows comparison of different restorative materials for restoration of abfraction lesions in the presence and absence of occlusal restoration .
the model can be used to validate more sophisticated computational models as well as to conduct various optimization studies . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: in 2012 , colorectal cancer was the second most diagnosed cancer in europe after breast cancer .
colorectal cancer was also responsible for the second highest number of cancer - related deaths after lung cancer .
currently , the only curative therapy for patients with colorectal cancer is surgery with radical removal of the tumour .
when the cancer is limited to the bowel wall , surgery itself normally attains the desired oncologic outcome . in cases of lymph node involvement , i.e. stage iii disease
it has been confirmed in several studies that a 5-fluorouracil ( 5-fu)-based chemotherapy regimen improves both overall and disease - free survival for patients with stage iii disease [ 24 ] . considering the numbers of patients and administered treatments , it is of great importance to find methods to tailor or at least optimise the therapy .
however , even patients with high - risk profiles , such as poorly differentiated tumours without lymph node metastasis , could benefit from additional treatment . in this post - operative
5-fu - based chemotherapy has also been shown to prolong overall survival in palliative settings , i.e. for patients with confirmed distant metastasis .
5-fluorouracil was developed in the 1950s by charles heidelberger , who discovered that rat hepatomas were consuming the pyrimidine uracil more rapidly than normal rat liver tissue .
5-fu is an analogue of uracil in which the hydrogen at position 5 is replaced by fluorine . using the same mechanism to enter the cell as uracil
, the 5-fu molecule is converted into the active metabolite 5-fluoro-2-deoxyuridine 5-monophosphate ( fdump ) , which forms an inhibitory ternary complex with thymidylate synthase ( ts ) and 5,10-methylenetetrahydrofolate ( methylenethf ) .
this results in the inhibition of thymidylate synthesis and impairment of both dna synthesis and dna repair .
the greatest impact is on cells that are rapidly dividing , such as tumour epithelial cells .
the response rate of colorectal tumours to 5-fu monotherapy is only around 10 % . by adding the stable calcium salt of 5-formyltetrahydrofolic acid ( calciumfolinate ) , which is converted in the liver into methylenethf
, the tumour response rate can be improved to 21 % , as has been shown in a meta - analysis .
the nordic flv therapy , which is a combination of 5-fu and leucovorin ( ref 12 ) that was introduced in the 1990s , is still the cornerstone of both adjuvant and palliative treatments for colorectal cancer in nordic countries .
the standard dosage is 500 mg / m 5-fu plus 60 mg / m leucovorin in the form of calciumfolinate , administered as an intravenous infusion 2 days in a row .
the regimen has been duly updated with the incorporation of novel drugs , such as oxaliplatin and antibodies into more effective combination therapies .
although it is a well established regimen , the evidence for the leucovorin dosage used is rather limited .
different regimens used in clinical practice worldwide apply levels of leucovorin that range from 20 to 500 mg / m .
leucovorin has no intrinsic antitumour effect but it enhances the effect of 5-fu by providing the cofactor methylenethf in abundance and by stabilising the ternary complex .
however , leucovorin must first be converted in two steps into methylenethf , which is the active metabolite .
this requirement for metabolic activation may result in inter - individual differences in uptake , thereby compromising the benefit gained from the addition of leucovorin in some of the patients .
the impressive advances that have been made in genetics and metabolite measurements ( metabolomics ) provide new possibilities for advanced studies of the folate metabolism and facilitate a better understanding of related cellular mechanisms .
ms / ms method that is sufficiently sensitive to separate and quantify different forms of folate .
thus , the actual concentration of methylenethf , and not only of total folates , can now be measured in tissue samples . as evidenced by our recent findings , using the novel method
, there is a significant variability in the folate levels in tumour and mucosa tissues between patients .
the aim of the present study was to determine the levels of different folate forms in tumour and mucosa tissue of patients with colorectal cancer who received different dosages of leucovorin intravenously at the time of surgery .
eighty patients scheduled for a colorectal resection with a cancer indication were enrolled in the study between january 2011 and january 2012 .
the pre - operative exclusion criteria were patient inability to understand the study information or inability to provide true informed consent .
there were no other exclusion criteria ( such as asa - class , renal function or pre - operative tumour stage ) .
the patients were pre - operatively randomised into four groups ; the first served as control group and received no leucovorin .
groups 2 , 3 , and 4 received 60 , 200 , and 500 mg / m leucovorin , respectively , administered intravenously at the initiation of general anaesthesia .
the leucovorin was manufactured in the form of calcium folinate ( dl - leucovorin ) supported by teva sweden ab helsingborg .
the patients were otherwise treated in accordance with normal routines and guidelines . during surgery , at the time of removal of the surgical specimen , the research nurse collected fresh tissue samples from both the tumour and macroscopically normal - appearing mucosa located 10 cm from the tumour .
the biopsies were snap - frozen in liquid nitrogen and stored at 80 c until used .
based on the routine pathology reports , four patients were excluded from the study because the analysis revealed a lack of adenocarcinoma tissue ; two patients had an obstruction related to diverticulitis , one had a squamous epithelial cancer , and one had a non - malignant adenoma . during analysis of blood samples , we discovered that one patient in treatment group two had received a leucovorin dose that was not according to the protocol and this patient is also excluded from the study .
the main assessment was of the folate levels in the mucosa and tumour tissues in relation to treatment group .
clinical and pathology data regarding diagnosis , tumour differentiation and stage , and pre - operative treatment regimen were retrieved to assess the different groups and enable a better understanding of the factors that might influence treatment responses .
a liquid chromatography electrospray ionisation tandem mass spectrometry ( lc ms / ms ) method was used to evaluate the levels of the folate derivatives , tetrahydrofolate ( thf ) , methylenethf , and 5-methyltetrahydrofolate ( methylthf ) in tumour tissue and adjacent mucosa , separately . ) .
ms / ms analyses were performed on a waters 2795 lc separation module coupled to a waters micromass quattro triple - quadrupole ms system with an electrospray ionisation ( esi ) source .
the separation of folates was performed using an atlantis dc18 3 m , 2.1 * 100 mm column ( waters ) together with the guard column atlantis dc18 , 3 m , 2.1 * 10 mm . the mobile phase consisting of eluent a ( 0.1 % of acetic acid in water ) and eluent b ( 0.1 % acetic acid in acetonitrile ) was used .
the extracted ions following mrm transitions were monitored at m / z 446 299 for thf , m / z 458 311 for methylenethf , m / z 460 313 for methylthf , and m / z 459 312 for tomudex ( is ) . on the day of sample analysis , extraction buffer was prepared containing 50 mm phosphate buffer , ph 7.0 , 1 % ascorbate , and 0.1 % -mercaptopropanol .
the tissue was weighed and placed in an eppendorf vial and a 10 volume of extraction buffer was added .
homogenisation was performed using a tissuelyzer ( two disruption steps at 25 hz for 2.5 min ) .
after deconjugation , protein precipitation , centrifugation , and ultrafiltration ( 30 min at 21,500g at 20 c ) were performed .
the solution at the bottom of the test tube was used for the lc ms / ms analysis .
calibration graphs were constructed by plotting the peak area ratio of each compound to internal standards against concentration . the standards and samples
intra - batch variability was determined by analysing tissue q - samples at low , medium , and high concentrations on the same day .
inter - assay variability was determined by analysing low , medium , and high concentration samples on four separate days .
the relative standard deviation ( rsd ) ranged from 2 to 7 % for all analyses , and the variability over 4 days ranged from 3 to 14 % for all analyses .
the accuracy of the method was determined by estimating the recovery by adding known amounts of the standard to a sample .
the average recoveries were 98 , 87 , and 93 % for thf , methylenethf , and methylthf , respectively .
the levels of thf , methylenethf , and methylthf in each sample were expressed as pmol / g wet - weight ( pmol / gww ) . due to the known interconversion of methylenethf and thf ,
the plasma samples were frozen , stored , and shipped at 80 c to charles river laboratories , uk , where the plasma concentrations of methylenethf , thf , methylthf , and formyl - thf were analysed using a validated lc
whitney / kruskal wallis , and matched - pair analyses ( wilcoxon signed rank test ) were used to examine differences between the groups .
also presented are descriptive statistics with mean or median values and measures of dispersion , as appropriate .
a liquid chromatography electrospray ionisation tandem mass spectrometry ( lc ms / ms ) method was used to evaluate the levels of the folate derivatives , tetrahydrofolate ( thf ) , methylenethf , and 5-methyltetrahydrofolate ( methylthf ) in tumour tissue and adjacent mucosa , separately . ) .
ms / ms analyses were performed on a waters 2795 lc separation module coupled to a waters micromass quattro triple - quadrupole ms system with an electrospray ionisation ( esi ) source .
the separation of folates was performed using an atlantis dc18 3 m , 2.1 * 100 mm column ( waters ) together with the guard column atlantis dc18 , 3 m , 2.1 * 10 mm . the mobile phase consisting of eluent a ( 0.1 % of acetic acid in water ) and eluent b ( 0.1 % acetic acid in acetonitrile ) was used .
the extracted ions following mrm transitions were monitored at m / z 446 299 for thf , m / z 458 311 for methylenethf , m / z 460 313 for methylthf , and m / z 459 312 for tomudex ( is ) . on the day of sample analysis
, extraction buffer was prepared containing 50 mm phosphate buffer , ph 7.0 , 1 % ascorbate , and 0.1 % -mercaptopropanol .
the tissue was weighed and placed in an eppendorf vial and a 10 volume of extraction buffer was added .
homogenisation was performed using a tissuelyzer ( two disruption steps at 25 hz for 2.5 min ) .
after deconjugation , protein precipitation , centrifugation , and ultrafiltration ( 30 min at 21,500g at 20 c ) were performed .
the solution at the bottom of the test tube was used for the lc ms / ms analysis .
calibration graphs were constructed by plotting the peak area ratio of each compound to internal standards against concentration .
the standards and samples were processed using the quanlynx quantitative processing tool in masslynx ( waters corp . ,
intra - batch variability was determined by analysing tissue q - samples at low , medium , and high concentrations on the same day .
inter - assay variability was determined by analysing low , medium , and high concentration samples on four separate days .
the relative standard deviation ( rsd ) ranged from 2 to 7 % for all analyses , and the variability over 4 days ranged from 3 to 14 % for all analyses .
the accuracy of the method was determined by estimating the recovery by adding known amounts of the standard to a sample .
the average recoveries were 98 , 87 , and 93 % for thf , methylenethf , and methylthf , respectively .
the levels of thf , methylenethf , and methylthf in each sample were expressed as pmol / g wet - weight ( pmol / gww ) . due to the known interconversion of methylenethf and thf ,
the plasma samples were frozen , stored , and shipped at 80 c to charles river laboratories , uk , where the plasma concentrations of methylenethf , thf , methylthf , and formyl - thf were analysed using a validated lc ms / ms method .
the jmp 11.0/sas software ( sas institute inc . , cary , nc , usa ) was used for the statistical analyses .
whitney / kruskal wallis , and matched - pair analyses ( wilcoxon signed rank test ) were used to examine differences between the groups .
also presented are descriptive statistics with mean or median values and measures of dispersion , as appropriate .
based on clinical diagnosis , 38 patients had colon cancer , 37 had rectal cancer , and three patients had cancer in both the colon and rectum synchronously .
the latter three patients were excluded from the statistical analyses of folate levels according to tumour location .
there were no significant differences regarding age , gender , tumour location , tumour stage , tumour differentiation , or lymph status between the four groups .
the mean times between administration of leucovorin and time of biopsy sampling , as well as ranges for the three groups are shown in table 1.table 1clinicopathological characteristics of the colorectal cancer patients sub grouped by leucovorin dosageparameterleucovorin dosage ( n)0 mg / m 60 mg / m 200 mg / m 500 mg / m age ( years ) median7365.67075.5 range4389428737893787sex male111279 female761211tumour location colon910811 rectum88108 colon + rectum1011primary tumour stage 10113 27997 39878 44022 data missing1000tumour differentiation well0000 moderate14131112 poor3266 mucinous0322 data missing1000pre - operative radiation short - term0652 long - term
0021 short + long - term
0173median time ( min ) leucovorin administration - biopsy sampling ( mean range):170 ( 65285)165 ( 72457)163 ( 65555 )
neoadjuvant long - term radiation / chemotherapy clinicopathological characteristics of the colorectal cancer patients sub grouped by leucovorin dosage
neoadjuvant long - term radiation / chemotherapy as shown , no statistical differences between the times from leucovorin administration to biopsy sampling were seen .
however , a difference regarding pre - operative treatment was noted ; in the control group , there was no patient with rectal cancer who had been given pre - operative radiation treatment or neoadjuvant treatment . regarding safety ,
the administration of the drug was associated with temporary red cheeks in one patient ( given 200 mg / m leucovorin ) and a short temporary hypotension reaction in one patient ( given 500 mg / m ) .
the mean levels of methylenethf , thf , and methylthf were analysed in both tumour and mucosa tissues obtained from patients of each treatment group ( table 2 ) .
the mean level of each folate increased with increasing dosage of leucovorin and showed a large inter - patient variation in all treatment groups .
the folate levels differed significantly between the mucosa and tumour tissues and were generally lower in the mucosa of the control group .
patients who received 60 or 200 mg / m leucovorin had significantly higher mean levels of methylenethf in their tumours , as compared to the levels in their mucosal samples .
after treatment with 500 mg / m leucovorin , the difference in methylenethf level between the tumour and mucosa samples was no longer statistically significant .
the same pattern was seen when the thf concentration or the sum of methylenethf and thf were analysed .
no significant differences in the levels of methylthf were seen between the tumour and mucosa samples in any of the treatment groups . however , in contrast to the other folates , the methylthf level in mucosa of the control group was significantly higher compared to the level in tumour tissue.table 2comparison of mean sd folate levels in tumour and mucosa tissues of the colorectal cancer patientsfolate formtissue typeleucovorin dosage ( n)0 mg / m 60 mg / m 200 mg / m 500 mg / m thftumour136 88249 97490 353543 279mucosa103 59210 96289 153455
282
p value0.0300.091<0.00010.12methylenethftumour880 4121,769 8183,024 1,9413,773
1,425mucosa669 2211,377 4701,883 4713,062 1,445
p value0.00160.0220.00030.090methylenethf + thftumour1,016 4752,018 8883,514 2,1094,266
1,563mucosa772 2651,587 5362,173 4613,517 1,607
p value0.0100.0180.00020.070methylthftumour141 861,056 3482,544 9594,129 1,293mucosa189 1111,066 3842,295 5014,095 2,093
p value0.00470.930.460.49leucovorin ( mean / range )
10 minnon applicable11,377 2,22530,900 6,17693,625 1,872 30 min8,199 1,23827,684 41,01369,445
9,172folate levels in pmol / gww
g / l plasma
p value by wilcoxon signed rank test
concentration in plasma comparison of mean sd folate levels in tumour and mucosa tissues of the colorectal cancer patients folate levels in pmol / gww
p value by wilcoxon signed rank test
concentration in plasma there were differences between the folate levels in colonic and rectal tumours according to treatment doses .
for all treatments groups , the mean methylenethf levels in the rectal tumours were significantly lower than those in the colonic tumours ( table 3 ; figs . 1 , 2 ) .
the difference was significant in the groups that received 60 or 200 mg / m leucovorin .
the thf level was significantly lower in rectal tumours of patients who received 60 mg / m .
as shown in table 3 , the methylenethf + thf levels were generally low in rectal , compared to colon , tumours . in contrast , the methylthf levels were higher in rectal tumour tissues of patients who were treated with leucovorin , and a significantly higher level was seen after treatment with 60 mg / m . as shown in fig . 2 , only 10 ( 50 % ) of the patients given 60
mg / m leucovorin achieved a methylenethf level in their tumour tissues that was above the highest value of any patient in the control group ( 1,714 pmol / gww ) . at 200 mg / m leucovorin ,
all patients , except one , reached methylenethf levels > 1,714 pmol / gww , and at 500 mg / m leucovorin , all patients had methylenethf levels above the level of the controls .
data were weighted according to time to vessel ligation , which was a parameter suspected to affect the tissue folate levels . however
, this did not affect the significant differences between colon and rectal tumour tissue.table 3comparison of mean sd folate levels in tumour tissues of the colorectal cancer patients by tumour locationfolate formtumour locationleucovorin dosage ( n)0 mg / m 60 mg / m 200 mg / m 500 mg / m thfcolon143 62306 79508 240522
317
p value0.410.00670.180.24methylenethfcolon1,016 4822,214 7794,207 2,5904,222 1,285rectum747 2301,213 4542,162
4063,222 1,530
p value0.260.0240.00290.066methylenethf + thfcolon1,159 5372,520 8264,715 2,8214,744 1,397rectum886 3281,391 4772,659 6963,716 1,726
p value0.260.00880.0190.094methylthfcolon162 991,257 2012,331
7574,022 1,551rectum123 63806 3382,795 1,1004,163 1,119
p value0.460.00670.560.54folate levels in pmol / gww
p value by kruskal
wallis test ( 2-sample test)fig . 1comparison of the methylenethf concentration in tumour tissue of patients with colon ( n = 29 ) or rectal ( n = 28 ) cancer after flv treatment .
as shown , patients with rectal cancer had lower levels of methylenethf in their tumours .
2comparison of the methylenethf levels in tumour tissue of patients with colon or rectal cancer after supplementation with 0 , 60 , 200 , or 500 mg / m leucovorin in combination with 5-fu .
individual patients with colon cancer are represented by blue dots , rectal cancer patients with red dots .
the horizontal line marks the highest methylenethf concentration found in the control patients ( 1,714 pmol / gww ) .
as shown , the tumoural methylenethf levels in rectal cancer patients were generally lower than in colon cancer patients after treatment with leucovorin comparison of mean sd folate levels in tumour tissues of the colorectal cancer patients by tumour location folate levels in pmol / gww
p value by kruskal
wallis test ( 2-sample test ) comparison of the methylenethf concentration in tumour tissue of patients with colon ( n = 29 ) or rectal ( n = 28 ) cancer after flv treatment .
as shown , patients with rectal cancer had lower levels of methylenethf in their tumours .
the horizontal line represents the grand mean comparison of the methylenethf levels in tumour tissue of patients with colon or rectal cancer after supplementation with 0 , 60 , 200 , or 500 mg / m leucovorin in combination with 5-fu .
individual patients with colon cancer are represented by blue dots , rectal cancer patients with red dots .
the horizontal line marks the highest methylenethf concentration found in the control patients ( 1,714 pmol / gww ) .
as shown , the tumoural methylenethf levels in rectal cancer patients were generally lower than in colon cancer patients after treatment with leucovorin a strong correlation was noted between the levels of leucovorin in blood samples collected 10 and 30 min after the given dose of calcium folinate and the levels of the different folate forms in both tumour and mucosa samples .
however , there was no correlation between the blood levels of leucovorin and levels of folate in tissue in relation to the administered dosage of the drug .
based on clinical diagnosis , 38 patients had colon cancer , 37 had rectal cancer , and three patients had cancer in both the colon and rectum synchronously .
the latter three patients were excluded from the statistical analyses of folate levels according to tumour location .
there were no significant differences regarding age , gender , tumour location , tumour stage , tumour differentiation , or lymph status between the four groups .
the mean times between administration of leucovorin and time of biopsy sampling , as well as ranges for the three groups are shown in table 1.table 1clinicopathological characteristics of the colorectal cancer patients sub grouped by leucovorin dosageparameterleucovorin dosage ( n)0 mg / m 60 mg / m 200 mg / m 500 mg / m age ( years ) median7365.67075.5 range4389428737893787sex male111279 female761211tumour location colon910811 rectum88108 colon + rectum1011primary tumour stage 10113 27997 39878 44022 data missing1000tumour differentiation well0000 moderate14131112 poor3266 mucinous0322 data missing1000pre - operative radiation short - term0652 long - term
0021 short + long - term
0173median time ( min ) leucovorin administration - biopsy sampling ( mean range):170 ( 65285)165 ( 72457)163 ( 65555 )
neoadjuvant long - term radiation / chemotherapy clinicopathological characteristics of the colorectal cancer patients sub grouped by leucovorin dosage
neoadjuvant long - term radiation / chemotherapy as shown , no statistical differences between the times from leucovorin administration to biopsy sampling were seen .
however , a difference regarding pre - operative treatment was noted ; in the control group , there was no patient with rectal cancer who had been given pre - operative radiation treatment or neoadjuvant treatment . regarding safety ,
the administration of the drug was associated with temporary red cheeks in one patient ( given 200 mg / m leucovorin ) and a short temporary hypotension reaction in one patient ( given 500 mg / m ) .
the mean levels of methylenethf , thf , and methylthf were analysed in both tumour and mucosa tissues obtained from patients of each treatment group ( table 2 ) .
the mean level of each folate increased with increasing dosage of leucovorin and showed a large inter - patient variation in all treatment groups .
the folate levels differed significantly between the mucosa and tumour tissues and were generally lower in the mucosa of the control group .
patients who received 60 or 200 mg / m leucovorin had significantly higher mean levels of methylenethf in their tumours , as compared to the levels in their mucosal samples .
after treatment with 500 mg / m leucovorin , the difference in methylenethf level between the tumour and mucosa samples was no longer statistically significant .
the same pattern was seen when the thf concentration or the sum of methylenethf and thf were analysed .
no significant differences in the levels of methylthf were seen between the tumour and mucosa samples in any of the treatment groups . however , in contrast to the other folates , the methylthf level in mucosa of the control group was significantly higher compared to the level in tumour tissue.table 2comparison of mean sd folate levels in tumour and mucosa tissues of the colorectal cancer patientsfolate formtissue typeleucovorin dosage ( n)0 mg / m 60 mg / m 200 mg / m 500 mg / m thftumour136 88249 97490 353543
279mucosa103 59210 96289 153455 282
p value0.0300.091<0.00010.12methylenethftumour880 4121,769 8183,024 1,9413,773 1,425mucosa669 2211,377 4701,883 4713,062 1,445
p value0.00160.0220.00030.090methylenethf + thftumour1,016 4752,018 8883,514 2,1094,266 1,563mucosa772 2651,587 5362,173 4613,517 1,607
p value0.0100.0180.00020.070methylthftumour141 861,056 3482,544 9594,129 1,293mucosa189 1111,066 3842,295 5014,095 2,093
p value0.00470.930.460.49leucovorin ( mean / range )
10 minnon applicable11,377 2,22530,900 6,17693,625 1,872 30 min8,199 1,23827,684 41,01369,445 9,172folate levels in pmol / gww
g / l plasma
p value by wilcoxon signed rank test
concentration in plasma comparison of mean sd folate levels in tumour and mucosa tissues of the colorectal cancer patients folate levels in pmol / gww
p value by wilcoxon signed rank test
concentration in plasma
there were differences between the folate levels in colonic and rectal tumours according to treatment doses .
for all treatments groups , the mean methylenethf levels in the rectal tumours were significantly lower than those in the colonic tumours ( table 3 ; figs . 1 , 2 ) .
the difference was significant in the groups that received 60 or 200 mg / m leucovorin .
the thf level was significantly lower in rectal tumours of patients who received 60 mg / m .
as shown in table 3 , the methylenethf + thf levels were generally low in rectal , compared to colon , tumours . in contrast , the methylthf levels were higher in rectal tumour tissues of patients who were treated with leucovorin , and a significantly higher level was seen after treatment with 60 mg / m . as shown in fig . 2 , only 10 ( 50 % ) of the patients given 60
mg / m leucovorin achieved a methylenethf level in their tumour tissues that was above the highest value of any patient in the control group ( 1,714 pmol / gww ) . at 200 mg / m leucovorin ,
all patients , except one , reached methylenethf levels > 1,714 pmol / gww , and at 500 mg / m leucovorin , all patients had methylenethf levels above the level of the controls .
data were weighted according to time to vessel ligation , which was a parameter suspected to affect the tissue folate levels . however
, this did not affect the significant differences between colon and rectal tumour tissue.table 3comparison of mean sd folate levels in tumour tissues of the colorectal cancer patients by tumour locationfolate formtumour locationleucovorin dosage ( n)0 mg / m 60 mg / m 200 mg / m 500 mg / m thfcolon143 62306 79508 240522
164rectum139 121178 67497 446494 317
p value0.410.00670.180.24methylenethfcolon1,016 4822,214 7794,207 2,5904,222 1,285rectum747 2301,213 4542,162 4063,222
1,530
p value0.260.0240.00290.066methylenethf + thfcolon1,159 5372,520 8264,715 2,8214,744 1,397rectum886 3281,391 4772,659 6963,716 1,726
p value0.260.00880.0190.094methylthfcolon162 991,257 2012,331 7574,022 1,551rectum123 63806 3382,795 1,1004,163 1,119
wallis test ( 2-sample test)fig . 1comparison of the methylenethf concentration in tumour tissue of patients with colon ( n = 29 ) or rectal (
as shown , patients with rectal cancer had lower levels of methylenethf in their tumours .
2comparison of the methylenethf levels in tumour tissue of patients with colon or rectal cancer after supplementation with 0 , 60 , 200 , or 500 mg / m leucovorin in combination with 5-fu .
individual patients with colon cancer are represented by blue dots , rectal cancer patients with red dots .
the horizontal line marks the highest methylenethf concentration found in the control patients ( 1,714 pmol / gww ) . as shown , the tumoural methylenethf levels in rectal cancer patients were generally lower than in colon cancer patients after treatment with leucovorin comparison of mean sd folate levels in tumour tissues of the colorectal cancer patients by tumour location folate levels in pmol / gww
p value by kruskal
wallis test ( 2-sample test ) comparison of the methylenethf concentration in tumour tissue of patients with colon ( n = 29 ) or rectal ( n = 28 ) cancer after flv treatment .
as shown , patients with rectal cancer had lower levels of methylenethf in their tumours .
the horizontal line represents the grand mean comparison of the methylenethf levels in tumour tissue of patients with colon or rectal cancer after supplementation with 0 , 60 , 200 , or 500 mg / m leucovorin in combination with 5-fu .
individual patients with colon cancer are represented by blue dots , rectal cancer patients with red dots .
the horizontal line marks the highest methylenethf concentration found in the control patients ( 1,714 pmol / gww ) .
as shown , the tumoural methylenethf levels in rectal cancer patients were generally lower than in colon cancer patients after treatment with leucovorin
a strong correlation was noted between the levels of leucovorin in blood samples collected 10 and 30 min after the given dose of calcium folinate and the levels of the different folate forms in both tumour and mucosa samples
. however , there was no correlation between the blood levels of leucovorin and levels of folate in tissue in relation to the administered dosage of the drug .
the role of leucovorin in 5-fu - based chemotherapy is to increase the level of the cofactor methylenethf needed to stabilise the ternary complex consisting of fdump , methylenethf , and ts in tumour cells .
thereby , the production of thymidine is inhibited leading to an impaired dna synthesis and dna repair .
the continuous development of assessment techniques and new biochemical methods provide tools to study different metabolites in more sophisticated ways . in the present study , a sensitive lc
ms / ms method was used to analyse metabolically active folate metabolites , including methylenethf .
a notable finding of the study was that only 50 % of the patients who received the common dose of 60 mg / m leucovorin achieved methylenethf levels in the tumour tissue that were higher than those detected in patients of the control group .
in contrast , in the group that received 200 mg / m leucovorin , only one patient did not reach the highest methylenethf level of the controls . furthermore , in the group that received 500 mg / m leucovorin , all patients had a methylenethf level well above the controls .
this indicates that in a large number of patients low levels of folates accumulated in the tumour , possible because of limited folate polyglutamylation .
another important finding was the significant difference in methylenethf and thf levels between the colorectal tumour tissue and the macroscopically normal - appearing mucosa ( table 2 ) .
this difference was observed in patients who had not received any treatment and was even more pronounced in those patients who received leucovorin at a dosage of 60 or 200 mg / m .
the study raises the question whether the commonly used dosage of leucovorin might result in a sub - optimal concentration of methylenethf in the tumour tissue to provide an optimal effect of 5-fu treatment .
if this is the case , several patients with colorectal cancer might be receiving inadequate treatment and may benefit from leucovorin concentrations as high as 200500 mg / m .
similar conclusions were drawn by schlemmer et al . in a study published in 2008 , which showed significant higher values regarding reduced folates in tumour tissues as well as in liver metastasis when doses of 200 and 500 mg / m were used .
adding to the complexity , there was a high inter - individual variation in the methylenethf levels in the tumours ( fig . 2 ) .
polymorphisms in genes that code for folate - associated enzymes , such as methylenetetrahydrofolate reductase , could be a part of the explanation for this phenomenon [ 1619 ] .
different activity of the enzymes needed in conversion of leucovorin to methylenethf could also play a role , as indeed could different starting levels of the tissue folates .
therefore , it is difficult to predict the levels of tissue folates that will be reached in an individual patient , in response to a given leucovorin dose based solely on the body surface area .
however , since leucovorin is not considered to be a toxic substance and only a few and mild adverse events were reported in the present study , further studies with high leucovorin supplementation levels ( 200500 mg / m ) could be reasonably pursued . hypothetically , high doses of leucovorin would make an abundance of methylenethf available for ternary complex formation between methylenethf , fdump , and ts , despite possible rate - limiting steps or local folate deficiencies .
the results further showed clear differences in the folate levels in relation to tumour location .
the methylenethf and thf + methylenethf levels differed significantly between patients with colon and rectal cancer ( table 3 ) . for all treatment groups ,
post - operative adjuvant chemotherapy was previously less established for cases of rectal cancer than for cases of colon cancer , but is now recommended in the swedish national guidelines in selected cases . based on the results of our study , it appears that the administered concentration of leucovorin in the standard treatment is inadequate for patients with rectal cancer in that it yields a clinically insufficient concentration of methylenethf in the tumour tissue .
this finding may explain why the evidence for a beneficial application of adjuvant treatment with 5-fu - based chemotherapy has not been as clear in rectal cancer as they are in colon cancer [ 20 , 21 ] .
the findings raise the question as to whether previous assumptions made regarding leucovorin dosages are correct .
it also shows that new techniques and advances in associated scientific areas make revaluation of previously studied subjects both worthwhile and important .
as the present study was limited in terms of the numbers of patients , the results needs to be confirmed in a larger study . among the strengths of the study are the broad inclusion criteria , reflecting clinical reality , and the randomisation of the patients to the treatment groups .
the randomisation should negate selection bias , although skewing was noted between patient groups in terms of neoadjuvant treatment ; no patient in the control group received any pre - operative radiotherapy . because a high turnover of folates might be required during repair of radiation - damaged tissue , the mean folate level at base line
could be anticipated to be lower if the rectal cancer patients of the control group had been subjected to radiotherapy .
however , we could not detect any differences in the folate levels between patients treated or not treated with radiotherapy .
furthermore , both higher ( methylthf ) and lower ( methylenethf ) folate levels were found in rectal tumours as compared to colon tumours , after leucovorin supplementation .
thus , there seems to be inherent differences in the response to leucovorin treatment between rectal and colon cancer .
the possibility exists that the difference in folate levels noted is a systematic bias due to treatment or surgical issues , including differences in the time passed after vessel ligation until biopsy sampling .
however , this potential confounder was tested for by including the time to vessel ligation in the statistical analysis and did not significantly affect the results . in a recent study , sadahiro et al . showed that leucovorin administration significantly increased the reduced folate levels in colorectal cancer tissue and adjacent mucosa .
the increase lasted until 18 h for mucosa and 12 h for colorectal cancer tissue .
however , in a clinical setting , the time span from the leucovorin administration until infusion of chemotherapy is usually no longer than 3090 min .
it can also be debated as to whether the fact that a tumour is a very heterogenic tissue has an important influence on the measured folate concentrations depending on how the biopsies are collected . in the present study , we have tried to address this problem by having the same two research nurses collecting tissues in a standardised way .
the data suggest that our results are comparable to previous results reported in the literature [ 14 , 23 , 24 ] .
a last and major challenge is the difficulty of extrapolating the findings into adjuvant treatment settings , as any visible tumour tissue has been removed by the time adjuvant treatment starts .
thus , the treatment effect will be exerted on normal tissues and , hopefully , on remaining circulating tumour cells or cell aggregations .
the nature of this issue itself presents challenges that need to be resolved in order to achieve treatment improvements .
the results of this study showed a large inter - patient variability of folate levels in tumour and mucosa tissue of colorectal patients after supplementation with leucovorin at the standardised dosage .
the low levels of methylenethf were most prominent in rectal cancer patients , where high leucovorin doses were needed to exceed baseline methylenethf values in tumour .
the results of this study indicate that the standardised dose may be sub - optimal since the achieved concentration of methylenethf in tissues of the patients may be insufficient to get an optimal antitumour effect of 5-fu
. on going studies will establish if a higher concentration of leucovorin yields a better treatment response . | ### Summary:
: purposecalcium folinate ( leucovorin ) , which is converted in vivo into biologically active folate , enhances the potency of 5-fluorouracil ( 5-fu)-based chemotherapy in colorectal cancer .
a common dosage of leucovorin in adjuvant and palliative settings is 60 mg / m2 .
the aim was to determine the levels of tetrahydrofolate ( thf ) , 5,10-methylenetetrahydrofolate ( methylenethf ) , and 5-methyltetrahydrofolate ( methylthf ) in tumour and mucosa of colorectal cancer patients who received different dosages of leucovorin intravenously at time of surgery.methodseighty patients scheduled for colorectal resection with indication of colorectal cancer were randomised into four groups to receive leucovorin at 0 , 60 , 200 , or 500 mg / m2 , respectively .
blood samples were taken 10 and 30 min after leucovorin administration .
biopsy samples from tumour and mucosa were collected and snap - frozen at surgery .
the levels of thf , methylenethf , and methylthf in tumour and mucosa were assessed by liquid chromatography electrospray ionisation tandem mass spectrometry ( lc ms / ms ) and the results were related to clinical diagnosis and therapeutic regimens.resultsthe folate levels in tissue revealed extensive inter - individual variability .
the mean methylenethf value for the four treatment groups were 880 , 1,769 , 3,024 and 3,723 pmol / gww
. only half of the patients who received 60 mg / m2 leucovorin had higher levels of methylenethf in tumour than patients who received 0 mg / m2 leucovorin .
rectal cancer patients had significantly lower levels of methylenethf compared with colon cancer patients.conclusionsthere was a large inter - patient variability of tissue folate levels in colorectal cancer patients after supplementation with leucovorin at standardised dosage .
high leucovorin doses were needed to exceed baseline methylenethf values , especially in rectal cancer patients .
the results indicate that the standardised leucovorin dose may be insufficient to attain the full antitumour effect of 5-fu .
further studies are needed to establish whether higher dosage yields a better treatment response . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: cells often communicate with their environment via transmembrane receptors that receive signals from the extracellular milieu and transmit them internally .
regulation occurs not only at the level of receptors binding to ligands , but can critically depend on the numbers of receptors displayed on the cell surface and the endocytic trafficking pathways shuttling receptors and receptor - ligand complexes away from and back to the plasma membrane ( for recent reviews see refs .
one of the main drivers of new actin filament formation adjacent to membranes is the arp2/3 complex ( actin - related protein 2/3 complex ) , which is activated by the wasp - family ( wiskott - aldrich syndrome family ) proteins ( for recent reviews see refs . 1 , 6 and 7 ) . during cell migration ,
new filament assembly occurs mostly underneath the plasma membrane , but also on internal membrane systems .
actin on intracellular vesicles is often in very small patches ( 1 m diameter ) and is usually transient and dynamic , requiring very sensitive high - speed imaging .
only recently has technology developed to a point where we are able to begin to capture some of the intricacies of intracellular actin / membrane interactions .
mammalian genomes encode at least five types of wasp family proteins and surprisingly , at least three ( n - wasp , wash and whamm ) , likely have important and evolutionarily conserved roles in membrane trafficking .
wasp proteins generate branched actin networks by bringing the arp2/3 complex and actin monomers together to nucleate a new branch from a mother filament .
in addition to wasp proteins , formins ( such as fmnl1/2 and diaphanous ) , which nucleate and processively promote elongation of unbranched filaments also can polymerize actin on vesicular structures .
likewise , spire1 , which contains multiple wasp - homology domains and can nucleate actin independently of arp2/3 complex , may cooperate with arp2/3 complex , as well as formin-2 ( cappuccino ) to somehow control progression of early to late endosomes .
here we highlight recent research surrounding the vesicle associated wasp - family protein wash and we propose that actin assembly has an important role in trafficking of various receptor cargoes through multiple endocytic compartments .
wash was originally identified as a gene upregulated in breast cancer cells that is located in the subtelomeric regions of multiple human chromosomes . in humans , there are several wash copies in the genome , with most of them currently curated as pseudogenes .
wash is found in a complex of five proteins , containing swip , fam21 , strumpellin and ccdc53 ( fig . 1 ) and termed the wash regulatory complex ( shrc ) .
schematic of the pentameric wash containing shrc complex in an inactivated state with sequestered vca domain ( depicted in analogy to the wave / scar complex ; see ref .
the most well understood aspect of actin in trafficking is probably the role of actin assembly in clathrin - mediated endocytosis .
this has been extensively reviewed elsewhere , so we will only briefly summarize the main ideas .
clathrin coated pits associate close to the plasma membrane with both dendritic actin networks and actin comet tails .
notably , the comet tails observed in a recent correlative em study were not always visible in the matching immunofluorescence pictures suggesting that small / subtle membrane associated actin structures still need high magnification microscopy to distinguish them from the high background of other cellular actin structures .
n - wasp contributes to the generation of branched actin networks on clathrin - coated vesicles .
actin is thought to form a cage around the newly forming neck of a nascent vesicle together with bar domain proteins and eventually dynamin .
actin polymerization helps to physically stabilize the tubular neck of a nascent vesicle as the clathrin coat assembles and the force from actin assembly pushes against the inherent membrane tension .
once dynamin assembles onto the neck , scission can begin via dynamin s gtpase powered squeezing mechanism , although the actual mechanical forces involved here are still debated .
finally , when the new vesicle breaks free , the clathrin coat is disassembled and actin may then polymerize at one pole to push the new vesicle away from the plasma membrane as it journeys to become an early endosome .
once the vesicle becomes an early endosome , it is likely to be associated with wash rather than n - wasp .
it is nt clear how n - wasp dissociates and wash associates or even when , but eea1 positive early endosomal vesicles contain wash puncta that co - localize with actin and arp2/3 complex .
wash mediated actin polymerization is maintained on endosomes until the multivesicular body ( mvb ) stage , or presumably until late endosomes ( le ) lose the ability to recycle receptors and merge / mature to lysosomes .
receptor transport back to the plasma membrane from an endocytic vesicle is much less defined than the endocytic internalization process .
the common view is that tubulin is the cytoskeletal element contributing to outward vesicular traffic via kinesins , and wash contains a putative tubulin binding motif , which may link actin and microtubule based transport ( reviewed in ref.7 ) .
but secretion , in a variety of cell types , shows little change upon tubulin depolymerization .
rocketing of vesicles with endo / lysosomal content might be facilitated by n - wasp and actin comet tail formation and a recent publication on vesicular transport in oocytes showed evidence for a novel mechanism of outward vesicle movement that is facilitated by actin cables assembled by formin2 and spire 1/2 .
thus , there are still many questions about the relative importance of actin and microtubules in delivery of vesicles back to the plasma membrane from internal endocytic compartments and likely different cell types and compartments have different mechanisms .
wash localizes on many different endosomal compartments , including early endosomes , late endosomes and , in dictyostelium , post lysosomes .
it co - localizes with the retromer complex , in support of the idea that wash - mediated actin networks work together with retromer in salvaging cargo such as receptors for retrograde transport . furthermore ,
depletion of wash led to a redistribution of ci - mpr ( cation - independent mannose 6-phosphate receptor ) , a cargo of retromer that is retrieved from endosomes back to the trans golgi .
wash strongly localizes to the rab7 positive late endosome / multivesicular body ( le / mvb ) , a compartment that is also marked by the retromer complex , which is thought to interact with rab7 .
seaman and colleagues identified the shrc subunit strumpellin , as a retromer interacting protein and showed that the other subunits of the wash regulatory complex also co - interact with retromer complex .
how wash functions together with retromer is not fully understood , but a recent study links the fam21 subunit of shrc to retromer directly and the shrc is likely to be important in the formation and/or organization of structures known as retromer tubules .
retromer tubules form when receptors are to be recycled back to the plasma membrane from endosomes .
temkin and colleagues found wash in association with the retromer tubule associated sorting nexin snx27 as an important component for recycling of the -2 adrenergic receptor .
however , this is a rab4-dependent process , so may be distinct from the rab7-dependent sorting of other receptors .
the mechanism for wash uncoupling from retrograde vesicles when they reach their destination is not known and it is unclear whether retromer and wash always co - cycle together .
increased imaging capability has allowed detection of multiple actin networks on various vesicle compartments , including tubules that emerge from endosomes , which often are associated with retrieval of cargo back to the plasma membrane or in the case of the ci - mpr , to the golgi .
the nature and function of actin on these emerging tubules and the small vesicles that bud from them is just beginning to be understood . deforming membranes to bud vesicles requires energy to overcome membrane tension and to induce curvature , movement and scission , which could come from actin polymerization .
the arp2/3 activator whamm ( wasp homolog associated with actin , membranes and microtubules ) localizes to the endoplasmic reticulum and golgi complex and is proposed to form a link between microtubules and nascent membrane tubules forming in er to golgi transport .
whamm is proposed to nucleate branched actin networks on nascent tubules and drive their active formation . in direct contrast , wash is proposed to oppose membrane tubulation , since knockdown of wash can result in increased appearance of tubules in cells .
wash was proposed to establish an actin network on a nascent tubule , allowing dynamin to be recruited and thus promote vesicle scission from the tubule .
this idea fits with previous studies of bar domain proteins showing that when actin assembly was prevented , the tubules failed to be cleaved .
the arrival of branched actin allowed dynamin to be recruited and efficiently cleave nascent tubules .
it is unclear if whamm and wash actually work by such contrasting mechanisms , with whamm promoting tubulation and wash promoting scission , but clearly further studies are needed . whether wash and whamm promote tubulation or scission of vesicles ,
several endosomal receptor cargos have now been analyzed for their dependence on wash function , actin polymerization and other members of the shrc .
all studies agreed that wash depletion led to a redistribution of recycling receptors from the plasma membrane , golgi or lysosomes to endosomal membranes indicating a retention of receptors at that level .
this was less pronounced for the constitutive recycling transferrin receptor , which was only modestly affected or even unaffected by wash depletion , than for receptors that are regulated by signal transduction and degradation like the integrin 51 .
perhaps surprisingly , it is increasingly becoming apparent that 51 integrins primarily recycle from a late endosomal compartment when cells are migrating in a 3d environment in agreement with wash s partial co - localization with rab7 positive endosomes .
recycling from a mature mvb / le compartment had been long suggested for trafficking of the mhcii in immune cells , which relies on the late endosomal environment for loading with cognate peptides .
the mechanism by which wash regulates sorting of receptors such as 51 integrin and targeting for recycling rather than degradation is not yet clear , but two lines of evidence point toward a possible role in actin - based sorting of receptors .
first , dictyostelium wash is important for the recycling of the vacuolar atpase that allows lysosomes to be neutralized and then exocytosed from cells .
insall and colleagues demonstrated that v - atpase is an actin binding protein and hypothesized that actin networks created by wash and arp2/3 complex capture v - atpase in patches on the surface of lysosomes and thus sort the v - atpase for removal and recycling .
second , in mammalian cells , a recent study by puthenveedu and colleagues identified determinants of receptor recycling and found that -2-adrenergic receptors need to be sorted into actin rich domains on endosomes to allow efficient exit from the endosome .
actin binding , either directly by the receptor or via receptor - associated proteins , as in the case of the -2-adrenergic receptor , was the only prerequisite for recycling of a subset of signaling receptors .
a systematic survey of endosomal transport discriminated between at least two separate types of receptor cargo .
the first group , represented by the transferrin receptor , had characteristics of passive cargo where receptor accumulation was positively correlated with the size of the endosome the recycling of receptors presumably commenced at a constant rate .
the second group , represented in the study by the egfr ( epidermal growth factor receptor ) , showed signs of guidance and adaptable regulation in the endosomal system .
the mean egfr cargo content remained constant independent of endosome size indicating tight regulation of egfr localization .
after activation , regulated receptors such as egf receptor are ubiquitinated and subsequently sorted toward degradation .
ubiquitinated egfr is sorted into intraluminal vesicles ( ilvs ) by the escrt ( endosomal sorting complex required for transport ) family of complexes and degraded after endosomal fusion with lysosomes .
thus degradation works by active sorting of receptors away from the limiting membrane of the endosome , suggesting that receptors are otherwise sorted for recycling to the plasma membrane or any other cellular destination .
the escrt complex and wash can localize to the same endosome and our preliminary data do not indicate direct co - localization ( fig . 2 ) .
actin binding of some receptors is necessary for efficient recycling from a distal endosomal compartment and we found that wash overexpression correlated with increased cell surface expression of 51 integrin .
recycling endosomes , a term used here for the aforementioned endosomal population still capable of retrograde receptor traffic , have been shown to consist of distinct domains and protrusions enriched in specialized sets of molecules required for transport away from endosomes .
( a ) immunofluorescence staining of the escrt-0 component hrs and wash on an endosomal membrane of a senescent imr90 fibroblast .
( b ) model of multivesicular body with wash and actin rich domains leading to recycling of receptors and escrt rich regions that lead to the sorting of ubiquitinated receptor into intraluminal vesicles .
we propose that actin and the wash complex might act as a positive recycling guide opposing escrt mediated sorting into ilvs of mvbs .
reversible actin binding extrinsic or intrinsic would form an ideal way to sequester receptors away from each other .
whenever receptors are destined for degradation the actin binding would be inhibited and sorting into escrt rich region could proceed .
the continuous occurrence of actin - rich domains from the plasma membrane to late endosomes would be an ideal method to hand over receptors that are destined for reuse . in summary , it is emerging that mammalian cells devote a considerable component of their actin nucleation promoting proteins to vesicle trafficking functions .
actin is likely to be important in more than its currently established role in pushing against membranes to drive protrusion and movement and these likely include receptor sorting and directed trafficking .
the actin nucleation promoting protein wash has emerged as an important regulator of receptor trafficking .
the roles of proteins such as wash and the actin networks that they generate are still only beginning to be understood and likely are complex .
a recent study demonstrated the presence of short cortical actin filaments on the plasma membrane and predicted that they would spontaneously form aster - shaped clusters on the membrane surface , due to myosins or to attractive forces between the filaments .
if receptors with engineered actin binding motifs are added to the system , nano - clusters spontaneously formed .
this showed that actin networks on membrane surfaces are in general able to organize receptors into clusters and suggests a novel mechanism by which they could alter sorting and/or signaling . | ### Summary:
: here , we present emerging ideas surrounding the interplay between the actin cytoskeleton and receptor transport and activation . the bulk of actin dynamics in cells is thought to contribute to architecture and mobility .
actin also contributes to trafficking , acting as a molecular scaffold , providing force to deform membranes , facilitating vesicle abscission or propelling a vesicle through the cytoplasm1,2 and recent studies highlight important connections between the directed trafficking of receptors and the impact on cell migration and actin dynamics .
additionally , a number of newly described actin nucleation promoting factors , such as the vesicle associated protein wash , reveal unexpected roles of actin in membrane traffic and suggest that the cell dedicates a significant proportion of its regulation of actin dynamics to controlling trafficking . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: copd is a chronic progressive lung disease , characterized by nonreversible airflow obstruction and intermittent exacerbations.1 treatment for copd is based on pharmacotherapy , pulmonary rehabilitation , and in some cases , long - term oxygen therapy .
exacerbations are a key cause of increased morbidity , mortality , and poor health status , and place a considerable burden on the health care system.2 approximately 15% of copd patients per year have exacerbations necessitating hospital admission;3,4 between 10% and 25% of patients admitted with hypercapnic respiratory failure due to copd die in hospital.5 reduced exacerbation frequency is therefore an important therapeutic target .
noninvasive ventilation ( niv ) is a method of providing ventilatory support via a mask and is effective in improving survival among patients with acute or acute - on - chronic hypercapnic respiratory failure in hospital.6,7 evidence for domiciliary use of niv in non - acute copd patients is more limited despite a number of systematic reviews.811 as patients immediately posthospitalization are at greater risk of recurrence of exacerbation than those more stable,12 this difference could influence the effectiveness of niv in preventing or reducing the impact of these events .
this is the first systematic review to stratify data by these two patient groups , and it is the most comprehensive review to date , including evidence from randomized controlled trials ( rcts ) , non - rcts , and rcts comparing different niv settings , and considering mortality , hospitalizations , and quality of life ( qol ) as outcomes . finally , this is the first systematic review to attempt an analysis , albeit exploratory , of the relationship between hypercapnia and clinical outcomes .
a protocol detailing the methodology was registered with prospero ( crd42012003286).13,14 a summary of the methods is presented here .
search strategies incorporated a combination of text words and index terms relating to niv and copd .
bibliographic databases ( medline , medline in - process , embase , cochrane central , cinahl , and science citation index expanded ( isi ) ) , the british library s zetoc and isi conference proceedings citation index , and clinical trial registers were searched from 1980 until september 2014 .
citation checking of included studies was undertaken , and experts in the field were consulted to identify further studies .
risk of bias was assessed based on the cochrane collaboration risk - of - bias tool ( for rcts and nonrandomized controlled studies ) , and additional criteria were considered for crossover trials ( ie , whether there was a carry - over effect , whether only first - period data were available , whether analysis was appropriate to crossover trials , and comparability of results with those from parallel - group trials).15 data extraction was performed by one reviewer using a standardized , piloted data extraction form , and numerical data were checked by a second reviewer .
study selection and data extraction of non - english language papers was performed by native speakers of the respective languages with guidance from the reviewers .
studies were grouped according to average proximity of patients to their most recent exacerbation that required hospitalization . if patients had not been hospitalized within 4 weeks to 3 months at commencement of the study or were described as stable , they were classed as the stable population .
where there was clear evidence that treatment with niv in a study commenced after an episode of hospitalization ( due to an exacerbation ) , these patients were classed as the posthospital population , with the assumption that on average , this population were at greater risk of a subsequent exacerbation .
separate analyses were performed for each study design ( rct , controlled studies ) and primary outcome ( survival and hospitalizations ) . where there was clinical and methodological homogeneity between studies reporting the same outcome and using the same outcome statistic ( reported or calculable ) , random effects meta - analysis was undertaken in stata ( stata statistical software : release 10 ; statacorp lp , college station , tx , usa ) .
secondary outcome data ( forced expiratory volume in 1 second , forced vital capacity , partial pressure of carbon dioxide [ paco2 ] , partial pressure of oxygen , 6-minute walk distance ) were not pooled due to between - study heterogeneity but are presented in forest plots in order to show the overall direction of effect and uncertainty .
exploratory post hoc analyses of study - level data were performed to determine if baseline hypercapnia could predict response to niv , or whether change in hypercapnia correlated with any effect of niv on mortality and hospitalizations
. guidelines of preferred reporting items for systematic reviews and meta - analyses were adhered to.16
screening of the 7,405 records identified by the searches yielded 21 rcts ( 18 niv vs usual care ; three niv vs another form of niv ) and ten nonrandomized controlled studies ( five prospective , five retrospective ; figure 1 ) .
all patients had global initiative for chronic obstructive lung disease stage iii and/or iv copd , or were described as severe
eighteen studies provided details on assessing patients for obstructive sleep apnea , to rule out overlap syndrome .
twenty studies were on stable populations and nine on posthospital populations , and there were no details for two .
for posthospital populations , there was clear evidence in all study reports that niv treatment commenced after hospitalization due to an exacerbation .
for both populations , there was usually no information on the length of time before niv was initiated , or previous exacerbation history .
two rcts17,18 included normocapnic patients , while one rct19 stated that the number of hypercapnic patients included was small .
niv settings , therapeutic / tolerability targets ( pressure , volume , or blood gases ) , and reporting of these varied across studies .
there was some variability in usual care , with three studies considered to have more intensive approaches to usual care : a 12-week multidisciplinary rehabilitation program , followed by a long - term home - based rehabilitation program,20,21 a pulmonary rehabilitation program for part of the rct,18 and a home supervision program.22 there was a lack of reporting of some details relevant to study quality , particularly regarding loss to follow - up , handling of missing data , and blinding of outcome assessors .
only three rcts included a sham niv arm , lack of which may have led to performance bias and/or bias in patient - reported qol . by definition ,
the nonrandomized studies were more prone to bias ; some retrospective studies had clear evidence of baseline imbalances between niv and comparator groups , with the consequence of this on study findings unknown .
length of follow - up varied between 3 and 24 months ( rcts ) and between 12 months and 10 years ( controlled studies ) .
the longest follow - up periods ( 410 years ) were in the retrospective controlled studies .
data from seven rcts19,21,2327 ( pooled relative risk [ rr ] 0.88 [ 0.55 , 1.43 ] , i=60.4% ) and four controlled studies22,2830 ( pooled rr 1.19 [ 0.65 , 2.18 ] , i=0% ) suggested no significant difference between domiciliary niv and usual care alone in terms of survival up to 24 months ( figure 2 ) . excluding the rct by casanova et al,19 which included only few patients with hypercapnia , had little effect , changing the pooled rr to 0.85 ( 0.46 , 1.58 ) .
data from five rcts21,2325,27 and three controlled studies22,28,29 ( figure 3 ) suggested a trend toward fewer hospital admissions / days in hospital with niv , albeit not statistically significant .
evidence on exacerbations not leading to hospitalization based on four rcts17,19,21,24 and one controlled study29 showed no significant effect of niv ( supplementary material ) .
for qol , there appeared to be a trend favoring niv , but a consistent benefit could not be demonstrated ; heterogeneity in outcomes measured and time points hampered analyses of this measure ( supplementary material ) .
there was some evidence to suggest that niv improved blood gases ( based on mainly unadjusted results ; figures 4 and 5 ) .
no survival benefit was evident from three rcts3133 ( pooled rr 0.89 [ 0.53 , 1.49 ] , i=25.1% ) , though four nonrandomized controlled studies,3437 which are potentially more prone to bias , favored niv ( pooled rr 0.45 [ 0.32 , 0.65 ] , i=0% ; figure 2 ) .
findings for hospital admissions were inconsistent , with one rct33 finding a statistically significant benefit of niv , one31 marginally favoring niv , and one32 marginally favoring usual care ( without niv ) ( figure 3 ) .
qol data were reported in only one posthospital rct,32 and there were no differences between niv and usual care . limited data from three trials3133 suggested a potential benefit from niv in terms of reduction in paco2 ( figure 5 ) .
none of the rcts assessed as having a high risk of bias contributed data to meta - analyses ; yet some of the nonrandomized controlled studies in the meta - analyses ( for both populations ) did .
the small number of studies precluded assessment of the potential for publication bias ( eg , using funnel plots ) and sensitivity analyses around study quality .
no further subgroup analysis ( beyond study design and population ) was possible , given the small number of trials and inconsistent reporting of relevant characteristics .
however , many clinicians believe that the extent of hypercapnia or a change in hypercapnia status is related to the effect of niv . in this context
, it is worth noting that the study by khnlein et al23 had the highest hypercapnia threshold as an eligibility criterion ( paco2 $ 7 kpa ) , and also showed a statistically significant survival benefit ( and a nonsignificant trend toward fewer hospital admissions ) .
further , the study by zhou et al,24 which along with the khnlein et al23 study had the highest mean paco2 , found a statistically significant benefit from niv in hospital admissions . in order to explore the hypercapnia level further as a potential predictor of benefit from niv , data on mean paco2 levels prior to initiation of niv and change in mean paco2 levels due to niv from each study ( where reported ) were plotted against mortality and hospitalization data in order to determine if baseline paco2 levels could predict response to niv , and whether the effect of niv on paco2 levels correlates with the effect on clinical outcomes ( figure 6a d ) .
these exploratory analyses suggested a trend toward a correlation between changes in hypercapnia status and hospital admissions ( based on eight rcts21,2325,27,3133 ) .
such a potential correlation was not observed for mortality ( based on ten rcts19,21,2327,3133 ) .
baseline hypercapnia status did not appear to predict response to niv for mortality ( based on ten rcts19,21,2327,3133 ) ; the data were suggestive of a possible trend toward a correlation between baseline hypercapnia and hospital admissions ( based on eight rcts21,2325,27,3133 ) .
formal subgroup analysis based on the level of hypercapnia was however not deemed to be appropriate as this would have meant dichotomizing trials based on an arbitrary co2 threshold .
adherence to niv and effect of niv settings could also not be analyzed . with regard to the effectiveness of different niv settings , three small crossover trials in stable populations
were identified : two38,39 comparing higher vs lower pressure niv and one40 comparing different back - up rates .
all were short term ( 68 weeks ) and did not assess mortality or hospitalizations / exacerbations .
treatment compliance was similar between arms in two studies,39,40 and higher in the high - pressure arm for the third,38 but drop - out rates were high in the pressure trials.38,39 the limited qol data precluded drawing firm conclusions .
the only statistically significant result38 was greater paco2 reduction with high - pressure niv ( supplementary material ) .
screening of the 7,405 records identified by the searches yielded 21 rcts ( 18 niv vs usual care ; three niv vs another form of niv ) and ten nonrandomized controlled studies ( five prospective , five retrospective ; figure 1 ) .
all patients had global initiative for chronic obstructive lung disease stage iii and/or iv copd , or were described as severe
eighteen studies provided details on assessing patients for obstructive sleep apnea , to rule out overlap syndrome .
twenty studies were on stable populations and nine on posthospital populations , and there were no details for two .
for posthospital populations , there was clear evidence in all study reports that niv treatment commenced after hospitalization due to an exacerbation .
for both populations , there was usually no information on the length of time before niv was initiated , or previous exacerbation history .
two rcts17,18 included normocapnic patients , while one rct19 stated that the number of hypercapnic patients included was small .
niv settings , therapeutic / tolerability targets ( pressure , volume , or blood gases ) , and reporting of these varied across studies .
there was some variability in usual care , with three studies considered to have more intensive approaches to usual care : a 12-week multidisciplinary rehabilitation program , followed by a long - term home - based rehabilitation program,20,21 a pulmonary rehabilitation program for part of the rct,18 and a home supervision program.22 there was a lack of reporting of some details relevant to study quality , particularly regarding loss to follow - up , handling of missing data , and blinding of outcome assessors .
only three rcts included a sham niv arm , lack of which may have led to performance bias and/or bias in patient - reported qol . by definition ,
the nonrandomized studies were more prone to bias ; some retrospective studies had clear evidence of baseline imbalances between niv and comparator groups , with the consequence of this on study findings unknown .
length of follow - up varied between 3 and 24 months ( rcts ) and between 12 months and 10 years ( controlled studies ) .
the longest follow - up periods ( 410 years ) were in the retrospective controlled studies .
data from seven rcts19,21,2327 ( pooled relative risk [ rr ] 0.88 [ 0.55 , 1.43 ] , i=60.4% ) and four controlled studies22,2830 ( pooled rr 1.19 [ 0.65 , 2.18 ] , i=0% ) suggested no significant difference between domiciliary niv and usual care alone in terms of survival up to 24 months ( figure 2 ) . excluding the rct by casanova et al,19 which included only few patients with hypercapnia , had little effect , changing the pooled rr to 0.85 ( 0.46 , 1.58 ) . data from five rcts21,2325,27 and three controlled studies22,28,29 ( figure 3 ) suggested a trend toward fewer hospital admissions / days in hospital with niv , albeit not statistically significant .
evidence on exacerbations not leading to hospitalization based on four rcts17,19,21,24 and one controlled study29 showed no significant effect of niv ( supplementary material ) . for qol , there appeared to be a trend favoring niv , but a consistent benefit could not be demonstrated ; heterogeneity in outcomes measured and time points hampered analyses of this measure ( supplementary material ) .
there was some evidence to suggest that niv improved blood gases ( based on mainly unadjusted results ; figures 4 and 5 ) .
no survival benefit was evident from three rcts3133 ( pooled rr 0.89 [ 0.53 , 1.49 ] , i=25.1% ) , though four nonrandomized controlled studies,3437 which are potentially more prone to bias , favored niv ( pooled rr 0.45 [ 0.32 , 0.65 ] , i=0% ; figure 2 ) .
findings for hospital admissions were inconsistent , with one rct33 finding a statistically significant benefit of niv , one31 marginally favoring niv , and one32 marginally favoring usual care ( without niv ) ( figure 3 ) .
qol data were reported in only one posthospital rct,32 and there were no differences between niv and usual care . limited data from three
trials3133 suggested a potential benefit from niv in terms of reduction in paco2 ( figure 5 ) .
none of the rcts assessed as having a high risk of bias contributed data to meta - analyses ; yet some of the nonrandomized controlled studies in the meta - analyses ( for both populations ) did .
the small number of studies precluded assessment of the potential for publication bias ( eg , using funnel plots ) and sensitivity analyses around study quality .
no further subgroup analysis ( beyond study design and population ) was possible , given the small number of trials and inconsistent reporting of relevant characteristics .
however , many clinicians believe that the extent of hypercapnia or a change in hypercapnia status is related to the effect of niv . in this context
, it is worth noting that the study by khnlein et al23 had the highest hypercapnia threshold as an eligibility criterion ( paco2 $ 7 kpa ) , and also showed a statistically significant survival benefit ( and a nonsignificant trend toward fewer hospital admissions ) .
further , the study by zhou et al,24 which along with the khnlein et al23 study had the highest mean paco2 , found a statistically significant benefit from niv in hospital admissions . in order to explore the hypercapnia level further as a potential predictor of benefit from niv , data on mean paco2 levels prior to initiation of niv and change in mean paco2 levels due to niv from each study ( where reported ) were plotted against mortality and hospitalization data in order to determine if baseline paco2 levels could predict response to niv , and whether the effect of niv on paco2 levels correlates with the effect on clinical outcomes ( figure 6a d ) .
these exploratory analyses suggested a trend toward a correlation between changes in hypercapnia status and hospital admissions ( based on eight rcts21,2325,27,3133 ) .
such a potential correlation was not observed for mortality ( based on ten rcts19,21,2327,3133 ) .
baseline hypercapnia status did not appear to predict response to niv for mortality ( based on ten rcts19,21,2327,3133 ) ; the data were suggestive of a possible trend toward a correlation between baseline hypercapnia and hospital admissions ( based on eight rcts21,2325,27,3133 ) .
formal subgroup analysis based on the level of hypercapnia was however not deemed to be appropriate as this would have meant dichotomizing trials based on an arbitrary co2 threshold .
adherence to niv and effect of niv settings could also not be analyzed . with regard to the effectiveness of different niv settings , three small crossover trials in stable populations
were identified : two38,39 comparing higher vs lower pressure niv and one40 comparing different back - up rates .
all were short term ( 68 weeks ) and did not assess mortality or hospitalizations / exacerbations .
treatment compliance was similar between arms in two studies,39,40 and higher in the high - pressure arm for the third,38 but drop - out rates were high in the pressure trials.38,39 the limited qol data precluded drawing firm conclusions .
the only statistically significant result38 was greater paco2 reduction with high - pressure niv ( supplementary material ) .
data from seven rcts19,21,2327 ( pooled relative risk [ rr ] 0.88 [ 0.55 , 1.43 ] , i=60.4% ) and four controlled studies22,2830 ( pooled rr 1.19 [ 0.65 , 2.18 ] , i=0% ) suggested no significant difference between domiciliary niv and usual care alone in terms of survival up to 24 months ( figure 2 ) . excluding the rct by casanova et al,19 which included only few patients with hypercapnia , had little effect , changing the pooled rr to 0.85 ( 0.46 , 1.58 ) . data from five rcts21,2325,27 and three controlled studies22,28,29 ( figure 3 ) suggested a trend toward fewer hospital admissions / days in hospital with niv , albeit not statistically significant .
evidence on exacerbations not leading to hospitalization based on four rcts17,19,21,24 and one controlled study29 showed no significant effect of niv ( supplementary material ) . for qol , there appeared to be a trend favoring niv , but a consistent benefit could not be demonstrated ; heterogeneity in outcomes measured and time points hampered analyses of this measure ( supplementary material ) .
there was some evidence to suggest that niv improved blood gases ( based on mainly unadjusted results ; figures 4 and 5 ) .
no survival benefit was evident from three rcts3133 ( pooled rr 0.89 [ 0.53 , 1.49 ] , i=25.1% ) , though four nonrandomized controlled studies,3437 which are potentially more prone to bias , favored niv ( pooled rr 0.45 [ 0.32 , 0.65 ] , i=0% ; figure 2 ) .
findings for hospital admissions were inconsistent , with one rct33 finding a statistically significant benefit of niv , one31 marginally favoring niv , and one32 marginally favoring usual care ( without niv ) ( figure 3 ) .
qol data were reported in only one posthospital rct,32 and there were no differences between niv and usual care . limited data from three trials3133 suggested a potential benefit from niv in terms of reduction in paco2 ( figure 5 ) .
none of the rcts assessed as having a high risk of bias contributed data to meta - analyses ; yet some of the nonrandomized controlled studies in the meta - analyses ( for both populations ) did .
the small number of studies precluded assessment of the potential for publication bias ( eg , using funnel plots ) and sensitivity analyses around study quality .
no further subgroup analysis ( beyond study design and population ) was possible , given the small number of trials and inconsistent reporting of relevant characteristics .
however , many clinicians believe that the extent of hypercapnia or a change in hypercapnia status is related to the effect of niv . in this context
, it is worth noting that the study by khnlein et al23 had the highest hypercapnia threshold as an eligibility criterion ( paco2 $ 7 kpa ) , and also showed a statistically significant survival benefit ( and a nonsignificant trend toward fewer hospital admissions ) .
further , the study by zhou et al,24 which along with the khnlein et al23 study had the highest mean paco2 , found a statistically significant benefit from niv in hospital admissions . in order to explore the hypercapnia level further as a potential predictor of benefit from niv , data on mean paco2 levels prior to initiation of niv and change in mean paco2 levels due to niv from each study ( where reported ) were plotted against mortality and hospitalization data in order to determine if baseline paco2 levels could predict response to niv , and whether the effect of niv on paco2 levels correlates with the effect on clinical outcomes ( figure 6a d ) .
these exploratory analyses suggested a trend toward a correlation between changes in hypercapnia status and hospital admissions ( based on eight rcts21,2325,27,3133 ) .
such a potential correlation was not observed for mortality ( based on ten rcts19,21,2327,3133 ) .
baseline hypercapnia status did not appear to predict response to niv for mortality ( based on ten rcts19,21,2327,3133 ) ; the data were suggestive of a possible trend toward a correlation between baseline hypercapnia and hospital admissions ( based on eight rcts21,2325,27,3133 ) .
formal subgroup analysis based on the level of hypercapnia was however not deemed to be appropriate as this would have meant dichotomizing trials based on an arbitrary co2 threshold .
with regard to the effectiveness of different niv settings , three small crossover trials in stable populations were identified : two38,39 comparing higher vs lower pressure niv and one40 comparing different back - up rates .
all were short term ( 68 weeks ) and did not assess mortality or hospitalizations / exacerbations .
treatment compliance was similar between arms in two studies,39,40 and higher in the high - pressure arm for the third,38 but drop - out rates were high in the pressure trials.38,39 the limited qol data precluded drawing firm conclusions .
the only statistically significant result38 was greater paco2 reduction with high - pressure niv ( supplementary material ) .
this is the first systematic review of domiciliary niv to attempt to account for differing baseline risks of exacerbation by categorizing populations into stable and posthospital based on proximity to an in - patient stay for an exacerbation ; it is also the most comprehensive review to date , including evidence from rcts , nonrandomized controlled studies , and rcts comparing different niv settings , and without restriction to english language - only publications .
overall , the evidence from rcts in a stable population could not demonstrate benefit for mortality from domiciliary niv compared to usual care alone ( seven rcts19,21,2327 and four controlled studies22,2830 ) , although there was a trend toward fewer hospital admissions ( five rcts21,2325,27 and three controlled studies22,28,29 ) , and to a lesser extent , improved qol ( seven rcts17,18,21,23,26,27,41 and one controlled study29 ) , for the stable population . a survival benefit for the posthospital population
could not be shown based on three rcts,3133 though there was some evidence of benefit based on four ( potentially biased ) nonrandomized controlled studies.3437 findings for hospital admissions ( three rcts3133 ) were inconsistent .
there was too little evidence to draw any conclusions on the potential benefits of high - pressure niv settings .
it was hoped that subgroup analyses based on the frequency of exacerbations prior to niv treatment would be possible , as frequent exacerbators ( patients with two or more exacerbations / year ) are a clinically relevant subgroup,42 with a generally stable exacerbation frequency on other existing therapies.43 however , this was hampered by lack of reporting of this parameter .
there is evidence , however , to support the use of recent hospitalization as a proxy for a higher risk of recurring exacerbation .
prior hospital admission is recognized to be the biggest driver for a further exacerbation requiring admission,12 and niv use in hospital has also been recognized as a predictor of overall exacerbation rate.44 furthermore , recurrent type 2 respiratory failure , that is , respiratory failure with carbon dioxide retention , occurs in over 30% , and readmission at 1 year in 60% , of those who require niv acutely in hospital.45 consequently , stratification based on niv started at recent hospitalization was thought to be a justifiable surrogate marker of exacerbation risk . in reality
, there is likely to be much more of a continuum of risk , and it is further unknown what proportion of the posthospital populations considered in the individual studies are copd patients at the more severe end of the disease spectrum .
the results of the review show that division of data based on potential exacerbation risk did not indicate a difference between populations in terms of mortality or hospitalizations ; in fact , there was no clear evidence for benefit for either population , though there was a nonsignificant trend toward a benefit with niv in the stable population , for hospital admissions .
the apparent similarity in hospitalization effect in our chosen subgroups is perhaps surprising , given that those previously admitted are at higher risk of subsequent readmission .
it is possible that the division used failed to capture other important differences within and between populations ; for example , the pretreatment exacerbation rates were unknown .
there was evidence of some heterogeneity between both stable and posthospital studies , with some studies showing a significant benefit from niv ; one rct23 in a stable population showed a statistically significant benefit from niv for mortality ( figure 2 ) , and one rct for stable24 and two for posthospital populations31,33 showed significant benefit for hospital admissions ( figure 3 ) .
two of these rcts23,33 used a higher hypercapnia threshold for patient inclusion ( paco2 > 7 kpa ) ; one rct25 had a lower inclusion criterion ( paco2 > 6 kpa ) , though means were suggestive of higher levels .
there was no detail on the inclusion threshold for the third rct.24 elements such as blood gases , prior admissions , and social support have been identified as drivers to clinical decision making regarding domiciliary niv in copd,46 all of which may impact niv efficacy .
the nonrandomized posthospital studies22,2830 assessing mortality ( figure 2 ) suggest a beneficial effect from niv ( significant pooled rr ) , however , it is possible that patient selection for niv biased findings toward a positive response to niv .
most populations included in studies were hypercapnic ( table 2 ) , although the threshold used to define this varied .
post hoc analyses undertaken across both stable and posthospital populations suggested a trend toward a positive correlation between changes in hypercapnia and hospital admissions ( but not for mortality or correlation using pretreatment paco2 level ) .
as these are exploratory analyses , the results should be interpreted cautiously ; the analysis used aggregate study - level
data for baseline hypercapnia , change in hypercapnia , and clinical outcomes , and a patient - level association can not be inferred even if there is clear biological plausibility .
further caveats relate to the fact that not all trials contributed data to these analyses and that paco2 change scores were mostly not adjusted for baseline differences .
nevertheless , it does suggest that there should be further investigation of the association between hypercapnia and clinical outcomes , particularly with regard to the ability of the niv to reduce paco2 levels .
patients hypercapnic at discharge may normalize their paco2 levels over time , although those who remain hypercapnic have higher mortality.47 thus , if hypercapnia ( or change in hypercapnia ) were a driver of niv response and were used to select patients for treatment after an exacerbation , subsequent reassessment may be needed to determine likelihood of ongoing benefit .
the current recommendation in the uk suggests that domiciliary niv is considered on health economic grounds if a patient has had three hospital admissions with acute hypercapnic respiratory failure.48 there may be other , as yet unconfirmed , patient characteristics which influence its effectiveness .
uncertainty also remains regarding the length of time niv may provide benefit for ; there are at least two rcts49,50 looking at the effect of discontinuing niv , but this question was beyond the scope of this systematic review .
a number of rcts of reasonably good methodological quality were available , particularly for the stable population , and a comprehensive search strategy meant that this systematic review identified more relevant studies than previous ones , even after taking into account different search periods .
no language restrictions meant that 19% of the included studies were non - english , a substantial proportion of the overall evidence base omitted by prior reviews.811 this is also the first systematic review to examine patient - related outcomes and incorporate data from nonrandomized studies .
furthermore , by calculating summary measures from raw data or converting data , the number of results that could be presented in forest plots was maximized .
in contrast to some previous systematic reviews , secondary outcome data ( lung function , blood gases , and 6-minute walk distance ) were not pooled due to a lack of results adjusted for baseline differences .
there were several limitations in the available data , largely due to inconsistency of reporting ( particularly for hospital admissions ) or measurement tools ( especially for qol ) .
furthermore , admissions data may be skewed ; thus , the mean ( sd ) may not be an appropriate metric to use , though it was frequently reported . for primary outcomes
, there was a lack of data explicitly linking the number of exacerbations to subsequent hospitalizations and survival for individual patients .
this latter point has potential implications for double - counting data as these outcomes are not independent of each other .
ventilator settings may influence effectiveness , and settings have changed over time , such that earlier settings may be considered ineffective today .
the small crossover trials3840 in this analysis did not allow any conclusions to be drawn , and subgroup analysis based on the larger / parallel trials was not possible due to inconsistent reporting : studies variously reported mean , median , or target settings , based on pressure , blood gas , or volume targets , with some stating only that levels were adjusted to patient comfort / tolerance .
reporting times also varied ( eg , at start of study or at discharge ) .
variable quality of data reporting , lack of exacerbation data , potential bias , and heterogeneity of reported outcomes were striking features of the included studies .
while trials of medications are often required to report certain outcomes as part of the licensing process , medical device studies , such as those included in our review , have not always had to meet such standards despite also being subject to regulatory processes .
more detailed reporting of exacerbations in particular would be valuable in this high - risk population .
it has been suggested that new rcts could include a sham niv arm in order to minimize potential bias , as well as high- and low - pressure niv arm to enable further exploration of the relationship between pressure and effectiveness ; many of the earlier studies included used pressures which experts would now consider equivalent to a sham treatment.19 however , sham niv could lead to an overestimate of the potential benefit of niv , due to its potential disbenefits on qol ; therefore , two control arms ( with and without sham niv ) are more likely to be appropriate .
qualitative work in niv users and prescribers not surprisingly suggests that a focus on patient - centered measures ( eg , qol , daily activity ) is needed , alongside research to delineate those in whom the treatment is most effective.46 which instruments best capture qol in this patient group and whether instruments are convertible is debatable .
there is at least one ongoing trial ( the uk hot - hmv trial , nct00990132 ) , which includes a population with an underlying risk of recurrent events similar to the post - hospital population described in this study .
findings from this trial will be important , but additional evidence from individual patient data analyses of pooled studies may be required to determine whether specific patient characteristics or equipment settings predict benefit from niv , and to establish optimum time points for starting ( and potentially discontinuing ) niv .
a previous review8,9 attempted such analyses , but based on a smaller group of studies , and without considering hospitalizations or survival .
it was hoped that subgroup analyses based on the frequency of exacerbations prior to niv treatment would be possible , as frequent exacerbators ( patients with two or more exacerbations / year ) are a clinically relevant subgroup,42 with a generally stable exacerbation frequency on other existing therapies.43 however , this was hampered by lack of reporting of this parameter .
there is evidence , however , to support the use of recent hospitalization as a proxy for a higher risk of recurring exacerbation .
prior hospital admission is recognized to be the biggest driver for a further exacerbation requiring admission,12 and niv use in hospital has also been recognized as a predictor of overall exacerbation rate.44 furthermore , recurrent type 2 respiratory failure , that is , respiratory failure with carbon dioxide retention , occurs in over 30% , and readmission at 1 year in 60% , of those who require niv acutely in hospital.45 consequently , stratification based on niv started at recent hospitalization was thought to be a justifiable surrogate marker of exacerbation risk . in reality
, there is likely to be much more of a continuum of risk , and it is further unknown what proportion of the posthospital populations considered in the individual studies are copd patients at the more severe end of the disease spectrum .
the results of the review show that division of data based on potential exacerbation risk did not indicate a difference between populations in terms of mortality or hospitalizations ; in fact , there was no clear evidence for benefit for either population , though there was a nonsignificant trend toward a benefit with niv in the stable population , for hospital admissions .
the apparent similarity in hospitalization effect in our chosen subgroups is perhaps surprising , given that those previously admitted are at higher risk of subsequent readmission .
it is possible that the division used failed to capture other important differences within and between populations ; for example , the pretreatment exacerbation rates were unknown .
there was evidence of some heterogeneity between both stable and posthospital studies , with some studies showing a significant benefit from niv ; one rct23 in a stable population showed a statistically significant benefit from niv for mortality ( figure 2 ) , and one rct for stable24 and two for posthospital populations31,33 showed significant benefit for hospital admissions ( figure 3 ) .
two of these rcts23,33 used a higher hypercapnia threshold for patient inclusion ( paco2 > 7 kpa ) ; one rct25 had a lower inclusion criterion ( paco2 > 6 kpa ) , though means were suggestive of higher levels .
there was no detail on the inclusion threshold for the third rct.24 elements such as blood gases , prior admissions , and social support have been identified as drivers to clinical decision making regarding domiciliary niv in copd,46 all of which may impact niv efficacy .
the nonrandomized posthospital studies22,2830 assessing mortality ( figure 2 ) suggest a beneficial effect from niv ( significant pooled rr ) , however , it is possible that patient selection for niv biased findings toward a positive response to niv .
most populations included in studies were hypercapnic ( table 2 ) , although the threshold used to define this varied .
post hoc analyses undertaken across both stable and posthospital populations suggested a trend toward a positive correlation between changes in hypercapnia and hospital admissions ( but not for mortality or correlation using pretreatment paco2 level ) .
as these are exploratory analyses , the results should be interpreted cautiously ; the analysis used aggregate study - level
data for baseline hypercapnia , change in hypercapnia , and clinical outcomes , and a patient - level association can not be inferred even if there is clear biological plausibility .
further caveats relate to the fact that not all trials contributed data to these analyses and that paco2 change scores were mostly not adjusted for baseline differences .
nevertheless , it does suggest that there should be further investigation of the association between hypercapnia and clinical outcomes , particularly with regard to the ability of the niv to reduce paco2 levels .
patients hypercapnic at discharge may normalize their paco2 levels over time , although those who remain hypercapnic have higher mortality.47 thus , if hypercapnia ( or change in hypercapnia ) were a driver of niv response and were used to select patients for treatment after an exacerbation , subsequent reassessment may be needed to determine likelihood of ongoing benefit .
the current recommendation in the uk suggests that domiciliary niv is considered on health economic grounds if a patient has had three hospital admissions with acute hypercapnic respiratory failure.48 there may be other , as yet unconfirmed , patient characteristics which influence its effectiveness .
uncertainty also remains regarding the length of time niv may provide benefit for ; there are at least two rcts49,50 looking at the effect of discontinuing niv , but this question was beyond the scope of this systematic review .
a number of rcts of reasonably good methodological quality were available , particularly for the stable population , and a comprehensive search strategy meant that this systematic review identified more relevant studies than previous ones , even after taking into account different search periods .
no language restrictions meant that 19% of the included studies were non - english , a substantial proportion of the overall evidence base omitted by prior reviews.811 this is also the first systematic review to examine patient - related outcomes and incorporate data from nonrandomized studies .
furthermore , by calculating summary measures from raw data or converting data , the number of results that could be presented in forest plots was maximized .
in contrast to some previous systematic reviews , secondary outcome data ( lung function , blood gases , and 6-minute walk distance ) were not pooled due to a lack of results adjusted for baseline differences .
there were several limitations in the available data , largely due to inconsistency of reporting ( particularly for hospital admissions ) or measurement tools ( especially for qol ) .
furthermore , admissions data may be skewed ; thus , the mean ( sd ) may not be an appropriate metric to use , though it was frequently reported . for primary outcomes , there was a lack of data explicitly linking the number of exacerbations to subsequent hospitalizations and survival for individual patients .
this latter point has potential implications for double - counting data as these outcomes are not independent of each other .
ventilator settings may influence effectiveness , and settings have changed over time , such that earlier settings may be considered ineffective today .
the small crossover trials3840 in this analysis did not allow any conclusions to be drawn , and subgroup analysis based on the larger / parallel trials was not possible due to inconsistent reporting : studies variously reported mean , median , or target settings , based on pressure , blood gas , or volume targets , with some stating only that levels were adjusted to patient comfort / tolerance .
reporting times also varied ( eg , at start of study or at discharge ) .
variable quality of data reporting , lack of exacerbation data , potential bias , and heterogeneity of reported outcomes were striking features of the included studies .
while trials of medications are often required to report certain outcomes as part of the licensing process , medical device studies , such as those included in our review , have not always had to meet such standards despite also being subject to regulatory processes .
more detailed reporting of exacerbations in particular would be valuable in this high - risk population .
it has been suggested that new rcts could include a sham niv arm in order to minimize potential bias , as well as high- and low - pressure niv arm to enable further exploration of the relationship between pressure and effectiveness ; many of the earlier studies included used pressures which experts would now consider equivalent to a sham treatment.19 however , sham niv could lead to an overestimate of the potential benefit of niv , due to its potential disbenefits on qol ; therefore , two control arms ( with and without sham niv ) are more likely to be appropriate .
qualitative work in niv users and prescribers not surprisingly suggests that a focus on patient - centered measures ( eg , qol , daily activity ) is needed , alongside research to delineate those in whom the treatment is most effective.46 which instruments best capture qol in this patient group and whether instruments are convertible is debatable .
there is at least one ongoing trial ( the uk hot - hmv trial , nct00990132 ) , which includes a population with an underlying risk of recurrent events similar to the post - hospital population described in this study .
findings from this trial will be important , but additional evidence from individual patient data analyses of pooled studies may be required to determine whether specific patient characteristics or equipment settings predict benefit from niv , and to establish optimum time points for starting ( and potentially discontinuing ) niv .
a previous review8,9 attempted such analyses , but based on a smaller group of studies , and without considering hospitalizations or survival .
the effectiveness of domiciliary niv remains uncertain ; however , some patients appear to benefit . further research is required to identify these patients and to explore the relevance of hypercapnic status or changes in hypercapnia due to niv in influencing clinical outcomes for patients on long - term niv ; optimum time points for starting niv and equipment settings also need to be established . | ### Summary:
: introductionnoninvasive ventilation ( niv ) improves survival among patients with hypercapnic respiratory failure in hospital , but evidence for its use in domiciliary settings is limited .
a patient s underlying risk of having an exacerbation may affect any potential benefit that can be gained from domiciliary niv .
this is the first comprehensive systematic review to stratify patients based on a proxy for exacerbation risk : patients in a stable state and those immediately post - exacerbation hospitalization.methodsa systematic review of nonrandomized and randomized controlled trials ( rcts ) was undertaken in order to compare the relative effectiveness of different types of domiciliary niv and usual care on hospital admissions , mortality , and health - related quality of life .
standard systematic review methods were used for identifying studies ( until september 2014 ) , quality appraisal , and synthesis .
data were presented in forest plots and pooled where appropriate using random - effects meta-analysis.resultsthirty-one studies were included . for stable patients
, there was no evidence of a survival benefit from niv ( relative risk [ rr ] 0.88 [ 0.55 , 1.43 ] , i2=60.4% , n=7 rcts ) , but there was a possible trend toward fewer hospitalizations ( weighted mean difference 0.46 [ 1.02 , 0.09 ] , i2=59.2% , n=5 rcts ) and improved health - related quality of life . for posthospital patients
, survival benefit could not be demonstrated within the three rcts ( rr 0.89 [ 0.53 , 1.49 ] , i2=25.1% ) , although there was evidence of benefit from four non - rcts ( rr 0.45 [ 0.32 , 0.65 ] , i2=0% ) .
effects on hospitalizations were inconsistent .
post hoc analyses suggested that niv - related improvements in hypercapnia were associated with reduced hospital admissions across both populations .
little data were available comparing different types of niv.conclusionthe effectiveness of domiciliary niv remains uncertain ; however , some patients may benefit .
further research is required to identify these patients and to explore the relevance of improvements in hypercapnia in influencing clinical outcomes .
optimum time points for commencing domiciliary niv and equipment settings need to be established . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: extremity surgery using a tourniquet to provide a bloodless surgical field has been utilized in several human studies as a model of ischemia / reperfusion ( i / r ) [ 14 ] .
different anesthetic methods , including general and regional anesthesia , have been used in order to influence the oxidative stress and inflammatory response seen in these models , and evaluation of the inflammatory response has been done by measuring inflammatory variables in blood [ 14 ] and muscle biopsies .
the ischemia and reperfusion ( i / r ) injury have an essential role regarding the pathogenesis in a number of clinical conditions such as stroke , myocardial infarction , and organ transplantation [ 57 ] .
reperfusion , necessary in providing the postischemic tissue with oxygen and other metabolic substrates , results also in acceleration of the cellular necrotic process and may cause the same consequences as prolonged ischemia [ 5 , 8 ] . during reperfusion ,
the formation of reactive oxygen species ( ros ) stimulates cytokine and chemokine production through nuclear factor b ( nf-b ) activation .
also , ros may cause an imbalance between the increased expression of different adhesion molecules on leukocytes and vascular endothelium and the reduced amounts of the antiadhesive nitric oxide ( no ) [ 810 ] .
microvascular barrier disruption with edema and diminished perfusion occurs as a result of the neutrophil adhesion , clot formation , and emigration of neutrophils to the extravascular compartment , a process linked to increased expression of adhesion molecules [ 8 , 11 ] .
no - donors ( e.g. , nitroprusside , diethylamine - no , and s - nitrosoglutathione ) have been demonstrated to reduce expression of adhesion molecules ( icam ; intercellular adhesion molecule , vcam ; vascular adhesion molecule , and p - selectin ) , whereas inhibition of no - synthesis augmented the expression in human endothelial cells [ 9 , 12 , 13 ] .
therefore , the balance between ros and no seems to be an important factor regarding the leukocyte and platelet adhesion induced by i / r .
the major site of adhesion ( rolling ) is the postcapillary venule where the interaction between leukocytes and endothelium occurs , all dependent on adhesion molecules .
inhaled no ( ino ) attenuated the inflammatory response in patients undergoing knee surgery with a bloodless technique using a tourniquet having general anesthesia .
the exogenous administration of no has also been shown to exert anti - inflammatory properties in other i / r settings , both animal [ 1618 ] and human .
we aimed to investigate whether knee surgery in regional anesthesia during tourniquet could be used as a model to study i / r with respect to local and systemic inflammatory activation .
therefore we performed a randomized controlled study with the intention to evaluate the potential inflammatory modulatory effect of ino in this model .
the protocol was approved by the human research ethics committee at karolinska institutet , stockholm , and the swedish medical product agency . written informed consent was obtained from each patient .
patients ( n = 45 ) planned for knee arthroplasty in spinal anesthesia by one specific orthopedic surgeon ( ah ) at the karolinska university hospital , huddinge , stockholm , sweden , were consecutively included in the study ( table 1 ) .
the patients were randomized into three groups ( n = 15 in each group ) , and the surgeon , the anesthetic , and the laboratory staff were blinded to the patient .
randomization , using sealed envelopes , occurred when the patients had arrived to the operating theatre .
group 1 received ino 80 ppm , and group 3 received placebo ( n2 ) , throughout the entire operation , whereas group 2 , partial ino ( pino ) , received ino 80 ppm from the beginning until tourniquet activation ( 300 mmhg ) with a break during ischemia until the blood circulation was restored ( release of tourniquet ) .
an intravenous line , 18 or 20 gauge , was inserted in the cubital fossa or in the forearm for blood sampling ( bd venflon ) .
0.5% bupivacaine in a range of 12.517.5 mg and 0.04% morphine 0.1 - 0.2 mg were given depending on the individual patient .
thereafter , an oxygen mask , covering mouth and nose , with 5 liter / min oxygen ( eco oxygen mask , intersurgical ltd . , uk ) mixed with no or placebo , was applied .
the muscle biopsies were taken before tourniquet activation and within 5 minutes after the release . during surgery
the patients were continuously sedated with propofol ( 0.54.0 mg / kg bw / hour ) .
methemoglobin was measured with an abl800 flex blood gas instrument ( radiometer medical , brnshj , denmark ) .
blood for plasma analysis was collected in edta tubes and centrifugated at 4000 rpm 10 minutes in + 4c .
plasma levels of icam ( intercellular adhesion molecule ) , vcam ( vascular adhesion molecule ) , e - selectin , and p - selectin were measured according to manufacturer 's instructions using a multiplex elisa kit ( r&d systems , abingdon , uk ) , designed for use with a luminex analyzer .
hmgb1 ( high mobility group box protein 1 ) was analyzed using elisa ( shino - test corporation , japan ) .
no ( final blended gas at a concentration of 80 ppm no in inspired gas , inomax , ikaria inc . , hampton , nj , usa ) or placebo ( nitrogen , n2
nitrogen dioxide ( no2 ) was constantly measured ( inovent ) in inspired air as recommended by the manufacturer .
muscle biopsies , measuring approximately 5 5 mm , were taken from musculus vastus medialis before and after the tourniquet .
the muscle biopsies were immediately frozen in isopentane ( c5h12 ) with liquid nitrogen and stored at 80c for subsequent analysis .
these were selected from the patients where the histopathology of the pre - and postischemic biopsy was good .
the muscle biopsy specimens were analyzed regarding icam , vcam , p - selectin , and cd68/macrophage expression using immunohistochemistry technique .
consecutive 7 m transverse cryostat sections were mounted on glass slides and air dried for 30 minutes before fixation in cold ( + 4c ) acetone for 3.5 minutes ( 30 seconds in 50% acetone and 3 minutes in 100% ) .
the slides were then rinsed in phosphate buffered saline ( pbs ) for 10 minutes and then treated with 1% h2o2 + 2% nan3 in room temperature ( rt ) for 60 minutes in darkness to eliminate endogenous peroxidase activity .
the slides were then rinsed 3 3 minutes in pbs and thereafter incubated with 1% horse serum ( vector laboratories inc . , burlingame , ca , usa ) in pbs for 15 minutes to avoid nonspecific binding .
primary antibodies ( anti - cd54/icam-1 , mouse igg1 , serotec , oxford , uk ; anti - cd106/vcam-1 , mouse igg1 , bd pharmingen , san diego , ca , usa ; anti - cd62p / p - selectin , mouse igg1 , santa cruz biotechnology inc . , heidelberg , germany ; anti - cd68/macrophages , mouse igg1 , dako a / s , glostrup , denmark ) were applied overnight to the sections at rt in a humid chamber . as a negative control we used an irrelevant mouse antibody ( isotype - matched irrelevant , mouse igg1 , dako a / s , glostrup , denmark ) as primary antibody . after washing in pbs 3 3 minutes secondary antibodies ( biotinylated , horse anti - mouse igg , vector laboratories inc . ,
burlingame , ca , usa ) diluted in pbs and 1% normal horse serum were applied to the sections for 30 minutes at rt followed by washing in pbs for 3 3 minutes .
the sections were then incubated with avidin - biotin complex ( avidin - biotin - horseradish peroxidase complex , vectastain , abc - hp kit , vector laboratories inc . , burlingame , ca , usa ) for 45 minutes in rt .
after washing in pbs for 3 3 minutes peroxidase reactions were developed using 3,3-diaminobenzidine ( dab substrate kit for peroxidase , vector laboratories inc . ,
burlingame , ca , usa ) for 7 minutes followed by 3 3 minutes washing in pbs .
the sections were then lightly counterstained with mayer 's hematoxylin and mounted using buffered glycerol .
tissue sections were analyzed using reichert - jung polyvar 2 ( leica microsystems , wetzlar , germany ) .
semiquantification ( scoring 0 , 1 + , 2 + , and 3 + ) was performed by two independent investigators , blinded with the respect to the study groups .
the number of cells positively stained for icam , vcam , p - selectin , and cd68/macrophages was estimated from the whole tissue sections .
statistical analysis to evaluate the effect of treatment and the effect of i / r over time was performed using two - factor repeated - measures analysis of variance ( anova ) with post hoc comparisons ( scheff ) when applicable , whereas sign test was used for the nonparametric data ( muscle biopsies ) .
15 individuals per sample group will , with a power of 90% , enable noticing a difference of 15% of soluble plasma p - selectin with a significance level of 5% ( alpha = p value ) .
plasma levels of hmgb1 , p - selectin , vcam , and e - selectin all remained unaltered with no differences between groups at any time point .
however , soluble icam showed a small , but significant , decrease in two of the three groups ( figure 2(e ) ) .
no correlation could be demonstrated between plasma levels of soluble adhesion molecules and hmgb1 and ischemic time ( e - selectin r = 0.0002 , icam r = 0.0006 , vcam r = 0.00002 , and hmgb1 r = 0.0858 ) . as an illustration
the lack of correlation for soluble p - selectin is shown in figure 3 . in the repeated muscle biopsies we found
there was no difference in the expression of cd68 + macrophages in the biopsies taken after the ischemia period .
the expression of adhesion molecules was consistently found in endothelial cells ; icam was equably scattered between muscle cells while vcam and p - selectin were found mainly in larger vessels ( arterioles and venules ) .
there were no differences in number of positive capillaries or cells observed between the three groups before and after ischemia and there were no within group changes concerning number of expressed adhesion molecules after the ischemia compared to before .
methemoglobin increased significantly over time in the ino treated groups compared to the placebo treated , thus , serving as a marker of exposure to ino ( figure 4 ) .
in this study we found no support in the peripheral circulation for endothelial cell activation measured by soluble adhesion molecules or for an inflammatory response measured by hmgb1 levels within 2 hours after ischemia in patients undergoing knee surgery using spinal anesthesia . a small decrease in soluble icam
furthermore , there were no signs of endothelial cell activation or of an increased number of macrophages homing into the muscle after the ischemia period in the thigh muscle .
to our surprise , no signs of endothelial cell activation or an inflammatory response could be observed neither in plasma nor in muscle biopsies in this clinical human study with reperfusion following an ischemic event . as a consequence , influence
neither was seen nor could be expected , regarding the randomized ino exposure on the measured parameters . in a recent study ino
has been demonstrated to provide an improvement in penumbral blood flow and neuronal survival in stroke or other ischemic conditions .
in contrast to the results in the present study , mathru et al . found , in anaesthetized patients going through knee surgery , significantly increased inflammation ( augmented expression of soluble p - selectin , cd11b / cd18 on neutrophils , plasma lipid hydroperoxide levels , activated nuclear factor-b , and myeloperoxidase activity in muscle biopsies as well as content of conjugated dienes ) ; also , ino significantly attenuated this inflammatory response .
however , there are some dissimilarities between the work of mathru et al . and the current study .
firstly , in the present study all the patients had spinal anesthesia in concordance to the clinical routine , in contrast to mathru et al . who used general anesthesia with thiopental and isoflurane .
the choice of anesthetic method may have importance , since different anesthetic drugs have been reported to have influence on inflammation in various settings .
for example , in an ovine endotoxin model , isoflurane anesthesia compared to consciousness resulted in significantly impaired renal function in combination with enhanced neutrophil activity and accumulation in the kidney .
interestingly , in anaesthetized rats , isoflurane protected the hepatic tissue compared to pentobarbital sodium in an i / r model , whereas isoflurane did not attenuate the liver damage yet ketamine did in an endotoxin model .
also , the anesthetic drug propofol has , in the i / r setting , been proposed to possess antioxidant capabilities , both in rats and in humans [ 2 , 4 , 26 , 27 ] . however , lack of beneficial effects against myocardial i / r injury ( rat ) using propofol has also been reported .
further , in patients undergoing coronary artery bypass graft surgery having remote ischemic precondition , propofol anesthesia could not , compared to isoflurane , decrease myocardial damage . also , local anesthetics have been shown to possess various effects on polymorphonuclear leukocytes such as inhibiting migration , enzyme release , and superoxide anion generation .
this impairment of neutrophil function may contribute to an anti - inflammatory and immunosuppressive effect .
the use of epidural anesthesia combined with general anesthesia for surgery has been suggested as a safe and reliable method in reducing overall postoperative complication rate and the incidence of cardiovascular failure and major infections complications .
park et al . found recently , when comparing arterial lactate levels in patients undergoing total knee arthroplasty having sevoflurane or spinal anesthesia , a higher lactate increase during sevoflurane anesthesia , thus suggesting a lower production of ischemic metabolites in the spinal anesthesia group .
improved microcirculation during organ inflammation has been indicated in an experimental rat model using epidural anesthesia .
a positive effect on the tissue perfusion by neuraxial block may modulate the inflammatory response during ischemia / reperfusion .
hence , there may be some inconsistencies regarding the influence of different anesthetic methods in various inflammatory settings , and since we used propofol sedation in addition to the spinal anesthesia it could be speculated that this compound may have attenuated the inflammatory response in the ischemic tissue . secondly , our patients were almost twice as old compared to patients in the mathru et al .
study . in humans , a positive correlation between age and plasma concentration of soluble icam and vcam has been observed .
therefore , it seems unlikely that the higher age in the present study could explain the difference in the inflammatory response .
soluble adhesion molecules have been reported to increase during aging ( rats ) ; also , when treated with lps older animals showed a more pronounced expression of these markers .
total tourniquet duration in the present study was 60140 minutes which is in concordance with the approximately two hours presented by mathru et al . .
the patients in the current study were all having the same type of surgery performed by the one surgeon : knee arthroplasty .
this design was established in order to optimize the reliability and validity of the study results .
there is not always an augmentation of the adhesion molecule expression in the i / r injury . in a major human i / r setting , liver transplantation , no increase in these parameters were seen .
conversely in other species , it has been shown differently . in a canine model of hepatic i / r
, the expression of icam , vcam , p - selectin , and e - selectin was increased after 60 minutes of warm ischemia .
further , p - selectin synthesis is increased by stimulation of tnf- or lps in murine but not in human endothelial cells .
hmgb-1 is considered a late mediator of sepsis in animal models [ 38 , 39 ] and has been correlated with outcome ( survivors / non - survivors ) in septic patients . however , in trauma patients a peak was seen as early as 26 hours after hospital admittance .
nevertheless , it has been shown that hmgb-1 is of vital importance in mediating injury in settings of i / r ; for example , in mice hmgb1 protein expression in the liver was upregulated one hour after reperfusion and after 30 minutes in the heart [ 41 , 42 ] .
in patient studies with cerebral and myocardial ischemia , respectively , elevated levels of hmgb1 were seen within 24 hours [ 43 , 44 ] .
the values of hmgb1 in the present study are in the expected normal range [ 45 , 46 ] .
hence , species difference , time in relation to i / r event , patient comorbidity , and cardiovascular disease risk factors may be variables influencing these parameters .
a decrease in soluble icam was observed over time in the placebo group and in the group receiving ino throughout surgery , a finding corresponding with an earlier study by huda et al . , where a decrease in soluble icam was seen after tourniquet in patients undergoing knee surgery .
notably this was seen in conjunction with an increase in icam mrna in muscle biopsies . in our study
the icam staining in the muscle biopsies did not confirm this decrease in soluble icam .
soluble forms of adhesion molecules are detectable in biological fluids and their concentrations may reflect an increased expression on the cellular level due to an inflammatory response [ 47 , 48 ] . however , the measurement of mrna has been questioned and demonstrated to have rather poor correlation with corresponding protein profiles . in this study a maximal dose of ino was administrated in order to evaluate the hypothesized anti - inflammatory effect , throughout the whole period of surgery or with a break when the tourniquet was activated .
this design was used in order to investigate if ino administered when there was circulation to the leg could modulate the inflammatory response , hypothesizing that the administration of ino may create a repository of no [ 50 , 51 ] .
expression of inflammation in this present study was evaluated using two standard methods : elisa and immunohistochemical techniques .
although no beneficial effect of ino administration in the present study could be observed , we have on the other hand no traces of harm neither locally nor systemically .
in this i / r setting in patients undergoing knee arthroplasty with a tourniquet time range 60 to 140 minutes in spinal anesthesia , no increase in the inflammatory response could be observed systemically or in the local muscle tissue .
further work could be addressed to the use of different i / r models and other types of no donors as well as anesthetic methods . | ### Summary:
: nitric oxide donors and inhaled nitric oxide ( ino ) may decrease ischemia / reperfusion injury as reported in animal and human models .
we investigated whether the attenuation of reperfusion injury , seen by others , in patients undergoing knee arthroplasty could be reproduced when patients had spinal anesthesia .
45 consecutive patients were randomized into three groups ( n = 15 ) .
groups 1 and 3 were receiving ino 80 ppm or placebo ( nitrogen , n2 ) throughout the entire operation , and group 2 only received ino in the beginning and at the end of the operation .
blood samples were collected before surgery , at the end of the surgery , and 2 hours postoperatively .
muscle biopsies were taken from quadriceps femoris muscle before and after ischemia .
there were no increases in plasma levels of soluble adhesion molecules : icam , vcam , p - selectin , e - selectin , or of hmgb1 , in any of the groups .
there were low numbers of cd68 + macrophages and of endothelial cells expression of icam , vcam , and p - selectin in the muscle analyzed by immunohistochemistry , prior to and after ischemia .
no signs of endothelial cell activation or inflammatory response neither systemically nor locally could be detected .
the absence of inflammatory response questions this model of ischemia / reperfusion , but may also be related to the choice of anesthetic method eudractnr . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: age - adjusted incidence was 24.5 per 100,000 population and 40.2 per year in males according to the central cancer registry in korea.1 the incidence is high compared to that in other countries . mortality rate of hcc is second to that of lung cancer in males , and it is the fourth highest among females in korea.1 but , pedunculated hcc ( p - hcc ) is a very unusual form of hcc .
reported an incidence of p - hcc of 0.24 - 3.0% among all hccs in japan.2 other abdominal tumors mimic p - hcc , and therefore , differential diagnosis is usually very difficult .
therefore , the resection rate of p - hcc is high , but the prognosis is poor due to recurrence and metastasis to the peritoneum , adrenal glands , and spleen.3,4,5 in our case also , it was difficult to diagnose p - hcc because it was mistaken for a pelvic mass .
we describe a case of primary hcc that was detected incidentally during an obstetric operation .
a 74-year - old woman was admitted to our hospital 3 years ago because of a palpable mass in the lower abdomen .
a huge palpable movable mass was detected in the lower abdomen , and the abdomen was slightly tender and distended .
blood tests demonstrated decreased hemoglobin / hematocrit , normal while blood cell and platelet count ( 10.4 g / dl/31.6% , 7,140/mm and 309,000/mm , respectively ) .
other laboratory findings showed mild hyperbilirubinemia , serum total bilirubin 1.4 mg / dl and slightly elevated liver enzymes , aspartate transaminase / alanine transaminze 57/45
hepatitis b virus surface antigen ( hbsag ) and hepatitis c virus antibody ( hcv - ab ) were negative . also , tumor markers such as alpha - fetoprotein ( afp ) , cancer antigen ( ca)-125 , ca19 - 9 , -hcg ( human chorionic goandotropin ) , carcinoembryonic antigen ( cea ) were within their normal limits .
transvaginal ultrasonography revealed a huge solid mass with internal low echogenicity in the upper portion of the uterus , and ct scans showed a multilobulated homogeneous enhancing mass between the right adnexa and the left hepatic lobe measuring 15.211.4 cm ( fig .
1 ) . hence , the initial impression was of a huge myoma uteri or right adnexal mass such as germ cell tumor ( e.g. dysgerminoma , choriocarcinoma ) .
thus total abdominal hysterectomy with bilateral salpingo - oophorectomy was planned in the gynecologic department . during the operation ,
an exophytic mass with a thin peduncle originating from the left lateral hepatic lobe was observed .
the biopsy result was adenoma of uncertain origin , but carcinoma could not be excluded . grossly , the tumor was fairly well - circumscribed and encapsulated .
2 ) . therefore , we performed wedge resection of the hepatic mass leaving an adequate resection margin .
on pathologic examination , the mass was a 1515 cm - sized nodular type , and the edmondson and steiner 's histologic grade was iii .
capsular invasion was present , but the other findings including vascular invasion were absent ( fig .
eggel classified the gross type of hcc into three types : nodular , diffuse , and massive.6 p - hcc is of the nodular type with exophytic growth .
it was first described by roux in 1897 as a carcinoma that protrudes from the liver with or without a pedicle.7 the first case of p - hcc was reported by goldberg and wallenstein in 1934 , which showed a 1.5 cm - sized pedicle and it originated in the left inferior hepatic lobe.8 the incidence of p - hcc was reported to be 0.24%-3.0% of all hccs in japan.2 of 432 surgical resected hepatocellular carcinomas , 18 ( 4.2% ) were p - hccs in a taiwanese study , and the male to female ratio was 2:1 with a mean age of 47.8 years.9 according to their gross appearance , p - hccs can be classified into pedunculated type with a pedicle as in our case , and pendunculated type without a pedicle and attached to the liver surface.10,11
mainly , p - hcc was mostly detected in the accessory lobe of the liver , and the accessory lobe is usually located on the right inferior hepatic lobe ; however it can be located on the other lobe.12 p - hcc can also occur in the ectopic liver tissue such as triangular ligament , spleen , umbilical fossa , retroperitoneum , mesentery , and gallbladder .
the preoperative diagnosis can be more difficult in such cases.2,13 when p - hcc develops in the right hepatic lobe with caudal growth ?
, which may show retroperitoneal extension , it is misdiagnosed as right adrenal tumor.5,14 occasionally , it grows with direct invasion into the peritoneum and spleen .
it is also misdiagnosed as a splenic or peritoneal mass.3,4 similarly , it may invade the duodenum and mimic a duodenal gastrointestinal stromal tumor.15 although the imaging modalities ( ct and mri ) have improved , it is still difficult for a radiologist to determine the tumor origin .
it can be misdiagnosed due to its location , and adherence to other organs . in our case ,
preoperative diagnosis was a right adnexal mass such as germ cell tumor or myoma uteri , but at the time operation , the mass was found to originate from the liver . also , the laboratory findings were nonspecific . in a japanese study ,
the positive rate of afp , which is generally used as a tool for differential diagnosis between hcc and other abdominal tumors , was reported to be 68% in hcc and 66% in p - hcc , and there was no significant difference.16 but , cunningham et al . reported that p - hcc is not related to hepatitis b virus infection and afp.17 in our case , laboratory findings including hepatitis b virus status and tumor markers were also unremarkable .
some authors reported that anatomical hepatectomy was more suitable than partial resection . but others reported that if the growth of p - hcc was limited to the liver , wider resection margins could be obtained .
however , since the respectability rate according to the tumor location is high , hepatectomies for p - hcc do not always yield a survival benefit .
the incidence of recurrence and disease - free survival is similar for these two entities.4,9 it has been reported that the prognosis is related to tumor size , capsular invasion , resection margin , and vascular invasion.9,18 horie et al.19 reported that almost all p - hccs show poorly differentiated characteristics using the edmondson and steiner 's classification.20 but yeh et al .
reported that more than half of the pedunculated tumors were well differentiated in 18 out of 432 hcc patients .
additionally , the overall survival for patients with a large p - hcc ( > 5 cm ) is better than the overall survival ( 54.5 months ) of patients with non p - hcc type ii .
especially , vascular invasion has been known to be associated with prognosis and recurrence of hcc.18 vascular invasion is relatively low in the p - hcc type.13 in our case also , vascular invasion was not observed . in conclusion , although the imaging modalities have improved , it is difficult to diagnose p - hcc due to its ambiguous origin .
but if there is no vascular invasion , the prognosis is better than that in the other types .
also , it is easier to perform surgical resection of the p - hcc type than the other types . | ### Summary:
: hepatocellular carcinoma ( hcc ) is one of the most common malignancies in the world , with high frequency rates in asia .
many of the patients have unresectable disease at the time of diagnosis , and early detection and surgical resection is the best hope for survival .
but , if hcc is presenting as an extrahepatic mass , the diagnosis is difficult .
herein , we report a case of primary hcc masquerading as a pelvic mass .
a 74-year - old woman was admitted to our hospital due to a palpable mass in the lower abdomen .
ct scan detected an approximately 15.013.411.4 cm - sized multilobulated homogeneous enhancing mass in the right adnexa .
operative findings showed that the pelvic mass originated from the liver .
we performed hepatic wedge resection .
permanent histopathologic report revealed primary hcc .
exophytic - growing hepatocellular carcinoma should be carefully diagnosed . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: radiation therapy is one of the most important therapeutic methods in the treatment of esophageal squamous cell carcinoma ( escc ) ; however , the overall survival and local control rates for this disease remain unsatisfactory .
the two - year survival rate is only 30 - 40% , and the local recurrence rate is over 50% after radiation with or without chemotherapy 1,2 .
the accurate delineation of the clinical target volume ( ctv ) in escc plays a very important role in disease control . however , there are no consistent standards for constructing the proper ctv based on the gross tumor volume ( gtv ) .
, we review pathological and clinical outcomes reported in the literature to determine the most appropriate ctv margin in patients with escc treated with radiation therapy .
as the biological behavior of adenocarcinoma of esophagus differs substantially from that of scc , the scope this review does not address the ctv of adenocarcinoma .
the ctv for esophageal squamous cell carcinoma should include the primary tumor and its corresponding subclinical lesions ( described below ) , which typically arise within the esophagus itself and its regional lymphatics .
different selections of margin size for creating ctv based on the gtv have been reported . however , in conventional radiation therapy , areas at risk for subclinical esophageal carcinoma were commonly included using 3 - 4-cm margins in the craniocaudal direction from the gtv ( following the course of the esophagus ) and a 1-cm margin in the lateral and anteroposterior directions from the gtv . whether such practice remains appropriate in the precision radiation therapy era needs to be reviewed .
ctvs of radiation therapy of esophageal scc should cover the primary tumor and its secondary lesions , which may or may not be apparent on imaging studied .
the secondary lesions frequently include direct invasion ( di ) , intra - mural metastasis ( imm ) , multicentric occurrent lesions ( mol ) , vascular invasion ( vi ) , microscopic lymph node metastasis ( lnmm ) and isolated tumor cells ( itc ) .
3 performed serial histologic investigations by measuring the length of the subepithelial extension of the lesion beneath the noncancerous epithelium and reported that coexisting secondary lesions predicted a poor prognosis .
based on this information , we believe that the presence of secondary lesions is closely related to the prognosis of patients with esophageal carcinoma ; patients with a larger number of secondary lesions have a poorer prognosis .
3 through the research of 17 patients with positive subepithelial extension of esophageal carcinoma , and reported that the mean depth of invasion is 4.11 mm ( range : 1.2 mm-9.5 mm ) , and tsutsui et al .
4 in similarly research reported that di is generally less than 30 mm in early - stage esophageal scc .
imm is defined using the following standard macroscopic and histologic criteria : ( 1 ) clearly separated from the primary tumor ; ( 2 ) located in the esophageal wall ; ( 3 ) has the gross appearance of a submucosal tumor without intra - epithelial extension of the tumor ; ( 4 ) has the same histologic type as the primary tumor ; and ( 5 ) lacks any evidence of intravascular growth .
different papers have reported the incidence of imm as ranging from 4.19% to 26% in escc , and the distance of imm spread from the primary tumor is 0.1 cm to 13 cm , with a maximum cranial distance of 13 cm and a maximum caudal distance of 9.5 cm ( as shown in table 1 ) .
kato et al . 7 reported that imm is strongly correlated with lymph node metastasis .
although most research has shown that imm is strongly correlated with overall prognosis 5 - 9 , the incidence and distance of imm remains controversial .
c ) mol : must be distinguished from a second carcinoma of non - esophagus origin and other lesions , such as imm , and should be defined by the following strict diagnostic criteria 10,11 : ( 1 ) each lesion has definite malignant features by pathological analysis ; ( 2 ) the individual lesions are discontinuous ; ( 3 ) the main tumor and secondary tumor coexist simultaneously ; ( 4 ) the main tumor is comparatively larger and more deeply invasive ; ( 5 ) secondary tumor lesions usually include intraepithelial carcinomas , such as atypical hyperplasia and carcinoma in situ , and a metastatic lesion should be excluded ; and ( 6 ) the tumor is located in the esophagus or the gastroesophageal junction .
secondary tumors that occur after a primary esophageal carcinoma ( approximately 1 year later ) are usually known as heterochronic multi - esophageal carcinoma and should not be included in the mol category .
the incidence of mol is 20.2 - 31% in esophageal scc patients who did not receive preoperative irradiation .
the cranial distance from the primary tumor was 0.88 - 7.14 cm , and the caudal distance was 0.57 - 6.26 cm ( table 2 ) .
the incidence of mol in patients administered preoperative irradiation was lower than patients who did not receive preoperative radiation .
reported that the mol rate was 11.7% ( 19/162 ) in patients who received preoperative irradiation and 25.6% ( 11/143 ) in patients who did not receive preoperative irradiation 10 .
tsutsui et al . reported that the mol rate among 303 patients , most of whom were administered preoperative irradiation , was only 5.61% ( 17/303 ) 11 .
mols appear to have an adverse prognostic effect in patients with escc , although currently there are no independent reports of this effect .
mols are more likely in patients with certain risk factors , including male sex , heavy drinking or smoking , and a family history of upper digestive tract carcinoma 12 .
d ) vi : is defined as the infiltration of tumor cells into lymph and blood vessels , as well as tumor embolus formation .
lam et al . 13 reported that the incidence of vi in escc was 16.67% ( 16/96 ) , most of which occurred at the base of the tumor but was occasionally found distal from the primary tumor , at a maximum distance of 5 cm .
the incidence of vi in early - stage escc was 13.89% ( 15/108 ) 14 and 39.1% ( 143/366 ) in advanced disease 15 .
all of these studies demonstrated that vi is an important prognostic factor ; however , none of these studies assessed the distance of vi sites from the primary tumor .
brcher found that when lymph vessels around the tumor were infiltrated , especially laterally , a higher likelihood of local - regional lymph node metastases was observed 15 .
e ) lnmm and itc : lnmm refers to 0.2 - 2 mm of tumor cell invasion into a lymph node , whereas less than 0.2 mm of infiltration is defined as itc .
both lnmm and itc are occult metastases that can not be found by routine pathologic examination . with the development of immunohistochemistry techniques , more occult
17 assessed lymph node - negative patients with resectable esophageal carcinoma , including squamous cell carcinoma and adenocarcinoma , and observed that the incidence of lnmm was 34.2% ( 25/73 ) .
patients with lnmm had a five - year overall survival probability of 30% , which was significantly lower than patients without lnmm , in whom the five - year survival rate was 76% ( p=0.02 ) .
natsugoe and colleagues 18 studied the locations of solitary lymph node metastases and micrometastases in escc and noted that the locations of the two types of nodal metastases were distributed similarly .
lymph node metastases were limited to the area of the recurrent nerve in the upper thoracic esophagus and to paraesophageal and perigastric nodes in the middle or lower thoracic esophagus ; investigators also found that the incidence of lnmm increased with tumor depth .
f ) pni : is defined as cancer cell infiltration into the perineurium or fasciculus , and can be detected at the boundary of the deepest tumor invasion .
tanaka et al . reported an incidence of 46.2% ( 48/104 ) of pni in resected escc and found that pni is an important prognostic factor for local relapse 19 .
however , sarbia et al . reported that the incidence of pni was 26.1% ( 42/161 ) among patients with the same histology and concluded that pni was not a prognostic factor based on univariate and multivariate survival analyses 20 .
recently , chen et al reported that pni was identified in 47.7% ( 209/433 ) cases , and they concluded that pni can play a role as an independent prognostic factor of outcomes 21 . though the results of those researches of pni remain controversial , we think pni will be a new maker for prognosis of escc in the future . in radiation therapy , the expansion margin from gtv to ctv is solely based on the consideration of subclinical lesions around the primary tumor .
our preliminary research into simulated plans ( using optimal flt and fdg pet / ct thresholds ) for squamous cell carcinoma of the thoracic esophagus found that an extended margin influences both organ - at - risk ( oar ) and planning target volumes , especially for those patients with larger tumors , will affect the oars adjacent to the target significantly .
powerful imaging approaches , such as fdg pet / ct , and advanced treatment technology such as image guided radiotherapy , incorporated into radiotherapy for escc , can be utilized to decrease the internal target volume and setup error , thus undoubtedly bringing dosimetric benefits to both the target and oars 22 .
our preliminary research has shown that even with a little larger gtv , will affect the ptv significantly , and also will influence organ - at - risk ( oar ) as a induced result . and the technique of pet imaging , ( flt versus fdg , for example ) can be further refined to reveal more subclinical disease and improve target delineation ( figure 1 ) .
pathologic research has shown that di , imm , mol , vi and pni are subclinical lesions that should be included in ctvp .
radiotherapy techniques have been developed that recommend the use of enlarged fields ( e.g. , whole - esophagus or whole - mediastinum ) to treat secondary lesions located far from the primary tumor .
both the radiation therapy oncology group ( rtog ) 85 - 01 trial and the rtog 94 - 05 trial employed enlarged radiation fields , initial target volume including supraclavicular fossae to the esophagogastric junction , and 5 cm margin beyond superior and inferior of the primary tumor , respectively .
however , these studies did not demonstrate improved local control or survival despite causing intolerable toxicities 23 . if there is no benefit to using enlarged irradiation field , what outcomes may be expected after involved field treatment ?
24 performed a retrospective study on 145 patients to assess the first site of disease relapse after definitive chemoradiotherapy .
the rt planning target volume included the gtv , with 1.5-cm lateral and 3-cm superior - inferior margins .
relapse occurred locally ( within the rt field ) in 55 patients , distantly ( metastatic ) in 13 patients , and as a combination of local and distant disease in 14 patients .
the local relapse rates were not influenced by tumor stage , lymph node status , or disease length .
the gtv to planning target volume ( ptv ) margins in this study appeared adequate .
interestingly , only 3 patients relapsed in regions adjacent to the rt fields . to improve local control
, it seems that larger field margins would unlikely have been clinically effective in these cases .
25 , who studied the ctvp for esophageal squamous cell cancer using pathological analysis , also support this view .
this study analyzed the extent of microscopic spread within the esophagus and concluded that the recommended ctv margin should be < 30 mm in approximately 94% of cases of esophageal cancer , although the investigators did not note the occurrence of each secondary lesion .
all previous studies suggest that smaller margins are acceptable and do not increase the local failure risk . however , these results are limited by the sample size , and some questions remain unanswered .
the esophagus has an extensive lymph drainage region , with draining lymph nodes spread in the region between the supraclavicular and upper abdomen .
the lymph nodes around the esophagus are invaded in the early stages of disease development , and skip metastases in regional lymph nodes are common in esophageal carcinoma .
the prophylactically irradiated region should include all potential metastases , although lnmm and itc can not be detected by conventional imaging methods .
26 retrospectively analyzed 51 cases of early ( superficially invasive ) carcinoma of the esophagus in patients who underwent extended radical esophagectomy and found that in 29 cases with lymph node metastasis , the rate of skip metastases was 24% .
27 studied a total of 1,584 resected lymph nodes obtained from 86 patients with resected esophageal carcinoma and found a 34% probability of skip metastasis at one or multiple stations . for thoracic esophageal scc ,
the incidence of lymph node metastasis was 70% , and the high risk regions were paracardiac nodes of the stomach , nodes of lesser gastric curvature , and the nodes of right laryngeal nerve . in total ,
35% of patients had positive cervical lymph nodes , and 45% had positive mediastinal and abdominal lymph nodes .
the most commonly involved mediastinal sites were the bilateral laryngeal nerves , subcarinal and paraesophageal regions , and the most commonly involved abdominal site was the paracardiac lymph nodes . the need to prophylactically irradiate areas at high risk of metastasis
they found that the rates of lymph node metastases for the upper , middle , lower and abdominal esophagus were 37.5% , 32.5% , 46% and 70% , respectively ; additionally , they suggested that in patients with upper and middle thoracic esophageal tumors , prophylactic radiation of abdominal lymph nodes was unnecessary and that irradiation of the supraclavicular region was not necessary in patients with middle and lower thoracic esophageal tumors .
29 retrospectively analyzed the pattern of lymph node metastasis in 1077 patients with thoracic escc who had undergone esophagectomy and lymphadenectomy and suggested a detailed technique for contouring a prophylactic nodal irradiation volume . for upper thoracic esophageal carcinomas ,
the superior prophylactic nodal irradiation volume should include the cervical paraesophageal and supraclavicular lymph nodes , and the superior margin should include the subcarinal lymph nodes .
for lower thoracic esophageal carcinomas , the superior margin should include the subcarinal lymph nodes , and the inferior margin should include the left gastric lymph nodes and common hepatic artery lymph nodes . for middle thoracic esophageal carcinomas , the prophylactic treatment volume should be customized depending on the clinical circumstances ; more thorough coverage of the mediastinal lymph nodes should be considered , especially in patients who are generally in good condition . as shown in figure 2 .
ctvs of radiation therapy of esophageal scc should cover the primary tumor and its secondary lesions , which may or may not be apparent on imaging studied .
the secondary lesions frequently include direct invasion ( di ) , intra - mural metastasis ( imm ) , multicentric occurrent lesions ( mol ) , vascular invasion ( vi ) , microscopic lymph node metastasis ( lnmm ) and isolated tumor cells ( itc ) .
3 performed serial histologic investigations by measuring the length of the subepithelial extension of the lesion beneath the noncancerous epithelium and reported that coexisting secondary lesions predicted a poor prognosis .
based on this information , we believe that the presence of secondary lesions is closely related to the prognosis of patients with esophageal carcinoma ; patients with a larger number of secondary lesions have a poorer prognosis .
kuwano et al . 3 through the research of 17 patients with positive subepithelial extension of esophageal carcinoma , and
reported that the mean depth of invasion is 4.11 mm ( range : 1.2 mm-9.5 mm ) , and tsutsui et al .
4 in similarly research reported that di is generally less than 30 mm in early - stage esophageal scc .
imm is defined using the following standard macroscopic and histologic criteria : ( 1 ) clearly separated from the primary tumor ; ( 2 ) located in the esophageal wall ; ( 3 ) has the gross appearance of a submucosal tumor without intra - epithelial extension of the tumor ; ( 4 ) has the same histologic type as the primary tumor ; and ( 5 ) lacks any evidence of intravascular growth .
different papers have reported the incidence of imm as ranging from 4.19% to 26% in escc , and the distance of imm spread from the primary tumor is 0.1 cm to 13 cm , with a maximum cranial distance of 13 cm and a maximum caudal distance of 9.5 cm ( as shown in table 1 ) .
kato et al . 7 reported that imm is strongly correlated with lymph node metastasis .
although most research has shown that imm is strongly correlated with overall prognosis 5 - 9 , the incidence and distance of imm remains controversial .
c ) mol : must be distinguished from a second carcinoma of non - esophagus origin and other lesions , such as imm , and should be defined by the following strict diagnostic criteria 10,11 : ( 1 ) each lesion has definite malignant features by pathological analysis ; ( 2 ) the individual lesions are discontinuous ; ( 3 ) the main tumor and secondary tumor coexist simultaneously ; ( 4 ) the main tumor is comparatively larger and more deeply invasive ; ( 5 ) secondary tumor lesions usually include intraepithelial carcinomas , such as atypical hyperplasia and carcinoma in situ , and a metastatic lesion should be excluded ; and ( 6 ) the tumor is located in the esophagus or the gastroesophageal junction .
secondary tumors that occur after a primary esophageal carcinoma ( approximately 1 year later ) are usually known as heterochronic multi - esophageal carcinoma and should not be included in the mol category .
the incidence of mol is 20.2 - 31% in esophageal scc patients who did not receive preoperative irradiation .
the cranial distance from the primary tumor was 0.88 - 7.14 cm , and the caudal distance was 0.57 - 6.26 cm ( table 2 ) .
the incidence of mol in patients administered preoperative irradiation was lower than patients who did not receive preoperative radiation .
reported that the mol rate was 11.7% ( 19/162 ) in patients who received preoperative irradiation and 25.6% ( 11/143 ) in patients who did not receive preoperative irradiation 10 .
tsutsui et al . reported that the mol rate among 303 patients , most of whom were administered preoperative irradiation , was only 5.61% ( 17/303 ) 11 .
mols appear to have an adverse prognostic effect in patients with escc , although currently there are no independent reports of this effect .
mols are more likely in patients with certain risk factors , including male sex , heavy drinking or smoking , and a family history of upper digestive tract carcinoma 12 . the ctv margin should be enlarged appropriately if these risk factors are noted .
d ) vi : is defined as the infiltration of tumor cells into lymph and blood vessels , as well as tumor embolus formation .
lam et al . 13 reported that the incidence of vi in escc was 16.67% ( 16/96 ) , most of which occurred at the base of the tumor but was occasionally found distal from the primary tumor , at a maximum distance of 5 cm .
the incidence of vi in early - stage escc was 13.89% ( 15/108 ) 14 and 39.1% ( 143/366 ) in advanced disease 15 .
all of these studies demonstrated that vi is an important prognostic factor ; however , none of these studies assessed the distance of vi sites from the primary tumor .
brcher found that when lymph vessels around the tumor were infiltrated , especially laterally , a higher likelihood of local - regional lymph node metastases was observed 15 .
e ) lnmm and itc : lnmm refers to 0.2 - 2 mm of tumor cell invasion into a lymph node , whereas less than 0.2 mm of infiltration is defined as itc .
both lnmm and itc are occult metastases that can not be found by routine pathologic examination . with the development of immunohistochemistry techniques , more occult lymph node metastases have been detected . using immunohistochemistry ,
17 assessed lymph node - negative patients with resectable esophageal carcinoma , including squamous cell carcinoma and adenocarcinoma , and observed that the incidence of lnmm was 34.2% ( 25/73 ) .
patients with lnmm had a five - year overall survival probability of 30% , which was significantly lower than patients without lnmm , in whom the five - year survival rate was 76% ( p=0.02 ) .
natsugoe and colleagues 18 studied the locations of solitary lymph node metastases and micrometastases in escc and noted that the locations of the two types of nodal metastases were distributed similarly .
lymph node metastases were limited to the area of the recurrent nerve in the upper thoracic esophagus and to paraesophageal and perigastric nodes in the middle or lower thoracic esophagus ; investigators also found that the incidence of lnmm increased with tumor depth .
f ) pni : is defined as cancer cell infiltration into the perineurium or fasciculus , and can be detected at the boundary of the deepest tumor invasion .
tanaka et al . reported an incidence of 46.2% ( 48/104 ) of pni in resected escc and found that pni is an important prognostic factor for local relapse 19 .
reported that the incidence of pni was 26.1% ( 42/161 ) among patients with the same histology and concluded that pni was not a prognostic factor based on univariate and multivariate survival analyses 20 .
recently , chen et al reported that pni was identified in 47.7% ( 209/433 ) cases , and they concluded that pni can play a role as an independent prognostic factor of outcomes 21 . though the results of those researches of pni remain controversial , we think pni will be a new maker for prognosis of escc in the future .
in radiation therapy , the expansion margin from gtv to ctv is solely based on the consideration of subclinical lesions around the primary tumor .
our preliminary research into simulated plans ( using optimal flt and fdg pet / ct thresholds ) for squamous cell carcinoma of the thoracic esophagus found that an extended margin influences both organ - at - risk ( oar ) and planning target volumes , especially for those patients with larger tumors , will affect the oars adjacent to the target significantly .
powerful imaging approaches , such as fdg pet / ct , and advanced treatment technology such as image guided radiotherapy , incorporated into radiotherapy for escc , can be utilized to decrease the internal target volume and setup error , thus undoubtedly bringing dosimetric benefits to both the target and oars 22 .
our preliminary research has shown that even with a little larger gtv , will affect the ptv significantly , and also will influence organ - at - risk ( oar ) as a induced result . and
the technique of pet imaging , ( flt versus fdg , for example ) can be further refined to reveal more subclinical disease and improve target delineation ( figure 1 ) .
pathologic research has shown that di , imm , mol , vi and pni are subclinical lesions that should be included in ctvp .
radiotherapy techniques have been developed that recommend the use of enlarged fields ( e.g. , whole - esophagus or whole - mediastinum ) to treat secondary lesions located far from the primary tumor .
both the radiation therapy oncology group ( rtog ) 85 - 01 trial and the rtog 94 - 05 trial employed enlarged radiation fields , initial target volume including supraclavicular fossae to the esophagogastric junction , and 5 cm margin beyond superior and inferior of the primary tumor , respectively
. however , these studies did not demonstrate improved local control or survival despite causing intolerable toxicities 23 . if there is no benefit to using enlarged irradiation field , what outcomes may be expected after involved field treatment ?
24 performed a retrospective study on 145 patients to assess the first site of disease relapse after definitive chemoradiotherapy .
the rt planning target volume included the gtv , with 1.5-cm lateral and 3-cm superior - inferior margins .
relapse occurred locally ( within the rt field ) in 55 patients , distantly ( metastatic ) in 13 patients , and as a combination of local and distant disease in 14 patients .
the local relapse rates were not influenced by tumor stage , lymph node status , or disease length .
the gtv to planning target volume ( ptv ) margins in this study appeared adequate .
interestingly , only 3 patients relapsed in regions adjacent to the rt fields . to improve local control
, it seems that larger field margins would unlikely have been clinically effective in these cases .
25 , who studied the ctvp for esophageal squamous cell cancer using pathological analysis , also support this view .
this study analyzed the extent of microscopic spread within the esophagus and concluded that the recommended ctv margin should be < 30 mm in approximately 94% of cases of esophageal cancer , although the investigators did not note the occurrence of each secondary lesion .
all previous studies suggest that smaller margins are acceptable and do not increase the local failure risk .
however , these results are limited by the sample size , and some questions remain unanswered .
the esophagus has an extensive lymph drainage region , with draining lymph nodes spread in the region between the supraclavicular and upper abdomen .
the lymph nodes around the esophagus are invaded in the early stages of disease development , and skip metastases in regional lymph nodes are common in esophageal carcinoma .
the prophylactically irradiated region should include all potential metastases , although lnmm and itc can not be detected by conventional imaging methods .
26 retrospectively analyzed 51 cases of early ( superficially invasive ) carcinoma of the esophagus in patients who underwent extended radical esophagectomy and found that in 29 cases with lymph node metastasis , the rate of skip metastases was 24% .
27 studied a total of 1,584 resected lymph nodes obtained from 86 patients with resected esophageal carcinoma and found a 34% probability of skip metastasis at one or multiple stations . for thoracic esophageal scc ,
the incidence of lymph node metastasis was 70% , and the high risk regions were paracardiac nodes of the stomach , nodes of lesser gastric curvature , and the nodes of right laryngeal nerve . in total ,
35% of patients had positive cervical lymph nodes , and 45% had positive mediastinal and abdominal lymph nodes .
the most commonly involved mediastinal sites were the bilateral laryngeal nerves , subcarinal and paraesophageal regions , and the most commonly involved abdominal site was the paracardiac lymph nodes .
the need to prophylactically irradiate areas at high risk of metastasis must be weighed against potential treatment toxicities .
they found that the rates of lymph node metastases for the upper , middle , lower and abdominal esophagus were 37.5% , 32.5% , 46% and 70% , respectively ; additionally , they suggested that in patients with upper and middle thoracic esophageal tumors , prophylactic radiation of abdominal lymph nodes was unnecessary and that irradiation of the supraclavicular region was not necessary in patients with middle and lower thoracic esophageal tumors .
29 retrospectively analyzed the pattern of lymph node metastasis in 1077 patients with thoracic escc who had undergone esophagectomy and lymphadenectomy and suggested a detailed technique for contouring a prophylactic nodal irradiation volume . for upper thoracic esophageal carcinomas ,
the superior prophylactic nodal irradiation volume should include the cervical paraesophageal and supraclavicular lymph nodes , and the superior margin should include the subcarinal lymph nodes . for lower thoracic esophageal carcinomas , the superior margin should include the subcarinal lymph nodes , and the inferior margin should include the left gastric lymph nodes and common hepatic artery lymph nodes .
for middle thoracic esophageal carcinomas , the prophylactic treatment volume should be customized depending on the clinical circumstances ; more thorough coverage of the mediastinal lymph nodes should be considered , especially in patients who are generally in good condition . as shown in figure 2 .
in summary , the ctv of esophageal carcinoma should cover the primary tumor and all detected secondary lesions that must be treated .
rarely , individual lesions may be located distant from the primary tumor , therefore empirical irradiation of the whole esophagus or mediastinum is likely unnecessary .
adequate margins within at least 3 cm of gross tumor volume and detected secondary lesions will also ensure that occult secondary lesions close to the primary tumor within the esophagus are also covered .
the precise method of creating reasonable ctv contours is to combine advanced imaging mediums ( e.g. , pet / ct , eus , etc . ) along with clinical features such as the tumor 's pathological type , differentiation , t stage , length and lymph node status , to detect and predict subclinical lesions with sufficient margin , thereby increasing local control and decreasing the risk of complications . in a recent report
, involved field irradiation was recommended , with a suggested 3 cm ctvp super - inferior margin expansion from gtvp , and the ctvn is defined as the gtvn plus a 0.5 - 1.0 cm radial margin , in the expectation that treatment - related toxicities would decline as the irradiation volume is diminished 30 .
therefore , we believe the future trends in the radiotherapeutic approach to escc will include moving towards a reduction in the ctv margin and , perhaps , dose - escalation .
the long - term result of this new approach has yet to be acquired and controversy will likely remain regarding this topic for some time . | ### Summary:
: accurate delineation of clinical target volume ( ctv ) is critical in the effective management of squamous cell carcinoma ( scc ) of esophagus using radiation therapy .
accurate delineation may improve the probability of local control and reduce the risk of complications . however , there are no consistent standards on the proper size of the margins added to the gross tumor volume ( gtv ) .
different institutions and radiation oncologists have discordant opinions . in this paper
, we review pathological and clinical outcomes to determine the most appropriate ctv for squamous cell carcinomas ( scc ) of esophagus .
the ctv for esophageal carcinoma should ensure that all subclinical lesions are encompassed regardless of the physical distance .
the most precise method for delineating a reasonable ctv is to combine advanced imaging techniques , such as pet / ct and eus , which allows the detection and prediction of subclinical lesions based on tumor characteristics such as the pathological type , differentiation , t disease , length and lymph node status . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: this is to ensure uniformity of the drug ingredients and hence the efficacy of the medicinal product .
obtaining the best mixing procedure is one of the greatest challenges faced by the industry .
this is because mixing performance can be influenced by powder properties , equipment design , processing conditions , and operator methodology .
most published work has focused on operating conditions such as impeller rotational speed , mixer inclination angle , and flow rate in continuous mixing process.14 however , only a few types of mixer designs have been examined in the literature . in industrial practice
, batch mixing is commonly used to produce large - scale output of new product formulations.5 continuous mixing is commonly applied in large industries and to established production procedures .
there is an increased demand for continuous mixing due to its short processing time , large output , and ease of handling as the need for labor is minimal .
however , there are some drawbacks to this type of system , as the factors influencing the mixing are more difficult to control
. moreover , homogeneity of the mixture is more difficult to achieve and the capital required to set up a complete processing system with a continuous mixer is much higher than for batch mixing.5 batch ribbon mixers are widely used in the pharmaceutical industry .
many factors can affect their mixing homogeneity and most of the literature has investigated only selected factors .
ct and abatzoglou,6 for example , reported the mixer filling height as the most important operational parameter in comparison with mixing time and impeller rotational speed .
the present study investigated the effect of feed preparation characteristics ( particle size and preblending ) and operational parameters ( rotational speed and mixing time ) on mixing homogeneity in a convective batch ribbon mixer .
a mixture of lactose , ascorbic acid , and zinc oxide was employed . due to the different characteristics of the powders , it was assumed the mixture was heterogeneous .
the convective batch ribbon mixer used in this study was designed for a laboratory study ( unpublished ) .
this mixer is classified as a convective mixer and is comprised of a u - shaped container ( length 30 cm , height 12 cm , width 10 cm ) that houses a horizontal ribbon mixer ( length 40 cm , diameter 9 cm ) with a double layer of spiral blades ( figure 1 ) .
this scaled - down mixer is made from poly(methyl methacrylate ) and the blade and shaft are made from stainless steel . a motor ( rw20 ; ika gmbh , knigswinter , germany ) is used to provide rotational movement to the shaft .
the powders are fed into and removed from the mixer through the detachable hinged top .
two model blends were formulated using ascorbic acid ( 25% ) ( northeast general pharmaceutical factory , shenyang , china ) , zinc oxide ( 2.5% ) ( approfit zinc oxide sdn bhd , puchong , malaysia ) , and lactose ( 72.5% ) ( dmv - fonterra excipients , goch , germany ) . the ratios of these powders were in accordance with the most common dosage of vitamin c supplement , in which the approximate amount of ascorbic acid in one tablet is 250 mg ( as the suggested dosage is 250 mg per day).7 this basic formulation was used as a model blend , consisting of an active substance ( ascorbic acid ) and excipients ( lactose and zinc oxide ) .
lactose acts as a binder while zinc oxide enhances the absorption of ascorbic acid by the human body .
feed can be prepared with ( 1 ) preblending or ( 2 ) without preblending . for the preblend ,
then 225 g lactose and 25 g of zinc oxide were manually mixed together for 5 minutes in an enclosed container by imitating a tumble mixer movement . then the lactose - zinc oxide mixture was similarly mixed manually with 250 g ascorbic acid .
( not preblended ) , all the ascorbic acid , zinc oxide , and lactose were fed into the mixer simultaneously . mixing parameters employed in this study
after the mixing process , a 100 g sample was collected at every twelve points within the mixer ( figure 3 ) to ensure thorough characterization by considering areas that that may have different shear conditions .
the selection of sampling positions was based on muzzio et al.8 three samples were withdrawn from each point .
a core sampling technique was applied for obtaining three - dimensional sampling as it allows a cross - sectional sample to be taken from each sample location . in this project ,
the effect of mixing parameters on the homogeneity of the output stream was determined by analyzing the output samples as a function of time . to analyze homogeneity ,
it is necessary to determine the amount of tracer ( ascorbic acid ) in the sample using chemical testing techniques .
the mixture was tested by titrating the dissolved sample with redox - indicator solution , 2,6-diclorophenolindophenol ( aoac method 967.21 ) . prior to this ,
this meant that 242.5 g of ascorbic acid was contained in 250 g of ascorbic acid powder . while , in 1000 g total quantity of mixture , the standard amount of ascorbic acid content in the mixture is 24.25% . therefore , 24.25% ascorbic acid content was set as the standard specification , with an acceptable range of 24.25% 2.4% .
the convective batch ribbon mixer used in this study was designed for a laboratory study ( unpublished ) .
this mixer is classified as a convective mixer and is comprised of a u - shaped container ( length 30 cm , height 12 cm , width 10 cm ) that houses a horizontal ribbon mixer ( length 40 cm , diameter 9 cm ) with a double layer of spiral blades ( figure 1 ) .
this scaled - down mixer is made from poly(methyl methacrylate ) and the blade and shaft are made from stainless steel . a motor ( rw20 ; ika gmbh , knigswinter , germany ) is used to provide rotational movement to the shaft .
the powders are fed into and removed from the mixer through the detachable hinged top .
two model blends were formulated using ascorbic acid ( 25% ) ( northeast general pharmaceutical factory , shenyang , china ) , zinc oxide ( 2.5% ) ( approfit zinc oxide sdn bhd , puchong , malaysia ) , and lactose ( 72.5% ) ( dmv - fonterra excipients , goch , germany ) .
the ratios of these powders were in accordance with the most common dosage of vitamin c supplement , in which the approximate amount of ascorbic acid in one tablet is 250 mg ( as the suggested dosage is 250 mg per day).7 this basic formulation was used as a model blend , consisting of an active substance ( ascorbic acid ) and excipients ( lactose and zinc oxide ) .
lactose acts as a binder while zinc oxide enhances the absorption of ascorbic acid by the human body .
feed can be prepared with ( 1 ) preblending or ( 2 ) without preblending . for the preblend ,
then 225 g lactose and 25 g of zinc oxide were manually mixed together for 5 minutes in an enclosed container by imitating a tumble mixer movement .
then the lactose - zinc oxide mixture was similarly mixed manually with 250 g ascorbic acid .
finally , the preblend powder was fed into the mixer . for feed preparation 2 ( not preblended )
, all the ascorbic acid , zinc oxide , and lactose were fed into the mixer simultaneously . mixing parameters employed in this study
after the mixing process , a 100 g sample was collected at every twelve points within the mixer ( figure 3 ) to ensure thorough characterization by considering areas that that may have different shear conditions .
the selection of sampling positions was based on muzzio et al.8 three samples were withdrawn from each point .
a core sampling technique was applied for obtaining three - dimensional sampling as it allows a cross - sectional sample to be taken from each sample location .
in this project , the effect of mixing parameters on the homogeneity of the output stream was determined by analyzing the output samples as a function of time . to analyze homogeneity ,
it is necessary to determine the amount of tracer ( ascorbic acid ) in the sample using chemical testing techniques .
the mixture was tested by titrating the dissolved sample with redox - indicator solution , 2,6-diclorophenolindophenol ( aoac method 967.21 ) . prior to this
this meant that 242.5 g of ascorbic acid was contained in 250 g of ascorbic acid powder . while , in 1000 g total quantity of mixture , the standard amount of ascorbic acid content in the mixture is 24.25% . therefore , 24.25% ascorbic acid content was set as the standard specification , with an acceptable range of 24.25% 2.4% .
figure 4 illustrates the amount of ascorbic acid present at the different mixing times at the lowest rotational speed used in this work , 40 rpm .
the lactose 200 m and lactose 100 m mixtures with preblending were more likely to meet the specification , whereby after 15 minutes mixing , they have fulfilled the minimum homogeneity requirement .
lactose 100 m , having relatively larger particle size in comparison with lactose 200 m , exhibited poor homogeneity in the absence of a preblend . lactose 200 m without preblending had better homogeneity , and achieved the minimum homogeneity requirement after 20 minutes of mixing time .
these trends are supported by the relatively small particle sizes ( table 1 ) and large apparent surface area ( figure 2 ) of lactose 200 m , which can adhere to the larger ascorbic acid particles thus minimizing segregation .
the flowability of the powder may also be considered as a factor that affects the homogeneity of the mixture .
lactose 100 m has better flowability than the lactose 200 m ( table 1 ) . due to the lack of mobility of lactose 200 m
, ascorbic acid tends to hold and lock lactose 200 m inside the powder bed and thus produces an ordered mixture .
mixtures containing lactose 100 m will need a longer period to achieve homogeneity as the particles are free to move and tend to segregate .
all mixtures achieved the homogeneity requirement after a mixing time of 25 minutes at the lowest rotational rate of 40 rpm .
figure 5 shows the amount of ascorbic acid present at the different mixing times at the medium rotational speed of 60 rpm .
it is interesting to note that , at 60 rpm , all the mixtures achieved the required homogeneity in a shorter mixing time of 20 minutes . at the highest rotational speed used in this work , 80 rpm , all mixtures met the specification after 10 minutes of mixing ( see figure 6 ) .
however , the mixture containing lactose 200 m without preblending showed particle segregation , and the homogeneity decreased below the minimum requirement .
the high rotational rate provides high shear stresses and this breaks down agglomerates of cohesive powders .
for instance , the results varied significantly ( standard deviation varied between 2.8 and 4.2 ) for each repetition test at 5 minutes and at 25 minutes for the mixture containing lactose 100 m without preblending . this error could also be due to the segregation effect .
it was found that mixtures containing lactose 200 m with preblending always met the specification with the shortest mixing time .
these results illustrate that using binders with a smaller particle size and using a preblending technique improves the mixing process in a convective batch ribbon powder mixer .
as the particle size becomes smaller , the contact surface of each particle will increase , thus promoting agglomeration of the different particles within the mixture . | ### Summary:
: purposeto investigate the effect of feed preparation characteristics and operational parameters on mixing homogeneity in a convective batch ribbon mixer.methodslactose 100 m , lactose 200 m , ascorbic acid , and zinc oxide powders were used for the mixing study .
operational parameters studied were rotational speed and mixing time .
the feed preparations studied were the use of preblending and the particle size of the feed materials .
the blends of ascorbic acid , zinc oxide , and lactose were prepared with preblending and without preblending , prior to mixing at different blender rotation speeds and mixing times .
chemical tests were performed to measure the homogeneity of the ascorbic acid in the model mixture.resultswith preblending , a mixture with lactose 200 m achieved the required homogeneity in a shorter period of time at a lower rotational speed.conclusionthe results indicated that the homogeneity of the mixtures was influenced by the blender rotation speed and mixing time .
better mixing can be obtained with higher rotation speeds and longer mixing time .
it was also observed that preblending and smaller feed particle size achieved the required homogeneity in a shorter period of time at a lower rotational speed .
these results illustrate that using binders with a smaller particle size and a preblending technique improves the mixing process in a convective batch ribbon powder mixer .
however , prolonged periods of high - speed mixing will lead to mixture segregation . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: four hundred and seventy participants from undergraduate ( 89.6% ) and postgraduate ( 10.4% ) english medium colleges across bengaluru were recruited for the study .
the mean age of the sample was 20.25 years ( standard deviation [ sd ] = 1.70 ) .
the participants were predominantly female ( 70% ) and a majority of them were single ( 95.3% ) , with 1.1% married and 0.4% separated or divorced . in terms of living arrangements , 70.3% were living with their families , 22% were living with a roommate , 7.2% were living alone , and 4.5% reported other living arrangements .
with respect to family composition , 79.2% were from intact families , 13.2% were from joint families , 6.7% had a single parent , and 0.9% indicated having a parent and a step - parent .
the questionnaire included information about age , gender , marital status , educational level and course , family composition , and living arrangements .
this self - report measure assesses the frequency , methods , characteristics , and functions of suicidal sib .
engagement in different methods of sib in the past 12-month period is assessed through 11 items .
additional items assess whether the behaviors were suicidal or nonsuicidal in nature , the concurrent use of alcohol or drugs , the degree of impulsivity and pain experienced , the age of onset of sib , and possible reasons for engaging in sibs .
the paper focuses on the frequency , methods , and selected characteristics of sib reported in the past year .
more detailed results on the characteristics of self - injury in this sample are available in a previous publication .
this 40-item self - report measure assesses five dimensions that reflect two underlying attachment dimensions , anxiety and avoidance , and is answered on a 6-point likert scale .
one subscale represents secure attachment ( confidence in self and others ) while the other four represent a particular aspect of insecure attachment ; discomfort with closeness , relationships as secondary ; need for approval and preoccupation with relationships .
discomfort with closeness describes a pattern of protecting from the feeling of vulnerability by being distant and not attaching to others ; relationships as secondary refer to a pattern where individuals protect themselves against hurt and vulnerability by emphasizing achievement and independence ; need for approval reflects individuals ' need for others ' acceptance and confirmation ; preoccupation with relationships involves an anxious reaching out to others to fulfill dependency needs .
two primary dimensions underlying attachment styles have been derived from the attachment style questionnaire items .
attachment anxiety ( 13 items ) refers to an individual 's excessive need for reassurance , fear of rejection , and a desire to merge with relationship partners .
attachment avoidance ( 16 items ) reflects the extent to which an individual avoids intimacy and is distrusting of others .
individuals with high levels of avoidance and/or anxiety possess insecure attachment while individuals with low avoidance and anxiety are securely attached .
the questionnaire has adequate internal consistency ( = 0.80 ) and test - retest reliability over a 10-week period ranged from 67 to 78 .
the ders is a 36-item self - report questionnaire , answered on a 5-point likert scale that assesses difficulties in emotion regulation .
the measure gives a total score as well as scores on six subscales derived through factor analysis ; nonacceptance of emotional responses , difficulties engaging in the goal - directed behavior , impulse control difficulties , lack of emotional awareness , limited access to effective emotion regulation strategies , and lack of emotional clarity .
the subscales of the ders yield good to excellent internal consistencies ( = 0.760.89 ) and subscale intercorrelations range from negligible to high ( range : r = 0.04 to r = 0.68 ) and have adequate construct validity . the institutional ethical clearance was obtained for the study .
eight of the twelve colleges approached provided consent for participation and groups of students were selected based on practical considerations of space , scheduling , and availability .
a debriefing session was carried out with the participants where issues relating to stress , coping , and the importance of help - seeking and accessing social support were discussed . a handout with the contact information of mental health services was provided to each participant .
descriptive statistics such as frequencies , percentages , means , and sds were computed to measure occurrence and characteristics of sibs .
the association between emotion regulation and attachment domains was assessed using the pearson product - moment correlation method .
the emotion regulation and attachment domains that were significant in the t - test were considered in the logistic regression analyses .
four hundred and seventy participants from undergraduate ( 89.6% ) and postgraduate ( 10.4% ) english medium colleges across bengaluru were recruited for the study .
the mean age of the sample was 20.25 years ( standard deviation [ sd ] = 1.70 ) .
the participants were predominantly female ( 70% ) and a majority of them were single ( 95.3% ) , with 1.1% married and 0.4% separated or divorced . in terms of living arrangements , 70.3% were living with their families , 22% were living with a roommate , 7.2% were living alone , and 4.5% reported other living arrangements .
with respect to family composition , 79.2% were from intact families , 13.2% were from joint families , 6.7% had a single parent , and 0.9% indicated having a parent and a step - parent .
the questionnaire included information about age , gender , marital status , educational level and course , family composition , and living arrangements .
this self - report measure assesses the frequency , methods , characteristics , and functions of suicidal sib .
engagement in different methods of sib in the past 12-month period is assessed through 11 items .
additional items assess whether the behaviors were suicidal or nonsuicidal in nature , the concurrent use of alcohol or drugs , the degree of impulsivity and pain experienced , the age of onset of sib , and possible reasons for engaging in sibs .
the paper focuses on the frequency , methods , and selected characteristics of sib reported in the past year .
more detailed results on the characteristics of self - injury in this sample are available in a previous publication .
this 40-item self - report measure assesses five dimensions that reflect two underlying attachment dimensions , anxiety and avoidance , and is answered on a 6-point likert scale .
one subscale represents secure attachment ( confidence in self and others ) while the other four represent a particular aspect of insecure attachment ; discomfort with closeness , relationships as secondary ; need for approval and preoccupation with relationships .
discomfort with closeness describes a pattern of protecting from the feeling of vulnerability by being distant and not attaching to others ; relationships as secondary refer to a pattern where individuals protect themselves against hurt and vulnerability by emphasizing achievement and independence ; need for approval reflects individuals ' need for others ' acceptance and confirmation ; preoccupation with relationships involves an anxious reaching out to others to fulfill dependency needs .
two primary dimensions underlying attachment styles have been derived from the attachment style questionnaire items .
attachment anxiety ( 13 items ) refers to an individual 's excessive need for reassurance , fear of rejection , and a desire to merge with relationship partners .
attachment avoidance ( 16 items ) reflects the extent to which an individual avoids intimacy and is distrusting of others .
individuals with high levels of avoidance and/or anxiety possess insecure attachment while individuals with low avoidance and anxiety are securely attached .
the questionnaire has adequate internal consistency ( = 0.80 ) and test - retest reliability over a 10-week period ranged from 67 to 78 .
the ders is a 36-item self - report questionnaire , answered on a 5-point likert scale that assesses difficulties in emotion regulation .
the measure gives a total score as well as scores on six subscales derived through factor analysis ; nonacceptance of emotional responses , difficulties engaging in the goal - directed behavior , impulse control difficulties , lack of emotional awareness , limited access to effective emotion regulation strategies , and lack of emotional clarity .
the subscales of the ders yield good to excellent internal consistencies ( = 0.760.89 ) and subscale intercorrelations range from negligible to high ( range : r = 0.04 to r = 0.68 ) and have adequate construct validity .
the questionnaire included information about age , gender , marital status , educational level and course , family composition , and living arrangements .
this self - report measure assesses the frequency , methods , characteristics , and functions of suicidal sib .
engagement in different methods of sib in the past 12-month period is assessed through 11 items .
additional items assess whether the behaviors were suicidal or nonsuicidal in nature , the concurrent use of alcohol or drugs , the degree of impulsivity and pain experienced , the age of onset of sib , and possible reasons for engaging in sibs .
the paper focuses on the frequency , methods , and selected characteristics of sib reported in the past year .
more detailed results on the characteristics of self - injury in this sample are available in a previous publication .
this 40-item self - report measure assesses five dimensions that reflect two underlying attachment dimensions , anxiety and avoidance , and is answered on a 6-point likert scale .
one subscale represents secure attachment ( confidence in self and others ) while the other four represent a particular aspect of insecure attachment ; discomfort with closeness , relationships as secondary ; need for approval and preoccupation with relationships .
discomfort with closeness describes a pattern of protecting from the feeling of vulnerability by being distant and not attaching to others ; relationships as secondary refer to a pattern where individuals protect themselves against hurt and vulnerability by emphasizing achievement and independence ; need for approval reflects individuals ' need for others ' acceptance and confirmation ; preoccupation with relationships involves an anxious reaching out to others to fulfill dependency needs .
two primary dimensions underlying attachment styles have been derived from the attachment style questionnaire items .
attachment anxiety ( 13 items ) refers to an individual 's excessive need for reassurance , fear of rejection , and a desire to merge with relationship partners .
attachment avoidance ( 16 items ) reflects the extent to which an individual avoids intimacy and is distrusting of others .
individuals with high levels of avoidance and/or anxiety possess insecure attachment while individuals with low avoidance and anxiety are securely attached .
the questionnaire has adequate internal consistency ( = 0.80 ) and test - retest reliability over a 10-week period ranged from 67 to 78 .
the ders is a 36-item self - report questionnaire , answered on a 5-point likert scale that assesses difficulties in emotion regulation .
the measure gives a total score as well as scores on six subscales derived through factor analysis ; nonacceptance of emotional responses , difficulties engaging in the goal - directed behavior , impulse control difficulties , lack of emotional awareness , limited access to effective emotion regulation strategies , and lack of emotional clarity .
the subscales of the ders yield good to excellent internal consistencies ( = 0.760.89 ) and subscale intercorrelations range from negligible to high ( range : r = 0.04 to r = 0.68 ) and have adequate construct validity .
eight of the twelve colleges approached provided consent for participation and groups of students were selected based on practical considerations of space , scheduling , and availability .
a debriefing session was carried out with the participants where issues relating to stress , coping , and the importance of help - seeking and accessing social support were discussed .
a handout with the contact information of mental health services was provided to each participant .
descriptive statistics such as frequencies , percentages , means , and sds were computed to measure occurrence and characteristics of sibs .
the association between emotion regulation and attachment domains was assessed using the pearson product - moment correlation method .
the emotion regulation and attachment domains that were significant in the t - test were considered in the logistic regression analyses .
table 1 indicates that the rate of sib in the past year was 31.2% . while 19.8% of the sample reported engaging in moderate / severe forms of sib , 11.3% of the individuals engaged in minor sib only . among those who reported sibs , the most common pattern was a combination of moderate / severe and minor forms of sib ( 15.3% ) , with only 4.5% engaging in moderate / severe methods alone .
the most common method endorsed by the participants was self - hitting ( 15.2% ) , a minor
method of sib followed by cutting ( 13.2% ) , a moderate / severe method of sib .
the mean number of types of sib performed was 2.6 ( sd = 18 , median = 2.0 , mode = 1 , range : 110 ) .
the mean age of the first sib behavior was 15.9 years ( sd = 3.0 ; median = 16.0 ; mode = 16.0 ; range : 725 years ) .
a majority of self - injury acts were not accompanied by suicidal intent ( 84.8% ) .
frequency , characteristics , and methods of self - injurious behavior ( past year ) among college students ( n=470 ) the results [ table 2 ] indicated significantly higher levels of anxious attachment ( p = 0.00 ) among youth who reported self - injuring behavior in the past year .
self - injuring youth exhibited higher levels of preoccupation with relationships ( p = 0.00 ) and need for approval in relationships ( p = 0.01 ) .
comparison of attachment patterns ( attachment style questionnaire ) and emotion regulation ( difficulties in emotion regulation scale ) between college students with and without self - injurious behavior ( n=470 ) there were no significant differences between the two groups in levels of secure attachment ( confidence in relationships ) and in the avoidant attachment domain , or in terms of viewing relationships as secondary and experiencing discomfort in relationships .
the results also indicated that the levels of emotion regulation differed significantly between the group of self - injurers and those who did not report sib .
the self - injuring group had significantly greater difficulties in terms of nonacceptance of emotions ( p = 0.01 ) , goal - directed behavior ( p = 0.01 ) , impulse control ( p = 0.01 ) , lower levels of emotional clarity ( p = 0.03 ) , and limited access to emotion regulation strategies ( p = 0.01 ) .
the self - injuring youth had significantly lower scores on the lack of emotional awareness subscale ( p = 0.01 ) as compared to those who did not report sib .
this indicates a greater sensitivity and awareness of their emotional states among youths who reported self - injury in the past year .
an additional analysis compared levels of attachment and emotion regulation in two groups ; the first with reporting moderate / severe self - injury and the second with minor self - injury only .
there were no significant differences in the levels of attachment among those who engaged in moderate / severe forms of self - injury ( e.g. , cutting , burning , self - tattooing ) and those who reported the relatively minor methods ( e.g. , self - hitting , biting , wound - picking ) alone .
there were no significant differences between the two self - injuring groups with respect to overall levels of emotion - regulation , except in the domain of impulse control .
the group reporting moderate / severe forms of self had significantly lower levels of impulse control than the self - injuring group using minor methods ( t = 2.08 ; p = 0.04 ) .
logistic regression analysis was carried out to identify probable risk factors that could predict sibs [ table 3 ] .
the seven independent variables selected were the emotion regulation and attachment domains whose levels differed significantly between groups of self - injuring and noninjuring groups .
these included nonacceptance of emotions , goal - directed behavior , impulse control , lower levels of emotional clarity , limited access to emotion regulation strategies , need for approval , and preoccupation with relationships .
logistic regression analysis of variables predicting self - injurious behaviors the model explained 11.2% ( nagelkerke r ) of the variance in sib and correctly classified 70% of the individuals .
the results indicated that higher levels of impulse control difficulties and a preoccupied attachment pattern of strongly desiring close relationships while fearing abandonment , both increased the likelihood of sib .
the results of the study revealed that the rate of sib in the past year among a community sample of indian college students was 31.2% .
this indicates that sibs are not uncommon among college youth and this rate falls toward the higher end of global estimates , ranging between 11.7% and 46.5% , in previous empirical research .
the relatively high rates found in this study could reflect the use of a multi - item questionnaire and the inclusion of relatively minor forms of self - injury .
recent research has moved away from examining the relationship between overall attachment and sib and has begun to focus on the possible differential role of subtypes of insecure attachment .
there is preliminary evidence that anxious attachment is associated more strongly with sibs while avoidant attachment has a more limited impact .
the present study also found that levels of avoidant attachment did not differ between the groups of self - injuring and nonself - injuring youth .
individuals who endorsed sibs also reported higher levels of reaching out to others to fulfill their dependency needs and tended to seek others ' approval for fear of rejection .
the finding is consistent with studies using self - report questionnaires that found anxious attachment styles to be linked with a greater incidence of sibs in community populations , in psychiatric inpatients and among individuals with borderline personality disorder .
individuals with anxious attachments are described as more attentive to and expressive of their distress and , therefore , tend to be more emotionally reactive .
sibs could be employed as a way of expressing and reacting to their overwhelming feelings of distress .
logistic regression analysis identified higher levels of preoccupied attachment and impulse control difficulties as predictive of sib among youths .
the preoccupied attachment has also been associated with borderline personality disorder , a diagnostic category described as vulnerable to acts of self - harm .
preoccupied attachment is conceptualized to be associated with hyperactivation of the attachment system in the face of perceived threat or emotional distress and hypervigilance to the possibility of rejection or abandonment .
this is accompanied by maladaptive appraisals , coping , and problem - solving and can intensify negative emotional experiences .
self - injury could be used as a method of coping with the negative emotions .
the findings also offer indirect support for theoretical models which trace developmental pathways from insecure attachment in childhood and view self - injurious acts as compensatory relational and emotion regulation strategies .
the findings of the study support literature , suggesting that individuals who self - injured have difficulties regulating their emotions .
further , individuals who self - injured may not be as effective in their use of emotion regulation skills and may turn to maladaptive methods , such as self - injury , when their adaptive methods are overwhelmed .
the present findings amplify our understanding of these processes as self - injuring youth indicated significantly higher levels of nonacceptance of emotions , difficulty in goal - directed behavior , impulse control difficulties , lack of emotional awareness , limited access to emotion regulation strategies , and lack of emotional clarity .
impulsivity has theoretically been proposed as an important construct in sibs and the present findings illuminate the particular role of impulsivity in increasing the risk for self - injuring acts .
in addition , self - injuring youth , using methods such as cutting or burning , reported higher impulsivity than those using less severe methods such as self - hitting or wound - picking .
previous research has found higher impulsivity among self - injurers when using self - reports but not consistently on behavioral tasks .
one possible explanation proposed for this discrepancy could be that self - injuring individuals tend to exhibit impulsivity only in the context of negative emotions .
they highlight the importance of the relational context and attachment vulnerabilities as well as the need to target specific difficulties in regulating emotions .
interventions that teach adaptive strategies for emotion regulation have been effective for self - injuring women with borderline personality disorder and these can be drawn from components of dialectical behavior therapy .
the results suggest that interventions targeting sib may need to widen the individual focus and assess the relational domain .
the potential healing and safety - affirming role of the therapeutic relationship and the importance of a relational perspective in working with self - injuring youth need more attention .
in addition , therapeutic strategies should be responsive to any attachment vulnerabilities that may be present .
the use of a multidimensional conceptualization of emotion regulation represents the strength of the study .
the sample composition of urban , largely female college - going youth arises from the use of a purposive sampling method and this restricts the generalizability of the results .
there are methodological limitations arising from the use of a self - report measure of attachment ; all attachment representations may not be consciously reportable .
the use of an interview - based measure like the adult attachment interview could help clarify the links between specific attachment representations and self - injuring acts .
future studies could explore the links between attachment and specific patterns of self - injury ( e.g. , severity , methods , age of onset , disclosure ) .
attachment style is seen as a distal risk factor for psychopathology and future research could include potential mediators of sibs .
this would allow for a clearer understanding of the complex pathways to self - injuring acts and better - informed preventive and therapeutic approaches .
| ### Summary:
: context : intentional self - directed acts of injury are the most common among adolescents and young adults .
developmental psychopathology theories that conceptualize pathways to self - injurious behaviors ( sibs ) implicate insecure attachment representations and inadequate self - regulatory skills to cope with emotional distress.aims:the study aimed to examine relationships between sibs , attachment , and emotion regulation among college students.materials and methods : a total of 470 participants from undergraduate and postgraduate colleges completed the functional assessment of self - mutilation questionnaire , attachment style questionnaire , and the difficulties in emotion regulation scale.results:results indicated that 31.2% of the participants reported sib in the past year , with the mean age of onset being 15.9 years .
moderate / severe forms of self - injury ( e.g. cutting , burning ) were reported by 19.8% of the sample .
self - injuring youth reported higher levels of anxious attachment , preoccupation with relationships and need for approval in relationships , and difficulties in all domains of emotion regulation .
logistic regression analysis identified preoccupation with relationships and impulse control difficulties as predictors of sib.conclusions:the findings have implications for comprehensive interventions for self - injuring youth . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: intracranial schwannomas , one of the most frequent primary brain tumors , commonly arise from the glial - schwann myelination junction of the sensory nerve , such as the vestibular and trigeminal cranial nerves ( cns ) .
although they usually develop within motor nerve fibers , especially in association with neurofibromatosis , sporadic involvement has also been described in the facial , hypoglossal , abducens and trochlear nerves3 ) . till date ,
only 20 cases of abducens nerve schwannomas have been reported , including the present case2,6,7 ) .
along with the typical radiological features of schwannomas , abducens palsy has been regarded as a preoperative diagnostic clue . however , in rare cases including this one5,7 ) , the absence of the abducens nerve sign raised difficulties in clinical presumption before surgery . according to the location of the tumor , abducens schwannomas can be classified into cisternal , cavernous , and cisternocavernous groups1 ) .
all the tumors that involved the cavernous sinus showed abducens palsy , preoperatively . although the absence of trochlear paresis , even in large trochlear schwannomas , can be explained by the long length of cavernous segment of trochlear nerve1 ) , little is known about similar phenomenon in abducens schwannoma .
based on the surgical experience of abducens schwannoma without the origin nerve deficit , the authors discuss a possible mechanism to explain this rare phenomenon according to the anatomical relation between the tumor and surrounding arachnoid structures .
a 76-year - old male patient , without significant medical illnesses , presented with right facial numbness and hearing impairment for a month .
the patient showed no neurological symptoms or signs except hypoestheia / hypoalgesia of the trigeminal nerve and mild hearing impairment on the right side .
magnetic resonance imaging revealed a multi - septated cystic mass on the right cerebellopontine angle ( fig .
the epidermoid cyst was excluded as a possible preoperative diagnosis based on diffusion - weighted image ( fig .
there was no enlargement of the internal auditory canal on computed tomography scans with bone window ( fig .
surgical resection was performed with the standard right lateral suboccipital approach . a thin - walled cystic mass displaced the lower cns inferolaterally , the vestibulo - facial cn complex laterally , and the trigeminal nerve superiorly . after being fenestrated through its cyst wall ,
the abducens nerve seemed normal in contour and diameter , although it compressed other surrounding cns .
the tumor and its origin cn were medially located anterior to the pontine membrane and coursed within the cerebellopontine cistern ( fig .
considering the fact that the abducens palsy , with / without neurological signs from other cn involvement or brain stem compression , leads to a preoperative diagnosis of abducens schwannoma , the absence of origin cn deficits can make it difficult to presume a tentative diagnosis and select the appropriate treatment strategy .
it is difficult to explain the inconsistency between tumor involvement of a cranial nerve and clinical non - manifestation . in nakamura
et al.'s5 ) case , the tumor was located in the prepontine area and demonstrated a large - size and solid nature .
they postulated that the possible mechanism for the absence of clinical manifestation may be due to neuronal tolerance induced by extremely slow growth of tumor .
another case , reported by vachata and sames7 ) , demonstrated that the small and cystic nature of the tumor could be associated with less compression against its origin cn and the absence of preoperative abducens paresis . in our present case ,
interesting peroperative findings were found to provide us some clues to understand the atypical clinical features .
first , the abducens nerve was maintained in normal contour and diameter despite being severely adhered by tumor .
the trigeminal nerve and vestibule - facial nerve complex , on the other hand , were displaced and appeared somewhat concaved against the tumor .
these features could be correlated with preoperative symptoms , facial numbness and minimal hearing impairment .
second , there was an arachnoid membrane covering the tumor and its origin , the abducens nerve .
this arachnoid membrane , demarcating brainstem from tumor and its origin nerve , was considered as the anterior pontine membrane .
the anterior pontine membrane is a bounding line between the prepontine cistern and cerebellopontine cistern .
generally , the trigeminal nerve and vestibule - facial nerve complex are contained in the cerebellopontine cistern , while the abducens cn in the prepontine cistern8 ) .
however , a recent detailed study for intracranial cistern revealed that the abducens nerve ascends just lateral to the anterior pontine membrane within the cerebellopontine cistern4 ) .
taken together with above mentioned facts , some possible mechanisms can be postulated to explain the absence of abducens nerve deficit . in this case , the tumor had originated from the abducens nerve in the cerebellopontine cistern . because the anterior pontine membrane was located medially to abducens nerve and played a possible role in anatomical barrier , the vector of tumor growth shifted to lateral aspect of the cerebellopontine cistern .
this growth pattern led to a more compression effect on the nerve structures in the cerebellopontine cistern , such as the trigeminal nerve and the vestibulo - facial nerve complex , than on its origin abducens nerve , and consequently to displaced and concaved changes in compressed cns , in contrary to the preserved abducens nerve .
although it is difficult to conclude the exact mechanisms for the lack of origin cn palsy in abducens schwannoma , the anatomical location of the abducens nerve may affect the direction of growth of the main tumor and the severity of compression of the surrounding cns .
if the abducens nerve is located in the cerebellopontine cistern , the anterior pontine membrane , just medial to abducens nerve , may cause the shift in the tumor growth vector to the lateral aspect and result in compression of the surrounding cns , instead of affecting the origin , abducens nerve . | ### Summary:
: the abducens nerve paresis generally can aid in the presumptive diagnosis of abducens schwannoma along with the typical radiological features of schwannomas .
the authors present a case of a 76-year - old male patient with a abducens schwannoma without abducens nerve paresis .
peroperatively , abducens nerve located in the cerebellopontine cistern had normal in contour and diameter , despite the mass originated from this nerve .
we hypothesize that anatomic location of abducens nerve may affect the vector of tumor growth to prevent destruction of its origin , the abducens nerve . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: congenital adrenal hyperplasia ( cah ) is caused by defects in one of the steroidogenic enzymes involved in the adrenal steroid biosynthesis from cholesterol to cortisol .
the most common cause of cah is 21-hydroxylase deficiency ( 21ohd ) where patients with the classic form present with or without salt loss ( salt wasting or simple virilizing forms , resp . ) during the neonatal period and affected females are born with virilized external genitalia . in the nonclassic form ,
signs of androgen excess such as acne , hirsutism , and menstrual irregularities can be observed as late as during adolescence and adulthood .
the worldwide incidence of classic 21ohd is 1 : 10.000 to 1 : 15.000 live births , while nonclassic 21ohd is much more prevalent occurring in 1 : 500 live births in caucasian populations [ 25 ] .
the cyp21a2 gene coding for the 21-hydroxylase enzyme is formed by 10 exons and 9 introns located on the short arm of chromosome 6 [ 6 , 7 ] .
cyp21a2 is arranged in tandem with a nonfunctional pseudogene ( cyp21a1p ) that shares 98% sequence identity with the active gene [ 8 , 9 ] .
there are common pseudogene - derived mutations identified in cyp21a2 that are found in more than 95% of all cah alleles . in general
, the less severe mutation present in the genotype determines the phenotype , establishing a good genotype - phenotype correlation .
furthermore , in vitro studies indicate that mutated cyp21a2 residual enzyme activities present a good correlation with in vivo disease severity [ 1113 ] .
therefore , in vitro analysis for novel or rare mutations is proposed as a complement for disease classification , especially where large groups of patients are not available for clinical investigation , thereby improving genetic counselling and clinical management [ 1417 ] . in this report
, we describe a detailed evaluation of the functional role of seven novel ( p.leu12met , p.arg16cys , p.ser101asn , p.ser202gly , p.pro267leu , p.gln389_ala391del , and p.thr450met ) and two previously reported but not functionally studied ( p.ser113phe and p.thr450pro ) cyp21a2 mutations [ 18 , 19 ] .
the aim of the study was to investigate the pathogenicity of novel / rare mutations using in vitro assays and to establish a correlation between their in vitro effect and a possible cah phenotype . in order to reach a reliable phenotype prediction
, we also expressed four mutations ( p.ile172asn , p.val281leu , p.pro453ser , and p.pro482ser ) known to cause cah of different severity , as well as a cyp21a2 normal variant ( p.ala15thr ) .
furthermore , we complemented the functional analyses with in silico predictions of mutation pathogenicity and the effects on protein structure using the model of the recently crystallized human cyp21a2 structure .
cyp21a2 genotyping was performed at universidade estadual de campinas , brazil , and at karolinska university hospital , sweden .
the study was approved by the ethics committee of universidade estadual de campinas and the regional ethics committee of karolinska institutet .
the cyp21a2 gene was specifically amplified in two or four fragments , depending on the presence or absence of the variant c at the intron 2 c.290 - 13a / c > g position .
sequencing of the amplified products has been performed using the bigdye terminator v3.1 cycle sequencing kit ( applied biosystems , usa ) according to the manufacturer 's instructions .
fragments were separated on a genetic analyzer from applied biosystems ( abi prism 3100 genetic analyzer / life technologies , usa ) .
segregation analysis was performed in all subjects by sequencing parental samples , except for subject 3 .
subject number 1 , a girl , presented with premature pubarche and accelerated growth velocity at the age of 4 years .
due to advanced bone age ( 8.7 y at 6.4 y chronological age ) she was subjected to 250 g synacthen stimulation test that exhibited an elevation in the 17ohp basal level from 13 nm to > 154 nm at 60 min .
the child was diagnosed with nc cah and cyp21a2 genotyping revealed a complex genotype with a novel mutation p.leu12met together with p.gln318 on the maternal allele and the nc mutation p.val281leu on the paternal allele .
subject number 2 came to medical attention when her daughter was diagnosed with cah and the family was genotyped for 21ohd .
she did not complain of any symptoms of androgen excess and stimulation with synacthen raised the 17ohp basal level just above the cut - off at 60 min ( 6 to 31 nm ) .
therefore , very mild nc cah was suspected but was not clinically confirmed in this case .
subject number 3 , a female , presented with menstrual irregularities , hirsutism and a clinical suspicion of nc cah at the age of 26 years .
although segregation analyses or biochemical investigational data were not available , we assumed that the genotype could be responsible for her clinical presentation and nc cah .
subject number 4 , a girl , was born appropriate for gestational age at gestational week ( gw ) 36 and detected via the neonatal screening program .
the 17ohp screening level ( 106 nm ) was slightly above the cut - off level ( 100 nm ) .
the second tier remained elevated ( 66 nm , cut - off 60 nm , gw37 + 2 ) . at birth
she had no signs of virilization or salt loss . at 6 months of age ,
a 250 g synacthen stimulation test was normal . due to her borderline hormonal screening values
heterozygosity for the p.ser202gly variant was also identified in subjects number 5 and number 6 at the ages of 1 month and 9 years , respectively .
both children were initially seen at a primary reference center and investigated for suspected signs of androgen excess .
however , the analyses of 17ohp , genotyping , and clinical examination could not confirm the diagnosis of cah .
subject number 7 , a girl , was virilized at birth ( prader iv ) and presented with a salt - losing crisis at day 7 .
sw cah was confirmed due to elevated levels of 17ohp and subsequent genotyping identified that she was compound heterozygous for the novel in - frame deletion p.gln389_ala319del inherited from her father and a 30-kb deletion inherited from her mother .
the girl was born virilized ( prader v ) and presented with an adrenal crisis at day 33 .
subjects numbers 9 , 10 , and 11 presented with different signs of androgen excess and clinical suspicion of cah ; for summary see table 1 . however , 17ohp levels remained within the normal range even after synacthen stimulation .
genotyping revealed that these subjects were heterozygous carriers for three novel mutations , p.arg16cys , p.pro267leu , and p.thr450met , respectively .
since the functional consequences for these novel amino acid substitutions were unknown , they were included in the present investigation .
the general description for the construction of vectors used in the cos-1 expression studies of mutated cyp21a2 has been previously described [ 11 , 22 ] .
expression of wild - type and mutant cyp21a2 enzymes and assays of 21oh activity were performed as previously described [ 23 , 24 ] .
enzyme activities were expressed as a percentage of conversion , taking the apparent specific activity of the cyp21a2 wild type as 100% .
intact cells were incubated as previously described together with 0.5 , 1.0 , 2.0 , 3.0 , or 6.0 m of unlabeled 17-hydroxyprogesterone ( sigma - aldrich , saint louis , usa ) as substrate .
after incubation at 37c for 20 min , steroids were extracted and analyzed as previously described .
apparent kinetic constants were calculated after linear regression of the data derived from determinations of enzymatic activity at each of the five different substrate concentrations . to ascertain similar amount of cyp21a2 expression in transfected cells , western
blotting was performed using rabbit polyclonal antibodies against human cyp21a2 as primary antibody ( sigma - aldrich , saint louis , usa ) and anti - rabbit igg ( ge healthcare life sciences , freiburg , germany ) as the secondary antibody ; see robins et al . for details .
the resolved three - dimensional structure of human cyp21 , pdb i d : 4y8w , was used as a starting point to evaluate the effect of the novel mutations on the protein structure .
the icm molecular modelling software ( version 3.8 - 1 , molsoft llc , la jolla , ca ) was used to perform structural calculations of the structures of each mutation , expanding on the strategy previously described .
first , all missing intrastructural loops were added to the 4y8w structure and the structure was optimized using energy minimization . a model of each mutation
was then generated by modifying the corresponding amino acid residue , followed by multiple steps of energy minimization .
the energy minimization was initially performed with strong backbone restraints , which were gradually relaxed and finally a global minimization without backbone restraints was performed .
each mutation was then evaluated based on energy and distances to the steroid and heme , as well as using the icm built - in function for evaluating stability changes from mutations by calculating the free energy changes .
the blast web interface was used to identify mammalian proteins similar to the human cyp21a2 enzyme .
the search was performed on the nov 2015 release of the refseq database and resulted in cyp21 protein sequences from 81 mammals .
the sequences with the highest similarity to the human cyp21a2 protein , one sequence per species , were retrieved from the database .
the retrieved sequences were aligned using the linsi approach of mafft , and for each position the sequence identity was calculated , counting a gap as a mismatch .
we have determined the residual activities of seven novel cyp21a2 mutations ( p.leu12met , p.arg16cys , p.ser101asn , p.ser202gly , p.pro267leu , p.gln389_ala391del , and p.thr450met ) and of two previously reported but not functionally studied alterations ( p.ser113phe and p.thr450pro ) .
we compared the data to the residual activities of five well - known reference mutations ( p.ala15thr , p.ile172asn , p.val281leu , p.pro453ser , and p.pro482ser ) using in vitro functional assays .
the different residual enzyme activities ranged from normal to completely abolished enzyme function and the mutations could therefore be defined as being normal polymorphisms or being able to cause cah of various degrees of severity ; figure 1 and table 3 illustrate the results . in order to unravel the mechanism responsible for reduced enzyme function and to better differentiate between a very mild mutation and a neutral amino acid change we determined the apparent kinetic constants for all mutants that exhibited a residual enzyme activity above 80% compared to the wild - type protein ( table 2 ) .
km ( substrate - binding capacity ) for all variants was in the same order of magnitude as for the wild - type protein except for the p.thr450met mutation .
the maximum velocity ( vmax ) was decreased for all variants , except for p.leu12met and for the reference mutation p.arg15thr , and both are thus considered to be normal variants ( table 2 ) .
equal protein expressions of mutant and wild - type proteins have been confirmed by western blotting ( data not shown ) .
table 3 summarizes the biochemical results , the putative effects on the protein structure for all mutants , and the final prediction of the phenotype .
structural calculations for p.ser101asn , p.ser113phe , ser202gly , and p.pro267leu are also illustrated in figure 2 .
the p.pro267leu mutation has no effect on protein structure , whereas p.ser101asn , p.ser202gly , and p.thr450met are predicted to have a minor effect .
conversely , p.ser113phe produces a more severe effect on protein structure since it interferes with the alfa helices comprising the active site .
the p.thr450pro mutation and the p.gln389_ala391del in - frame deletion are predicted to have deleterious effects on the cyp21a2 structure .
nine novel / rare mutations , identified in individuals investigated and genotyped for cah , have been expressed in vitro and enzymatic activities were compared with the functional activity of the wild - type protein .
the reference mutations present a gradient of increasing residual activities that are associated with the cah phenotype variability .
the p.ile172asn mutation is a classic mutation in most cases leading to sv cah , with a very low residual enzyme activity towards both 17ohp and progesterone .
the mutations p.val281leu , p.pro453ser , and p.pro482ser are three nc cah mutations that present different degrees of residual activity , p.pro482ser being the mildest variant and p.val281leu being the most frequent mutation causing nc cah with a residual activity of approximately 50% . at last , p.ala15thr is considered to be a neutral amino acid change . expressing these well - characterized mutations at the same time as the novel mutations allowed a better intercomparison among mutants and provided a genotype - phenotype prediction .
two of the analyzed mutations , p.leu12met and p.arg16cys , are located in the first hydrophobic domain of the protein .
this region comprises the membrane targeting , anchoring domain and is important for in vitro stability .
it is unsuitable for computational protein structure analysis and is missing from the published crystal structures [ 20 , 32 ] .
arg16 is also well conserved ( 69% ) and the corresponding amino acid residue in bovine is histidine , indicating conservation of a positively charged , polar residue .
the mutation p.leu12met was identified in cis with the p.gln318 mutation and consequently this is a null allele , whereas the p.arg16cys was identified in a heterozygous carrier .
therefore it was impossible to evaluate their pathogenicity based on the phenotype of the subjects ( table 1 ) . in vitro functional studies showed that the mutant p.leu12met did not demonstrate a significant difference in enzymatic activity or in kinetic constants when compared with the wild - type and p.ala15thr proteins .
the p.arg16cys mutant demonstrated a very mild reduction in enzyme activity , similar to p.pro482ser ( table 3 ) in addition to a clear reduction in apparent vmax ( table 2 ) .
although we did not identify a compound heterozygous patient to confirm our hypothesis , this mutation may be associated with a very mild nc cah phenotype .
the p.ser101asn mutation was identified in an asymptomatic mother of a brazilian cah patient ( table 1 ) .
ser101 is conserved among mammalian species ( 74% ) and is located between two residues that are part of the channel for product passage .
however , the structural calculations implied only a minor effect on protein structure caused by the mutation .
in fact , in vitro studies confirmed a very mild effect with a reduction of activity to 94% and 74% towards 17ohp and progesterone , respectively .
however , we could not confirm our hypothesis because the individual did not present any obvious symptoms and a neutral amino acid change could not completely be ruled out .
the mutation p.ser113phe may disturb an adjacent -helix based on the structural calculations for the model of human cyp21a2 .
it is located in the vicinity of ser109 , leu110 , and trp117 , which form part of the proximal substrate - binding pocket and the heme - binding region .
therefore this amino acid substitution may interfere with the recognition and binding of the substrate and , consequently , affect enzyme activity .
the in silico predictions were in line with the in vitro studies where a minimal activity of 4% towards both substrates was obtained ( table 3 ) .
consequently , p.ser113phe can be associated with sv cah if found in a homo- or hemizygous state .
although p.ser113phe had been previously reported by haider et al . as a nc mutation , no patient description or in vitro studies
the two brazilian carriers were genotyped because cah was suspected but no other mutations were identified . in the swedish subject , however , it was identified in compound heterozygosis with the null mutation p.gln318 .
this girl has been followed during her first year of life and so far no signs of virilization have been detected , but a nc cah phenotype can not be ruled out at this young age .
functional studies showed a reduction in enzyme activity to the level of the nc mutation p.pro482ser and a reduced vmax ( tables 2 and 3 ) .
the structural calculations implied that this mutation causes a minor effect on protein structure since both serine and glycine are small amino acid residues and ser202 is located in a loop close to the surface of the protein .
the p.pro267leu mutation was identified in a girl that was investigated for premature pubarche at 4 years of age .
pro267 is weakly conserved among mammalian species ( 51% ) and is located in a loop between two -helices .
functional studies showed a minor effect on enzyme activity similar if not milder than for p.pro482ser .
kinetic studies showed a reduction in vmax but to finally exclude p.pro267leu as a neutral variant additional and symptomatic cah cases with this mutation need to be identified ( table 2 ) .
the in - frame deletion of three amino acids ( p.gln389_ala391del ) is the result of the nucleotide deletion c.1165_1173delcaaggcgcc in exon 9 .
based on the phenotype of the patient who has sw cah ( table 1 ) a drastic effect on the enzyme activity could be predicted .
the patient is compound heterozygous for this mutation inherited from her father and a 30-kb deletion inherited from her mother .
the three deleted residues ( glu , gly , and ala ) are highly conserved among mammalian species ( 83% , 94% , and 94% , resp . ) . based on the structural analysis of human cyp21a2 , these amino acids are located inside an -helix just before a his that has been shown to interact with the exxr structural motif , important for the tertiary structure of the cyp21a2 enzyme .
the deletion by itself may be deleterious to the structure or function of the protein . in vitro studies
no reduction in protein level was seen by western blot analysis ( data not shown ) , although specific stability studies have not been performed .
finally , the novel mutation p.thr450met has been identified in a heterozygous carrier in the brazilian population .
previously , the p.thr450pro mutation was identified in an iranian girl with sw cah ( table 1 ) .
thr450 is highly conserved ( 89% ) among mammalian species and is located inside a short sheet , which is disturbed by the p.thr450pro mutation .
the sheet is not central to the protein , but the structural calculations imply that the mutation affects protein structure significantly .
the p.thr450met substitution , however , does not disturb the sheet to the same extent .
we expressed both mutant proteins in vitro and obtained results that confirmed the structural predictions ( table 3 ) .
the p.thr450pro mutation had a drastic effect on enzyme function , similar to the classic reference mutation p.ile172asn , whereas the p.thr450met mutant gives a milder reduction in enzyme activity to the level of other nc mutations ( table 3 ) but with a more severe impact on apparent kinetic constants ( table 2 ) .
we studied the functional effects of nine novel / rare mutations in the cyp21a2 enzyme . we conclude that p.leu12met is a normal variant and the mutations p.ser113phe , p.gln389_ala391del , and p.thr450pro
the mutations p.arg16cys , p.ser101asn , p.ser202gly , p.pro267leu , and p.thr450met could be associated with milder forms of nonclassic cah , although the identification of additional symptomatic cases will further define the clinical spectrum for these variants .
the study showed a good correlation between genotype and phenotype for mutations identified in compound heterozygous individuals .
furthermore , the putative effects on protein structure based on in silico predictions using the recently crystallized human cyp21a2 structure confirmed the pathogenicity of the mutations and the results were in agreement with the functional studies . | ### Summary:
: we present the functional and structural effects of seven novel ( p.leu12met , p.arg16cys , p.ser101asn , p.ser202gly , p.pro267leu , p.gln389_ala391del , and p.thr450met ) and two previously reported but not studied ( p.ser113phe and p.thr450pro ) cyp21a2 mutations .
functional analyses were complemented with in silico prediction of mutation pathogenicity based on the recently crystallized human cyp21a2 structure .
mutated proteins were transiently expressed in cos-1 cells and enzyme activities towards 17-hydroxyprogesterone and progesterone were determined .
residual enzyme activities between 43% and 97% were obtained for p.arg16cys , p.ser101asn , p.ser202gly , p.pro267leu , and p.thr450met , similar to the activities of the well - known nonclassic mutations p.pro453ser and p.pro482ser , whereas the p.leu12met variant showed an activity of 100% .
conversely , the novel p.ser113phe , p.gln389_ala391del , and p.thr450pro mutations drastically reduced the enzyme function below 4% .
the km values for all novel variants were in the same order of magnitude as for the wild - type protein except for p.the450met .
the maximum velocity was decreased for all mutants except for p.leu12met .
we conclude that p.leu12met is a normal variant ; the mutations p.arg16cys , p.ser101asn , p.ser202gly , p.pro267leu , and p.thr450met could be associated with very mild nonclassic cah , and the mutations p.ser113phe , p.gln389_ala391del , and p.thr450pro are associated with classic cah .
the obtained residual activities indicated a good genotype - phenotype correlation . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: wound exudate is composed of fluid and cells including neutrophils and macrophages . in the inflammatory phase , wound exudate is part of the normal healing process1 ; however , excessive postoperative exudate can increase pain , swelling , seroma , and risk of infection2 . furthermore
intraoral vertical ramus osteotomy ( ivro ) and sagittal split ramus osteotomy ( ssro ) are representative methods of mandibular ramus osteotomy .
the prominent difference between ssro and ivro is the presence of inter - segmental fixation5 .
inter - segmental fixation is required after ssro , whereas bone segments are free from each other after ivro .
also , the extent of subperiosteal dissection and the design of osteotomy are different . given the above differences ,
the purpose of this study was to measure the amount of postoperative drainage after ivro and ssro by inserting a closed suction drainage system into the bilateral mandibular osteotomy sites .
this study followed the declaration of helsinki on medical protocol and ethics , and the regional ethical review board of yonsei dental hospital institutional review board approved the study ( irb no .
this retrospective cohort study includes subjects who underwent ivro or ssro orthognathic surgery for correction of dentofacial deformities by two expert surgeons at the department of oral and maxillofacial surgery , yonsei dental hospital between 2007 and 2013 .
the exclusion criteria were existing medical , physical , and mental conditions that would increase bleeding tendency ; correction of mandibular deformity by another technique ; abnormal preoperative prothrombin time , partial thromboplastin time , bleeding time , or platelet count ; and other hematologic abnormalities that could affect the result .
the 20 patients treated with ivro were placed in group i , and the 20 patients treated with ssro were placed in group ii .
one patient in group i and three patients in group ii underwent only mandibular operations .
mean age and standard deviation ( sd ) of the 40 patients were 23.95 years and 4.78 years .
mean age ( sd ) was 22.1 ( 2.94 ) years in group i and 25.8 ( 5.57 ) years in group ii .
two expert surgeons performed all operations , and there was no difference in osteotomy design of ivro and splitting technique and osteosynthesis in ssro .
a closed suction drainage system was inserted at the operation site of the mandibular ramus following mandibular osteotomy and repositioning .
data was collected and analyzed with independent t - test using the pasw statistics 18.0 software ( ibm co. , armonk , ny , usa ) .
results were described as the amount of postoperative drainage from a drain bulb per person every 8 hours postoperatively.(table 2 , fig .
1 ) immediately after the operation , the mean ( sd ) amount of drainage was 31.20 ( 12.31 ) ml and 30.25 ( 20.72 ) ml in group i and group ii , respectively ; however , the difference was not statistically significant ( p=0.861 ) . at 8 hours
postoperatively , the mean ( sd ) amount of drainage was 19.90 ( 10.94 ) ml and 25.75 ( 18.08 ) ml in group i and group ii , respectively ; however , the difference was not statistically significant ( p=0.225 ) . at 16 hours
postoperatively , the mean ( sd ) amount of drainage was 13.90 ( 6.37 ) ml and 19.70 ( 9.38 ) ml in group i and group ii , respectively , and the difference was statistically significant ( p=0.029 ) . at 24 hours
postoperatively , the mean ( sd ) amount of drainage was 9.47 ( 5.2 ) ml and 8.50 ( 8.29 ) ml in group i and group ii , respectively ; however , the difference was not statistically significant ( p=0.658 ) . at 32 hours
postoperatively , the mean ( sd ) amount of drainage was 4.95 ( 4.57 ) ml and 5.91 ( 6.67 ) ml in group i and group ii , respectively ; however , the difference was not statistically significant ( p=0.601 ) .
the total amount ( sd ) of drainage from the closed suction drainage system was 79.42 ( 23.86 ) ml and 90.11 ( 42.85 ) ml in group i and group ii , respectively .
there was no statistically significant difference between the two groups ( p=0.338).(table 3 ) postoperatively , volume usually decreased every 8 hours in both groups . at 32 hours
the first phase is the inflammatory phase , which includes formation of hematoma , extravasation , release of cytokines , and aggregation of immune cells
the second phase of fractured bone healing is formation of a soft callus characterized by cartilage around a fractured bone to connect a bony gap .
then the soft callus becomes a hard callus in the third phase , and the final phase of bone healing is the remodeling phase . in the remodeling phase
these same four phases of bone healing begin with exudate and swelling in the inflammatory phase .
we inserted a closed suction drainage system into bilateral mandibular osteotomy sites to decrease postoperative swelling , seroma , and incidence of infection .
clifton et al.7 reported a systematic review with a closed suction drainage system after operation for hip fracture and demonstrated that there was no significant difference in the occurrence of complications between a drained wound and an undrained wound .
though there is some debate about its necessity , closed suction drainage is considered a useful device for decreasing postoperative complications in various fields .
he et al.8 performed a systematic review of randomized controlled trials studying insertion of a drain after axillary lymph node dissection for breast cancer . in comparison with undrained wounds ,
therefore , we inserted closed suction drainage systems into osteotomy sites , expecting a decrease in postoperative complications .
ueki et al.9 showed that the amount of intraoperative bleeding was lower after ivro than after ssro .
the study demonstrated that blood loss was 216.6 ml after ssro and 125.5 ml after ivro .
yet , there is no comparative study examining the amount of postoperative drainage from osteotomy areas after ivro and ssro .
therefore , we measured the amount of postoperative drainage after each type of operation by inserting a closed suction drainage system into mandibular osteotomy sites after orthognathic surgery .
some clinicians assume that the amount of intraoperative bleeding and postoperative exudate from osteotomy areas is larger after ivro than after ssro because bone segments after ivro are not fixed by screws .
we hypothesized that the amount of postoperative drainage might be larger after ssro than ivro because sagittal split osteotomy on ramus causes more extensive medullary exposure than vertical osteotomy on ramus .
these data allowed comparison of drainage output from the bulb of a closed suction drainage system between group i and group ii .
our findings may help determine which method can reduce postoperative swelling , seroma formation , and risk of infection .
although patients in group i showed less postoperative drainage than group ii , these data did not show any statistically significant difference between the groups ( p=0.338 ) .
thus , surgeons do not need to consider postoperative drainage when determining which method is preferred for mandibular surgery .
these data further suggest that the closed suction drains may be removed 32 hours after orthognathic surgery , because the amount of postoperative drainage during the last 8 hours was below 10 ml in both groups . at that time , the risk of swelling , hematoma formation , and probability of infection would decrease .
first , the two surgeons usually performed ssro only for mandibular advancement , whereas they did ivro for mandibular setback .
mandibular segments had less exposed bone marrow after mandibular setback . consequently , the differing surgical plan for each method may have affected our results .
the above variables may influence the amount of postoperative drainage from a closed suction drainage system .
there may also be some difference in the ability of our two surgeons , though they performed the same osteotomy technique for ivro and ssro .
ivro and ssro have different osteotomy design and different exposure of medullary bone ; therefore , one might think that the amount of postoperative drainage from a closed suction drainage system is different from each method .
our results revealed that there was no statistically significant difference in postoperative drainage of blood and exudate from bilateral mandibular osteotomy areas after ivro and ssro . | ### Summary:
: objectivesthe purpose of this retrospective study was to compare the amount of postoperative drainage via closed suction drainage system after intraoral vertical ramus osteotomy ( ivro ) and sagittal split ramus osteotomy ( ssro).materials and methodswe planned a retrospective cohort study of 40 patients selected from a larger group who underwent orthognathic surgery from 2007 to 2013 .
mean age ( range ) was 23.95 ( 16 to 35 ) years .
patients who underwent bilateral ivro or ssro were categorized into group i or group ii , respectively , and each group consisted of 20 patients . closed suction drainage system was inserted in mandibular osteotomy sites to decrease swelling and dead space , and records of drainage amount were collected .
the data were compared and analyzed with independent t-test.resultsthe closed suction drainage system was removed at 32 hours postoperatively , and the amount of drainage was recorded every 8 hours . in group
i , the mean amount of drainage was 79.42 ml in total , with 31.20 ml , 19.90 ml , 13.90 ml , 9.47 ml , and 4.95 ml measured at 0 , 8 , 16 , 24 , and 32 hours postoperatively , respectively . in group
ii , the mean total amount of drainage was 90.11 ml , with 30.25 ml , 25.75 ml , 19.70 ml , 8.50 ml , and 5.91 ml measured at 0 , 8 , 16 , 24 , and 32 hours postoperatively , respectively .
total amount of drainage from group i was less than group ii , but there was no statistically significant difference between the two groups ( p=0.338 ) .
there was a significant difference in drainage between group i and group ii only at 16 hours postoperatively ( p=0.029).conclusionivro and ssro have different osteotomy design and different extent of medullary exposure ; however , our results reveal that there is no remarkable difference in postoperative drainage of blood and exudate . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: the reports of recent years indicate an increased risk of atopic diseases in children after solid organ transplantation .
food allergy constitutes a significant clinical problem , occurring in 6.6 - 57% of children , usually after liver transplants , sporadically after small intestine transplants , and exceptionally after renal transplants [ 14 ] .
less common clinical manifestations of atopy after solid organ transplantation include bronchial asthma and atopic dermatitis ( ad ) [ 57 ] .
the pathogenesis of post - transplant allergy is not fully understood ; most likely , it encompasses several factors , including the immunosuppressive treatment employed in order to prevent transplant rejection .
the largest number of controversies regard calcineurin inhibitors ( cni ) , especially tacrolimus ( tac ) , whose use is associated with an adverse impact on the immune and alimentary systems [ 8 , 9 ] .
tacrolimus is known to increase intestinal permeability , thus facilitating the absorption of potential allergens and promoting the development of hypersensitivity and the clinical manifestation of allergy .
immunological dysregulation and deviation of the immune response to th2 under the influence of calcineurin inhibitors results from the inhibition of the transcription of genes controlling the synthesis of cytokines , primarily il-2 .
this has been confirmed by study results demonstrating that the immunosuppressive effect of tac on the population of th2 lymphocytes is clearly weaker than its effect on th1 lymphocytes .
therefore , it has been suggested that the relative predominance of th2 cytokines ( il-4 and il-5 ) , typical of allergic disorders , is responsible for the high concentrations of ige and eosinophilia diagnosed during tac therapy .
cni also exert a negative influence on regulatory t cells ( cd4+cd25+foxp3 ) , which may be associated with insufficient control of allergen - specific th2 lymphocytes and may ultimately contribute to allergy manifestation during the use of these agents .
the passive transfer of allergy from donors , observed in adult transplant recipients , is rarely described in children . in this case , the allergy is transient and associated with the transfer of allergen - specific ige ( sige ) and/or th2 lymphocytes from allergic donors . at present ,
polish literature lacks reports concerning de novo allergy manifestations in children after the transplantation of solid organs .
this report presents the case of a boy who presented with symptoms of food allergy associated with ad and treatment - resistant lesions in the orofacial area after an orthotopic heart transplant procedure .
the boy described in this paper is the youngest patient in poland who has undergone successful heart transplantation .
the currently 3-year - old boy ( g1 , t1 , natural birth in the 39 week of gestation , birth weight 3300 g ; pregnancy history included a urinary tract infection in the mother ; family medical history was negative for atopic diseases ) was first hospitalized during the 2 month of life at the department of general pediatrics of the s. szyszko independent public clinical hospital no . 1 in zabrze administered by the medical university of silesia in katowice due to periodic cyanosis and the appearance of a murmur above the heart .
at admission , cradle cap and intertriginous lesions were found under the patient 's axillae and in the diaper area .
the location of the skin lesions , low concentration of total ige ( cige ) = 2.31 iu / ml ( age norm : 1.5 - 3.6 iu / ml ) , no specific ige ( sige ) ( norm
< 0.35 ku / l ) , and quick recession of lesions after topical treatment ( sudocrem ) unequivocally excluded atopic origin of the lesions .
chest x - ray visualized a widened mediastinal shadow at the level of the heart with accentuated cardiac waistline , while echocardiography revealed an enlargement of the left ventricle , impaired contractility , and a patent foramen ovale with trivial left - to - right shunt .
dilated cardiomyopathy in the course of noncompaction of the left ventricular endocardium was suspected ; in accordance with the cardiologist 's recommendations , captopril and spironolactone were included in the treatment . in the 3rd month of life , the patient was again admitted to the hospital due to an infection of the upper respiratory tract : physical examination did not reveal any skin lesions characteristic of atopic dermatitis ( ad ) .
the diagnosis of dilated cardiomyopathy in the course of left ventricular noncompaction was confirmed in the patient 's 4 month of life during a planned hospitalization at the department of pediatric cardiology of the silesian center for heart diseases ( sccs ) in zabrze .
based on the performed diagnostic examinations of the circulatory system ( chest x - ray , echocardiography , electrocardiography ) , the boy was qualified for an urgent heart transplant .
after two months on the waiting list , on september 15 , 2010 ( i.e. , in the 6 month of life ) , the patient underwent bicaval orthotopic heart transplantation at the sccs in zabrze .
the monitoring of the function of the transplanted heart was conducted on the basis of echocardiographic examinations .
protocol endomyocardial biopsies were not performed due to the patient 's low body mass and the increased risk of complications associated with cardiac catheterization .
the employed immunosuppressive treatment included : calcineurin blockers , i.e. , tacrolimus ( initial dose : 2 2 mg , current : 2 1 mg ) , mycophenolate mofetil ( 2 250 mg ) , and prednisone ( initial dose : 1 10 mg , current : 1 1 mg ) .
after 1.5 years , mycophenolate mofetil was discontinued due to the appearance of side effects ( chronic diarrhea , hypochromic anemia ) . during the 19 month of his life , the boy was hospitalized due to periodic water stools , lack of body mass buildup , and chronic anemia , initially at the department of pediatric gastroenterology and hepatology of the aforementioned hospital in zabrze and then twice at the children 's memorial health institute of the clinic of gastroenterology , hepatology , and nutrition disorders in warsaw with the suspicion of post - transplant lymphoproliferative disorder .
additional examinations revealed reduced concentration of iron = 47 g / dl ( norm : 59 - 158 g / dl ) , increased concentration of ferritin = 584 ng / ml ( norm : 20 - 200 ng / ml ) , hypomagnesemia = 0.38 mmol / l ( norm : 0.7 - 0.9
mmol / l ) , hypocalcemia = 1.77 mmol / l ( norm : 2.1 - 2.55 mmol / l ) , hyponatremia = 118 mmol / l ( norm : 135 - 145 mmol / l ) , increased blood level of amylase = 584 u / l ( 25 - 100
u / l ) , positive antibodies against endomysium ( igg class in concentration of 1:40 and vestigial in concentration of 1:80 ) , and an initially doubtful ( igg = 9.7 u / ml ) but later confirmed as negative ( igg < 7 u / ml ) result for the presence of antibodies against tissue transglutaminase ( igg class ) .
the examinations also revealed a high concentration of total ige = 607 iu / ml ( age norm : 15 - 30 iu / ml ) and the presence of sige against several food allergens : chicken egg white sige = 12.2 ku / l ( class 3 ) , chicken egg yolk sige = 1.13 ku / l ( class 2 ) , soy sige = 1.1 ku / l ( class 2 ) , cow milk sige = 3.02 ku / l ( class 2 , norm < 0.35 ku / l ) .
virological tests for rotavirus ( rv ) and cytomegalovirus ( cmv ) infection were negative .
inflammation of the mucous membrane ( stage iii / iv ) and the duodenum ( stage ii ) was found in the acquired segments of the large intestine .
eosinophilic enteritis and graft - versus - host disease were excluded based on histopathological and immunohistochemical examinations .
the patient was hospitalized multiple times at the department of general pediatrics of independent public clinical hospital no . 1 in zabrze and the department of cardiology , congenital heart diseases , and electrotherapy of the sccs in zabrze due to intensified skin lesions suggesting severe ad .
erythema and exfoliation around the mouth first appeared in the 12 month of the boy 's life ( i.e. , 6 months after the transplant ) and were most likely associated with overusing the pacifier ( latex allergy ? ) .
three months later , these signs were joined by vesiculo - erosive lesions on the margin between the oral mucosa and the vermilion border
herpetic inflammation was diagnosed , and aciclovir was included in the therapy , resulting in improvement . moreover ,
exfoliative erythemas , itching papules , and vesicles were observed on the patient 's skin ; these were treated with antihistamine and anti - scabies agents , which resulted in only partial improvement of the boy 's clinical condition ( fig .
several months later , the boy presented with small papular eruptions in a circinate distribution as well as larger foci of exfoliative erythemas on the skin of the chest and upper extremities ; concurrently , a large inflammation appeared around the patient 's mouth , and the skin of his face reddened .
these changes were associated with the diagnosed active epstein - barr virus ( ebv ) infection , which occurred after the treatment with human immunoglobulin ( gammagard ) ; number of ebv copies = 1300 - 11500/1 g dna . as the lesions around the mouth persisted with varying intensity ( edema , rubor , epidermal exfoliation , deep cracks on the lips and mouth corners ) , samples for bacteriological testing
were acquired several times ; the successive examinations revealed the presence of staphylococcus aureus , streptococcus agalactiae , klebsiella pneumoniae , enterobacter cloacae , candida albicans , morganella morganii , candida dubliniensis , and pneumocystis jirovecii .
skin lesions on the patient 's extremities laboratory investigation revealed the following : crp = 0.025 mg / l 34.59 mg / l ( norm :
0 - 5 mg / l ) , hb = 9.3 - 12.6 g / dl ( age norm : 11.2 - 15.8 g / dl ) , lowered tibc = 37.6 mol / l ( norm : 55 - 75
mol / l ) , normal uibc = 29.3 mol / l ( norm : 22 - 61.7
mol / l ) , leukocytes = 11.15 - 32.6 thousand/l ( norm : 4 - 10 thousand/l ) , eosinophils = 0 - 15% ( norm : 1 - 5% ) absolute eosinophilia = 410/l ( norm : 80 - 400/l ) , iga = 3.51
g / l ) , ige = 429.6 iu / ml ( age norm : 15 - 23 ui / ml ) , cmv pp65 antigen absent .
swabs obtained from the skin lesions when the disease intensified revealed dermal staphylococcus , staphylococcus aureus , and saccharomycetes . due to the lowered concentrations of iron ( fe ) and zinc ( zn ) in blood serum , their supplementation was started ( 33 mg / day zn and 50 mg / day fe ) ; follow - up laboratory examinations demonstrated normal concentrations of these elements .
the therapy included an elimination diet ( eliminating cow milk protein , gluten and eggs , soy , nuts ) , sanitary regime , prohibition of silicone pacifiers , skin care with emollients , topical treatment with glucocorticoids with the exception of the facial area ( 0.5 - 1% hydrocortisone ) , as well as general and topical antibiotic treatment in the case of signs of bacterial and/or fungal superinfection . during the elimination diet and the topical treatment of skin lesions , the eczematous lesions on the face and extremities
were observed to subside with the exception of the area around the mouth ( perioral dermatitis ) ; for this reason , tacrolimus was replaced with ciclosporin ( csa ) .
no improvement was noted after 3 months of csa administration ; in view of the observed side effects ( hirsutism on the frontal region of the face and gingival hypertrophy ) , tacrolimus was again included in the therapy . at present , the boy is 3 years old .
persistent , treatment - resistant lesions in the orofacial area continue to pose a significant clinical problem .
the persisting ailments include inflammation of the vermilion border , erythema around the mouth , median lip fissures , gingival edema , and the appearance of longitudinal creases on the mucous membrane of the mouth vestibule .
multiple times each year , the disease intensifies , and purulent lesions develop in the aforementioned area , requiring hospitalization ( fig .
furthermore , the clinical signs during the spring and summer also include eyelid swelling ( fig .
additional examinations demonstrate increasing concentrations of cige = 2500 iu / ml and eosinophils : % of eosinophils = 7% , absolute eosinophilia = 746/l .
specific ige values for food allergens and airborne allergens are below 0.35 ku / l ( class 0 ) , except for sige for chicken egg yolk = 0.614 ku / l ( i.e. class 2 ) .
bacterial superinfection of the skin lesions in the orofacial area intensification of ad skin lesions with eyelid swelling and conjunctivitis
manifestations of de novo allergies after the transplantation of solid organs are best documented in the case of liver transplants .
a significant risk factor for allergy during the post - transplant period is the age of the donor and recipient < 1 year , which is associated with the immaturity of the immune system and the regulatory mechanisms as well as with the use of immunosuppressive treatment in the form of tacrolimus [ 8 , 13 , 14 ] .
allergies are less common after renal transplants ( 6% of children ) , which may be partially related to the different immunosuppression scheme employing csa as well as recipient age .
tac is known to be 10 - 100 times stronger than csa in inhibiting the synthesis of il-2 and enhancing the synthesis of il-5 , il-13 , and ige [ 2 , 3 ] . moreover , tac increases the permeability of the intestinal mucosa and damages the intestinal barrier serving as protection from excessive antigen uptake , which may predispose to allergy development .
it has been demonstrated that reducing the tac dose or replacing it with csa may contribute to alleviating the symptoms of allergy , reducing the concentrations of cige , sige , and eosinophils , and negativizing the spt results .
the currently available literature includes two reports confirming the manifestation of allergy after heart transplantation in children [ 3 , 6 ] .
it should be mentioned that , in the present case , no allergy was observed before the procedure ( low cige and no sige in the 2 month of life ) , and the family 's medical history did not feature atopic diseases , which are known to be an important risk factor for the development of allergy per se in the offspring .
the signs of ige - dependent food allergy ( diarrhea , no body mass increase ) and ad appeared in the present patient within the first year after the orthotopic heart transplant performed during the patient 's 6 month of life .
after the start of the elimination diet , the symptoms associated with the gastrointestinal tract subsided , the skin lesions were alleviated , and the number of sige for milk , chicken egg white , and soy was reduced , which may serve as indirect evidence that the patient acquired tolerance to the listed foods .
the literature data indicate that post - transplant food allergy is usually polyvalent ( milk , eggs , peanuts , soy , wheat , fish ) and manifests itself from several months to over a year after transplantation , which was also the case with our patient [ 4 , 10 , 14 , 16 ] .
notwithstanding , the manifestation of allergy may also occur after several years [ 15 , 17 ] .
food allergy most often appears in the form of urticaria ( hives ) and vasomotor edemas , anaphylaxis , or , less commonly , eosinophilic gastroenteritis [ 15 , 16 ] .
we can assume with fair probability that the signs of food allergy and ad presented by the patient are associated with the tac treatment and the immaturity of the immune system .
it is also known that viral diarrhea and ebv infection predispose to food allergy manifestation [ 10 , 14 ] .
b lymphocytes infected with ebv are stimulated to synthesize ige , il-4 , and il-5 , which may induce chronic eosinophilic inflammation and promote allergy development . in our patient ,
the replication of the epstein - barr virus in serum was confirmed by the pcr method ( a large number of ebv copies ) .
the treatment - resistant orofacial lesions in the form of erythema around the mouth , diffuse edema and fissures of the median lip , gingival edema , and longitudinal creases on the mucous membrane of the mouth vestibule continue to pose a significant clinical problem .
the frequent recurrence of staphylococcal infections and candidiasis observed around the patient 's mouth is a side effect of the employed immunosuppression and results from the weakened functioning of the immune system .
it is worth underscoring that high concentrations of cige have a negative impact on the process of eliminating bacteria from the skin and promote chronic pathogen colonization by inhibiting neutrophil adhesion , phagocytosis , and respiratory burst .
as mentioned in the case study , lymphoproliferative disorders were excluded in our patient ; the persistent hypergammaglobulinemia may serve as evidence for chronic inflammation .
similar orofacial lesions in small children after liver and renal transplants have been reported by other authors [ 14 , 15 , 20 ] .
suggest that treatment - resistant inflammatory lesions of the oral mucosa occurring after the transplantation of solid organs in neonates and small children should be considered as a separate nosological entity ( long - standing oral mucosal lesions ) .
these changes appear from 1 to 4 years after transplantation and may persist for years .
they are characterized by the presence of round nodules covering the dorsum of the tongue , which , ultimately , transform into fissures .
other typical signs include hypertrophy of the oral mucosa ( mucosal tags ) , hyperplastic foci with fissures forming the image of cobblestone mucosa , erythemas around the mouth and diffuse edemas , inflammation of the mouth corners , and median lip fissures .
exhibited vasomotor edemas , urticaria , and anaphylaxis immediately after the consumption of allergenic foods .
it can not be excluded that the swelling of the eyelids described in the present case may have been associated with accidental consumption of food allergens .
although the use of an elimination diet improves the symptoms of food allergy , it has no effect on orofacial lesions , as confirmed by observations . unfortunately , the substitution of tac with csa also failed to alleviate the abovementioned inflammatory lesions in our patient .
it is believed that the coexistence of allergy and chronic inflammation of the vermilion border and the oral mucosa may result from immunological dysregulation .
it has been suggested that autoantigens and the commensal bacterial flora of the oral cavity may contribute to the initiation of chronic inflammatory changes .
an association has been found between the incidence and intensity of gingival hypertrophy and the presence and density of colonies of saccharomycetes from the candida genus . to conclude , in small children after heart transplantation who exhibit high total concentrations of ige and eosinophils , diarrhea , and skin lesions , the allergic origin of the symptoms should be excluded .
an elimination diet , recommended for food allergy , has no impact on the chronic inflammatory lesions of the orofacial area observed after heart transplants . maintaining proper oral hygiene plays a significant role in preventing and alleviating inflammatory lesions of the periodontium and the oral cavity in transplant recipients .
| ### Summary:
: in recent years , we have been observing an increased proportion of atopic diseases in children after solid organ transplantation .
the pathogenesis of post - transplantation allergy is not completely understood and probably involves several factors , including immunosuppressive therapy . in this paper
we present a case of 3-year old boy , after orthotopic heart transplantation at 6 months of age , with symptoms of food allergy associated with atopic dermatitis and changes in the orofacial area .
the mentioned symptoms and elevated levels of total and specific ige occurred with a year of transplant . because of failure to achieve remission after typical allergy therapy we suspected that the reason of allergy in this case can be immunosuppressive therapy . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: examinations of torture victims , even years after torture , have found a high incidence of
mental and physical symptoms .
the physical symptoms are mainly associated with the
musculoskeletal system , but symptoms in vital organs are also common1 , 2 . however , the
occurrence of positive physical findings suggesting an organic cause for these symptoms are
reported to be low , and therefore torture victims symptoms are often classified as
psychosomatic3 , 4 . throughout the years , several chronic muscular pain syndromes have
been described . regional or diffuse pain in the musculoskeletal system
is often associated
with poor sleep , tiredness , paraesthesiae , headache , and irritable symptoms of the gut and
bladder5,6,7 .
the etiology and
pathogenesis of the chronic muscular pain syndromes are not fully known , but today there is
general agreement that changes in spinal and supra - spinal pain modulating mechanisms are of
central importance8 , 9 .
musculoskeletal sequelae of torture often show the same clinical
picture as that seen in chronic muscular pain syndromes .
several studies of torture victims
agree that physical complaints are common even many years after torture .
complaints of pain
with relation to the musculoskeletal system dominate , but neurological symptoms and
complaints from various organ systems are also common . in 1993 , the rehabilitation and research centre for torture victims ( rct ) in copenhagen ,
denmark , reviewed 51 torture victims who were examined on average 8.5 years after being
tortured .
the results were as follows : 92% complained of pain related to the
musculo - skeletal system ( 65% in the head and neck , 30% in the back , 8% in the upper
extremities , 41% in the lower extremities , 12% in more than one region ) , 37% had
neurological complaints , 18% complaints of the heart and lung , 30% complaints of the stomach
and intestines , and 18% complaints of the urinary tract and genitals ( unpublished data ) .
these findings are in agreement with a swedish study of 200 torture victims , of whom 62% had
muscle pain , 28% joint pain , 19% neurological complaints ( disturbances of sensation ,
radiating pain ) , 32% complaints of the stomach and gut , 27% symptoms of the urinary tract
and genitals , and 30% vegetative symptoms ( shortness of breath , palpitations , profuse
sweating)2 .
thus , the clinical picture is one of localized or diffuse pain in the muscles , joint pain ,
and neurological complaints , mainly in the form of disturbances of sensation and radiating
pain , as well as irritable symptoms of the organs , the same picture seen in chronic muscle
pain syndromes . in the literature ,
the commonest objective findings are also related to the
musculoskeletal system , typically as muscular tenderness as well as tenderness and
restricted movements of the joints and spine . under neurological examination disturbances of
sensation
dominate , whereas motor impairment such as decreased power and lack of reexes is
rarer1 , 3 .
apart from these findings , physical examination supplemented by
other examinations , such as x - ray , ultrasound scanning , endoscopy , ecg , or eeg , rarely
reveal abnormalities ( unpublished data , rct ) .
this discrepancy between the many physical
complaints and the few objective findings has led to classification of torture victims
symptoms as psychosomatic .
one group of torture survivors in korea , injured during the may 18 democratic movement ,
reportedly showed 42% to have physical diseases , 30% physical and mental diseases , 18%
mental diseases and 10% unknown diseases10 . given that most may 18 participants suffer from ptsd even 25 years
after the incident , their sequelae have developed along with ptsd11 .
many studies of such survivors suggest that physical
symptoms are predominantly pain occurring in the musculoskeletal system , which appears
several years after torture12 .
various
studies have been carried out of physiotherapy for torture survivors by rehabilitation
centers all over the world ; however , little has been done in korea .
thus the purpose of this
study was examine the effect on ptsd , pain and lumbar function when manual therapy is
performed for torture survivors with chronic lower back pain .
the study was performed using a pre / post - test control group design . at the t center located
in g city ,
30 subjects who met the selection criteria and exclusion criteria for low back
pain among male torture survivor subjects ( n=30 ) were selected . by means of a coin toss ,
they were divided randomly into a complex manual therapy group ( experimental group=15 ) and a
self - exercise group ( control group=15 ) .
this study was approved by the psychological t
center , and all the participants provided their written informed consent . in the experimental group ,
the average age was 59.26.6 years , the average height was
169.66.5 cm , and the average weight was 64.88.8 kg . in the control group ,
the average age
was 62.66.6 years , the average height was 167.75.8 cm , and the average weight was
67.38.9 kg . for the experimental group ,
complex manual therapy was performed twice a week for 8 weeks
to improve sequelae in the musculoskeletal system caused by torture . in one session ,
myo - facial release ( mfr ) was carried out for half an hour , to release muscle tension by
gently pulling up and down on the erector spinae muscles with the hands , with the client in
a prone position .
for another half an hour the muscle energy technique ( met ) was performed ,
to release tension in the hamstring and gluteus maximus with the client s feet on the
therapist s shoulders , and the subjects exercised by pushing down on the shoulders with the
feet .
subsequently , the following exercises were carried out for an hour to mitigate
hypertension and pain in the digitorum longus of the lower back : pelvic posterior tilt
exercise ; upper abdominal exercises ; lumbar stabilization exercise extension exercise for
muscle strength by bridge exercise a with sling , and self - exercise13 .
the control group was educated in self - exercise for the back using manual therapy . during
the education , verbal explanations , demonstrations by the therapist , and handouts were
provided .
both groups carried out their exercises for 90 minutes a session 3 times per week .
the total
period of the intervention was 8 weeks . in this study , subjects lower back pain was evaluated using the scales used were pds - k ,
visual analog scale ( vas ) , korean oswestry disability index ( kodi ) , and dynamic balance
test .
pds - k is a brief but reliable self - report measure of ptsd which assesses ptsd and
symptom severity in accordance with diagnostic and statistical manual of mental disorders - iv
( dsm - iv ) .
since it contains six diagnostic criteria , it can be used as a diagnosis method
and applied to those who experience various traumatic events14 , 15 . to identify the extent of pain over the body , vas was used .
the client marked their pain
score directly on a scale ranging from 0 to 10 .
the index has nine items which
are scored from 0 to 5 ( pain level , personal hygiene , lifting objects , gait , sitting ,
standing , sleeping , social activity , and traveling and moving ) .
dynamic
balance was measured using a balance system sd ( biodex inc , usa ) .
the measurement device is
composed of a round mat with a motion - detecting sensor , a monitor on which targets are
displayed , and a computer and printer . for window spss 18.0
was used for the statistical analysis , the paired t - test
was used for before and after comparison , and independent t - test was used for between group
comparison with a significance level of =0.05 .
changes were compared over time in back pain , function and balance between the two groups .
in the pds - k examination , the control group did not show difference between before and after
the intervention , while the experimental group showed a significant reduction in score
compared to the control group ( p<0.001 ) ( table
1table 1.intergroup comparisons of pds - k , vas , kodi , and the dynamic balance testperiodexperimental group ( n=15)control group ( n=15)msdmsdpds - k ( score)pre36.16.933.35.8post22.46.931.57.1vas ( score)pre61.455.557.66.6post52.87.1**57.67.3kodi ( score)pre76.513.869.014.1post59.55.5**69.511.2dynamic balance test ( sec)pre4.20.76.80.5post4.20.7 * 4.20.7 : complex manual therapy group , : self - back exercise group .
* : paired t - test , : independent sample t - test , * : p<0.01 ,
* * : p<0.001 ) . : complex manual therapy group , : self - back exercise group .
* : paired t - test , : independent sample t - test , * : p<0.01 ,
* * : p<0.001 in the pain examination , the control group did not show difference between before and after
the intervention , whereas the experimental group showed a significant reduction in pain
compared to the control group ( p<0.001 ) ( table
1 ) . for the kodi , the control group did not show difference before and after ,
whereas the experimental group showed significant differences in pain and disabilities in
routine life such as sitting , standing , and sleeping ( p<0.001 ) ( table 1 ) . in the balance test , the control group did not show
difference between before and after the intervention , whereas the experimental group showed
significant improvement in balance ( p<0.001 ) ( table
1 ) . in the comparison of the groups ,
a significant differences were found for
pds - k , pain score , kodi , and balance test ( p<0.001 ) ( table 1 ) .
examinations of torture victims , even years after torture , have revealed a high incidences
of mental and physical symptoms .
physical symptoms are mainly associated with the
musculoskeletal system , but symptoms of the vital organs are also common18 .
the sequelae in the musculoskeletal system caused by torture depend on the torture method ,
and some torture survivors have shown peripheral polyneuropathy and neuropathic pain
symptoms10 .
although these symptoms are
not necessarily considered a mental problem , they are sometimes not pain signals from
peripheral tissues and organs , but rather nerve system pain . except for nociceptive pain ,
neuropathic pain elements which are related to acute or chronic inflammation caused by
musculoskeletal lesions are taken into account when examining torture survivors12 .
physiotherapists have carried out continuous dialogue about torture experiences and pain
with clients who have experienced torture .
the information that clients share is of use to
observe their pain patterns , and can be utilized in the treatment process19 . among the sequelae after torture , pain extending to the musculoskeletal system is related
to lack of sleep , fatigue , paresthesia , headache , and sensitive responses in the internal
organs and the urinary bladder .
the sequelae in the
musculoskeletal system caused by torture show similar clinical patterns to the symptoms of
common chronic muscle pain syndrome2 . in this study ,
complex manual therapy carried out for torture survivors , decreased ptsd
symptoms after the intervention according to the pds - k score , and the kodi score for
disabilities also decreased .
this indicates there was mitigation of lower back pain , leading
to complementary and positive effects on both constructive and functional elements of the
lower back . in the present study ,
complex manual therapy led to significantly lower pds - k
scores in the experimental group than in the control group .
this indicates that a variety of
manual therapies are effective , even in cases of post - traumatic stress disorder and
psychological factors .
although these results are those of a single case study , they suggest
areas for future study20 . vas results after complex manual therapy were significantly lower in the experimental group
than in the control group .
this indicates that complex manual therapy is effective at
reducing the low back pain of survivors of torture and is consistent with the previously
cited study20 .
torture survivors believe
that manual therapy is more effective , together with physical therapy , to manage their back
pain .
the kodi scores after complex manual therapy were significantly lower in the
experimental group than in the control group .
the stabilization exercise for the body , using
a sling , after the mfr and met techniques in complex manual therapy , improved the function
of the right lumbar region , and was found useful by participants . finally , dynamic balance
ability improved after the intervention , indicating that the performance of complex manual
therapy for torture survivors as they age is an effective approach for preventing falls by
senior survivors of torture .
traditional physical therapy performed in hospitals to treat the lower back pain of torture
survivors has spatial limitations .
the complex schedule of back pain treatment performed for
torture survivors in this study appears to be useful for reducing chronic lower back pain
and improving function in long - term sequelae of torture .
a fall prevention program administering
complex manual therapy offers a new physical therapy intervention for torture survivors .
this study was limited in that it is difficult to generalize partial research findings .
therefore , it will be necessary to conduct research with greater numbers of participants
with various symptoms .
this study did not distinguish between the individual effects of the
treatment techniques involved in the complex manual therapy . also , the pain assessment had
limitations , because it which did not vary according to the characteristics of the sequelae
of torture survivors .
the concept that torture survivors are chronic pain patients , combined
with existing knowledge of the treatment of chronic pain patients in general , further
underlines the need for the availability of such treatment . in the light of the global
extent of such problems
there is also a need for the development of differentiated forms of
treatment , adaptable to differences in treatment traditions and the capacity of resources in
different countries . | ### Summary:
: [ purpose ] this study aimed to identify the impact of physiotherapy using complex manual
therapy as a part of an integrated treatment for sequelae in the musculoskeletal system of
torture survivors .
[ subjects ] this study reviewed 30 male torture survivors presenting
with chronic low back pain .
they were randomly selected and divided into two groups : an
experimental group and a control group .
[ methods ] for the experimental group , complex
manual therapy was performed twice a week for 8 weeks to improve the physical sequelae of
patients .
improvement was measured using the pds - k for post - traumatic stress disorder
( ptsd ) , the visual analog scale ( vas ) for pain examination , the korean oswestry disability
index ( kodi ) for back function assessment , and the balance system sd as a dynamic balance
test .
the total period of the intervention for both groups was 8 weeks .
[ results ] for the
experimental group , pds - k , vas , kodi , and the dynamic balance test all showed significant
improvements after the intervention , which they did not for the control group . in the
comparison of the groups ,
pds - k , vas , kodi , and the dynamic balance test all showed
significant differences .
[ conclusion ] complex manual therapy for torture survivors with
chronic low back pain contributes to functional recovery by reducing back pain .
the
treatment can be considered to have positive effects on sequelae in the musculoskeletal
system of torture survivors as they age . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: mice carrying the hdac1 and hdac2 floxed alleles were bred with schwann cell lineage expressing dhh - cre line 7 , to generate hdac1;dhh(hdac1cko ) , hdac2;dhh(hdac2cko ) , or hdac1;hdac2;dhh ( dcko ) , and control heterozygous ( hdac1;hdac2;dhh ) offspring .
the control mice developed and behaved the same as age - matched wild - type mice . since hdac1 or 2 single mutant phenotypes were indistinguishable from heterozygous control , we mainly focused on the control ( hdac1;hdac2;dhh ) and dcko for subsequent analyses .
conditional -catenin activation ( catn ) 5,18 mice were generated by breeding with the dhh - cre line to generate control ( catn ) and -catenin activating mice ( catn;dhh ) , in which -catenin is stabilized in the schwann cell lineage .
dhh - cre - mediated excision of the exon 3 of the -catenin allele produced a shortened , stable form of -catenin that lacks its n - terminal phosphorylation and ubiquitination sites , resulting in constitutive activation of canonical wnt signaling in the schwann cell lineage .
animal use and studies were approved by the institutional animal care and use committee of the university of texas southwestern medical center at dallas .
sciatic nerves were fixed in 4% paraformaldehyde for 10 min , and then were embedded in oct , cut into 10-um as cross or longitudinal sections . for brdu pulse labeling , animals at p4 were injected intraperitoneally with 100 mg brdu / kg body weight 2 hrs prior to sciatic nerve collection .
primary antibodies were used : mouse anti - mbp , anti - mpz , anti - mag ( covance ) , rabbit anti - krox20/egr2 ( covance ) , goat anti - oct6 ( santa cruz ) , goat anti - sox10 ( abcam ) , mouse anti - brdu ( bd biosciences ) , rabbit anti - ki67 ( thermo scientific ) , rabbit anti - caspase 3 ( millipore ) , anti - p300/cbp ( santa cruz ) , anti - nf-b p65/rela ( santa cruz ) and anti - acetylated nf-b p65 ( acetyl k310 ) ( abcam ) .
the acetyl - p65 antibody detected nf-b p65 acetylation at k310 , the major acetylation site in p65 .
currently , the antibodies for nf-b acetylated at k314 and k315 are not commercially available .
all images were acquired using zeiss lsm 510 confocal microscope . for electron microscopy , sciatic nerves were dissected and fixed in fixative solution containing 2% paraformaldehyde and 2% glutaraldehyde and 0.1 m cacodylic acid ( ph7.2 ) and processed for electron microscopy .
qrt - pcr was carried out using the abi prism 7700 sequence detector system ( perkin - elmer applied biosystems ) using gapdh ( taqman kit , applied biosystems ) as an internal as previously described 5 .
qpcr primers for mouse species : mpz f : ctggtccagtgaatggtct , r : gtcccttggcatagtggaaa ; mbp f : tcacagaagagaccctcaca , r : gccgtagtgggtagttcttg ; oct6 f : gttctcgcagaccaccatct , r : gtctcctccagccacttgtt ; sox10 f : agcccaggtgaagacagaga , r : gtcaaactggggtcgtgag ; hes1 f : tctggaaatgactgtgaaca , r : gtcacctcgttcatgcactc ; hes5 f : agctacctgaaacacagcaaagcc , r : taaagcagcttcatctgcgtgtcg ; id2 f : tgaacgactgctactccaagctca , r : gtgctgcaggatttccatcttggt ; id4 f : gcagtgcgatatgaacgactgcta , r : taacgtgctgcaggatctccactt ; gpr126 f : ttatgtgagctgtgccgggtactt , r : attcctcccacagatctgcaccat ; gjb1 f : ttcagaatcatggtgctggtggtg , r : accaagataagctgcagggaccat ; krox20 f : caggagtgacgaaaggaagc , r : accagaggctgaagactgg ; sox2 f : cacaactcggagatcagcaa , r : ctccgggaagcgtgtactta ; sox11 f : gctggaagatgctgaaggac , r : gtcgggataatcagccatgt ; c - jun f : acccccactcagttcttgtg , r : agttgctgaggttggcgtag ; jag-1 f : caaatgagtgcgaggccaaacctt ,
r : agccaggaaggcaatcacagtagt qpcr primers for rat species : mbp f : ttgactccatcgggcgcttcttta , r : gctgtgccacatgtacaaggatca ; sox10 f : gctatccaggctcactacaag r : actgcagctctgtctttgg ; id2 f : atggaaatcctgcagcacgtcatc , r : acgtttggttctgtccaggtctct ; id4 f : actgtgcctgcagtgcgatatgaa , r : tgcaggatctccactttgctgact ; hes1 f : agaaaaattcctcgtccccg , r : tttcatttattcttgcccggc ; hes5 f : accagcccaactccaaac , r : agtaaccctcgctgtagtcc ; jag1 f : gactacgagggcaagaactg , r : gttggaagagatataccgcacc ; dll-1 f : ttctctggcttcaactgtgag , r : tcatccacattgtcctcgc ; dll-3 f : attctatgggcctcgatgtgaggt , r : aggatcttcaccgccaacacacaa rat schwann cells were prepared from sciatic nerves of newborn rats ( 12 d old ) as described previously20 . for routine culture ,
rat schwann cells were grown under the proliferation condition [ dmem ( gibco ) with 10% fetal bovine serum ( fbs ) ( hyclone ) supplemented with 10 ng / ml neuregulin ( r&d ) and 5 m forskolin ( sigma - aldrich ) ] .
cells between passages 2 and 4 were used in all experiments . to promote differentiation ,
schwann cells were cultured in a differentiation medium [ dmem with n2 ( gibco ) supplemented with 5 m forskolin ] , resulting in a substantial increase of expression of differentiation markers including mpz and krox20 .
primary mouse schwann cells were prepared from sciatic nerves of newborn mice ( p1 ) as described by yeisr et al.21 and cultured on poly - d - lysine ( sigma ) coated plate in dmem ( gibco ) with 10% fetal bovine serum ( fbs ) ( hyclone ) supplemented with 50ng / ml beta heregulin ( egf domain ) ( r&d system ) .
the primary schwann cells were greater than 95% pure and used for transfection study after isolation . for reporter assays
, rat schwann cells were transfected with luciferase reporters and expression vectors using lipofectamine 2000 .
transfected cells were cultured for 48 hr before harvesting to measure the luciferase activity using luciferase assay kit ( promega ) .
the prsv - renilla luciferase plasmid was included to control for variable transfection efficiencies between different experiments ( n 3 times ) .
briefly , sciatic nerves were dissected from control and hdac mutant mice and immediately fixed in 1% formaldehyde for 25 min at room temperature .
nerves were washed in pbs , homogenized in 150 mm nacl , 10% glycerol , 0.3% triton x-100 and 50 mm tris - hcl ( ph 8.0 ) containing protease inhibitor cocktail ( roche ) as described by jang et al . 22 . lysates were then sonicated with a bioruptor sonicator ( diagenode ) to ~500 bp . sheared chromatin ( ~30 g ) was incubated with 2 g of anti - hdac1 , anti - hdac2 , anti - p65 , anti - acetylated p65 k310 , anti - trimethyl - histone3 k4 ( abcam ) , anti - trimethyl - histone3 k9 ( abcam ) and anti - p300 ( abcam ) , respectively , for each chip assay .
real - time pcr was carried out using quantitative sybr green pcr mix ( applied biosystems , inc . ) .
the relative fold - enrichments were determined by the 2 methods as previously described 23 .
primers used for chip - pcr analysis : sox10 proximal promoter ( 1/176 ) : forward aggcagc agtgcgggtcaca ; reverse : tgactgagccgctgcagacg ; sox10 5utr(900/1140 ) : forward aatcattgaggccttgattc ; reverse ctctacagcctagttag tgt .
id4 promoter ( 700/493 ) : forward attccagccagca cattcc ; reverse ggagtgaccagccaatcag ; gapdh proximal promoter : forward tttgaaa tgtgcacgcaccaagcg ; reverse tgagtcctatcctgggaaccatca . quantifications were performed from at least three experimental groups .
p values are from student 's two - tailed t test to compare two sets of data .
mice carrying the hdac1 and hdac2 floxed alleles were bred with schwann cell lineage expressing dhh - cre line 7 , to generate hdac1;dhh(hdac1cko ) , hdac2;dhh(hdac2cko ) , or hdac1;hdac2;dhh ( dcko ) , and control heterozygous ( hdac1;hdac2;dhh ) offspring .
the control mice developed and behaved the same as age - matched wild - type mice . since hdac1 or 2 single mutant phenotypes were indistinguishable from heterozygous control , we mainly focused on the control ( hdac1;hdac2;dhh ) and dcko for subsequent analyses .
conditional -catenin activation ( catn ) 5,18 mice were generated by breeding with the dhh - cre line to generate control ( catn ) and -catenin activating mice ( catn;dhh ) , in which -catenin is stabilized in the schwann cell lineage .
dhh - cre - mediated excision of the exon 3 of the -catenin allele produced a shortened , stable form of -catenin that lacks its n - terminal phosphorylation and ubiquitination sites , resulting in constitutive activation of canonical wnt signaling in the schwann cell lineage .
animal use and studies were approved by the institutional animal care and use committee of the university of texas southwestern medical center at dallas .
sciatic nerves were fixed in 4% paraformaldehyde for 10 min , and then were embedded in oct , cut into 10-um as cross or longitudinal sections . for brdu pulse labeling , animals at p4 were injected intraperitoneally with 100 mg brdu / kg body weight 2 hrs prior to sciatic nerve collection .
primary antibodies were used : mouse anti - mbp , anti - mpz , anti - mag ( covance ) , rabbit anti - krox20/egr2 ( covance ) , goat anti - oct6 ( santa cruz ) , goat anti - sox10 ( abcam ) , mouse anti - brdu ( bd biosciences ) , rabbit anti - ki67 ( thermo scientific ) , rabbit anti - caspase 3 ( millipore ) , anti - p300/cbp ( santa cruz ) , anti - nf-b p65/rela ( santa cruz ) and anti - acetylated nf-b p65 ( acetyl k310 ) ( abcam ) .
the acetyl - p65 antibody detected nf-b p65 acetylation at k310 , the major acetylation site in p65 .
currently , the antibodies for nf-b acetylated at k314 and k315 are not commercially available .
sciatic nerves were dissected and fixed in fixative solution containing 2% paraformaldehyde and 2% glutaraldehyde and 0.1 m cacodylic acid ( ph7.2 ) and processed for electron microscopy .
qrt - pcr was carried out using the abi prism 7700 sequence detector system ( perkin - elmer applied biosystems ) using gapdh ( taqman kit , applied biosystems ) as an internal as previously described 5 .
qpcr primers for mouse species : mpz f : ctggtccagtgaatggtct , r : gtcccttggcatagtggaaa ; mbp f : tcacagaagagaccctcaca , r : gccgtagtgggtagttcttg ; oct6 f : gttctcgcagaccaccatct , r : gtctcctccagccacttgtt ; sox10 f : agcccaggtgaagacagaga , r : gtcaaactggggtcgtgag ; hes1 f : tctggaaatgactgtgaaca , r : gtcacctcgttcatgcactc ; hes5 f : agctacctgaaacacagcaaagcc , r : taaagcagcttcatctgcgtgtcg ;
id2 f : tgaacgactgctactccaagctca , r : gtgctgcaggatttccatcttggt ; id4 f : gcagtgcgatatgaacgactgcta , r : taacgtgctgcaggatctccactt ; gpr126 f : ttatgtgagctgtgccgggtactt , r : attcctcccacagatctgcaccat ; gjb1 f : ttcagaatcatggtgctggtggtg , r : accaagataagctgcagggaccat ; krox20 f : caggagtgacgaaaggaagc , r : accagaggctgaagactgg ; sox2 f : cacaactcggagatcagcaa , r : ctccgggaagcgtgtactta ; sox11 f : gctggaagatgctgaaggac , r : gtcgggataatcagccatgt ; c - jun f : acccccactcagttcttgtg , r : agttgctgaggttggcgtag ; jag-1 f : caaatgagtgcgaggccaaacctt , r : agccaggaaggcaatcacagtagt qpcr primers for rat species : mbp f : ttgactccatcgggcgcttcttta , r : gctgtgccacatgtacaaggatca ; sox10 f : gctatccaggctcactacaag r : actgcagctctgtctttgg ; id2 f : atggaaatcctgcagcacgtcatc , r : acgtttggttctgtccaggtctct ; id4 f : actgtgcctgcagtgcgatatgaa , r : tgcaggatctccactttgctgact ; hes1 f : agaaaaattcctcgtccccg , r : tttcatttattcttgcccggc ; hes5 f : accagcccaactccaaac , r : agtaaccctcgctgtagtcc ; jag1 f : gactacgagggcaagaactg , r : gttggaagagatataccgcacc ; dll-1 f : ttctctggcttcaactgtgag , r : tcatccacattgtcctcgc ; dll-3 f : attctatgggcctcgatgtgaggt , r : aggatcttcaccgccaacacacaa
rat schwann cells were prepared from sciatic nerves of newborn rats ( 12 d old ) as described previously20 . for routine culture ,
rat schwann cells were grown under the proliferation condition [ dmem ( gibco ) with 10% fetal bovine serum ( fbs ) ( hyclone ) supplemented with 10 ng / ml neuregulin ( r&d ) and 5 m forskolin ( sigma - aldrich ) ] .
cells between passages 2 and 4 were used in all experiments . to promote differentiation ,
schwann cells were cultured in a differentiation medium [ dmem with n2 ( gibco ) supplemented with 5 m forskolin ] , resulting in a substantial increase of expression of differentiation markers including mpz and krox20 .
primary mouse schwann cells were prepared from sciatic nerves of newborn mice ( p1 ) as described by yeisr et al.21 and cultured on poly - d - lysine ( sigma ) coated plate in dmem ( gibco ) with 10% fetal bovine serum ( fbs ) ( hyclone ) supplemented with 50ng / ml beta heregulin ( egf domain ) ( r&d system ) .
the primary schwann cells were greater than 95% pure and used for transfection study after isolation . for reporter assays
, rat schwann cells were transfected with luciferase reporters and expression vectors using lipofectamine 2000 .
transfected cells were cultured for 48 hr before harvesting to measure the luciferase activity using luciferase assay kit ( promega ) .
the prsv - renilla luciferase plasmid was included to control for variable transfection efficiencies between different experiments ( n 3 times ) .
briefly , sciatic nerves were dissected from control and hdac mutant mice and immediately fixed in 1% formaldehyde for 25 min at room temperature .
nerves were washed in pbs , homogenized in 150 mm nacl , 10% glycerol , 0.3% triton x-100 and 50 mm tris - hcl ( ph 8.0 ) containing protease inhibitor cocktail ( roche ) as described by jang et al .
lysates were then sonicated with a bioruptor sonicator ( diagenode ) to ~500 bp . sheared chromatin ( ~30 g ) was incubated with 2 g of anti - hdac1 , anti - hdac2 , anti - p65 , anti - acetylated p65 k310 , anti - trimethyl - histone3 k4 ( abcam ) , anti - trimethyl - histone3 k9 ( abcam ) and anti - p300 ( abcam ) , respectively , for each chip assay .
real - time pcr was carried out using quantitative sybr green pcr mix ( applied biosystems , inc . ) .
the relative fold - enrichments were determined by the 2 methods as previously described 23 .
primers used for chip - pcr analysis : sox10 proximal promoter ( 1/176 ) : forward aggcagc agtgcgggtcaca ; reverse : tgactgagccgctgcagacg ; sox10 5utr(900/1140 ) : forward aatcattgaggccttgattc ; reverse ctctacagcctagttag tgt .
id4 promoter ( 700/493 ) : forward attccagccagca cattcc ; reverse ggagtgaccagccaatcag ; gapdh proximal promoter : forward tttgaaa tgtgcacgcaccaagcg ; reverse tgagtcctatcctgggaaccatca .
p values are from student 's two - tailed t test to compare two sets of data .
| ### Summary:
: schwann cell myelination is tightly regulated by timely expression of key transcriptional regulators that respond to specific environmental cues , yet molecular mechanisms underlying such a process are poorly understood . here
, we report that hdac1/2-regulated acetylation state of nf-b is critical in orchestrating the myelination program .
mice lacking hdac1/2 exhibit severe dysmyelination with schwann cell development arrested at the immature stage .
we find that nf-b p65 becomes heavily acetylated in hdac1/2 mutants , inhibiting the expression of positive regulators of myelination , while inducing the expression of differentiation inhibitors .
we observe that nf-b protein complex switches its association with p300 to that with hdac1/2 as schwann cells differentiate .
nf-b and hdac1/2 act coordinately to regulate the transcriptionally - linked chromatin state for schwann cell myelination .
thus , our results reveal an hdac - mediated developmental switch for controlling myelination in the peripheral nervous system . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: alterations of certain metabolic pathways in prostate tumors could be used diagnostically to infer the molecular phenotype of the tumor , or to monitor patients whose tumors have an established molecular profile .
this is particularly important in a disease such as prostate cancer , in which metastatic disease in bone is not routinely biopsied .
furthermore , these results could lead to the discovery of radiopharmaceuticals to image prostate cancer patients noninvasively .
finally , enzymes in these metabolic pathways could represent therapeutic targets for prostate tumors that are addicted to the putative driving oncogenes .
thus , metabolic reprogramming as a function of distinct molecular aberrations can have major diagnostic and therapeutic implications .
this work was supported by nih / nci grant 2r01ca131945 , the df / hcc spore in prostate cancer ( nih / nci p50 ca90381 ) , the prostate cancer foundation , the dod synergist idea development award 11498838 to m.l . | ### Summary:
: oncogene - associated metabolic signatures in prostate cancer , identified by an integrative analysis of cultured cells and murine and human tumors , suggest that akt activation results in a glycolytic phenotype whereas myc induces aberrant lipid metabolism .
heterogeneity in human tumors makes this simplistic interpretation obtained from experimental models more challenging .
metabolic reprogramming as a function of distinct molecular aberrations has major diagnostic and therapeutic implications . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: epithelial tumors with sarcomatous features are occasionally observed in various organs , including the liver .
most sarcomatous carcinomas in the liver are regarded as sarcomatous differentiation from hepatocellular carcinoma , and their clinical characteristics and pathologic significance have been satisfactorily elucidated .
sarcomatous transformation has been reported in about 3.99.4% of hepatocellular carcinomas at autopsy and in about 4.5% of cholangiocarcinomas .
the optimal treatment of these rare lesions is unclear , partly because of the typically aggressive clinical course .
a 61-year - old japanese male was seen at an outside hospital with abdominal pain and distention .
an intraabdominal mass was found on abdominal computed tomography ( ct ) , and he was referred for further evaluation .
both parents had died of hepatic cirrhosis . on physical examination , he was afebrile , with mild tenderness in the upper abdomen and with massive distention .
routine blood tests showed : wbc 24,300/l , hb 7.3 g / dl , fdp 123.7 g / ml , d - dimer 111.2 ng / ml , t - bili 1.24 mg / dl , ast 35 mu / ml , ldh 810 mu / ml , alp 392 mu / ml , che 99 mu / ml , crp 18.28 mg / dl , hbs antigen negative , hcv antibody positive , cea 1.2 ng / ml , and ca19 - 9 5 u / ml . repeat ct showed a large solitary heterogeneous mass , 25 cm in diameter , in the left upper quadrant with evidence of intratumoral bleeding and irregular enhancement peripherally ( arrowhead , fig .
1 ) . there was no clear distinction between the mass and the left lateral segment of the liver .
the anterior wall of the stomach was diffusely adherent to the posterior side of the mass .
2 ) . the tumor seemed to originate from the gastric wall and was suspected to be a gastrointestinal stromal tumor .
intraoperative findings revealed that the tumor was densely adherent to the lateral segment of the liver , gallbladder , anterior wall of the stomach , left side of the diaphragm and parietal peritoneum .
lateral segmentectomy , total gastrectomy , cholecystectomy and partial resection of the diaphragm and parietal peritoneum were performed , with a roux - en - y reconstruction .
hematoxylin and eosin staining of histologic sections of the resected specimen showed a malignant neoplasm with undifferentiated spindle cells .
malignant cells with glandular formations similar to intrahepatic bile ducts showed a transition from a differentiated component to an undifferentiated one between the tumor and the liver .
the carcinomatous component ( < 10% of the cells ) stained positive for cytokeratin-7 and cytokeratin-19 , but negative for hepatocytes . the sarcomatous component
( 90% of the cells ) stained positive for vimentin and keratin-1 , but negative for cytokeratin-7 , cytokeratin-19 and hepatocytes .
the adenocarcinoma appeared to be derived from the intrahepatic bile duct with transformation to sarcomatous cells .
the patient was discharged from the hospital for supportive care and died on the 34th postoperative day from rapid tumor progression .
sarcomatous transformation has been reported to occur in a hepatocellular carcinoma previously treated with transcatheter arterial chemoembolization .
nakajima et al . reported 7 cases of cholangiocarcinoma with sarcomatous changes with a median age of 69 years and abdominal pain as the main presenting symptom .
abdominal ct showed low - density lesions enhanced at the periphery resembling ordinary cholangiocarcinoma , which were difficult to differentiate by imaging alone . in the present case ,
a solid lesion and a cystic lesion were found on ct , suggesting a fragile tumor such as a gastrointestinal stromal tumor .
most previously reported cases showed cytokeratin and vimentin expression in the sarcomatous component characteristic of epithelial derivation , as seen in the present case [ 3 , 4 , 5 ] .
gupta et al . reported cytomorphological features of cholangiocarcinoma with sarcomatous changes , with spindle - shaped cells , scanty cytoplasm and hyperchromatic nuclei .
although these are useful for preoperative diagnosis , needle biopsy may be contraindicated with the risk of intratumor hemorrhage and peritoneal dissemination , as in our case .
it has been reported that the prognosis for cholangiocarcinoma with sarcomatous changes is worse than that for typical cholangiocarcinoma .
the factors that account for the poor prognosis may be ascribed to the intrahepatic development , especially the high potential of the sarcomatous component to metastasize .
reported that the survival rate of patients with surgically resected disease was significantly higher than that in patients without resection .
reported combination chemotherapy with gemcitabine and cisplatin as a potential treatment for controlling disease progression . in our case
, there was no time to give adjuvant therapy because of rapid recurrence and general deterioration .
cholangiocarcinoma with sarcomatous changes is an extremely rare tumor composed of mixed malignant epithelial and mesenchymal cells .
the outcome of this case shows that this neoplasm generally pursues a highly aggressive and malignant clinical course , with rapid growth and wide local infiltration , leading to poor prognosis .
radical surgery with adjuvant chemotherapy and close follow - up may be important in the effective management of this disease . | ### Summary:
: a 61-year - old japanese male was seen at an outside hospital with abdominal pain and distention .
an intraabdominal mass was found on abdominal computed tomography ( ct ) , and he was referred for further evaluation .
he was afebrile , with mild tenderness in the upper abdomen and massive distention .
routine blood work showed severe inflammation and anemia .
repeat ct showed a large solitary heterogeneous mass , 25 cm in diameter , in the left upper quadrant with evidence of intratumoral bleeding and irregular enhancement peripherally .
there was no clear distinction between the mass and the peripheral organs .
surgery was performed with persistent anemia and exacerbation of abdominal pain .
lateral segmentectomy , total gastrectomy , cholecystectomy and partial resection of the diaphragm and parietal peritoneum were performed .
the final diagnosis was cholangiocarcinoma with sarcomatous changes . on the 16th postoperative day a ct scan revealed recurrent tumor .
the patient died on the 34th postoperative day from rapid tumor progression . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: packaged water is any potable water that is manufactured or processed for sale which is sealed in food - grade bottles , sachets , or other containers and intended for human consumption .
sale of packaged water has exploded all over the world in recent years , largely as a result of public perception that it is safe , tastes better , and has a better quality compared to raw tap water [ 25 ] .
the increment in consumption globally could also be due to a result of an increase in per capita use as well as population growth [ 6 , 7 ] . even in countries where tap water quality is considered excellent ,
demand was so high , making packaged water the fastest growing product of the nonalcoholic beverage market worldwide [ 8 , 9 ] .
the above situation is not any different in the study area , kampala , and all over uganda where water packaged in bottles and polythene bags has become a very common consumer product most especially in the urban centres .
the high demand may attract substandard products and counterfeits into the market . with this increase in consumption of packaged water
, there is a possibility of producing products that are not fit for human consumption because of monetary interests .
access to safe drinking water is still one of the major challenges of the 21st century .
unsafe water is a global public health threat , placing persons at risk for a host of diarrhoeal diseases as well as chemical intoxication .
although disease outbreaks due to contaminated packaged water are not common , any possible contamination may lead to widespread epidemic because of the high demand and coverage . therefore access to an adequate and safe water supply is very important and can result in significant benefits to health .
packaged water has ever been implicated as a source of outbreaks of cholera and typhoid fever as well as traveler 's disease in countries such as portugal and spain [ 1 , 1517 ] .
several studies have shown that packaged water can be contaminated with bacteria at various stages of production [ 1823 ] . under improper or prolonged storage of bottled water
, bacteria can grow to levels that may be harmful to human health [ 1 , 4 , 5 ] . in kampala ,
however , continuous surveillance of its quality at retail premises is not being carried out .
therefore , this study assessed the physical and bacteriological quality of locally packaged water sold for public consumption in kampala , uganda .
this was a cross - sectional study carried out in kampala , the capital city of uganda .
kampala is divided administratively into 5 divisions , namely , central division , kawempe division , makindye division , nakawa division , and lubaga division .
available sources of drinking water in the city include spring water , piped water , wells , boreholes , and lake .
the three major causes of morbidity and mortality in kampala are malaria , respiratory infections , and diarrhoeal diseases .
there are over 20 bottled water brands in uganda and around 14 of them are in kampala .
the number of sachet water manufacturing premises is not known since most of them operate illegally .
three of the five municipalities in the city , namely , lubaga , makindye , and kawempe , were randomly selected for involvement in the study .
main trading centres of the selected parishes were purposively selected because it is where most of the packaged water brands sold were likely to be found .
the selected trading centres in each municipality were bwaise in kawempe , kasubi in lubaga , and kabalagala in makindye municipality .
a total of 90 samples ( 60 bottled and 30 sachets ) of all the common brands of packaged water available on market during the month of january were collected for this study .
a total of 10 brands of bottled water and 15 brands of sachet water were sampled .
all samples were purchased randomly from several retail outlets and supermarkets in the selected trading centres of kampala . at the retail outlets , duplicate samples ( two ) bottles of water of each brand and of the same batch were procured from each of the three selected trading centres , thus 20 samples from each municipality giving a total of 60 bottled samples .
all the fifteen sachet water brands available on market were sampled . on average , five different brands of sachet water were sampled in duplicate from each of the three trading centres giving a total of 15 brands and 30 samples of sachet water .
all the samples were retained in their original sealed containers and clearly marked for identification with letters from a to j for bottled water and from k to y for sachet water samples .
they were transported to school of public health laboratory , makerere university , at kasangati in kampala in a sample carrier containing ice packs and analysed within 2 to 4 hours of collection .
then 25% of the samples , a blank sample ( a negative control ) and spiked sample ( a positive control ) , were sent to national water and sewerage corporation ( nwsc ) laboratory in kampala for analysis so as to compare with the analysis findings . the membrane filtration method for bacteriological analysis with m - lauryl sulphate broth as culture medium was used .
100 ml of water from each sample was filtrated using a membrane filter and then incubated at 44.5c and 37.5c for 18 hours for faecal and total coliforms , respectively .
turbidity was measured using turbidity tubes and reported in ntu and ph using wagtech ph meter .
the analysis for total coliform and faecal coliform organisms per 100 ml was reported in terms of cfu/100 ml . glassware or materials used in this experiment were washed with distilled water and then autoclaved at 121c for 15 minutes to ensure sterility . the bacteriological and physical quality of the packaged water was determined by comparing it with the national and who standards for packaged water which requires water samples of good quality to be with 0 coliforms per 100 ml of water and turbidity of < 5 ntu and ph of 6.58.5 , respectively .
data was analysed using both descriptive and inferential statistics . for the descriptive statistics , frequencies and cross tabulations
the main outcome was bacteriological quality of the packaged water ( presence or absence of either total coliform or faecal coliform ) .
other outcomes were turbidity level ( within the acceptable limits or not ) and ph ( within the acceptable limits or not ) .
mann - whitney u test was used to compare median total coliform count of bottled water to that of sachet water .
wilcoxon signed - rank test was used to test whether the mean of the packaged water brands was statistically different from the required standard of zero total coliform forming units per 100 ml .
fisher 's exact test was used to compare the proportion of bottled water with total coliform to that of sachet water .
the strength of association was determined using odds ratio and p values at 95% level of confidence .
the test for normality of the data used was shapiro - wilk test . to ensure quality , water samples were transported and analysed within 24 hours .
equipment was calibrated before use , a blank sample and a spiked sample were included in the analysis , and a reference laboratory ( nwsc ) was used for validation of the findings .
approval to conduct the study was obtained from makerere university school of public health higher degree research and ethical committee .
the median total coliform count of sachet and bottled water samples was 3.0 and 0.0 per 100 ml of water , respectively .
the median ph and turbidity of both bottled water and sachet water were within the acceptable range .
all the samples ( both bottled water and sachet water ) showed negative growth for faecal coliform as shown in table 1 . using wilcoxon signed - rank test ,
the median total coliform count in sachet water brands was found to be significantly above the acceptable level of zero ( z = 2.94 , p value = 0.003 ) but that of bottled water brands was not ( z = 1.633 , p value = 0.102 ) .
mann - whitney u test showed a statistically significant difference between the median count of total coliform in both sachet water and bottled water brands ( u(24 ) = 37.0 , p = 0.027 ) .
majority ( 70% , 21/30 ) of the sachet water samples and a few ( 15% , 9/60 ) of bottled water samples analysed showed positive growth for total coliform above the acceptable levels of 0 cfu/100 ml of water set by who and national standards .
most ( 73.3% , 11/15 ) of sachet water and a few ( 30% , 3/10 ) of bottled water brands had total coliform count above the acceptable limit of 0 cfu/100 ml as shown in table 2 .
the odds of sachet water being likely to be contaminated with total coliform were 13 times higher when compared to bottled water ( or = 13.2 , ci : 4.1243.58 ) as shown in table 3 .
the physical and bacteriological state of packaged water is a very important aspect that should be observed by all the packaging companies .
bottled water is generally of good quality for drinking , but if it is not properly protected during bottling and transit , it could be contaminated . as per the national and who standards , packaged water should have turbidity of less than 5 ntu , ph range of 6.58.5 , and total coliform and faecal coliform of 0.00 per 100 ml . as a measure for safety ,
indicator organisms of coliforms are investigated and their presence generally indicates that the water may contain disease causing agents .
coliforms are in two categories : total ( all ) coliforms count which indicates general contamination and faecal coliform count which indicates faecal contamination and is a significant indicator of pollution .
the physical properties of packaged water showed that ph and turbidity were within the permissible limits which indicate that packaged water was suitable for consumption .
these results are similar to studies conducted in delhi , india ; alexandria , egypt ; and kano state , nigeria [ 2527 ] . however , these results contradict results from studies carried out in ghana and nigeria which showed ph values for sachet water ranging from 5.4 to 7.6 [ 28 , 29 ] and in amhara , ethiopia , from 5.3 to 5.5 which implies that some of the packaged water was not suitable for human consumption .
another study carried out in georgia , united states , showed that sachet ice water had 95 and 3 samples with ph and turbidity outside the acceptable levels .
the study findings showed that some bottled water samples and most of the sachet water samples had total coliform above the acceptable levels for human consumption and the deference was statistically significant between the 2 categories ( p = 0.027 ) .
these findings to a greater extent concur with the findings of other studies [ 9 , 1721 , 3235 ] .
however , they are similar to findings from a study carried out in lahore , pakistan , where 3 out of the 10 bottled and 4 out of the 15 sachet water brands tested did not meet who and national standards of 0 cfu per 100 m , and other studies in sub - saharan africa , where detectable total coliforms were found in packaged water [ 5 , 37 ] . correspondingly , the proportion of sachet water contaminated with total coliforms at 73.3% was higher than that in a study conducted in accra , ghana , where only 18% of the samples exceeded this level .
the rate of total coliform contamination in sachet water was higher than that in bottled water .
this finding concurs with those of studies conducted in delhi and jaipur , india ; dar es salaam , tanzania ; and kumasi , ghana [ 18 , 20 , 25 , 32 ] . furthermore ,
none of the samples of both bottled water and sachet water were positive for faecal coliform and exceeded the acceptable turbidity level and ph range .
this finding is consistent with the finding of other studies conducted by [ 9 , 13 , 32 , 39 ] who found out no microbial indicators of faecal contamination in packaged water .
the presence of total coliform in packaged water can be linked to a number of factors such as the raw water source used , hygienic practices observed during production , improper storage in unhygienic and high temperature conditions , and lack of protective measures due to the common treatment methods used ( ozonation and ultraviolet light ) against bacterial regrowth [ 40 , 41 ] . in view of this , the possibility of regrowth of microorganisms is greatly increased considering that the temperature in kampala may be as high as 28c .
studies conducted in the united arab emirates and united states of america demonstrated that organisms multiply more easily between 25c and 37c [ 21 , 42 ] .
another study carried out in freetown , sierra leone , showed that increase in concentration of total coliforms may be due to growth of microorganisms already present within the packaged water .
the findings suggest need for the government and other stakeholders to intensify surveillance activities and enforce strict hygienic measures in this rapidly expanding industry to improve water quality .
the source and treatment process of sachet water therefore need further investigation . some of the possible reasons why sachet water is more likely to be contaminated than bottled water could be attributed to better hygienic practices observed in the bottled water industry compared to sachet water industry .
these include use of protective sealed caps on bottles , improved and hygienic filling system , source of water , time between production and sale , and use of nonreturnable plastic containers [ 5 , 18 , 20 ] . in kampala the most common source of water used in sachet water
there may also be a possibility that sachet water was contaminated before packaging as observed by [ 23 , 44 ] .
other reasons could be due to plastic sachets that can easily be punctured and leak compared to plastic bottles ; sachet water is most likely to be hand filled with water of suspect quality under unhygienic conditions and sold cheaply ; it is much easier to reseal a plastic sachet than to mend the broken seal of water bottle for producing counterfeits .
lastly , sachet water producers are operating illegally ; therefore , they are not registered and being monitored . despite the presence of total coliforms in some packaged water samples , it may be safer than other alternative drinking water sources .
presence of faecal coliform is the most important indicator for water contamination . during the typhoid outbreak in kampala , majority of the water sources tested
in addition , spring water sources in kampala were found to be contaminated with faecal coliform . with only 85% of the population in kampala having access to improved sources of drinking water
, many consumers may resort to alternative sources , including sachet water , wells , and springs , among which sachet water may be the safest .
therefore , there is need to balance protection of public health and access to drinking water as emphasized in some studies conducted in sierra leone and ghana [ 5 , 47 ] .
these findings suggest the need for the government and other stakeholders to intensify surveillance activities and enforce strict hygienic measures to packaged water industries to improve water quality , the source , treatment process , and stage ( retail outlet or manufacturing premises ) of packaged water contamination should be investigated .
it can be concluded from the results of this study that both bottled water and sachet water sold at retail outlets were free from faecal contamination .
majority of sachet water samples were contaminated with total coliform above acceptable limits for human consumption .
findings suggest need for the government and other stakeholders to intensify surveillance activities and enforce strict hygienic measures to packaged water industries and retail outlets to improve water quality . the source , treatment process , and stage ( retail outlet or manufacturing premises ) of packaged water contamination should be investigated . | ### Summary:
: objective . to assess the bacteriological and physical quality of locally packaged drinking water sold for public consumption . methods .
this was cross - sectional study where a total of 60 samples of bottled water from 10 brands and 30 samples of sachet water from 15 brands purchased randomly were analyzed for bacteriological contamination ( total coliform and faecal coliform per 100 ml ) using membrane filtrate method and reported in terms of cfu/100 ml . results .
both bottled water and sachet water were not contaminated with faecal coliform .
majority ( 70% , 21/30 ) of the sachet water analyzed exceeded acceptable limits of 0 total coliforms per 100 ml set by who and the national drinking water standards .
the physical quality ( turbidity and ph ) of all the packaged water brands analyzed was within the acceptable limits .
there was statistically significant difference between the median count of total coliform in both sachet water and bottled water brands ( u(24 ) = 37.0 , p = 0.027 ) .
conclusion . both bottled water and sachet water
were not contaminated with faecal coliforms ; majority of sachet water was contaminated with total coliform above acceptable limits .
government and other stakeholders should consider intensifying surveillance activities and enforcing strict hygienic measures in this rapidly expanding industry to improve packaged water quality . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: differentiated thyroid carcinoma , especially papillary thyroid carcinoma ( ptc ) , commonly metastasizes to the regional lymph nodes , lungs , and bone .
however , the brain is an uncommon site of metastasis , being found only in 0.15%1.3% of cases.1 moreover ; cerebellar metastases from ptc are exceptionally rare , with only 13 reported cases of cerebellar metastasis from ptc having been published so far.2 herein , we describe and discuss the signs and symptoms , diagnostic work - up , differential diagnosis , and management in three cases of cerebellar metastasis from ptc .
a 74-year - old female with a diagnosis of ptc , tall cell variant ( pt3n1am0 ) , underwent total thyroidectomy , followed by radioactive iodine ablation ( 150 mci ) in february 2009 .
the patient was taking l - thyroxine 125 g as thyroid replacement therapy , and remained in complete remission until june 2013 , when she presented with a 3-month history of left upper neck pain .
magnetic resonance imaging of the brain revealed an enhancing mass involving the left side of the clivus and the left occipital condyle ( figure 1 ) .
computed tomography ( ct ) showed intense hypermetabolic activity ( standardized uptake volume 138 ) , corresponding to the destructive mass involving the clivus and left occipital condyle ( figure 2 ) .
histopathology of the biopsy revealed tall papillary cells ( height at least two or three times their width ) mixed with small fragments of bone , and immunopositivity for thyroid transcription factor-1 and cytokeratin 19 confirmed the diagnosis of metastatic tall cell variant ptc ( figure 3 ) .
the patient was treated with external beam irradiation via intensity modulated radiotherapy ( imrt ) .
a total dose of 6,600 cgy was delivered to the tumor in 33 fractions over 6.5 weeks .
follow - up has been undertaken for 18 months , and the patient has remained clinically asymptomatic without any evidence of recurrence or distant metastases .
a 67-year - old female with a diagnosis of ptc insular variant ( pt4n1bm0 ) underwent total thyroidectomy and neck dissection in april 2011 . after surgery ,
she was treated with radioactive iodine ( 150 mci ) and thyroid bed irradiation via imrt with a dose of 66 gy in 33 fractions , in september 2011 , she developed lung metastasis , and was treated with a second radioactive iodine ablation dose ( 200 mci ) . in august 2013 ,
neurological findings were cranial nerve ii , iii , and v palsies on the left side .
whole body scintigraphy showed intense foci of uptake in the skull base and in both lungs .
ct brain revealed an infiltrative enhancing mass occupying the right cavernous sinus and extending to the pituitary fossa and clivus ( figure 4a and b ) .
histopathological examination of a transnasal - transsphenoidal biopsied lesion revealed islands of small uniform cells , areas of tumor necrosis , and microfollicles with thyroglobulin , which confirmed the diagnosis of metastatic ptc , insular variant ( figure 5 ) .
the lesion was treated with imrt , and a total dose of 6,000 cgy in 30 fractions was delivered to the tumor over 6 weeks without any significant acute toxicity .
after completion of imrt , the patient was given a third radioactive iodine ablation dose ( 150 mci ) . at 14 months of follow - up , the patient was alive with progressive in disease in the lungs , an elevated thyroglobulin level ( 5,000 g / l ) , and a stable skull base lesion .
a 65-year - old male underwent total thyroidectomy for multifocal ptc , follicular variant ( pt3n1m0 ) , followed by radioactive iodine ablation ( 150 mci ) in july 2006 .
the patient was on thyroid replacement therapy with l - thyroxine 150 g , and was in complete remission until december 2013 , when he presented with a 2-month history of headache , dysphagia , hoarseness , dysarthria , and hearing impairment .
pertinent neurological findings were cranial nerve ix , x , xi , and xii palsies on the left side ( collet - sicard syndrome ) with moderate sensorineural hearing loss and 100% word recognition on the affected side .
ct / magnetic resonance imaging brain revealed a large infiltrative mass involving the petrous , tympanic , and mastoid parts of the left temporal bone with intracranial extension .
there was also evidence of invasion of the left sigmoid sinus , left internal jugular vein , and left internal auditory canal ( figure 6 ) .
histopathological examination confirmed the diagnosis of metastatic ptc , follicular variant ( figure 7 ) .
following surgery , the residual tumor was treated with imrt , using a total dose of 6,000 cgy in 30 fractions .
after 12 months of follow - up , the patient remained well without any signs of progression or treatment - related complications .
skull base metastasis ( sbm ) of differentiated thyroid carcinoma shows a predominance of follicular thyroid carcinoma ( ftc ) , because ftc is more prone to spread via the hematogenous route to the lungs and bone.2 however , sbm from ptc is rare . to date , only ten cases of sbm from ptc have been reported ( table 1).311 in agreement with the reported cases , sbm in our series were seen in the sixth and seventh decades of life , at a mean age of 68.6 ( range 6574 ) years , and the mean interval between initial diagnosis and sbm was 56.3 ( range 2889 ) years.3,8 in our series , two patients with aggressive variants of ptc ( tall cell and insular ) were recognized . according to the recent literature , these aggressive variants have a worse prognosis than classic ptc , and patients with these variants should be treated aggressively with thyroidectomy , neck dissection , and radioactive iodine , regardless of tumor size.12 the most common symptoms of sbm from ptc in our series were headache and cranial nerve palsies , which is in agreement with reports in the literature.11,12 however , a rare presentation of collet - sicard syndrome ( cranial nerve ix , x , xi , and xii palsies ) was also described , which is the first reported case in sbm from ptc.13 diagnosis of sbm is challenging , because these lesions are often mistaken for chordoma , chondrosarcoma , meningioma , or schwannoma on ct and magnetic resonance imaging.14 biopsies should be performed in such cases for definitive diagnosis . in our series ,
complete surgical resection is often difficult because of the presence of adjacent vital structures ( brainstem , cochlea , and cranial nerves ) , cerebrospinal fluid leak , and bleeding . in our series , one patient had safe partial resection via a transcranial far lateral approach , which was found in agreement with the literature.15 for unresectable and residual tumors , radiation therapy is feasible option . with the advent of novel techniques in radiation therapy ( imrt , protons , carbon ions , and stereotactic radiosurgery ) , it is now possible to deliver a high dose to the tumor to achieve better local control without any serious acute toxicity , as seen in our series.16 in conclusion , sbm from ptc is a rare clinical entity , and is often associated with cranial nerve dysfunction .
histopathological tissue diagnosis should always be attempted to initiate effective treatment , which relies on a multidisciplinary approach to prolong disease - free and overall survival rates . | ### Summary:
: skull base metastasis from differentiated thyroid carcinoma , including papillary and follicular thyroid carcinoma , is a rare manifestation . herein , we present three cases of skull base metastasis of papillary thyroid carcinoma . the mean age of the patients was 68.6 ( 6574 ) years , and the mean interval between initial diagnosis and skull base metastasis was 56.3 ( 2889 ) months .
cranial nerve palsies were seen in all patients .
intensity modulated radiation therapy to deliver 6,0006,600 cgy to the skull base metastasis was given to all patients , in addition to partial resection in one patient .
at the time of last follow - up , all skull base metastases were well controlled . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: the neck contains many important structures belonging to the vascular , respiratory , digestive , and neural systems , so penetrating neck trauma can cause significant morbidity and mortality .
the skeletal system does not protect the neck like it does other areas of the body .
the mortality rate was 11% in world war i , 7% in world war ii , and 3 - 6% in civilians today .
gun or knife wounds are the most common causes of penetrating neck injuries : stab wounds cause 1 - 2% , gunshot wounds 5 - 10% and rifles cause 50% of the deaths .
a primary survey should be performed consisting of checking and treating the airway , breathing , and circulation .
it is not easy to make a decision regarding neck exploration . with the current advances in diagnostic capabilities ,
selective management , i.e. , observation and checking for major arterial and venous injury , is the most popular practice now for stable patients with penetrating neck trauma .
saving patients lives is important , but saving the function of the larynx is also important , because people must eat , talk , and breathe .
therefore , to save the function of the larynx , it is important , if at all possible , to preserve damaged tissue and organ fragments .
a laceration in the submental area had been sutured at another hospital . after being followed for 1 hour in the first hospital
subsequently , he developed swelling in the submental region and then progressively worsening respiratory distress .
indirect laryngoscopy showed a mass in the vallecula , and his vocal cords could not be seen clearly .
neck ultrasonography showed a hematoma in the submental region . under orotracheal general anesthesia , we opened the sutures and extended the incision by 1 cm at both ends .
we drained the hematoma and saw that a branch of the lingual artery had been cut .
we ligated the bleeding vessel and followed the incision to the right vallecula . on direct laryngoscopy
, we saw a small laceration on the right anterior vallecula surface and no other pathology .
then , we sutured the cut muscles , platysma , and cutaneous tissue on both sides .
a 53-year - old male was admitted to our emergency room with a laceration in the left neck .
the laceration started in the sternocleidomastoid muscle , a third of the way anterior to the midpoint and continued to the anterior neck midline horizontally [ figure 1 ] .
the injury occurred when he was being shaved by barber who had epilepsy and had a seizure while he was shaving him .
when we examined the patient initially in the emergency room , he was not in respiratory distress .
we saw that the lower third of the sternocleidomastoid muscle , thyrohyoid muscle , and omohyoid muscle had been cut horizontally .
we stopped the bleeding with ligation and sutured the ends of the sternocleidomastoid , thyrohyoid , and omohyoid muscles together .
case 2-lateral view of neck laceration a 53-year - old male was admitted to our emergency room with a deep stab wound in his neck after attempting suicide .
the wound started to the left of the medial head of the sternocleidomastoid muscle and continued horizontally to the right of the medial head of the right sternocleidomastoid [ figure 2 ] .
the thyroid cartilage was cut horizontally and away from the supraglottic region , and the damage continued to the hypopharynx and ended anterior to the prevertebral mucosa [ figure 3 ] . when initially examined in the emergency room , he was in moderate respiratory distress
we did not attempt orotracheal or nasotracheal intubation because of the badly damaged larynx . under local anesthesia
, we made a tracheotomy and then induced general anesthesia . using his self - inflicted wound ,
when we dissected the neck , we saw that the thyroid ala , both laryngeal ventricles , and the lower third of the epiglottis were cut horizontally .
the patient has no significant carotid or venous injuries , although there were some minor venous injuries .
we reconstructed all of the damaged structures and sutured the sinus piriformis mucosa , epiglottis petiole , and thyroid cartilage alae .
he has not had any voice , swallowing , or breathing problems since his tracheotomy was closed .
there is some residual damage to the epiglottis on the right side [ figure 4 ] .
case 3-anterior view of neck laceration case 3-after laceration it was seen that thyroid cartilage was cut horizontally and epiglottis and vocal cords were exposed case 3-endoscopic view of larynx 3 months after surgery we gave all patients second - generation antibiotics for surgical prophylaxis . after 5 days follow - up , the first and second patients were discharged without any complications .
a laceration in the submental area had been sutured at another hospital . after being followed for 1 hour in the first hospital
subsequently , he developed swelling in the submental region and then progressively worsening respiratory distress .
indirect laryngoscopy showed a mass in the vallecula , and his vocal cords could not be seen clearly .
neck ultrasonography showed a hematoma in the submental region . under orotracheal general anesthesia , we opened the sutures and extended the incision by 1 cm at both ends .
we drained the hematoma and saw that a branch of the lingual artery had been cut .
we ligated the bleeding vessel and followed the incision to the right vallecula . on direct laryngoscopy
, we saw a small laceration on the right anterior vallecula surface and no other pathology .
then , we sutured the cut muscles , platysma , and cutaneous tissue on both sides .
a 53-year - old male was admitted to our emergency room with a laceration in the left neck .
the laceration started in the sternocleidomastoid muscle , a third of the way anterior to the midpoint and continued to the anterior neck midline horizontally [ figure 1 ] .
the injury occurred when he was being shaved by barber who had epilepsy and had a seizure while he was shaving him .
when we examined the patient initially in the emergency room , he was not in respiratory distress .
we saw that the lower third of the sternocleidomastoid muscle , thyrohyoid muscle , and omohyoid muscle had been cut horizontally .
we stopped the bleeding with ligation and sutured the ends of the sternocleidomastoid , thyrohyoid , and omohyoid muscles together .
a 53-year - old male was admitted to our emergency room with a deep stab wound in his neck after attempting suicide .
the wound started to the left of the medial head of the sternocleidomastoid muscle and continued horizontally to the right of the medial head of the right sternocleidomastoid [ figure 2 ] .
the thyroid cartilage was cut horizontally and away from the supraglottic region , and the damage continued to the hypopharynx and ended anterior to the prevertebral mucosa [ figure 3 ] . when initially examined in the emergency room , he was in moderate respiratory distress
we did not attempt orotracheal or nasotracheal intubation because of the badly damaged larynx . under local anesthesia
, we made a tracheotomy and then induced general anesthesia . using his self - inflicted wound ,
when we dissected the neck , we saw that the thyroid ala , both laryngeal ventricles , and the lower third of the epiglottis were cut horizontally .
the patient has no significant carotid or venous injuries , although there were some minor venous injuries .
we reconstructed all of the damaged structures and sutured the sinus piriformis mucosa , epiglottis petiole , and thyroid cartilage alae .
he has not had any voice , swallowing , or breathing problems since his tracheotomy was closed .
there is some residual damage to the epiglottis on the right side [ figure 4 ] .
case 3-anterior view of neck laceration case 3-after laceration it was seen that thyroid cartilage was cut horizontally and epiglottis and vocal cords were exposed case 3-endoscopic view of larynx 3 months after surgery we gave all patients second - generation antibiotics for surgical prophylaxis .
after 5 days follow - up , the first and second patients were discharged without any complications .
anatomically , the neck can be divided into three major zones for surgery : zone 1 , below the cricoids to the thoracic inlet ; zone 2 , from the cricoids to the angle of the mandible ; and zone 3 , above the angle of the mandible .
if a neck laceration is limited to within the platysma muscle , serious morbidity is unlikely .
waseem and gernsheimer reported a 16-year - old boy with a minimal laceration on the neck , but serious injuries to the larynx and esophagus . in our study
, all three patients neck lacerations reached the subplatysmal region . in the initial assessment and management of any critically ill patient , maintaining the airway , breathing , and circulation ( abc ) are the first steps .
a portable flexible laryngoscope might be helpful for examining a patient with a cut throat in the emergency room .
if the patient has difficulty with respiration , orotracheal , or nasotracheal intubation should be tried first .
the probability of success in airway management is further increased by the provision of equipment and skills for advanced airway management , including endotracheal intubation and cricothyroidotomy .
if there is a large laceration in the neck , the laryngeal structures appear to be badly damaged , and the patient is in worsening respiratory distress , do not attempt oral or nasal intubation , but perform an emergency tracheotomy .
the patient 's hemodynamic system should be examined , and hemogram and coagulation parameters should be measured .
if a patient 's vital signs are stable and the patient is not in hypovolemic shock or serious respiratory distress , the physical examination can be performed in the emergency room .
additionally , doppler ultrasonography and computed tomography ( ct ) angiography are useful for detecting carotid and venous system injuries . in two patients ,
as one patient needed an emergency tracheotomy , we did not have time for a radiological examination , but called a cardiovascular surgeon for a consultation in the operating room .
the indications for neck exploration with a neck laceration are continuing hemorrhage , serious respiratory distress , subcutaneous emphysema , a hematoma of the neck , hematemesis , hemoptysis , hoarseness , and stridor .
all three of our patients had hemorrhage , two had respiratory distress , and one had hemoptysis [ table 1 ] .
clinical characteristics of the reported subjects our first patient was not followed sufficiently after treatment at the first hospital .
anyone with a neck laceration who needs surgical treatment should be followed for at least 24 hours after the operation before he or she is discharged .
this could prevent morbidity caused by hemorrhage . in our second case , we opted for orotracheal intubation because the patient was not in respiratory distress , his vital signs were normal , and we did not detect any damage to the larynx .
our third case presented to our emergency department after attempting suicide . attempted suicide by cutting the throat is rare . in a right - handed patient ,
the incision starts on the left side of the neck and continues to the right side .
stone and callahan reported that with vascular injury , the mortality rate of neck lacerations was 50% . in our series
, it is helpful to consult a vascular surgeon in the operating room . with extensive laryngeal injury
a total or partial laryngectomy or tracheal pull - up and re - anastomosis might be needed in some cases . in our case
we reconstructed all of the damaged structures , suturing the sinus piriformis mucosa , epiglottis petiole , and two thyroid cartilage alae .
, there was no pathology on indirect laryngoscope other than a small defect in the right epiglottis surface .
therefore , it is beneficial to reconstruct all of the laryngeal structures whenever possible , even when the laryngeal skeleton has been damaged seriously .
lacerations in the pharyngo - esophageal region can be missed when the patient is first examined .
the esophagus is sheltered by the larynx cartilages and is not easily injured . in one series of penetrating neck lacerations ,
15% had vascular injuries , 10% had laryngotracheal injuries , and 7% had esophageal injuries . in our small series , 66% had laryngeal injuries , 33% had minor vascular injuries , and 0% had esophageal injuries .
airway management is the first action , if the patient has no significant vascular injury .
all patients who have penetrating neck trauma should be examined periodically for hematoma or edema of the neck .
voice quality and airway patency might be improved if laryngeal repair is performed within 24 hours of trauma .
ct angiography should be performed for all neck penetration patients whose injuries penetrate the platysma .
a patient who has a neck injury should be admitted and monitored for 24 hours after surgical treatment . | ### Summary:
: in head and neck surgery , penetrating neck injuries are uncommon .
the neck contains many important structures , so such trauma can cause significant morbidity and mortality . a patient with penetrating neck trauma
should be examined promptly in the emergency room .
if possible , damaged tissue and organ fragments should be preserved carefully . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: the nitric oxide ( no ) in the lung / airways has a key role as a vasodilator , bronchodilator , neurotransmitter and inflammatory mediator . exhaled nitric oxide ( feno ) and nasal nitric oxide
( n no ) measurement is an area of ongoing research in the study of airway inflammation .
the feno level measurement has been validated and standardized for supporting the diagnosis in cases of eosinophilic inflammation of airways , bronchial hyperreactivity and asthma .
feno levels have been higher in atopic than non - atopic bronchial asthma patients and some studies also reported that healthy atopic subjects without symptoms or signs of airway disorders have higher feno levels than non - atopic subjects .
similarly the effect of clinical atopy , with atopic cases having higher levels as compared to non - atopic cases . to
the best of our knowledge , the literature on exhaled breath and nasal nitric oxide from india is lacking .
hence , this study was undertaken to answer the question about the relationship between the noninvasive methods of nitric oxide measurements in bronchial asthma and allergic rhinitis and their correlation with atopic profile of indian population .
the diagnosed patients of bronchial asthma ( ba ) , allergic rhinitis ( ar ) and bronchial asthma with allergic rhinitis ( ba - ar ) were enrolled for the study from the outpatient clinics .
a total of 90 subjects ( 36 females and 54 males ) aged between 6 - 38 years were evaluated and they were divided into 4 groups : group a - 25 bronchial asthma ( without allergic rhinitis ) ; group b - 25 allergic rhinitis ( without bronchial asthma ) ; group c - 25 bronchial asthma with allergic rhinitis and group d - 15 controls . patients from all the 4 groups were further subdivided into atopic and non - atopic subgroups based on the skin prick test results for the purpose of analysis .
the diagnosis of asthma and allergic rhinitis were based on global initiative for asthma ( gina ) and allergic rhinitis and its impact on asthma ( aria ) respectively .
other exclusion criterion were 1 ) smoker ( former and current smokers ) 2 ) inhaled / nasal / oral steroid intake in preceding one month 3 ) episode of upper or lower respiratory tract infection in the preceding one month and 4 ) history of urticaria / eczema .
all the 90 subjects underwent a battery of investigations including baseline spirometry , feno and n no measurements , skin prick tests and blood sampling , absolute eosinophil counts and serum total ige levels .
written informed consent was obtained from all subjects / parents ( in case of subject 's age < 18 years ) to participate in the study .
the measurements of exhaled nitric oxide and nasal nitric oxide was performed using niox chemiluminescence analyzer ( aerocrine ab , solna , sweden ) in accordance with the 2005 ats / ers recommendations .
the patient was inserted the mouthpiece , inhaled through mouth to total lung capacity ( tlc ) and then immediately exhaled at a constant flow rate ( 50 ml / s ) to residual volume without breath - holding .
the duration of exhalation had to be sufficient ( > 4 seconds in subjects < 12 years and > 6 seconds in subjects > 12 years ) .
repeated , reproducible exhalations were performed to obtain at least two no plateau values that agreed with in 10% of each other .
the mean level of two reproducible recordings was used as the result value . the n no measurement
the measurements were always performed at the same place and the sampling timing was between 10 - 11 am .
skin prick testing ( spt ) to 58 common aeroallergens was performed in all the patients as per standard guidelines .
these are the commonest aeroallergens in clinical practice of allergy in india as per the study by singh et al .
atopy was defined as a positive skin prick test ( wheal diameter of > 3 mm as compared to buffer saline as control ) for at least 1 aeroallergen .
serum total ige was estimated by elisa method using minilyser - tecan , austria , calbiotech kit as per manufacturer 's instructions .
the number of peripheral blood eosinophils was counted in edta containing blood samples using an automated analyzer .
spirometry was performed on a dry , rolling - seal spirometer of the benchmark model lung function machine ( p.k .
all data analysis was performed using spss statistical package version 16.0 for windows ( spss , chicago , il , usa ) .
the data was examined for distribution and homogeneity of variances was checked before applying parametric tests . the data on feno and n no were expressed as mean sd . the variables were compared between the four groups using one - way analysis of variance ( anova ) and the post hoc bonferroni alpha significant difference test for multiple comparisons .
the univariate analyses of factors associated with feno was done using pearson correlation . the conventional 5% level ( p < 0.05 )
the diagnosed patients of bronchial asthma ( ba ) , allergic rhinitis ( ar ) and bronchial asthma with allergic rhinitis ( ba - ar ) were enrolled for the study from the outpatient clinics .
a total of 90 subjects ( 36 females and 54 males ) aged between 6 - 38 years were evaluated and they were divided into 4 groups : group a - 25 bronchial asthma ( without allergic rhinitis ) ; group b - 25 allergic rhinitis ( without bronchial asthma ) ; group c - 25 bronchial asthma with allergic rhinitis and group d - 15 controls . patients from all the 4 groups were further subdivided into atopic and non - atopic subgroups based on the skin prick test results for the purpose of analysis .
the diagnosis of asthma and allergic rhinitis were based on global initiative for asthma ( gina ) and allergic rhinitis and its impact on asthma ( aria ) respectively .
other exclusion criterion were 1 ) smoker ( former and current smokers ) 2 ) inhaled / nasal / oral steroid intake in preceding one month 3 ) episode of upper or lower respiratory tract infection in the preceding one month and 4 ) history of urticaria / eczema .
all the 90 subjects underwent a battery of investigations including baseline spirometry , feno and n no measurements , skin prick tests and blood sampling , absolute eosinophil counts and serum total ige levels .
written informed consent was obtained from all subjects / parents ( in case of subject 's age < 18 years ) to participate in the study .
the measurements of exhaled nitric oxide and nasal nitric oxide was performed using niox chemiluminescence analyzer ( aerocrine ab , solna , sweden ) in accordance with the 2005 ats / ers recommendations .
the patient was inserted the mouthpiece , inhaled through mouth to total lung capacity ( tlc ) and then immediately exhaled at a constant flow rate ( 50 ml / s ) to residual volume without breath - holding .
the duration of exhalation had to be sufficient ( > 4 seconds in subjects < 12 years and > 6 seconds in subjects > 12 years ) .
repeated , reproducible exhalations were performed to obtain at least two no plateau values that agreed with in 10% of each other .
the n no measurement was done using the same analyzer by the nasal aspiration method .
the measurements were always performed at the same place and the sampling timing was between 10 - 11 am .
skin prick testing ( spt ) to 58 common aeroallergens was performed in all the patients as per standard guidelines .
these are the commonest aeroallergens in clinical practice of allergy in india as per the study by singh et al .
atopy was defined as a positive skin prick test ( wheal diameter of > 3 mm as compared to buffer saline as control ) for at least 1 aeroallergen .
serum total ige was estimated by elisa method using minilyser - tecan , austria , calbiotech kit as per manufacturer 's instructions .
the number of peripheral blood eosinophils was counted in edta containing blood samples using an automated analyzer .
spirometry was performed on a dry , rolling - seal spirometer of the benchmark model lung function machine ( p.k .
all data analysis was performed using spss statistical package version 16.0 for windows ( spss , chicago , il , usa ) .
the data was examined for distribution and homogeneity of variances was checked before applying parametric tests . the data on feno and n no were expressed as mean sd . the variables were compared between the four groups using one - way analysis of variance ( anova ) and the post hoc bonferroni alpha significant difference test for multiple comparisons .
the univariate analyses of factors associated with feno was done using pearson correlation . the conventional 5% level ( p < 0.05 )
of the total 90 subjects , 54 were males and rests of 36 subjects were females .
the mean ages , age distribution , anthropometric variables ( height , weight , bmi ) were normally distributed amongst all the groups .
patient demographics and laboratory investigations the mean levels of feno in all the four groups are depicted in table 1 .
all the three groups had higher feno levels compared to the control group [ table 1 ] .
the ba and ba - ar groups had significantly higher levels than the ar group [ figure 1a ] . also , the ba - ar group had higher feno levels when compared to the ba group although the comparison failed to reach statistical significance .
intergroup comparison of feno levels ppb ( mean sd ) ; p < 0.05 statistically significant ; ns- not significant ; ba- bronchial asthma ; ar- allergic rhinitis : ba - ar- bronchial asthma with allergic rhinitis the mean levels of n no in all the four groups are shown in table 1 .
the ar group and ba - ar group had significantly higher n no levels as compared to the control and ba groups [ figure 1b ]
. however , the ba group had n no levels lower than the control group .
intergroup comparison of n no levels ppb ( mean sd ) ; p < 0.05 statistically significant ; ns- not significant ; ba- bronchial asthma ; ar- allergic rhinitis : ba - ar- bronchial asthma with allergic rhinitis the control group had 8 atopic subjects and 7 non - atopic subjects .
the feno levels between the atopic and non - atopic control subjects did not differ significantly ( p = 0.771 ) .
the atopic patients suffering from ba , ar and ba - ar had statistically significant higher levels of feno in comparison to non - atopic patients of same group [ figure 2 ] .
however , in comparison the mean n no levels did not differ significantly ; between the atopic and non - atopic patients in all the four groups .
intragroup comparison of feno levels between atopic and non - atopic patients ; p < 0.05 - statistically significant ba- bronchial asthma ; ar- allergic rhinitis : ba - ar- bronchial asthma with allergic rhinitis the patients in all the four groups were further subdivided into 3 sub - groups on the basis of number of positive responses on spt ; 0 , 1 - 3 and > 3 .
the feno and n no levels were analyzed in these subgroups [ table 2 ] .
the feno levels positively and significantly correlated with the number of positive responses on spt in patients suffering from ba - ar ( p < 0.05 ) . the ba group and
ar group also showed a positive correlation albeit a weaker one ( p = 0.07 ) .
however , no significant correlation of n no levels and number of positive response on spt were found in any of the four groups .
no with spt positivity of number of allergens the serum total ige and aec levels were significantly higher in ba , ar and ba - ar groups when compared to the control group .
however , no significant difference was found in their levels in atopic and non - atopic patients in each of the four groups . in the study , overall feno levels correlated significantly with serum total ige levels ( p = 0.002 ) , however n no levels were not significantly correlated with serum total ige levels ( p = 0.254 ) .
the aec levels also correlated positively and significantly with feno levels ( p = 0.004 ) and n no levels ( p = 0.01 ) .
the pft parameters fev1 , fvc and fev1/fvc did not show a significant correlation with either feno or n no levels .
the mean levels of feno in all the four groups are depicted in table 1 .
all the three groups had higher feno levels compared to the control group [ table 1 ] .
the ba and ba - ar groups had significantly higher levels than the ar group [ figure 1a ] . also , the ba - ar group had higher feno levels when compared to the ba group although the comparison failed to reach statistical significance .
p < 0.05 statistically significant ; ns- not significant ; ba- bronchial asthma ; ar- allergic rhinitis : ba - ar- bronchial asthma with allergic rhinitis
the mean levels of n no in all the four groups are shown in table 1 .
the ar group and ba - ar group had significantly higher n no levels as compared to the control and ba groups [ figure 1b ] . however , the ba group had n no levels lower than the control group .
intergroup comparison of n no levels ppb ( mean sd ) ; p < 0.05 statistically significant ; ns- not significant ; ba- bronchial asthma ; ar- allergic rhinitis : ba - ar- bronchial asthma with allergic rhinitis
the feno levels between the atopic and non - atopic control subjects did not differ significantly ( p = 0.771 ) .
the atopic patients suffering from ba , ar and ba - ar had statistically significant higher levels of feno in comparison to non - atopic patients of same group [ figure 2 ] .
however , in comparison the mean n no levels did not differ significantly ; between the atopic and non - atopic patients in all the four groups .
intragroup comparison of feno levels between atopic and non - atopic patients ; p < 0.05 - statistically significant ba- bronchial asthma ; ar- allergic rhinitis : ba - ar- bronchial asthma with allergic rhinitis
the patients in all the four groups were further subdivided into 3 sub - groups on the basis of number of positive responses on spt ; 0 , 1 - 3 and > 3 .
the feno and n no levels were analyzed in these subgroups [ table 2 ] .
the feno levels positively and significantly correlated with the number of positive responses on spt in patients suffering from ba - ar ( p < 0.05 ) .
the ba group and ar group also showed a positive correlation albeit a weaker one ( p = 0.07 ) .
however , no significant correlation of n no levels and number of positive response on spt were found in any of the four groups .
the serum total ige and aec levels were significantly higher in ba , ar and ba - ar groups when compared to the control group .
however , no significant difference was found in their levels in atopic and non - atopic patients in each of the four groups . in the study , overall feno levels correlated significantly with serum total ige levels ( p = 0.002 ) , however n no levels were not significantly correlated with serum total ige levels ( p = 0.254 ) .
the aec levels also correlated positively and significantly with feno levels ( p = 0.004 ) and n no levels ( p = 0.01 ) .
the pft parameters fev1 , fvc and fev1/fvc did not show a significant correlation with either feno or n no levels .
exhaled nitric oxide ( feno ) measurement is non - invasive , simple and well tolerated method and is now used as a clinical biomarker for assessment of airway inflammation .
similarly , nasal nitric oxide ( n no ) measurement is useful in the diagnosis , treatment and follow - up of patients with nasal pathology , especially because as it is noninvasive . in the present study we have demonstrated that healthy individuals had mean feno levels of 12.73 7.8 ppb whereas other studies on chinese , african population and data from asthma and allergy research group had mean feno levels ranging from 20 - 39ppb . in a study by ciprandi et al .
, the children suffering from asthma and rhinitis had mean feno levels of 41 ppb , with asthma had 37 ppb and those with rhinitis had 31 ppb ( p < 0.001 ) .
we also found that feno levels were highest in ba - ar group ( 41.44 29.9 ppb ) followed by ba group ( 34.96 17.2 ppb ) and ar group ( 16.40 10.3 ppb ) . in agreement with the literature , we observed higher feno levels in ba and ba - ar groups in comparison to the control group ( p < 0.05 ) and ar group ( p < 0.05 ) .
the measurement of nasal inflammation in ar would rely on detecting increased levels of nasal no resulting from increased expression of inos ( inducible nitric oxide synthase ) , akin to the increase of exhaled nitric oxide levels in bronchial asthma . in a study by stewart et al .
, the mean n no levels of 853.3 ppb in ar and 763.4 ppb in ba - ar groups were higher in comparison to 674.1 ppb levels in ba group . in our study
also the n no levels in ar ( 271.44 120.3 ppb ) and ba - ar groups ( 336.42 124.6 ppb ) were significantly higher in comparison to ba group ( 100.58 111.2 ppb ) and control group ( 114.50 76.0 ppb ) .
the above findings are attributed to increase in local production of nitric oxide in nasal epithelium in patients suffering from allergic rhinitis .
we did not find any statistical difference among any other groups for n no levels .
these results were in agreement with the previous studies by kharitonov et al . , and lee et al .
the effect of presence and degree of clinical atopic conditions on feno levels has been addressed in the literature .
the higher feno levels in atopic asthmatics has been documented , however the effect of atopy on feno levels of healthy subjects requires further validation .
in his study showed atopic constitution , defined as positive skin prick test results , which does not increase feno levels in healthy nonsmoking adults with no signs or symptoms of airway disorders .
similar to this study , we also found no significant difference in feno levels with respect to atopic status in the control group . in the present study the atopic ba , ar and ba - ar subjects had significantly higher feno levels in comparison to non - atopic subjects of the same group .
et al . the atopic allergic rhinitis subjects had statistically significant higher feno levels when compared to non - atopic subjects .
similar result was observed in the present study and this supports the hypothesis of a presence of subclinical inflammation of lower airways , and may predict development of asthma in future .
we found higher levels of nno in atopic subjects of ba , ar and ba - ar in comparison to non - atopic subjects ; though the relationship was statistically not significant .
the association between the degree of atopy and feno levels has been studied by ho et al . and strunk et al . , and they concluded that as number of positive responses on skin prick test increases , the feno levels also increases .
we also found the similar positive correlation between feno levels and number of positive responses on spt in ba - ar group ( p < 0.05 ) .
similarly , atopic ba subjects also showed a positive correlation albeit a weaker one ( p = 0.07 ) .
the plausible explanation for this finding has been attributed to difference of inflammatory cells recruitment in atopics ( eosinophilic ) and non - atopic asthmatics ( neutrophilic ) as well as to cell activity of no producing cells . however , in a study by moore et al .
, in asthmatics feno was not always associated with the number of positive skin prick test response .
thus , there exists a complex relationship between atopic profile and feno levels which requires further evaluation .
also , we found no significant association between n no levels and the number of allergens positive on spt in any of the groups of our study .
the higher feno and n no levels in atopic subjects could be attributed to induction of inos enzyme .
inos is the characteristic enzyme found in association with mucosal mast cells , eosinophils , and t - lymphocyte activation as described in cases of allergic rhinitis and bronchial asthma . in bronchial biopsies of asthmatics an up regulation of expression of inos
has been observed and immuno - cytochemical studies have also demonstrated expression of noss in human nasal mucosa .
the feno and n no levels are known to be influenced by age , sex , height , smoking and atopy status of the individual . in current study , all the groups ( ar , ba , ba with ar and controls ) were comparable with respect to all these factors except the atopic status .
hence , we could evaluate correlation of atopic status with feno and n no levels .
hence , a further large - scale population based study is required for assessing applicability of feno and n no levels in evaluation of ba and/or ar patients .
feno and nno may serve as non - invasive marker of airway inflammation and atopy .
hence , they can be used for early recognition of airway inflammation and also as a guide for follow - up and management of ba and ar .
this requires further large scale studies to validate the levels of feno and n no and simultaneously confirm the correlation with atopic status .
in conclusion , the feno levels reflect the inflammatory activity of the airway epithelium and is associated with presence as well as degree of atopy in a sensitized patient , determined by positive skin prick test results to common aeroallergens .
the study also highlights the need for evaluation of patient for the existence of allergic rhinitis or bronchial asthma in cases with higher feno levels . the n no levels can be used as an inflammatory marker for supporting the diagnosis of coexisting allergic rhinitis in bronchial asthma patients .
further , large scale studies are required to develop reference equations and cutoff values for feno and n no levels to aid in diagnosis and follow - up in indian population . | ### Summary:
: objective : exhaled nitric oxide ( feno ) and nasal nitric oxide ( n no ) measurement is an area of ongoing research in the study of airway inflammation .
the atopic status is known to influence the levels of feno and n no .
this study was undertaken to study the relationship between nitric oxide measurements in bronchial asthma and allergic rhinitis along with their correlation with atopic profile of indian population.materials and methods : ninety subjects were recruited for the study comprising of 25 each of bronchial asthma ( ba ) , allergic rhinitis ( ar ) , bronchial asthma with allergic rhinitis ( ba - ar ) and 15 healthy controls . these were assessed for atopy and exhaled breath analysis of nitric oxide .
the measurements of feno and n no levels were done using niox chemiluminescence analyzer .
atopy was assessed by skin prick testing ( spt ) against 58 common aero - allergens and subjects with 1 positive spt were labeled as atopic.results:the ba - ar and ba groups had higher feno levels in comparison to the control ( p < 0.05 ) and ar group ( p < 0.05 ) .
the ar and ba - ar groups had higher n no levels compared to the control group ( p < 0.05 ) and ba group ( p < 0.05 ) .
the increasing feno levels significantly correlated with the increase in the number of allergen sensitization in patients suffering from ba - ar ( p < 0.05 ) .
however , the ba group showed a weaker positive correlation ( p = 0.07).conclusion : feno is a non - invasive marker of airway inflammation .
also , feno levels correlate with presence and degree of atopy in ba and ar .
simultaneously , n no could be a surrogate marker of rhinitis . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: flap advancement is an integral part of root coverage procedures . when re - adapting flaps , coronal positioning facilitates healing by primary intention .
possible complications documented in mucogingival surgeries include bleeding , pain , necrosis of the graft or the overlying flap , hemorrhage , ecchymosis and swelling .
occurrence of such post - operative complications is a major factor determining the patient 's future attitude to the treatment procedures .
a recent study has shown comparable results with that of the connective tissue graft technique , which has the most predictable outcome for root coverage .
this technique is usually indicated in patients with a thick gingival biotype as in these cases , the periosteum has sufficient thickness and can be easily manipulated on to the root surface .
it is also the technique of choice in cases where the patient is not willing to go for a second donor site surgery .
this is a case series involving gingival recession in five patients in the maxillary canine - premolar area , which were treated at our facility using this periosteal pedicle graft ( ppg ) technique .
although the procedure showed acceptable clinical results in terms of root coverage , excessive post - operative edema involving the canine space , was observed the next day after surgery , without exception in all the five cases .
although some amount of swelling is expected after coronal repositioning of a flap , the extent of swelling noted in these cases was unacceptable as it caused considerable patient morbidity and apprehension .
this article highlights the clinical appearance of this complication , its severity and discusses ways by which it may be prevented .
this was an observation that the author came across while performing a randomized controlled clinical trial in assessing the efficacy of the ppg as a root coverage procedure .
the mean age of the patients was 37.5 years ( range 28 - 48 years ) .
the recessions were present in relation to the maxillary canine or first premolar tooth [ figure 1 ] , belonging to miller class i recession . there was a vertical recession depth of 4 mm in two of the cases , and 3 mm in the remaining three cases from the cement - enamel junction .
scaling and root planing was performed on all the five cases prior to the surgical procedure .
gingival recession with respect to the maxillary right canine and premolar the surgical procedure was performed by a single trained calibrated surgeon .
a full thickness flap was elevated 3 - 4 mm apical to the osseous crest .
an incision was made through the periosteum where the flap was still attached to the bone to create a partial thickness flap [ figure 2 ] , and a periosteal pedicle flap raised and inverted over the planed and conditioned root surface [ figure 3 ] .
the periosteum was stabilized using size 4 - 0 resorbable sutures ( vicryl , ethicon ) .
the overlying flap was then coronally positioned over the periosteal graft and sutured using size 4 - 0 surgical silk ( ethicon ) [ figure 4 ] . a non - eugenol pack ( coe - pak )
post - operatively , 400 mg of ibuprofen ( brufen ) was prescribed 3 times a day for 5 days .
chlorhexidine ( 0.12% ) mouth rinse ( periex ) was also prescribed to be used twice a day for 2 weeks .
reflection of a partial thickness flap to expose the periosteum periosteal graft raised and inverted over the recession area partial thickness flap sutured in a coronal position three of the patients reported to the clinic with an extra - oral , painless swelling involving the right canine and buccal spaces on the 2 day after surgery [ figure 5 ] , out of which two cases also exhibited ecchymosis below the lower eyelid .
post - operative swelling in relation to the canine / buccal / periorbital spaces the swelling was firm and tender on palpation and also extended to the lower eyelid in two of the cases .
a considerable amount of apprehension and some skepticism regarding the treatment procedure was noted in all patients .
after initial observation of such an occurrence , in the first two patients ; the patients who followed , were prescribed a serratiopeptidase containing tablet ( lyser - d ) thrice daily for 3 days , post - operatively .
the success of any root coverage procedure not only depends upon the amount of root coverage achieved , but also upon the patient comfort and satisfaction following the procedure .
the authors suggested this technique , as periosteum can be easily harvested near the surgical site itself and does not require a secondary donor site .
hence , the need for a second surgical site as in case of a sub - epithelial connective tissue graft is eliminated .
furthermore , periosteum has a rich vascular plexus , and the periosteal cells tend to release vascular endothelial growth factors , which may play a role in new attachment procedure .
patient discomfort was reported to be lesser in case of the ppg as compared to the connective tissue graft , but no complications have been reported until date in relation to this technique . however , in our case , all the patients reported of severe post - operative swelling the next day involving the canine and buccal space area , which persisted for up to 5 days . swelling due to
edema may require up to 72 h in order to peak and is guided by muscle attachments , fascia and bone .
reflection of the periosteum creates a dead space allowing the blood and inflammatory fluid to move in the direction of least resistance .
when the surgical site is in the canine premolar area , the blood that gets collected in the infraorbital space tends to coagulate and can give rise to hematoma formation .
lengthy surgical procedures may create extensive tissue injury and prolong vasodilation that in turn permits more fluid to accumulate in the interstitial spaces and results in higher levels of biologic and inflammatory mediators .
thus , we suggest that post - operative complications such as swelling and hematoma formation may be minimized by :
minimizing the duration of the surgerygentle handling of the tissuesavoiding overt reflection of the flap in an attempt to obtain better coverage .
not controlling the bleeding from soft - tissue before suturing , can direct the blood and inflammatory fluid into the infra orbital space .
it is advisable to control the soft - tissue bleeding by applying firm pressure with moist gauze on the flap prior to suturing .
minimizing the duration of the surgery gentle handling of the tissues avoiding overt reflection of the flap in an attempt to obtain better coverage .
not controlling the bleeding from soft - tissue before suturing , can direct the blood and inflammatory fluid into the infra orbital space .
it is advisable to control the soft - tissue bleeding by applying firm pressure with moist gauze on the flap prior to suturing .
edema and related morbidity seem to be a constant and expected complication of ppg when used in the maxillary canine / premolar area .
these complications can be minimized by some of the above mentioned precautions and post - operative care methods .
the aim of this case series was to highlight one of the possible frequent complications of the ppg technique , which should be kept in mind while selecting this particular procedure for recession coverage . | ### Summary:
: post - operative complications following flap surgeries or mucogingival procedures are important factors influencing patient 's perception of periodontal procedures .
hence , it is important to foresee such complications and take adequate measures pre- and post - operatively .
we treated five consecutive cases of gingival recession in the maxillary canine - premolar area using the inverted periosteal graft with a coronally positioned flap technique . following each of these surgeries , the patients complained of post - operative swelling the next day involving the canine space or buccal space area .
the swelling persisted for at least 5 days , however , it was painless .
this paper highlights the post - operative complications associated with the said procedure and makes a case for detail enquiry in the form of controlled studies . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: transverse testicular ectopia ( tte ) is a rare congenital anomaly in which both testes descend through a single inguinal canal .
several co - morbidities of tte , such as persistent mullerian duct syndrome and inguinal hernia , have been reported , but tte with disorders of sex development dsd ) is rare .
a 8-year - old boy with 45,xo/46,xy dsd with proximal hypospadias was presented to our hospital for further examination for a left inguinal mass .
he underwent one - stage hypospadias repair for scrotal hypospadias and exploratory laparotomy in another hospital when he was one year old . at that time
the right spermatic vessels and vas deferens , which ran into the left inguinal internal ring along with the left spermatic vessels and vas deferens , was found in the exploratory laparotomy , and the right testis was diagnosed as a vanishing testis via left scrotal approach because a similar structure like the nubbin was located cephalad to the left testis .
after that , he was referred to our hospital for a small tumor positioned cephalad to the left testis .
physical examination revealed a normally positioned left testis and a small tumor cephalad to the left testis .
ultrasound showed a homogeneous mass like a normal testis cephalad to the left testis , so we suspected right tte .
laparoscopy revealed that the right spermatic vessels and vas deferens ran into the left inguinal internal ring along with the left spermatic vessels and vas deferens , and we did nt find any persistent mullerian duct and right intraabdominal testis [ figure 1 ] .
subsequently , we found two separate spermatic cords and gonads in the left inguinal exploration [ figure 2 ] .
the perioperative histopathological examination revealed normal testicular tissue , and therefore we performed trans - septal orchidopexy for the right testis under laparoscopic guidance .
( a ) the right vas deferens and testicular vessels are seen entering the left internal inguinal ring along with the left vas deferens and testicular vessels .
( b ) schema of the laparoscopic fi ndings : ( 1 ) left internal inguinal ring , ( 2 ) left spermatic vessels , ( 3 ) right spermatic vessels , ( 4 ) right vas deferens , ( 5 ) left vas deferens , and ( 6 ) left medial umbilical ligament .
tte is a rare congenital anomaly in which both testes descend through a single inguinal canal .
although tte often coexists with abnormalities such as inguinal hernia and persistent mullerian duct syndrome , dsd in combination with tte is extremely rare .
dsd affect approximately 2 in 10,000 live births , but there are no previous reports about dsd with sex chromosomal abnormality in combination with tte .
various anatomic factors ( defective implantation , rupture , or tearing of the gubernaculum , obstruction of the internal inguinal ring , development of adhesions between the testis and adjacent structures , late closure of the umbilical ring , etc . )
are suggested as causative or inducible factors in failure of testicular descent . in this case , considering coexisting dsd with sex chromosomal abnormality , inappropriate androgen secretion or abnormality of androgen receptor might have contributed to the development of tte . also , rare cases of anti - mullerian hormone gene mutations with unilateral tte with absence of mullerian duct structures have been reported .
laparoscopy clearly reveals the anatomy of internal inguinal ring and intraperitoneal space , and is helpful in performing bilateral orchidopexy in tte without confusion regarding the laterality of the testes . especially in case of impalpable testis with dsd , laparoscopy is very useful tool for searching the localization of impalpable testis and internal genitalia at one time .
this case is a first report about dsd with sex chromosomal abnormality in combination with tte .
laparoscopy is very useful for both diagnosis and treatment of tte especially in patients with dsd to examine the internal genitalia concomitantly . | ### Summary:
: transverse testicular ectopia ( tte ) is a rare congenital anomaly .
although tte often coexists with abnormalities such as inguinal hernia and persistent mullerian duct syndrome , disorders of sex development ( dsd ) in combination with tte is extremely rare .
we report a case of dsd with sex chromosomal abnormality in combination with tte . to our knowledge
, this case report is a first presentation of such anomaly . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: in the field of neurosurgery , newly established treatments have always been preceded by technical advancements .
the treatment paradigm of cerebral aneurysms has changed since the introduction of detachable coils for endovascular therapy approximately 20 years ago . to overcome the previous drawbacks of surgical clipping and to improve surgical outcomes ,
several tools are recently been introduced , and the direction of progress is towards robotic neurosurgery . among several tools for minimally invasive neurosurgery , the keyhole approach and neuroendoscopy have been the focus since 1990s , owing to technical advancements after a long stagnation from the initial concept and proposed techniques .
the authors reviewed the historical , technical , and clinical perspectives of the keyhole approach and neuroendoscopy for the treatment of cerebral aneurysms .
the history of endoscopy originated with cystoscopy for bladder diseases , and over the past 200 years , this procedure progressed with stepwise technical advancements and clinical applications10,40 ) . in 1806
, philip bozzini devised the basic concept of endoscopy consisting of a long tube and external light source .
antonin jean desormeaux developed and clinically performed a cystoscopy in 1853 and first coined the term
in 1879 , maximilian carl - fredrich nitze developed the first modern endoscope comprising a series of lenses and a platinum filament lamp at the distal tip . in the field of neurosurgery ,
victor de lespinasse performed the first endoscopic procedure of resection of a choroid plexus using cystoscopy in 1910 .
william jason mixter performed the first endoscopic third ventriculostomy for hydrocephalus in 192322 ) , tracy putman adapted the endoscope for electrocauterization in 1934 , and john scarff developed a new system with a mobile cauterizing electrode , irrigation system , fiberoptic illumination , and movable tip in 1935 .
although the potential of endoscopy was recognized , the technical completeness was still immature during this period .
in addition , the introduction of the shunt system in 1952 and microscopy in the 1960s pushed the endoscopy to the back burner of development . however , innovative technical advances by some inventors in the 1950s and 1960s , including harold hopkins , an english optical physicist , led to the reappearance of endoscopy in the neurosurgical field .
harold hopkins and narinder singh kapany developed a fiberoptic cable for light transmission from an external light source in 1950 , and harold hopkins and karl storz invented a rigid high - resolution endoscope with new type of lens in 196640 ) . following another outstanding development in 1969 by george smith and willard boyle at bell s laboratory of a charge - coupled device that converts optical data to electrical impulses , endoscopic systems became more compact and effective2 ) .
a few clinical applications were reported by werner prott for the visualization of the cerebellopontine angle in 197431 ) , by michael apuzzo for the inspection of basilar bifurcation aneurysm , lumbar discectomy and trans - sphenoidal approach in 19771 ) , and by falk oppel for microvascular decompression in 198126 ) . due to the progressive improvement of endoscopy systems and surgical instruments in the 1970s ,
neuroendoscopy has become comparable or even superior to microscopy in selected cases since the 1990s10,40 ) .
generally , neuroendoscopy is commonly used for intraventricular , skull base , spinal , and other lesions .
intraventricular lesions , such as hydrocephalus , cysts and tumours , have been the major target of endoscopic procedures from the beginning .
the endoscopic endonasal approach is the representative approach targeting benign tumours such as pituitary adenoma , craniopharyngioma , chordoma and meningioma , and , recently , cerebral aneurysms . in spine diseases ,
endoscopy is used for thoracoscopic sympathectomy , discectomy , laminotomy , and resection of tumours and cysts . for paediatric cases ,
neuroendoscopy has been applied for hydrocephalus , intraventricular cysts and tumours , skull base tumours , and , recently , craniosynostosis .
cerebrovascular diseases are considered the final target of neuroendoscopy because bleeding hinders the endoscopic view , and controlling the bleeding is difficult under an endoscopic view with limited instruments .
however , the indications are slowly increasing with the introduction of new endoscopic instruments as well as exoscopy .
certain vascular lesions at specific locations ( e.g. , posterior circulation aneurysms ) could be treated more effectively with an endoscopic approach .
looking back on the history of cerebral aneurysm treatment , surgical managements have improved since victor horsley s ligation of the common carotid artery for an ipsilateral cerebral aneurysm in 1855 .
walter dandy performed the first direct neck clipping with a v - shaped silver clip in 19358 ) , and gazi yasargil started to use microscopy in the 1960s20 ) .
the era of endovascular treatment began when guido guglielmi invented detachable coils in 199117 ) , and endovascular intervention is accepted as a primary treatment modality for cerebral aneurysms with lower complication rates and satisfactory outcomes compared to surgical clipping23 ) , to reduce surgical morbidities , much effort has been recently made , such as intraoperative cerebral angiography , intraoperative indocyanine green ( icg ) angiography , intraoperative physiologic monitoring , neuroendoscopy , the keyhole approach , and new instrument designs .
the keyhole approach is not so long that donald wilson and mario brock first attempted a limited craniotomy as a premature step in 1970s3,37 ) , and john jane described a modified supraorbital approach with minimal brain retraction in 198219 ) .
coming into the late 1980s , the concept and indications of a keyhole approach were established by josip paladino and axel perneczky27,30,36 ) . a standard craniotomy supplies a sufficient space for inspection and instruments as well as room for diverse angles of approach towards the target lesion . meanwhile , a keyhole craniotomy provides an essential space for microscopic viewing and 2 or 3 instruments .
a wide range of areas can be approached by varying the microscopic angle of the view ; however , only a fixed and limited approach angle towards one target is permitted via the keyhole . according to the axel perneczky s report in 199836 ) , the keyhole approach is not limited via a limited corridor but is rather a tailored and adjusted method for minimal exposure and retraction of the brain .
its advantages include minimal brain exposure , excellent cosmetic results , preservation of the surrounding structures , and short procedural time .
it also has some disadvantages : less opportunity for changing a plan , weak microscopic illumination , and difficulty in proximal control over the parent arteries .
however , these types of disadvantages can be overcome via preoperative planning with imaging modalities , intraoperative manipulation with instruments such as an endoscope and specific devices , and specific facilities such as a hybrid operating system9 ) .
keyhole approaches may be still inappropriate in cases with a high probability of massive bleeding and brain swelling ; however , the proportion of keyhole surgeries appears to be increasing .
the symbolic and representative approach is supraorbital , which is applicable for most anterior circulation aneurysms .
a supraorbital keyhole craniotomy exposes the anterior cranial fossa just above the orbit and sphenoid ridge ( fig .
it can be classified into 3 types : ( 1 ) superciliary ( or eyebrow ) supraorbital craniotomy ( sso approach)6,28,36 ) ; ( 2 ) frontolateral supraorbital craniotomy ( fl approach)3,38 ) ; and ( 3 ) lateral supraorbital craniotomy ( lso approach)5,18 ) .
when performing the sso approach , surgeons should consider surrounding structures : supraorbital and supratrochlear nerves at the medial side of the incision , the frontal branch of the facial nerve at the lateral side , and the extent of the frontal sinus .
muscle injury and bleeding are minimal because peeling the temporalis muscle to make the keyhole is sufficient and does not destroy the sphenoid ridge .
however , a small craniotomy sometimes makes it hard to retract the frontal lobe and secure a sufficient space for the procedure , forehead hypaesthesia and frontalis palsy temporarily but infrequently occur , and olfactory nerve injury during clipping of the anterior communicating artery ( acoa ) aneurysms is not rare .
the fl approach is fundamentally the same as the sso approach ; however , fl approach has a lower risk of nerve injury , a higher cosmetic satisfaction and a chance to make a larger bone flap because the skin incision is made just behind the hairline and an interfacial dissection is performed .
the lso approach includes a skin incision just behind the hairline , incision and retraction of the temporalis muscle , and a more laterally located supraorbital craniotomy .
therefore , there exists a risk of muscle problems such as pain , bleeding , swelling and atrophy .
however , it is advantageous in cases with inferiorly directed aneurysms and large frontal sinus , and it has a lower risk of olfactory nerve injury .
if necessary , the craniotomy can be extended into the middle cranial fossa crossing the sphenoid ridge such that the lso approach has a wider range of application through medial and lateral sylvian dissection ; compared to the sso and fl approaches , the medial sylvian dissection is the only window towards the aneurysms . meanwhile , in cases with intradural bony drilling of sphenoid ridge and anterior clinoid process , endoscopic assistance , and bilateral approach via the unilateral corridor , lso and fl approaches are more advantageous than sso approach because of the flexibility of craniotomy size .
finally , there are mini - pterional ( mp ) and mini - interhemispheric ( mi ) approaches .
the mp approach is mainly used for middle cerebral artery aneurysms by focally exposing the perisylvian area24,34 ) . via the mi approach ,
the most important aspect in selecting mp and mi approaches is the venous structures because damage to major bridging veins can result in painful complications of venous infarction and haemorrhagic conversion .
thus , preoperative imaging of both the arteries and veins is essential to select an appropriate approach and determine a craniotomy area .
based on the personal experience during the past 3 years , 377 aneurysms in 280 patients were treated via keyhole approaches and composed 87.9% of all the aneurysms treated . the percentage of patients undergoing the fl , lso , sso , mp and mi approaches were 43.8% , 23.8% , 15.5% , 13.4% , and 3.5% , respectively ; and the treatment results consisted of complete occlusion in 75.4% of aneurysms , residual neck ( remnant < 1 mm ) in 20.7% , and residual sac in 4.8% .
among 325 unruptured aneurysms in 244 patients , the mortality was zero , and the permanent morbidity was 0.6% per aneurysm and 0.8% per patient with excellent cosmetic results and a short operation time of approximately 150 minutes .
occasionally , an endoscope and mirror were needed because of weak illumination and blind spots beyond the line of the microscopic view , and specific instruments such as devices with tubular shaped and bayonet type of shafts , various designs of aneurysm clips and malleable clip applier with a small head were effective .
strong illumination , clear depiction in a close - up view and a wide viewing angle .
in addition , when using the holding arms , bimanual manipulation is possible14,29 ) , which allows surgeons to safely and precisely clip certain aneurysms beyond the straight line of the microscopic view39 ) .
this usefulness can be highlighted when clipping is performed via the small corridor of keyhole approaches .
sometimes , a micromirror is simple to use ; however , the image resolution is low , and fog on the mirror can be problematic .
neuroendoscopy was implemented to treat aneurysms in the early 1990s , and its role has become widespread from assisting microscopy procedures to providing the main view . in selected cases ,
aneurysm clipping has evolved from endoscope - assisted procedures to endoscope - controlled ones1,14 ) , and neuroendoscopy is progressively used via the keyhole13,33 ) and endonasal12,15,16,35 ) approaches as well as conventional approaches .
endoscopic endonasal approaches are thought to be a good alternative for aneurysms located in the medial paraclinoid segment of the internal carotid artery ( ica ) and posterior circulations such as basilar bifurcation , as well as those in cerebellar and vertebral arteries , which are limited with conventional surgical approaches35 ) . to date , the smallest endoscope diameter is 2.7 mm , and a rigid endoscope produces the best imaging quality .
neuroendoscopy with softer ( fiberoptic and steerable ) shafts that have a smaller diameter would be more useful in the near future .
personally , the author started to use neuroendoscopy after a painful experience during an incomplete inspection around the aneurysm and blind clipping using a keyhole approach .
neuroendoscopy is mainly used in selected cases such as inferiorly directed aneurysms at the distal ica , superoposteriorly directed aneurysms at the acoa and middle cerebral arteries , and ica bifurcations . in total , 9.0% ( 34 of 377 aneurysms ) were clipped using either endoscopic - assisted or controlled keyhole approaches .
icg fluorescence angiography ( icga ) is a prominent techniques in the surgical treatment of cerebrovascular diseases . since raabe et al .
introduced this technique to the field of cerebrovascular surgery in 200332 ) , microscopic icga has been widely used in aneurysm clipping , bypass surgery , arteriovenous fistulas and malformations in the brain and spine .
it is especially used in aneurysm surgeries in order to detect and correct any compromise of the perforators and parent arteries and/or incomplete clipping .
however , microscopic icga systems have some shortcomings for structures beyond the line of the microscopic view and deep - seated structures with weak illumination .
such limitations can be profound during the procedures utilizing the keyhole craniotomy . therefore , some neurosurgeons from japan , germany and korea ( our system ) developed endoscopic icg angiography ( eicga ) systems4,7,21,25 ) .
compared to conventional endoscopy , endoscopic icga has some additional advantages for aneurysm clipping in that it can visualize the icg fluorescence within small perforators , parent arteries and clipped aneurysms beyond the line of microscopic view , detect even faint fluorescence of deep - seated structures , and obtain icg fluorescent images for a longer duration .
our system has a unique technical superiority over the commercial endoscopic icga systems simultaneous display and real - time merging of both visible light and icg fluorescence images .
previous systems can alternatively visualize either the visible light or icg fluorescence images , which is inconvenient and has the risk of violating unseen structures during the fluorescence mode .
recently , we completed a prospective clinical study with our dual channel eicga system in treating cerebral aneurysms .
our system showed a higher detection rate of branch orifices and the exact clip position than the commercial microscopic icga ( fig .
looking back on the history of cerebral aneurysm treatment , surgical managements have improved since victor horsley s ligation of the common carotid artery for an ipsilateral cerebral aneurysm in 1855 .
walter dandy performed the first direct neck clipping with a v - shaped silver clip in 19358 ) , and gazi yasargil started to use microscopy in the 1960s20 ) .
the era of endovascular treatment began when guido guglielmi invented detachable coils in 199117 ) , and endovascular intervention is accepted as a primary treatment modality for cerebral aneurysms with lower complication rates and satisfactory outcomes compared to surgical clipping23 ) , to reduce surgical morbidities , much effort has been recently made , such as intraoperative cerebral angiography , intraoperative indocyanine green ( icg ) angiography , intraoperative physiologic monitoring , neuroendoscopy , the keyhole approach , and new instrument designs .
the keyhole approach is not so long that donald wilson and mario brock first attempted a limited craniotomy as a premature step in 1970s3,37 ) , and john jane described a modified supraorbital approach with minimal brain retraction in 198219 ) .
coming into the late 1980s , the concept and indications of a keyhole approach were established by josip paladino and axel perneczky27,30,36 ) . a standard craniotomy supplies a sufficient space for inspection and instruments as well as room for diverse angles of approach towards the target lesion . meanwhile , a keyhole craniotomy provides an essential space for microscopic viewing and 2 or 3 instruments .
a wide range of areas can be approached by varying the microscopic angle of the view ; however , only a fixed and limited approach angle towards one target is permitted via the keyhole . according to the axel perneczky s report in 199836 ) , the keyhole approach is not limited via a limited corridor but is rather a tailored and adjusted method for minimal exposure and retraction of the brain .
its advantages include minimal brain exposure , excellent cosmetic results , preservation of the surrounding structures , and short procedural time .
it also has some disadvantages : less opportunity for changing a plan , weak microscopic illumination , and difficulty in proximal control over the parent arteries .
however , these types of disadvantages can be overcome via preoperative planning with imaging modalities , intraoperative manipulation with instruments such as an endoscope and specific devices , and specific facilities such as a hybrid operating system9 ) .
keyhole approaches may be still inappropriate in cases with a high probability of massive bleeding and brain swelling ; however , the proportion of keyhole surgeries appears to be increasing .
the symbolic and representative approach is supraorbital , which is applicable for most anterior circulation aneurysms .
a supraorbital keyhole craniotomy exposes the anterior cranial fossa just above the orbit and sphenoid ridge ( fig .
it can be classified into 3 types : ( 1 ) superciliary ( or eyebrow ) supraorbital craniotomy ( sso approach)6,28,36 ) ; ( 2 ) frontolateral supraorbital craniotomy ( fl approach)3,38 ) ; and ( 3 ) lateral supraorbital craniotomy ( lso approach)5,18 ) .
when performing the sso approach , surgeons should consider surrounding structures : supraorbital and supratrochlear nerves at the medial side of the incision , the frontal branch of the facial nerve at the lateral side , and the extent of the frontal sinus .
muscle injury and bleeding are minimal because peeling the temporalis muscle to make the keyhole is sufficient and does not destroy the sphenoid ridge .
however , a small craniotomy sometimes makes it hard to retract the frontal lobe and secure a sufficient space for the procedure , forehead hypaesthesia and frontalis palsy temporarily but infrequently occur , and olfactory nerve injury during clipping of the anterior communicating artery ( acoa ) aneurysms is not rare .
the fl approach is fundamentally the same as the sso approach ; however , fl approach has a lower risk of nerve injury , a higher cosmetic satisfaction and a chance to make a larger bone flap because the skin incision is made just behind the hairline and an interfacial dissection is performed .
the lso approach includes a skin incision just behind the hairline , incision and retraction of the temporalis muscle , and a more laterally located supraorbital craniotomy .
therefore , there exists a risk of muscle problems such as pain , bleeding , swelling and atrophy .
however , it is advantageous in cases with inferiorly directed aneurysms and large frontal sinus , and it has a lower risk of olfactory nerve injury .
if necessary , the craniotomy can be extended into the middle cranial fossa crossing the sphenoid ridge such that the lso approach has a wider range of application through medial and lateral sylvian dissection ; compared to the sso and fl approaches , the medial sylvian dissection is the only window towards the aneurysms . meanwhile , in cases with intradural bony drilling of sphenoid ridge and anterior clinoid process , endoscopic assistance , and bilateral approach via the unilateral corridor , lso and fl approaches are more advantageous than sso approach because of the flexibility of craniotomy size .
finally , there are mini - pterional ( mp ) and mini - interhemispheric ( mi ) approaches .
the mp approach is mainly used for middle cerebral artery aneurysms by focally exposing the perisylvian area24,34 ) . via the mi approach ,
the most important aspect in selecting mp and mi approaches is the venous structures because damage to major bridging veins can result in painful complications of venous infarction and haemorrhagic conversion .
thus , preoperative imaging of both the arteries and veins is essential to select an appropriate approach and determine a craniotomy area .
based on the personal experience during the past 3 years , 377 aneurysms in 280 patients were treated via keyhole approaches and composed 87.9% of all the aneurysms treated . the percentage of patients undergoing the fl , lso , sso , mp and mi approaches were 43.8% , 23.8% , 15.5% , 13.4% , and 3.5% , respectively ; and the treatment results consisted of complete occlusion in 75.4% of aneurysms , residual neck ( remnant < 1 mm ) in 20.7% , and residual sac in 4.8% .
among 325 unruptured aneurysms in 244 patients , the mortality was zero , and the permanent morbidity was 0.6% per aneurysm and 0.8% per patient with excellent cosmetic results and a short operation time of approximately 150 minutes .
occasionally , an endoscope and mirror were needed because of weak illumination and blind spots beyond the line of the microscopic view , and specific instruments such as devices with tubular shaped and bayonet type of shafts , various designs of aneurysm clips and malleable clip applier with a small head were effective .
strong illumination , clear depiction in a close - up view and a wide viewing angle .
in addition , when using the holding arms , bimanual manipulation is possible14,29 ) , which allows surgeons to safely and precisely clip certain aneurysms beyond the straight line of the microscopic view39 ) .
this usefulness can be highlighted when clipping is performed via the small corridor of keyhole approaches .
sometimes , a micromirror is simple to use ; however , the image resolution is low , and fog on the mirror can be problematic .
neuroendoscopy was implemented to treat aneurysms in the early 1990s , and its role has become widespread from assisting microscopy procedures to providing the main view . in selected cases ,
aneurysm clipping has evolved from endoscope - assisted procedures to endoscope - controlled ones1,14 ) , and neuroendoscopy is progressively used via the keyhole13,33 ) and endonasal12,15,16,35 ) approaches as well as conventional approaches .
endoscopic endonasal approaches are thought to be a good alternative for aneurysms located in the medial paraclinoid segment of the internal carotid artery ( ica ) and posterior circulations such as basilar bifurcation , as well as those in cerebellar and vertebral arteries , which are limited with conventional surgical approaches35 ) .
to date , the smallest endoscope diameter is 2.7 mm , and a rigid endoscope produces the best imaging quality .
neuroendoscopy with softer ( fiberoptic and steerable ) shafts that have a smaller diameter would be more useful in the near future .
personally , the author started to use neuroendoscopy after a painful experience during an incomplete inspection around the aneurysm and blind clipping using a keyhole approach .
neuroendoscopy is mainly used in selected cases such as inferiorly directed aneurysms at the distal ica , superoposteriorly directed aneurysms at the acoa and middle cerebral arteries , and ica bifurcations . in total , 9.0% ( 34 of 377 aneurysms ) were clipped using either endoscopic - assisted or controlled keyhole approaches .
icg fluorescence angiography ( icga ) is a prominent techniques in the surgical treatment of cerebrovascular diseases . since raabe et al .
introduced this technique to the field of cerebrovascular surgery in 200332 ) , microscopic icga has been widely used in aneurysm clipping , bypass surgery , arteriovenous fistulas and malformations in the brain and spine .
it is especially used in aneurysm surgeries in order to detect and correct any compromise of the perforators and parent arteries and/or incomplete clipping . however , microscopic icga systems have some shortcomings for structures beyond the line of the microscopic view and deep - seated structures with weak illumination .
therefore , some neurosurgeons from japan , germany and korea ( our system ) developed endoscopic icg angiography ( eicga ) systems4,7,21,25 ) .
compared to conventional endoscopy , endoscopic icga has some additional advantages for aneurysm clipping in that it can visualize the icg fluorescence within small perforators , parent arteries and clipped aneurysms beyond the line of microscopic view , detect even faint fluorescence of deep - seated structures , and obtain icg fluorescent images for a longer duration .
our system has a unique technical superiority over the commercial endoscopic icga systems simultaneous display and real - time merging of both visible light and icg fluorescence images .
previous systems can alternatively visualize either the visible light or icg fluorescence images , which is inconvenient and has the risk of violating unseen structures during the fluorescence mode .
recently , we completed a prospective clinical study with our dual channel eicga system in treating cerebral aneurysms .
our system showed a higher detection rate of branch orifices and the exact clip position than the commercial microscopic icga ( fig .
with the advent of new and advanced surgical instruments and techniques , the percentage of aneurysm clippings utilizing a keyhole approach is increasing .
neuroendoscopy also has progressively become more useful for either keyhole or endonasal approaches for cerebral aneurysms .
developments in minimally invasive surgical approaches and neuroendoscopy such as 3d display and exoscopy are considered an intermediate step towards robotic neurosurgery , which would be the pinnacle of achieving minimal invasiveness and complication risks . in the near future ,
the authors predict the use of tele - surgery , microanastomosis with a haptic sense , and intraoperative imaging of the anatomy , physiology and pathology of patients with robotic systems . a step towards robotic surgery has already begun in the field of general and urologic surgery , and neurosurgery | ### Summary:
: treating diseases in the field of neurosurgery has progressed concomitantly with technical advances . here , as a surgical armamentarium for the treatment of cerebral aneurysms ,
the history and present status of the keyhole approach and the use of neuroendoscopy are reviewed , including our clinical data .
the major significance of keyhole approach is to expose an essential space toward a target , and to minimize brain exposure and retraction . among several kinds of keyhole approaches ,
representative keyhole approaches for anterior circulation aneurysms include superciliary and lateral supraorbital , frontolateral , mini - pterional and mini - interhemispheric approaches . because only a fixed and limited approach angle toward a target is permitted via the keyhole , however , specialized surgical devices and preoperative planning are very important .
neuroendoscopy has helped to widen the indications of keyhole approaches because it can supply illumination and visualization of structures beyond the straight line of microscopic view .
in addition , endoscopic indocyanine green fluorescence angiography is useful to detect and correct any compromise of the perforators and parent arteries , and incomplete clipping .
the authors think that keyhole approach and neuroendoscopy are just an intermediate step and robotic neurosurgery would be realized in the near future . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: a central paradox of physical activity is the association of moderate exercise with decreased cardiovascular morbidity and mortality [ 1 , 2 ] , whereas vigorous physical exertion increases the short - term risk of sudden cardiac death [ 3 , 4 ] . due to the rising participation in endurance sports ,
there is much current interest in postexercise changes in cardiac function . ever since the first marathon runner , phidippides , collapsed and died at the finish of his famous run in ancient greece , death due to heart - related stress has been an occasional occurrence in marathon events .
sudden unexpected death during marathons and other high impact activities is usually due to underlying and often unsuspected heart disease [ 68 ] and such catastrophes often attract substantial public attention .
identification of marathon runners at risk is difficult , and the need for medical examinations remains controversial [ 2 , 10 , 11 ] .
the risk of sudden cardiac death associated with marathon running has been suggested to be too low to recommend routine screening for coronary artery disease [ 12 , 13 ] .
an alternative approach to cardiac screening is to identify biomarkers which may predispose runners to increased risk of cardiac events .
many physical and biochemical changes have been described during endurance sports including transient changes in systolic and more persistent diastolic dysfunction ( as determined by mri ) of both the left ( lv ) and right ventricle ( rv ) [ 1416 ] and consistent increases in cardiac biomarkers troponin [ 1719 ] and b - type natriuretic peptide ( bnp ) [ 18 , 20 , 21 ] .
however , none of the pre - race levels of these biomarkers can predict the post - race changes in cardiac function .
surface enhanced laser desorption ionization time - of - flight mass spectrometry ( seldi - tof - ms ) is a widely used tool to identify specific markers for diseases and certain physiological conditions .
seldi - tof - ms profiling has been successfully applied to various cardiovascular disease studies [ 2224 ] . in this study ,
seldi - tof - ms was used to discover differentially expressed proteins associated with increased risk of cardiac dysfunction prior to , during , and after a marathon event .
this discovery study was an adjunct to a recently published investigation into traditionally accepted biochemical indices and physiological indices of cardiac stress , such as acute and chronic right ventricular dysfunction , heart chamber morphology and function , edema , tissue perfusion , dynamic myocardial contraction , and cardiac blood flow as determined by cardiovascular magnetic resonance .
this study was reviewed and approved ( hic # 08 - 254 ) by beaumont hospital 's human investigation committee . from 425 volunteers , twenty - five ( 12 male and 13 female ) were randomly selected and consented for the study .
baseline screening included cardiopulmonary exercise testing , blood biomarker analysis , cardiovascular mri , and 24-hour ambulatory electrocardiography 4 weeks before ( pre - race ) and within 7 hours after race .
the actual mean time for the post - race mri was 4.03 1.62 hours ( range 0.837.02 hrs ) .
blood samples were drawn at the pre- and post - race mri procedures but also at the finish line of the race .
the time from blood draw through processing and freezing ranged from 40 minutes to 135 minutes with an average of draw to freeze time for all three samplings of 66.8 minutes . this included a 30 min ambient incubation to allow for clotting .
blood drawn at the finish line was processed at the site of the race and samples were frozen on dry ice until returned to the lab and stored at 80c .
plasma and serum were separated but only serum was used in the seldi analysis described in this study .
discovery proteomics was performed using a proteinchip seldi - tof - ms , enterprise edition ( bio - rad laboratories , hercules , ca , usa ) .
two protein chip types with different binding chemistries were selected for the analysis . these were cm10 ( weak cation exchange ) and imac-30 ( immobilized metal affinity chromatography ) .
runner identification and sampling times were de - identified and assigned a barcode using bigr ( healthcare it , rockville , md , usa ) . for seldi array spotting , samples were applied using the proteinchip software randomizer function and were blinded at this point .
once spectra were generated , sampling time was assigned in order to perform comparative analysis .
briefly , serum samples were thawed on ice then centrifuged to clear , after which 20 l of supernatant was denatured by the addition of 30 l of u9 buffer ( 9 m urea , 2% chaps , 50 mm tris - hci , 1% dtt , ph 9.0 ) ( bio - rad ) .
the samples were incubated on ice for 30 min and subsequently 200 l of 25 mm tris ph 7.4 was added .
next , 2 l of sample was spotted in duplicate , after randomization , onto an array with 4 l of pre - spotted low stringency binding buffer ( 0.1 m sodium acetate , ph 4.0 ) .
proteins were allowed to bind in a humid chamber for 30 minutes after which liquid was removed and the spots allowed to dry .
next , 1 l of saturated sinapinic acid ( spa ) in 50% ( v / v ) acetonitrile and 0.5% trifluoroacetic acid was applied as an energy absorbing matrix and allowed to crystallize by solvent evaporation for 10 minutes at room temperature .
after another addition / drying of 1 l spa , the arrays were ready for seldi data acquisition .
arrays of each chip type were bombarded under two laser intensity conditions ( low energy 1600 nj and high energy 3500 nj ) to more closely analyze lower and higher mass ranges .
each spot was divided into 50 partitions ( 4 pixels per partition ) , and each selected pixel was bombarded 12 times ( the first two being warming shots at the selected energy + 10% ) . for the 1600 nj condition ,
energy source was set at 25 kv , positive ions , mass range 020,000 da , focus mass = 5,000 da , matrix attenuation = 1000 , sampling rate = 800 mhz . under 3500 nj bombardment , settings were adjusted to mass range = 0200,000 da , focus mass 16,000 , and matrix attenuation = 5,000 .
multiple aliquots of a pooled reference sample consisting of a mixture of all the samples were also spotted onto the proteinchips for quality control , standardization , and normalization purposes .
analysis was performed using proteinchip data manager 3.5 ( bio - rad laboratories , inc .
once accumulated , spectra were subject to peak detection , and qualified mass peaks were then defined by first creating and applying mass calibration equations using bio - rad 's all - in - one peptide standards ( low energy condition ) or all - in - one protein standards ( high energy condition ) .
peak intensity calculations were subsequently adjusted after baseline subtraction ( fitting width set at 10 times the expected peak width using the smoothing function set at 25 points for the low mass range and 10 points for the high mass range ) .
next , noise was reduced by adjusting the average filter to 0.2 times the expected peak width .
peak intensities within a condition were subsequently normalized to total ion current to compensate for spectrum - to - spectrum variations , and outlying spectra were removed from the analysis .
spectra were then aligned to a reference - pool sample with a normalization factor of 1 .
peak clustering was then carried out to group peaks of similar mass across multiple spectra using automatic first - pass peak detection settings of signal to noise > 2.0 .
peak clusters were further defined using second - pass peak detection ( signal - to - noise ratio > 2 , valley depth = 2.0 ) with minimum peak threshold set at 15% and a mass window approximately 0.1% of the peak mass .
after peak clustering , peaks were subjected to statistical analysis with p values calculated across each group . those clusters showing significant differences
( p value 0.05 ) in the univariate analysis were compared against protein databases to identify potential candidate biomarkers . to afford a wide search range of proteins to choose from , a broad selection of pi range
was explored along with a m / z value within 0.1 decimal place of the observed value to account for posttranslational modifications such as phosphorylation and methylation . from this starting point ,
physical characteristics were selected by their potential to play a role in cardiac function , to be involved in known cardiopathologies and if the candidate was a secretory protein likely to be present in serum . by design
, this investigation was to yield a broad range of m / z candidates for further investigation .
identification of proteins / peptides that demonstrated significant changes across the three specimen collection times was carried out using anova using a p value of 0.05 to indicate significance . to establish significant changes between runners who did or did not experience a significant cardiac mri change in right ventricular efflux volume ( rv ef ) after race , a 2-way anova model using the method of moments was used .
a total of 693 protein / peptide clustering peaks > 1 kda were detected using the four different conditions ( two different chip types at two different laser intensities ) .
the number of protein / peptide peak clusters was 124 on cm10 ( low energy ) , 334 on cm10 ( high energy ) , 133 on imac30 ( low energy ) , and 92 on imac ( high energy ) ( see figure , sdc 1 , representative spectra from the two seldi protein chip binding surfaces were utilized in this study which were bombarded under two laser intensity conditions ( 1 ) cm10 1600 nj , ( 2 ) cm10 3500 nj , ( 3 ) imac30 1600 nj and ( 4 ) imac30 3500 nj ) .
the peak intensities of 116 of the 693 protein / peptide clusters were significantly different at the three different time points studied as compared to an all sample pooled control .
this chip identified 22 proteins that were significantly altered ( p 0.05 ) in the pre- , immediately post - race , and 2nd mri samples whilst 73 were identified on the high laser power chip .
twelve of these proteins were identified across different combinations of chip and laser power ( see tables , sdc 14 for the m / z ratios of proteins that were significantly different within each protein surface and laser power condition ) .
we identified 7 different patterns of protein expression change within the runners ( table 1 ) .
38% of significantly changed proteins showed an inverted v pattern that is , low levels before race , high levels at the finish line and reversion to low levels by the 2nd mri ( pattern 1 ) .
the opposite pattern , that is , v was seen in 20% of proteins ( pattern 2 ) .
a progressive increase in protein levels was seen in 10% of the proteins ( pattern 3 ) , and 25% of proteins showed no change between pre - race and finish line but rose significantly at the second mri ( pattern 4 ) .
5% showed the opposite pattern with similar levels pre - race and finish line but a drop at the second mri ( pattern 5 ) .
figure 1 shows an example of pattern 1 and pattern 4 across the 25 runners . in both cases , even though the overall trend followed the described pattern , there was individual variation between the runners and some deviated from the overall pattern ; this was true for many of the significantly changed peaks .
based on the previous data , 17 of the 25 runners were demonstrated to have significant changes in their right ventricular efflux fraction ( rv ef ) that was considered to be the most important clinical change .
when runners were dichotomized into these two groups , we identified 5 proteins whose pre - race level significantly predicted post - race rv ef changes , 16 proteins whose finish - line levels were associated with rv ef changes , and 15 proteins whose levels at the second mri were associated with rv ef reductions .
figure 2(a ) shows a relatively abundant protein of mass charge ratio ( m / z ) 8922.3 in which a low pre - race level was associated with the runners at risk of rv ef reductions ( p = 0.009 ) whilst figure 2(b ) shows a lower abundance protein of m / z ratio 17897.5 in which a higher pre - race level predicted risk of rv ef reductions ( p = 0.0074 ) .
four of the 5 pre - race proteins associated with significant rv ef changes were elevated in the at risk
runners , and 4 of 5 exhibited pattern 2 of expression changes ( table 1 ) .
only two proteins showed significant changes in two of the three time observations . in figure 2(c ) , high pre - race levels ( p = 0.042 ) of a less abundant protein of m / z = 17772.3 was associated with at risk runners whilst a lower post - race level ( p = 0.023 ) was associated with runners who experienced significant rv ef changes . in figure 2(d ) , a moderately abundant protein of m / z 10418.6 showed significant elevations at the finish line ( p = 0.001 ) and at the post - race mri ( p = 0.043 ) and was associated with rv ef reductions . at the finish line , 9 of the 16 proteins
10 of the protein peaks were significantly altered with p values less than 0.01 ( table 2 ) . at the post - race mri time point
, 10 of the 15 significantly altered protein peaks were raised in the runners who were found to have rv ef reductions .
in contrast , to the other two time points , proteins changes at this time point were predominantly pattern 4 ( 7/15 ) and pattern 2 ( 6/15 ) .
the changes tended to be more subtle with only three protein peaks being significant at less than the 0.01 level ( table 2 ) .
of the significantly different clustered protein peaks from specified time points in the study which correlated runner 's cardiac stress based on mri findings , candidates were chosen after comparing m / z ratios against the uniprotkb / swiss - protein database using the tagident tool available from the swiss institute of bioinformatics ' expasy proteomics server ( table 2 ) . although tentative , several proteins potentially associated with cardiac and systemic response to stress were consistent with the m / z ratios and chromatographic characteristics of the significantly altered seldi - tof peaks .
the seldi - tof - ms technology implemented in the proteinchip system is designed to perform ms analysis of protein mixtures retained on chromatographic array surfaces .
easily obtainable clinical biofluid samples , such as blood , urine or saliva can be directly applied to the proteinchip array surface .
an advantage of seldi - tof - ms is its relatively high tolerance for salts and other impurities , also the complexity of the samples is reduced as proteins and any contaminants that do not bind to the spot surface are removed . in this study ,
seldi - tof - ms analysis revealed biomarkers with m / z ratios which had dynamic and significantly changed profiles before , at the finish line and up to 7 hours after running a marathon .
although the identification of the significantly altered proteins in this study has yet to be confirmed by further mass ms analysis and validation by elisa , bead array or western blotting , there is compelling evidence from the exercise literature that cytokines and other proteins involved in the inflammatory response are key players in the response to strenuous exercise [ 27 , 28 ] .
however , to our knowledge , this is the first study that has potentially implicated pre - race levels of cytokines as predictors of significant cardiac changes following a marathon race .
specific changes , both after strenuous exercise and in infectious disease states , include the acute phase response , leukocyte mobilization and activation , release of inflammatory mediators ( cytokines ) , tissue damage and cell infiltration , the production of free radicals and activation of the complement , coagulation , and fibrinolytic pathways .
brenner and colleagues showed that prolonged exercise induces a significant increase in il-6 and tumor necrosis factor plasma levels , the mobilization of cytotoxic cell populations and increased natural killer cell cytotoxic activity , all suggesting that prolonged exercise was effective in activating several components of the inflammatory response .
cytokines are potent intercellular signaling molecules that regulate inflammation and immune responses by acting locally at extremely low concentrations in a paracrine or autocrine manner . a systemic inflammatory response syndrome ( sirs ) can be elicited by a variety of serious insults such as severe trauma , burns , hemorrhagic shock , sepsis , and ischemia / reperfusion injuries and exhaustive exercise .
nieman and coworkers have shown that four key cytokines , il-6 , il-1ra , il-10 , and il-8 , are increased for distances up to the 26.2 mile marathon race . however , these are among many pro- and anti - inflammatory cytokines and factors that are secreted systemically after exhaustive exercise or eccentric exercise [ 3135 ] .
interestingly , three of the 5 proteins whose pre - race levels among the 25 runners were predictive of post - race mri changes were provisionally identified as cytokine family members : il1rn , il1 and il8 . also tentatively identified were positive acute - phase proteins including c - reactive protein ( crp ) and saa which have been shown to increase during bouts of exercise , presumably to promote healing of damaged tissues .
not all proteins can be visualized equally well with seldi - tof ; the range below 20 kda is especially well resolved while sensitivity for higher molecular weight proteins is lower .
detection of high intensities of protein peaks of a specific molecular mass may not necessarily mean that high levels of the corresponding protein product will be present in body fluids due to the suppression of signals through higher - affinity binding , so that absolute quantization is not possible .
however , as long as similar biological fluids are compared this is not an issue for biomarker discovery .
standardized sample processing is crucial to reproducible and robust seldi - tof analysis and we tried to minimize variation as described in section 2 .
analytical bias was minimized by running the samples in only two batches with several overlapping samples and analysis was performed on the overall dataset with a consistent baseline subtraction , normalization , alignment and noise reduction strategy .
we are currently in the process of identifying the candidate proteins using a fractionation and nano lc / ms / ms strategy leading to verifying their significance with more quantitative elisa assays .
this study has for the first time identified potentially measurable biomarkers that could form the basis for a predictive test for significant cardiac damage during a marathon race . at this stage , we can not speculate further on the significance of these results and the mechanisms involved until positive identification of the proteins is made and the differential expression data has been verified .
there could be many explanations for the diversity changes we observed ( table 1 ) that are involved in the mechanism of the response ( acute and recovery ) to exercise - induced cardiac stress .
as examples , patterns 1 and 2 would seem to be involved in the acute response of proteins during and immediately after the race , pattern 3 may indicate an inflammatory response , and patterns 4 and 5 may indicate a recovery response .
it is important to note that , although these patterns were the predominant change amongst the runners , there was individual variation amongst runners exemplified in figure 2 .
the use of seldi - tof has uncovered not only potential proteins that may be involved in the acute and recovery phases of marathon running but has discovered proteins whose pre - race levels may predispose runners to higher risks of running - associated cardiac injury .
this is the first step in the development of biomarker profiles that could be used on a more regular basis to indicate the individual risk of running a marathon . | ### Summary:
: purpose . to utilize proteomics to discover proteins associated with significant cardiac magnetic resonance imaging ( mri ) changes in marathon runners
. methods . serum from 25 runners was analyzed by surface enhanced laser desorption ionization time - of - flight mass spectrometry ( seldi - tof - ms ) .
proteomic profiles were compared in serum samples obtained prior to the race , at the finish line and within 7 hours after race to identify dynamic proteins correlated with cardiac mri changes .
results .
693 protein / peptide clusters were identified using two proteinchip surface chemistries and , of these , 116 were significantly different between the three time points .
we identified 7 different patterns of protein expression change within the runners and 5 prerace protein peaks , 16 finish - line protein levels , and 15 postrace proteins which were correlated with significant postrace cardiac mri changes .
conclusions .
this study has identified baseline levels of proteins which may be predictive of risk of significant cardiac damage following a marathon race .
preliminary identification of the significant proteins suggested the involvement of cytokines and other proteins involved in stress and inflammatory response . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: laparoscopic port closure ( lpc ) is usually performed by different techniques after release of pneumoperitoneum ( pp )
. there has been progressive development of new methods and refinement of existing techniques to achieve the best outcome .
however , serious complications due to the closure techniques have been reported . in general , the classical method of port - site closure is widely used because of its simplicity and cost effectiveness . in some of the closure techniques , special instruments and types of needles
, occasionally this closure can be difficult and is associated with the predictable fear of injuring or including the underlying bowel loops , omentum , or other abdominal organs by the needle .
this may result in less optimum closure and subsequent complications , including port - site incisional hernia ( pih ) .
several closure methods have been tested , and some of these have proved to cause less morbidity . due to the variable rates of pih and its drastic complications reported in these studies , it is important for individual surgeons to audit their results to prevent or reduce these complications .
this study evaluates the classical closure method and discusses the factors associated with port - site incisional hernia .
this is a retrospective study of 5541 patients who underwent laparoscopic procedures for different indications under the care of a single consultant surgeon between january 2000 and january 2007 .
we used 5-mm , 10-mm , and 12-mm ports , depending on the type of operation and a 3-edged reusable trocar for creation of ports .
we used disposable ports in bariatric surgery and an xcel [ ethicon ] port in cases of possible adhesions from a previous laparotomy .
the data were retrieved for patients who developed port - site complications , including port - site incisional hernia ( pih ) . the management and follow - up of these complications
all patients who underwent laparoscopic surgery and the classical port closure technique under the care of a single laparoscopic surgeon were included in this study , regardless of american society of anesthiology grading , body mass index , type of procedure , and age of the patient .
the patients who had their ports closed using techniques other than the classical one were excluded from this study .
the ports were cleaned with 10% povidone iodine solution , and 3-ml to 5-ml of 0.5% marcaine was infiltrated into the ports along the planes . at the end of the procedure , the pp was released and closure was performed using j - shaped needle and pds suture .
closure of the fascial defect was performed for all ports > 5 mm in adults and as small as 5 mm in children .
obese patients , a port closure device was used to achieve secured closure of the fascial defect .
this is a retrospective study of 5541 patients who underwent laparoscopic procedures for different indications under the care of a single consultant surgeon between january 2000 and january 2007 .
we used 5-mm , 10-mm , and 12-mm ports , depending on the type of operation and a 3-edged reusable trocar for creation of ports .
we used disposable ports in bariatric surgery and an xcel [ ethicon ] port in cases of possible adhesions from a previous laparotomy .
the data were retrieved for patients who developed port - site complications , including port - site incisional hernia ( pih ) . the management and follow - up of these complications
all patients who underwent laparoscopic surgery and the classical port closure technique under the care of a single laparoscopic surgeon were included in this study , regardless of american society of anesthiology grading , body mass index , type of procedure , and age of the patient .
the patients who had their ports closed using techniques other than the classical one were excluded from this study .
the ports were cleaned with 10% povidone iodine solution , and 3-ml to 5-ml of 0.5% marcaine was infiltrated into the ports along the planes . at the end of the procedure , the pp was released and closure was performed using j - shaped needle and pds suture .
closure of the fascial defect was performed for all ports > 5 mm in adults and as small as 5 mm in children .
obese patients , a port closure device was used to achieve secured closure of the fascial defect .
different laparoscopic procedures were performed in 5541 patients . these included 250 appendicectomies , 1621cholecystectomies , 63 gastric bypasses , 198 diagnostic laparoscopies , 456 nissen fundoplications , 1833 herniorrhaphies , 40 bowel resections and anastomoses , and 1080 procedures for different indications , including splenectomy , adrenalectomy , release of adhesions , ectopic testis , and
the mean age of patients was 52 years ( range , 8 to 91 ) .
the 8 port - site incisional hernias ( pih ) were subsequently repaired as elective cases .
the other 5 hernias developed after groin hernia repair . no immediate major complications or mortality was reported in relation to port - site complications .
all patients attended the first visit of follow - up in the clinic , which was 4 weeks to 6 weeks after the operation .
patients who had simple operations , such as appendectomy , hernia repair , or cholecystectomy , were discharged to their general practitioner 's care after the first visit and advised to call our unit in case of problems including port - site complications .
the mean follow - up was 43 months ( range , 25 to 96 ) .
it also explores the safety and efficacy of port closure after the release of pneumoperitoneum .
one of the preventable complications is pih , which could develop at any port site .
however , our experience showed that it most frequently develops at the midline , possibly because of the absence of supporting muscle .
the incidence of pih is variable from center to center , depending on several factors including surgical technique and , of course , surgical experience .
the fact that the incidence and spectrum of laparoscopic complications is greater than previously perceived made development and continuing improvement of the access techniques , instruments , and laparoscopic training important to reduce these avoidable complications , especially the dangerous problems like incarcerated hernia .
the extent of laparoscopic access complications is found to correlate with the experience of the surgeon and the learning curve .
the incidence of these complications in a study of 4857 laparoscopic operations was incisional hernias 0.5% , bleeding from abdominal - wall vessels 0.2% , bowel injury 0.06% , and wound infections 0.06% .
the incidence of pih was reported to be as low as 0.08 in another large series .
the risk factors for development of pih are the trocar diameter , the trocar design , pre - existing fascial defects , and some operation- and patient - related factors , in addition to the direction of the port insertion , use of a drain , and the site of the port . the risk of trocar - site hernia is greater in obese and bariatric patients because of the larger preperitoneal space and elevated intraabdominal pressure ; thus , fascial closure alone is not adequate , while the size of the port is another major risk factor , and some authors advise closure of holes > 5 mm at the fascial level . however , surprisingly , pih was reported for 3-mm ports in children and as small as 5-mm ports with bowel obstruction in adults.this raises concern and questions as to whether to close these small ports .
tonouchi et al reviewed 63 studies of trocar - site hernias and concluded that a fascial defect of 10 mm should be closed , including the peritoneum , while opinion varies as to whether a 5-mm trocar - site defect should be closed . in children
, we used a 5-mm port as the smallest port , and this is routinely closed at the fascial level , while in adults we would close any port > 5 mm . in spite of this ,
however , the 8 hernias occurred in the last 2 years and were not related to the experience or the learning curve .
all these developed following the classical closure technique with j - shaped needle at 10-mm epigastric and umbilical port and 5-mm lumber ports in adult patients .
these 8 pih , which came to our attention during a mean follow - up of 40 months , represent an acceptable incidence in such large series compared with reports in the literature .
the easy closure and cost - effectiveness associated with the classical method are promising compared with other techniques , such as deschamps needle and nonbladed laparoscopic trocars . the incidence of port - site hernia for specific procedures it is difficult to anticipate which patient will develop pih during follow - up . taking into consideration the abovementioned risk factors for development of pih , the incidence of it can be reduced and the most serious bowel strangulation may be prevented .
clinically , surgeons may misdiagnose pih in symptomatic patients , because of the absence of physical signs or no appropriate imaging study is arranged . in a symptomatic patient , the pih may be incidentally detected in the course of investigating other pathologies .
if they have no complications after surgery , they are usually discharged and told to call our unit in case of complications .
alternately , they can be referred to our clinic by their general practitioner to confirm specifically whether a hernia has developed or not , because hernia development is time - dependent . depending on the clinical findings , a subsequent ultrasound or mri scan
the number of complications in our series is low , and this reinforces the idea that closure of all sites > 10 mm is extremely important , and it confirms the conclusion of tonouchi et al .
the real number of minimal access operations may be higher in other practices , but this does not influence the conclusion of this study because a large number of cases were included
. there may be asymptomatic hernias that develop later , and therefore , with long follow - up , the incidence of pih is expected to increase .
eight clinical hernias out of 5541 operations is a an acceptable rate ; however , the iceberg phenomenon did exist , and the true incidence of pih in our series is expected to be > 0.14% . in that context , the diagnosis of all subclinical hernias was not possible with this study , and imaging to confirm subclinical and asymptomatic pih is difficult to arrange for more than 5000 patients .
the meticulous closure of laparoscopic ports is important to prevent or reduce the incidence of port - site incisional hernia and its complications .
although the classical closure method with a curved or j - shaped needle has been associated with an acceptable incidence of port - site hernia , development of a new technique of closure is suggested to further prevent or reduce this . | ### Summary:
: background : laparoscopic surgery is widely practiced and offers realistic benefits over conventional surgery .
there is considerable variation in results between surgeons , concerning port - site complications .
the aim of this study was to evaluate the laparoscopic port closure technique and to explore the factors associated with port - site incisional hernia.methods:between january 2000 and january 2007 , 5541 laparoscopic operations were performed by a single consultant surgeon for different indications .
the ports were closed by the classical method using a j - shaped needle after release of pneumoperitoneum .
the incidence of port - site incisional hernias was calculated .
all patients were followed up by outpatient clinic visits and by their general practitioners.results:during a 6-year period , 5541 laparoscopic operations were performed .
eight patients ( 0.14% ) developed port - site hernia during a mean follow - up period of 43 months ( range , 25 to 96 ) and required elective surgery to repair their hernias . no major complications or mortality was reported.conclusion:laparoscopic port closure using the classical method
was associated with an acceptable incidence of port - site hernia .
modification of the current methods of closure may lead to a new technique to prevent or reduce the incidence of port - site incisional hernias . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: the adhesion of circulating blood platelets to the subendothelial matrix exposed upon vessel wall injury represents the initial event of the haemostatic process required to limit hemorrhage .
platelets express several membrane receptors specific for all the major adhesive ligands of the vascular extracellular matrix . among these ,
collagen is probably the most important subendothelial matrix component involved in thrombus formation , and platelet adhesion to collagen is associated with a complex pattern of activatory signaling pathways .
integrin 21 and glycoprotein vi ( gpvi ) are the two main platelet receptors for collagen and , in the rheological conditions of low shear rates , typically present in large veins and venules , are sufficient to mediate firm platelet adhesion . at high shear rates , characteristic of small arteries and stenotic vessels , platelets are unable to efficiently interact to exposed collagen fibers , and in these conditions adhesion is preceded by platelet tethering and rolling on the site of injury .
this process is mediated by the membrane gpib - ix - v complex , a platelet - specific receptor for the multimeric glycoprotein von willebrand factor ( vwf ) . at high shear stress , circulating vwf rapidly interacts with exposed collagen fibers and undergoes a conformational change that allows the interaction with the gpib - xi - v complex , decelerating platelets and favoring the subsequent stable adhesion mediated by other platelet receptors .
the interaction of platelet adhesion receptors with subendothelial matrix components stimulates an intricate pattern of signal transduction pathways , that trigger spreading , secretion of soluble proaggregating molecules , thromboxane a2 ( txa2 ) synthesis and release , and phosphatydilserine exposure .
these events recruit and activate additional circulating platelets to initiate a process of cell aggregation , that generates a rapidly growing thrombus at the site of damaged vessel wall .
the stability of platelet adhesion and of the subsequent thrombus formation is reinforced by autocrine stimulation by the released soluble agonists , in particular adp and txa2 , and by thrombin produced through the coagulation cascade .
these agonists stimulate specific g - protein - coupled receptors ( gpcrs ) expressed on platelet surface and typically lead to the activation of phospholipase c ( plc ) isoforms , that release diacylglycerol ( dag ) and inositol trisphosphate ( ip3 ) .
ip3 mediates ca release from intracellular stores , whereas dag stimulates several effectors containing the dag - regulated c1 domain , such as classical and novel protein kinase c isoforms .
concomitantly , other signaling molecules , including phosphatidylinositol 3 kinases ( pi3ks ) , protein tyrosine and serine / threonin kinases , and ras - like small gtpases , are activated and contribute to promote full platelet activation .
these events eventually promote platelet aggregation and thrombus formation , which are supported by the stimulation of integrin iib3 , that is converted into a high - affinity state for fibrinogen , whose binding mediates interaction of adjacent cells promoting thrombus growth [ 2 , 4 , 5 ] . several signaling pathways evoked upon platelet adhesion require the intervention of one or more ras - like small gtpases , that operate as molecular switches by cycling between an inactive state bound to gdp and an active state bound to gtp through the action of specific guanine nucleotide exchange factors ( gefs ) and gtpase - activating proteins ( gaps ) .
platelets express several ras - like gtpase , including ras [ 7 , 8 ] , ral , rho , rac and , cdc42 , but are particularly rich of members of the rap subfamily of gtpases .
this paper will focus on platelet rap gtpases to highlight recent insights into the mechanism of activation and recruitment upon stimulation of the major platelet adhesion receptors .
it is now well established that rap gtpases are involved in several cell functions , including growth , proliferation , cell - cell contact , and adhesion .
the rap family consists of five members : two rap1 proteins ( rap1a and rap1b ) that share 90% sequence homology and three rap2 proteins ( rap2a , rap2b , and rap2c ) which are about 70% homologous to rap1 [ 1416 ] .
an important difference between the two subfamilies is that rap2 proteins typically display a lower sensitivity to gaps , promoting a prolonged rap2 signaling compared to that of rap1 .
although regulated by the same set of gefs and gaps , rap1 and rap2 can be involved in distinct processes , as shown in cell types different from platelets [ 17 , 18 ] , suggesting that they may operate through different effectors .
the biochemical basis of these different effects has not been thoroughly investigated ; however it might also be related to the differences in posttranslational modifications and subcellular localization of rap1 and rap2 isoforms .
rap1b is the most abundant gtpase in platelets and represents up to the 0.1% of total proteins , but platelets also contain rap2b , which , however , is about ten times less abundant than rap1b .
very low levels of rap1a and rap2a have been detected in platelets , whereas rap2c is not present [ 12 , 16 , 20 ] . probably because of these different levels of expression ,
only a limited number of studies have addressed the biochemistry and function of rap2b in platelets [ 19 , 2124 ] , while the majority of the investigations have focused on rap1b . in platelets ,
the most abundant and functionally relevant rapgef is certainly the ca- and dag - regulated caldag - gefi , which represents the key regulator of rap gtpases activation downstream of plc activation [ 2528 ] .
the expression of low levels of other rap1gefs , as pdz - gef and caldag - gefiii , has also been reported , but in some cases their presence remains controversial [ 29 , 30 ] .
the only gap specific for rap gtpases identified in platelets is rap1gap2 , whereas rap1gap1 , spa-1 , and e6tp1 have not been found .
it has been shown that rap1gap2 is able to associate with 14 - 3 - 3 and to modulate cell adhesion when overexpressed in hela cells ; however the importance of this regulator in platelet function is still unknown .
the role of rap gtpases , and in particular of rap1 , in the regulation of cell adhesion is well documented by a number of observations in different cell types [ 3235 ] .
rap gtpases participate to the conversion of integrins into a high - affinity state for their ligands , that in turn allows cells to interact , in a controlled fashion , with other cells and with extracellular matrix components .
the ability of integrins to bind their ligands is regulated by inside - out signaling pathways that originate inside the cell and are then transmitted to the extracellular ligand - binding domain of the receptor .
integrin - mediated platelet functions include adhesion , aggregation , and thrombus formation , and thus it appears reasonable for rap1b to be involved in these responses . in this context
, important information has been collected upon the generation of the genetically modified mice that do not express either rap1b , or the main rap1gef present in platelets , caldag - gefi .
rap1b knockout mice display a prolonged tail bleeding time and a marked protection from platelet - dependent arterial thrombosis , demonstrating an essential role of this gtpase in both haemostasis and thrombosis .
the importance of rap1b activation in thrombus formation is also confirmed by analysis of caldag - gefi knockout mice .
although the clotting parameters are normal , caldag - gefi knockout mice display strong defects in haemostasis assessed by bleeding tail analysis .
in addition , platelets in whole blood collected from caldag - gefi knockout mice fail to form thrombi when perfused over a fibrillar collagen surface both at low and high shear rates [ 26 , 38 ] .
moreover , the lack of caldag - gefi is also associated with defective in vivo thrombosis , that is virtually abolished in arteries and strongly reduced in venules .
these alterations of the haemostatic and thrombotic functions of platelets , which are driven by both cell - matrix and cell - cell adhesion , are indicative of a role for rap1b in the regulation on platelet integrin function .
platelets express at least five different integrins ( iib3 , 21 , 51 , 61 , and v3 ) and in particular integrins iib3 and 21 play a predominant role in platelet adhesion and activation .
however , integrins 51 and 61 are required to mediate shear - resistant adhesion , whereas the function of integrin v3 is less understood . a number of ex vivo studies on human and murine platelets have demonstrated that rap1b plays a critical role in the regulation of integrin iib3 affinity state and , therefore , controls platelet aggregation induced by soluble agonists [ 26 , 27 , 37 , 40 ] .
important information on the mechanism of inside - out integrin activation has been collected using transfected cell lines to reconstitute this signaling pathway .
these studies indicate that integrin signaling involves the interaction of the head domain of the cytoskeletal protein talin with specific sites of integrin -tail and with the plasma membrane [ 41 , 42 ] .
talin can synergize with kindlin-1 and -2 to mediate integrin iib3 conversion into the active state ; however , the overexpression of kindlin alone is not sufficient to promote integrin activation . in talin- and integrin iib3-expressing cho cells
, the coexpression of pkc at levels comparable to those present in platelets induces a strong responsiveness to pma exposure , and the overexpression of a constitutive active form of rap1a bypasses the requirement of pkc , indicating that , in this model , rap1 lies downstream of pkc . among different potential rap1 effectors , riam ( rap1-interacting adaptor molecule ) was shown to be involved in integrin regulation , and its overexpression in cell lines bypasses the requirement of rap1 .
moreover , riam knockdown suppresses rap1-mediated integrin activation , as well as the association between talin and integrin -tail [ 45 , 46 ] .
however , the importance of riam in platelet physiology and integrin iib3-mediated platelet aggregation still needs to be determined and will require the development of riam knockout mouse models .
further support to the hypothesis that rap1b regulates integrin affinity was provided by the analysis of rap1b and caldag - gefi knockout mice . generally ,
the lack of rap1b or caldag - gefi is coupled to a substantial defect in integrin iib3 activation and platelet aggregation .
rap1b - deficient platelets display a reduced aggregation in response to a wide range of concentrations of agonists , as adp and epinephrine , and to low doses of collagen , thrombin receptor - specific agonist aypgkf , and ca ionophore .
the lack of caldag - gefi is associated with a more severe reduction of platelet aggregation caused by the same set of agonists , whereas the dag analogue pma and high doses of thrombin induce a comparable extent of platelet aggregation in wild - type and caldag - gefi - deficient platelets .
the caldag - gefi - independent pathway leading to platelet aggregation requires pkc activation , subsequent granule release , and p2y12 stimulation by secreted adp [ 26 , 28 , 47 ] . similarly to integrin iib3 , also integrin 21 is present on the platelet surface in at least two different affinity states for its ligands , and conversion into the high - affinity state facilitates collagen - mediated platelet activation [ 4850 ] . in this context
, it has been recently shown that , under certain conditions , rap1b expression is required to allow a proper integrin 21 activation .
indeed , platelets from rap1b knockout mice show defective integrin 21 activation upon stimulation of the collagen receptor gpvi , but not upon stimulation of thrombin or adp receptors . however , the extent of adhesion to collagen via integrin 21 is normal in platelets from rap1b knockout mice , suggesting that adhesion to collagen under static conditions does not involve rap1b - dependent stimulation of integrin 21 .
interestingly , in contrast to what was observed for rap1b - deficient platelets , platelets from caldag - gefi knockout mice display a reduced ability to adhere to immobilized collagen under static conditions , when compared to wild - type cells . moreover , also
the ex vivo analysis of thrombus formation on immobilized collagen under flow has revealed a reduced area coverage and thrombus growth in caldag - gefi knockout platelets .
interestingly , the addition of adp and txa2 increases the adhesion of caldag - gefi knockout platelets to a collagen surface at low shear rates , without restoring thrombus growth .
in addition to the key role played in platelet adhesion to collagen , the expression of caldag - gefi is also required for an efficient platelet interaction with other 1 integrin ligands as laminin and fibronectin .
the observed differences between rap1b and caldag - gefi knockout mice , which are particularly evident in terms of phenotype severity , may be related to possible additional functions of caldag - gefi , independent of rap1b activation , that can be required for efficient integrin - mediated adhesion . moreover , in rap1b knockout platelets rap1a or rap2b could partially compensate the lack of rap1b . indeed ,
although expressed at lower level rap1a can be activated by platelet stimulation in rap1b knockout platelets . by contrast , since caldag - gefi also stimulates rap2b activity in platelets , this isoform can not compensate the lack of rap1b , and this may explain the more severe phenotype of caldag - gefi knockout mice .
however , it should also be considered that some discrepancy in the results obtained from caldag - gefi and rap1b knockout mice simply reflects the different experimental conditions adopted .
an increasing number of observations indicate that rap gtpases and adhesive receptors are connected in a bidirectional fashion .
as described above , a major role for rap gtpases is the regulation of integrin affinity for the specific ligands . in this context rap1b activation
is triggered by stimulation of many gpcrs in platelets and participates to the organization of the signaling pathway for integrin inside - out activation .
however , in the last years , an increasing number of studies have proved the involvement of rap1b also in integrin outside - in signaling and have documented its activation downstream of many platelet adhesive receptors .
integrin 21 is a collagen receptor important for a proper hemostasis in humans , as documented by the observation that mutations of this receptor are associated with bleeding disorders and reduced platelet responses to collagen [ 54 , 55 ] .
integrin 21 is a critical platelet adhesion receptor , that interacts with collagen , by recognizing hexapeptidic sequences , such as gfoger , gloger , gasger , groger , and glogen [ 5658 ] , but it also binds tenascin , and mediates platelet adhesion to the small proteoglycan decorin .
platelet adhesion via integrin 21 directly stimulates rap1b activation , without the need for further autocrine stimulation by secreted adp or released thromboxane a2 .
experiments performed with platelets from genetically modified mice have shown that caldag - gefi is the only gef required for rap1b stimulation downstream of integrin 21 .
the dissection of the signaling pathway involved indicates that plc2 expression and activation are mandatory for integrin 21-triggered rap1b activation .
interestingly , recruitment of platelet integrin 21 mediates the activation of plc2 by two redundant mechanisms : a classical src - mediated phosphorylation of plc2 itself and a phosphorylation - independent mechanism involving the rac gtpase .
these observations indicate the existence of important crosstalk between rac1 and rap1b gtpases in the control of platelet adhesion and activation , with rac1 being potentially upstream of rap1b . as it will be discussed later
, the existence of a crosstalk between rap and rac has been recently confirmed also downstream of gpvi
. further analysis of caldag - gefi and plc2 knockout mice demonstrated that the lack of rap1b activation is accompanied by a significant inhibition of integrin iib3 conversion into the high - affinity binding state for fibrinogen , demonstrating that rap1b activation plays a key role in the crosstalk between integrins and regulates integrin 21-mediated platelet aggregation [ 27 , 61 ] .
more recently , it has been demonstrated that maximal rap1b activation induced by integrin 21 downstream of plc2 requires the contribution of an additional ca - dependent signaling pathway involving the focal adhesion kinase pyk2 and the subsequent stimulation of pi3k. in fact , the lack or the impaired activation of pyk2 and pi3k causes a defective rap1b activation triggered by integrin 21 engagement .
these findings outline that , as previously observed in platelets stimulated with adp or other soluble agonists [ 6365 ] , also in integrin 21 outside - in signaling rap1b activity is regulated by pi3k .
since virtually no residual rap1b activity is detected in caldag - gefi - deficient platelets , this observation points to a contribution of pi3k activity in the regulation of caldag - gefi , but the molecular mechanism for this process is still to be defined .
gpvi is membrane glycoprotein specifically expressed in platelets , functionally associated with the itam - containing transmembrane adapter protein fcr -chain [ 66 , 67 ] .
it is well documented that platelet gpvi is responsible for the first set of signals induced by platelet interaction with collagen and that it strongly cooperates with integrin 21 to mediate full collagen - induced response [ 50 , 68 ] .
the gpvi - fcr -chain complex initiates a tyrosine - kinase - based signaling cascade which involves src and syk kinases , the adaptor proteins lat and slp76 , and leads to phosphorylation and stimulation of plc2 . mouse or human platelets lacking gpvi
fcr -chain display severe defects in collagen - induced activation , integrin iib3 regulation and platelet aggregation [ 7076 ] .
as part of the signaling pathways for collagen - induced platelet activation , gpvi stimulation triggers rap1b activation .
this process , however , is at least partially dependent on adp secretion and the subsequent stimulation of p2y12 receptor , both in human and murine platelets [ 24 , 65 , 77 ] .
nevertheless , the existence of a direct , p2y12-independent pathway of gpvi - mediated rap1b activation has been confirmed by the analysis of aggregation of platelets collected from wild - type and rap1b knockout mice , performed in the presence of adp receptors antagonists .
these experiments show that the lack of rap1b is associated with a reduced adp - independent , gpvi - mediated platelet aggregation , demonstrating that this gtpase is required for an efficient gpvi signaling .
interestingly , direct rap1b - activation - mediated downstream of gpvi depends on the activity of pi3k , and it has been demonstrated that the contribution of both the and isoforms of pi3k is required [ 65 , 77 , 78 ] . as for the other platelet collagen receptor , integrin 21 , caldag - gefi is a specific regulator of rap1b activation also downstream of gpvi [ 28 , 53 ] .
in addition , a number of gpvi - dependent responses have been found to be impaired in caldag - gefi - deficient platelets .
some of these , such as integrin iib3 activation , and platelet aggregation are consistent with the well - documented role for rap1b , and other defects , such as the reduction of erk signaling leading to a decreased txa2 synthesis , or the impaired granule secretion , point to possible novel implication for this gtpase in platelet function [ 28 , 53 , 79 ] .
the gpvi - mediated signaling pathway leading to rap1b activation involves the small gtpase rac1 . the observation that rac1 is involved in plc2-dependent stimulation of rap1b downstream of integrin 21 has been extended in a recent work by stefanini and coauthors showing that the two gtpases exert a mutual influence also downstream of gpvi .
indeed , rap1b signaling sustains rac1 activation , and , in turn , rac1 provides a feedback regulation of rap1 through caldag - gefi and p2y12 .
interestingly , the ability of gpvi - fcr -chain complex to stimulate rap1b has been directly compared to the stimulation of the closely related rap2b .
it has been reported that gpvi ligation results in a time - dependent rap2b activation , that is not influenced by platelet aggregation ( i.e. , integrin iib3-mediated fibrinogen binding ) and actin cytoskeleton remodelling .
differently to what was observed for rap1b , secreted adp plays only a negligible role in rap2b activation triggered by gpvi , whereas ca mobilization and pkc activation are both required . another remarkable difference between activation of rap1b and rap2b downstream of gpvi is that rap2b stimulation is largely independent from pi3k activity .
however , it is important to note that pi3k inhibitors suppress thrombin - induced rap2b activation .
rap1 and rap2 are therefore differently regulated by pi3k , depending on the nature of the stimulus .
recently , it has been shown that rap2b activation depends on caldag - gefi and p2y12 signaling , similarly to what was already demonstrated for rap1b . according to the lower sensitivity to gaps
, rap2b displays a higher baseline activation that is also a more sustained in time , compared to that of rap1b [ 53 , 80 ] .
therefore , our current information on the contribution of rap2b to platelet adhesion is still really limited .
integrin iib3 ( also known as gpiib / iiia ) is the most abundant platelet membrane receptor and is responsible of the binding of platelets to soluble fibrinogen , a process that mediates platelet aggregation .
as introduced before , integrin iib3 undergoes a conformational change upon platelet activation , that increases the receptor affinity for fibrinogen .
this inside - out activation of the integrin function involves rap1b stimulation and its association with riam , talin and other signaling and cytoskeletal proteins , such as vinculin and kindlin [ 2 , 44 , 46 ] .
however , in addition to the key role in platelet aggregation , integrin iib3 is also able to mediate platelet adhesion to immobilized fibrinogen and to other rgd - containing ligands , including vwf , vitronectin , fibronectin , and thrombospondin .
integrin iib3 interaction with its ligands initiates an outside - in signaling pathway , that contributes to the regulation of the later phases of platelet activation and is required for firm platelet adhesion and spreading on extracellular matrices [ 8587 ] , fibrin clot retraction , platelet procoagulant activity , and microparticle release [ 89 , 90 ] .
the first evidence for the involvement of rap1b in integrin iib3 outside - in signaling was obtained from studies with thrombin - stimulated platelets in the presence of integrin antagonists , including the peptide grgds , that prevent fibrinogen binding and platelet aggregation . in this context
it was initially shown that sustained rap1b activation mediated by thrombin requires the interaction between integrin iib3 and fibrinogen , as it was inhibited by the rgds peptide .
the activation of rap1b by integrin iib3 has been confirmed by the direct observation that platelet adhesion to immobilized fibrinogen stimulates the accumulation of gtp - bound rap1b .
integrin iib3-mediated rap1b activation is regulated by multiple intracellular effectors , including src kinases , pkc , and cytosolic ca . moreover
, rap1b - deficient platelets display a reduced spreading on fibrinogen compared with wild - type controls , whereas clot retraction is abolished , indicating that stimulation of rap1b is important for integrin iib3-mediated platelet responses [ 37 , 79 ] .
the gpib - ix - v receptor complex , which contains four transmembrane proteins , gpib , gpib , gpix , and gpv , mediates platelet binding to vwf in a shear - dependent fashion .
the vwf - gpib - ix - v interaction is required to slow down circulating platelets on the site of injury and is strongly involved in the regulation of integrin iib3 and in the formation of arterial thrombi .
the adhesive function of gpib - ix - v is coupled to the generation of intracellular signals that support platelet activation mainly through the phosphorylation of the itam - bearing fciia receptor , which is physically associated with it .
moreover , fciia receptor - independent signal transduction pathways occurring downstream of gpib - ix - v and leading to protein phosphorylation , calcium oscillation , and integrin iib3 activation have been identified .
gpib - ix - v ligation triggers the subsequent activation of integrin iib3 that mediates firm platelet adhesion and initiates thrombus formation . despite the relevance of the initial platelet adhesion through gpib - ix - v at the site of arterial injury for the whole process of thrombus formation ,
the information about the ability of this adhesion receptor to trigger rap gtpases activation is extremely limited .
it has been shown that platelet stimulation with vwf triggers the activation of both rap1b and rap2b and promotes their association with the cell cytoskeleton through a process involving the fciia receptor .
vwf - induced rap2b translocation to the cytoskeleton , in particular , is dependent on integrin iib3 as it is prevented in the presence of anti - integrin iib3-specific antibodies , as well as in patients affected by glanzmann 's thrombasthenia , a genetic disorder associated with the lack of expression of integrin iib3 .
antibody - mediated clustering of fciia receptor , that induces its tyrosine phosphorylation and mimic the signaling pathway triggered by vwf - mediated gpib - ix - v stimulation , is coupled to rap1b activation in a fashion completely dependent on secreted adp .
unfortunately , studies that used transgenic mouse models to elucidate the role of rap1b in gpib - ix - v - mediated platelet responses have not been reported .
the great effort devoted to understand the roles of rap gtpases in the regulation of platelet function produced a huge amount of evidence demonstrating their critical role in haemostasis and thrombosis . as schematically summarized in figure 1 , the involvement of rap gtpases in adhesion dynamics is complex and bidirectional , as they are both activated by adhesive receptors and essential for the regulation of the adhesive properties of integrins .
the crucial implication of rap gtpases in the control of cell adhesion suggests that the identification of their effectors may help to define novel possible targets for effective antiplatelet therapies for the treatment of cardiovascular diseases . | ### Summary:
: integrins and other families of cell adhesion receptors are responsible for platelet adhesion and aggregation , which are essential steps for physiological haemostasis , as well as for the development of thrombosis .
the modulation of platelet adhesive properties is the result of a complex pattern of inside - out and outside - in signaling pathways , in which the members of the rap family of small gtpases are bidirectionally involved .
this paper focuses on the regulation of the main rap gtpase expressed in circulating platelets , rap1b , downstream of adhesion receptors , and summarizes the most recent achievements in the investigation of the function of this protein as regulator of platelet adhesion and thrombus formation . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: spinal stability is important for prevention and treatment of lumbar damage ( mcgill , 2001 ) , and requires concurrent activity of all trunk muscles around the lumbar region ( lehman et al . ,
the spinal muscles used for spinal stability are divided into global muscles , which are large muscles located on the surface of the abdomen and lumbus and are engaged in overall stability , and local muscles , which are intrinsic muscles situated deep in the abdomen and lumbus , are directly connected to the spine and engage in fine adjustment of the spine and stability of the spinal segments ( bergmark , 1989 ) .
concurrent activity between the global and local muscles maintains the spine in a stabilized condition ( marshall and murphy , 2005 : stevens et al . , 2007 ) ,
which is essential for physical posture , balance and recovery of stability ( duarte et al . , 2002 ) .
loss of this trunk control function is a factor for body misalignment , decrease in upper and lower extremity motor function and impairment in balance adjustment , gait ability and activities of daily living ( verheyden et al . , 2006 ) .
therefore , trunk control can be used to evaluate balance , gait and recovery in daily routines ( hsieh et al . , 2002 ) .
stabilization exercises are conducted to adjust force when the patient s posture is unstable and to control movements consciously and unconsciously so that the spine maintains a neutral position , which is the best posture for the spine to adjust to an external load .
both global trunk and segment deep muscles play critical roles in providing stability and maintaining the upright posture ( kisner and colby , 2016 ) , and is an intervention that prevents repetitive micro - damage of the muscles around the spine and degenerative change of the spinal joints ( richardson et al . , 1999 ) .
it is used as an essential therapeutic method for low - back pain patients to recover trunk control ability ( maffey - ward et al . , 1996 ) .
the three methods used to activate the stabilizer muscle system in the lumbar vertebra include a drawing - in manoeuver ( di ) to pull the navel towards the spine , abdominal bracing ( ab ) to splay the lumbar region laterally by fixing the abdominal muscles and a posterior pelvic tilt ( pt ) to make the pelvis tilt posteriorly in a positive manner and the lumbar vertebra even . among them ,
the first method activates the transversus abdominis ( tra ) , minimizing contraction of the oblique abdominal or not contracting the muscle ( kisner and colby , 1999 ) . as a technique to measure this ,
ultrasonography is a useful noninvasive tool to measure the size and activity conditions of deep trunk muscles , such as the tra and multifidus ( kwon et al . , 2011 ) .
ultrasonography can observe an object directly on a real - time basis and enables fast measurement and repetitive tests without the risk of radiation exposure ( hedrick et al .
, we examine the thickness of the abdominal muscle and its activity during the performance of the three drawing - in methods .
the procedures of this study were harmless to the human body . all subjects read and signed a written consent form .
they listened to an account of the study s purpose and methods , understood the study content and consented to participate in this experiment ( table 1 ) . using ultrasonography and electromyography ,
the experimenter measured the thickness of the tra , internal oblique ( io ) and external oblique ( eo ) muscle .
also measured was the activity of the io and eo while the subject was performing the three drawing - in methods .
the three spinal stabilization methods di , ab , and pt were performed 3 times randomly .
drawing - in manoeuver : the subject lay in a supine position on a bed with the knee joint flexed at 90. both hands were placed beside the head , and the eyes were fixed on one point on the ceiling . as the subject breathed out , the navel was posteriorly pulled up .
abdominal bracing : in the same posture as described above , the subject breathed out and pulled in the navel with constant pressure .
posterior pelvic tilt : in the same posture as described above , the subject breathed out , had the lumbus evenly on the bed and the pelvis was pulled back .
changes in the thickness of the io and eo were analysed using ultrasonography ( f31 , hitachi - aloka medical . , tokyo , japan ) while the subjects were resting and in a state of three draw - in method .
ultrasonographic imaging was obtained using a 10-mhz linear probe ( ust-5413 ) , with the midpoint of the transducer placed along the midaxillary line in the transverse plane just above the right iliac crest ( hodges et al . , 2003 ) .
a wireless surface electromyography ( telemyo 2400 t , noraxon co. , scottsdale , az , usa ) , was used to obtain measurements . each muscle s surface electrode was attached to the middle area of the belly where the muscles were most activated in parallel with the direction of the muscle fibres in a manual muscle test .
the interval between the two electrodes was maintained at 2 cm to compare differences in potential between the two electrodes .
all raw data from the electromyograph were transformed into root mean square and analysed as described below . in order to compare electromyography signals between subjects and between muscles
, a standardization process was performed that assumed muscle contraction of certain motions as the reference voluntary contraction ( rvc ) and used the % rvc based on the rvc ( cram et al . , 1998 ) to standardize electromyography signals . a one - way analysis of variance ( anova )
was utilized to examine changes in the thickness of abdominal muscles and changes in muscle activity when abdominal drawing - in techniques were performed . as a post hoc test ,
statistical processing for data analysis was conducted using pasw statistics ver . 18.0 ( spss inc . , chicago , il , usa ) , and the significance level to verify statistical significance was set at 0.05 . in this study ,
the experiment was conducted on a single force plate to examine movements and ground reaction forces in the feet while the subjects were standing up from sitting ( bp600400 , amti co. , watertown , ma , usa ) , and data on vertical , forward - and - backward and side - to - side ground reaction forces were obtained .
a one - way anova approach was used to compare the changes according to the three angles and heights .
fisher lsd post hoc analysis was performed and the statistical significance level was set to 0.05 .
the procedures of this study were harmless to the human body . all subjects read and signed a written consent form .
they listened to an account of the study s purpose and methods , understood the study content and consented to participate in this experiment ( table 1 ) .
using ultrasonography and electromyography , the experimenter measured the thickness of the tra , internal oblique ( io ) and external oblique ( eo ) muscle . also measured
was the activity of the io and eo while the subject was performing the three drawing - in methods .
the three spinal stabilization methods di , ab , and pt were performed 3 times randomly .
drawing - in manoeuver : the subject lay in a supine position on a bed with the knee joint flexed at 90. both hands were placed beside the head , and the eyes were fixed on one point on the ceiling . as the subject breathed out , the navel was posteriorly pulled up .
abdominal bracing : in the same posture as described above , the subject breathed out and pulled in the navel with constant pressure .
posterior pelvic tilt : in the same posture as described above , the subject breathed out , had the lumbus evenly on the bed and the pelvis was pulled back .
changes in the thickness of the io and eo were analysed using ultrasonography ( f31 , hitachi - aloka medical . , tokyo , japan ) while the subjects were resting and in a state of three draw - in method .
ultrasonographic imaging was obtained using a 10-mhz linear probe ( ust-5413 ) , with the midpoint of the transducer placed along the midaxillary line in the transverse plane just above the right iliac crest ( hodges et al . , 2003 ) .
a wireless surface electromyography ( telemyo 2400 t , noraxon co. , scottsdale , az , usa ) , was used to obtain measurements .
each muscle s surface electrode was attached to the middle area of the belly where the muscles were most activated in parallel with the direction of the muscle fibres in a manual muscle test .
the interval between the two electrodes was maintained at 2 cm to compare differences in potential between the two electrodes .
all raw data from the electromyograph were transformed into root mean square and analysed as described below . in order to compare electromyography signals between subjects and between muscles ,
a standardization process was performed that assumed muscle contraction of certain motions as the reference voluntary contraction ( rvc ) and used the % rvc based on the rvc ( cram et al . , 1998 ) to standardize electromyography signals .
a one - way analysis of variance ( anova ) was utilized to examine changes in the thickness of abdominal muscles and changes in muscle activity when abdominal drawing - in techniques were performed . as a post hoc test ,
fisher least significant difference ( lsd ) test was carried out . statistical processing for data analysis
, chicago , il , usa ) , and the significance level to verify statistical significance was set at 0.05 . in this study ,
the experiment was conducted on a single force plate to examine movements and ground reaction forces in the feet while the subjects were standing up from sitting ( bp600400 , amti co. , watertown , ma , usa ) , and data on vertical , forward - and - backward and side - to - side ground reaction forces were obtained .
a one - way anova approach was used to compare the changes according to the three angles and heights .
fisher lsd post hoc analysis was performed and the statistical significance level was set to 0.05 .
the ultrasonography measurements for the drawing - in , ab and pt techniques were 0.640.20 , 0.540.15 , and 0.460.12 mm , respectively , with significant differences for the tra muscle ( table 2 ) .
the post hoc test showed a significant difference between the drawing - in and ab techniques and between the drawing - in and pt techniques .
the electromyography results of the drawing - in , ab , and pt techniques were 4.35%1.72% , 3.00% 1.48% , and 2.70%1.52% of rvc , respectively , for the io abdominal .
there was a significant difference in the drawing - in , ab , and pt techniques for the eo abdominal ( 5.10%3.30% , 3.85%3.89% , 2.25%1.29% of rvc , respectively ) ( table 3 ) .
the post hoc test showed a significant difference between the drawing - in and ab techniques and between the drawing - in and pt techniques for the io abdominal and a significant difference between the drawing - in and pt techniques for the eo abdominal .
three techniques are commonly employed in the clinical field to activate abdominal muscles , but their effects are not obvious . in this study , experiments were conducted to minimize activity of the internal and eo and to examine which of the three techniques resulted in the greatest thickness and activity of the tra .
the treatment goal of the drawing - in technique is to activate the tra , minimizing contraction of the oblique muscles or not contracting those muscles .
with coactivation of the tra and multifidus , the di technique was more effective than ab and pt ( hodges and richardson , 1996 ) .
the di increases internal pressure by moving the abdominal wall inward ( kisner and corby , 2016 ) , and for this reason is recommended for stabilization training . in the present study ,
ultrasonography showed significant changes in the thickness of the tra compared to the internal and eo when using the di method .
kisner and colby ( 2016 ) also reported that activation of these muscles was minimized or not perceived when surface electrodes were attached to the rectus abdominis and eo prior to using the di method .
ab in contrast with the di method showed activation of the oblique abdominal and stabilized the global muscles ( richardson et al . , 1992 ) .
in the present study , activity of di in both the internal and eo was high using the ab and pt techniques with surface electromyography , and the activity of the tra significantly increased as shown by ultrasonography .
this is judged to be because the activity of the io and eo changed without changes to their thickness .
the pt exercise largely activates the rectus abdominis , which is used for dynamic flexion of the trunk .
this muscle is not considered a key stabilization muscle of the spine and is not regarded as important in stabilization training ( hodges and richardson , 1997 ) .
this method is mostly used to perceive movement of the pelvis and lumbar vertebrae ; stabilization muscles may be activated if the range of motion of the lumbus by pelvic tilting is spotted and the neutral location or the pelvic functional range of motion is known . | ### Summary:
: in this study , we examine the thickness of the abdominal muscle and its activity during the performance of the three drawing - in methods .
the subjects were 20 healthy male and female students in their 20s . using ultrasonography and electromyography ,
the experimenter measured the thickness of the transversus abdominis ( tra ) muscle , internal oblique ( io ) muscle and external oblique ( eo ) muscle .
the ultrasonography measurements for the drawing - in manoeuver ( di ) , abdominal bracing , and posterior pelvic tilt ( pt ) techniques were 0.640.20 , 0.540.15 , and 0.460.12 , respectively , with significant differences for the tra .
the electromyography results of the di , sa , and pt techniques were 4.351.72 , 3.001.48 , and 2.701.52 , respectively , for the io .
there was a significant difference in the di , sa , and pt techniques for the eo ( 5.103.30 , 3.853.89 , 2.251.29 , respectively ) .
the di method activated the oblique abdominal muscles , but there was no great change in their thickness ; the tra , however , was selectively strengthened through changes in its thickness . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: this exposition also makes scars and deformities clearly visible when looked upon ; hence , a meticulous repair of lip injuries is important for the cosmetic outcome .
lip amputations , however , are rare and swift management with microsurgical approach is essential for a good cosmetic and functional outcome .
we present a case of lip amputation due to dog bite and a review of the literature .
a medline / pubmed search was performed for all scientific english literature involving lip amputation and replantation using microsurgery .
lip avulsion , lip replantation , and lip reimplantation .
a 28-year - old woman presented at an emergency department on a weekend night at a rural hospital following dog bites sustained to her lips .
there were two bites , one that lacerated the lower lip that was still connected to the face by a small , lateral pedicle and one that amputated more than half of the upper lip .
the defect crossed the philtrum medially and extended laterally to the nasolabial fold ( figure 1 ) .
the patient was referred to the sahlgrenska university hospital and arrived at the department of plastic surgery 90 min after the trauma .
the amputate , measuring 4.5 3 cm , had been kept in a hypothermic state ( figure 2 ) .
peroperatively , a 1 mm superior labial artery was identified laterally on the amputate and was microsurgically anastomosed to the proximal stump of the superior labial artery using 100 s and t sutures .
the lip was sutured in three layers : the mucosa , the orbicularis oris muscle , and finally , the skin , which was loosely sutured to allow bleeding and lessen the risk of hematoma .
a leech ( hirudo medicinalis ) was applied to the lip in order to achieve venous drainage and it immediately regained adequate skin color and became less swollen ( figure 3 ) .
the lower lip was also sutured in three layers and was adequately vascularized through the right inferior labial artery during the whole procedure . during first night , leeches were applied every 45 min , and thereafter , the interval was extended , guided by the color of the lip ; day 2 every 90 min , day 35 every 2 h , day 610 every 3 h , day 1112 every 4 h. on the 13th day , the lip did not need leech therapy and the patient could be discharged on day 14 .
anticoagulant therapy was provided using subcutaneous injection of dalteparin 5000 u / day for 14 days .
the constant bleeding from the lip during leech therapy necessitated several blood transfusions to a total of seven units .
preoperative picture showing the defect in the upper lip and the large laceration of the lower lip .
the amputated part of the upper lip , measuring 4.5 3 cm , was kept in a hypothermic state .
broad spectrum antibiotics ( meropenem 0.5 g three times daily ) was used for 10 days in order to prevent infections from bacteria associated with dog bites and bacteria of the leeches normal flora ( e.g. aeromonas hydrophila ) .
nutrition was achieved by clinifeeding tube during the first three days but was converted to parenteral nutrition due to severe nausea and vomiting . on the 8th day , the patient could ingest sufficient amounts per oral route .
the patient received a tracheostomy preoperatively in order to secure the airway due to face swelling and the continuous bleeding from the lip which to some extent went into the mouth and throat .
at one - year follow - up , the patient had good oral continence , good lip motion , no problems with articulation , but the sensitivity for heat / cold and pin prick was still poor ( figure 4 ) .
lip amputation is rare but has severe consequences both functionally and esthetically if it can not be primarily reconstructed with the use of the amputated tissue .
smaller segments ( 1.5 cm ) can , in an elective setting , survive as composite grafts .
however , in a traumatic setting , especially with larger segments , the chance for the survival of a composite graft is small and highly unpredictable and can therefore not be recommended . in the literature search ,
32 cases were found in english literature [ 421 ] , 16 case reports and two case series of microsurgically treated amputated lips ( table 1 ) . even after the artery has been anastomosed and the lip amputate revascularized
, the search for a suitable vein can be difficult . in the lips , the veins are usually small , and since the trauma mechanism in 84% of the cases were some sort of bite , the chance to find a good - size anastomosable vein is small . if , however , a vein anastomosis can be accomplished , the resulting outflow is often insufficient . in the 15 cases with venous anastomosis
, some sort of method to relieve venous congestion was still needed in 60% of the cases ( table 1 ) .
this can be achieved in several ways ; medicinal leeches , mechanical pricking with topical heparin or intra - replant heparin.[421 ] without venous anastomosis , it is essential to use some sort of venous drainage for the replanted segment to survive . therefore , it is good a good idea to be prepared to use an additional method to relieve venous congestion , even when a successful venous anastomosis is accomplished . in the cases where no venous anastomosis was possible ,
the average duration for the relief of venous congestion was 6.6 days ( range 112 days ) .
this is in accordance with neoangiogenesis creating functional veins 46 days postreplantation . in the presented case
, we used medicinal leeches , which can be hard to accept for the patient , even though the patient tolerated it well in this case .
the usage of leeches also involves significant blood loss which requires blood transfusions . in this case , the patient had a total of seven units of blood , which is within the normal limit in when using leeches for 12 days .
there is a risk of infection but with the use of proper prophylactic antibiotic , the risk can be decreased .
even if the time lapse from trauma to repair is long , a successful lip replantation has been managed after as long as 17 h of ischemia . thus , even if the primary contact is at a rural hospital where microsurgery is not available , it is well motivated to send the patient to a secondary hospital with experience in microsurgical technique , provided that the amputate is handled correctly and put in a hypothermic state .
18 , 10 and 1218 being case reports , 9a m and 11a c being case series .
about 19% ( n = 6 ) of the 32 cases got partial necrosis , none had total necrosis .
there is no international consensus on what type of anticoagulant / s or prophylactic antibiotics to use in this type of cases .
heparin , dextran , and aspirin were the most commonly used substances in these 32 cases , either alone or in combinations .
the authors report no conflicts of interest . the authors alone are responsible for the content and writing of this article . | ### Summary:
: abstracta case with a patient who suffered an upper lip amputation and a lower lip laceration due to dog bite is presented .
the amputated segment was replanted using microsurgical technique .
the operative technique and postoperative care is presented , as well as a review of the current literature on the subject . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: a 27-year - old primipara at the 38th week of pregnancy visited the neurosurgery department with the complaint of a headache that continued from 2 years ago .
no other neurologic symptom was found except the hemorrhage in the left lateral cerebral ventricle by the brain mri .
the patient 's consciousness was lucid and the preoperative physical examination results were weight 77.5 kg , height 167 cm , blood pressure 120 - 140/60 - 80 mmhg , and heart rate 62 - 80/min .
the blood test results were hemoglobin 12.0 g / dl , platelet 159,000/l , and pt / aptt 9.8 ( inr 0.89)/23.4 .
the findings from all the other tests , including electrocardiography and chest x - ray imaging , were in the normal range .
for the preanesthetic treatment , an intravenous injection of famotidine 20 mg and an intramuscular injection of glycopyrrolate 0.2 mg were carried out 30 minutes beforethe operation . the heated , lactated ringer 's solution 700 ml
the patient 's blood pressure was 120/80 mmhg and heart rate was 65/min after arriving in the operating room . before the peridural anesthesia
after letting the patient be in the left lateral recumbent position , the epidural space was verified with the loss of resistance method usingan 18 g tuohy paracentesis needle by the median lumbar puncture in between l4 - 5 lumbar spines , and the catheter was installed and fixed . after an injection of 1.5% lidocaine 3 ml , the tested amount , containing 1 : 200,000 epinephrine , no increase in the heart rate or spinal anesthesia symptom was found . to make the total volume of phenylephrine and ephedrine 20 ml , phenylephrine 0.5 mg and ephedrine 30 mg were mixed with physiological saline and infused at the flow rate of 40
thereafter , dural tapping was carried out using a 25 g paracentesis needle by the median lumbar puncture method in between the l5-s1 lumbar spines .
after checking the cerebrospinal fluid , the intraspinal injection of 0.5% bupivacaine 7 mg and fentanyl 20 g followed . after changing the patient 's position into the supine position ,
the right hip was supported with a pillow so that the uterus could be tilted toward the left .
the operation started after checking that the sensory deprivation reached t4 - 5 by the pinprick test .
the intraoperative vital signs were relatively stable with the blood pressure of 120 - 150/60 - 80 mmhg and the heart rate of 65 - 85/min .
a ventiask , from which the oxygen fraction of inspired air was 35% , was applied , and a capnometer was installed below the patient 's nose to monitor the capnogram .
the continued infusion of phenylephrine and ephedrine was stopped 15 minutes after the spinal anesthesia because the blood pressure was kept stable . a 2,900 g healthy female infant was given birth and the apgar score of
the patient did not complain of any discomfort and the total duration of the operation was 1 hour .
the total amount of the fluid infused during the operation was 2,000 ml and the amount of urine was 1,100 ml .
for the postoperative desensibilization , the patient - controlled epidural analgesia was performed by mixing morphine 8 mg and fentanyl 500 mcg with 0.125% ropivacaine 100 ml , totally 118 ml , and infusing the mixture at the flow rate of 1.5 ml / hr . the vital signs in the recovery room were stable .
the visual analogue scale ( vas ) was maintained at 0 to 1 during the hospitalization .
the patient was discharged on the fifth day after the operation without any specific finding and is now followed up as an outpatient in the neurosurgery department .
moyamoya disease is a rare disease that brings about stricture and progressive occlusion in internal carotid arteries at both sides .
the disease invades the far external parts that are the procephalic , mesencephalic , and cerebral arteries , and eventually the blood supply to the parenchyma becomes dependent on the lateral angiogenesis from the vertebral artery .
neurologic abnormalities such as transient ischemic attack , paroxysmal hemiplegia , hemiamyosthenia , involuntary movement , and epileptic seizure are found in children .
the neurologic abnormalities are more frequently found in children when hyperventilation is caused by crying , coughing , or eating hot food .
the abnormalities are due to the decrease of the cerebral blood flow and the higher cerebral oxygen consumption rate than occurs in adults .
the cardinal symptoms in adults are headache and disturbance of consciousness due to cerebral ischemia or intracerebral hemorrhage .
a cerebral aneurysm also sometimes occurs in the case of adults . in the case of moyamoya disease accompanied by pregnancy
, the significant fact is that the probability of neurologic abnormalities exacerbation and an intracerebral hemorrhage is increased . in this case report
the hypercoagulable state induced by pregnancy and hypocapnia caused by hyperventilation in the delivery procedure are more likely to bring about cerebral ischemia . in addition to the risk of hyperdynamic circulation due to pregnancy and increased abdominal pressure from labor pain , the risk of an intracerebral hemorrhage due to hypertension is increased , as well as the danger of rupture when accompanied by an aneurysm .
thus , selective cesarean section has been known to be appropriate rather than vaginal delivery .
various cases have been reported in general anesthesia , spinal anesthesia , and peridural anesthesia [ 8 - 10 ] .
the objective anesthesia control is to maintain the balance between the cerebral blood flow and the cerebral oxygen consumption rate .
although the protective effect on the ischemia part can be expected since inhalation anesthetics reduce the cerebral metabolic rate in the case of general anesthesia , there is risk of pulmonary aspiration during tracheal intubation , intracerebral hemorrhage due to the increased blood pressure , and fetal distress .
it is difficult to evaluate the cerebral function with respect to the intraoperative intracerebral hemorrhage or cerebral ischemia .
non - invasive cerebral oxygen saturation monitoring such as invos an help the prediction of intraoperative intracerebral hemorrhage or cerebral ischemia , but the sensitivity and specificity of the monitoring method are limited . in the case of spinal anesthesia and peridural anesthesia ,
the risk of blood pressure increases while fetal distress and pulmonary aspiration decrease . the cerebral function can be evaluated and abnormal neurologic symptoms can be detected by observing the patient 's consciousness .
peridural anesthesia has advantages such that the hemodynamic change is gradual in comparison with spinal anesthesia and additional anesthetic injection is possible , but the induction failure rate is higher than that of spinal anesthesia .
spinal anesthesia bears the risk of cerebral ischemia due to the hypotension induced by the sympathetic block . in this case report , we chose the spinal - peridural joint anesthesia and carried out a continuous infusion of phenylephrin and ephedrine mixed with physiological saline to prevent hypotension .
the spinal - peridural joint anesthesia provides several advantages such that blood pressure elevation that may be caused by laryngoscope insertion and endotracheal intubation in general anesthesia can be avoided ; the mother 's pulmonary aspiration and the fetal distress can be prevented ; the cerebral function can be evaluated ; and the abnormal neurologic symptoms can be detected by observing the patient 's consciousness .
when compared to the case of performing either peridural anesthesia or spinal anesthesia alone , the spinal - peridural joint anesthesia provides rapid expression and a stable blocking effect , which are the advantages of spinal anesthesia , as well as control of the blocking level , extension of anesthesia , and easy postoperative pain control , which are the advantages of peridural anesthesia .
however , caution should be given to the risk of cerebral ischemia due to hypotension when carrying out the spinal - peridural joint anesthesia . in this case , the fluid volume preload and the uterine displacement were performed to avoid hypotension and the blood pressure was continuously monitored by the radial artery catheter . however , these measures were not enough to prevent hypotension , so phenylephrin and ephedrine mixed with physiological saline were continuously infused . concerning the hypertensor that is continuously infused to prevent hypotension , mercier et al
. reported that the hypotension frequency in the group to which an ephedrine - phenylephrine mixture was infused was less than that of the group to which only ephedrine was infused .
jung et al . reported that the hypotension prevention and postoperative nausea and vomiting suppression were more effective in the group to which only phenylephrine was infused and the group to which a phenylephrine - ephedrine mixture was infused than in the group to which only ephedrine was infused .
based on these results , phenylephrine 0.5 mg and ephedrine 30 mg were mixed with physiological saline to make the total volume of phenylephrine and ephedrine 20 ml .
the mixture was infused at the total flow rate of 40 ml / hr so that the flow rate of phenylephrine and ephedrine could be 16.6 g / min and 1 mg / min , respectively .
hypocapnia by hyperventilation was avoided and the body temperature was kept at 35.2 - 36.6 by maintaining the paco2 at 30 - 40 mmhg with periodic arterial blood gas analysis through the radial artery catheter .
moreover , in order to reduce the risk of complications , such as intracerebral hemorrhage , due to the increased blood pressure induced by the postoperative pain , a patient - controlled epidural analgesia was performed . in conclusion , we report the case where the selective cesarean section of a pregnant woman diagnosed with moyamoya disease was successfully carried out by simultaneously applying spinal - peridural joint anesthesia and continuously infusing phenylephrin and ephedrine mixed with physiological saline to prevent hypotension . in addition , we have given a related literature survey . | ### Summary:
: moyamoya disease is a rare progressive occlusive disease of the internal carotid arteries .
we report a case of combined spinal - epidural anesthesia in a patient with moyamoya disease presenting for cesarean section .
hypotension associated with spinal anesthesia for cesarean section is the most common and serious adverse effect despite the use of uterine displacement and volume preload .
we continuously infused phenylephrine and ephedrine to prevent hypotension .
the intraoperative hemodynamic state was stable .
the patient had no significant postoperative complications . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: this question came up from the syndrome of somatoparaphrenia where patients can not recognize their own body parts because of certain brain damage .
therefore the self - identification , especially called as the sense of ownership , has been researched over the long time in multisensory research .
however it is difficult to investigate the body ownership simply because all multimodal cues normally are bounded and not independent .
for instance , if you touch an object , the touch feeling always follows the view of the touch and they come from the same body . in contrast , sensory cues on external objects are independent .
therefore it is possible to investigate the sense of ownership when stimuli are applied to the real body and fake counterparts .
this is why body ownership illusion where someone experiences external objects as one 's own body parts has been intensively conducted ; the methodology of rubber hand illusion ( rhi ) has been extensively used . in rhi , participant is asked to watch a fake hand placed in front of him or her , while their real hand is hidden from the view .
then synchronous stimuli to the participant 's hand and dummy counterpart lead the participant to feel the fake one as his or her hand . in conventional rhi studies , they suggest that integration between multimodal information such as visual , tactile , and proprioceptive information is important to provide the sense of ownership [ 5 , 6 ] . due to the simple setup , the mechanism of the sense of ownership has been researched through this methodology with neuroimaging like fmri , pet , or eeg .
using fmri , activity in prefrontal cortex , ventral premotor cortex [ 710 ] , intraparietal sulcus [ 8 , 11 ] , and extrastriate body area associated with the experience of the sense of ownership has been found . as for pet
, it is reported that the body ownership is related to activity in the right posterior insula , sensorimotor cortex . besides , the studies using eeg show that the gamma band activity in the parietal area reflects the sense of ownership .
an enhanced somatosensory n140 component and erp modulations have also been observed after the period of synchronous stimuli .
moreover , tms as well as neuroimaging methods have been used to investigate the brain activity during the illusion , which shows that significant activity in right temporoparietal junction and extrastriate body areas during rhi [ 16 , 17 ] .
the regions of activity associated with the sense of ownership are differently reported depending on neuroimaging methods .
to summarize , it is at least obvious that wide brain areas including prefrontal cortex , ventral premotor cortex , sensorimotor cortex , parietal cortex , intraparietal cortex , and extrastriate body area are associated with the sense of ownership and these areas reflect multisensory integration .
many neuroimaging experiments have conducted recently as mentioned above . nevertheless , the studies investigating body ownership using near - infrared spectroscopy ( nirs ) are yet to be studied .
it measures the relative changes in oxygenated hemoglobin ( oxy - hb ) and deoxygenated hemoglobin ( deoxy - hb ) concentration .
the reason why the studies on nirs are limited is that nirs has low spatial resolution in contrast to fmri .
however , nirs is easy to use and relatively robust against body sway because it can be very portable and is less invasive than fmri and pet .
therefore participant 's movement is nearly natural in measurement on nirs , which is difficult to be achieved with other neuroimaging methods .
moreover , electromagnetic devices do not affect nirs unlike fmri , so we can introduce mechanical devices easily into rhi design for purpose of automatic setup .
for these reasons , we measure brain activity during rhi using nirs . in this experiment
, we introduce automated setup for rhi because brain areas associated with the sense of ownership may respond to the observation of touch applied by another person . we aim to eliminate the interference with multimodal integration .
then we induced rhi to participants with the stimulator and investigated whether the rhi using nirs could show the activity associated with the sense of ownership .
we also analyze the functional connectivity of nirs data during rhi , since dynamic relationship among brain areas associated with the sense of ownership has not yet been demonstrated well .
although there are several functional connectivity studies related to body ownership [ 14 , 20 ] , the studies focusing on causality are limited .
causality between different brain regions is more important and meaningful than simple correlation because neurons in brain transmit impulse as information to other neurons .
therefore we calculate granger causality between any two brain areas during rhi and consider significant causality as functional connectivity .
ten healthy volunteers ( 8 males and 2 females ; aged 2024 years ) participated in the following experiment .
eight out of the 10 subjects were right - handed and the rest were left - handed .
all subjects understood the purpose of the experiment and then provided written informed consent prior to participation .
the study was approved by the local ethical committee at the tokyo university of agriculture and technology in accordance with the declaration of helsinki . for automating setup ,
there are several methodologies to avoid interferences in sense of ownership through observation of being touched by another person . due to the development of virtual reality ( vr ) technique ,
firstly , we attached two paintbrushes to servomotors where the speed of rotation and direction were controlled with a microcontroller ( see figure 1 ) .
we were careful to regulate the maximum speed to reduce mechanical noise , which may disturb the illusion .
the participant 's right hand and the fake hand , which were veiled by a partition , wore cotton gloves in order to reduce the difference of shape and texture .
the torque of the servomotor is 2.5 kgfcm , which is enough to move the brushes which stimulate strongly the hand even over the cotton gloves .
moreover we put a board under their hands to adjust the height where each participant feels the stimulus on the back of their hand before beginning each session .
moreover , both hands were aligned to the same direction ( i.e. , congruent ) and were placed with 19 cm apart from each other .
this is because hand ownership decreases when the fake hand is not aligned with the participant 's hand or when an object instead of the fake hand is stroked . in the experiment , there were three experimental conditions ( synchronous , asynchronous , rest ) on rhi .
we manipulated the timing of the stroke stimuli on the both of hands , namely , ( a ) synchronous , two brushes stimulated the participant 's hand and the fake hand simultaneously for 600 ms at intervals of 500 ms ; ( b ) asynchronous , alternately the fake hand and the participant 's hand were stimulated one by one for 600 ms at intervals of 500 ms ; ( c ) rest , the two brushes did not stroke both hands at all .
each condition lasted for 120 s , and we defined the unit as session . the participants took a rest for 90 s between each session . besides they were asked to answer questionnaire on a 7-point likert scale ranging from 1 ( completely disagree ) to 7 ( completely agree ) for 60 s after the end of both synchronous and asynchronous conditions to assess the hand ownership .
this questionnaire comprised five statements : ( q1 ) i felt as if the rubber hand was my hand , ( q2 ) touch feeling is located on rubber hand , ( q3 )
( q4 ) it seems that i have more than one right hand , and ( q5 ) it seems that i have no right hand .
the first two statements ( q1 ) and ( q2 ) were relevant to the hand ownership .
on the other hand , the other statements ( q3)(q5 ) served as suggestibility and task - compliance .
all scores of each statement among all participants were tested by analysis of variance ( anova ) and tukey - kramer post hoc comparison .
we used nirs system ( foire-3000 ; shimadzu , kyoto , japan ) to record brain activity with 130 ms time resolution .
foire-3000 operates at 780 , 805 , and 830 nm wavelengths so as to measure relative concentration levels in oxy - hb and deoxy - hb by applying the modified beer - lambert law .
the eight pairs of emitting and detecting probes were placed on the frontal - to - parietal areas using a holder which was configured with a 4 5 array around cz in international 1020 system ( see figure 2 ) .
20 channels from frontal cortex to parietal cortex consisted of the emitting and detecting probes with a distance of 30 mm between the neighboring probes . for preprocessing , band - pass filter is used commonly to remove some noise in nirs data because the noise and a slow drift can be induced by change of posture and arousal level , fatigue , continuing warming , and so on .
we applied 3rd order butterworth band - pass filter of 0.0090.1 hz to eliminate the drift component and physiological noise such as respiratory , cardiac , and motion artifacts and flatten the baseline .
then we set the beginning part of nirs data in each session as the baseline , as we mentioned above .
this is because we took a longer rest ( 30 s ) between each session . for statistical analysis , significant activation at all channels during each session
namely , we calculated peak nirs value at each channel across time domains of each session , and then we classified these sessions into two sets and defined illusion set and nonillusion set as follows : illusion set ( answered ( q1 ) + ( q2 ) 10 in synchronous condition ) and nonillusion set ( answered ( q1 ) + ( q2 ) 6 in asynchronous condition ) .
this is because ( q1 ) and ( q2 ) were relevant to the extent of rhi and were useful to see the brain activity more influenced by the illusion .
after that , an unpaired t - test assessed whether peak nirs values were different between illusion and nonillusion sets so that we made unpaired comparison analysis not between subjects but between illusory and nonillusory conditions .
granger causality is statistical method to investigate causal relations among simultaneously acquired signals , which is based on linear prediction theory of time series .
the concept of granger causality is simple as follows : assume that there are two stationary variables x1 and x2 .
in a pth order vector autoregressive formulation , and a univariate autoregressive formulation , the x1 component takes each form(1)x1t=j=1pa1,jx1tj+j=1pa2,jx2tj+t , x1t=j=1pa1,jx1tj+t , where corresponds to the residual , which is independent and identically distributed ( iid ) .
in contrast , x2 causes x1 if the coefficients in a2 are significantly different from 0 .
in other words , if the covariance of is smaller than by the inclusion of x2 , then we can say x2 has causality on x1 .
therefore , it can be tested by performing an f - test of the difference between covariance of and covariance of (2)fx2x1=lncovcov.the appropriate order of the model p was determined by bayesian information criteria avoiding overfitting a finite data sequence . besides , coefficients a were estimated by ordinary least squares to minimize the model error . in the study , we used multivariate granger causality analysis .
x1 , although there are lagged dependencies of x1 and x2 on x3 ( i.e. , x2 x3 , afterwards x3
we used multivariate analysis because we recorded 20 time series and all other observations x3 xn may give misleading causality .
we may reconsider two formulas as(3)x1t=j=1pa1,jx1tj+j=1pa2,jx2tj+j=1pk=3nak , jxktj+t , x1t=j=1pa1,jx1tj+j=1pk=3nak , jxktj+twith the conditioning other observations x3 xn included in both regressions . the causality x2 to x1 conditioned on x3 xn is defined again as(4)fx2x1 x3xn = lncovcov.we calculated multivariate granger causality above using mvgc toolbox and averaged out the number of connectivity for illusion set and nonillusion set .
chi - square test for independence was performed to see the difference of the total connectivity between these sets . in the study
, we utilized 120-s long nirs data for the above - mentioned analysis ( we dubbed them as original data ) .
however , we could not have confidence when the illusion exactly occurred , because we did not instruct the participants to give a response once they experienced the illusion .
another rhi study reported that the illusion started after 14.3 9.1 s ( mean sd ) .
thus we trimmed 30 s off from the beginning of each trial and exploited the 90-s nirs data as modified data .
the modified data would be considered that it does not include the time before the onset of the illusion .
then we analyzed both original ( 120-s ) and modified ( 90-s ) data for functional connectivity .
the completed questionnaire shows that most of the participants experienced rhi in synchronous condition ( see figure 3 ) .
the mean of rating score for ( q1 ) i felt as if the rubber hand was my hand across all participants in synchronous condition was 5.4 ( s.d .
1.4 ) and that for ( q2 ) touch feeling is located on rubber hand during synchronous condition was 5.2 ( s.d .
moreover , those for ( q1 ) and ( q2 ) in asynchronous condition were 2.7 ( s.d .
1.4 ) for each . therefore the questions capturing the experience of rhi were rated between 5 and 7 , which means confirming the presence of rhi during synchronous condition , and the mean scores of ( q1 ) and ( q2 ) were significantly higher in synchronous condition than in asynchronous condition ( both p < .001 , wilcoxon signed - rank test ) .
the difference of rating between the illusion questions ( i.e. , q1 , q2 ) and the other control questions ( q3 , q4 , and q5 ) was significant ( f(4,195 ) = 77.94 , p < .001 , anova ; contrast comparing ( q1 , q2 ) to ( q3 , q4 , q5 ) , all p < .001 , tukey - kramer post hoc comparison ) . from the result of questionnaire , we classified the sessions into illusion set and nonillusion set ( see analysis and table 1 ) and calculated peak nirs values of oxy - hb on each channel during task for illusion set and nonillusion set ( see analysis and figure 4 ) .
a t - test analysis showed there was significant difference between two sets on ch . 13 ( t - value = 2.15 , df = 59 , p = .036 , unpaired two - tailed t - test ) .
11 of oxy - hb in illusion set was slightly higher than that in nonillusion set ( t - value = 1.86 , df = 59 , p = .068 , unpaired two - tailed t - test ) , although the other channels did not show significant activation ( all p > .10 , unpaired two - tailed t - test ) .
finally , we averaged the number of functional connectivity for the illusion set and nonillusion set in original and modified data ( see analysis and figure 5 ) . in the original data , the rate of connectivity from ch .
chi - square test showed that the number of the connectivity was significantly higher than that in nonillusion set ( = 3.98 , df = 1 , p = .046 , chi - square test ) .
however , chi - square test showed that the number of the connectivity was not significantly but slightly more than that in nonillusion set ( = 2.86 , df = 1 , p = .091 , chi - square test ) .
in the study , we developed automatic stimulator for rhi , which could eliminate the interference of human interaction .
human and social interaction like the observation of touch by another person leads to the activation on premotor cortex , primary somatosensory cortex , and extrastriate body area .
therefore , the automatic system for rhi is valuable to see the pure activation associated with the sense of ownership .
it is difficult for humans to always stimulate both of hands at the exact same time .
a study suggests that discrepancy of more than 300 ms between visual stimulation of the rubber hand and tactile stimulation to the participant 's own hand will weaken rhi . to induce strong rhi
the quality of stimuli also should be consistent between participants and sessions . by such reasons ,
the precise control of stimulus by the automatic stimulator provided stability and reproducibility of illusion . in particular , we developed unmediated stimulator , not with virtual reality because the unmediated condition produced stronger illusion .
however , it was recently possible to make the participant experience the strong illusion in immersive virtual reality ( ivr ) where the participant 's body is replaced with a life - sized virtual body seen from first person perspective .
it is expected that the parameters , which we defined in the study , will be useful to set up the illusion in ivr that is enough to represent the participant 's body .
the mean score of ( q1 ) and ( q2 ) , which are relevant to rhi , was significantly higher than that of ( q3 ) , ( q4 ) , and ( q5 ) , which was used as control .
in addition , the mean score of ( q1 ) and ( q2 ) was significantly higher in synchronous condition than in asynchronous condition .
rhi is induced by synchronous stimuli , not asynchrony , because the visuotactile information should be integrated at the same time .
therefore , the automatic stimulator we developed could provide rhi to most of participants , and their brains should be activated rather during the illusion than the nonillusion .
in fact , we could find the activation in specific brain areas during the present illusion contrasted to the absent illusion .
the activation on the right motor related areas was found in rather illusion set than nonillusion set .
they proposed that ventral premotor cortex seems to be crucial in multisensory integration . in a macaque study
, premotor cortex actually is area of convergence of visual , tactile , and proprioceptive information .
our results also fit with these results where motor related areas are associated with multisensory integration , namely , the sense of ownership .
in addition to the motor related areas , we also found the activation on the right frontal cortex .
prefrontal cortex is also correlated with the sense of ownership and self - location [ 7 , 30 ] .
many studies suggest that prefrontal cortex plays a role in self - referential processing and collection of multisensory information and control of action by giving and taking this information with motor areas .
furthermore , it is reported that damage to prefrontal cortex causes abnormal bodily self - consciousness . for these evidences
, we identified the areas that are associated with the sense of ownership in the study of rhi using nirs . in analysis of granger causality
, we investigated the functional connectivity in the data starting at 30 s , in addition to the analysis in the original data [ 34 , 35 ] .
although the results were a little different between the original and modified data , we still found significant functional connectivity from the frontal cortex to the motor related areas where the activation has been identified .
as mentioned above , prefrontal cortex collects visuotactile information and exchanges it with premotor cortex .
the results suggest that frontal cortex and motor related areas communicate with each other when the sense of ownership changes .
it also indicates that motor related areas integrate visuotactile information for reconstructing the sense of ownership as other studies revealed .
the exchange of the information between prefrontal cortex and premotor cortex reflects the selection of the action to execute .
therefore , there is a possibility that rhi helps participants to activate specific brain areas that play a role of action selection .
other studies actually reveal that the brain mechanisms of body ownership overlap the mechanisms of motor imagery that has been used to study action selection .
our results also follow the suggestion that the sense of ownership is related to neural mechanism underlying motor control .
note that the activation found in this study was in the right hemisphere , although participants ' right hands were stimulated .
other studies reported the predominant involvement of the right inferior frontoparietal network when people recognize the changes of their body representation [ 37 , 38 ] .
the study also suggests that right frontal and motor areas are correlated with the sense of ownership .
most of the experiments assessing the sense of ownership require participants to have natural posture .
therefore , nirs study would deal with the experiment of the sense of ownership , which other neuroimaging could not .
moreover , nirs is used to detect mental disorders ( e.g. , depression , bipolar disorder , and schizophrenia ) by comparing the hemodynamics during task and rest .
in particular , schizophrenia patients feel stronger rhi contrasted to healthy people [ 39 , 40 ] .
it is expected that the granger causality analysis using nirs during rhi will be used as biomarker for the diagnosis of mental disorders or neurorehabilitation for paralyzed patients .
consequently , from the results , we have not observed the activation on sensorimotor cortex and parietal cortex in the illusion , which should appear .
furthermore , we identified some inexplicable functional connectivities where the brain regions were not correlated with the sense of ownership .
it would be necessary to clarify some inexplicable connectivities introducing regularization such as lasso that enhances the prediction accuracy in regression analysis .
therefore , a specific marker that indicates if the functional connectivity is meaningful is expected .
further investigation is required for identifying individual variability of the nirs values and the connectivity .
in the study , we measured the brain activity during rhi induced by the automated stimulator with nirs and investigated the significant activation and functional connectivity by granger causality . as a result
, we found a reliable activity and connectivity from the frontal to the motor related areas during the illusion .
therefore , there is a possibility that frontal cortex and right motor related areas communicate with each other when sense of ownership is modified .
this exchange of the information between frontal cortex and motor related areas reflects the selection of the action to execute .
our results suggest that sense of ownership is associated with neural mechanism underlying motor control .
it is expected that the granger causality analysis with nirs during rhi will be used as a biomarker for diagnosis of mental disorders or neurorehabilitation for paralyzed patients .
however , we also found some inexplicable connectivities in the results . further investigation of the functional connectivity is required to remove some connectivities as artifact by introducing the regression analysis with regularization . | ### Summary:
: the self - identification , which is called sense of ownership , has been researched through methodology of rubber hand illusion ( rhi ) because of its simple setup . although studies with neuroimaging technique , such as fmri , revealed that several brain areas are associated with the sense of ownership , near - infrared spectroscopy ( nirs )
has not yet been utilized .
here we introduced an automated setup to induce rhi , measured the brain activity during the rhi with nirs , and analyzed the functional connectivity so as to understand dynamical brain relationship regarding the sense of ownership .
the connectivity was evaluated by multivariate granger causality . in this experiment ,
the peaks of oxy - hb on right frontal and right motor related areas during the illusion were significantly higher compared with those during the nonillusion .
furthermore , by analyzing the nirs recordings , we found a reliable connectivity from the frontal to the motor related areas during the illusion .
this finding suggests that frontal cortex and motor related areas communicate with each other when the sense of ownership is induced .
the result suggests that the sense of ownership is related to neural mechanism underlying human motor control , and it would be determining whether motor learning ( i.e. , neural plasticity ) will occur .
thus rhi with the functional connectivity analysis will become an appropriate biomarker for neurorehabilitation . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: polymer brushes consist of a relatively
dense layer of macromolecular chains tethered to a surface by one
of their ends .
these systems can be designed
to obtain a convenient modification of the properties of the underlying
surface , leading to their control at the submicrometric scale . in
general , the properties of the brushes strongly depend on the interplay
between the intrinsic properties of the individual polymer chains
and the constraints introduced by the presence of the substrate and
the neighboring chains .
this gives polymer brushes a rich structural
landscape and , consequently , a broad range of potential applications ,
currently being used as a key approach for the creation of advanced
soft matter systems and nanotechnologies .
for instance , among the most well - established applications of polymer
brushes , we can find the control of the flocculation of colloidal
particles , the design of filtration and
separation systems , and the control of
the adsorption and sensing of biomolecules .
besides the simple tuning of the properties of material surfaces ,
in recent years there has been a growing interest in the use of polymer
brushes for the creation of responsive interfaces , i.e. , surfaces
whose properties may change or adapt to the environmental conditions
and/or exhibit a controlled response to external stimuli .
for example ,
it is possible to achieve the spontaneous modification of the brushes
structures and their swelling properties according to the nature of
the solvent , the switchable functionalization
of their free surfaces controlled by the background temperature or ph , and their
use as mechanical nanosensors and actuators . among the diverse stimuli that may control the structure of responsive
surfaces , the use of external fields is particularly appealing for
technological applications . as a well - known example
, electric fields
can be used to modify the structure of brushes made out of polyelectrolytes .
another attractive approach is the creation of brushes with a response
to external magnetic fields .
the control of the interface properties
by means of external magnetic fields provides an evident advantage ,
especially for applications in which the system interacts with substances
that are undesirably sensitive to electric fields and/or to other
potential control parameters , such as the background temperature or
ph .
however , in difference with polyelectrolytes , polymers with a
significant magnetic response are far less common substances .
to date ,
only polymers that exhibit magnetic properties at very low temperature
have been possible to synthesize .
nevertheless ,
the creation of a magnetoresponsive surface can be achieved by applying
more sophisticated approaches .
some of the most advanced techniques
for the design of responsive surfaces include the incorporation of
colloidal particles into the system in order to facilitate the control
of their functional and/or structural properties .
in particular , the
incorporation of magnetic colloids into polymer brush - like structures
is a promising strategy to obtain a magnetoresponsive behavior . despite
their potential interest , to our best knowledge
just a few studies
on the design of such magnetoresponsive supramolecular nanostructures
exist to date . in such works ,
the magnetic colloids
are simply embedded into a polymer brush without a fine control of
their locations and moment orientations . here
, we propose an alternative
design of a magnetoresponsive brush - like system , based on the replacement
of the tethered polymer chains by supramolecular magnetic filaments ,
i.e. , by polymer - like chains of prealigned ferromagnetic colloids
that have been permanently cross - linked by means of macromolecules
in order to keep their chain structure under a broad range of conditions .
magnetic filaments grafted to one end to a surface have been used
in recent years to work as micro- and nanofluidic pumps and mixers , either alone or in sparse arrays . in this work
we explore the possibility
of increasing the grafting density of such tethered magnetic filaments
to form a brush - like structure at a supramolecular scale , with ferromagnetic
colloids playing the role of polymer monomers .
we expect this system
to have a much higher and controllable magnetic response than the
aforementioned polymer brushes loaded with magnetic particles in a
less organized way .
in particular , we focus on the study of the equilibrium
structural properties of the filament brush as the first step to determine
the potential of this system for practical applications . with this
goal , we perform extensive langevin dynamics simulations with a bead
spring
model of the filament brush that takes into account the cross - links
between the surface of the colloids .
we analyze its equilibrium structures
for different grafting densities and filament lengths and determine
the effects of the long - range magnetic dipolar interactions by means
of a comparison with non magnetic filament brushes .
we also compare
our results with previous theoretical works on brushes of neutral
polymers and polyelectrolytes with extended electric dipoles .
finally ,
we introduce a graph theory based analysis approach to our
best knowledge , novel in this context in order to characterize
the internal structure of the brush .
we found that the magnetic filament
brush , for high enough grafting densities , is split into two well - pronounced
structural regions : near the substrate , it is very compact , albeit
its internal structure is less interlaced and more anisotropic in
comparison to a nonmagnetic filament brush ; the upper part of the
brush is composed by dangling chain free ends .
we also observed that
our model for the cross - links within supramolecular filaments introduces
significant differences in the overall brush structure with respect
to what is found in conventional bead
these differences make the magnetic filament brush to exhibit a higher
magnetization and a more pronounced change in its thickness , when
exposed to external fields , than the ones shown by polyelectrolyte
brushes with extended electric dipoles or embedded magnetic colloids .
the paper is organized as follows : in the next section , we describe
the model of the brush used in our computer simulations ; next , we
study the overall structural properties of the brush i.e . ,
its structure at the scale of complete filaments ; a higher resolution corresponding
to the scale of individual beads
is then used to explain the
unusual behavior brought to the system by the long - range magnetic
dipolar interactions ; finally , the manuscript ends with a brief summary .
in recent works we introduced
a phenomenological bead spring model of magnetic filaments
that represents a chain of permanently cross - linked monodisperse ferromagnetic
colloids , whose magnetic moments have an orientation fixed with respect
to the colloid solid body structure .
the cross - links
are assumed to consist of polymers attached to the surface of neighboring
particles , created when the colloids are in a straight chain disposition
with a head - to - tail arrangement of their magnetic moments .
current
experimental techniques allow the tuning of the length of the cross - linkers
in a rather broad range .
briefly , our
model represents the colloids as soft core spheres with a characteristic
diameter d and a point magnetic dipole moment
located at their center .
we take into account the long - range magnetic
interactions between the beads by means of the conventional dipole
dipole
pair potential:1where , being the displacement vector
connecting the centers of beads i and j with dipolar moments i and j respectively .
it
is worth noting that introducing point dipoles an exact representation
for the case of magnetic single domain colloids provides a
substantial difference from early models of polyelectrolytes , in which
extended electric dipoles where introduced by alternating the sign
of the monomer electric charges . in particular ,
the point dipoles located at the particles centers introduce a strong
anisotropy in the interactions at the scale of individual particles ,
without regard to the ( in)existence of a permanent connectivity between
them .
the soft core steric interaction between the beads is
modeled with a weeks chandler
andersen pair potential
( wca),2where ulj(r ) is the
conventional lennard - jones potential3and rcut = 2d is the shifting parameter that makes the potential purely repulsive .
the constraining effects of the cross - linkers that bond any pair of
neighboring particles are represented by a simple harmonic spring
whose ends are attached to the surface of both soft spheres , i.e. ,
to points at a distance d/2 from the sphere centers .
the locations of such attachment points correspond to the projections
of the head and the tail of the magnetic moments of every bead .
figure 1a shows a scheme
of this linking potential , whose expression is4where and are the unitary vectors parallel to each associated dipole moment .
we want to underline that this linking model is also significantly
different from the usual spring models applied to molecular polymers typically ,
finitely extensible nonlinear elastic springs . such springs only provide an isotropic constraint to the
center to center distance between the beads . here , instead
, we aim
at representing accurately the effect of the cross - linkers which ,
being anchored to the surface of the colloids , also constrain the
rotational degrees of freedom .
the combination of potentials 2 and 4 favors the arrangement
of the dipoles into a head - to - tail alignment parallel to the chain
backbone , thus making the filaments locally more straight than isotropic
spring - linked chains and , consequently , highly magnetoresponsive .
we expect this model to be a more accurate representation
of a - type stockmayer polymers , i.e. , polymers with monomer dipoles
being aligned along the backbone , than that of extended fluctuating
dipoles made out of point charges .
the
model also differs significantly from other coarse - grained models
of cross - linked superparamagnetic colloids , i.e. , particles in which the dipole moment is not
coupled to the chain backbone . for simplicity , in this work ,
we measure all the physical parameters of the system in reduced units ,
taking as reference the reduced characteristic diameter of the colloids , d = 1 , their reduced mass m = 1 , and the
prefactor of the reduced steric potential 2 ,
s = 1 . according to our previous
works ,
the prefactor of the potential 4 is set
to ks = 30 , a value that
provides average bond lengths close to the reference bead soft core
diameter ( d = 1 ) and a maximum distance between two
bonded particle surfaces to be approximately half of the particle
diameter .
finally , we take for the squared dipole moment of the magnetic filament beads .
these
values for the interparticle interaction parameters correspond to for example , magnetite spheres with a magnetic core diameter of
approximately 2530 nm coated with a 510 nm polymer
shell , which is also used to cross - link the particles . ( a ) schematic representation
of the links between neighboring magnetic beads used in our filaments
model . the orientation of the dipoles is indicated by both the black
arrows and the red and gray colors of the beads .
( b ) example of an
initial filament brush configuration , corresponding to filaments of
length n = 10 and a grafting density of =
0.027 . finally , the filament brush is
modeled in the following way .
first , a set of identical filaments
with n beads each is placed in a cubic simulation
box of side length l , with periodic boundary conditions
in the x and y directions to mimic
an infinite horizontal brush size .
every chain is grafted by fixing
the position of one of its end beads close to a flat steric surface
located at z = 0 . the steric repulsion produced by
this surface on the beads
is given by a truncated shifted 93
lennard - jones potential , which is obtained
by applying expression 2 to5where r is in this case the z coordinate position
of the bead center .
the potential 5 is the result
of integrating a conventional 126 lennard - jones potential
over an infinite flat surface .
the position of its minimum determines
a new cutoff , rcut= 3d/2 , to which the z position of the fixed
end particle is permanently set .
the orientation of the dipole of
this fixed end particle is also set to permanently remain pointing
in the z direction .
the rest of the filament beads
are initially disposed in a perfect head - to - tail arrangement perpendicular
to the surface .
the horizontal positions of the grafting points are
placed in a square lattice of separation constant a. therefore , the number grafting density of the brush , , defined
as the number of grafting points per unit of grafting surface area ,
is given by = a. figure 1b shows , as an example ,
the initial configuration of a brush of filaments with length n = 10 and grafting density = 0.028 . with
this filament brush model , extensive computer simulations
were performed
for different values of n and by means of
the espresso 3.2.0 simulation package . in order to
avoid the explicit simulation of the background fluid , we chose the
langevin dynamics ( ld ) simulation method . in ld simulations , the effect of the background fluid
is treated
implicitly by introducing stochastic terms in the translational and
rotational equations of motion that apply to each particle i6where fi and i are the total force and torque , mi is the mass , ii the inertia tensor , and t and r the translational and rotational
friction constants , respectively .
finally , i , t and i , r are respectively a gaussian random
force and torque that satisfy the usual fluctuation dissipation
relations , namely , they have a zero mean value and a variance equal
to 2lt , where
l = { t , r } and t is the reduced temperature .
the values
of the dynamical parameters i.e . , mass , inertia tensor , and
friction constants are physically irrelevant for the determination
of the equilibrium properties of the system .
thus , we take t = 1 and r = 3/4 as values known to produce a conveniently fast relaxation
to equilibrium in this type of simulation . finally , in order to ensure isotropic rotations , an identity matrix
is taken for the inertia tensor .
dipole interactions , due to their long - range
nature . in a relatively dense system of magnetic dipoles with periodic
boundaries
therefore , we chose to use the dipolar - p m
method , specifically designed to accurately
compute the magnetic dipolar interactions of pseudoinfinite systems ,
in combination with the dipolar layer correction method .
the latter is required to take into account
the slab geometry of our system , i.e. the absence of periodic boundaries
in the z direction .
first , for each simulation run , the background
temperature of the system , measured in reduced units , was set to t = 1 .
then , an initial configuration for a given set of
values of n and was created and a first pre - equilibration
cycle was performed without computing the dipolar interactions , i.e. ,
by taking = 0 .
this pre - equilibration cycle consisted
of a progressive increment of the integration time step , from 10 to 10 , in 10 subcycles of 5
10 timesteps each . for
= 5 , a second
analogous pre - equilibration cycle was then performed to progressively
increase the dipolar moment of the beads from 10 to its final value .
once such pre - equilibration cycles were completed ,
an equilibration cycle of 10 timesteps and a final cycle
of measures were performed .
the length of the equilibration cycle
was chosen to ensure that both the average and the variance of the
energy and the mean - square total magnetic moment were able to reach
the saturation . in every run ,
finally , a minimum of five independent
runs were performed for every set of explored parameters .
in order to determine the effect of the
dipolar interactions on the equilibrium structure of the filament
brush , we first analyze two conventional overall chain parameters :
the density profile and the distribution of chain heights . the number density distribution of chain monomers
as a function of the distance to the grafting surface , (z ) , is a common parameter used to characterize brush - like
structures . in this case , we compute
this parameter for the positions of the bead centers .
figure 2 shows the results of n (z ) obtained for two selected
values of chain length and grafting density , for nonmagnetic ( = 0 , squares ) and magnetic filaments ( = 5 , filled circles ) .
the main plots correspond to the profiles
calculated for the whole set of particles in the system , whereas ,
in the insets only the particles located at the free ends of the chains
have been considered . we multiply them by n to make
the scales along ordinate comparable .
the data is plotted as a function
of the height normalized with the characteristic contour length of
the filaments , z * = z/(n1)d . as predicted by the semenov
witten
theory ( smw ) , and as is found in conventional models of polymer brushes , the nonmagnetic brush has an approximately parabolic
profile , corresponding to the following expression7the main plots show an excellent agreement
in the least - squares fit of this function to the simulation data at
heights larger than z * 0.3 .
more importantly , figure 2 also illustrates
the existence of a significant difference in the behavior of magnetic
brushes : without exception , the magnetic brush has a more compact
structure than the nonmagnetic one , with a higher density close to
the grafting surface and a lower density far from it .
a shift of the
density profile toward the substrate was also found in models of polyelectrolytes
with extended dipoles . in our case
, we
observe the decay of density in the upper region to deviate from a
parabolic behavior when dipoles are present . instead , a least - squares
fit of the de gennes self - similar carpet profilefigure 2examples
of density profiles corresponding to the combination of two chain
lengths ( n = 10 , 30 ) and two grafting densities (
= 0.04 , 0.111 ) .
inset figures , plotted in semilogarithmic scale , correspond
to the distribution of the free end beads of the filaments .
solid
thin and thick lines in the main figures are , respectively , the fits
of eqs 7 and 8 to the rightmost range of the simulation data
. squares
correspond to = 0 ; filled circles to = 5.8shows a good agreement with the simulation
data for z * 0.4 . the profile for the free
ends is also significantly different in the dipolar brush . while the
nonmagnetic chains keep most of their free ends far from the grafting
surface , as predicted by the smw model , the main part of the magnetic free ends is found to be in close
contact with it .
this means that the dipolar interactions within the
brush prevent the filaments to reach their normal entropic extension
in the z direction , leading to a more compact overall
brush structure with a clear 1.3-power scaling . at this point
one might wonder if the filaments are forming individual closed loops
to minimize the magnetic flux , as is known to happen to dipolar chains
under conditions of strong intrachain dipolar interactions in front
of the thermal fluctuations and other non intrachain interactions .
however , the calculation of the probability distribution for the
normalized end - to - end distance of the chains , , shown in figure 3 for a given chain length and grafting density ,
proves that there exists just a slight increase of closed chains in
the dipolar case with respect to the nonmagnetic one , being in both
cases a very small fraction in the system .
therefore , the internal
structure of the magnetic brush is more complex than the one given
by a simple closure of the chains .
this points to the relevance of
the dipolar interchain interactions in the structure of the magnetic
brushes .
examples
of density profiles corresponding to the combination of two chain
lengths ( n = 10 , 30 ) and two grafting densities (
= 0.04 , 0.111 ) .
inset figures , plotted in semilogarithmic scale , correspond
to the distribution of the free end beads of the filaments .
solid
thin and thick lines in the main figures are , respectively , the fits
of eqs 7 and 8 to the rightmost range of the simulation data
. squares
correspond to = 0 ; filled circles to = 5 .
probability distributions of the normalized end - to - end distance obtained
for magnetic ( = 5 , filled circles ) and non magnetic
( = 0 , open squares ) brushes with chain length n = 30 and grafting density = 0.040 .
finally , we make a comparison of our density profiles
with earlier models of brushes of neutral polymers and polyelectrolytes
with extended dipoles . following the latter , for this
purpose
we calculate the normalized average brush height , z* , from the first moment of the density profile:9table 1 shows the values of this parameter
for selected values of chain length , grafting density and dipole moment .
by calculating the ratio z*=5/z * =0
, we can see that the relative decrease in the brush
height introduced by the dipolar interactions increases with both
the chain length and the grafting density , ranging roughly from 22
to 34% .
this behavior is different from the case of polyelectrolyte
brushes with extended dipoles : as shown by the study of kaznessis
and co - workers , the influence of the
electric dipoles becomes less pronounced as the grafting density increases ,
showing a change from 10 to 5% for the same range of parameters .
one
can assume that the qualitative difference in the physical behavior
of a magnetic filament brush compared to a brush consisting of polyelectrolyte
chains with alternating charges stems from the fact that in the latter
system , with increasing grafting density , the interaction that mainly
determines the internal structure of a brush is the central coulomb
interaction between individual point charges , rather than the dipolar
one .
in contrast , for a magnetic filament brush , the directionality
of the dipole
dipole interaction is enhanced when the bead
density grows and , consequently , the average distance between the
point dipoles is reduced . further insight on the overall structure
of the brush
can be obtained by looking at the probability distribution
of filament mean heights , p(hc ) , where hc is the average z position of the centers of every bead i belonging
to a given filament , hc = ( 1/n ) i=1nzi .
this parameter
will tend to a value of one - half of the characteristic contour length
of the chains for a brush formed by vertically straight filaments .
figure 4a shows the probability
distributions obtained for brushes of chains with length n = 30 and two selected grafting densities .
as it is expected , the
magnetic brushes show a clear shift of the curves toward lower heights
when compared to the corresponding magnetic case .
the latter shows
a single maximum whose position tends to shift toward higher values
as the grafting density grows , and consequently , the steric repulsion
forces the chains to adopt more vertically extended conformations .
more interestingly , for high values of the grafting density , the dipolar
brush develops a second maximum in its distribution of mean heights .
this second maximum is located at higher values and its origin is
the enhanced crowding of the region near the grafting surface : since
the dipolar brush is more compact in such lower regions , it more easily
reaches a saturation value in its local bead density .
as the grafting
density grows , more free ends of the chains are expelled from the
lower crowded region and forced to dangle above it .
finally , the difference
in heights between magnetic and nonmagnetic brushes can be better
visualized in figure 4b , where two examples of typical brush configurations are depicted
with a height color scale .
( a ) comparison of the probability distributions
of the mean height of chains with length n = 30 obtained
for magnetic and nonmagnetic brushes with two selected grafting densities .
( b ) top and side views of typical nonmagnetic ( left ) and magnetic
( right ) brushes .
the color scale indicates the z coordinate
of the center of every individual bead , relative to the characteristic
contour length of the chains , ( n 1)d . these examples correspond to the parameters n = 30 , = 0.111 , = 0 and 5 . in order to check
if the density profile can be effectively manipulated
with an external magnetic field , we performed an additional set of
simulations in which fields with different strengths were applied
perpendicular to the grafting surface , h = hk. in this way , we expect that , once the interaction
of the dipoles with the field becomes strong enough to overcome the
thermal fluctuations and the magnetic dipole dipole interaction
between the beads , the chains will experience a vertical extension
in order to maximize their alignment with the direction of the field .
as a result
, the thickness of the brush will steadily increase with
the field strength , up to the point where the end - to - end distance
approaches the chain contour length .
an example of such an evolution
of the density profile is provided in figure 5a .
the zero - field density profile , with its
characteristic 1.3-power tail , evolves into a basically rectangular
distribution with growing field .
initially , this evolution is rather
slow due to the dominance of dipolar bead
bead interactions
and the internal structure of the brush ( which , for zero field , will
be explained in detail in the next section ) .
as the field - dipole coupling
becomes stronger , the internal structure of the brush simplifies drastically ,
as the chains tend to straighten and coalign with the external field ,
avoiding any entanglements .
the alignment of the bead dipoles leads
to the change of the average brush magnetization , m. this parameter is defined as the total magnetic
moment of the system projected on the direction of the external field:10where nt is the total
number of beads in the system , and ik denotes the z coordinate of the magnetic moment of bead i. the
averaging is performed over all sampled configurations . note that
in these simulations the dipole moments of the grafted beads are always
pointing perpendicular to the grafting surface ( i.e. , parallel to
the field ) .
this means that the zero - field magnetization of the brush
can not be strictly zero . in the following ,
we subtract the zero - field
magnetization from the total , m*
= mh
mh=0 .
in figure 5b
, we present
the change of this parameter with growing field . as it can be observed ,
the magnetization of the brush grows and approaches a plateau , corresponding
to the value of the saturation magnetization . for an individual chain
,
one can predict the equilibrium magnetization using the model proposed
by mendelev and ivanov for self - assembled , not cross - linked chains
of magnetic particles .
the agreement between
the simulation data and the analytical approach is rather good , even
though the latter is a very rough description of the magnetization
of a magnetic filament due to its disregard of the cross - links .
even
more surprising is that the analytical model , in which the interparticle
correlations are underestimated , predicts higher values of the magnetization
for small values of h. in a previous work , we showed that the initial susceptibility of
a magnetic filament is enhanced by the presence of the permanent bonds .
in the brush
it can
be explained looking at the first moment of the density profiles ,
also plotted in figure 5b .
as one can see , the qualitative change of the average brush height
and the brush magnetization with growing field is basically the same .
on the one hand ,
the observed height - magnetization coupling can be
attributed to a strong correlation between the direction of the dipole
and the orientation of the chain backbone . on the other hand ,
the
fact that the average chain height is changing at a slower rate than
the magnetization at low field strength indicates the presence of
a complex internal structure of the brush caused most probably by
the interchain interactions .
the upper boundary of the field range ,
for which the complex internal structure of the brush turns out to
be important and makes the chain straightening difficult , can be localized
by looking at the point where the analytical curve and the simulation
data cross .
this crossover takes place
due to the reduction of the interchain interaction caused by the straightening
of the chains .
( a ) density profiles for different values of an applied
external dimensionless magnetic field , h. ( b ) reduced
magnetization , m* ( simulations with
circles and theoretical model with a solid line ) , and the first moment
of the simulated density profile , z*
( squares ) , as a function of h. both plots are for n = 10 , = 0.111 , = 5 .
finally , it is worth mentioning
that the system studied here has a stronger response not only with
respect to polyelectrolyte brushes with extended electric dipoles ,
as discussed above , but also in comparison to former systems that
have magnetic colloids embedded within the polymer brush structure .
for instance , in the experimental study of choi and co - workers or the computational one of ye et al . , the maximum extension of the brush thickness
under an applied external magnetic field did not exceed 30% .
in our
case , according to the values of z*
shown in figure 5b ,
the thickness of a magnetic filament brush is expected to change by
almost a factor of 2 .
these differences in the change of the thickness
are mainly a consequence of the higher compactness of the magnetic
filament brush under weak and zero field conditions . with this
discussion
we have proven that , in order to fully understand the behavior
of the filament brush magnetic response and its enhanced structural
change , it is essential to look at the free field case , where the
interparticle correlations are not affected by the presence of an
external force . in order to unveil this point , we need to analyze
other observables with a higher structural resolution . this analysis
is performed in the next sections .
here , we scrutinize the zero - field structure of the
brush on the level of chain beads . in this way , we are able to analyze
local fluctuations and pinpoint the part of the pure dipolar interaction
in the a - type stockmayer brush microstructure , avoiding the inherent
contribution from charges present in the aforementioned model of polyelectrolyte
brushes . in simulations
, chains can stretch
and shrink somewhat , due to the presence of springs and soft core
interactions between neighbors ( see , eqs 24 ) .
apart from these
permanent links , particles from both the same chain and from neighboring
chains can come in close contact forming clusters .
our analysis is
based on the characterization of such clusters by means of an approach
based on graph theory .
first ,
we introduce the parameters we chose for the characterization of the
brush microstructure .
these beads unavoidably interact with each other
via both dipolar and steric interactions , independently from being
or not permanently bonded .
the interplay of these interactions and
thermal fluctuations leads to a complex equilibrium self - assembly
of the beads within the brush . in order to classify these structures
formed by individual beads ,
we introduce a criteria of two beads forming
a cluster : two beads are connected if , and only if , the distance between
them is smaller than a certain rc . here , we set rc to be the maximum length among all permanent bonds observed in the
simulation measurements for a given brush . in this way , all permanently
bonded particles are considered connected , but additional connections
may also form in each configuration . in order to reduce the computational
load of the calculations , and taking into account that here we are
only interested in a qualitative comparison between the magnetic and
the nonmagnetic cases ; in this and the next sections , we do not consider
the lateral periodic boundaries when computing the distances between
beads belonging to different chains .
however , checks shown that the
periodicity of the system equally affects magnetic and nonmagnetic
brushes and does not qualitatively influence the results provided
below
. graphical representation of adjacency matrices ( upper row ) and corresponding
simulation snapshots ( lower row ) . on the left
, we visualize the configuration
of a magnetic filament brush with n = 15 and
= 0.04 ; on the right , the configuration for a nonmagnetic brush with
the same chain length and grafting density is presented .
isolated
chains are not shown explicitly in the graphical representation : their
numbers are provided in the corners . in order to underline the difference
in the cluster topology , we present each cluster with a different
color . in the snapshots , all isolated chains are semitransparent . in order to classify the connections
between different beads and to create its convenient graphical representation ,
we employ a standard algorithm from the graph theory to build a so - called adjacency matrix , a =
{ ai , j}. this matrix has a dimension nt nt .
the
elements of a are ai , j = 1 if beads i and j are connected , and ai , j = 0 otherwise . on the basis of such a matrix ,
one can build a graph of the connected beads , in which all beads form
a set of vertices and their connections serve as edges .
upper images show the graph representation of randomly chosen
configurations from the simulation data of the brush with
= 0.04 , n = 15 .
one can see that the amount of clusters
different from isolated chains ( the number shown in the corner ) is
much higher if no magnetic interaction is present ( right , framed with
gray ) . to show the topology of the brush in real space , in the lower
row we provide the snapshots corresponding to the visualized adjacency
matrices .
all clusters that have connectivity n
1 ( isolated chains ) are semitransparent , whereas every other cluster
is colored differently .
figure 6 shows how the presence of noncentral interaction , which favors
head - to - tail or antiparallel orientation of dipoles ( left , framed
with red ) , reduces the probability of the formation of bulky interlaced
clusters with multiple branching points . for the magnetic brush
, one
can see the presence of a ring - like structure , as well as longer linear
clusters .
the only way to form an extended linear aggregate is when
the chain folds and attaches its free end to the grafted bead of a
neighboring chain .
this type of fold can explain the higher density
of the magnetic brush near the grafting surface that was evidenced
by the profiles (z ) in the previous section .
since the choice of the configuration was essentially random , it is
more reliable to analyze some thermodynamically averaged characteristics .
the first quantity is the number of edges
in the graph ( ones in the adjacency matrix ) averaged over all sampled
configurations .
the edges are drawn with solid black lines . to confirm
that the dipolar interaction inhibits the formation of bulky clusters
with multiple junctions , we study the average degree of the
vertices , i.e. , the average number of edges connected per vertex ( see
arrows in figure 7 ) .
besides this , in order to estimate the importance of a certain vertex
in the network of connections , we perform the analysis of the so - called
centrality . in particular , we use betweenness , which is a
standard tool used to characterize nodes in graph theory . in order
to describe this parameter ,
if v is the set of vertices , and u and w are two randomly chosen members of this set ,
then the edges you need to walk from u to w form a path .
there might be many ways to walk from u to w , thus , for any two vertices there
exists a set of paths .
the shortest path is the one containing the
minimal amount of edges . using this formalism ,
the betweenness of
a vertex v which belongs to the set of vertices v of the clustered brush , can be computed as the ratio:11where puws is the total number of shortest paths between vertices u and w , and puws(v ) is the number of those paths
that pass through v. the betweenness is shown in figure 7 with dashed circles ,
whose color corresponds to the value indicated in the legend . in that
example , the shortest path between 1 and 4 , as well as the one between
2 and 4 , goes through 3 .
all other vertices are either directly connected
or totally disconnected , as is the case of v = 5 ,
so their betweenness is zero .
we begin our analysis of the brush structure at the bead scale
by addressing the changes in the vertices degree , . for the
initial configuration ( a brush with straight vertical chains of length n ) , the distribution of the degrees is evident : all free
ends ( whose number is nt / n ) have = 1 ; all grafted ends also have
= 1 ; the remaining beads ( in the amount nt ( 1 2/n ) )
have = 2 . in a thermodynamically equilibrated brush
, the chain
beads can have a higher degree , depending on how many added nearest
neighbors they have as a consequence of thermal fluctuations or magnetic
dipole
the histograms of
for the initial brush configurations and for thermodynamically
equilibrated brushes obtained for selected values of n , , and for both = 0 and 5 , are presented
in figure 8 .
it can
be easily seen that the width of the histograms is broader for nonmagnetic
brushes ( front ) with respect to that of the magnetic filament brush
( middle ) . in general , the degree of vertices is growing with increasing
grafting density for both brushes as a consequence of the increasing
combinatoric probability for two particles to form a connection ( additional
edge ) . however , looking at these histograms , one can say that the
assumption for dipolar forces to work against the formation of bulky
clusters and multiple junctions ( first noticed in figure 6 ) becomes more grounded . in
order to elucidate the nature of the redistribution of degrees , we
analyze the behavior of the free and the grafted ends of the filaments .
dipole interaction significantly strengthens the role
of both free and grafted ends in the cluster formation . for a grafted
end to take part in the cluster ,
it is essential that a neighboring
chain bends and attaches either its free end or any other bead to
it .
alternatively , the chain , whose grafted end has > 1 ,
bends by itself to connect one of the beads to the grafted one ( examples
can be found in figure 6 ) . in both cases
, these two configurations effectively increase the
density of beads near the grafting surface and decrease the average
height of a brush made of magnetic filaments .
histograms of the vertices
degree corresponding to two selected chain lengths and grafting densities .
histograms in the back correspond to the initial , out of equilibrium
configurations ; the ones in the middle , to the magnetic brush ; in
the front , we show the histograms for the nonmagnetic brush .
relative error intervals do not exceed 5% . in order to estimate the total number of newly formed
connections within the brushes , we plot in figure 9 the average number of non permanent edges
in the adjacency matrix , e* , normalized
by the total number of particles , nt , as a function of grafting density for various chain lengths .
note that we obtain e* by subtracting
permanent bonds from the total amount of edges and focus on the temporary
connections only .
it is of course expected that , for both magnetic
and nonmagnetic brushes , the amount of edges grows rapidly with the
grafting density .
however , the total amount of edges formed in a nonmagnetic
brush is higher than the one in a brush made of magnetic filaments .
this can be explained by the selectivity of the connections in the
magnetic case : there is only a limited volume of space around each
bead to where a second one could be attracted ( and a part of this
volume is already occupied by the permanent neighbors ) . the attempt
of establishing a new connection from outside of such favorable regions
results in a strong dipolar repulsion between the beads .
in such a
way , magnetic forces prevent the formation of random connections and
stimulate the formation of energetically advantageous ones , whose
amount is relatively low .
average number of newly formed edges as a function
of . red filled symbols correspond to magnetic filament brushes ,
open symbols to nonmagnetic ones .
we use a log scale for the ordinate
axis . in order to understand how this
anisotropy of the magnetic dipolar interaction influences the overall
connectivity of the networks and clusters , as the final step , we study
the centrality of the connections . in figure 10 , we present two different types of plots
in four panels . in the upper panels
the results for n = 10 are presented , whereas lower panels correspond to n = 30 .
the left side corresponds to = 0.04 , the right one
is for = 0.111 .
first , we focus on the lower part of each
panel , where one can see the plots of the average betweenness for
each particle in the system ( the bead indices can be seen along the
horizontal axes ) . in these plots ,
gray lines describe the nonmagnetic
brush , whereas the red lines characterize the brush made of magnetic
filaments .
the overall parabolic profiles of the curves come as a
consequence of the brush finite size .
in addition , one can
clearly see two types of periodicity in these graphs . in order to
understand these periodicities
, one needs to know the way the indices
are assigned to the particles .
for example , in case of = 0.04
and n = 10 , the particle with zeroth index is the
free end of the first chain ; the particle with index 9 is the grafted
bead of the first chain . to determine the position of a particle with
index p , one needs to calculate first [ p / n ] + 1 ( with [ ] denoting the integer part ) ,
this defines the number of the chain to which the particle belongs ;
next , the res(p / n ) + 1 ( with res( )
denoting the residue of the division ) will provide the position within
the chain from the free end . according to this assignment
, the shorter
period in the curves corresponds to the distribution of cb along individual permanent chains ( grafted
and free ends tend to have a lower value than the middle parts ) .
the
larger period is another manifestation of the system finite size :
it reflects the distance to the edges of the simulation box of the
grafting positions of the permanent chain to which the given bead
belongs . for short chains and low grafting densities
, the overall
entanglement of the brush is very low , that is why the value of betweenness
is weakly dependent on the grafting position of the corresponding
permanent chain .
the different periods become more evident as the
structure becomes more entangled . more importantly , the plots of the
average betweenness of each particle show that beads in magnetic filament
brushes have higher betweenness ( notice the dominance of gray lines
at low values ) . in order to understand where this difference stems
from
, one needs to look at the upper plots . here , we present the average
distribution of betweenness along positions in the chains .
chain particles
are drawn explicitly along the vertical axes , with the grafted bead
in the bottom and the free end on the top . in this way
, the horizontal
axis indicates the value of betweenness ( growing to the right for
the magnetic brush and to the left for the nonmagnetic one ) .
color
gradients are used to represent the number of particles with the given
value of cb at the corresponding
position along the chain .
the lighter is the color , the less beads
had the respective betweenness . in the initial configuration , when
all chains are straight pointing perpendicular to the grafting surface ,
the betweenness of each chain bead at the position k can be calculated asfigure 10betweenness .
upper panels are for n =
10 ; lower panels are for n = 30 .
left panels are
obtained for = 0.04 ; right ones for = 0.111 . in the
lower parts of each panel ,
the betweenness ( averaged over all sampled
configurations ) is plotted for each particle in the brush ( gray lines
for a nonmagnetic system , red lines for a brush made of magnetic filaments ) .
the numbers along the horizontal axes are the beads indices . in the
upper parts of the panels , we plot the distributions of betweenness
depending on the position of the bead within the permanent chain ,
which is sketched along the vertical axes of the plots ( magnetic on
the right , gray / red
the parabolas
in the upper left panel ( n = 10 and = 0.04 )
characterize the betweenness for the initial configuration with straight
chains ; corresponding parabolas for the other parameters can not be
seen in the provided scale.12where k = 1 , ... , n and n is the number of particles in the permanent chain .
expression 12 is obtained
by simple combinatoric considerations : for a given bead k in an isolated chain of length n , one can find
other k 1 beads in one of the directions
along the chain ; from each of those latter beads , there is a path
that passes through k to the n
the expression
in eq 12 reflects the
symmetry of the chain with respect to its central bead and its graphical
representation is shown as solid lines in the upper left plot of figure 10 .
for the other
three cases ( higher n and ) the results of
the eq 12 for the initial
configurations would not be distinguishable from zero in the scales
used in the plots .
the betweenness for particles in the equilibrated
brush is always higher than the one of the initial configuration due
to the growing amount of nonpermanent connections .
a more interesting
observation is that the betweenness of the grafted ends is significantly
higher in the magnetic filament brush than in the nonmagnetic one .
for the latter
therefore , the fact that one sees gray
lines close to the horizontal axes in the plots of the average betweenness
for each particle ( lower plots ) is explained by the lower connectivity
of the grafted ends in the nonmagnetic case .
finally , the distributions
of betweenness along the chains also evidence that , in general , cb(k ) is higher
in the magnetic filament brush and has a less pronounced maximum when
approaching the middle of the chain .
these results confirm the assumption
of the strong directional clustering in magnetic filament brushes .
upper panels are for n =
10 ; lower panels are for n = 30 .
left panels are
obtained for = 0.04 ; right ones for = 0.111 . in the
lower parts of each panel , the betweenness ( averaged over all sampled
configurations )
is plotted for each particle in the brush ( gray lines
for a nonmagnetic system , red lines for a brush made of magnetic filaments ) .
the numbers along the horizontal axes are the beads indices . in the
upper parts of the panels ,
we plot the distributions of betweenness
depending on the position of the bead within the permanent chain ,
which is sketched along the vertical axes of the plots ( magnetic on
the right , gray / red ; nonmagnetic on the left , gray ) .
the parabolas
in the upper left panel ( n = 10 and = 0.04 )
characterize the betweenness for the initial configuration with straight
chains ; corresponding parabolas for the other parameters can not be
seen in the provided scale .
the fact that the grafted and the free ends actively participate
in the bead self - assembly within the magnetic filament brush not only
explains the reason for it to be more compact but also why a weak
external magnetic field can not yield high magnetization . for a brush
to reach the saturation magnetization , it is essential that all chains
become almost straight
. therefore , the field should be high enough
to prevent the strong bending of the filaments produced by the dipolar
entanglements , in which the free and grafted ends take an important
role .
in this manuscript , we presented the results
of a combined theoretical computational study of magnetic supramolecular
filament brushes .
the interest of this system lies in the possibility
to control the structural behavior of the brush with an external magnetic
field of a moderate strength .
this perspective opens up a broad range
of new applications in different fields , such as chromatography and
microfluidics .
the first step on this way was to understand the fundamental
difference brought by the magnetic interactions and the structure
of head - to - tail cross - linked dipoles that form the filaments to a
polymer brush - like system . in order to do this ,
we compare by means
of langevin dynamics simulations the behavior of magnetic filament
brushes to that of nonmagnetic neutral brushes , polyelectrolyte brushes
with extended electric dipoles and polyelectrolyte brushes with embedded
magnetic colloids .
it is worth mentioning that the differences brought
by the magnetic interactions become evident already at the filament
scale : in contrast to a nonmagnetic filament brush or to the one made
out of polyelectrolyte chains , both with parabolic density distributions ,
the magnetic brush with the same grafting density is denser close
to the substrate but it has a clear 1.3-power tail at farther
distances .
this results in bimodal height distributions for dense
magnetic brushes , whereas regular brushes exhibit unimodal profiles .
this difference is more pronounced as the length of the chains that
form the brush increases .
this is not true for a polyelectrolyte brush
with extended dipoles , for which the role of the dipolar interactions
gets screened with increasing grafting density .
it turned out that
the zero - field internal structure of a magnetic filament brush has
a crucial influence on the magnetic response of these systems .
if
a weak external magnetic field is applied , the magnetic response of
the filament brush is partially hindered by the interchain interactions
within the compact region near the grafting substrate .
however , if
the field is strong enough to compete with the interparticle magnetic
dipole
dipole interaction and thermal fluctuations , then the
total magnetization fast reaches a value close to its saturation due
to an almost complete straightening of the chains . the latter results
in a pronounced change of the density profiles . in order to
elucidate both the reasons for the magnetization hindrance under low
fields and the different behavior of the magnetic and nonmagnetic
brushes at the scale of individual chain beads , we employed graph
theory .
we performed a cluster analysis by introducing the concept
of connected beads , according to a simple distance criterium . on the
basis of this approach ,
the brush was presented as a graph , in which
the number of edges ( connections ) , the degree of vertices and the
peculiarities of the connectivity were carefully analyzed for various
grafting densities and chain lengths in both magnetic and nonmagnetic
cases .
we found that magnetic interactions act against random density
fluctuations , and on average the number of connections in the magnetic
brush is lower than in a nonmagnetic one , albeit both grow with the
grafting density .
the dominant connective unit in the dipolar brush ,
except for the highest grafting density , is a bead with only two neighbors .
it was found that free ends in a dipolar brush also tend to have a
second neighbor . to allow this
, a chain has to bend , frequently to
connect to the grafted bead of a neighboring chain .
this is also confirmed
by centrality analysis : free ends in a dipolar brush have a higher
degree of betweenness than in the case of a nondipolar brush . for
the latter ,
the distribution of degrees is shifted toward higher values ,
and the probability for a bead to have more than two neighbors simply
grows with increasing grafting density . at the same time , the betweenness
for free ends of nondipolar brush is rather low due to the absence
of any directional interaction . note that the long - range nature
of magnetic dipole dipole interaction results in a qualitative
change in the behavior of a brush , which can not be obtained by introducing
a simple angular dependent short - range potential between chain beads .
the dipolar forces between beads in one chain effectively lead to
local stiffening , but also result in long - range anisotropic interchain
interactions .
neither the same kind of behavior can be achieved by using extended
electric dipoles , as this will lead to the dominance of central coulomb
interaction at short distances on growing grafting density .
besides
that , the magnetic filament brush proposed here shows a much stronger
height change under the influence of an applied external magnetic
field in comparison to previously studied systems . in future ,
we plan to develop a theoretical approach to describe the density
profile of a magnetic filament brush .
it is also essential to perform
a detailed study of the chain parameters , such as dipolar strength
and angular bond rigidity , as well as determine the influence of the
temperature on the equilibrium structure of the system . | ### Summary:
: the
equilibrium structure of supramolecular magnetic filament brushes
is analyzed at two different scales .
first , we study the density and
height distributions for brushes with various grafting densities and
chain lengths .
we use langevin dynamics simulations with a bead
spring
model that takes into account the cross - links between the surface
of the ferromagnetic particles , whose magnetization is characterized
by a point dipole .
magnetic filament brushes are shown to be more
compact near the substrate than nonmagnetic ones , with a bimodal height
distribution for large grafting densities .
this latter feature makes
them also different from brushes with electric dipoles .
next , in order
to explain the observed behavior at the filament scale , we introduce
a graph theory analysis to elucidate for the first time the structure
of the brush at the scale of individual beads .
it turns out that ,
in contrast to nonmagnetic brushes , in which the internal structure
is determined by random density fluctuations , magnetic forces introduce
a certain order in the system . because of their highly directional
nature , magnetic dipolar interactions prevent some of the random connections
to be formed . on the other hand , they favor a higher connectivity
of the chains free and grafted ends .
we show that this complex
dipolar brush microstructure has a strong impact on the magnetic response
of the brush , as any weak applied field has to compete with the dipole
dipole
interactions within the crowded environment . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: tinea capitis is a fungal infection of the scalp and hair , which is seen predominantly in preadolescent children .
tinea capitis may be rare in adults due to the fungistatic saturated fatty acids in sebum that appears at puberty .
the vast majority of dermatophytes involved in the etiology in children and adults are limited to the genera microsporum and tricophyton .
in contrast to its dominating role in superficial dermatophytosis , the anthropophilic fungus trichophyton rubrum is not considered as a scalp pathogen .
the case reported here is worth noting because of its atypical clinical presentation resulting in delayed treatment . to the best of our knowledge ,
only few cases of trichophyton rubrum induced kerion in otherwise healthy adults have been described till date .
a 70-year - old female presented with a nine - month history of multiple itchy , crusted and pustular lesions over the scalp .
she had been treated with multiple antibiotics for the last two months without any improvement .
the patient was not on any immunosuppressant drug and no other family member was suffering from similar disease .
the scalp showed multiple , crusted plaques involving the vertex and occipital area of scalp .
the lesions were non - indurated , mildy tender and studded with numerous papules and pustules .
a potassium hydroxide ( koh ) preparation made from the scalp scrapings and the hair showed fungal hyphae [ figure 2 ] .
a diagnosis of trichophyton rubrum induced kerion was made and the patient was treated with oral itraconazole 100 mg daily for six weeks . there was complete clearance of lesions with some residual scaring alopecia [ figure 3 ] .
tinea capitis in an elderly female showing crusting , pustules and matting of hair with hair loss koh mount of scrapings showing hyphae ( magnification 40 ) after six weeks of treatment , all the inflammatory lesions have cleared .
invasion of the keratin of hair by dermatophytes after puberty is a rare event in otherwise healthy subjects .
only 3 - 5% of tinea capitis occur in adults over 20 years of age .
although the disease was once thought to be rare in adulthood , a growing number of authors have reported an increase in tinea capitis among adults , particularly menopausal and elderly women .
factors that may favor the development of disease at this age include hormonal changes , the use of certain hair care products and using the services of hair salons , which can be a source of infection . in most of the cases that have been reported , including our own case , the diagnosis was delayed .
this delay is probably due to both the rarity of this infection in adults and its atypical clinical manifestations .
the disease may resemble bacterial folliculitis , folliculitis decalvans , dissecting cellulitis , or the scaring related to lupus erythematosus .
recently three elderly patients were reported , who developed boggy erosions that mimicked erosive pustular dermatosis but were actually attributable to fungal infections ( kerion ) .
the intense inflammatory response apparently suppressed fungal growth , as fungi were not seen in initial biopsies and were not isolated from pus .
the presentation of pustular inflammatory lesions , crusting and associated lymphadenopathy was confused with bacterial infection ; the correct diagnosis was done by koh mount and culture .
previous studies have shown that clinical presentation of tinea capitis is not correctly indicative of the type of fungus causing the disease , as it also depends on other unknown factors . in our patient with inflammatory lesions ,
although griseofulvin remains , for some authors , the treatment of choice for tinea capitis in children and adults , both terbinafine and itraconazole are considered acceptable alternatives .
the differential diagnosis of inflammatory skin condition of scalp in elderly patients should include tinea capitis . a simple koh examination ( and/or fungal culture ) should be performed routinely , as inappropriate and delayed treatment can lead to complications like scaring alopecia . | ### Summary:
: tinea capitis is generally thought to be a common disease in children but not in adults . when infection does occur in adults
, it may have an atypical appearance .
we report an elderly female with inflammatory tinea capitis caused by trichophyton rubrum .
she had numerous pustular lesions throughout the scalp with alopecia , initially treated for bacterial infection .
we concluded that tinea capitis should remain in the differential diagnosis of elderly patients with alopecia and pyoderma like presentations and culture test should be routinely done in such patients to avoid complications . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: stress induced cardiomyopathy ( scm ) is characterized by transient left ventricular ( lv ) dysfunction and chest pain , together with electrocardiographic ( ecg ) changes that mimic those of acute myocardial infarction ( ami ) .
generally , it has been known that in the absence of underlying comorbid conditions , scm has good prognosis .
an 87-year - old woman with continuous chest discomfort was referred to our hospital and we suspected that she had ami .
she slipped down on the floor and was admitted to another hospital due to multiple rib fractures and stayed there for 10 days . on admission to our hospital , she complained of chest pain .
she had no history of cardiovascular risk factors nor did she have family history of heart disease .
her blood pressure was 80/40 mm hg and her pulse rate was 125 beats / min .
an ecg was done on admission and sinus rhythm , st - segment elevation and abnormal q wave in leads v1 - 4 were observed ( fig .
laboratory data on admission showed increased levels of cardiac biomarkers ( troponin - i 8.2 ng / nl and ck - mb 50 u / l ) .
echocardiography showed akinesis in apical segments of lv and right ventricular ( rv ) , and hyperkinesis in the basal segments of lv ( fig .
filling defect ( 0.8 cm in size ) and left to right shunt flow were shown on apical segment of interventricular septum ( fig . 2c and d ) .
post - ami vsr was suspected and she underwent emergency cardiac catheterization . however , coronary angiography revealed normal coronary artery with thrombolysis in myocardial infarction grade 3 ( fig .
since the patient and her family did not want to get a cardiac operation , only medical therapy including intravenous inotropics was continued .
her peak troponin - i level gradually decreased during follow - up examinations . on the third day after admission
, ecg showed persistent st - segment elevation in v2 - 5 , and q - wave in lead avr , iii , and v1 - 4 ( fig .
1b ) . on the fourth day after admission , polymorphic ventricular tachycardia developed ( fig .
1c ) , and the patient died even after cardiopulmonary resuscitation was performed ( fig .
patients suffering from scm may have clinical presentation very similar to that of acute coronary syndrome patients .
usually , ecg at presentation shows st - segment elevation and/or pathological q waves are present in almost 40% of patients.1)2 ) furthermore , elevated cardiac biomarker levels and regional wall motion abnormalities mimic ami .
differentiating scm from ami is important , as misdiagnosis may result in treatment with thrombolytic agents which may pose patients at unnecessary risk of bleeding .
clinical features of scm are as follows : 1 ) abnormal , reversible wall motion that improves rapidly within a few weeks , 2 ) abnormal ecg patterns ( either st - segment elevation or t - inversion ) or slightly elevated cardiac biomarker levels , 3 ) no significant epicardial coronary artery stenosis nor vasospasm , 4 ) presence of physical or emotional stress as trigger factors , 5 ) absence of recent significant head trauma , intracranial bleeding , pheochromocytoma , or myocarditis.3)4 ) reported pathologic findings of cardiac rupture in scm are inflammatory infiltration , coagulation necrosis , hemorrhage , fibrosis , and contraction band necrosis.5 ) these findings imply that prolonged ischemia causes cardiac rupture . contraction band necrosis is a kind of myocardial injury , but it is different from ischemic cardiac necrosis.6 ) sacha et al.7 ) reported that contraction band necrosis at free wall rupture site is a typical result of catecholamine cardiotoxicity and that it may play a primary role in cardiac rupture . in scm patients , cardiac rupture can occur at certain sites of lv , such as interventricular septum , rv wall , and lv free wall .
izumi et al.8 ) reported a case of ventricular septal perforation in a scm patient .
the case was very similar to ours in that the patient was an old female , and had persistent st - segment elevation along with slightly elevated cardiac enzyme levels .
we could not confirm reversible wall motion abnormalities in this case , but based on the following findings ( st - segment elevation without reciprocal changes on ecg , normal coronary angiogram , physical stress as a trigger factor , characteristic abnormal wall motion on echocardiography , and moderately elevated cardiac biomarker ) , we suspected that this patient had scm associated with vsr . coronary spasm and thrombus can be the cause of post - ami vsr in normal coronary artery .
however , since the patient had no history of angina nor cardiovascular risk factors except for her old age , there is low possibility of her having had variant angina or thrombus and thus , there is low chance that her vsr was developed by ami .
therefore , we suspected that her vsr was developed by scm , due to tissue necrosis from catecholamine toxicity .
the prognosis of patients with scm is generally favorable.9 ) however , some fatal complications with scm , such as lv free wall rupture , were reported .
scm can cause cardiac rupture in a manner and time course similar to that of ami .
however , there are some differences between ami induced cardiac rupture and scm induced cardiac rupture.8 ) the diagnosis of cardiac rupture caused by scm , not by ami should be considered in the presence of emotional or physical trigger factors , abnormal wall motion which is not consistent with coronary territory , cardiac enzyme elevation not to correlated infarct size of lv , persistent st - segment elevation even after continued medical treatment , and the finding of normal coronary angiogram . in conclusion , we highly suspect that vsr was developed by scm although coronary vasospasm could not be thoroughly excluded . | ### Summary:
: an 87-year - old woman with continuous chest discomfort was referred to our hospital .
st - segment elevation in lead v1 - 4 was detected on electrocardiography and ventricular septal rupture ( vsr ) was observed on echocardiography .
post - acute myocardial infarction ( ami ) vsr was suspected and she underwent emergency cardiac catheterization
. however , coronary angiography showed normal coronary artery . on the fourth day after admission , the patient died .
we suspect that vsr was developed by stress induced cardiomyopathy , not by ami . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: nephrotic syndrome is characterized by nephrotic range proteinuria ( defined as urine protein : creatinine ratio 2000 mg / g ) and hypoalbuminemia ( serum albumin level 2.5 g / dl ) , most commonly associated with hyperlipidemia and edema .
the most common cause of nephrotic syndrome in the pediatric population is idiopathic nephrotic syndrome ( ins ) , present in 90% of children with nephrotic syndrome diagnosed between 1 and 10 years of age and in 50% of children with the diagnosis made at the age of > 10 years .
the disease is more common in boys than in girls , and the incidence of ins is 2 - 7/100,000 children < 15 years of age , but the prevalence is 16/100,000 due to the recurrent nature of the disease .
corticosteroids are the treatment of choice in ins . although about 80 - 90% of children with ins respond to corticosteroids , 20 - 30% become steroid - dependent . chronic corticosteroid therapy in patients with steroiddependent or frequently relapsing ns ( frns or sdns )
is associated with numerous side effects ( e.g. growth retardation , obesity , osteoporosis , arterial hypertension , glaucoma , cataract , and psychoemotional changes ) .
also steroid - sparing immunosuppressive medications used in these patients ( alkylating agents , calcineurin inhibitors , rituximab ) have many toxic , commonly irreversible adverse effects .
although its direct mechanism of action is not known , it is postulated that levamisole enhances the th1 lymphocyte - mediated immune response and reciprocally down - regulates the th2 lymphocytemediated immune response via selective induction of transcription of several genes , e.g. the interleukin 18 gene and , probably , via activation and induction of maturation of dendritic cells .
moreover , it potentiates monocyte and macrophage functions , including phagocytosis and chemotaxis , and increases neutrophil mobility , adherence , and chemotaxis .
recently , it was suggested that levamisole s mode of action is attributable to its direct effects on podocytes .
jiang reported that levamisole induced expression of glucocorticoid receptor ( gr ) and activated gr signaling in podocytes .
furthermore , levamisole was able to protect against podocyte injury in a puromycin aminonucleoside ( pan)-treated cell model .
numerous studies suggest that levamisole reduces the frequency of relapses and corticosteroid doses in children with frns and sdns [ 816 ] . in most cases
most commonly ( 1 - 2% ) reversible leucopenia , sporadically liver toxicity , seizures , gastrointestinal symptoms , psoriasis - like cutaneous reaction , and vasculitis were noted [ 1719 ] .
the aim of this study was to present a single center s experience in the treatment of frequently relapsing and steroid - dependent nephrotic syndrome with levamisole .
we studied retrospectively 72 children ( 41 boys , 31 girls ) aged from 1.9 to 15.6 ( median age : 5.6 years ) with sdns / frns treated in our department with levamisole in the years 1984 - 2011 . in all studied children the following parameters were evaluated : age of first bout of the disease [ years ] , duration of the disease [ years ] , number of nephrotic syndrome relapses and proteinuria relapses before levamisole treatment [ n , n / year ] , result of renal biopsy , medications used before levamisole treatment , prednisone dose on levamisole initiation [ mg / kg/24 h ] , duration of levamisole treatment [ months ] , duration of prednisone treatment during levamisole therapy [ months ] , time to first ns / proteinuria relapse on levamisole treatment [ months ] , number of proteinuria / ns relapses during levamisole treatment [ n , n / year ] , and adverse events of the treatment .
nephrotic syndrome was defined as proteinuria 50 mg / kg/24 h or protein : creatinine ratio 2000 mg / g , hypoalbuminemia ( 2.5 g / dl ) with hyperlipidemia and edema .
relapse of ns was defined as 3 days of nephrotic proteinuria , most commonly with accompanying hypoalbuminemia , hyperlipidemia , and edema , and remission as 3 consecutive days without proteinuria in urinalysis or daily urinary collection .
patients who achieved remission during an 8-week course of corticosteroid therapy were considered as having steroid - sensitive ns , patients with two or more relapses within 6 months of the initial response or with four or more relapses in any 12-month period as having frequently relapsing ns , patients with 2 consecutive relapses during tapering of the corticosteroid dose or within 14 days after corticosteroid withdrawal as having steroid - dependent ns , finally , patients not achieving remission within 8-week corticosteroid treatment were defined as having steroid - resistant ns . the first attack of ns was treated with prednisone in the dose of 60 mg / m/24 h or 2 mg / kg/24 h ( not exceeding 60 mg/24 h ) for 4 - 6 weeks , then in the same dose every 48 hours for 4 weeks , with gradual tapering of the dose within the next month ( years 1970 - 1995 ) or 4 months ( after 1995 ) .
levamisole treatment was started in case of steroid dependence with long - term corticosteroid therapy [ 35 ( 48.6% ) children ] or intensified side effects of corticosteroid therapy [ obesity in 22 ( 30.6% ) , growth retardation in 6 ( 8.3% ) , hirsutism in 5 ( 6.9% ) , arterial hypertension in 3 ( 4.2% ) , and cataract in 1 ( 1.4% ) child ] .
levamisole was administered according to the following protocol : in the first month 2.5 mg / kg/48 h , and in the following months 2.5 mg / kg twice weekly . in every case levamisole was started in patients in remission of ns . during levamisole treatment in all patients we evaluated complete blood count and transaminases one week after initiation of therapy and then every 4 weeks .
hypertransaminasemia was defined as a rise of liver enzymes above the reference range and neutropenia as a drop in neutrophil count below the reference range .
detailed analysis was performed in those children treated with levamisole for at least 6 months .
the following tests were used : student s t test , mann - whitney u test , wilcoxon test , fisher s exact test , kaplan - meier analysis , pearson linear correlation , and spearman s rank correlation , when appropriate . the statistical significance level was defined as p < 0.05 .
among 72 studied children 53 ( 73.6% ) were treated with levamisole for at least 6 months .
mean duration of ins was about 3 years , and mean number of relapses before levamisole treatment was about 6 .
all children were treated with oral corticosteroids , and 18 ( 34.0% ) were given other medications , most commonly methylprednisolone pulses .
renal biopsy was performed in 24 out of 53 patients ( 45.3% ) , mostly before the year 1995 , with mesangial proliferation being the most common finding .
baseline characteristics of the studied children with idiopathic nephrotic syndrome treated with levamisole for at least 6 months treatment with levamisole is presented in table 2 .
the mean dose of prednisone on initiation of levamisole treatment was 1.2 mg / kg/24 h , and the mean duration of levamisole treatment was 1 year and 3 months . during levamisole
twenty - seven ( 79.4% ) out of those 34 children also received prednisone when proteinuria relapsed .
twenty - three children relapsed during the first 6 months , with 8 relapsing in the following half - year , and the remaining 3 relapsed during the second year of levamisole treatment . in 19 ( 35.8% )
children there were no recurrences of proteinuria during levamisole treatment ( mean duration of levamisole treatment in this group was 14.2 6.0 months ) .
three children treated with levamisole for 15 , 16 , and 23 months were free of proteinuria even after levamisole was stopped , for 20 , 27 , and 37 months , respectively .
maintenance of remission in children with ins treated with levamisole is presented in figure 1 . the number of relapses per year before and during levamisole therapy is presented in figure 2 . during treatment with levamisole in children with
ins the number of relapses of the disease significantly decreased ( 2.7 2.0 vs. 1.8 2.1 , p = 0.02 ) . the course of nephrotic syndrome during levamisole treatment maintenance of remission in children with idiopathic nephrotic syndrome treated with levamisole number of relapses in children with idiopathic nephrotic syndrome before and during levamisole treatment in the whole group of 53 children we found negative correlations between time to first relapse of proteinuria and total number of relapses ( r = 0.59 , p < 0.001 ) and number of relapses in one year ( r = 0.60 , p <
adverse events of levamisole treatment were found in 16 out of 72 ( 22.2% ) children treated with levamisole : allergic rash in 9 , abdominal pain in 3 , hypertransaminasemia in 3 , arthralgia in 2 , leucopenia in 1 , thrombocytopenia in 1 .
numerous immunosuppressive agents are used in the treatment of frequently relapsing and steroid - dependent nephrotic syndrome in order to limit the doses of corticosteroids . due to many serious , commonly irreversible adverse events of these drugs ,
it should be emphasized that use of levamisole is severely limited due to its unavailability in many european countries .
thus , most patients import the medication on their own from countries where it is available as an antihelmintic agent .
tanphaichitr was the first to describe the role of levamisole in the treatment of childhood idiopathic nephrotic syndrome in 1980 .
the effectiveness of levamisole in reducing the frequency of relapses in children with frns and sdns is well documented [ 4 , 1016 ] .
thus , treatment with levamisole significantly reduces the cumulative dose of steroid intake , as was proven by al - saran and ekambaram et al . .
it should be stressed that only a few of these studies were randomized controlled trials [ 1012 ] .
the results of an international multicentre placebo - controlled trial are to be released this year .
interestingly , levamisole was found to be equally effective as cyclophosphamide in maintaining remission in children with steroid - dependent / frequently relapsing nephrotic syndrome [ 13 , 21 ] . on the other hand , moustafa and tolba found the highest resistance to treatment ( defined as failure to induce 6-month remission ) in frns / sdns children on levamisole ( n = 40 ) compared to those treated with cyclophosphamide , cyclosporine a , mofetil mycophenolate or azathioprine . also , in a recently published retrospective study by basu et al .
tacrolimus was significantly more effective than mofetil mycophenolate or levamisole in maintaining relapse - free survival over a period of 30 months in a cohort of 340 children with frns / sdns .
nevertheless , taking into account its low cost and good safety profile , we believe that in the era of modern immunosuppressive medications such as mofetil mycophenolate , tacrolimus , and rituximab there is still a place for levamisole application in children with ins . in our group of patients
we were also able to prove a significant reduction in the number of ins relapses . in three patients remission
this observation is in accordance with the results of recent studies suggesting that its steroidsparing effects last for months after its withdrawal [ 13 , 20 , 24 , 25 ] .
boyer et al . , elmas et al . , and ekambaram et al .
found that in some children levamisole has a long - lasting effect even 12 months after withdrawal .
there is no clear answer to the protocol of prednisone tapering in children on levamisole treatment . in the study of the british association of pediatric nephrologists ( bapn )
after 112 days significantly more children receiving levamisole were in remission compared to the control group ( 14/31 vs. 5/30 , p < 0.01 ) .
al - saran compared in a prospective study the effectiveness of levamisole and a low corticosteroid dose ( < 0.5 mg / kg/48 h ) in maintaining remission in children with frns / sdns .
patients on levamisole therapy were characterized by a significantly lower number of relapses and higher reduction of steroid dose compared to the control group .
it should be noted that the frequency of relapses during levamisole therapy was 0.96 1.80/patient / year , which is much less than in our population ( 1.9 2.1/patient / year ) .
prednisolone was tapered by 2.5 - 5 mg every 4 weeks to 0.5 mg / kg on alternate days . in this cohort
the number of relapses was also reduced from 3.0 1.5 to 0.9 0.7/patient / year .
it should be stressed that in the studies by al - saran and bagga levamisole was administered , unlike in our protocol , at a dose of 2.5 mg / kg on alternate days for the whole period of therapy [ 4 , 15 ] . in our study group time to first relapse on levamisole treatment correlated negatively with number of relapses in further observation .
thus , we can conclude that early recurrence of proteinuria is highly suggestive of ineffectiveness of levamisole .
side effects were not rare , though they were mild in nature and fully reversible after withdrawal of the medication .
incidence of side effects of levamisole treatment in children with ins varies from no adverse events [ 4 , 20 , 23 ] to 14.7% . like in our patients , most cases of adverse events
more severe cases are sporadically reported , such as disseminated autoimmune disease with high titers of igm anticardiolipin and p - anca antibodies described by barbano et al . .
the limitations of our study are the retrospective design and small number of patients with relatively high diversity in age and treatment protocols , which could have influenced the response to levamisole treatment .
also , due to the retrospective nature of our study it was impossible to determine in many patients the dose of corticosteroids administered during the relapse of nephrotic syndrome while on levamisole treatment , and we did not include these data in our paper .
in addition , our study was uncontrolled and , since spontaneous improvement occurs commonly in patients with ins , especially during puberty , we can not rule out this factor in our patients .
levamisole is effective in reducing the number of relapses in children with frequently relapsing and steroid - dependent nephrotic syndrome .
early relapse of proteinuria on levamisole treatment in children with frns / sdns suggests low efficacy of further treatment .
| ### Summary:
: introductionnumerous studies suggest that levamisole , an antihelmintic agent with an immunomodulatory effect , reduces the number of relapses in children with frequently relapsing and steroid - dependent nephrotic syndrome ( frns / sdns ) .
the aim of the study was to present a single center s experience in treatment of frns and sdns with levamisole.material and methodsamong 72 children with frns / sdns treated in our department with levamisole in the years 1984 - 2011 we studied in detail 53 patients ( mean age : 6.5 3.0 years ) , in whom the medication was administered for at least 6 months .
in these 53 patients we evaluated : the course of the disease before levamisole , the renal biopsy result , medications used , prednisone dose on levamisole initiation , duration of levamisole treatment , time to first relapse and number of relapses on levamisole , and levamisole side effects.resultsthe duration of nephrotic syndrome was 3.4 2.9 years , and the number of relapses before levamisole treatment was 6.0 3.4 . the dose of prednisone on initiation of levamisole treatment was 1.2 0.6 mg / kg/24 h , and the duration of levamisole treatment was 15.0 7.3 months . during levamisole
treatment proteinuria relapsed in 34/53 ( 64.2% ) children , and the time to first relapse was 8.8 8.1 months . during levamisole therapy relapses of the disease decreased significantly ( 2.7 2.0 vs. 1.8 2.1 relapses / year ,
p = 0.02 ) .
time to first relapse correlated with total number of relapses ( r = 0.59 , p < 0.001 ) and number of relapses in one year during levamisole treatment ( r = 0.60 , p < 0.001).conclusionslevamisole is effective in reducing the number of relapses in children with frequently relapsing and steroid - dependent nephrotic syndrome
. early relapse of proteinuria on levamisole treatment in children with frns / sdns suggests low efficacy of further treatment . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: extended - spectrum beta - lactamase ( esbl ) producers are gram - negative bacteria that produce enzymes that bestow resistance to most beta - lactam antibiotics like penicillins , cephalosporins , and the monobactam aztreonam .
these esbl producers have been noticed mainly in the enterobacteriaceae family of bacteria which may harbour several antibiotic resistance determinants making treatment of infections caused by these pathogens more difficult .
extended - spectrum beta - lactamase producers have a complex epidemiology ; the most prominent bacteria involved include e. coli and k. pneumoniae whose reservoirs comprise the environment ( soil and water ) , wild animals , farm animals , food , and pets . in some communities , backyard poultry houses at residential premises may disseminate antimicrobial - resistant esbl producers in the environment as previously observed . a study conducted in spain identified the presence of esbl - producing bacteria in poultry with e. coli strains comprising esbl ctx - m-14 , ctx - m-9 , and shv-12 . in another study conducted in britain ,
54.5% of ctx - m - carrying e. coli was isolated from broiler abattoirs and 3.6% from individual broiler caecal samples .
food animals colonized with esbl - producing bacteria can enhance the spread of bacteria at the community level .
antimicrobial - resistant e. coli asymptomatically colonizes the intestinal flora of food animals with a likelihood of becoming infectious to humans if consumed through the food chain .
furthermore the predominant presence of cefotaxime - munich genes in healthy broiler chickens can in the long run spread the resistant esbl - genes from the rearing environment into the food chain .
contamination of meat products during slaughtering , dressing , and evisceration of internal contents is another risk factor that can result in further spread of resistant esbls genes within the human population [ 3 , 6 ] .
extended - spectrum beta - lactamase - producing bacteria are frequently resistant to many antimicrobial agents usually recommended for the treatment of infections such as gentamicin , fluoroquinolones , and trimethoprim - sulfamethoxazole .
this leads to serious challenges in the treatment of esbl - enterobacteriaceae infections because the bacterial plasmid may harbour several antibiotic resistance determinants .
heavy usage of antibiotics has been reported to be a risk factor in the acquisition of esbl - producing organisms .
an increased trend of resistance to commonly used antibiotics , namely , ampicillin , cotrimoxazole , gentamicin , erythromycin , tetracycline , and third - generation cephalosporins , has been observed [ 10 , 11 ] . in the present study we found the presence of esbl - producing e. coli bacteria in market - ready chickens .
these organisms have been established to confer resistance to many antimicrobial agents recommended for the treatment of infections such as gentamicin , fluoroquinolones , and trimethoprim - sulfamethoxazole .
this leads to serious challenges in the treatment of esbl - enterobacteriaceae infections [ 10 , 11 ] .
a baseline study was therefore initiated to determine the carriage of esbl in food of animal origin in market - ready broiler chickens in zambia .
lusaka covers an estimated area of 360 km and is located at 1530 latitude south and 2817 longitude east .
a poultry abattoir was considered for the purpose of poultry swab sampling at a point where broiler chickens were to enter the market .
a total of 384 poultry samples were collected at the slaughterhouse , before the carcasses were chilled .
this involved the use of sterile swab sticks ( oxoid , basingstoke , uk ) which were placed in tubes containing a cary - blair transport medium ( oxoid , basingstoke , uk ) .
the poultry samples were inoculated on macconkey agar ( oxoid , basingstoke , uk ) containing 2 mg / l of cefotaxime ( sigma - aldrich , munich , germany ) for preliminary screening of esbl - producing bacteria .
the colonies that grew on macconkey agar were identified as lactose fermenters or nonlactose fermenters .
identification of e. coli lactose - fermenting positive colonies was done using phenotypic characteristics and confirmed by the triple sugar iron ( tsi ) and imvic tests as described by rayamajhi et al . and batchelor et al . .
for genetic detection , e. coli isolates were cultured on brain - heart - infusion broth ( nissui , tokyo , japan ) at 37c for 24 hours .
the e. coli isolates were subjected to pcr for confirmation of resistance genes : tem ( temoniera ) , shv ( sulphydryl variable ) , and ctx - m ( cefotaxime - munich ) using primers previously used by other workers [ 14 , 16 ] .
the pcr ( finnzymes oy , finland ) was performed in a total reaction volume of 10 l consisting of 5 l phusion master mix , 2 l sterile distilled water , 2 l primers ( forward and reverse ) , and 1 l bacterial dna template .
the pcr was performed using the rapid cycle dna amplification method comprising an initial denaturation step at 98c for 30 seconds , followed by 35 cycles of template denaturation at 98c for 1 second and primer annealing at 60c for 5 seconds and 72c for 1 second with final extension at 72c for 10 seconds .
the pcr products were later viewed with ethidium bromide after electrophoresis through 1.5% agarose gel .
the antimicrobial susceptibility testing was done using the kirby - bauer disc diffusion method on mueller hinton agar ( becton , dickinson and company , md , usa ) based on the clinical laboratory standard institute ( clsi ) guidelines .
the antibiotic discs ( becton , dickinson and company , md , usa ) used included ampicillin ( 10 g ) , sulfamethoxazole / trimethoprim ( 1.25/23.75 g ) , streptomycin ( 300 g ) , ciprofloxacin ( 5 g ) , tetracycline ( 30 g ) , gentamicin ( 10 g ) , nalidixic acid ( 30 g ) , chloramphenicol ( 30 g ) , ceftazidime ( 30 g ) , norfloxacin ( 10 g ) , and cefotaxime ( 30 g ) .
the phenotypic confirmation of esbl isolates was done by the combination of disc approximation method using either ceftazidime ( 30 g ) or cefotaxime ( 30 g ) alone followed by overnight incubation at 37c for 1824 hrs .
interpretation of susceptibility patterns on other antimicrobial discs was done using guidelines laid down in the clsi , which provides break points corresponding to zone of inhibition diameter .
an increase in antibiotic zone diameter ( 512 mm ) for either ceftazidime or cefotaxime indicated esbl production [ 10 , 18 ] .
of the 384 e. coli isolates analyzed for the presence of esbl - producing isolates on pcr , a total of 20.1% , 77/384 , ( 95% ci ; 43.265.5% ) were confirmed to be esbl - producing isolates .
the esbl - producing e. coli isolates carried the -lactamase genes of either blactx - m , blashv , and blatem or a combination .
the major gene detected on pcr was blactx - m cluster , followed by blashv cluster , and blatem cluster .
a combination of blactx - m + blatem cluster showed 4.4% ( 17 isolates ) .
this was followed by a combination of blactx - m + blashv cluster and blactx - m + blashv + blatem cluster with 0.52% ( 2 isolates ) and the lowest was a combination of blatem + blashv cluster with 0.3% ( 1 isolate ) ( table 1 ) .
the seventy - seven ( 77 ) e. coli isolates preliminarily identified as esbl - producing e. coli were subjected to antibiotic susceptibility testing .
of 77 e. coli isolates analyzed , 85.7% ( 66/77 ; ci : 75.792 ) were resistant to one or several antimicrobial compounds .
the diversity of the antibiotic resistant and susceptible e. coli isolates was clearly observed with 66 isolates being resistant to one or more antibiotics used and 11 isolates being susceptible to all antibiotics tested .
interestingly , high resistance rates were noticed in ampicillin ( 100% ) , cefotaxime / ceftazidime ( 100% ) , tetracycline ( 59.7% ) , chloramphenicol ( 57.1% ) , and norfloxacin ( 54.5% ) ( table 2 ) . it was further observed that multidrug resistance ( mdr ) of e. coli isolates to six or more drugs
was most frequent ( 45.5% , 35/77 ) followed by resistance to five drugs ( 11.7% , 9/77 ) and four drugs ( 11.7% , 9/77 ) .
based on the antimicrobial susceptibility test results , e. coli from poultry in this study can be grouped in six phenotypes ( table 3 ) .
bacteria in food - producing animals are spread through the food chain . in africa ,
the heavy usage of antibiotics has been reported to be a risk factor for acquisition of esbl - producing organisms resulting in an increased trend of resistance to commonly used antibiotics , namely , ampicillin , cotrimoxazole , gentamicin , erythromycin , tetracycline , and third generation cephalosporins . in zambia , drugstores which stock human and livestock antimicrobial agents are coming up without proper guidance on the dispensation of drugs .
the inadequate monitoring of the drugstores in the nation has led people to easily access the livestock antibiotics without following the recommended laid down clinical prescription procedures thereby increasing the risk of esbl in food animals .
detection of esbl - producing e. coli isolates in poultry has not been fully conducted in zambia .
this cross sectional study revealed that an overall of 20% esbl - producing e. coli isolates were detected in poultry .
the high prevalence observed may be due to frequent administration of antimicrobials to poultry which in turn increases the risk of higher antimicrobial - resistant e. coli strains in the normal intestinal flora as observed in a study conducted by carattoli . in this study , it was established that food animals were possible reservoirs for resistant faecal flora particularly e. coli .
furthermore , the high colonization rate could be attributed to cross contamination of poultry in abattoirs particularly during slaughtering and dressing .
the processes of slaughtering and dressing are potential risk factors that may exacerbate the transmission rate of esbl - producing e. coli resistant genes as described by lavilla et al . and reich et al .
the predominant esbl - producing e. coli gene identified in this study was blactx - m cluster with 13% which was relatively low in relation to 54.5% of blactx - m carrying e. coli isolated from poultry chickens in britain . in zambia ,
the economic situation has led many residents to rearing broiler chickens as an income generating venture .
this brings humans into close contact with poultry which could be a possible route of shedding esbl producers into the environment .
however , no detailed studies have yet been conducted in zambia to specifically describe the types of esbl - producing enterobacteriaceae present in apparently healthy chickens and other food animals .
in addition , the study also showed that esbl - producing e. coli isolates carried multiple types of beta - lactamase genes and that the combination of blactx - m + blatem cluster was predominant followed by blashv cluster and blatem cluster .
this therefore confirms that esbl - mediated plasmids are capable of carrying more than one beta - lactamase gene and thus result in high - level presence of beta - lactam resistant phenotypes as described by rottier et al . .
previous studies in spain identified e. coli strains comprising blactx - m-14 , blactx - m-9 , and blashv-12 as the predominant esbl - producing subtypes isolated among poultry .
antimicrobial susceptibility testing revealed interesting patterns with resistance rates observed in the majority of antimicrobial agents tested . from the antimicrobial susceptibility results , 85.7% ( 66/77 ; ci : 75.792 ) of isolates were resistant to chloramphenicol , ciprofloxacin , gentamicin , nalidixic acid , norfloxacin , streptomycin , sulfamethoxazole / trimethoprim , and tetracycline .
for instance , a study on published literature for democratic republic of congo , mozambique , tanzania , and zambia revealed an increased trend of resistance to ampicillin , cotrimoxazole , gentamicin , erythromycin , tetracycline , and third - generation cephalosporins . in this study ,
high resistance rates to beta - lactam drugs , namely , ampicillin ( 100% ) , cefotaxime , and ceftazidime ( 100% ) , were observed among the isolates investigated .
at least six phenotypes were observed from this study , indicating a wide diversity of resistance .
unfortunately , the study had a limitation as it was not able to establish the type of antimicrobials frequently used for poultry feed and growth promotion .
this is the first study to be conducted in zambia on detection of esbl - producing e. coli isolates in poultry .
this therefore further confirms that poultry can be one of the major and potential reservoirs for the antimicrobial esbl resistant genes which could spread into the food chain .
the study has also shown a widespread occurrence of multidrug resistance patterns of e. coli isolates in poultry . | ### Summary:
: the frequent administering of antibiotics in the treatment of poultry diseases may contribute to emergence of antimicrobial - resistant strains .
the objective of this study was to detect the presence of extended - spectrum -lactamase- ( esbl- ) producing escherichia coli in poultry in zambia .
a total of 384 poultry samples were collected and analyzed for esbl - producing escherichia coli .
the cultured e. coli isolates were subjected to antimicrobial susceptibility tests and the polymerase chain reaction for detection of blactx - m , blashv , and blatem genes .
overall 20.1% , 77/384 , ( 95% ci ; 43.265.5% ) of total samples analyzed contained esbl - producing escherichia coli .
the antimicrobial sensitivity test revealed that 85.7% ( 66/77 ; ci : 75.792 ) of esbl - producing e. coli isolates conferred resistance to beta - lactam and other antimicrobial agents .
these results indicate that poultry is a potential reservoir for esbl - producing escherichia coli .
the presence of esbl - producing escherichia coli in poultry destined for human consumption requires strengthening of the antibiotic administering policy .
this is important as antibiotic administration in food animals is gaining momentum for improved animal productivity in developing countries such as zambia . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: copd is a disease posing a heavy burden and expenditure in the health care system worldwide.1,2 while mortality due to the major illnesses is declining , death attributable to copd continues to rise and is projected to be the third major killer by 2020.3 in hong kong , copd patients currently occupies ~8% of all medical beds and ranks fourth in the cause of death.4 copd is a chronic illness and its clinical management involves a multidisciplinary approach with numerous treatment modalities over a long period of time .
like many other chronic illnesses , self - management is important in copd . for a successful self - management plan
, the patients themselves should be equipped with sound knowledge of the disease and its treatments .
not surprisingly , patient education is an integral element of copd management in international guidelines such as the global initiative for chronic obstructive lung disease ( gold)5 and copd foundation6 guidelines .
identification of patient factors that have significant impact on copd knowledge enables the service provider to tailor - make educational materials to fit certain group of patients .
furthermore , knowing which areas of knowledge are particularly deficient in study cohorts may enable improvement of overall educational content .
the ultimate goal is to facilitate self - management practices necessary for optimal control of the disease .
several systematic reviews79 of structured education intervention for copd have emphasized the evaluation of health outcomes with respect to service utilization , health - related quality of life , spirometric indices , and particularly knowledge level .
published reports examining the comprehensive profile on patients knowledge with respect to copd are available,1012 with one of these showing the beneficial effects of education interventions with increase in knowledge specific to copd.10 besides the deficiency in overall copd knowledge,13 understanding and knowledge related to copd pathophysiology was rather deficient in copd patients in both outpatient and inpatient settings among western populations.12 however , there were scanty data on the level of patients knowledge of copd and factors affecting the knowledge of copd among chinese population .
this study assessed the disease - specific knowledge of chinese patients with copd in hong kong and examined the associations between knowledge and characteristics of copd patients .
we hypothesize that patients who had received copd education within the previous 2 years possess better copd knowledge compared to those who never had received copd education and that higher knowledge of copd would be associated with higher education level .
a cross - sectional study was conducted in the kwai tsing district of the kowloon west cluster of the hong kong hospital authority , between september 2009 and september 2010 .
there were two target groups : 40 patients who had undergone copd education as part of an outpatient pulmonary rehabilitation program within 2 years and 60 patients who never received any ( in our institution , copd education was not offered in usual care ) .
otherwise , patients were randomly selected from family medicine clinics , general outpatient clinics , and specialist clinics and screened for suitability to be recruited into the study .
inclusion criteria were having a diagnosis of copd and receiving treatments for copd , had spirometry within 12 months of screening showing post - bronchodilator forced expiratory volume in 1 second ( fev1 ) to forced vital capacity ( fvc ) ratio < 0.7 , and willing to participate in the study . if no spirometry data within 1 year were available , one would be performed at the screening visit .
all spirometry tests were done according to the american thoracic society guidelines14 using local reference values.15 patients were excluded if they had significant coexisting respiratory disease ( eg , kyphoscoliosis , lung fibrosis , bronchiectasis ) , significant cognitive impairment from any cause , poor vision , or were illiterate . written informed consent was obtained from all recruited patients , who were then invited to attend the pmh respiratory research clinic once to perform study - related procedures . during the study visit , sociodemographic information , including sex , age , education level , smoking status , drinking status , and working status , was collected .
patients were asked to self - report diagnoses of hypertension , diabetes mellitus , benign prostatic hypertrophy , tuberculosis , and stroke .
patients were also identified if they had ever received copd education or attended copd classes taught by respiratory nurses or allied health staff .
after the study visit , the patients continued to attend follow - up at their original clinics .
the primary outcome of disease - specific knowledge was measured using the bristol copd knowledge questionnaire ( bckq ) , which was developed by white et al13 and published in 2006 .
earlier , we engaged a professional service to translate this questionnaire into a traditional chinese version .
there were five steps in the process : forward translation , backward translation , review of the traditional chinese version by clinician , cognitive debriefing , and final proof - reading .
the bckq is a 65-item instrument extensively assessing the level of knowledge and understanding relating to copd , aggregating 13 knowledge topics : 1 ) epidemiology , 2 ) etiology , 3 ) symptoms , 4 ) breathlessness , 5 ) phlegm , 6 ) infections , 7 ) exercise , 8) smoking , 9 ) vaccination , 10 ) inhaled bronchodilators , 11 ) antibiotics , 12 ) oral steroids , and 13 ) inhaled steroids .
each topic has five items , and for each item , there are three response options true , false , and
therefore , each topic has a score ranging from 0 to 5 , and the total score which sums up the scores of all 13 topics ranges from 0 to 65 .
permission to use the english version of bckq has been obtained from the copyright owner .
descriptive statistics of sociodemographic and clinical characteristics of patients were presented in terms of mean and standard deviation ( sd ) for continuous variables and count and proportion for categorical variables .
proportions of patients giving correct answers for each item and for each knowledge topic were calculated .
mean and sd of the 13 knowledge topic score and total score were shown for comparisons with international literature about the disease - specific knowledge of copd patients .
linear regressions were performed to explore the associations between disease - specific knowledge and patients characteristics .
data were analyzed using spss windows version 21.0 ( ibm corporation , armonk , ny , usa ) .
the primary outcome of disease - specific knowledge was measured using the bristol copd knowledge questionnaire ( bckq ) , which was developed by white et al13 and published in 2006 .
earlier , we engaged a professional service to translate this questionnaire into a traditional chinese version .
there were five steps in the process : forward translation , backward translation , review of the traditional chinese version by clinician , cognitive debriefing , and final proof - reading .
the bckq is a 65-item instrument extensively assessing the level of knowledge and understanding relating to copd , aggregating 13 knowledge topics : 1 ) epidemiology , 2 ) etiology , 3 ) symptoms , 4 ) breathlessness , 5 ) phlegm , 6 ) infections , 7 ) exercise , 8) smoking , 9 ) vaccination , 10 ) inhaled bronchodilators , 11 ) antibiotics , 12 ) oral steroids , and 13 ) inhaled steroids .
each topic has five items , and for each item , there are three response options true , false , and
therefore , each topic has a score ranging from 0 to 5 , and the total score which sums up the scores of all 13 topics ranges from 0 to 65 .
permission to use the english version of bckq has been obtained from the copyright owner .
descriptive statistics of sociodemographic and clinical characteristics of patients were presented in terms of mean and standard deviation ( sd ) for continuous variables and count and proportion for categorical variables .
proportions of patients giving correct answers for each item and for each knowledge topic were calculated . mean and sd of the 13 knowledge topic score and total score were shown for comparisons with international literature about the disease - specific knowledge of copd patients .
linear regressions were performed to explore the associations between disease - specific knowledge and patients characteristics .
data were analyzed using spss windows version 21.0 ( ibm corporation , armonk , ny , usa ) .
from october 2009 to september 2010 , 49 patients were targeted for recruitment into the copd - educated group and 40 were recruited and analyzed , while 80 were targeted for recruitment into the non - copd - educated group and 60 were analyzed .
of those , 91% were male , and the mean age was 72.29 years with an sd of 6.75 .
a large proportion of patients ( 81% ) were ex - smokers , while 3% and 16% were nonsmokers and current smokers , respectively .
most of the patients were nondrinkers ( 57% ) , which was more than ex - drinkers ( 37% ) and current drinkers ( 6% ) .
most patients received primary education ( 61% ) , which was more than those receiving no formal ( 21% ) , secondary ( 15% ) , and postsecondary education ( 3% ) . the majority ( 92% ) of patients
mean postbronchodilator fev1 was 0.92 l ( sd : 0.43 ) and 41.8% predicted ( sd : 18.86 ) , while the mean postbronchodilator fev1/fvc ratio was 0.44 ( sd : 0.12 ) . using the gold severity staging according to percent predicted fev1 , 71% of subjects had severe ( 38% ) and very severe ( 33% ) stages of copd .
the percentages of subjects giving correct response for each of the 65 items and 13 knowledge topics are displayed in table 2 .
of the 65 bckq items , item 7a walking is better exercise than breathing exercises to improve fitness and item 8a stopping smoking will reduce the risk of heart disease had the first and second greatest percentages ( 100% and 98% ) of subjects giving a correct response , respectively , whereas item 4a severe breathlessness prevents travel by air had the lowest percentage of 6% . among the 13 knowledge topics ,
the eighth topic smoking and the fifth topic phlegm had the first and second greatest percentages ( 79.6% and 78.2% ) of correct response , respectively , while the 12th topic oral steroids had the lowest ( 37.8% ) .
table 3 presents the bckq overall score and knowledge scores of all the 13 topics .
the mean and median of bckq overall of our patients were 41.01 ( sd : 10.64 ) and 42.50 , respectively . in line with the percentages of correct response
, the topics of smoking and phlegm achieved the first ( 3.97 , sd : 0.82 ) and second ( 3.91 , sd : 1.17 ) highest mean scores , respectively , while the topic of oral steroids
nine out of all topics ( except phlegm , exercise , smoking , and inhaled bronchodilators ) had the full coverage attaining the lowest ( zero ) and highest ( five ) possible scores .
table 4 displays the mean and sd of bckq overall score in each subgroup and the regression coefficients estimating the effects of the sociodemographic and clinical characteristics on bckq overall scores .
the bckq overall scores progressively decline ( p<0.001 ) with increase in education level , with the highest bckq overall score of 46.71 at no formal education among all subgroups . compared to no formal education , patients achieving primary , secondary , and postsecondary education had overall bckq scores of 5.906 ( 95% ci : 11.148 to 0.664 , p=0.027 ) , 8.005 ( 95% ci : 15.309 to 0.700 , p=0.032 ) , and 23.021 ( 95% ci : 35.028 to 11.015 , p<0.001 ) , respectively . drinking status was associated ( p=0.020 ) with overall copd knowledge : nondrinkers had higher bckq overall scores than current drinkers , having a decrement of 13.006 ( 95% ci : 22.236 to 3.776 , p=0.006 ) . on the other hand ,
none of the measured clinical characteristics , including the attendance of copd education , were associated with overall copd knowledge .
this is the first study that used a validated instrument to assess knowledge level in ethnic chinese patients and examined the associated clinical and sociodemographic characteristics .
the bckq demonstrated strengths in knowledge in the topics of smoking and phlegm with a mean score of 3.97 ( 79.4% ) and 3.91 ( 78.2% ) , respectively .
likewise , it revealed gaps in knowledge in the topic of oral steroids with only a mean score of 1.88 ( 37.6% ) .
such deficiency of knowledge about their own chronic illness is indicative of inadequate health literacy among the study subjects , given the strong correlations of the knowledge level with health literacy among patients with not only copd16 but also other chronic diseases.17,18 having identifying areas with weak knowledge level , enhancement in these areas is warranted in future education materials and classes . putting in the same metric of bckq overall score , the knowledge level of both the copd patients and health care professionals managing those patients was available for comparison . in a uk study,19
the bckq was administered to health care professionals involved in the service delivery of copd intervention in primary and secondary care .
not surprisingly , the bckq overall score of health care professionals had a higher mean score than that of copd patients ( mean : 50 vs 41 ) .
the topics of breathlessness and medications scored worst for the health care professionals . in the knowledge topic of inhaled steroids , it is interesting and worrying that copd patients had greater knowledge score ( mean : 2.95 vs 2.70 ; correct% : 59.0% vs 54.0% ) than health care professionals .
this study showed that knowledge of copd in hong kong chinese was deficient , especially in highly educated subjects .
in contrast to conventional perception , adjusted analysis demonstrated the inverse association of education level with the bckq overall score and urged caution on the intuitive thinking that lower level of education in copd patients would be associated with poorer copd knowledge .
there is no ready explanation for this finding , but one might speculate that this is a tortoise rabbit race scenario in which those who had higher education pay less attention to the education materials .
this finding underlined the enhancement on communication and transfer of copd knowledge from health professionals to patients and thus the unmet need for the structured self - management education program for highly educated patients with copd . in educating those patients
, their level of knowledge is an important short - term outcome of self - management education intervention because the increase in the knowledge level may act as a mediator of the improvement in long - term clinical outcomes of hospitalization , exacerbation frequency , and management .
another study conducted in hong kong20 reported the underprovision of education intervention , as low as 18% , in the clinical management of copd patients , suggesting the urgent need to improve accessibility to education intervention among copd patients , regardless of education level .
disappointingly , attendees of copd education exhibited a decrease , albeit insignificantly , in copd knowledge compared to nonattendees .
these findings call for a critical review of the content and conduct of existing copd education programs , with particular emphasis on the weaker knowledge topic observed in this study
. however , it would be premature to conclude that the current copd education program is ineffective , since we did not directly measure change in knowledge level before and after such program .
besides education level , nondrinkers were observed to have a significantly higher bckq overall score in our study .
there is little evidence that the current drinker had lower acquired knowledge than nondrinker among patients with chronic disease .
it was postulated that frequent drinkers ( low - risk drinking is defined as no more than three drinks in any single day and no more than seven drinks per week for women , and no more than four drinks in any single day and no more than14 drinks per week for men21 ) may have less self - efficacy and awareness than nondrinkers who indicated a high level of knowledge . however , those variables were not measured in our study to justify the interrelationships among them .
first , the total number of subjects is small , with reduced statistical power to identify additional potentially significant factors .
second , we did not randomly choose our study subjects who had undergone some form of copd education because 40 is the maximum number we could identify .
nonetheless , the 60 patients who had not undergone any copd education were randomly selected .
the result was that the two groups were not well matched in a number of clinical characteristics ( table 1 ) .
third , it is possible that subjects who have undergone copd education 1 month previously have better knowledge than those who did it 1 year or 2 years previously , and this is not addressed in our study .
we can not rule out the possibility that copd knowledge was associated with drinking status and education level , and these should be examined in a longitudinal study .
there is marked overall deficiency of disease knowledge among our copd patients , which appears not improved with the current copd education programs .
impairments in the level of copd knowledge were evident in patients who were current drinkers or had higher level of education . | ### Summary:
: backgroundthis study aimed to determine the associations of various sociodemographic factors with the level of disease - specific knowledge among hong kong chinese patients with copd.methodsa cross - sectional survey of 100 chinese adults with copd recruited from outpatient clinics was conducted from september 2009 to september 2010 .
data on the knowledge specific to copd and patients sociodemographics were collected from face - to - face interviews .
primary outcome of disease - specific knowledge was measured using 65-item bristol copd knowledge questionnaire ( bckq ) , summing up the 65 items as the bckq overall score .
associations of sociodemographic factors with the bckq overall score were evaluated using the linear regression model.resultsthe mean bckq overall score of our patients was 41.01 ( sd : 10.64 ) .
the knowledge in topics of smoking and phlegm achieved the first ( 3.97 , sd : 0.82 ) and second ( 3.91 , sd : 1.17 ) highest mean scores , respectively , while the topic of oral steroids returned the lowest mean score of 1.89 ( sd : 1.64 ) .
the bckq overall score progressively declined ( p<0.001 ) with increase in education level , with the highest bckq overall score of 46.71 at no formal education among all subgroups .
compared to nondrinkers , current drinkers were associated with lower total bckq score.conclusionwe found that among copd patients in outpatient clinics , impairments in the level of copd knowledge were evident in patients who were current drinkers or had higher level of education . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: entamoeba histolytica infection is common in developing countries due to the poor environment . in developed countries ,
this amebic infection is also an important issue for travelers in highly epidemic countries or in the immunocompromised population , including patients with aids or receiving organ transplantation .
the most common clinical symptoms of amebic infection are amebic colitis , which has various symptoms , and amebic liver abscess .
the best current estimate is that e. histolytica causes 3450 million symptomatic infections annually worldwide , resulting in 40,000100,000 deaths each year .
worldwide , approximately 4050 million people develop colitis or extraintestinal disease annually with 40,000 deaths .
most patients with e. histolytica infection are asymptomatic , comprising about 90% of those infected .
ameboma is a rare complication of amebic colitis and may caused related intraluminal granulation tissues that mimic colon carcinoma .
we present a 45-year - old male with intermittent bloody stool and right lower abdominal pain for about 1 month .
he had been buying and selling merchandise in indonesia for 18 years . according to the patient 's statement
he also denied any history of hemorrhoids and had not suffered from the same episode before .
the increased bloody stool amount was first noted 4 days previously ( on february 14 ) and subsequently about 56 times per day with a volume of 2030 ml / time .
he had also been suffering from abdominal pain over the periumbilical area , especially on the right site , for about 1 month .
he had eaten raw food with sashimi and uncooked eggs about 1 month previously . according to his statement , the locals clean the dishes with groundwater .
colonoscopy was also done at the emergency room and showed multiple small polyps over the terminal ileum and multiple indurated ulcerations over the rectum and cecum ( fig .
1 ) . a mild elevation in c - reactive protein and erythrocyte sedimentation rate were noted .
pathologic examination was also performed and showed chronic inflammatory infiltrate of lymphoplasma cells , eosinophils and neutrophils in the edematous fibrous lamina propria .
focal aggregations of amoeba trophozoites were demonstrated by periodic acid - schiff stain ( fig .
after 3 days of treatment the symptoms , including bloody stool and fever , had resolved .
follow - up colonoscopy showed much improvement 4 months post treatment and complete remission after 8 months ( fig .
the risk of contracting amebic colitis includes people living in endemic regions ( india , africa , mexico and parts of central and south america ) , immigrants from or travelers to endemic regions , male homosexuals and institutionalized persons .
in addition , malnourished patients , infants , elderly , pregnant women and patients receiving glucocorticoids may be at increased risk for fulminant disease . in our case , the patient lived in an endemic region ( india ) and his dishes were cleaned with uncooked water . combined with the symptom of bloody stool for about 1 month , amoebic colitis should be differentially diagnosed .
other tests , including antigen detection assays , are the best current means for diagnosing intestinal amebiasis since they are sensitive , specific , rapid , easy to perform and distinguish e. histolytica from entamoeba dispar infections .
stool specimens for microscopy are far less sensitive than antigen detection and can not differentiate between species .
ameboma is a mass of granulation tissue with peripheral fibrosis and a core of inflammation related to amebic chronic infection usually found in the cecum and ascending colon . in the colonoscopy
finding , ulcerative mass with ulceration and mucosal change over the rectum , ascending colon and cecum , crohn 's disease , carcinoma of the colon , non - hodgkin 's lymphoma , tuberculosis , fungal infection , aids - associated lymphoma and kaposi 's sarcoma are considerations of differential diagnosis .
ameboma was considered in the first place because of the patient 's young age , multiple lesions in the ascending colon , cecum , and rectum , and the fact that the edge of the ulcerative mass was not abrupt as in malignancy .
sometimes , ameboma is treated as crohn 's disease with glucocorticoids , which leads to fulminant colitis .
the major complications of ameboma include perforation , obstruction , intussusception , anorectal fistula and appendicitis .
furthermore , tinidazole , ornidazole and nitazoxanide are alternative therapies [ 7 , 8 ] .
after metronidazole treatment for invasive amoebic dysentery , agents for the cure of luminal infection with paromomycin , the second - line agent diloxanide furoate or diiodohydroxyquinoline ( iodoquinol ) are necessary due to persistent parasites in 4060% of patients [ 9 , 10 ] .
therefore , metronidazole and paromomycin should not be given at the same time owing to the side effects of paromomycin , the most common being diarrhea , and because it is difficult to differentially diagnose this from the patient 's response to treatment .
follow - up stool examinations are required after completion of the therapy since no regimen is completely effective . in this case , the initial presentation was intermittent bloody stool with abdominal pain .
the contamination way was through contaminated dishes , which are washed with groundwater in the high - prevalence region of indonesia .
the sites of ameboma were also compatible with the most common sites of amebic colitis , including the cecum , ascending colon and terminal ileum .
the appearance was that of carcinoma - like lesions . the therapeutic strategy combined metronidazole for the invasive amebic dysentery and iodoquinol for the luminal infection .
after treatment , the symptoms dramatically improved and there was complete resolution after 8 months shown by follow - up colonoscopy .
vaccination may be considered as a priority for people traveling to high - prevalence countries and at high risk for amoebic infection . | ### Summary:
: ameboma is a rare complication of amebic colitis presenting as a mass of granulation tissue with peripheral fibrosis and a core of inflammation related to amebic chronic infection .
the initial presentations are usually obstruction and low gastrointestinal bleeding .
the most common sites are the ascending colon and the cecum .
it may mimic colon carcinoma , crohn 's disease , carcinoma of the colon , non - hodgkin 's lymphoma , tuberculosis , fungal infection , aids - associated lymphoma and kaposi 's sarcoma in colonoscopy findings . the therapeutic strategy should be combined with antibiotics for invasive dysentery and eradication of luminal cysts . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: adult intussusception is a rare clinical entity accounting for 5% of all cases of intussusceptions .
intussusception in adults is caused by an identifiable lesion , such as a benign or malignant tumour , as the lead point .
therefore , surgical treatment is often required for intussusception in adults , and it is controversial whether pre - operative and intra - operative reduction of intussusception in adults should be performed .
inflammatory fibroid polyps ( ifps ) are rare , benign submucosal tumours of the gastrointestinal tract .
ifps usually arise from the stomach , followed by the small bowel [ 3 , 4 ] .
ifps are commonly asymptomatic , but they sometimes present with various symptoms , depending on their anatomical location and size .
intussusceptions are one of their clinical conditions associated with ifps [ 3 , 4 ] .
we describe a patient in whom successful pre - operative colonoscopic reduction for intussusception - induced ifp was very effective in the diagnosis and treatment .
a 35-year - old woman visited the emergency department with a 2-day history of increasingly worsening abdominal pain .
physical examination showed that her blood pressure was 113/72 mmhg , pulse was 97 b.p.m . , and body temperature was 37.7 c .
laboratory examination showed that her haemoglobin level was 13.0 mg / dl , haematocrit level was 39.2% , white blood cell count was 10 870 mm
( 74.6% segmented neutrophils ) and c - reactive protein level was 0.07 mg / dl .
an enhanced computed tomography ( ct ) scan of her abdomen showed the presence of a large intraluminal mass located in the transverse colon with signs of intussusception ( fig .
abdominal findings indicated no peritonitis or ischaemic change ; therefore , colonoscopy was performed to release the intussusception and diagnosis the lead point lesion .
there was an oval - shaped , 4-cm mass in the transverse colon , indicating ileocecal - type intussusception ( fig .
the clinical impression was that intussusception was due to a non - epithelial tumour , such as a gastrointestinal stromal tumour , which could be pushed back into the ileum easily using pressurized air .
figure 1:(a ) axial ct scan of the abdomen showing a mass ( arrow ) filling the transverse colon with accompanying mesenteric fat and vessels ( arrowhead ) within the lumen .
a low - density mass ( arrow ) is pushed back into the caecum .
figure 2:endoscopic examination showing a pedunculated lesion with the base near the ileocecal valve , occupying most of the transverse colic lumen .
( a ) axial ct scan of the abdomen showing a mass ( arrow ) filling the transverse colon with accompanying mesenteric fat and vessels ( arrowhead ) within the lumen .
endoscopic examination showing a pedunculated lesion with the base near the ileocecal valve , occupying most of the transverse colic lumen .
there was no movable caecum or intestinal oedema ; the laparoscopic - assisted operation was performed uneventfully .
the ileocecal segment was resected , and functional end - to - end anastomosis was performed .
results of the histopathological examination showed a 3.5 4.5 cm ifp composed of oedematous stroma containing spindle - shaped stromal cells , lymphoid nodules and eosinophils ( fig .
results of immunohistochemical analysis indicated that the spindle cells were negative for smooth muscle actin , c - kit , desmin and cd34 ( fig .
figure 3:a ) the bowel wall is cut away , showing the mass emanating from the ileum .
( b ) the tumour is composed of bland spindle cells with a fibromyxoid background , containing numerous eosinophils .
figure 4:the spindle cells are negatively stained for cd34 ( a ) , c - kit ( b ) , s100 ( c ) and smooth muscle actin ( d ) .
a ) the bowel wall is cut away , showing the mass emanating from the ileum .
( b ) the tumour is composed of bland spindle cells with a fibromyxoid background , containing numerous eosinophils .
the spindle cells are negatively stained for cd34 ( a ) , c - kit ( b ) , s100 ( c ) and smooth muscle actin ( d ) .
the patient has had no specific post - operative complications ; she was discharged 11 days post - operatively .
about 8090% of adult cases of intussusception are due to benign or malignant neoplasms as a lead point .
one of the causes is ifp , a rare , benign submucosal tumour that can occur throughout the gastrointestinal tract .
the most common site for ifps is the gastric mucosa , accounting for ~70% of cases , followed by the small bowel , accounting for 23% , with the ileum predominating .
some authors have reported that ifps arise from an allergic reaction against an inflammatory stimulus .
although most patients have a non - specific presentation , those with small intestinal lesions form a symptomatic mass , causing obstruction by intussusception .
a definitive diagnosis of ifp is usually based on intra - operative findings , and a precise pre - operative diagnosis is very difficult to make .
the treatment of ifps is resection through an endoscopic or surgical procedure . in the present patient
, pre - operative colonoscopy showed that the location of the lesion was the terminal ileum ; additionally , an epithelial tumour was ruled out based on endoscopic findings , although no definitive diagnosis could be made with a biopsy .
it is important that ifps , although rare , are considered in the differential diagnosis of adult cases of intussusceptions , especially cases of intussusception - induced submucosal tumour - like lesions .
pre - operative colonoscopic reduction of intussusception is very effective in its diagnosis and treatment . in children with intussusceptions ,
the standard therapy is reduction . in adults , however , many studies have pointed out that pre - operative or intra - operative reduction of intussusceptions should not be performed because malignant tumours exist in many cases and there is a possibility of dissemination or haematogenous metastases [ 3 , 5 , 7 ] .
conversely , some authors have emphasized that pre - operative endoscopic reduction may enable physicians to make a qualitative diagnosis and conduct elective surgery after improving intestinal oedema and shortening the length of the intestine to be resected .
furthermore , a better field of view provided by bowel decompression through reduction may facilitate a minimally invasive laparoscopic operation .
intussusceptions are divided into ( i ) enteroenteric , ( ii ) ileocecal , ( iii ) ileocolic and ( iv ) colocolic types according to where they occur .
the enteroenteric type is generally difficult to reduce by performing pre - operative endoscopy because of anatomical reasons , whereas the remaining three types of intussusception are highly likely to be a good indication for pre - operative colonoscopy .
some authors have reported successful laparoscopic operation in other diseases causing intussusceptions , such as lipoma and hamartoma [ 9 , 10 ] . in the present patient
, we chose to perform pre - operative reduction , because her physical and ct findings indicated no ischaemia or necrosis of the intestines and no peritonitis ; the patient underwent a laparoscopic operation without complications . in the diagnosis and treatment of adult cases of intussusceptions , a laparoscopic procedure after endoscopic reduction
could be useful , provided that the patient 's condition is tolerable and the surgeon is familiar with performing endoscopic and laparoscopic procedures .
however , many published papers have described the reduction of intussusception in a negative manner [ 3 , 5 , 7 ] .
when malignancy is strongly considered , a decision to perform reduction needs to be made with caution .
more relevant case reports of intussusceptions in adults need to be accumulated in the future .
pre - operative colonoscopic diagnosis and reduction have advantages , as they help in the decision - making of therapeutic strategies and facilitate the operation , especially the laparoscopic procedure .
| ### Summary:
: abstractintussusception occurs mainly in children but rarely in adults .
about 8090% of adult cases of intussusception are due to benign or malignant neoplasms as a lead point .
one of the causes is an inflammatory fibroid polyp ( ifp ) , a rare , benign entity that occurs more frequently in the stomach than the ileum .
we describe an uncommon case of a patient who presented with intussusception - induced ifp of the ileum . a 35-year - old woman presented with a 2-day history of abdominal pain .
a computed tomography scan demonstrated ileocolic intussusception . during colonoscopy , reduction by
pressured air easily released intussusception , and we suspected a submucosal tumour of the ileum .
successful pre - operative colonoscopic reduction was helpful for performing laparoscopic ileocecal resection 2 days later .
results of the histopathological examination confirmed a large ifp .
the patient 's post - operative course was uneventful .
pre - operative reduction by colonoscopy is effective for the diagnosis and treatment of intussusception - induced ifp . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: sudden death is at least 20 times more common in people with epilepsy compared with the general population and may occur without a clear structural or pathological identifiable cause .
sudden unexplained death in epilepsy ( sudep ) is one of the most common causes of death in patients with epilepsy , with an annual incidence of 2.2 - 10/1,000 patients .
some of the postulated mechanisms for sudep are cardiac arrhythmias , central apnea , neurogenic pulmonary edema and asphyxia .
the occurrence of asystole during a seizure is the most dramatic manifestation of ictal bradycardia and may contribute to seizure - related injury and sudep .
there are reports of sudep in video - eeg monitoring unit in patients with unsuccessful resuscitation .
we report an elderly man with chronic epilepsy who developed in - hospital symptomatic ictal bradyarrythmia due to junctional escape rhythm and hypotension during a generalized seizure , from which he recovered with supportive treatment .
a 66-year - old gentleman had generalized tonic - clonic seizures ( gtcs ) since the age of 14 years , which was well controlled for nearly two to three decades with antiepileptic drug ( aed ) viz .
the seizure frequency was 1 - 2 episodes per month in spite of polypharmacy with valproate ( 900 mg / day ) , carbamazepine ( 800 mg / day ) and phenobarbitone ( 120 mg / day ) .
he did not have any comorbid illnesses such as ischemic heart disease , diabetes mellitus or hypertension .
he was presented to us 3 days following an episode of gtcs with a confusional state .
initial examination revealed a disoriented patient with gait ataxia , fine tremor of outstretched hands , pes cavus and hammer toes and diminished ankle jerks .
scalp eeg at admission showed generalized slowing in theta range and there was no epileptiform activity .
plasma ammonia was slightly raised ( 76.8 mol / l ; range : 11 - 35
mr imaging of brain carried out showed mild generalized atrophy with a cystic lesion secondary to gliosis of the left anterior temporal region [ figure 1 ] .
the serum levels of phenobarbitone was elevated [ 53.35 g / ml ; reference range : 15 - 40 g / ml ] , while that of carbamazepine was 7.11 g / ml [ range : 4 - 12 g / ml ] and valproate was 33.58 g / ml [ range : 50 - 100 g / ml ] were within therapeutic limits .
a possibility of chronic uncontrolled symptomatic localization related secondary generalized epilepsy due to gliosis in the left temporal region with phenobarbitone toxicity was considered after evaluation .
mri showing a cystic gliotic area in the left anterior temporal region ( a ) : flair axial ; ( b ) : t2w coronal ; and ( c ) : t2w sagittal on the third day of hospitalization , the patient had a generalized seizure . during the immediate postictal period
, he was drowsy and diaphoretic , with shallow respiration , bradycardia [ pulse rate : 52/min , feeble radial pulse ] and hypotension [ systolic blood pressure : 60 mmhg ] .
an electrocardiogram obtained at this time showed a heart rate of 43/min , with p - wave coming after qrs complex suggestive of junctional av rhythm [ figure 2a ] .
he was given supportive treatment with nasal oxygen ( 3 l / min ) , intravenous fluids and dopamine ( 10 g / kg / min ) .
about 40 minutes later , the heart rate normalized to 72 per minute and blood pressure rose to 100/80 mmhg .
the serum creatine kinase - mb [ 21 u / l ; normal 9 - 25 u / l ) and troponin - i done after 4 hours was 0.6 ng / ml ( ref : up to 0.1 ) .
repeat troponin - i was 0.6 ng / ml . a repeat ecg carried out 2 hour later was normal [ figure 2b ] .
he recovered completely and at the time of discharge 11 days later , he did not have any neurological deficits . ( a ) : 12-lead ecg taken during the peri - ictal period shows junctional rhythm , inverted p - wave in ii , iii and avf ( arrow ) .
note that p - wave follows the qrs complex indicating retrograde p conduction ; ( b ) : 12-lead ecg done 2 hours after the seizure demonstrates normal sinus rhythm with upright p - wave in ii , iii and avf ( arrow ) preceding the qrs complex this event led to a possibility of self - remitting in - hospital symptomatic ictal bradyarrythmia ( junctional av rhythm ) and hypotension during a generalized seizure .
after 6 months of follow - up , he was asymptomatic and seizure free on levetiracetam and valproate .
our patient had unique presentation of symptomatic bradyarrythmia and autonomic dysfunction in the form of severe hypotension , perspiration following a generalized tonic seizure .
a more severe such event might have been fatal . although ictal bradyarrythmia have been documented in patients undergoing video - eeg , postictal symptomatic prolonged bradyarrythmia with hypotension is exceptional .
the possible risk factors associated with sudep are history of generalized seizures and frequent gtcs , severity of seizures , subtherapeutic aed levels , young adults , long duration of epilepsy , early onset of epilepsy , aed polytherapy , and intelligence quotient < 70 among others .
moreover , inter - ictal autonomic dysfunction have been documented in people especially those with uncontrolled seizures .
sudep has been defined as the sudden , unexpected , witnessed or unwitnessed , nontraumatic and nondrowning death of patients with epilepsy with or without evidence of a seizure , excluding documented status epilepticus , and in whom postmortem examination does not reveal a structural or toxic cause of death .
it has been difficult to precisely define the causes of sudep because most the reports are unwitnessed .
hypothesis regarding the causes of sudep are based on a synthesis of what is known from a small number of witnessed cases , information gathered at the scene of unwitnessed cases , and risk factors identified in epidemiological studies .
postictal central or obstructive apnea or a cardiac arrhythmia seems to represent the most likely mechanisms .
cardiac arrhythmogenesis in cryptogenic epilepsy could be due to ion channel dysfunction and may coexist in the same patient .
tachycardia is the commonest cardiac abnormality observed during seizures and fatal tachyarrhythmia is one plausible cause for sudep . tachyarrhythmia
reported a patient who developed ictal tachycardia during seizure while undergoing eeg recording and in immediate postictal period developed asystole for 31 seconds .
proposed mechanisms for this transient bradycardia include a direct effect of the seizure discharge or a response to apnea mediated by the cardiorespiratory reflex .
it is also possible that an autonomic dysfunction during seizure could result in a catecholaminergic surge causing slow av junctional rhythm .
other cardiac abnormalities , including supraventricular tachycardia , atrial fibrillation ( af ) and junctional rhythms , have been reported in patients undergoing video - eeg / ecg monitoring .
our patient had prolonged symptomatic postictal bradyarrythmia without any cardiac ischemia which recovered with supportive treatment .
however , it is likely that due to lack of continuous video - eeg / one lead ecg recording , an independent cardiac arrhythmia might have been missed .
reporting of such cases will increase awareness among treating physicians and thereby monitoring of such events , its early recognition and prompt treatment might prevent death . | ### Summary:
: we report an elderly man with chronic uncontrolled localization - related epilepsy on three aeds , who developed in - hospital symptomatic bradyarrythmia due to junctional atrio - ventricular ( av ) rhythm after an episode of generalized seizure during his hospital stay . on further evaluation ,
the cardiac enzymes were normal and 2d - echocardiogram showed mild left ventricular hypertrophy .
patient recovered from the same with supportive treatment within few hours .
we emphasize on importance of prompt recognition of this event and its implication including one of the mechanism for sudden unexplained death in epilepsy . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: a natural disaster may be defined as sudden ecological disruption or threat that exceeds the adjustment capacity of the affected community and requires external assistance ( 1 , 2 ) .
natural disasters include earthquakes , floods , tidal waves ( tsunamis ) , landslides , hurricanes , volcanic eruptions , as well as droughts ( 2 ) .
natural disasters result in immediate , significant loss of life and long - term physical impairments such as spinal cord injuries ( sci ) , traumatic brain injuries ( tbi ) , amputations , fractures , and peripheral nerve injuries ( 3 ) ; related mental health conditions including situational anxiety and post - traumatic stress disorder occur concomitantly ( 47 ) .
in addition to acute injuries , persons also suffer exacerbations of pre - existing chronic health problems and disabilities ( 811 ) .
though saving lives immediately after a natural disaster is the highest initial priority , the focus of the local and international medical response effort quickly shifts to the treatment of severe , traumatic injuries and related health problems ( 12 ) . from the perspective of health - related rehabilitation , the primary focus is the functioning of the surviving population . as defined by the world health organization 's ( who ) international classification of functioning , disability , and health ( icf ) ,
functioning is a dynamic interaction of the health and health - related domains of body functions and structures as well as
disability is an umbrella term for impairment in body functions or structures and limitation in activity and/or restriction in participation .
since an individual 's functioning and disability occurs within a larger social and individual context , the icf also includes environmental and personal factors ( 13 ) ( see fig .
, health - related rehabilitation is a major health strategy that focuses on the functioning ( i.e. functional status ) of persons with physical or mental disability and considers their resources and environment ( 14 , 15 ) . the who model of the international classification of functioning , disability , and health ( icf ) .
health - related rehabilitation begins with the onset of injury or disease and can extend over a lifetime , often involving treatment in the hospital , community , and home settings .
since a person 's functional needs require attention in the immediate living environment as well as in the greater community ( 15 ) , a range of activities including provision of accessible and appropriate home care ; housing ; transportation ; and educational , vocational , and social opportunities is necessary .
based on the person 's unique medical needs , health - related rehabilitation is best delivered by a multi - disciplinary team including , at a minimum , a specialist in physical and rehabilitation medicine ( prm ) , a physical therapist , an occupational therapist , and a rehabilitation nurse ( 16 ) . as an expert in disability and functioning who is also trained in the diagnosis and treatment of general health problems , the prm physician performs a critical role in integrating rehabilitation efforts with other health strategies and providers .
physical and occupational therapists trained in neurological and orthopedic rehabilitation perform indicated interventions ; a rehabilitation nurse provides overall medical case management ; the rehabilitation psychologist provides impairment and bereavement counseling and also connects the patient to psychosocial supports in the community especially critical when family members , relatives , and homes are lost ( 17 ) .
non - medical caregivers ideally become increasingly involved in the rehabilitation process as the person 's medical status and needs change .
their committed participation is essential for optimal outcomes and even survival , especially for the low functioning , highly dependent patient in the home setting .
this paper is based on a scientific literature review supplemented by secondary analysis of injury data as well as reports from the gray literature .
a qualitative literature review was conducted including searches of the internet - based , open access databases pubmed and google scholar .
due to high relevance to the role of health - related rehabilitation in disaster relief , searches were performed on the epidemiology of injury and disability in natural disaster , the impact of natural disasters on health and rehabilitation systems , and the assessment and measurement of disability due to natural disasters .
these lines of inquiry were chosen according to the key aspects of the microdis research program on health impacts of natural disaster ( 18 ) .
the who - sponsored emergency events database em - dat ( www.emdat.be ) served as the data source for numbers of injuries and deaths in natural disasters by year of event ( 19702010 ) , region , and country .
absolute numbers of injuries and deaths due to natural disasters of all kinds were extracted by year and region ( n=246 ) . as regards earthquakes , we also calculated ratios of injuries to deaths for each year and country ( n=568 ) ; cases in which no deaths were reported were excluded .
we compared these data along 10-year periods by analyses of variance . to test for statistical significance of differences in numbers of injuries , numbers of deaths , and injuries to death ratios between time periods
, we performed post hoc tests with dunnett 's t3 correction for multiple testing in the case of inhomogeneous variances between groups ( 19 ) .
the dunnett t3 correction is conservative in that the family wise error rate ( i.e. the error rate for the whole set of comparisons between groups ) will never exceed alpha . in the case of injuries and deaths due to all natural disasters
we supplemented the post hoc comparison of time periods with two negative binomial regressions of the number of injuries and deaths , respectively , on the year of the event . in the case of injuries to deaths ratios in earthquakes , we calculated a generalized estimated equation ( gee ) model , fitted to a negative binomial distribution , and using country as panel and year as time variable .
a qualitative literature review was conducted including searches of the internet - based , open access databases pubmed and google scholar .
due to high relevance to the role of health - related rehabilitation in disaster relief , searches were performed on the epidemiology of injury and disability in natural disaster , the impact of natural disasters on health and rehabilitation systems , and the assessment and measurement of disability due to natural disasters .
these lines of inquiry were chosen according to the key aspects of the microdis research program on health impacts of natural disaster ( 18 ) .
the who - sponsored emergency events database em - dat ( www.emdat.be ) served as the data source for numbers of injuries and deaths in natural disasters by year of event ( 19702010 ) , region , and country .
absolute numbers of injuries and deaths due to natural disasters of all kinds were extracted by year and region ( n=246 ) . as regards earthquakes , we also calculated ratios of injuries to deaths for each year and country ( n=568 ) ; cases in which no deaths were reported were excluded .
we compared these data along 10-year periods by analyses of variance . to test for statistical significance of differences in numbers of injuries , numbers of deaths , and injuries to death ratios between time periods
, we performed post hoc tests with dunnett 's t3 correction for multiple testing in the case of inhomogeneous variances between groups ( 19 ) .
the dunnett t3 correction is conservative in that the family wise error rate ( i.e. the error rate for the whole set of comparisons between groups ) will never exceed alpha . in the case of injuries and deaths due to all natural disasters
we supplemented the post hoc comparison of time periods with two negative binomial regressions of the number of injuries and deaths , respectively , on the year of the event . in the case of injuries to deaths ratios in earthquakes , we calculated a generalized estimated equation ( gee ) model , fitted to a negative binomial distribution , and using country as panel and year as time variable .
the incidence of morbidity and mortality caused by natural disasters is highly variable and depends upon many environmental and human factors ( 2022 ) .
earthquakes in the people 's republic of china from 2000 to 2009 , for instance , injured 387,829 persons ( 0.7% of all affected persons ) and killed 87,947 people ( 0.17% ) ( 22 ) .
a higher percentage of the affected population was injured ( 4.4% ) or killed ( 2.5% ) in the armenian earthquake of 1988 .
adolescents and persons aged 40 and older were disproportionately injured ; also , persons residing in taller buildings and higher within the buildings suffered higher incidences of injury ( 20 ) .
the 2010 earthquake in haiti injured about 300,000 ( 8.8% ) and killed 222,570 people ( 6.5% ) with 3,400,000 being affected ( 22 ) .
significant causes of this devastating effect include the proximity of the epicenter to the densely populated center of port - au - prince on a busy weekday afternoon and the low - quality concrete building construction .
conversely , in the united states earthquakes affected 30,619 persons from 2000 to 2009 ; 523 injuries ( 1.7% ) and only 3 deaths are reported ( 22 ) .
floods , by comparison , cause fewer injuries than earthquakes ; the recent flood in pakistan , for example , resulted in 2,327 injuries ( 0.00011% ) and 2,021 deaths ( 0.00010% ) reported ( 22 ) .
2 shows the absolute number of primary injuries reported globally across all natural disasters from 1970 to 2010 .
the asian continent is significant for an increase in the absolute number of reported injuries despite the fact that the population of the asia - pacific region has been growing more slowly than that of the rest of the world since 1990 , dropping from 1.5% in the early 1990s to 1.0% in 2008 ( 23 ) .
development of the absolute number of reported injuries ( logarithm to base 10 ) by year and world region from 1970 to 2010 over all types of natural disaster ; the solid line parallel to the abscissa means 100,000 injuries ( lg ( 100,000)=5 ) . source : own calculation based on data from www.emdat.be ; numbers of injuries were extracted by year and region . fig .
3 displays mean numbers of reported injuries and deaths due to all natural disasters in asia in 10-year periods since 1970 ; injuries are more prominent than deaths dating from 1980 to 1989 .
the following differences in mean numbers of injuries were statistically significant according to dunnett t3 post hoc tests : 19701979 versus 19901999 and 19801989 versus 19901999 .
no differences in mean numbers of death reached the level of significance ( see figs . 2 and 3 ) .
this result was confirmed by the two negative binomial regressions of the numbers of injuries and deaths , respectively , on year of event ( injuries : b year=0.064 ; p<0.001 ; deaths : b year=0.003 ; not significant ) . development of mean numbers of injuries and deaths due to all types of natural disaster from 1970 to 2010 in the asian continent ; error bars indicate 95% confidence intervals ( for mathematical reasons , confidence intervals for the period 1970 to 1979 reach below zero ) .
4 indicates the odds ratio of sustaining injury compared to death in earthquakes globally since 1970 ; the increasing odds of injury over time may be due to both , advances in natural disaster response and changes in definitions of injury , measurement , or reporting of data .
the following differences were statistically significant according to dunnett t3 post hoc tests : 19701979 versus all other periods ; 19801989 versus 20002011 .
it is important to note that results may be different if other time periods were chosen .
however , a significant trend regarding an increase in the ( odds ) ratio of injuries to deaths over time was also confirmed by the gee model ( b year=0.049 , p<0.001 ) ( see fig .
4 ) . odds ratio of being injured in an earthquake in relation to death from 1970 to 2011 ( january ) and over all continents ; error bars indicate 95% confidence intervals .
data on types of disaster - induced injury and potentially disabling conditions are less available and mostly derived from chart reviews of individual hospitals as opposed to multi - center or population - based studies ( 24 ) .
major and potentially disabling injuries after natural disasters that have been documented include sci , tbi , limb amputation , long bone fractures , crush injuries , and peripheral nerve injuries ( 2530 ) .
minor injuries include conditions such as swollen feet and legs , leg pain and cramps , tendonitis / fasciitis , wound infections , and musculoskeletal strain and pain ( 3134 ) .
reliable data on the distribution of these injury types in disaster - affected populations are widely unavailable.key concepts such as definitions , even conventional , that describe the population exposed to death and injury from earthquakes have yet to be established . as a result , not only are results from different studies not comparable , denominators are inadequate even within a study , making rates and ratios suspect .
( 35 )
key concepts such as definitions , even conventional , that describe the population exposed to death and injury from earthquakes have yet to be established . as a result , not only are results from different studies not comparable , denominators are inadequate even within a study , making rates and ratios suspect .
( 35 ) various sources of bias in recording of injury data exist as well .
studies reflect findings in individuals who present for care at medical facilities , largely excluding those who do not , for example ; even more significantly , functional health outcomes and long - term disability measures are seldom collated for analysis even if performed .
finally , aggregate population injury is rarely systematically assessed at the time of disaster when its knowledge could potentially have the most impact .
persons with pre - existing physical disabilities and those with chronic physical and mental health conditions as well as very young and old people are at increased risk for suffering additional co - morbidities as a result of a natural disaster .
even when evacuated safely , the loss of medications , assistive devices , and support personnel can worsen the condition of these vulnerable persons and further impair their overall functioning and quality of life ( 10 , 36 , 37 ) . moreover , these persons often have greater difficulty meeting basic needs following a natural disaster since adequate transportation and sheltering are often not included in local disaster response plans ( 9 , 11 ) .
compromised basic and specialty medical care following a natural disaster also increases risk of medical complications including infection , organ failure , and even death ( 3840 ) .
according to a study after the great hanshin - awaji earthquake in 1995 , it was found that the odds ratio ( or ) of death for persons with pre - existing physical disabilities nearly doubled ( 41 ) ; a similar study after the taiwanese earthquake in 1999 ( 40 ) found that the or was 1.7 for deaths of persons with pre - existing moderate physical disability and doubled for persons with pre - existing mental conditions .
there are few studies that evaluate the effectiveness of rehabilitation interventions following a natural disaster .
since prospective , randomized controlled trials of specific interventions following disaster are not feasible , retrospective analyses of hospital cohorts , observational studies , and surveys are performed to measure the clinical impact of physical rehabilitation on disaster - induced disability .
for example , it was demonstrated following the 2005 earthquake in pakistan that patients under the care of prm physicians had reduced lengths of hospital stay , fewer complications , and better clinical outcomes than patients in centers with no physiatrist supervision ( 42 , 43 ) .
conversely , it was noted that although early rehabilitation of sci survivors in major provincial hospitals following the 2008 sichuan earthquake showed generally positive results , post - discharge follow - up resulted in a reverse of functional gains as well as secondary complications in some patients due primarily to insufficient long - term , community - based rehabilitation ( cbr ) resources ( 44 ) .
the incidence of morbidity and mortality caused by natural disasters is highly variable and depends upon many environmental and human factors ( 2022 ) .
earthquakes in the people 's republic of china from 2000 to 2009 , for instance , injured 387,829 persons ( 0.7% of all affected persons ) and killed 87,947 people ( 0.17% ) ( 22 ) .
a higher percentage of the affected population was injured ( 4.4% ) or killed ( 2.5% ) in the armenian earthquake of 1988 .
adolescents and persons aged 40 and older were disproportionately injured ; also , persons residing in taller buildings and higher within the buildings suffered higher incidences of injury ( 20 ) .
the 2010 earthquake in haiti injured about 300,000 ( 8.8% ) and killed 222,570 people ( 6.5% ) with 3,400,000 being affected ( 22 ) .
significant causes of this devastating effect include the proximity of the epicenter to the densely populated center of port - au - prince on a busy weekday afternoon and the low - quality concrete building construction .
conversely , in the united states earthquakes affected 30,619 persons from 2000 to 2009 ; 523 injuries ( 1.7% ) and only 3 deaths are reported ( 22 ) .
floods , by comparison , cause fewer injuries than earthquakes ; the recent flood in pakistan , for example , resulted in 2,327 injuries ( 0.00011% ) and 2,021 deaths ( 0.00010% ) reported ( 22 ) .
2 shows the absolute number of primary injuries reported globally across all natural disasters from 1970 to 2010 .
the asian continent is significant for an increase in the absolute number of reported injuries despite the fact that the population of the asia - pacific region has been growing more slowly than that of the rest of the world since 1990 , dropping from 1.5% in the early 1990s to 1.0% in 2008 ( 23 ) .
development of the absolute number of reported injuries ( logarithm to base 10 ) by year and world region from 1970 to 2010 over all types of natural disaster ; the solid line parallel to the abscissa means 100,000 injuries ( lg ( 100,000)=5 ) . source : own calculation based on data from www.emdat.be ; numbers of injuries were extracted by year and region . fig .
3 displays mean numbers of reported injuries and deaths due to all natural disasters in asia in 10-year periods since 1970 ; injuries are more prominent than deaths dating from 1980 to 1989 .
the following differences in mean numbers of injuries were statistically significant according to dunnett t3 post hoc tests : 19701979 versus 19901999 and 19801989 versus 19901999 .
no differences in mean numbers of death reached the level of significance ( see figs . 2 and 3 ) .
this result was confirmed by the two negative binomial regressions of the numbers of injuries and deaths , respectively , on year of event ( injuries : b year=0.064 ; p<0.001 ; deaths : b year=0.003 ; not significant ) . development of mean numbers of injuries and deaths due to all types of natural disaster from 1970 to 2010 in the asian continent ; error bars indicate 95% confidence intervals ( for mathematical reasons , confidence intervals for the period 1970 to 1979 reach below zero ) .
4 indicates the odds ratio of sustaining injury compared to death in earthquakes globally since 1970 ; the increasing odds of injury over time may be due to both , advances in natural disaster response and changes in definitions of injury , measurement , or reporting of data .
the following differences were statistically significant according to dunnett t3 post hoc tests : 19701979 versus all other periods ; 19801989 versus 20002011 .
it is important to note that results may be different if other time periods were chosen .
however , a significant trend regarding an increase in the ( odds ) ratio of injuries to deaths over time was also confirmed by the gee model ( b year=0.049 , p<0.001 ) ( see fig .
4 ) . odds ratio of being injured in an earthquake in relation to death from 1970 to 2011 ( january ) and over all continents ; error bars indicate 95% confidence intervals .
data on types of disaster - induced injury and potentially disabling conditions are less available and mostly derived from chart reviews of individual hospitals as opposed to multi - center or population - based studies ( 24 ) . consequently , disability in the community in developing regions is relatively unstudied .
major and potentially disabling injuries after natural disasters that have been documented include sci , tbi , limb amputation , long bone fractures , crush injuries , and peripheral nerve injuries ( 2530 ) .
minor injuries include conditions such as swollen feet and legs , leg pain and cramps , tendonitis / fasciitis , wound infections , and musculoskeletal strain and pain ( 3134 ) .
reliable data on the distribution of these injury types in disaster - affected populations are widely unavailable.key concepts such as definitions , even conventional , that describe the population exposed to death and injury from earthquakes have yet to be established . as a result , not only are results from different studies not comparable , denominators are inadequate even within a study , making rates and ratios suspect .
( 35 )
key concepts such as definitions , even conventional , that describe the population exposed to death and injury from earthquakes have yet to be established . as a result , not only are results from different studies not comparable , denominators are inadequate even within a study , making rates and ratios suspect .
( 35 ) various sources of bias in recording of injury data exist as well .
studies reflect findings in individuals who present for care at medical facilities , largely excluding those who do not , for example ; even more significantly , functional health outcomes and long - term disability measures are seldom collated for analysis even if performed .
finally , aggregate population injury is rarely systematically assessed at the time of disaster when its knowledge could potentially have the most impact .
persons with pre - existing physical disabilities and those with chronic physical and mental health conditions as well as very young and old people are at increased risk for suffering additional co - morbidities as a result of a natural disaster .
even when evacuated safely , the loss of medications , assistive devices , and support personnel can worsen the condition of these vulnerable persons and further impair their overall functioning and quality of life ( 10 , 36 , 37 ) .
moreover , these persons often have greater difficulty meeting basic needs following a natural disaster since adequate transportation and sheltering are often not included in local disaster response plans ( 9 , 11 ) .
compromised basic and specialty medical care following a natural disaster also increases risk of medical complications including infection , organ failure , and even death ( 3840 ) .
according to a study after the great hanshin - awaji earthquake in 1995 , it was found that the odds ratio ( or ) of death for persons with pre - existing physical disabilities nearly doubled ( 41 ) ; a similar study after the taiwanese earthquake in 1999 ( 40 ) found that the or was 1.7 for deaths of persons with pre - existing moderate physical disability and doubled for persons with pre - existing mental conditions .
there are few studies that evaluate the effectiveness of rehabilitation interventions following a natural disaster .
since prospective , randomized controlled trials of specific interventions following disaster are not feasible , retrospective analyses of hospital cohorts , observational studies , and surveys are performed to measure the clinical impact of physical rehabilitation on disaster - induced disability .
for example , it was demonstrated following the 2005 earthquake in pakistan that patients under the care of prm physicians had reduced lengths of hospital stay , fewer complications , and better clinical outcomes than patients in centers with no physiatrist supervision ( 42 , 43 ) .
conversely , it was noted that although early rehabilitation of sci survivors in major provincial hospitals following the 2008 sichuan earthquake showed generally positive results , post - discharge follow - up resulted in a reverse of functional gains as well as secondary complications in some patients due primarily to insufficient long - term , community - based rehabilitation ( cbr ) resources ( 44 ) .
the significant negative health consequences of natural disasters usually overwhelm the affected society including the health system ( 45 ) , especially in low - resourced regions of the world where most natural disasters occur ( 46 ) .
moreover , health professionals and their families may be affected themselves , thereby limiting medical facility and professional organization response as well as disrupting overall societal function ( 47 ) .
destruction or weakening of pre - existing rehabilitation services translates into minimal rehabilitative strategy being practiced during the immediate emergency response , further burdening an already challenged post - disaster health system .
poor functional outcomes and long - term negative consequences for the individual , community , and society result . the unexpected death or disability of an earning family member , for instance
efficient use of rehabilitative strategies will not only help unburden the challenged health system by mobilizing patients , but will also facilitate recovery of the post - disaster society by facilitating victims access to education and employment opportunities .
regrettably , the provision of rehabilitative services is extremely limited during the immediate emergency response due to surgical bias of responding teams and the general lack of rehabilitation knowledge of team members .
the lack of host rehabilitation and health services infrastructure compounds the lack of rehabilitation perspective ; often few or no rehabilitation services or professional providers , especially prm physicians , exist in areas affected by natural disasters ( 10 , 4850 ) . to compensate for this lack of expertise ,
foreign rehabilitation responders can provide focused training to fellow team members as well as to local rehabilitation and non - rehabilitation providers in the field , hospital , and community settings throughout the disaster response .
ideally , rehabilitation providers participate in victim triage , consult peri - operatively , and assist with post - operative care .
lack of rehabilitation expertise post - operatively , for example , can result in pressure sores and wound infections in mobility - limited persons ( 10 ) . in an extreme case ,
sci patients were found to be waiting for a cure and had not begun rehabilitative measures 8 months after the 2003 earthquake in bam , iran ( 52 ) . missed critical , injury - specific therapeutic windows result in longer hospital lengths of stay and translate to suboptimal functional outcomes with long - term negative consequences for the individual and the society ( 36 ) . besides making critically needed hospital beds available , effective rehabilitative strategies also help return family members to work producing income to sustain the family and reconstruct the post - disaster society .
foreign responding organizations with rehabilitation personnel face significant challenges to effective deployment within the disaster zone .
individual rehabilitation providers must be properly qualified , the team deployment - ready , travel arranged , and on - scene assignment confirmed with the host country responsible organization(s ) . on arrival in the host country ,
even if effectively deployed , however , international service providers must be aware that rehabilitation service coordination between the host organization , local disabled persons organizations ( dpos ) , the central disaster rehabilitation response authority , and collaborating rehabilitation non - governmental organizations ( ngos ) may be limited ( 3 , 48 , 53 ) . unfortunately , since
cross - cutting issue ( 54 ) within the humanitarian response framework ( i.e. as opposed to specifically identified areas of coordination including
food, education, and health ) , disability issues appear at risk for more inefficient communication , coordination , and resource allocation ( 55 ) . consequently , responding foreign teams must assume responsibility for coordinating directly with other rehabilitation providers to ensure that appropriate interventions are performed in the acute care setting initially and subsequently in community follow - up . also , closely held cultural beliefs about health - related rehabilitation and disability ( 36 , 52 ) sometimes limit the potential impact of rehabilitative services .
often , disability is viewed as a static rather than as a dynamic condition ( 56 ) .
for example , in many low - resourced countries it is believed that persons with permanent impairments such as sci will depend on their families and be an object of charity their entire life .
disability is alsocommonly believed to be contagious and therefore to affect the entire family ( 54 , 57 ) .
severe traumatic injuries sustained in a natural disaster require specialized management from the onset to reduce mortality and morbidity and to optimize individual functioning including social participation .
both tbi and sci victims require immediate evacuation from the disaster zone to tertiary care facilities as opposed to nearby temporary shelters , field hospitals , or community hospitals .
spinal cord patients require specialized transport / transfer protocols and expert consultation for decision - making on definitive management ( conservative vs. surgical ) ( 48 , 49 ) .
once stabilized and managed in the appropriate inpatient setting , these patients can be transferred to either a less acute care setting or to their home where they will benefit from treatment provided by their caregiver , a community - based facility , or a mobile rehabilitation service depending on specific needs .
these services would also identify and treat disaster victims who may not have received care as well as those with pre - existing disability who could benefit from rehabilitative therapies .
optimal rehabilitative and medical care initiated following a natural disaster , however , results in a higher incidence of survivors with a significant physical disability ( i.e. sci ) that can require significant long - term rehabilitative care .
patients can be trained in the use adaptive technologies , assistive devices , and mobility aids depending on their level of functional need .
medical equipment , however , must be compatible with the technological standards and physical environment of the affected community ( 58 ) ; powered wheelchairs are difficult to operate and maintain in developing countries , for example ( 59 ) .
regrettably , the provision of rehabilitative services is extremely limited during the immediate emergency response due to surgical bias of responding teams and the general lack of rehabilitation knowledge of team members .
the lack of host rehabilitation and health services infrastructure compounds the lack of rehabilitation perspective ; often few or no rehabilitation services or professional providers , especially prm physicians , exist in areas affected by natural disasters ( 10 , 4850 ) . to compensate for this lack of expertise ,
foreign rehabilitation responders can provide focused training to fellow team members as well as to local rehabilitation and non - rehabilitation providers in the field , hospital , and community settings throughout the disaster response .
ideally , rehabilitation providers participate in victim triage , consult peri - operatively , and assist with post - operative care .
lack of rehabilitation expertise post - operatively , for example , can result in pressure sores and wound infections in mobility - limited persons ( 10 ) . in an extreme case ,
sci patients were found to be waiting for a cure and had not begun rehabilitative measures 8 months after the 2003 earthquake in bam , iran ( 52 ) . missed critical , injury - specific therapeutic windows result in longer hospital lengths of stay and translate to suboptimal functional outcomes with long - term negative consequences for the individual and the society ( 36 ) . besides making critically needed hospital beds available
, effective rehabilitative strategies also help return family members to work producing income to sustain the family and reconstruct the post - disaster society .
foreign responding organizations with rehabilitation personnel face significant challenges to effective deployment within the disaster zone .
individual rehabilitation providers must be properly qualified , the team deployment - ready , travel arranged , and on - scene assignment confirmed with the host country responsible organization(s ) . on arrival in the host country ,
even if effectively deployed , however , international service providers must be aware that rehabilitation service coordination between the host organization , local disabled persons organizations ( dpos ) , the central disaster rehabilitation response authority , and collaborating rehabilitation non - governmental organizations ( ngos ) may be limited ( 3 , 48 , 53 ) .
cross - cutting issue ( 54 ) within the humanitarian response framework ( i.e. as opposed to specifically identified areas of coordination including food, education, and health ) , disability issues appear at risk for more inefficient communication , coordination , and resource allocation ( 55 ) .
consequently , responding foreign teams must assume responsibility for coordinating directly with other rehabilitation providers to ensure that appropriate interventions are performed in the acute care setting initially and subsequently in community follow - up .
also , closely held cultural beliefs about health - related rehabilitation and disability ( 36 , 52 ) sometimes limit the potential impact of rehabilitative services .
often , disability is viewed as a static rather than as a dynamic condition ( 56 ) .
for example , in many low - resourced countries it is believed that persons with permanent impairments such as sci will depend on their families and be an object of charity their entire life .
disability is alsocommonly believed to be contagious and therefore to affect the entire family ( 54 , 57 ) .
severe traumatic injuries sustained in a natural disaster require specialized management from the onset to reduce mortality and morbidity and to optimize individual functioning including social participation .
both tbi and sci victims require immediate evacuation from the disaster zone to tertiary care facilities as opposed to nearby temporary shelters , field hospitals , or community hospitals .
spinal cord patients require specialized transport / transfer protocols and expert consultation for decision - making on definitive management ( conservative vs. surgical ) ( 48 , 49 ) .
once stabilized and managed in the appropriate inpatient setting , these patients can be transferred to either a less acute care setting or to their home where they will benefit from treatment provided by their caregiver , a community - based facility , or a mobile rehabilitation service depending on specific needs .
these services would also identify and treat disaster victims who may not have received care as well as those with pre - existing disability who could benefit from rehabilitative therapies .
optimal rehabilitative and medical care initiated following a natural disaster , however , results in a higher incidence of survivors with a significant physical disability ( i.e. sci ) that can require significant long - term rehabilitative care .
patients can be trained in the use adaptive technologies , assistive devices , and mobility aids depending on their level of functional need .
medical equipment , however , must be compatible with the technological standards and physical environment of the affected community ( 58 ) ; powered wheelchairs are difficult to operate and maintain in developing countries , for example ( 59 ) .
significant injuries and associated surgical and rehabilitative care are often poorly documented during the immediate response to a natural disaster due to the emergent focus on saving and salvaging lives amidst chaotic , austere conditions .
the loss of host facilities and personnel combined with the influx of international teams with varying recordkeeping practices can compromise recordkeeping further .
even well - established teams , however , may maintain substandard records and not provide them to receiving facilities on transfer or to patients upon discharge unless directly instructed by the host institution or government .
independently functioning international teams that do keep adequate records may not provide them to the national hosts on departure .
this fragmentation and inconsistency of medical recordkeeping compromises surgical - rehabilitation continuity of care , especially as patients are transferred to the community , resulting in poorer patient outcomes .
incomplete medical recordkeeping also limits further analysis since epidemiological data of post - disaster injury is usually extracted from individual hospital chart reviews and therefore may not accurately represent the affected population .
( also , facility records only reflect injured persons who present for care , as indicated earlier . )
consequently , comprehensive data following a natural disaster from which long - term delivery of rehabilitative services can be planned is not generally available . compounding incomplete disaster baseline and vital statistics , measurement of the impact of disaster - induced disability
the disability adjusted life year ( daly ) is the main indicator of cost - effectiveness of risk control measures and widely used by who and the world bank ( 60 ) ; however , its use is limited in national health services .
the dalys are based on an individual 's underlying medical diagnosis and therefore they do not reflect the change in functional status or well - being due to rehabilitation services . moreover , dalys may be unreliable since they do not adjust for personal or environmental factors ( 61 , 62 ) . other functional status measures ( 63 ) such as the functional independence measure ( fim ) ( 64 , 65 ) are employed in research and clinical settings .
unfortunately , their use is generally restricted to the inpatient setting in developed countries and field use is impractical as these instruments require trained administration and are time - consuming to administer .
moreover , their inter - cultural validity as well as suitability for largely illiterate populations is questionable , indicating use of language independent assessment tools ( 66 ) . to answer the call for more effective assessment of the impact of rehabilitative interventions on the lives of persons with disabilities ,
several measures have been proposed based on the who 's international classification of functioning , disability , and health ( icf ) .
the who disability assessment schedule ( whodas 2.0 ) is an example of open resource instrument that can be used in population surveys ( 67 ) .
regardless of what measure and indicators are developed , however , the humanitarian health community must readily adopt these evidence - based approaches in order to better measure the impact of its rehabilitation programming and to reduce the delayed health impact on the affected population ( 68 ) .
system impacts of disability and rehabilitation after a natural disaster can foreseeably be modeled with cost - effectiveness analyses ( cea ) .
these ceas are economic evaluations widely used in developed countries to assess the relative value of one intervention over another for a given problem or condition .
their use in developing countries is relatively uncommon , although who has published standard guidelines for ceas .
one present rehabilitation - related use in the post - trauma setting is that of physiotherapy associated with evaluation of an orthopedic procedure ( 69 ) .
a wider use of existing measurement and assessment measures in addition to the development of new ones is required to more effectively measure the impact of physical rehabilitation strategies on disaster - induced disability in individuals and populations following a natural disaster .
this focused review has examined the role of health - related rehabilitation in disaster relief in terms of the epidemiology of injury and disability in natural disasters , the impact of natural disasters on health and rehabilitation systems , and the assessment of disability due to natural disasters . selected challenges to and
strategies for providing health - related rehabilitation following a natural disaster were addressed . although significant mortality , severe disabling injuries , and long - term disability have been demonstrated in natural disasters , health - related rehabilitation is only marginally employed as a disaster planning and response strategy .
the necessity of more comprehensive baseline disaster disability statistics and more effective measurement of rehabilitation outcomes in disaster is emphasized . this focused review is intended to guide further inquiry into the role of health - related rehabilitation in disaster relief with the aim of strengthening the rehabilitation perspective in the response to natural disaster .
the authors have not received any funding or benefits from industry or elsewhere to conduct this study . | ### Summary:
: backgroundnatural disasters result in significant numbers of disabling impairments .
paradoxically , however , the traditional health system response to natural disasters largely neglects health - related rehabilitation as a strategic intervention.objectivesto examine the role of health - related rehabilitation in natural disaster relief along three lines of inquiry : ( 1 ) epidemiology of injury and disability , ( 2 ) impact on health and rehabilitation systems , and ( 3 ) the assessment and measurement of disability.designqualitative literature review and secondary data analysis.resultsabsolute numbers of injuries as well as injury to death ratios in natural disasters have increased significantly over the last 40 years .
major impairments requiring health - related rehabilitation include amputations , traumatic brain injuries , spinal cord injuries ( sci ) , and long bone fractures .
studies show that persons with pre - existing disabilities are more likely to die in a natural disaster .
lack of health - related rehabilitation in natural disaster relief may result in additional burdening of the health system capacity , exacerbating baseline weak rehabilitation and health system infrastructure .
little scientific evidence on the effectiveness of health - related rehabilitation interventions following natural disaster exists , however .
although systematic assessment and measurement of disability after a natural disaster is currently lacking , new approaches have been suggested.conclusionhealth-related rehabilitation potentially results in decreased morbidity due to disabling injuries sustained during a natural disaster and is , therefore , an essential component of the medical response by the host and international communities .
significant systematic challenges to effective delivery of rehabilitation interventions during disaster include a lack of trained responders as well as a lack of medical recordkeeping , data collection , and established outcome measures .
additional development of health - related rehabilitation following natural disaster is urgently required . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: diffuse large b - cell lymphoma ( dlbcl ) is the most common lymphoid malignancy worldwide .
its incidence increases with age and about 40% of cases occur in patients over 70 years .
herein , we describe a case of a frail elderly patient with renal insufficiency and dlbcl treated with r - mini - chop .
the patient was assigned clinical stage iibx , with a high age - adjusted international prognosis index .
thus , an adapted chemotherapy regimen was proposed which consisted of r - mini - chop every 21 days , with a reduction of 10% in the doses of doxorubicin and cyclophosphamide . during the treatment , the patient went through regular dialysis sessions , 3 times per week , with an extra session performed 12 h after each chemotherapy administration .
after 6 cycles of r - mini - chop , the patient achieved unconfirmed complete remission , and consolidation radiotherapy was performed . at the last follow - up , he was still in unconfirmed complete remission , with a progression - free survival of 11.3 months .
r - mini - chop represented a reasonable treatment option for this patient with renal failure .
the oncogeriatric approach led to a successful management of this frail patient , highlighting that an adapted plan of care is a key issue to improve the outcomes of elderly cancer patients .
life expectancy has grown over the last decades , and further increases are projected . by the year 2030 , the population older than 75 years will be multiplied by three , and of those over 85 years of age there will be twice as many as today . considering that ageing is associated with an increment in cancer incidence , a specific approach will be required to deal with these patients . diffuse large b - cell lymphoma ( dlbcl ) is the most common lymphoid malignancy worldwide .
its incidence increases with age and about 40% of cases occur in patients over 70 years .
the prognosis of elderly patients with lymphoma is worse when compared to their younger counterparts , particularly for those with aggressive subtypes , as a consequence of the difficulties encountered during treatment and even before choosing the adequate treatment . as a result of these factors , and sometimes simply because of their age , elderly lymphoma patients are often treated with regimens with low doses of standard chemotherapeutics or less toxic but also less active drugs .
similarly , tolerance to treatment is also affected by physiological changes related to ageing , such as declining renal function . as expected
, there is a paucity of data on the management of cancer patients with renal impairment , and the treatment approach to non - hodgkin 's lymphoma patients undergoing maintenance hemodialysis ( hd ) is a challenging concern .
nevertheless , several trials show that a treatment with curative intent is still possible in elderly patients , and adapted chemotherapy can offer long life expectancy [ 4 , 5 , 6 ] .
peyrade et al . , in a prospective trial of the groupe d'etude des lymphomes de l'adulte ( gela ) , proposed an attenuated regimen of treatment based on the classic chemotherapy regimen r - chop , the so - called r - mini - chop , as standard treatment for elderly lymphoma patients with good performance status .
there is little data regarding the management of frail elderly patients with dlbcl , and even less is known about the treatment of such patients in hd .
thus , we describe a case of a frail 77-year - old patient with renal insufficiency and dlbcl treated with an attenuated immunochemotherapy after an adapted care plan guided by a comprehensive geriatric assessment ( cga ) .
a 77-year - old man , on maintenance hd for 4 years , started experiencing persistent fatigue .
his physical examination was unremarkable and the imaging workup with a chest tomography revealed a heterogeneous 8.3 9.8 cm mass on the left upper lobe of the lung , as well as mediastinal lymph nodes .
a biopsy was done and pathology demonstrated dlbcl , cd20 positive , ki67 95% . after staging with an fdg pet / ct ( positron - emission tomography with 2-[fluorine-18]-fluoro-2-deoxy - d - glucose ) , the patient was assigned clinical stage iibx ( fig .
1 ) , with a high age - adjusted international prognosis index . in order to evaluate the functional status of the patient ,
a cga was performed and brought up multiple comorbidities ( long - lasting hypertension , chronic arterial vasculopathy , end - stage renal disease , depression and osteoarthrosis of the knee and elbows ) , polypharmacy , an increased risk for falls due to the osteoarthrosis and medications used , minimal dependency for activities of daily living ( difficulty only in transferring ) and significant dependency for instrumental activities of daily living , only being able to use the telephone without help , with a score of 11 .
his performance status was graded as 2 , and we found a cirs - g ( cumulative illness rating scale geriatric ) score of 9 and a severity index of 3 .
the mini - nutritional assessment denoted a risk for malnutrition , with a body mass index of 23 and albumin of 4 g / dl at diagnosis .
furthermore , the sof ( study of osteoporotic fractures ) frailty score was positive the patient was unable to rise from a chair 5 times without using the arms , and he reported a reduced energy level . in respect to psychosocial aspects , his social support and
caregivers were his wife and son , and no distress factors were identified among them .
good , in a scale with options between excellent , good , fair and poor . in summary ,
information from the cga and the results of the sof index indicated that we were dealing with a frail patient . nevertheless , we believed that , with geriatric intervention , nutritional monitoring and physiotherapy , the patient could tolerate a tailored treatment .
after proper evaluation of cardiac function , an adapted chemotherapy regimen was proposed which consisted of r - mini - chop every 21 days , with the following doses : 375 mg / m rituximab , 25 mg / m doxorubicin , 400 mg / m cyclophosphamide and 1 mg vincristine on day 1 of each cycle and 40 mg / m oral prednisone on days 15 .
additionally , doses of doxorubicin and cyclophosphamide were reduced by 10% , following directions of dose adjustment in elderly cancer patients with renal insufficiency . during the treatment
although no drugs in this chemotherapy scheme are significantly removed by the hd , an extra session was performed 12 h after each chemotherapy administration in order to improve drug tolerance .
prophylactic granulocyte colony - stimulating factor was not given ; hematologic toxicity was accessed every other week with complete blood cell counts .
the patient had a good tolerance to the treatment , with no adverse events and/or grade 3/4 toxicities .
after 6 cycles of r - mini - chop , the patient achieved unconfirmed complete remission ( fig .
two months after completion of radiotherapy , the patient presented with mild congestive heart failure , functional class ii . at the last follow - up , he was still in unconfirmed complete remission , with a progression - free survival of 11.3 months and no further deterioration of his previous functional status .
lymphoma in elderly patients is a common clinical scenario , although the optimal therapeutic approach to such patients has not been established .
moreover , the main challenge of this case was how to choose a suitable treatment for a frail older patient undergoing hd .
foremost , as a guide to the decision - making process , the geriatric assessment played a central role in understanding our patient 's functional reserve and social support .
the cga is a tool developed by geriatricians to evaluate the elderly exploring the functional status , emotional conditions , social support , nutritional status , polypharmacy and the presence of geriatric syndromes . with the data provided by the cga
, oncologists possess relevant information about the physiological status of the patient , which helps to avoid subjective decisions of who should or should not be treated based only on chronological age . a major issue encountered by oncologists treating older cancer patients is how to select patients suitable for standard or attenuated therapy . regarding this , the recognition of a frail person is of critical importance .
definition of frailty is controversial , and the most accepted description is the one proposed by fried et al . , derived from the cardiovascular health study ( chs ) , in which 3 or more of the following 5 components have to be present : unintentional weight loss , self - reported reduced energy level , reduced grip strength , slow walking speed and a low level of physical activity .
the chs index , however , is a complex and time - consuming method and other scales are often used to screen frailty .
thus , a practical clinical tool commonly used is the sof index , in which frailty is identified by the presence of 2 or more of the following 3 items : weight loss , the subject 's inability to rise from a chair 5 times without using the arms , and reduced energy level .
thus , our patient was at increased risk of toxicities , requiring an oncogeriatric management and tailored treatment plan . referring to the burden of comorbidities on treatment selection , another capital concern about this case
was related to the patient 's chronic renal failure , as few data is available about the management of such patients undergoing chemotherapy .
pharmacokinetic studies on rituximab in patients with end - stage renal disease demonstrated that this agent is not eliminated by dialysis .
similarly , the use of vincristine is safe in severe renal failure ( < 30 ml / min ) , with no need for dose adjustment . on the other hand ,
doxorubicin 's main active metabolite ( doxorubicinol ) is not predominantly eliminated by the urinary tract ( 10% ) , not requiring dose adjustment
. currently , there are no guidelines for dose adjustment of doxorubicin in renal impairment , but janus et al
. suggest that the drug should be administered on the day without hd or after it .
as regards cyclophosphamide , between 30 and 60% of its dose is eliminated by the kidneys as the drug itself or as its metabolites and , consequently , its pharmacokinetics can be modified in renal insufficiency patients .
hence , it is suggested to reduce the dose of cyclophosphamide by 25% in hd patients and to deliver the drug after hd sessions .
janus et al . also suggest the use of partial dialysis removal to improve drug tolerance , recommending starting hd sessions at a certain time following chemotherapy to remove the drugs that have not been distributed to the site of action and could generate side effects .
based on this rationale , we judged it reasonable to submit our patient to an extra hd session 12 h after each chemotherapy cycle .
indeed , the patient experienced no hematological toxicity related to the treatment . given the previously exposed clinical scenario about this patient 's functional status and comorbidities , he could have been considered only for best supportive care or palliative chemotherapy .
nonetheless , as we were the first to present a case of dlbcl , a malignancy with a high chance of response to treatment and cure , and supported by the geriatric intervention , we decided to start treatment with curative intent .
indeed , lymphoma in elderly patients is not less responsive to treatment than in younger patients , and the major issue is to choose the adequate chemotherapy and to achieve a long - lasting complete response . in a randomized trial by the gela group in patients aged 6080 years
, the combination of chop and rituximab was significantly superior to chop alone in terms of complete response and survival . in 2011 ,
the same group studied the efficacy of a low - dose chop regimen and rituximab ( r - mini - chop ) , in a prospective study with patients older than 80 years with dlbcl , achieving a 2-year overall survival of 59% and a 2-year progression - free survival of 47% , with 62% of the patients achieving a complete or unconfirmed complete response rate .
the great balance between efficacy and safety of this attenuated immunochemotherapy guided the decision to choose r - mini - chop to treat our patient ; in addition , we implemented a reduction of 10% in doxorubicin and cyclophosphamide doses .
probably , the choice of an anthracycline - containing regimen was essential to achieve a good outcome in our patient , as shown in other series [ 3 , 5 , 6 ] . however , a great concern refers to the cardiotoxicity related to anthracyclines . in the study of peyrade et al . , r - mini - chop in elderly patients was associated with a 6% rate of serious cardiac adverse events .
additional data shows that the risk of developing congestive heart failure after 8 years for an elderly patient receiving an anthracycline dose of 2535 mg / m per cycle , repeated for 6 cycles , is only marginal .
nevertheless , our patient developed congestive heart failure , functional class ii , although we can not warrant that it was strictly related to doxorubicin , given other concomitant risk factors were also present ( long - lasting hypertension , chronic arterial vasculopathy , end - stage renal disease and radiotherapy ) .
for patients with known altered cardiac function , alternative regimens such as cop ( cyclophosphamide , vincristine and prednisone ) are reasonable , although their response rates are low .
when planning the chemotherapy regimen , it is essential to question if there really is any contraindication to the use of chop - based regimens , as patients not treated with chop have a worse survival and a higher death rate from lymphoma . in conclusion
, r - mini - chop represented a reasonable treatment option for this senior adult with renal failure , with good disease control and no relevant hematological toxicity .
the information from the cga and an oncogeriatric approach led to a successful management of this frail patient , highlighting that an adapted plan of care is a key issue to improve outcomes of elderly cancer patients . | ### Summary:
: purpose of the studydiffuse large b - cell lymphoma ( dlbcl ) is the most common lymphoid malignancy worldwide .
its incidence increases with age and about 40% of cases occur in patients over 70 years .
herein , we describe a case of a frail elderly patient with renal insufficiency and dlbcl treated with r-mini-chop.case reporta 77-year - old man on maintenance hemodialysis started experiencing persistent fatigue .
he was diagnosed with a large mass on the left lobe of the lung .
biopsy demonstrated a dlbcl , cd20 positive .
the patient was assigned clinical stage iibx , with a high age - adjusted international prognosis index .
a proper geriatric assessment revealed a frail patient .
thus , an adapted chemotherapy regimen was proposed which consisted of r - mini - chop every 21 days , with a reduction of 10% in the doses of doxorubicin and cyclophosphamide . during the treatment
, the patient went through regular dialysis sessions , 3 times per week , with an extra session performed 12 h after each chemotherapy administration .
the patient experienced no adverse events or grade 3/4 toxicities .
after 6 cycles of r - mini - chop , the patient achieved unconfirmed complete remission , and consolidation radiotherapy was performed . at the last follow - up , he was still in unconfirmed complete remission , with a progression - free survival of 11.3 months.conclusionsr-mini-chop represented a reasonable treatment option for this patient with renal failure .
the oncogeriatric approach led to a successful management of this frail patient , highlighting that an adapted plan of care is a key issue to improve the outcomes of elderly cancer patients . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: microarrays have become standard tools for gene expression analysis as the messenger rna levels of thousands of genes can be measured in one assay . in a standard microarray experiment , total rna or mrna is extracted from cells or tissue , labeled by reverse transcription with radioactive or fluorescent - tag - labeled nucleotides and hybridized to the arrays .
after hybridization and washing , the arrays are scanned and the hybridization intensities at each spot are determined by image - analysis software .
two - channel microarrays open up the possibility of carrying out many hybridizations in parallel using a common reference rna . in such experiments ,
this procedure results in multivariate grouped data in which one group represents a condition with several replicates .
such data can be represented as a matrix with n rows ( genes ) and p columns ( hybridizations ) and a vector of length p containing the group labels .
these data are characteristic of multi - condition microarray experiments . to analyze such data ,
multivariate statistics are needed . before carrying out the analysis , the data must be pre - processed by background subtraction , computation of ratios and array - wise normalization .
a wide variety of supervised approaches have been described , for example , classification and regression trees or support vector machines . among unsupervised methods , hierarchical clustering and other clustering approaches , as well as
projection methods such as multidimensional scaling , principal components analysis ( pca ) and correspondence analysis have been described .
such projection techniques reduce the dimensionality of multivariate data to embed the variables and objects of the data in a visualizable ( two- or three - dimensional ) space .
the projection aims to represent the objects and variables in the reduced space in such a way that they approximate their original distances in the high - dimensional space .
this enables one to extract and visualize the dominant effects on variance from the data . with pca , linear combinations ( principal components ) of the original variables
this enables a biological interpretation of the nature of coherent variation . in microarray experiments ,
the identification of subsets of genes with large variation between groups is of primary interest .
. carried out hierarchical clustering of gene - expression data and computed an average expression profile for each cluster , providing the input for a response model .
a direct significance analysis to select genes from microarray data ( sam ) was proposed by tusher et al . .
this method is based on t - like ( in the case of two conditions ) or f - like statistics .
groups of genes are generated by iterative exclusion of fixed fractions of genes ( typically 10% ) with smallest absolute loadings according to the first principal component .
after orthogonalization of the data with respect to an averaged expression profile of the first group , the procedure is repeated .
another pca - based method of gene selection using pca - derived gene coefficient vectors and f - statistics was described by landgrebe et al . .
although these methods allow the detection of patterns or ' characteristic nodes ' by dimension reduction and the selection of gene subsets with large variation between condition groups , the reliability of the results has to be determined .
therefore , it is imperative to assess whether the results are statistically reliable relative to the level of noise in the data .
classical statistical parametric tests depend on the assumptions of normality and independence of variables ( hybridizations ) . yet , these assumptions do not hold for microarray data . consequently , computationally intensive methods such as permutation tests or bootstrap procedures as introduced by efron
ghosh describes another approach based on mixture modeling to assess the reliability of clustering results .
other permutation - based approaches were published by tusher et al . and dudoit et al . .
an approach of wall et al . tries to combine pca - based gene selection with a confidence measure using leave - one - out cross - validation . here
we describe an approach combining pca - directed gene selection with validation by permutation tests .
we use a test statistic based on the genes ' object scores to select genes with high variance with respect to the principal components .
the method was developed for the analysis of microarray data having several conditions with a few replicates per condition or a group structure .
we demonstrate this approach by applying it to the well - characterized data of spellman et al . .
although other methods are better adapted to the analysis of temporal effects ( for example ) , we chose the yeast data to allow comparison with other approaches applied to this dataset .
we revealed the main sources of variance in the data and described the genes related to this variance .
this allowed the interpretation of variance and the permutation - validated selection of genes in a functional context .
we carried out permutation - test - validated pca on grouped data with few replicates to study variation in gene expression across several conditions , to understand the structure of the data , to uncover patterns underlying the hybridization conditions and to identify subsets of genes with large variation across these patterns .
pca is primarily aimed at finding and interpreting complex relationships between variables in a dataset .
the central point of such analysis is to decompose the original n p data matrix ( n objects , p variables ) in the following manner : where x is the n p data matrix , a is the n p matrix of factor scores and f is the p p matrix of factor loadings . with s = p factors the total variance of all variables is explained .
the decomposition of x is done in such a way that the factors explain the total variance in a descending order .
therefore , it is possible to reduce the data to s dimensions with a minimum loss of information expressed by the matrix of residuals e : where is the n s matrix of factor scores , the p s matrix of factor loadings and e is the matrix of residuals as a result of dimension reduction . in this manner , pca provides a projection of the objects from p - dimensional to s - dimensional space .
in grouped data with replicates per group ( condition ) , there is additional information about the columns of the data matrix : y ' = ( y1,y2 , ... , yp ) is a set of class labels identifying the replicates for each condition .
although pca is generally not considered to be appropriate for grouped data , the method has been adapted for this data type ( rank - ordered pca ) .
the consecutive steps of the permutation validated pca procedure are shown in figure 1 . in step 1 , we perform rank - ordered pca based on the polished gene expression matrix x ( see materials and methods ) by computing separate oneway anovas on the principal components loadings for each of the components . if the between - group variance dominates the total variability in the data , pca discriminates between groups . in this situation ,
the first components of the pca and components with high f - values are identical .
thus , following the order of explained variance , we select the components with significant f - statistics ( p 0.01 ) . at the occurrence of a component with nonsignificant f - statistics ,
data approximated in the space based on these components reflect the between - group variance .
thus , in step 3 of the procedure , we compute components from the group - averaged data and derive the exact between - group variance for each gene , which can be estimated by : where agi is the factor score for gene g and component i. as a test value , we use ( step 3 ) . genes with a high value are candidates for selection . to assess the reliability of the results we perform a permutation analysis ( steps 4 - 6 ) . under the hypothesis of no effect of different conditions on gene expression profiles ,
the class labels given by y ' are randomly sampled to determine the permutation distribution of the required test statistics .
computing pcas from randomized group - averaged data yields the distribution of the test statistic tg for each gene g ( step 4 ) : we compute 1,000 permutation distributions for each gene ( step 5 ) . in step 6 we select the genes for which tg is greater than the 95% quantile of the permutation distribution of tg .
the last step is the visualization of the arrays and selected genes in the reduced k - components space . if k = 2 , a twofold visualization is suggested .
genes lying near an axis of a condition are upregulated in this hybridization and genes lying in the opposite direction are repressed . with several conditions ,
therefore , the visualization maybe supported by color - coded expression - profile tables . here
, the data matrix is rearranged according to the angular distance from the x - axis for each gene ( rearranging n rows ) . the same is done for hybridizations ( rearranging p columns ) . if k > 2 several biplots and color - coded tables must be constructed . to demonstrate our approach
, we applied it to the yeast cell - cycle data published by spellman et al . .
these authors synchronized the yeast cell cycle using independent methods of cell - cycle arrest and measured the expression of all yeast open reading frames ( orfs ) at different time points after the cell - cycle synchronization .
we analyzed the cell - cycle - related genes selected by spellman et al . to demonstrate the relationship between cell - cycle phases and gene - expression patterns and to select a subset of genes that show the highest and most reproducible variance across the cell - cycle phases .
the cell cycle is a temporal continuum that is generally grouped into cell - cycle phases .
the classification of genes in cell - cycle phase groups enables one to analyze the variance of gene expression across the cell - cycle phases and to select genes with different and robust regulation .
an analysis of variance ( anova ) using the variable loadings as dependent variables and the classification - derived cell - cycle phase groups as factors was carried out .
figure 2 shows a plot of the first two component loadings against each other . of the data 's variance ,
the plot shows that the resulting ordination of the hybridizations corresponds to the assignment of cell - cycle phases by spellman et al . .
the angular position of the hybridizations in the plot reflects their correct temporal situation in the cycle .
they are shown with colored labels in figure 2 and show a counterclockwise shift in expression in the cell cycle .
thus , the first two components approximate the cell - cycle aspect of the data quite well and could be interpreted as cell - cycle components . they reflect the main temporal aspect of the data .
a second pca was carried out on the group - averaged data using the original cell - cycle classification with two components ( 94.4% explained variance ) .
figure 3 shows a biplot of the 773 gene scores and the five cell - cycle phase group loadings . for each gene
the distance to the origin indicates the variance in the reduced two - dimensional space .
the hole in the middle of the plot reflects the fact that only genes related to the cell cycle were chosen by spellman et al . .
genes without variance with respect to the cell cycle ( equally transcribed in most cell - cycle phases ) would lie in the middle of the biplot . in figure 3 ,
these genes had a test value above the 95% percentile of the permutation distribution of the related test statistic .
figure 3 allows the assignment of the genes to the cell - cycle phases in which they are regulated .
as illustrated by figures 3 and 4 , in the cell - cycle phase m / g1 , cdc46 ( encoding part of the replication complex ) was selected as an upregulated gene , whereas the histone genes htb2 , hta2 and hho1 ( also marked by spellman et al . and fellenberg et al . ) were selected as downregulated genes . in phases g1 and s , pol30 ( replication complex ) and rad51 ( cell - cycle - related protein kinase ) were selected .
the histone genes repressed in m / g1 were upregulated in s. in g2 and m , clb1 ( g2/m - specific cyclin involved in mitotic induction ) , cdc5 ( mitotic dna replication ) and clb2 ( g2/m - specific cyclin involved in mitotic induction ) were selected as upregulated , in phase m cdc20 ( cyclin degradation , part of the anaphase - promoting complex ) .
thus , among the known genes selected by our algorithm , many play a crucial role in the cell cycle . as described by spellman et al . , the microarray expression data confirm the results of other gene expression studies . in this experiment , mrnas from whole brains of mice of different genetic backgrounds which had been treated with an antagonist directed against the ligand - binding domain of a seven - transmembrane neuropeptide receptor ( the corticotropin - releasing hormone receptor 1 ( crh - r1 ) ) were compared to mrnas from brains of mice lacking a functional crh - r1 ( crh - r1 knockout mice ) using cdna - microarrays ( table 1 ) .
we computed a pca based on the polished matrix of single hybridizations to show that the treatment group members clustered together ( data not shown ) .
we performed an anova using the variable loadings as dependent variables and the treatment groups as factors .
we carried out pca for group - averaged data with two components ( 54.8% explained variance ) .
the two components describe a gradient effect of the abolition of crh - r1 function in different genetic backgrounds .
component 1 ( abscissa ) distinguishes the crh - r1 abolition ( null mutant ) from relatively mild crh - r1 function impairment ( h1 , w1 : 1 day of treatment with antagonist ) . with the increasing effect on the animals of gene function impairment ,
the animals ' loadings on the first component become more similar to the genetic crh - r1 inactivation .
component 2 ( ordinate ) distinguishes between impairment of heterozygotes treated for 1 day and wild - type animals treated for 7 days ( both of 129ola / cd1 background ) . because long - term - treated wild - type animals of 129svj background ( sy ) are similar to the knockout animals , treatment seems to have a strong effect in these animals .
animals with a 129ola / cd1 background ( group wy ) show a weaker response to treatment with the antagonist .
both components describe abolition - of - function effects in a background - dependent manner .
thus , given a particular genetic background , treatment with an antagonist against crh - r1 can mimic the genetic abolition of gene function .
only 25 genes were selected by permutation tests and are labeled with gene symbols in figure 5 .
these genes show high variance across the treatment groups and are highly reproducible . only genes that contrast the groups ko and s7 on one side and in the groups w1 and w7 on the other side
the profiles of these genes are illustrated in figure 6 and support the interpretation of the biplot . in this experiment ,
29 12-week - old male mice of 129svj background were treated with mirtazapine , paroxetine or vehicle for 1 , 7 or 28 days ( table 2 ) .
cdna microarrays were used to measure the mrna expression in total brain homogenates of these animals .
we computed a pca based on the polished matrix of single hybridizations to show that the treatment groups were ordinated together ( data not shown ) .
we performed an anova using the variable loadings as dependent variables and the treatment groups as factors .
they explained 36.3% of the data 's variance and the object ( gene ) scores with respect to these two components were used to compute the variance of genes according to the group differences .
we carried out a pca with group - averaged data and two components ( 72.1% explained variance ) .
figure 7 shows a biplot of these components with 127 selected genes at the 95% percentile ( labeled with numbers ) and 30 genes at the 99% percentile ( labeled with gene symbols ) .
the components describe the effects of antidepressant treatment on the mouse brain . the first component ( abscissa )
the second component discerns short ( 1 day ) from longer ( 7 or 28 days ) treatment and can be interpreted as the treatment duration effect .
figure 8 shows the 30 genes selected at the 99% percentile in a color - coded expression table .
we carried out permutation - test - validated pca on grouped data with few replicates to study variation in gene expression across several conditions , to understand the structure of the data , to uncover patterns underlying the hybridization conditions and to identify subsets of genes with large variation across these patterns .
pca is primarily aimed at finding and interpreting complex relationships between variables in a dataset .
the central point of such analysis is to decompose the original n p data matrix ( n objects , p variables ) in the following manner : where x is the n p data matrix , a is the n p matrix of factor scores and f is the p p matrix of factor loadings . with s = p factors the total variance of all variables is explained .
the decomposition of x is done in such a way that the factors explain the total variance in a descending order .
therefore , it is possible to reduce the data to s dimensions with a minimum loss of information expressed by the matrix of residuals e : where is the n s matrix of factor scores , the p s matrix of factor loadings and e is the matrix of residuals as a result of dimension reduction . in this manner , pca provides a projection of the objects from p - dimensional to s - dimensional space .
in grouped data with replicates per group ( condition ) , there is additional information about the columns of the data matrix : y ' = ( y1,y2 , ... , yp ) is a set of class labels identifying the replicates for each condition .
although pca is generally not considered to be appropriate for grouped data , the method has been adapted for this data type ( rank - ordered pca ) .
the consecutive steps of the permutation validated pca procedure are shown in figure 1 . in step 1 , we perform rank - ordered pca based on the polished gene expression matrix x ( see materials and methods ) by computing separate oneway anovas on the principal components loadings for each of the components . if the between - group variance dominates the total variability in the data , pca discriminates between groups . in this situation ,
the first components of the pca and components with high f - values are identical .
thus , following the order of explained variance , we select the components with significant f - statistics ( p 0.01 ) . at the occurrence of a component with nonsignificant f - statistics ,
data approximated in the space based on these components reflect the between - group variance .
thus , in step 3 of the procedure , we compute components from the group - averaged data and derive the exact between - group variance for each gene , which can be estimated by : where agi is the factor score for gene g and component i. as a test value , we use ( step 3 ) . genes with a high value are candidates for selection . to assess the reliability of the results we perform a permutation analysis ( steps 4 - 6 ) . under the hypothesis of no effect of different conditions on gene expression profiles ,
the class labels given by y ' are randomly sampled to determine the permutation distribution of the required test statistics .
computing pcas from randomized group - averaged data yields the distribution of the test statistic tg for each gene g ( step 4 ) : we compute 1,000 permutation distributions for each gene ( step 5 ) . in step 6 we select the genes for which tg is greater than the 95% quantile of the permutation distribution of tg .
the last step is the visualization of the arrays and selected genes in the reduced k - components space . if k = 2 , a twofold visualization is suggested .
genes lying near an axis of a condition are upregulated in this hybridization and genes lying in the opposite direction are repressed . with several conditions ,
therefore , the visualization maybe supported by color - coded expression - profile tables . here
, the data matrix is rearranged according to the angular distance from the x - axis for each gene ( rearranging n rows ) . the same is done for hybridizations ( rearranging p columns ) . if k > 2 several biplots and color - coded tables must be constructed .
to demonstrate our approach , we applied it to the yeast cell - cycle data published by spellman et al . .
these authors synchronized the yeast cell cycle using independent methods of cell - cycle arrest and measured the expression of all yeast open reading frames ( orfs ) at different time points after the cell - cycle synchronization .
we analyzed the cell - cycle - related genes selected by spellman et al . to demonstrate the relationship between cell - cycle phases and gene - expression patterns and to select a subset of genes that show the highest and most reproducible variance across the cell - cycle phases .
the cell cycle is a temporal continuum that is generally grouped into cell - cycle phases .
the classification of genes in cell - cycle phase groups enables one to analyze the variance of gene expression across the cell - cycle phases and to select genes with different and robust regulation .
an analysis of variance ( anova ) using the variable loadings as dependent variables and the classification - derived cell - cycle phase groups as factors was carried out .
figure 2 shows a plot of the first two component loadings against each other . of the data 's variance ,
the plot shows that the resulting ordination of the hybridizations corresponds to the assignment of cell - cycle phases by spellman et al . .
the angular position of the hybridizations in the plot reflects their correct temporal situation in the cycle .
they are shown with colored labels in figure 2 and show a counterclockwise shift in expression in the cell cycle .
thus , the first two components approximate the cell - cycle aspect of the data quite well and could be interpreted as cell - cycle components .
a second pca was carried out on the group - averaged data using the original cell - cycle classification with two components ( 94.4% explained variance ) .
figure 3 shows a biplot of the 773 gene scores and the five cell - cycle phase group loadings . for each gene
the distance to the origin indicates the variance in the reduced two - dimensional space .
the hole in the middle of the plot reflects the fact that only genes related to the cell cycle were chosen by spellman et al . .
genes without variance with respect to the cell cycle ( equally transcribed in most cell - cycle phases ) would lie in the middle of the biplot . in figure 3 , 60 genes are labeled with gene symbols .
these genes had a test value above the 95% percentile of the permutation distribution of the related test statistic .
figure 3 allows the assignment of the genes to the cell - cycle phases in which they are regulated .
as illustrated by figures 3 and 4 , in the cell - cycle phase m / g1 , cdc46 ( encoding part of the replication complex ) was selected as an upregulated gene , whereas the histone genes htb2 ,
hta2 and hho1 ( also marked by spellman et al . and fellenberg et al . ) were selected as downregulated genes . in phases g1 and s , pol30 ( replication complex ) and rad51 ( cell - cycle - related protein kinase ) were selected .
the histone genes repressed in m / g1 were upregulated in s. in g2 and m , clb1 ( g2/m - specific cyclin involved in mitotic induction ) , cdc5 ( mitotic dna replication ) and clb2 ( g2/m - specific cyclin involved in mitotic induction ) were selected as upregulated , in phase m cdc20 ( cyclin degradation , part of the anaphase - promoting complex ) .
thus , among the known genes selected by our algorithm , many play a crucial role in the cell cycle . as described by spellman et al . , the microarray expression data confirm the results of other gene expression studies .
in this experiment , mrnas from whole brains of mice of different genetic backgrounds which had been treated with an antagonist directed against the ligand - binding domain of a seven - transmembrane neuropeptide receptor ( the corticotropin - releasing hormone receptor 1 ( crh - r1 ) ) were compared to mrnas from brains of mice lacking a functional crh - r1 ( crh - r1 knockout mice ) using cdna - microarrays ( table 1 ) .
we computed a pca based on the polished matrix of single hybridizations to show that the treatment group members clustered together ( data not shown ) .
we performed an anova using the variable loadings as dependent variables and the treatment groups as factors .
we carried out pca for group - averaged data with two components ( 54.8% explained variance ) .
the two components describe a gradient effect of the abolition of crh - r1 function in different genetic backgrounds .
component 1 ( abscissa ) distinguishes the crh - r1 abolition ( null mutant ) from relatively mild crh - r1 function impairment ( h1 , w1 : 1 day of treatment with antagonist ) . with the increasing effect on the animals of gene function impairment ,
the animals ' loadings on the first component become more similar to the genetic crh - r1 inactivation .
component 2 ( ordinate ) distinguishes between impairment of heterozygotes treated for 1 day and wild - type animals treated for 7 days ( both of 129ola / cd1 background ) . because long - term - treated wild - type animals of 129svj background ( sy ) are similar to the knockout animals , treatment seems to have a strong effect in these animals .
animals with a 129ola / cd1 background ( group wy ) show a weaker response to treatment with the antagonist .
both components describe abolition - of - function effects in a background - dependent manner .
thus , given a particular genetic background , treatment with an antagonist against crh - r1 can mimic the genetic abolition of gene function .
only 25 genes were selected by permutation tests and are labeled with gene symbols in figure 5 .
these genes show high variance across the treatment groups and are highly reproducible . only genes that contrast the groups ko and s7 on one side and in the groups w1 and
the profiles of these genes are illustrated in figure 6 and support the interpretation of the biplot .
in this experiment , 29 12-week - old male mice of 129svj background were treated with mirtazapine , paroxetine or vehicle for 1 , 7 or 28 days ( table 2 ) .
cdna microarrays were used to measure the mrna expression in total brain homogenates of these animals .
we computed a pca based on the polished matrix of single hybridizations to show that the treatment groups were ordinated together ( data not shown ) .
we performed an anova using the variable loadings as dependent variables and the treatment groups as factors .
they explained 36.3% of the data 's variance and the object ( gene ) scores with respect to these two components were used to compute the variance of genes according to the group differences .
we carried out a pca with group - averaged data and two components ( 72.1% explained variance ) .
figure 7 shows a biplot of these components with 127 selected genes at the 95% percentile ( labeled with numbers ) and 30 genes at the 99% percentile ( labeled with gene symbols ) .
the components describe the effects of antidepressant treatment on the mouse brain . the first component ( abscissa )
the second component discerns short ( 1 day ) from longer ( 7 or 28 days ) treatment and can be interpreted as the treatment duration effect .
figure 8 shows the 30 genes selected at the 99% percentile in a color - coded expression table .
here we propose a method for analyzing microarray data with group structure imposed by different conditions .
we combine the visualization focused on the variance of genes between groups and gene selection , taking into account the within - group variance . based on pca , this method is able to visualize relationships between hybridizations by dimension reduction .
yet , data visualization via a biplot allows more than biological interpretation of the components . after appropriate data preprocessing , searching for genes with changes in expression patterns across the groups can be based on the genes ' ( objects ' ) distance from the centroid of the biplot .
this distance is proportional to the variance of genes in the dimension - reduced space .
but a selection of genes must be accompanied by an assessment of whether the results are statistically reliable relative to the level of noise in the data . whereas
classic statistical tests ( like t- and f - statistics ) are based on assumptions concerning distribution and variable independence that do not hold for microarray data the permutation - validation procedure presented here makes no assumption about the dependence of gene - expression measurement within the expression matrix x. therefore , gene - specific scatter is taken into consideration by calculating the test - value permutation distributions for each gene under the null hypothesis of no group - structure effect in the expression profiles .
another method for validating pca results using a leave - one - out approach ( wall et al . ) is very global , and can only be applied when the conditions correspond to a continuous parameter , such as time or dose .
the last step of the permutation - validated pca procedure concerns the visualization and the interpretation of the selected genes according to their importance in a biological context . in the case of two dimensions ( k = 2 ) ,
a color - coded expression profile can be generated by rearranging the selected genes and the arrays with respect to angular distances in the biplot .
when looking at a biplot showing several variable loadings , a given object ( gene ) has to be projected on all different variables ( conditions ) to understand its pattern with regard to all of them .
a color - coded expression - profile table may support this visual interpretation . as a further development of the method described here , we envisage cluster analysis of the selected genes for higher dimensions ( k > 2 ) .
the application of permutation - validated pca to microarray data shows that the basic sources of variance could be extracted from all datasets : the components computed from the spellman et al .
yeast data described the cell cycle and allowed ordinations of the hybridizations according to their temporal situation in the cell cycle .
arrays misclassified by the fourier transformation were assigned to shifted positions in the cell cycle ( this was also achieved by correspondence analysis ) .
the components computed from the abolition of crh - r1 function experiment described a gradient of increasing functional impairment depending on the genetic background of the animals .
the analysis of the antidepressant data also shows how principal components led to an understanding of the fundamental biological phenomena captured by the data : here , they discern the types of treatment and the treatment duration .
but there were important differences in the results : whereas the grouped pca of the cell - cycle data explained 94.4% of the data 's variance , the corresponding rates were 72.1% explained variance for the antidepressant data and 54.8% for the crh - r1 abolition data .
in a situation with homogeneous array groups and preselected genes such as the cell - cycle data , the level of explained variance was very high as the components explained the kind of variance the genes were preselected for .
for the antidepressant data , no a priori information about the relation of genes to treatment type and duration was available .
thus the level of explained variance was lower ( 72.1% ) , although the two components used to build the test statistics still captured a big part of the variance present in the data .
although the material used for the antidepressant treatment data ( rna from total mouse brain homogenates containing a variety of cell types ) was more heterogeneous than the clonal yeast cell lines , antidepressant effects on the brain 's mrna transcription were so important that clear variance structures emerged in the data .
in contrast , the level of explained variance for the crh - r1 function abolition data was 54.8% .
in this experiment , different methods of impairing or abolishing the function of crh - r1 were used on different mouse genetic backgrounds .
heterogeneity within the groups was also higher than in the antidepressant experiment , probably because a selective pharmacologic antagonization of the neuro - modulating peptide crh had a less pronounced and stereotypic effect on transcription in the brain than the antidepressant drugs acting on a wide spectrum of neurotransmitter receptors , transporters and related enzymes .
in this situation of high variance in the experimental design , and a relatively high rate of heterogeneity in the treatment groups , permutation - validated pca only selected genes reflecting the contrast between the groups w1 , w7 on one side and s7 and k0 on the other side because this contrast was captured by the first two components .
thus , a multivariate approach trying to compare very different gene expression patterns at the same time might lead to loss of information .
in such a case , the selection of genes should be treated with caution and cross - validation by independent methods should be applied if hypotheses are to be derived from the selected genes .
, permutation - validated pca can be used to extract the leading source of variance from microarray data , to visualize relationships between genes and hybridizations and to select informative genes in a statistically reliable manner .
this selection accounts for the level of reproducibility of replicates or group structure as well as gene - specific scatter .
a subset of the data from spellman et al . was used . to acquire our own data , microarrays were manufactured , mice treated and total brain rna extracted , labeled and hybridized as described in .
briefly , mice were killed after the end of treatment , rna was extracted by rneasy and trizol procedure .
total rna ( 100 g ) was fluorescence - labeled by oligo - dt - primed reverse transcription to cdna in the presence of cy3-dutp as described by eisen and brown .
after reverse transcription , total brain cy3-labeled cdna from each animal was hybridized to a microarray .
raw data were assessed with the spectrum vs.3.2 image - analysis software developed by chen et al . .
data from spellman et al . were also used by fellenberg et al . ; we did not modify the described preprocessing .
matrix rows ( genes ) with missing observations were excluded from the datasets , resulting in data without missing values . to normalize and compare the different hybridizations to each other , the intensity measured at each spot of the arrays was divided by the centered median of the intensities measured at the corresponding spot in the reference groups .
thus , every single hybridization was normalized against the reference groups by computing the log2 of the ratios ( the mean of groups so , ho and wo for the crh - r1 data and group c28 for the antidepressant data ) .
. given an n p data matrix , the following model can be stated : xgj = + g + j + gj + gj in this model , xgi is the log - ratio of gene g under experimental condition j , g is the normalizing effect for gene g ( row ) , j is the experimental variance effect for j ( column ) , gj is the differential gene expression for gene g under experimental condition j and gj is the random error . to estimate the interaction term gj ,
several other effects must be controlled : as g reflects the relation of experiment rna to normalizing rna and is of no biological interest , it can be controlled by mean centering rows .
j reflects the global variance in rna preparation , labeling efficacy and hybridization quality as well as other sources of experimental variance between the arrays and can be controlled by standardizing the matrix columns .
the term gj can thus be obtained by data polishing , that is , the matrix is iteratively subjected to column standardization and row mean centering until convergence is reached .
a subset of the data from spellman et al . was used . to acquire our own data , microarrays were manufactured , mice treated and total brain rna extracted , labeled and hybridized as described in .
briefly , mice were killed after the end of treatment , rna was extracted by rneasy and trizol procedure .
total rna ( 100 g ) was fluorescence - labeled by oligo - dt - primed reverse transcription to cdna in the presence of cy3-dutp as described by eisen and brown .
after reverse transcription , total brain cy3-labeled cdna from each animal was hybridized to a microarray .
raw data were assessed with the spectrum vs.3.2 image - analysis software developed by chen et al . .
data from spellman et al . were also used by fellenberg et al . ; we did not modify the described preprocessing .
matrix rows ( genes ) with missing observations were excluded from the datasets , resulting in data without missing values . to normalize and compare the different hybridizations to each other ,
the intensity measured at each spot of the arrays was divided by the centered median of the intensities measured at the corresponding spot in the reference groups .
thus , every single hybridization was normalized against the reference groups by computing the log2 of the ratios ( the mean of groups so , ho and wo for the crh - r1 data and group c28 for the antidepressant data ) .
therefore , these groups do not appear in figures 5 to 8 . given an n p data matrix , the following model can be stated : xgj = + g + j + gj + gj in this model , xgi is the log - ratio of gene g under experimental condition j , g is the normalizing effect for gene g ( row ) , j is the experimental variance effect for j ( column ) , gj is the differential gene expression for gene g under experimental condition j and gj is the random error . to estimate the interaction term gj ,
several other effects must be controlled : as g reflects the relation of experiment rna to normalizing rna and is of no biological interest , it can be controlled by mean centering rows .
j reflects the global variance in rna preparation , labeling efficacy and hybridization quality as well as other sources of experimental variance between the arrays and can be controlled by standardizing the matrix columns .
the term gj can thus be obtained by data polishing , that is , the matrix is iteratively subjected to column standardization and row mean centering until convergence is reached .
we thank the gsf - research center , the max - planck - gesellschaft and the volkswagenstiftung for funding .
colors indicate the cycle phase to which the hybridizations were classified by spellman et al . .
m / g1 , yellow ; g1 , green ; s , blue ; g2 , red ; m , brown .
the labeled arrays are misclassified cdc hybridizations assigned to new cell - cycle phases by pca .
biplot of gene scores and cell - cycle phase group loadings according to the first two components of the pca .
color - coded expression - profile table of the genes selected from the cell - cycle data by permutation test .
the cycle phase groups and the genes are arranged according to the angular position in the pca biplot ( see figure 3 ) .
biplot of gene scores and treatment group loadings according to the first two components of the pca .
color - coded expression - profile table of the genes selected from the crh - r1 function abolition data by permutation test .
the treatment groups and the genes are arranged according to the angular position in the pca biplot ( see figure 5 ) .
biplot of gene scores and treatment groups loadings according to the first two components of the pca .
genes labeled with numbers have test values above the 95% percentile of the permutation distribution ; genes labeled with gene symbols have test values above the 99% percentile .
color - coded expression - profile table of the genes selected from the antidepressant data by permutation test above the 99% percentile .
the treatment groups and the genes are arranged according to the angular position in the pca biplot ( see figure 7 ) .
hybridizations performed in the crh - r1 abolition experiment thirty - three 12-week - old male mice with the genotypes shown in column 1 ( k were crh - r1 deficient animals , h and w were their littermates ) were treated orally with an antagonist directed against the crh - r1 ( janssen compound r121919 ) for 0 , 1 or 7 days at a dose of 40 mg per kg body weight .
untreated groups ( h0 , w0 , s0 ) were used to normalize the data and do not appear in figures 5 and 6 .
design of the antidepressant experiment twenty - nine 12-week - old male mice of genotype 129svj were treated with the drug mirtazapine ( a ) , paroxetine ( p ) or vehicle ( c ) by mouth for 1 , 7 or 28 days at a dose of 40 mg per kg body weight .
the untreated control group ( c28 ) was used to normalize the data and does not appear in figures 7 and 8 . | ### Summary:
: backgroundin microarray data analysis , the comparison of gene - expression profiles with respect to different conditions and the selection of biologically interesting genes are crucial tasks .
multivariate statistical methods have been applied to analyze these large datasets .
less work has been published concerning the assessment of the reliability of gene - selection procedures . here
we describe a method to assess reliability in multivariate microarray data analysis using permutation - validated principal components analysis ( pca ) . the approach is designed for microarray data with a group structure.resultswe used pca to detect the major sources of variance underlying the hybridization conditions followed by gene selection based on pca - derived and permutation - based test statistics .
we validated our method by applying it to well characterized yeast cell - cycle data and to two datasets from our laboratory .
we could describe the major sources of variance , select informative genes and visualize the relationship of genes and arrays .
we observed differences in the level of the explained variance and the interpretability of the selected genes.conclusionscombining data visualization and permutation - based gene selection , permutation - validated pca enables one to illustrate gene - expression variance between several conditions and to select genes by taking into account the relationship of between - group to within - group variance of genes .
the method can be used to extract the leading sources of variance from microarray data , to visualize relationships between genes and hybridizations and to select informative genes in a statistically reliable manner .
this selection accounts for the level of reproducibility of replicates or group structure as well as gene - specific scatter .
visualization of the data can support a straightforward biological interpretation . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: stress urinary incontinence ( sui ) is defined as an involuntary loss of urine during physical exertion , sneezing , coughing , laughing , or other activities that put pressure on the bladder .
numerous studies have shown that urinary incontinent patients have lower health - related quality of life ( hrqol ) compared to the healthy population or to controls [ 25 ] .
symptoms of sui can cause great discomfort , embarrassment , and loss of self - confidence that can lead to withdrawal from social , occupational , domestic , physical , and sexual aspects of life .
daily activities including hobbies , household work , and physical recreation can often be limited to areas around the location of toilets to avoid potentially embarrassing situations .
sui is classified depending on the underlying etiology , with either loss of urethral support ( type i ) , urethral hypermobility ( type ii ) , or intrinsic sphincter deficiency ( type iii ) being the main causative factor .
as far as surgery is concerned , mid - urethral polypropylene slings ( mps ) introduced under the central part of the urethra in order to restore its weakened support have become the most popular treatment of sui in females over the last two decades .
complications such as erosion , tape misplacement , de novo detrusor instability , too high tension of the sling , or its improper placement are rather rare .
the general success rate reported may be as high as 71% with five - year observation .
the outcome depends on surgical technique , patient 's age , concurrent pelvic organ prolapse , intrinsic sphincter deficiency , neuromuscular properties of the patient 's tissue , tape material , as well as medical conditions such as diabetes , obesity , and obstructive pulmonary disease [ 916 ] .
we know that in some cases recurrent or persistent sui after sling operations may be caused by too loose placement of the sling providing insufficient support for the urethra . in the current study , we describe our novel method of shortening of the sling as a second - line treatment of tvt failure .
the aim of the study is to present the outcome of the novel operative technique of shortening of the midurethral polypropylene sling in patients with unsatisfactory result of the previous tvt installation .
the study group consisted of 4 women , aged 46 - 61 , who had undergone tvt procedures performed according to the manufacturer 's guidelines , but resulted in persistent urinary incontinence .
initial sling placements were performed 4- , 11- , 3- , and 8 months before admission to our unit . before undertaking the second - line treatment
all patients had been examined to investigate other possible causes of tvt failure . urinalysis and urinary culture as well as urodynamic and transvaginal ultrasonography were performed .
after urodynamics , which were performed before the second - line treatment , we state that all of our patients failed the first procedure due to inadequate support of the urethra .
all patients were classified as type i stress urinary incontinence according to blaivas criteria .
results of urodynamics after the tvt failure then , as the sub - optimal urethral support was detected to be the cause of the tvt failure , all patients were qualified for the second - line operation .
patients qualified for the study underwent the following functional tests to estimate the preoperative and postoperative continence : physical examinations , cough tests , 24-h pad tests , and quality of life questionnaires king 's health questionnaire ( khq ) preoperatively and 12 months after the second procedure .
the minimum possible score is 0 ( best health ) and the maximum possible score is 100 ( worst health ) .
the preoperative 24-h pad tests confirmed insufficient results ( median result after the first failure procedure was 288.0 g ) of the previous tvt installation in all cases .
after the incision of the anterior vaginal wall , the fragment of sling was exposed and a 5 - 8 mm fragment of it was excised ( urethrolysis was not performed ) .
the remaining ends of the tape after excision were mobilized only enough to make the re - anastomosis possible .
we used a non - absorbable suture 2 - 0 to perform the re - anastomosis , which created more adequate support for the urethra .
the small incision in the anterior vaginal wall was closed with interrupted sutures ( caprosyn 3 - 0 ) . after the procedure ,
step 1 : ( left image ) incision of the anterior vaginal wall and preparation of the sling .
step 2 : ( middle image ) excision of a small fragment of the sling .
step 3 : ( right image ) re - anastomosing both ends of the sling by non - absorbable suture ( two interrupted sutures ) .
neither blood loss nor any other complication occurred and patients were discharged the next morning .
spontaneous voiding with minimal ( less than 50 ml ) post - void residual urine ( pvr ) was found in all patients before discharging home and on follow - up visits ( range 11 - 13 months ) and it did not increase .
the follow - up showed no side effects related to the used method or any de novo urgency or obstructive symptoms .
it meant that the cough and 24-h pad tests ( < 5.0 g ) were negative and patients estimated their continence as good .
all patients were classified as stage i in the pelvic organ prolapse quantification ( popq ) scale .
the general health perceptions measured after 12-month follow - up by king 's health questionnaire increased after the second procedure by a mean value of 44.25% .
incontinence impact decreased by mean value 44.6% . in all patients , role and physical limitations significantly decreased ( respectively by mean value 88.5% and 80.5% ) . in all women , personal relationships before and after the second operation were good .
preoperatively in all women we evaluated emotions higher than 67/100 points . in follow - up , three women estimated negative emotions on the zero level and only one woman on the level 11/100 points .
surgical treatment of sui using the supra - pubic tension - free vaginal tape was first introduced in 1995 by ulmsten and petros .
it is based on restoring sufficient support to the urethra , which is believed to be the principal factor causing sui . in the following years
, several pubovaginal or transobturator polypropylene sling systems have been developed and have gained acceptance due to good results and rather low complication rates .
irrespectively of the system used , the long - term failure rate of the treatment is about 30% after 5-years follow - up . meaning that
because of a very large number of performed procedures , a lot of patients may suffer from persistent or recurrent sui after the operation .
incontinence after tvt can be caused by many factors like : detrusor instability , infection , vesico - vaginal fistula , or over - flow leakage , but one of the most common causes is less than optimal support by the sling on the urethra . in the literature , management of recurrent
sui starts with the exclusion of possible concomitant factors and is usually based on insertion of the second sling .
it should rather be the pubovaginal sling system , as there are two studies indicating that this approach has a higher cure rate than the transobturator one in repeat midurethral sling cases [ 20 , 21 ] .
compared the outcome of tvt between primary and repeated surgeries and found that repeated procedures had a significantly lower cure rate than primary ones ( 31% vs. 13% , p < 0.001 ) so repeated tvt may lead to the frustrating situation where the patient has two slings installed and still leaks .
thus other methods based on repairing the sling may appear to be an attractive option .
lo et al . in 2006 described a simple method of shortening the tvt tape using figure - eight sutures to treat the recurrent sui . in their series of 14 patients with recurrent sui ,
villet et al reported a transvaginal sling shortening with midline sling plication using 4-zero polypropylene suture for re - tensioning the loosened sling on one patient after an unsuccessful tvt procedure .
neuman reported successful elimination of sui symptoms in four patients who underwent a similar procedure with non - absorbable no . 0 nylon suture .
our concept is based on removing the part of the tape and shortening it by re - anastomosing its ends with nonabsorbable sutures .
the length of the fragment to be excised was decided according to the surgeon 's experience in order to obtain adequate support of the urethra . in future studies it may be possible to correlate the length of the removed fragment with the result of second line treatment and to use this data to plan preoperatively the length of removed tape according to the severity of incontinence .
the technique is very simple , cheap , and proven to be very effective in restoring continence and improving patients quality of life .
the operative shortening of the sling is a very simple , cheap , and effective method for second - line treatment in cases of tvt failure and , in our opinion , may be offered to the majority of patients with insufficient urethral support after the first procedure .
however , long - term , prospective , randomized studies with adequate case numbers are required to verify this novel surgical method of shortening the sling and comparing it with current alternative procedures for recurrent sui . | ### Summary:
: introductionstress urinary incontinence ( sui ) is defined as an involuntary loss of urine during physical exertion , sneezing , coughing , laughing , or other activities that put pressure on the bladder . in some cases ,
recurrent or persistent sui after sling operations may be caused by too loose placement of the sling . in the current study , we describe our method of shortening of the sling as a second - line treatment of tension - free vaginal tape ( tvt ) failure.materials and methodsfour women , aged 46 - 61 , after initial tvt operation were treated for persistent sui .
the severity of sui was estimated by : physical examinations , cough tests , 24-h pad tests , and king 's health questionnaire .
the shortening procedure , based on excising the fragment of tape and suturing it back , was performed in all patients.resultsall cases achieved a good result , which was defined as restoration of full continence .
no complications occurred .
the 12-month follow - up showed no side - effects .
the postoperative control tests : the cough and 24-h pad tests were negative in all women .
the general health perceptions increased after the shortening procedure by a mean value 44.25% . the incontinence impact decreased by a mean value 44.6% . in all patients , role and physical limitations significantly decreased ( by 88.5% and 80.5% , respectively ) .
the negative emotions connected with sui significantly decreased after the second procedure.conclusionsthe operative shortening of the implanted sling is a simple , cheap , and effective method of second - line treatment in cases of tvt failure and may be offered to the majority of patients with insufficient urethral support after the first procedure . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: cerebral venous thrombosis ( cvt ) is a rare type of cerebrovascular disease that can occur at any age even in neonate .
it accounts for 0.5% of all strokes with an annual incidence of 34 cases per million populations .
cvt is a multifactorial disease , and at least one predisposing factors can be identified in 80% of patients .
thrombophilia , either genetic or acquired , is among the most frequent risk factors identified in more than 20% of the cvt patients .
hyperhomocysteinemia , an established independent risk factor for venous and arterial thrombosis , may result from genetic or environmental factors or a combination of both .
one of the main causes of mild to moderate hyperhomocysteinemia involves genetic defects in the enzyme methylenetetrahydrofolate reductase ( mthfr ) , which plays a central role in homocysteine ( hcy ) and folate metabolism .
deficiencies in mthfr enzyme leads to hyperhomocysteinemia which may result in arterial and venous thrombotic disorders .
two common mutations in mthfr gene , the c677 t and a1298c , have been associated with decreased mthfr activity and elevated plasma hcy levels .
the association between mthfr c677 t mutation with cvt has been studied extensively with conflicting results . unlike mthfr c677 t mutation , studies investigating the role of mthfr a1298c mutation in cvt are limited . until date , only a few studies investigated the role of mthfr a1298c in cvt .
more recently , a case control study by fekih - mrissa et al . demonstrated a significant association of mthfr a1298c mutation with cvt . since , there is little information on the prevalence of mthfr a1298c mutation in iranian cvt patients
, we aimed to perform a case control study to investigate the relationship between the mthfr a1298c mutation , total hcy levels , and cvt development in an iranian population .
fifty - five unrelated patients with cvt were referred to the coagulation center of iranian blood transfusion organization for thrombophilia screening .
the clinical records and objective documentation of cvt were reviewed by a neurologist to confirm the diagnosis .
five patients were excluded from the analysis because the diagnosis was uncertain . altogether , 50 patients ( 17 men and 33 women ; mean age 38 years ranging 2063 years ) with objectively confirmed diagnosis of cvt were included in the study .
the controls consisted of 75 healthy individuals ( 25 men and 50 women ; mean age 36 years ; ranging 1865 years ) matched for age and sex with the patients , and without any history of thrombosis and/or use of vitamin b supplements and folate .
blood was drawn in ethylenediaminetetraacetic acid containing vacutainer tubes from fasting subjects for analysis of total plasma hcy .
samples were centrifuged at 4c and plasma fraction was aspirated and transferred to plastic tube and stored at 20c until analysis for total hcy .
total plasma hcy levels were determined by microplate enzyme immunoassay using a commercial kit ( axis shield diagnostic ltd . , uk ) according to manufacturer 's instruction .
the assay 's detection range was 2.550.0 m . dna was extracted from blood leukocyte according to the method described by lahiri and nurnberger .
mthfr a1298c mutation was analyzed by polymerase chain reaction - restriction fragment length polymorphism ( pcr - rflp ) method as previously described by van der van der put et al . with a slight modification .
the sequences of the primers were : 5ctt tgg gga gct gaa gga cta cta c-3 and 5-cac ttt gtg acc att ccg gtt tg-3 which amplified a 163 bp fragment of dna .
polymerase chain reaction conditions were optimized for the hybaid thermal cycler and included an initial denaturation at 92c for 120 s and 40 subsequent cycles of denaturation at 92c for 60 s , annealing at 62c for 60 s and extension at 72c for 30 s. this was followed by a final extension period at 72c for 4 min .
the amplified products were digested with 2.5 u of mboii ( fermentas , vilnius , lithuania ) for 3 h at 37c .
the a1298c mutation abolishes an mboii restriction site and digestion of the 163 bp amplicon results in 84 , 31 , 30 , and 18 bp fragments in the presence of the 1298c allele , and 56 , 31 , 30 , 28 , and 18 bp fragments in the presence of the 1298a allele [ figure 1 ] .
dna fragments were separated by electrophoresis on a 4% agarose gel and visualized with ethidium bromide .
lane 1 : ladder 50 bp ; lane 2 : undigested control ( 163 bp ) ; lane 3 : positive control for wild type ( aa ) genotype ; lane 4 : positive control for homozygote ( cc ) genotype ; lane 5 : positive control for heterozygote ( ac ) genotype ; lanes 6 and 7 : heterozygote genotype ( ac ) ; lanes 8 and 9 : wild - type genotype ( aa ) ; lane 10 : homozygote ( cc ) genotype allele frequencies were calculated by gene counting in cvt patients and control subjects .
mean ages and plasma total hcy levels differences between cvt patients and control subjects were assessed by student 's t - test .
furthermore , a t - test was used to assess the association of mthfr a1298c mutation with cvt and plasma total hcy levels . moreover ,
analysis of different genetic models including dominant , recessive , and co - dominant was done using chi - square test .
statistical analysis was performed by statistical package for the social sciences version 15 ( spss inc . , chicago , il ) and the statistical significance was set at p < 0.05 .
fifty - five unrelated patients with cvt were referred to the coagulation center of iranian blood transfusion organization for thrombophilia screening .
the clinical records and objective documentation of cvt were reviewed by a neurologist to confirm the diagnosis .
five patients were excluded from the analysis because the diagnosis was uncertain . altogether , 50 patients ( 17 men and 33 women ; mean age 38 years ranging 2063 years ) with objectively confirmed diagnosis of cvt were included in the study .
the controls consisted of 75 healthy individuals ( 25 men and 50 women ; mean age 36 years ; ranging 1865 years ) matched for age and sex with the patients , and without any history of thrombosis and/or use of vitamin b supplements and folate .
blood was drawn in ethylenediaminetetraacetic acid containing vacutainer tubes from fasting subjects for analysis of total plasma hcy .
samples were centrifuged at 4c and plasma fraction was aspirated and transferred to plastic tube and stored at 20c until analysis for total hcy .
total plasma hcy levels were determined by microplate enzyme immunoassay using a commercial kit ( axis shield diagnostic ltd . , uk ) according to manufacturer 's instruction .
dna was extracted from blood leukocyte according to the method described by lahiri and nurnberger .
mthfr a1298c mutation was analyzed by polymerase chain reaction - restriction fragment length polymorphism ( pcr - rflp ) method as previously described by van der van der put et al . with a slight modification .
the sequences of the primers were : 5ctt tgg gga gct gaa gga cta cta c-3 and 5-cac ttt gtg acc att ccg gtt tg-3 which amplified a 163 bp fragment of dna .
polymerase chain reaction conditions were optimized for the hybaid thermal cycler and included an initial denaturation at 92c for 120 s and 40 subsequent cycles of denaturation at 92c for 60 s , annealing at 62c for 60 s and extension at 72c for 30 s. this was followed by a final extension period at 72c for 4 min .
the amplified products were digested with 2.5 u of mboii ( fermentas , vilnius , lithuania ) for 3 h at 37c .
the a1298c mutation abolishes an mboii restriction site and digestion of the 163 bp amplicon results in 84 , 31 , 30 , and 18 bp fragments in the presence of the 1298c allele , and 56 , 31 , 30 , 28 , and 18 bp fragments in the presence of the 1298a allele [ figure 1 ] .
dna fragments were separated by electrophoresis on a 4% agarose gel and visualized with ethidium bromide .
lane 1 : ladder 50 bp ; lane 2 : undigested control ( 163 bp ) ; lane 3 : positive control for wild type ( aa ) genotype ; lane 4 : positive control for homozygote ( cc ) genotype ; lane 5 : positive control for heterozygote ( ac ) genotype ; lanes 6 and 7 : heterozygote genotype ( ac ) ; lanes 8 and 9 : wild - type genotype ( aa ) ; lane 10 : homozygote ( cc ) genotype
mean ages and plasma total hcy levels differences between cvt patients and control subjects were assessed by student 's t - test .
furthermore , a t - test was used to assess the association of mthfr a1298c mutation with cvt and plasma total hcy levels .
moreover , analysis of different genetic models including dominant , recessive , and co - dominant was done using chi - square test .
statistical analysis was performed by statistical package for the social sciences version 15 ( spss inc . , chicago , il ) and the statistical significance was set at p < 0.05 .
our study population consisted of 50 patients with cvt and 75 apparently healthy subjects matched for age and sex as control .
the mean age of cvt patients and control subjects were 38 28.2 and 36 30.6 , respectively which did not differ significantly ( p = 0.5 ) . of 50 cvt patients ,
17 were male and 33 were female while out of 75 control subjects , 25 were male and 50 were female .
there was no significant difference in sex distribution between cvt patients and control subjects ( p = 0.85 ) .
mean plasma total hcy levels were significantly higher in cvt patients than control subjects ( 13.7 4.5 vs. 9.9 3.6 mol / l , p = 0.015 ) .
the prevalence of mthfr a1298c genotypes was similar between cvt patients and control subjects and did not differ significantly [ table 1 ] . neither 1298ac heterozygote genotype ( p = 0.33 ) nor 1298cc homozygote genotype ( p = 0.32 ) was significantly associated with cvt .
moreover , no significant differences were observed in the frequency of mutant 1298c allele between cvt patients and control subjects ( p = 0.16 ) .
prevalence of mthfr a1298c allele and genotypes in cvt patients and controls we also evaluated the risk of cvt development in codominant , dominant , and recessive models of mthfr a1298c polymorphism .
as shown in table 2 , no evidence of significant association was found between cvt patients and control subjects in any genetic model ( codominant models : cc vs. aa , odds ratio [ or ] = 0.93 , 95% confidence interval [ ci ] : 0.661.27 , p = 0.33 ; ac vs. aa , or = 0.82 , 95% , ci : 0.621.12 , p = 0.29 ; dominant model : ac + cc vs. aa , or = 0.85 , 95% , ci : 0.581.16 , p = 0.31 ; recessive model : cc vs. ac + aa , or = 1.06 , 95% , ci : 0.691.39 , p = 0.43 ) .
analysis of mthfr a1298c in cvt patients and control subjects using codominant , dominant , and recessive models as shown in table 3 , the association between mthfr a1298c genotypes and plasma total hcy levels were not significant in both cvt patients ( p = 0.92 ) and control subjects ( p = 0.78 ) , indicating lack of impact of various genotypes of this polymorphism in determining levels of plasma total hcy .
effects of the mthfr a1298c genotypes on total hcy levels in cvt patients and controls in addition , statistical analysis using t - test showed that the wild - type , heterozygote , and homozygote genotypes in patients had significantly higher plasma total hcy levels than corresponding genotypes in control subjects ( p < 0.01 ) .
the relative genotype and allele frequency in our population compared to some other populations was shown in table 4 . as shown in table 4 , the mthfr a1298c mutation is relatively prevalent in our population .
cerebral vein thrombosis is a relatively rare but severe thrombotic disorder characterized by severs clinical manifestation and a high mortality rate .
elevated plasma total hcy have been proposed as a significant risk marker for cvt in several studies .
the study by martinelli et al . demonstrated that hyperhomocysteinemia increased the risk of cvt by four - fold . in another study by cantu et al .
the estimated risk of association between hyperhomocysteinemia and cvt was reported 4.6 . in agreements with these reports ,
our study also demonstrated a positive association between hyperhomocysteinemia and cvt ( p = 0.001 ) .
plasma hcy is influenced by factors such as nutritional deficiencies , malignancies , medications , and mutations in the mthfr gene .
the a1298c mutation of the mthfr gene has been reported to result in a less active enzymatic variant that may lead to an increased total hcy and thrombosis . however
, conflicting data have been reported about the association of the mthfr a1298c mutation with hyperhomocysteinemia and cvt .
plasma hcy levels are affected with both genetic and environmental factors and it appears that the a1298c polymorphism alone does not significantly affect plasma hcy levels .
environmental factors such as folate and vitamin b12 status in different populations could significantly modify the effect of this polymorphism on plasma hcy levels .
therefore , the variable results of association studies may be explained by the presence of other genetic or environmental risk factors affecting plasma hcy levels and subsequently cvt development .
our results showed that mthfr a1298c mutation in either heterozygote or homozygote state did not affect plasma hcy levels and thus were in agreement with the results of zetterberg et al . and guant - rodriguez et al .
numerous studies have reported mthfr a1298c mutation as a significant risk factor for cvt . in the most recent case - control study ,
the frequency of mthfr 1298cc genotype in cvt patients ( 37.14% ) was significantly higher compared with control subjects ( 0% ) , ( or ) = 10.25 , 95% , ci : 5.618.7 , p = 0.001 ) .
results of the present study showed that heterozygosity or homozygosity for mthfr a1298c mutation did not confer an increased risk for cvt .
therefore , our study was inconsistent with those studies that showed significant association between mthfr a1298c mutation and cvt .
the reasons for non - consistency of association studies are numerous and many factors such as population heterogeneity , sample size , variation in study design and gene - gene , and gene - environment interactions may contribute to variable association results .
the a1298c mutation appears relatively prevalent in the iranian population and the frequency of the 1298cc genotype ( 14.67% ) in iranian population is much higher than the frequency reported for portugalian ( 5.98 ) , american ( 7.9% ) , brazilian ( 5% ) , and poland ( 4% ) populations .
however , the frequency of the 1298cc genotype in the iranian population is lower than the frequency reported for pakistan ( 23% ) and lebanese ( 23.9% ) populations . taken together , the high frequency of the mthfra1298c mutation in our population , its similar distribution between cvt patients and control subjects and its lack of impact in determining levels of total hcy , is opposite with a plausible role for this common mutation as a risk marker for cvt . in the current study , we used pcr - rflp technique for a1298c genotype analysis . in comparison to some of the newer techniques for single nucleotide polymorphism ( snp ) analysis such as dna sequencing ,
pcr - rflp is a laborious and time consuming technique that requires specific endonucleases and long time from start to completion of the analysis .
it also requires that a genetic variation creates or abolishes a recognition site for a specific restriction enzyme .
moreover , star activity may result in alteration of the specificity of restriction enzyme and in non - specific digestion of dna in non - optimized reaction condition .
in addition , pcr - rflp analysis is not suitable for high - throughput analysis .
however , in the current study we used pcr - rflp analysis for a1298c snp analysis , as it is an inexpensive and easy - to - design method that requires no expensive equipment .
we also followed exactly the instructions of kit in order to minimize the possible star activity of restriction enzyme .
the limitation of this study is the small size of the study group , so the results can be considered as preliminary .
further information is needed from more studies over the world to analyze the contribution of mthfr a1298c genotype to the risk of cvt .
based on this study , we suggest that mthfr a1298c mutation is not a significant risk marker for cvt development . | ### Summary:
: background : cerebral venous thrombosis ( cvt ) is an uncommon condition characterized by severe clinical manifestations and high mortality rate . there is limited data on the role of methylenetetrahydrofolate reductase ( mthfr ) a1298c mutation as a risk factor for cvt development in iranians.aim:the aim was to investigate a possible association between fasting plasma homocysteine ( hcy ) levels , mthfr a1298c mutation , and cvt in iranian population.materials and methods : the study population consisted of 50 patients with a diagnosis of cvt ( 2063 years old ) and 75 healthy subjects ( 1865 years old ) as control .
genotyping of the mthfr a1298c mutation and hcy measurement was carried out by polymerase chain reaction - restriction fragment length polymorphism technique and enzyme immunoassay method , respectively.results:fasting plasma total hcy levels were significantly higher in cvt patients than controls ( p = 0.015 ) .
no significant differences were observed in the mthfr a1298c genotypes frequency between cvt patients and controls ( p > 0.05 ) .
the frequency of the 1298c allele was 36% and 37.5% in cvt patients and controls , respectively and did not differ significantly between the two groups ( p = 0.16).conclusions : our study demonstrated that mthfr a1298cmutation is not a significant risk factor for cvt . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: radial polydactyly associated with triphalangeal thumb accounts for 2% of congenital anomalies of the upper limbs ( 1 ) .
radial polydactyly , the most common digital duplication in asian and white people , has a wide range of manifestations ( 2 - 4 ) .
many classifications have been proposed for describing this type of deformity . our patient had polydactyly on the radial side of the hand and the four ulnar digits with normal apearance .
the features of this patient s polydactyly did not fit any of the well - known classifications .
the differential diagnosis in such cases includes the 6-fingered hand ( nonopposable thumb ) , multiple duplication of the index finger with absent thumb , mirror hand , and the duplicate or multiple hand deformity ( 5 ) .
the original classification of radial polydactyly was published by wassel in 1969 ( 6 ) .
various changes have been made to this original scheme , but the main structure remains unchanged and it continues to be the most common classification system for this type of deformity .
analysis of our patient s deformity highlights the difficulty of fitting such rare cases into any classification system .
wassel s classification is based on the level of duplication , from distal to proximal ; uneven numbers are bifid duplication and even numbers are complete duplications ( type i refers to bifid distal phalanx and type vi to duplicated metacarpal ) .
the wassel classification is sufficient for simple radial polydactyly but a broader classification is needed to accurately classify triphalangism , triplication , and tetraplication .
wood and miura proposed additional subtypes to cover triphalangism and triplication ( 7 , 8) . in wood s classification , type iv is subdivided into two subtypes : type iva , in which both duplications have a triphalangeal component at the level of the metacarpophalangeal ( mp ) joint ; type ivb , in which the triphalangeal component is only on the radial side .
types vii a , b , and c refer to ulnar , bilateral , and radial triphalangism , respectively .
type d refers to a central triphalangeal deformity with a nontriphalangeal hypoplastic digit on each side ( known as triplication ) .
we present an unusual case of radial polydactyly not covered by any of the aforementioned types .
a 16-year - old boy was seen for assessment of a congenital anomaly of the left hand .
the 4 ulnar digits appeared normal and there was 1 separated , deformed thumb , and 3 deformed and syndactylized thumbs on the radial side ( fig .
a sinus tract on the radial side of the wrist had been present from birth ( fig .
ulnar deviation at the wrist was limited , range of shoulder motion was normal , and there was a 30 degree lack of extension at the elbow .
a- opposition of 3 radial thumbs , b- three radial thumbs in view , c- v shaped deformity of 4 thumbs , dcongenital
sinus on radial side of wrist ( base of thumb ) .
attached to the radial main thumb were 2 hypoplastic thumbs , one starting from the metacarpal and the other from the distal interphalangeal joint ( fig .
there was one metacarpal , duplicated trapezium , scaphoid , and lunate bones , and a bifurcated radius .
a degree of fusion between the two radial epiphyses produced relative shortening of the bone compared to the ulnar length at the wrist joint ( fig .
3 ) .
a , two main triphalangeal thumbs duplicated from the metacarpophalangeal joint .
b , attached to the radial main thumb are two hypoplastic branches , one from the metacarpal and the other from the distal interphalangeal joint .
e , ulnar lengthening relative to
duplicated radius bone .
a and b , anteroposterior and lateral view of left elbow .
after preoperative planning , we excised the three radial thumbs and corrected the deformed ulnar thumb by closing wedge osteotomy , shortening , and ip joint arthrodesis .
embryologically , limb buds are an outgrowth of mesoderm into the overlaying ectoderm . this bulging ectoderm , known as the apical ectodermal ridge ( aer ) , appears 26 days after fertilization ( 9 ) .
the terminal portion of the mesoderm is called the zone of polarizing activity ( zpa ) . sonic hedgehog
( shh ) , which is expressed in the posterior portion of the zpa , is the main regulator of the anteroposterior axis ( the formation of ulnar and radial structures ) ( 10 )
. zone of polarizing activity regulatory sequence ( zrs ) is a limb specific shh enhancer on chromosome 7q36 .
zrs regulates shh expression and point mutation in zrs results in exaggerated shh activity ( 11 ) .
ectopic anterior expression of shh results in various forms of preaxial polydactyly and triphalangeal thumb .
thumb triplication and triphalangeal thumbs are known to be more prevalent in populations with genetic isolates and mutations located at chromosome 7q36 ( 10 ) .
the basic defect that produces radial polydactyly , triphalangeal thumb and 6-fingered hand is the appearance of ectopic shh in the anterior mesoderm ( 12 ) .
al - qattan reviewed the pathogenesis of these malformations viewed as a spectrum of severity of embryonic events ( 11 ) .
biphalangeal duplicated thumb is usually unilateral , sporadic and resulted from developmental error can cause minor anterior shh expression .
thumb triplication , radial polydactyly with triphalangism , and isolated triphalangism are the result of moderate anterior expression of shh and are related to point mutation of zrs on the 7q36 chromosome . in animal models ,
elevated levels of shh in the radial aspect of the limb bud cause mirror hand or ulnar dimelia ( 12 ) . in humans
, there is a relationship between radial polydactyly and zrs mutations .
in the southwestern region of the netherlands , an area known for the high rate of zrs point mutation , triplication and radial polydactyly with triphalangism accounts for about one third of cases of radial polydactyly ( 13 ) , while in other populations they account for around 7% . in a study of 5 generations of a family , radhkrishna and
coworkers strongly suggest that radial polydactyly , triphalangeal thumb and duplication of the big toe can be manifestations of the same autosomal dominant gene ( 14 ) .
it is likely that other factors modify the expression of this gene . in our case
the patient had no deformity of the foot and no family history for any type of deformity .
it is likely that a gene mutation ( zrs on 7q36 chromosome ) is the cause of our patient s polydactyly .
wassel s simple classification of radial polydactyly has been generally adopted . in 1978 , wood showed that many other forms of thumb polydactyly exist , including a double triphalangeal thumb sharing common metacarpal and different patterns of thumb polydactyly with triphalangeal components .
mennen described another variant of thumb triplication ; all thumbs were fully developed but triphalangeal and shared an enlarged first metacarpal ( 15 ) .
an essential feature of the triple thumb deformity is that the extra digits be opposable or partially opposable at birth .
when the duplicated radial digits are not opposable and lie in the same plane as the other digits ( the fingers ) , the deformity is referred to as the 6-fingered hand ( 16 ) . finally hentz suggested that some cases of non - opposable triphalangeal radial polydactyly be classified as absent thumb with multiple duplication of the index , especially if the radial metacarpal shows a distal epiphyseal plate ( the normal thumb metacarpal has a proximal epiphyseal plate ) ( 17 ) .
this concept has not gained popularity , however , because epiphyseal anomalies of thumb metacarpals are not uncommon , including the presence of double epiphysis .
an essential feature of both classic and non - classic mirror hand is the presence of symmetry ( although not necessarily perfect ) around the midline . the hand deformity in our case lacked this essential feature .
on the basis of wassel s classification and adapting upton s nomenclature , zuidam et al proposed a universal classification that included combined radial polydactyly , triphalangism , deformities , and symphalangism .
t for triplication , tph for triphalangism or a ray with three phalanges ,
h for a hypoplastic or floating ray , d for deviation of duplicates from the longitudinal axis , s for symphalangism , a condition with fusion of the joint . the location of the affected ray is designated as follows;u for an ulnar ray , m for a middle ray , and
r for a radial ray ( 18 ) .
the zuidam s classification and nomenclature covers a broad range of manifestations of radial polydactyly , ( including triplication , triphalangism , hypoplastic deformities , and symphalangism ) .
duplication up to trapezium ( type viii ) is covered by this classification . in our case
there was duplication of all radial - sided carpal bones , including the scaphoid and lunate bones as well as bifurcation of the radius bone .
we propose the addition of type ix to designate duplication of all radial - sided carpal bones ( trapezium , scaphoid and lunate ) , and type x for bifurcation of the radius bone . because in the case of tetraplicated thumb , radial , middle and ulnar side are not applicable , we propose the use of the numbers 1,2,3 and 4 from radial to ulnar thumbs .
our case would thus be classified as type x te , ivu , iim tph2/4 , h1/3 . | ### Summary:
: radial polydactyly , the most common digital duplication in asian and white populations , has a wide range of manifestations .
its classification is useful for planning and assessing surgical treatment .
our patient had four thumbs , duplicated radial carpal bones , and a bifurcated radius .
this presentation is not covered by any of the current classifications . to the best of our knowledge ,
this is the first case of such characteristics reported to date .
consequently , we propose some modifications in the nomenclature and classification of radial polydactyly . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: appropriate aesthetics and desirable characteristics of acrylic resin make this material a good candidate for prosthodontic applications .
this material presents excellent aesthetic properties ; it has adequate strength , low water sorption , low solubility and low thermal conductivity and is free from toxicity .
although the properties of this material are not ideal in every respect , the abovementioned desirable features account for its popularity .
however , it has limitations including a high thermal expansion coefficient , low thermal conductivity , a low elasticity coefficient , low impact strength , and low resistance to fatigue [ 25 ] .
several researchers have demonstrated that pmma can show good fatigue behaviour and impact strength when it is reinforced by carbon fibers [ 3 , 6 , 7 ] .
also , polyethylene and sapphire fibers seem to enhance the physical properties of acrylic resin .
furthermore , physical and mechanical properties of acrylic resin , such as flexural modulus , can also be improved using metal fibers [ 3 , 8 ] .
for instance , the incorporation of silver , copper , and/or aluminium in the form of powder into the resin was found to improve its thermal conductivity , polymerization shrinkage , and water sorption [ 3 , 8 , 9 ] .
recently , autopolymerizing polymethyl methacrylate resin was reinforced with silane - treated glass fibers ; which increased the strength of the resin .
flexible resins can be considered as an alternative to conventional acrylic resins in the construction of dentures due to their advantages in terms of aesthetics and comfort .
therefore , numerous studies have been conducted to study the physical and mechanical properties of these materials . regarding the increasing advancements in nanotechnology in terms of adding nanosilver particles to an acrylic base ,
the use of nanosilver particles has been preferred to silver powder because the nanoparticles cause better processing and smoother surfaces than the silver powder . to the authors knowledge , to date
there has not been any conclusive study about the effect of the addition of nanosilver particles to the acrylic denture base on its thermal conductivity , compressive strength and tensile strength .
this experimental study was performed at the prosthodontic department of the tabriz university college of dentistry . to determine the sample size
considering the estimated thermal conductivity of acrylic resin ( similar to the acrylic resin used in this study ) to be 12.16 0.7 , =0.5 , power of 80% , and one unit of thermal difference , the ideal sample size was calculated to be 6 for each group in a total of 18 cases .
each group was then divided into two subgroups :
group a as the control group , with unmodified pmma , or pure acrylic resin powder ( triplex , ivoclar vivadent ag , lichtenstein , germany ) ; andgroup b as the test group , with pmma mixed with 5 weight% nanosilver ( model number : sp - a00601 , iran ) .
group a as the control group , with unmodified pmma , or pure acrylic resin powder ( triplex , ivoclar vivadent ag , lichtenstein , germany ) ; and group b as the test group , with pmma mixed with 5 weight% nanosilver ( model number : sp - a00601 , iran ) .
although previous studies have been conducted on metal fillers including tin , al2o3 , copper , and silver with weight percentages of 5% , 15% , and 20% , we used 5 weight% of nanosilver in order to minimize the probable unfavourable changes in mechanical and chemical properties of the denture acrylic base .
the proportional amounts of acrylic resin powder and nanosilver ( model no : spa00601 , iran ) , determined by weighing with a digital scale , were mixed in an amalgamator to achieve a homogenous mixture of pmma and nanosilver powder .
the specimens were the same size , and were thoroughly processed using emery paper with very fine particles .
the size of all specimens was measured by a micrometer with an accuracy of 0.01 mm .
the specimens had one of two shapes . some were cylindrical with dimensions similar to those of thermal conductivity measurement apparatus ( figure 1 ) .
the cylindrical specimens had a length of 38 cm and a diameter of 25 cm ( figure 1 ) .
for the preparation of these samples , cast iron flasks with the same shape and internal dimensions as the standard sample were produced . to prepare the cylindrical samples ,
a piece of special cellophane paper was placed on the paste surface , and the muffle door was inserted in place and tightened by screws .
the muffle and pmma complex were placed under the pressure apparatus , with pressure equalling 1.5 pounds to prevent bubble or void formation within the samples and to establish a pmma paste with the same interior surfaces as the muffle .
as mentioned , the samples were measured using a high - accuracy ( 0.01 m ) device .
then , they were processed using emery paper in order to remove any possible surface roughness or surface bubbles .
the alternatively shaped specimens were rectangular , with dimensions of 2 cm by 20 cm by 200 cm ( figure 2 ) .
the specimens of this shape were also flasked and heated in prepared muffles , similar to the cylindrical samples .
the cylindrical specimens were drilled by a hand - piece fissure bur to make two holes , each with a diameter of 1 mm , at a distance of 6.5 mm from the two ends ( figure 3 ) .
then , the samples were inserted in the thermal conductivity measurement apparatus ( cusson s thermal conductivity apparatus , england , figure 4 ) .
the apparatus had two thermocouple systems that entered into the two holes in the specimens .
the water flowed through the two openings of the specimens , and the difference of temperature at the two points was measured by a thermometer attached to the apparatus .
then , according to the measured parameters , the thermal conductivity coefficient ( k ) of the specimens was calculated using the following formula :
k = jml(t2t1)at(t2t3)where t = time of water flow , a = section area , l = length of the specimen , m = water volume , j = mechanical equivalent of temperature which is 0.186 j / kcal , t2 = temperature of the cold extremity , t3 = temperature of the warm extremity , t1= temperature of the water upon entrance , and t2=temperature of the water upon exit . at this phase , both the control group ( pmma ) and the test group ( pmma+ 5% of nanosilver by weight ) of the cylindrical samples were tested , and the thermal conductivity coefficient for each group was determined .
the abovementioned apparatus measured the thermal conductivity coefficient of different materials in relation to standard cylindrical specimens made of copper ( cu ) .
the standard samples ( i.e. , those specimens made of copper ) were placed in one side , and the measurable samples were inserted in a special site on the other side .
the cylindrical specimens were inserted in related points in the compressive strength measurement apparatus , the dark device , as shown in figure 5 , and were fixed by levers .
the apparatus exerted increasing compressive force on two sides of the specimens until the specimens broke ; the force at the time of breakage was transferred to the computer and analysed .
the compressive strength of the sample , displayed on the apparatus monitor , was recorded .
the samples used in the compressive strength test were cylindrical samples with dimensions of 38 mm by 25 mm , just like the samples used in the thermal conductivity test .
the rectangular specimens were inserted in relative points on a universal tensile strength measurement machine , zwick z100 , as depicted in figure 6 , and were fixed by levers .
the apparatus exerted increasing tensile force on two sides of each specimen until the specimen broke ; and the load at the time of fracture was recorded as it appeared on the apparatus monitor .
this machine has one fixed arm and one mobile arm which move to generate force against the sample .
the control samples were placed in the machine first , and were fixed at one end .
the device exerted increasing tensile force on the other end of the specimen until the specimen broke .
then , the tensile strength exerted at the time of fracture was recorded as it appeared on the apparatus monitor . after examining the control group samples , the test group samples were studied , and the tensile strength at the time of fracture was also recorded .
the cylindrical specimens were drilled by a hand - piece fissure bur to make two holes , each with a diameter of 1 mm , at a distance of 6.5 mm from the two ends ( figure 3 ) .
then , the samples were inserted in the thermal conductivity measurement apparatus ( cusson s thermal conductivity apparatus , england , figure 4 ) .
the apparatus had two thermocouple systems that entered into the two holes in the specimens .
the water flowed through the two openings of the specimens , and the difference of temperature at the two points was measured by a thermometer attached to the apparatus .
then , according to the measured parameters , the thermal conductivity coefficient ( k ) of the specimens was calculated using the following formula :
k = jml(t2t1)at(t2t3)where t = time of water flow , a = section area , l = length of the specimen , m = water volume , j = mechanical equivalent of temperature which is 0.186 j / kcal , t2 = temperature of the cold extremity , t3 = temperature of the warm extremity , t1= temperature of the water upon entrance , and t2=temperature of the water upon exit . at this phase ,
both the control group ( pmma ) and the test group ( pmma+ 5% of nanosilver by weight ) of the cylindrical samples were tested , and the thermal conductivity coefficient for each group was determined .
the abovementioned apparatus measured the thermal conductivity coefficient of different materials in relation to standard cylindrical specimens made of copper ( cu ) .
the standard samples ( i.e. , those specimens made of copper ) were placed in one side , and the measurable samples were inserted in a special site on the other side .
the cylindrical specimens were inserted in related points in the compressive strength measurement apparatus , the dark device , as shown in figure 5 , and were fixed by levers .
the apparatus exerted increasing compressive force on two sides of the specimens until the specimens broke ; the force at the time of breakage was transferred to the computer and analysed .
the compressive strength of the sample , displayed on the apparatus monitor , was recorded .
the samples used in the compressive strength test were cylindrical samples with dimensions of 38 mm by 25 mm , just like the samples used in the thermal conductivity test .
the rectangular specimens were inserted in relative points on a universal tensile strength measurement machine , zwick z100 , as depicted in figure 6 , and were fixed by levers .
the apparatus exerted increasing tensile force on two sides of each specimen until the specimen broke ; and the load at the time of fracture was recorded as it appeared on the apparatus monitor .
this machine has one fixed arm and one mobile arm which move to generate force against the sample .
the control samples were placed in the machine first , and were fixed at one end .
the device exerted increasing tensile force on the other end of the specimen until the specimen broke .
then , the tensile strength exerted at the time of fracture was recorded as it appeared on the apparatus monitor . after examining the control group samples , the test group samples were studied , and the tensile strength at the time of fracture was also recorded .
table 1 shows the results of independent t - test for assessing the effect of nanosilver on the thermal conductivity , tensile strength and compressive strength of polymethyl methacrylate .
the results showed that : the test group had significantly higher thermal conductivity than the control group .
although previous studies have been conducted on metal fillers including tin , al2o3 , copper , and silver with weight percentages of 5% , 15% , and 20% , we used 5% weight of nanosilver in order to minimize the probable unfavourable changes in mechanical and chemical properties of the acrylic base of the denture .
since polymethyl methacrylate ( pmma ) shows excellent appearance , ease in processing , and reparability , it can be considered as an excellent currently available denture base material , which is most commonly used for the fabrication of complete dentures .
therefore , it is used broadly in prosthetic dentistry [ 2 , 3 , 12 , 13 ] . however , its application is restricted due to its relatively poor thermal and mechanical properties [ 1316 ] .
some inherent disadvantages of pmma are its low thermal conductivity ( 5.710 - 4oc / cm2 ) , which is three times lower than that of metals and patient ( especially first - time users ) dissatisfaction .
furthermore , its high coefficient of thermal expansion causes the release of internal stress , resulting in dimensional inaccuracy and a relatively low modulus of elasticity , leading to rapid deformation at low stress .
mucosal irritation caused by the release of pmma has also been reported [ 1 , 19 ] .
three different procedures have been considered in order to improve the impact properties of pmma . :
( 1 ) development of an alternative material to pmma ; ( 2 ) chemical modification of pmma by creating transverse bands or by adding a rubber graft copolymer and ( 3 ) reinforcement of pmma with other materials such as carbon fibers , glass fibers , and ultra - high modulus polyethylene , tin , or aluminium .
hence , its low impact and flexural strength should be improved when it is used in the acrylic resin prosthesis [ 3 , 13 ] . reinforcing the resin
can be assumed as a solution in this regard . a durable repair approach for denture base fracture
is desired in order to avoid recurrent fracture .according to several research studies , patient acceptance of denture prostheses can be affected by physical properties of denture base materials [ 12 , 13 , 17 , 20 ] .
denture base acrylic resins have low thermal conductivity as compared with denture base metal alloys .
the thermal conductivity of the denture base also plays an important role in parotid gland secretory function , and in gustatory and digestive responses to thermal changes of hot and cold foods in the mouth .
the secretory function of the parotid gland increases with an increase in palatal tissue temperature .
it has been shown that the thermal conductivity of denture base acrylic resin increases by the addition of 15 volume% of thermally conductive sapphire ( al2o3 ) whiskers .
different materials such as metal fillers and ceramics have been used to solve this problem . mixing the acrylic resin with al2o3 at two different weight percentages ( 15 wt% and 20 wt% ) significantly increased the thermal conductivity and the rate of acrylic base warming .
because of the low thermal conductivity of pmma ( 5.710 - 4oc / cm2 ) and the acrylic resins used in dentures , fillers of various metals including silver ( with a thermal conductivity of 1000oc / cm2 ) , aluminium , and copper particles have been used at various weight percentages for increasing the thermal conductivity of acrylic resins [ 11,2123 ] .
sehajpal and sood showed that the thermal conductivity of pmma can be increased by 4.53 , 4.43 , and 4.04 times , respectively when fillers of silver , aluminium , and copper particles at 25% concentration are added to pmma .
nanosilver particles were applied in the present study to increase the thermal conductivity of the acrylic resin .
this choice was initially made because of silver s ( ag ) higher thermal conductivity , as mentioned above .
recently , there have been advancements in the production of heat conductor ceramics such as sapphire ( al2o3 ) , silicon nitride , boron nitride , and aluminium nitride , which all have thermal conductivity levels close to those of metals .
therefore , they have been used as fillers in acrylic resin powders , due to their advantages of having high thermal conductivity , as well as low density and white colouring ; which have the least effect on denture base appearance .
have stated that the thermal conductivity , impact strength , compressive strength , and warping of pmma could be improved when 5 volume% of these metal powders is added to pmma .
tin powder was superior to aluminium powder in improving the impact and compressive strength of pmma ; while aluminium powder was superior to tin powder in improving the thermal conductivity of pmma ( 44% vs. 31% , respectively ) and decreasing its warping .
therefore , it can be concluded that physical and mechanical properties of pmma will be improved by using metal - filled resin .
messersmith et al . added sapphire ( al2o3 ) to conventional denture base acrylic resin at 9.35 volume% and 15 volume% .
the thermal conductivity and transverse strength of the sapphire - containing composites were significantly higher than those of the unmodified acrylic resin .
thermal conductivity was found to depend on the volume percentage of cylindrical fillers , as well as on the innate conducting properties of al2o3 , denying the role of spherical fillers in increasing the thermal conductivity .
the findings of the present study suggest that spherical fillers can also significantly increase the thermal conductivity of pmma , because the nanosilver particles have a spherical shape .
overall , thermal conductivity , as one of the most important characteristics of the denture base , plays a major role in the secretions of salivary glands and enzymes , the taste of the food , and the gustatory response [ 11 , 20 ] . adding 5 wt% to 20wt% of aluminium oxide powder ( al2o3 ) filler increases the flexural strength and thermal conductivity of heat - polymerized acrylic resin [ 11 , 23 ] .
the addition of silica to pmma denture base materials does not produce a significant improvement in the transverse bend or impact strength of the dentures , as compared to conventional heat - cured acrylic resins . according to nagai , transverse strength and the modulus of elasticity in repaired acrylic specimens
the transverse and impact strengths of heat - polymerized denture base resin were also increased when metal wire and glass fibers were utilized as reinforcements [ 12 , 13 ] .
moreover , the flexural strength of specimens reinforced with continuous unidirectional glass fibers was significantly higher than that of metal wire or woven fiber reinforcements .
however , using zirconium powder as reinforcement for high - impact acrylic resin increased the transverse and impact strengths of the resin significantly .
the compressive strength of pmma increased with the addition of silver , aluminium , and copper fillers , while the tensile strength decreased .
the disadvantages of metal - filled acrylic resin include heavy weight , relining problems , decreased tensile strength , increased density , and cosmetic problems .
vallittu and vallittu and lassila showed that the bonding of metal wire to acrylic resin enhanced the fracture resistance of specimens ; while the different positions of the wires had no effect on the fracture resistance [ 27 , 28 ] .
some researchers have used various metal wires for this purpose , including aluminium and aramid , and concluded that these additions enhanced the fracture resistance of the acrylic base [ 11 , 20 ] .
. showed that glass fiber reinforcement significantly enhanced both the flexural strength and the flexural modulus of pmma .
another restriction of pmma application is due to its low fracture resistance , which should be improved when it is going to be utilized as denture base material .
various methods have been used to reinforce acrylic denture base material in order to repair fractures in complete dentures .
nevertheless , reinforcement of pmma by metal plates showed insignificant effect on the transverse strength of the restoration [ 3034 ] .
macroscopic retention of the metal strengtheners to the pmma had only a minor effect on its strength , in contrast to microscopic retention , which had a marked effect .
chemical bonding between the pmma and the metal reinforcement has been shown to enhance the strength of the prosthesis , with some exceptions .
heat - polymerizing acrylic resin has been the most common denture base material for more than 60 years .
however , the mechanical strength of acrylic resin is not sufficient to maintain the longevity of dentures .
one frequent problem that occurs with denture bases is fracture caused by such factors as poor fit of the denture base , poorly balanced occlusion , and stress on the denture base after years of use [ 25 , 32 , 33 ] .
john et al . performed an in - vitro study to determine whether the flexural strength of conventional acrylic resin is less than that of the same resin when reinforced with glass , aramid , or nylon fibers .
flexural strength was improved when the acrylic resin was reinforced by different fibers . in this
regard , acrylic resin showed the highest flexural strength when glass fibers were used as reinforcement in comparison with acrylic resin reinforced by aramid and then nylon .
the incorporation of nanosilver ( antibacterial agent ) in denture base resin can inhibit oral pathogens from colonizing on the denture base and keep dentures clean , though it had no significant influence on the mechanical properties of denture base resin .
after culturing for 24 hours , 75% of streptococcus mutans and 49% of candida albicans were inhibited separately . considering the use of 5 wt% , 15wt% , and 20wt% aluminium oxide , copper , and silver powder in recent studies [ 3 , 11 , 20 , 23 ] , this study was performed using 5 wt% nanosilver in order to minimize the probable adverse effects on the mechanical and chemical properties of the acrylic base .
we found unfavourable brownish discoloration of the dentures to be the most significant problem with this low percentage of nanosilver powder .
the other reason for choosing such low percentage of nanosilver was to significantly lower the patient costs for the dentures containing nanosilver particles . adding 5 wt% of nanosilver powder to pmma improved its thermal conductivity .
this improvement was probably due to the uniform distribution of metal particles within the pmma . to reach this goal ,
the nanosilver and acrylic powders were poured into an amalgamator mixer to mix the fine particles and produce a uniform mixture . in similar studies , adding 5 wt% of silver , copper , and aluminium to pmma improved its thermal conductivity , although it decreased its tensile strength [ 22 , 35 ] . in sehajpal and sood s study , adding silver , aluminium and copper droplets by 5 volume% increased the compressive strength of the denture base by up to 2.5% ; while increasing the particle ratio to 20% was associated with greater increase in compressive strength .
increased the compressive and impact strengths of the denture base by adding metal ( aluminium and copper ) droplets by 5 volume% .
we also obtained similar results . in the present study , adding 5 wt% of nanosilver powder to pmma improved its thermal conductivity ( by 3.3% ) and compressive strength ( by 18.6% ) , but decreased its tensile strength ( by 13.4% ) .
this study was conducted to evaluate the effect of adding nanosilver particles to pmma in terms of three properties of acrylic resin .
results showed that the addition of nanosilver particles significantly increased the thermal conductivity and compressive strength of the acrylic base , while decreasing its tensile strength .
considering the obtained results and the effect of nanosilver particles on increasing the thermal conductivity and compressive strength of the acrylic base , adding these particles to the palatal portion of the acrylic base of a total maxillary denture is recommended . since adding nanosilver particles by 5 wt% decreased the tensile strength of the acrylic resin ,
it is recommended that this study be repeated with different mixtures of various percentages of nanosilver particles , in order to determine the best weight percentage that minimizes this disadvantage . | ### Summary:
: objective : polymethyl methacrylate ( pmma ) , widely used as a prosthodontic base , has many disadvantages , including a high thermal expansion coefficient and low thermal conductivity , a low elasticity coefficient , low impact strength and low resistance to fatigue .
this study aimed to make an in vitro comparison of the thermal conductivity , compressive strength , and tensile strength of the acrylic base of complete dentures with those of acrylic reinforced with nanosilver.materials and methods : for this study , 36 specimens were prepared .
the specimens were divided into three groups of 12 ; which were further divided into two subgroups of control ( unmodified pmma ) and test ( pmma mixed with 5 weight% nanosilver).the results were analysed by independent t-test.results:this study showed that the mean thermal conductivity and compressive strength of pmma reinforced with nanosilver were significantly higher than the unmodified pmma ( p<0.05 ) , while the tensile strength decreased significantly after the incorporation of nanosilver ( p<0.05).conclusion : considering our results suggesting the favorable effect of silver nanoparticles on improving the thermal conductivity and compressive strength of pmma , use of this material in the palatal area of maxillary acrylic resin dentures is recommended . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: as a new class of potential fluorescence probes , quantum dots ( qds ) have attracted great interests of the researchers because of their unique and excellent properties over traditional fluorescent dyes and fluorescent proteins [ 13 ] . compared to conventional organic fluorescent dyes ,
qds possess higher photoluminescence ( pl ) , excellent quantum yield ( qy ) , size - dependent tunable luminescence wavelength , wide continuous absorption , narrow fluorescence band , and better photostability . over the past two decades
, great efforts have been focused on the development of sensors [ 48 ] based on qds , and the detection of metal ions is the active field .
some researchers have realized the specific detection of metal ions through modification of qds with different surface - attached ligands [ 913 ] , such as the detection of cu ions through thioglycerol - capped cds qds and mercaptopropionic acid - coated core / shell cdte / cdse qds , the detection of zn ions through l - cysteine - capped cds qds , the detection of ag ions through thioglycolic acid - coated cdse qds , the detection of cu and ag ions through peptide - coated cds qds , and the detection of pb ions through glutathione - capped zncdse and cdte qds . as one of the most toxic heavy metals and persistent contaminants which can not be biodegraded in ecosystem [ 14 , 15 ] , mercuric ion ( hg ) requires new and efficient detection methods .
the major challenges in developing qds - based hg probe are the preparation of water - soluble qds with high luminescence quantum yield and the selectivity of the system [ 1619 ] .
herein , through hydrothermal route , a series of high - quality n - acetyl - l - cysteine- ( nac- ) capped qds with excellent water solubility , stability , and high qy ( the average qy is 50% ) have been synthesized [ 2022 ] . based on the prepared nac - capped cdte qds as the fluorescence probe , a rapid , cost - efficient , sensitive , and selective detection method for hg(ii )
ions has been developed in which hg(ii ) efficiently quenches the fluorescence of qds and produces a new peak in near - infrared area . since size effect is a basic characteristic of semiconductor nanocrystals ,
the proposed hg(ii ) detection mechanism was also deduced through fluorescence spectrum , ultraviolet absorption spectrum , and x - ray photoelectron spectrum ( xps ) .
cdcl2h2o , hg ( clo4)2 , rhodamine 6 g , and sodium borohydride ( nabh4 ) were obtained from aldrich .
deionised distilled ( di ) water prepared from a milli - q - ro4 water purification system ( millipore ) was used and purged with nitrogen ( n2 ) for 30 min before use .
nabh4 was used to react with tellurium with a molar ratio of 2 : 1 in di water to prepare sodium hydrogen telluride ( nahte ) .
cdcl2 ( 1.25 mm ) and nac ( 1.56 mm ) were dissolved in 40 cm of di water in an ice - water bath .
the precursor solution was adjusted to ph 9 by stepwise addition of 1.0 m naoh at 4c .
subsequently , a fresh nahte solution at 0c was added to the above prepared precursor solution and stirred vigorously . the molar ratio of cd : te : nac was fixed at 1.0 : 0.2 : 1.2 .
finally , the solution was put into a 40-cm teflon - lined stainless steel autoclave .
it was loaded in an oven at 200c for a specified time ( 3050 min ) and then cooled to the room temperature by a hydrocooling process . to remove nac - cd complexes at the end of the synthesis ,
cold 2-propanol was added to the reaction mixture to precipitate nac - capped cdte qds .
the as - prepared products were dried overnight under vacuum at 40c for further experiments .
5.0 m of cdte qds in 50 mm tris - hcl buffer at ph 7.8 was used , and the excitation wavelength was 450 nm .
rhodamine 6 g in ethanol was chosen as the reference standard ( qy = 95% ) .
uv - visible absorption spectra were acquired with a varian cary 100 scan uv / visible spectrophotometer .
photoluminescence spectra were recorded on a photon technology international qm4 spectrofluorometer equipped with a thermoelectrically cooled ingaas photodiode for near - infrared ( nir ) region measurement .
xps measurements were acquired with a leybold heraeus skl 12 x - ray photoelectron spectrometer .
figure 1 shows the fluorescence spectra of nac- capped cdte qds ( em = 565 nm ) in hg(ii ) ions titration experiments ( in 50 mm tris - hcl buffer at ph 7.8 ) . as shown in figure 1 , hg(ii ) ions can efficiently quench the pl intensity of cdte qds . with the addition of hg(ii ) ions , the pl peak intensity at 565 nm decreases with a slight bathochromic shift of pl spectrum .
when hg(ii ) ions concentration is increased to 1.0 m , the pl peak intensity reduces to only a few present of its original value
. meanwhile , new emission peak appears at 700900 nm , and its fluorescent intensity increases with the addition of hg(ii ) ions ( inset of figure 1 ) .
the relationship between fluorescence intensity of cdte qds and concentration of hg(ii ) ions can be described by stern - volmer plot as follows :
( 1)ioi=1+ksv[q ] ,
where io and i are the pl intensities of cdte qds in the absence and presence of quencher q , [ q ] is the hg(ii ) ion concentration , and ksv is the stern - volmer constant .
figure 2 describes a stern - volmer quenching curve with io / i as a function of hg(ii ) ion concentration , and a very good linearity is observed in the lower concentration range .
the linear rang is from 20 to 430 nm with ksv at 5.49 10 m. the limit of detection is 8.0 nm which is determined on the basis of three times the standard deviation of six replicate measurements of the quenched pl intensity by the addition of 30 nm hg(ii ) .
however , when the concentration of hg(ii ) ions is higher than 430 nm , the line is curved upward because of superquenching effect ( vide infra ) . to study the selectivity of the system , we investigated the influences of common biological metallic ions on the fluorescence intensity of nac - capped cdte qds .
as shown in figure 3 , most common metallic ions , including li , na , k , ca , mg , zn , cd , pd , fe , pb , and cu , exhibit no significant effect on the fluorescence intensity of qds even at relatively high concentrations , while hg exhibits strong quenching ability to the intensity even at low concentration .
in particular , with the addition of hg ions , there appears a new emission peak at the nir region 700900 nm , and no other metallic ions produce the similar phenomena .
different from other traditional fluorescent probes which only rely on the fluorescence change of the qds , the newly appearing pl peak ensures excellent selectivity in detection of hg ions .
furthermore , a series of different - sized qds were chosen to study the impact of qds diameter upon the position of the new peak .
as shown in figure 4 , the newly appeared peaks appear at the relatively fixed position regardless of the difference of qds diameters , showing that the wavelength of the new peak is irrelevant to the size of qds .
however , the smaller - sized qds can be more easily quenched by hg(ii ) ions , and the intensity of newly appeared peak is stronger , which is beneficial to the excellent sensitivity of the system .
it is known that the fluorescence intensity of smaller - sized qds can be easily influenced by the environment and other interfering materials , greatly limiting the selectivity of the system .
therefore , to ensure both good sensitivity and selectivity , this paper chooses nac - capped cdte qds with their emission peak at 565 nm . to explain the difference in linearity of the system in low and high hg(ii ) concentrations
, we proposed two interaction modes between nac - capped cdte qds and hg(ii ) with the increase of hg(ii ) ions . when hg(ii ) ions concentration is relatively low ( < 430 nm ) , the hg(ii ) ions interact with the carboxylate moiety of ligand ( nac ) on the surface of cdte qds by electrostatic forces .
when the concentration further increases ( > 430 nm ) , hg(ii ) ions would further interact with cdte qds , displacing the cd in the cdte to form alloyed cdxhg1xte ncs .
these surface changes of nac - capped cdte qds , on one hand , increase surface defects of qds and render luminescence quenching of qds ; on the other hand , by facilitating nonradiative e / h annihilation acting as electron - hole recombination centres and decreasing radiative e / h annihilation ( luminescence ) , these alloys cdxhg1xte ncs lead to superquenching of the original qds .
meanwhile , the formation of cdxhg1xte ncs increases the original diameter of nac - capped cdte qds and narrows the band gaps of these ncs , producing an obvious bathochromic shift of the pl spectrum at 700900 nm .
in which the formation of ultrasmall particle ag2se on the surface of cdse qds was proved after the addition of ag , during their study of functionalized cds qds as selective ag probe .
figure 5 displays the absorption spectra of nac - capped cdte qds with the addition of hg(ii ) ions , in which the absorption peak red - shifts with the increase in hg(ii ) concentration , inferring the formation of larger cdxhg1xte ncs . to further confirm our proposition ,
xps was used to analyze the surface components of qds after the addition of hg(ii ) ions .
xps is known as a surface analytical tool that is sensitive to the atomic composition of the outermost 10 nm of a sample surface
. a larger amount of hg(ii ) ions was added into qds solution , and the resultant product was precipitated by cold 2-propanol . the product was washed and dried overnight for xps measurement .
if hg(ii ) ions combine only with the ligands on the surface of nac - capped qds , they will be removed by the addition of 2-propanol , while if hg(ii ) ions bind directly onto the surface of cdte qds and form alloyed cdxhg1xte ncs , they will be precipitated out .
the appearances of characteristic cd ( 3d5/2 ) peak at 404.8 ev and te ( 3d5/2 ) peak at 572.2 ev are depicted in figure 6 .
the typical binding energies for the hg ( 4f ) peaks at 101.0 and 105.0 ev confirm the presence of hg on the cdxhg1xte ncs ( figure 6(c ) ) .
the selective detection of hg(ii ) ions through the interaction of hg(ii ) ions and nac - capped cdte qds has been realized in our system .
the fluorescence intensity of cdte qds can be remarkably quenched by the addition of hg ions , and there appears a new peak at about 820 nm . the linear response range and the limit of detection are 20430 and 8.0 nm hg(ii ) , respectively .
the influence of most physiologically important metallic cations upon the system , including li(i ) , na(i ) , k(i ) , ca(ii ) , mg(ii ) , zn(ii ) , cd(ii ) , pd(ii ) , fe(iii ) , pb(ii ) , and cu(ii ) , was tested to prove the selectivity of the system .
we further proposed that the possible mechanism for the new peak is that hg(ii ) ions displace the cd in the cdte and form alloys cdxhg1xte ncs , which has been proven by ultraviolet absorption spectrum and x - ray photoelectron spectrum . | ### Summary:
: a simple , rapid , and specific method for hg(ii ) detection has been proposed based on the fluorescence change of n - acetyl - l - cysteine - capped cdte quantum dots ( qds ) . the presence of hg(ii ) ions could quench the fluorescence of qds at 565 nm and meanwhile produce new peak in 700860 nm wavelength range .
the linear response range is 20430 nm with the detection limit at 8.0 nm hg(ii ) .
it was found that the position of the new peak was irrelevant to the size of qds .
furthermore , the mechanism of the quenching of qds fluorescence by hg(ii ) and the appearance of new peak in near - infrared area were also discussed and deduced through ultraviolet absorption spectrum , fluorescence spectrum , and x - ray photoelectron spectrum . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: the darwin plant dionaea muscipula has developed bilobed traps at the leaf tip to allow the capture of small animals .
this insect - dominated diet enables the venus flytrap to overcome the limitations of its soil nutrient - poor habitats .
insects in search of food are attracted by odorants produced by the flytrap ( kreuzwieser et al . , 2014 ) , and
when visiting the capture organ they inadvertently stimulate mechanosensitive trigger hairs , causing the firing of action potentials ( aps ) . two consecutive aps result in the release of viscoelastic energy stored in the peculiar biomechanics of the capture organ .
the trap closes within a fraction of a second , trapping the visitor ( forterre et al .
by trying to escape the cage , the prey animal repeatedly touches the mechanical sensors , stimulating the capture organ to fire further aps .
this ongoing electrical excitation causes the closed trap to hermetically seal and flood the resulting green stomach with a digestive enzyme cocktail ( bhm et al . , 2016 ) .
during the absorption phase , macromolecule degradation products and minerals derived from the prey are internalized by the trap ( scherzer et al . , 2013 , kruse et al . , 2014 , gao et al . , 2015 , scherzer et al . , 2015 ) .
in non - carnivorous plants , such minerals are only accessible from the soil and are taken up by the roots in a highly selective manner .
sodium that is toxic in high concentrations is mostly left behind in glycophytes and deposited in halophytes ( shabala et al . , 2014 ) .
in contrast , d. muscipula gland cells take up sodium from digested sodium - rich insects , and we have very recently identified the molecular nature of the flytrap - associated na transport entity as an ortholog of the trk / ktr / hkt family ( bhm et al . , 2016 ) .
when the corresponding flytrap gene was expressed in xenopus oocytes , the recorded na dependent currents carried the hallmark features of a sodium channel .
glycine polymorphisms in certain members of the trk / ktr / hkt family have been associated with proton- and sodium - driven potassium co - transport , we asked how hkt1 mutations of polymorphic sites affect sodium channel function in dionaea . to answer this question , a structure model of the dmhkt1 sodium - selective pore
was obtained by homology modeling , and serine residue mutants were generated and functionally analyzed .
thus , we reveal and discuss the transport features of the sodium - selective dmhkt1 channel .
dmhkt1 is particularly expressed in digesting glands , known to be responsible for nutrient and mineral uptake .
seawater - like sodium loads are known to be toxic for growth and development in non - halophytic plants ( luan et al . , 2009 ) .
to study the response of this halophyte - like behavior , we exposed glands to the salinities that halophytes can experience , and followed the plasma membrane electrical responses .
exposure to na concentrations up to 60 mm na depolarized the gland cells from 140 to 60 mv ( supplemental figure 1a ) , thereby crossing the ap threshold of about 100 mv ( beilby , 2007 ) .
when increasing the sodium concentration to near seawater levels of 3% ( 510 mm ) , balotin and dipalma ( 1962 ) observed spontaneous action potential firing induced in the leaf of dionaea .
reconstructing this scenario enabled us to follow the membrane electrical response resulting from exposure to high salinity using attached voltage - recording surface electrodes and intra - gland cell microelectrodes . prior to saline treatment ,
aps in resting traps were elicited by bending a touch - sensitive trigger hair ( figure 1a ) . upon exposure to 3% nacl , the gland cells depolarized by about 30 mv from their resting state of 120 to 140 mv ( figure 1b ) , superimposed by single aps . with continuing high saline stimulation
, multiple aps appeared , the frequency of firing increased and , after about 1 min , the gland cells entered a phase dominated by a self - sustained oscillatory electrical activity ( figure 1a and 1b ) . in this phase , the intracellular voltage - recording electrodes monitored up to 20 aps per minute .
in contrast to animal nerve cells , the size and profile of these aps did not change significantly , even when traps were exposed to 510 mm na .
this indicates that na fluxes neither participate in nor influence the characteristic shape of the ap ( figure 1c ) .
certain homologs of the archetype trk / ktrs , such as plant hkts , are capable of transporting sodium ions ( hauser and horie , 2010 , waters et al . , 2013 ) .
based on alignments with selected trk / ktr / hkt protein sequences from bacteria and plants ( corratge - faillie et al . , 2010 , hauser and horie , 2010 , ali et al . , 2012 , gomez - porras et al . , 2012 ) , we analyzed the dmhkt1 phylogenetic relationship with other trk / ktr / hkt proteins and classified the dionaea channel as a member of the hkt subclass 1 , with closest homology to hkt1.1 and hkt1.2 from eucalyptus ( bhm et al . , 2016 ) .
interestingly , wheat tahkt1 ( now grouped in subclass two renamed tahkt2 ; platten et al . , 2006 ) , when expressed in the xenopus oocyte system , was found to couple k uptake to h , as well as na influx in a co - transporter - like manner ( schachtman and schroeder , 1994 , rubio et al . , 1995 ) .
in addition , hkt from rice has been proposed to transport calcium ions ( lan et al .
, 2010 , horie et al . , 2011 ) . to quantify the kinetics of sodium transport through gland cells , as well as to test for na / k flux coupling
, we used the microelectrode ion flux measuring ( mife ) technique ( shabala et al . , 1997 ,
mm k , we increased the extracellular na concentration stepwise from 0 to 50 mm and determined the net flux changes of the two cations . when this experimental scenario was applied to non - stimulated traps , no concentration - dependent fluxes of either na or k were observed .
only when traps were pre - treated with the prey surrogate coronatine ( cor ) was the increase in external na level followed by a concentration - dependent influx of sodium ions ( figure 2a ) . importantly , the k flux remained unaffected under these conditions , indicating that na and k fluxes are not coupled to each other . to determine whether na transport in gland cells is coupled to a proton flux , we varied the external proton concentrations during in planta current - clamp measurements .
as depicted in supplemental figure 1a , the sodium - induced depolarization triggered at ph 6 remained unaffected when the ph was shifted to 4 and vice versa .
that the mife - detected net sodium flux into stimulated traps remained unaffected by a 10 000-fold change in the proton - motive force ( figure 2b ) demonstrates that dionaea gland cells operate an electrogenic na flux as opposed to h / na co - transport .
when we determined the chord conductance of dmhkt1 expressed in oocytes , we found no conductance toward any monovalent cation , apart from na ( figure 2c ) . a near nernstian behavior of a 55-mv shift in reversal potential per 10-fold change in extracellular na concentration ( bhm et al . , 2016 ) is in line with our notion for dmhkt1 operating as a sodium - selective ion channel .
also , the sodium - driven current in dmhkt1-expressing oocytes was not affected by ph changes between values of 4 , 6 , and 8 ( supplemental figure 1b ) .
thus , in the heterologous expression system , dmhkt1 functions similarly to the ph - independent na - selective uptake system of dionaea glands , as characterized herein .
furthermore , the sodium influx in dmhkt1 oocytes was rather insensitive to the addition of calcium to the extracellular medium ( figure 2d ) .
this result indicates that dmhkt1-based na transport neither is modulated by ca ions nor is the dionaea sodium channel itself permeable to ca .
the findings described above document that the flytrap hkt1 does not represent a co - transporter coupling na fluxes to those of k , h , or ca . in this respect , dmhkt1 seems to share its na selectivity with the trk / ktr / hkt - type isoforms grouped in subfamily 1 ( ali et al .
a characteristic of all members of this subfamily is that they carry a serine residue in their first pore loop .
in contrast , k - permeable trk / ktr / hkts , such as the wheat , barley , and rice orthologs belonging to subfamily 2 , frequently have a glycine in the respective position ( supplemental figure 2 ) .
when this particular serine residue in dionaea hkt1 was replaced by glycine , the na conductance ( in 100 mm na and at vm = 140 mv ) dropped by about 75% .
in addition , the mutant channel gained a pronounced conductance for k ( figure 3a ) .
when increasing the kcl concentration stepwise to 100 mm , maximal conductance of the s84 g was reached at 50 mm k ( figure 3b ) .
this effect could be related to the k self - inhibition known from ion channels in the animal system ( sheng and kleyman , 2003 ) and from the k / na transporter ( hvhkt2 ; 1 ) of barley ( mian et al . , 2011 ) .
because of this self - inhibition effect under high k concentrations ( figure 3b ) , currents mediated by the mutant were of similar amplitude in either 100 mm na- or k - based media ( figure 3a ) .
when decreasing the concentrations of the alkali cations k and na from 100 to 10 mm , dmhkt1 s84g - mediated inward k currents were twice as high as those of na . in the presence of na and k , current amplitudes were additive ( figure 3c ) .
this indicates that in dmhkt1 , the serine - to - glycine mutation alters the permeability of na relative to k. to study the nature of sodium - potassium interdependence , we exposed dmhkt1 s84 g to a stepwise increase in sodium concentration in the presence of 10 mm extracellular potassium . with increasing sodium concentrations , the wild - type na conductance showed a saturation curve with a km(na ) of 44.0 4.4 mm , while the na conductance of the mutant channel increased linearly ( figure 3d ) .
the na conductance of wild - type dmhkt1 was largely unaffected when the na was at constant levels alongside a variable external k content .
however , the serine - to - glycine mutant exhibited a saturation curve defined by a km(k ) value of 23.5 7.24 mm ( figure 3e ) . a constant na concentration of 10 mm increased the km(k ) 2.6-fold over the km(k ) value ( 9.01 1.99 mm ) obtained with pure k solutions ( figure 3b ) .
interestingly , under these conditions we did not observe the self - inhibition of dmhkt1 s84 g ; this could only be found in the sodium - free k solution ( figure 3b ) .
these observations lead to the conclusion that , because of the weak sodium conductance in the mutant , the presence of this ion hinders potassium from passing the pore . to study ion permeation through the na / k - permeable dmhkt1 mutant s84 g
, we used an approach based on the anomalous mole fraction effect ( amfe ) for both alkali cations ( figure 3f ) .
we tested dmhkt1 s84 g , which , as shown above , is permeable to both na and k ions . in this approach , the total concentration of the mixture ( [ na ] plus [ k ] )
is fixed to 50 mm , while the mole fraction [ na]/([na ] plus [ k ] ) is altered ( takeuchi and takeuchi , 1971 , neher , 1975 ) .
the current through the pore of dmhkt1 s84 g measured is mediated by the motion of the ions through the selectivity filter .
for some channels , the conductance of the mixture is lower than the end - point conductance for single ions , which is described as amfe .
nonetheless , in the dionaea dmhkt1 s84 g , a linear decrease in influx was observed when 50 mm k was continuously replaced by na ( figure 3f ) , and no amfe was detectable .
this finding indicates that the pore of the dmhkt1 channel contains a maximum of one ion at a time , as opposed to allowing k and na to interact during the pore transition process by sharing binding sites .
thus , the nature of the side chain at position 84 is key to the selectivity filter of dmhkt1 .
the serine in the dionaea wild - type channel restricts alkali metal cation permeation to na , while a glycine residue at this position leads to preferential k permeation .
consequently , it can be concluded that the glycine residue found in the pore of subfamily two of hkt1-like molecules leads to a higher affinity for k than na in these transporters .
to gain first structural insights into the architecture of the selectivity filter in dmhkt1 , we calculated the binding - site location for the monovalent cation as described by scherzer et al .
( 2013 ) . assuming a single binding site , as indicated by the michaelis
menten kinetics of dmhkt1 s84 g ( figure 3b ) , and a k concentration at this point that is in electrochemical equilibrium with the bath medium , we located the k - binding site in dmhkt1 s84 g at ( = 0.37 0.012 ) 37% within the membrane electrical field relative to the extracellular face of the dionaea channel ( figure 4a , insert ) . to study the alkali metal binding site(s ) in the pore of wild - type dmhkt1 and the mutant s84 g in more detail , we performed homology modeling using the structure of the bacterial trk / ktr / hkt ion channel ktrab from bacillus subtilis ( vieira - pires et al .
in contrast to the classical k ion channels of the kcsa family , which comprise four identical subunits , trk / ktr / hkt - type ion channels consist of one single chain ; thus the pore , built from four loops , is inherently asymmetric .
analysis of the pore signature from the ktrb template structure of b. subtilis , however , reveals four - fold pseudo - symmetry with an apparently invariant glycine residue present in all four pore - lining loops close to the extracellular entrance of the channel .
in contrast to k ion channels of the kcsa family , hkt ion channels contain only one metal ion coordination site in the pore formed by a double ring of main - chain carbonyl groups located on the four pore loops ( figure 4a4e ) , as is apparent in the structure of b. subtilis ktrb ( pdb : 4j7c ) .
using our model of dmhkt1 ( figure 4a ) , the metal ion coordination site in the pore can be estimated at 35% within the membrane viewed from the channel 's extracellular face .
thus , the electrophysiological and structural approaches consistently locate the selectivity filter at the same position ( figure 4a ) .
close to this spot , the homology modeling also showed that the central glycine residue , which is present in the first pore loop of the template ktrb , is replaced by a serine , ultimately affecting the pore geometry and , hence , metal ion coordination ( figure 4b4d ) .
modeling suggests two possible orientations for serine 84 : one where the side - chain hydroxyl group is inside the na - conducting pore ( figure 4c ) , and the other where it points away from the pore interior .
to test whether the orientation of the hydroxyl group is key for na / k discrimination , we introduced an alanine into position 84 ( figure 4e ) .
the small alanine lacks the polar side - chain hydroxyl group , but in contrast to a glycine residue it nevertheless enforces the channel to adopt the same backbone conformation within the metal - coordinating double carbonyl ring , as with serine ( figure 4e and supplemental figure 3 ) .
the dmhkt1 mutant s84a , when expressed in xenopus oocytes , was still permeable to na and k , similar to the mutant s84 g .
however , the k influx was only half that observed with s84 g ( figure 4f ) .
these findings suggest that the hydroxyl group of the serine residue of wild - type dmhkt1 does indeed participate in cation selection , and is therefore likely to be oriented into the pore interior .
a mole fraction experiment is a very powerful tool for determining whether only one ion occupies the selectivity filter at a time , or whether the selectivity filter can hold several ions that then interfere with each other during ion channeling in the pore .
an amfe is usually interpreted in a multi - ion model where different ions compete for multiple binding sites , often resulting in flux coupling ( hille , 1992 ) .
our finding of the absence of an amfe shows that the channel contains , at most , only a single ion at a time .
together , our combined molecular modeling and mutational analysis on dmhkt1 and structural data available for other members of the hkt family provided insights into how ion selectivity in this channel family is achieved ( see also supplemental figure 2 ) .
ion channel isoforms of this family , which are capable of transporting potassium , share four glycine residues in the center of the four pore - lining loops .
the special backbone conformation introduced into the loop segments by these glycine residues allows the formation of two stacked main - chain carbonyl rings , which yields a potassium - selective metal - coordination site .
in contrast to those isoforms , dmhkt1 , in which the first pore loop harbors a serine residue instead , is highly sodium selective .
the exchange of ser84 in the first pore loop of dmhkt1 renders the fully sodium - selective dmhkt1 into an hkt isoform that does not further discriminate between sodium and potassium ( figure 3a ) .
this strongly indicates that the hydroxyl group of the serine residue is an integral part of the sodium coordination .
since in our homology model the side chain of s84 faces the pore interior , its hydroxyl group possibly acts as an additional water - like coordination group ( figure 4c ) similar to what was proposed for analogous ktrb variants also showing an increased na / k selectivity ( tholema et al . , 2005 ) .
however , rather than a size - restrained ion selectivity mechanism due to narrowing of the pore by the serine side chain as proposed by tholema et al .
( 2005 ) , we suggest that the change in the carbonyl ring geometry together with the additional hydroxyl group results in a metal ion - binding site with a coordination number between 5 and 6 . this altered geometry with a lower coordination number seems , then , to provide a perfect selection filter for sodium over potassium . for a more detailed description of the selectivity filter , see also supplemental text s1 .
while k is the most abundant cation in the cytoplasm of plant cells , typically reaching about 100 mm , na is highly toxic even at low - mm cytosolic concentrations ( kingsbury and epstein , 1986 , luan et al . , 2009 ) .
the key to salt tolerance is to sequester the na taken up by the plant to the vacuoles or transfer it to older tissues ( blumwald , 2000 , munns and tester , 2008 ) . in a parallel study we have shown that stimulated flytraps take up and accumulate prey - derived sodium via dionaea sodium channels , which operate in gland cells ( bhm et al . , 2016 ) .
the sodium intake and storage in the trap parenchyma of carnivorous dionaea is reminiscent of the salt management of the succulent halophytes ( shabala et al . , 2014 ) .
depending on the salinity to which the green stomach is exposed , glands depolarize , resulting in aps ( figure 1a and 1b ) , the same type of electrical signal initiated when prey animals accidentally touch the trigger of the darwin plant ( escalante - perez et al . , 2011 ) .
generated in the trigger hair mechanosensor , these aps travel along the lobe surface to excite the motor unit and the glands ( escalante - perez et al . , 2011 ) . in animal axons
, aps depend on inward - flowing na ( depolarization ) , but in dionaea , sodium ions in general and dmhkt1-based na channeling in particular are unlikely to contribute to the aps .
this notion is manifested by the fact that even high na levels do not significantly change the ap shape and amplitude ( figure 1c ) . in other words , in dionaea , the ap itself is salt insensitive ; rather , the carnivorous plant consuming sodium - rich animals seems to take advantage of na intake for maintaining cellular osmotic potential and turgor just like halophytes ( shabala , 2011 ) .
the resting potential of non - stimulated traps is in the range of 120 to 140 mv .
upon high saline stimulation , entry of na via dmhkt1 shifts the membrane toward the threshold ( around 100 mv [ beilby , 2007 ] ) of the dionaea ap . in the pacemaker mode ,
this repetitive firing of aps prevents the flytrap from na influx - dependent , long - term depolarization .
positively charged na entering the cell is counteracted by a skor / gork - type channel ( for review see hedrich , 2012 ) , which mediates an outward flux of positively charged k. this in toto electroneutral cation exchange keeps the membrane potential hyperpolarized
. such a function can only be fulfilled by the na - selective dmhkt1 channel , since na / k - permeable isoforms , present in bacteria and many plant species , would interfere with the ap in the flytrap and with the information management it requires to hunt for animals to obtain its nutrient supply .
structures of wild - type dmhkt1 and the mutants s84 g and s84a were obtained by homology modeling using the structure of the bacterial trk / ktr / hkt ion channel ktrab from b. subtilis ( vieira - pires et al . , 2013 )
the structure of the bacterial template ktrab was determined with the ion channel unit ktrb in complex with its cytosolic regulatory subunit ktra .
the ion channel forms a hetero - octameric assembly in the asymmetric unit of the crystal , with two ktrb channel dimers and four regulatory subunits , ktra , bridging the two ion channel dimers ( vieira - pires et al . ,
as no regulatory subunit corresponding to ktra exists for dmhkt1 , and no information is available as to whether dmhkt1 also forms dimers , one protein chain ( chain i ) of the template ( pdb : 4j7c ) was selected for homology modeling .
an amino acid sequence alignment was performed using the sequences of dmhkt1 , the selected structure template , and other plant and bacterial hkt ion channels from rice , wheat , barley , reed , arabidopsis , succulents , and escherichia coli , and by employing the software clustalw2 .
the dmhkt1 monomer was then modeled on the basis of the template structure of ktrb by replacing the amino acids that differed in the sequence alignment using the tool proteindesign from the software package quanta2008 ( accelrys , san diego ) .
each repeat consists of a long transmembrane helix m1 , a 3.5-turn pore helix with the subsequent pore loop forming the selectivity filter , and a second transmembrane helix m2 , which in repeats 1 , 2 , and 4 is kinked in the middle by almost 90 , the result of a conserved two - amino - acid motif that contains at least one glycine . in repeat 3 of the template ktrb
, helix m2 has a large glycine-/serine - rich insertion forming a bulged - out loop .
insertions and deletions ( compared with the template ) found in the loops between helix m1 and the pore helix of all four repeats of dmhkt1 , as well as the bulged loop of helix m2 of repeat 3 , were modeled manually .
larger insertions , as found in the transition loops of helix m2 of one repeat to the m1 helix of the next repeat ( as found between repeats 1 and 2 , and between repeats 2 and 3 ) were not modeled .
backbone torsion angles were restrained to obey angles within the allowed region of the ramachandran plot when possible . if present , incorrect van der waals contacts were eliminated first by performing side - chain rotamer searches using the tool xbuilt in the software quanta2008 .
final refinement involved a stepwise energy - minimization routine whereby all backbone atoms were first kept fixed and side - chain atoms were restrained by a soft harmonic potential ( eharm = 10 kcal mol ) . in subsequent steps , the harmonic potential was gradually decreased to zero . in the final minimization step ,
the backbone atoms were restrained by a harmonic potential ( eharm = 20 kcal mol ) and energy minimization was performed until the lennart jones energy was negative , indicating the absence of van der waals clashes .
only geometrical terms were used because the energy - minimization procedure did not implement solvent molecules for proper treatment of electrostatics .
d. muscipula plants were purchased from cresco carnivora ( the netherlands ) and grown in plastic pots at 22c with a 16:8-h light / dark photoperiod .
for induction of digestion , 100 m cor solution ( sigma - aldrich , germany ) was directly applied to the respective tissues , and samples were used after 24 h. net fluxes of na and k were measured using the non - invasive mife technique ( university of tasmania , australia ) .
the theory of non - invasive mife measurements and all specific details of microelectrode fabrication and calibration are available in our prior publications ( shabala et al .
, 1997 , shabala et al . , 2006 , shabala and shabala , 2002 ) . in brief , microelectrodes with an external tip diameter of 2 m were pulled , salinized , and filled with either k - selective cocktail ( k 60031 , sigma ) or with a highly na- selective resin that is not responsive to k ( jayakannan et al . , 2011 ) .
electrodes were calibrated to an appropriate set of standards and mounted on a 3d micromanipulator ( mmt-5 ; narishige , toyko , japan ) .
an immobilized lobe was placed into a 90-mm petri dish containing 40 ml of basic salt medium ( bsm : 0.2 mm kcl , 0.1 mm cacl2 , adjusted to the required ph using 2-(n - morpholino)ethanesulfonic acid [ mes]/tris ) and placed into a faraday cage .
na- and k - selective microelectrodes were positioned , with their tips aligned , 50 m above the lobe surface using a 3d hydraulic manipulator . during measurements , a computer - controlled stepper motor moved electrodes in a slow ( 10 s ) square - wave cycle between the two positions , close to ( 50 m ) and away from ( 150 m ) the trap surface . the potential difference between two positions was recorded by the mife chart software ( shabala et al . , 1997 ) and converted to an electrochemical potential difference using the calibrated nernst slopes of the electrodes .
net ion fluxes were calculated using the mifeflux software for cylindrical diffusion geometry ( newman , 2001 ) . to study the dose dependence of na uptake , intact dionaea leaves
a single lobe was cut and immobilized in a measuring chamber by using medical adhesive ( vh355 ; ulrich ag , st gallen , switzerland ) .
net na and k fluxes were measured in response to the successive increase in the nacl content of the external bsm ( nacl : 0 , 3 , 10 , 50 mm ) for 3 min at each nacl concentration .
the ph of the media was maintained at 5 or 4 , and ph 8 in figure 2b .
traps without cor treatment were used as controls . to quantify aps in the venus flytrap , we used no invasive surface potential electrodes .
one ag / agcl wire was fixed with tape to the outer trap surface , and electrical connection was improved by applying a droplet of kontakt - gel ( labokinika , rottenburg , germany ) .
electrical signals were amplified 100-fold and recorded with patchmaster software ( heka , lambrecht , germany ) . the standard solution containing 0.1 mm kcl ,
10 mm cacl2 and 15 mm mes , adjusted with tris to ph 6 , was kept at 1060 mosm / kg with d - sorbitol when required .
the concentrations of nacl used to supplement the standard solution were 0 mm and 510 mm ( 3% ) . prior to measurements ,
the lobe of a cut trap was glued to a chamber bottom and left for recovery ( 30 min ) in a standard solution containing 0.1 mm kcl , 10 mm cacl2 , and 15 mm mes , adjusted with tris to ph 6 , or 15 mm tris , adjusted with mes to ph 4 .
the concentrations of nacl used to supplement the standard solution were 60 , and 510 mm ( 3% ) . during experiments leaves
were continuously perfused with the standard solution ( 1 ml / min ) . for stimulation ,
a 1-min exposure to the respective nacl concentration was sufficient . for double - electrode voltage - clamp studies
the standard bath solution contained 10 mm tris / mes ( ph 5.6 ) , 1 mm cacl2 , 1 mm mgcl2 and 1 mm lacl3 , osmolality adjusted to 220 mosm / kg with d - sorbitol .
lithium was used to balance the ionic strength for measurements under varying cation ( na and k ) concentrations .
solutions for selectivity measurements were composed of the standard bath solution supplemented with 100 mm na , nmdg ( n - methyl - d - glucamine ) , li , k , rb , or cs chloride salts . for current voltage relations ( iv curves ) ,
single - voltage pulses were applied in 10-mv increments from 200 to + 60 mv , starting from a holding potential ( vh ) of 0 mv .
steady - state currents ( iss ) were extracted at the end of the test pulses lasting 50 ms .
this work has been supported by the european research council under the european union 's seventh framework program ( fp/20010 - 2015)/erc grant agreement no . [
this work was also supported by the international research group program ( irg14 - 08 ) , deanship of scientific research , king saud university , saudi arabia ( e.n . ) , and by grants from the australian research council ( project dp150101663 ) and the grain research and development corporation ( to s. shabala . ) .
| ### Summary:
: the animal diet of the carnivorous venus flytrap , dionaea muscipula , contains a sodium load that enters the capture organ via an hkt1-type sodium channel , expressed in special epithelia cells on the inner trap lobe surface . dmhkt1 expression and sodium uptake activity
is induced upon prey contact . here
, we analyzed the hkt1 properties required for prey sodium osmolyte management of carnivorous dionaea .
analyses were based on homology modeling , generation of model - derived point mutants , and their functional testing in xenopus oocytes .
we showed that the wild - type hkt1 and its na+- and k+-permeable mutants function as ion channels rather than k+ transporters driven by proton or sodium gradients .
these structural and biophysical features of a high - capacity , na+-selective ion channel enable dionaea glands to manage prey - derived sodium loads without confounding the action potential - based information management of the flytrap . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: in 1971 , rechtschaffen stated that if sleep does not serve an absolute vital function , then it is the biggest mistake the evolutionary process ever made . indeed , almost all the animal species , from the largest mammals to the fruit flies , show a behavioral state that can be considered sleep - like .
sleep seems to be a crucial need , as much as drinking or eating , to such an extent that chronic sleep deprivation in rats produces cellular and molecular changes in brain that makes the animal die within a matter of weeks .
different hypotheses were suggested to explain the functions of sleep , but a general consensus exists today that sleep is strictly linked to memory , learning and , in general , to the mechanisms of neural plasticity .
indeed , cognitive impairments , especially in learning , and memory tasks [ 57 ] , are one of the main consequences of sleep deprivation .
although the link between sleep , memory , and neural plasticity has been widely investigated , such a relation is not yet completely understood .
several findings are in line with the hypothesis of a homeostatic , sleep - mediated synaptic downregulation [ 8 , 9 ] , while other studies support a consolidation model based on the reactivation , during sleep , of the same areas which were active during wakefulness [ 10 , 11 ] . since it is widely accepted that synaptic plasticity mechanisms underlie motor and cognitive recovery , understanding the relationship between sleep and plasticity
the main aim of the present paper is to review studies showing how sleep - dependent plasticity could be involved in functional recovery from different neuropsychological conditions ( poststroke brain damage , obstructive sleep apnea , alzheimer 's disease , and autism ) and to provide insights on how the efficacy of rehabilitation protocols could be improved by methods which enhance sleep - dependent plasticity .
the term functional recovery has different implications for the various clinical conditions considered , depending on the hypothetical mechanisms underlying each disturb . in the current review
, we will adopt a very general definition and will refer to it as a process involving improvement or slowing down of deterioration in different areas ( motor and/or cognitive ) of the illness . aiming to propose a possible role of sleep - dependent plasticity in functional recovery , we will shortly summarize how sleep and plastic process are related .
namely , we will discuss the role of sleep in ensuring the consolidation of plastic changes and the possibility of learning new things every day .
to this aim , we will highlight the findings about how plastic changes during wakefulness affect the subsequent sleep and try to understand what kind of plastic modifications occurs during sleep .
then , we will report empirical evidence about the molecular and electrophysiological consequences of sleep deprivation on the plastic mechanisms .
finally , we will discuss how sleep - dependent plasticity could influence functional recovery , and we will suggest how to increase efficacy of rehabilitative protocols by enhancing sleep quality , reducing sleep disorders , and promoting sleep - dependent plasticity .
spontaneous wakefulness is characterized by molecular changes associated with long - term potentiation ( ltp ) [ 12 , 13 ] , and by an increase of synaptic density .
the synaptic homeostasis hypothesis [ 8 , 9 ] posits that the mechanisms of synaptic potentiation during wakefulness are directly related to the enhancement of slow wave activity ( swa ; 0.54.5 hz ) in the electroencephalogram ( eeg ) during the subsequent sleep .
swa is considered a measure of sleep need , and there is well - established evidence that swa increases with the time spent awake and progressively decreases during sleep .
this hypothesis is based on the observation that increased expression of ltp markers during wakefulness is followed by higher level of swa during the subsequent sleep .
a demonstration that the increase of swa during sleep depends directly on the ltp mechanisms , and not on wakefulness as such , comes from animal studies showing that when the expression of ltp - related molecules is reduced , due to damages to the noradrenergic system , the swa peak during sleep is blunted [ 12 , 17 , 18 ] .
the relation between changes in cortical plasticity during wakefulness and quantitative changes of swa in subsequent sleep is topographically specific ; a higher ltp in a particular cortical area is directly correlated to an increase of the swa activity in that area .
huber and co - workers have investigated the effects on sleep of a specific visuomotor task ( adaptation to a rotated frame of reference ) that activates the right parietal cortex and seems to be related to a synaptic potentiation mechanism .
results showed that this task , when compared with a subjectively indistinguishable control task , induced during the subsequent sleep an increase of swa , which was limited to the right parietal area .
this finding supports the hypothesis of the activation of a local homeostatic process during sleep .
similarly , a declarative learning task induced an increase of swa and spindle activity ( 1215 hz ) in the left frontal area during sleep after a training session , which was positively correlated with changes in memory performance .
finally , a potentiation of tms - evoked eeg responses induced in the premotor cortex , through the application of a 5 hz repetitive tms ( rtms ) , was positively correlated with an increase of swa in the following sleep , which was topographically specific for the same premotor site . what happens if a synaptic depression process occurs during wakefulness ?
huber and co - workers have found that a short - term arm immobilization was associated with impaired motor performance , smaller somatosensory evoked potentials ( seps ) , and motor evoked potentials ( meps ) and was followed by a local reduction in swa during the successive sleep episode . in summary , plastic changes occurring during wakefulness seem to induce coherent and topographically specific local changes in swa during the subsequent sleep
. further support to the hypothesis that changes in cortical plasticity lead to homeostatic modifications in swa during sleep comes from studies using tms paired associative stimulation ( pas ) protocol , a method that allows to induce plastic changes in the human cortex by coupling , with a fixed interstimulus interval allowing the sensory impulse to reach and energize the s1/m1 cortex , a peripheral electric stimulus and a magnetic pulse on the scalp .
the direction of the plastic changes ( potentiation or depression ) depends on the interval between the stimuli [ 2426 ] . by using the pas protocol
it has been observed that ltp and long - term depression ( ltd ) lead to an increase and a reduction in swa during sleep in somatosensory cortex , respectively .
other studies have found different , albeit coherent with the general hypothesis , patterns of topographic changes in swa [ 28 , 29 ] and spindle activity after the pas protocol .
these findings still support the hypothesis of a link between cortical plasticity and sleep homeostasis but stress the need of a better knowledge of the underlying neurophysiological mechanisms . in computational studies
, it has been observed that stronger synaptic connections are associated with higher swa [ 30 , 31 ] .
moreover , an increase in swa during sleep which is topographically specific for the motor cortex , induced in vivo in rats by learning a motor task , was associated with a post - training increase , in the same cortical area , of c - fos and arc levels , two activity - dependent proteins involved in motor learning [ 3335 ] . finally , a causal relation between brain - derived neurotrophic factor ( bdnf ) expression during wakefulness and subsequent sleep homeostasis has been observed in vivo ; higher levels of bdnf lead to increased swa during subsequent sleep [ 36 , 37 ] .
together , these data suggest that changes in cortical plasticity during wakefulness lead to homeostatic modifications in swa during sleep , supporting the hypothesis of a direct relation between cortical plasticity and sleep regulation .
according to the synaptic homeostasis hypothesis [ 8 , 9 ] sleep has a functional role in promoting the so - called synaptic downscaling .
this process would have the function of restoring the total synaptic strength to a sustainable energy level , favouring memory and performance gain .
in other words , the experience - dependent synaptic potentiation occurring during wakefulness is proportionally reflected in the following sleep , and in particular during nrem sleep , a condition which is characterized by slow oscillations and is an ideal scenario for the experimental induction of ltd - like mechanisms .
swa would support downscaling by the alternation of a depolarization phase ( up - phase ) and a hyperpolarization phase ( down - phase ) .
the hypothesis of a link between plastic changes and swa has received considerable empirical support by the findings of significant fluctuation of different molecular and electrophysiological markers within the sleep - wake cycle .
absolute levels of brain metabolism significantly decrease after a period of sleep , consistently with the hypothesis of a synaptic downscaling process during sleep .
moreover , while molecular processes associated with ltp reach lower levels during sleep than during wakefulness [ 12 , 41 ] , molecular changes involved in ltd - like mechanisms increase during sleep , compared with waking time [ 13 , 41 ] . at an electrophysiological level
, animal studies found that different markers of synaptic efficacy increase after prolonged wakefulness and decrease following a period of sleep [ 41 , 42 ] . notwithstanding this evidence , it is likely that the synaptic homeostasis hypothesis does not allow for a comprehensive understanding of the processes that occur during sleep .
frank points out that different molecules , like arc , observed at high levels in the cerebral cortex after waking , mediate both ltp and ltd processes [ 13 , 44 ] and the synthesis of gaba in inhibitory interneurons [ 45 , 46 ] .
their presence , then , is not a clear indication of synaptic potentiation or depression .
moreover , different studies show that some neuromodulators involved in synaptic potentiation increase during nrem sleep [ 47 , 48 ] and some potentiation - related molecular changes have been observed during sleep [ 4952 ] .
these studies seem to question some predictions of the synaptic homeostasis hypothesis in favour of a consolidation model , which predicts an increased potentiation of specific neural circuits as a prerequisite of consolidation mechanisms .
in this perspective , the consolidation process should involve a sleep - dependent reorganization and redistribution of the newly acquired information between different brain systems , so that it can be defined as a system consolidation process .
in particular , the parallel activation of specific neocortical and hippocampal networks during wakefulness , which represent , respectively , long - term and temporary store in declarative memory system , should induce a selective reactivation of the same circuits during subsequent sleep [ 10 , 11 , 54 , 55 ] . several findings support this model pointing out to the crucial role played by sleep - specific brain activity in favouring consolidation of memory traces [ 19 , 5660 ] . according to the model , slow oscillations originated during sws in neocortical networks
allow the formation of spindle - ripple events that mediates the hippocampus - to - neocortex transfer of memory information .
specifically , the depolarizing up - phase of slow oscillations drives the hippocampus to trigger the reactivation of memory representations that are gradually transferred to the neocortex via thalamo - cortical spindles . in this view
, sharp - wave hippocampal ripples represent the reactivation of memory traces while thalamo - cortical spindles , modulating cortical ca influx , provide the background suitable for the changes in neocortical synaptic connections underlying the long - term storing of memory traces in the neocortical respective networks [ 5659 , 62 ] . several evidences in both animals and humans
point to the association between learning processes during wakefulness and a coherent neural re - activation during subsequent sleep .
monocular deprivation studies [ 63 , 64 ] showed that ocular dominance plasticity in cats undergoes a sleep - mediated consolidation process that involves both synaptic potentiation and depression mechanisms ( monocular deprivation induces stronger cortical responses to the open eye and weaker responses to the deprived one after than before sleep ) . the same pattern of neuronal activation observed during song rehearsal of the zebra finch was found during sleep , and it leads to a temporary deterioration of song quality correlated with a global enhanced learning .
a neural re - activation during sleep has been observed in rats after simple spatial tasks [ 54 , 67 , 68 ] .
moreover , the engagement in a learning task results in increased slow oscillations , spindles activity , and hippocampal ripples that seem to be associated with an improved performance [ 19 , 53 , 56 , 57 , 60 , 62 ] .
results from humans studies are consistent with the findings in animals , showing a sleep - dependent re - activation of brain regions involved in previous learning . by positron emission tomography ( pet )
recordings , maquet and co - workers found such a specific re - activation during rem sleep that followed a training on a serial reaction time task , while other studies found a re - activation during sws following declarative learning task [ 70 , 71 ] .
more in detail , rasch and co - workers showed that the presentation of an odor cue , previously associated with a visual - spatial learning task ( memory for cards locations ) , during sleep induces a greater hippocampal activation , which positively affects task performance .
this study provides the first evidence of a causal link between re - activation during sleep and consolidation of memory traces .
interestingly , the enhancement of memory took place only if the odor was presented during sws , but not during rem , and not in case of a procedural learning task .
these findings are consistent with the hypothesis of a differential role of sws and rem on consolidation of different memory functions . in our view
, this dissociation should be taken into consideration in a rehabilitative perspective that takes into account sleep features during treatment . traditionally , according to the
dual processes theory , the postsleep improvement in procedural memory has been ascribed to rem sleep , while sws is responsible for the consolidation of declarative memory [ 73 , 74 ] .
studies using declarative memory tasks showed a better retention performance after sleep if it consists mainly of sws [ 21 , 71 , 73 , 75 ] . in others , boosting swa enhanced word pairs retention [ 7678 ] , but not the retention of procedural memories .
conversely , the recall of a mirror - tracing task improved more after a retention interval spent in rem sleep than in sws , and post - sleep performance improvement in a finger - tapping task was correlated with the time spent in rem sleep .
however , this different role for rem and sws has not been confirmed by other studies .
several nondeclarative tasks , like perceptual discrimination and rotation adaptation , are also benefited by sws , whereas rem sleep in some instances seems to mediate the consolidation of emotional aspects of declarative memory .
theory should be considered an oversimplification , and , actually , a large body of evidence seems to support a different theory , the sequential or
hypothesis , which states that consolidation process involves both sws and rem sleep , regardless of the memory system the traces belong to . according to this hypothesis ,
what leads to the consolidation of a still labile memory trace during sleep is the repeated pattern of non - rem sleep followed by rem sleep .
model so that the integration of the two perspectives suggests that consolidation processes would consist in the repetition of sleep cycles with sws favouring a system consolidation of memory by a reactivation and a redistribution of memories to the neocortical long - term storage .
in this view , subsequent rem sleep allows local processes of consolidation at synaptic level , whereby cortical memory representations are further stabilized [ 53 , 83 ] . with respect to the different role of rem and
slow wave sleep ( sws ) , chauvette and co - workers , using an electrical stimulation at low frequency ( 1 hz ) of the medial lemniscal fibers in cats , studied the somatosensory cortical - evoked local field power ( lfp ) responses before and after a period of sws .
the amplitude of the responses in the somatosensory cortex was increased after sws compared to the previous waking period , suggesting that sws induces synaptic upscaling , rather than downscaling . on the other hand ,
the analysis of firing rates across cycles of nrem - rem - nrem sleep in rat hippocampal pyramidal cells and interneurons showed a significant increase in the firing rates during nrem sleep , while a substantial decrease was associated with rem sleep .
in addition , the decrease in the firing rates between the first and the last episode of nrem sleep was positively correlated with the amount of theta activity ( 47 hz ) during rem sleep .
together , these findings suggest that different kinds of synaptic renormalization occur during sleep , and the role of rem sleep and theta waves must be better analysed . the results by grosmark and co - workers could represent a link between the consolidation model and the downscaling process .
in particular , born and feld suggest that a local upscaling of specific memories could occur in concomitance of global downscaling processes .
since the early empirical observations of de manacine , it is well known that sleep loss has degrading effects on alertness and performance .
if sleep is a behavioral state in which the body recovers physical and mental energies , the lack of sleep can jeopardize the execution of neurocognitive , psychological , and behavioral processes .
there are numerous empirical evidences about the harmful consequences of chronic sleep loss , such as drowsiness , reduced alertness , communication difficulties , and cognitive deficits [ 89 , 90 ] .
in particular , different forms of learning are negatively affected by sleep deprivation in humans and animals [ 57 ] , albeit recent findings point out that long - term consolidation does not seem to be affected by sleep loss in adolescents .
patients with primary insomnia showed a decreased sleep - dependent memory consolidation in procedural and declarative learning associated with the reduction of rem sleep [ 92 , 93 ] and sws , respectively .
moreover , most of neurodegenerative diseases , like alzheimer 's disease ( ad ) , parkinson 's disease ( pd ) , or dementia with lewy bodies ( dlb ) , which are usually characterized by memory impairment , share a common pattern of sleep features . in these diseases , sleep is usually more fragmented , sws is decreased , and spindles , k - complexes and rem sleep are often reduced ( for a review , see ) .
the detrimental effects of sleep loss on memory suggest a deterioration of the underlying neuronal processes .
in particular , alterations of ltp / ltd mechanisms may underlie at least a part of the behavioural alterations observed during sustained wakefulness .
one of the most well - established consequences of sleep deprivation is the increase of delta and theta eeg activity [ 96 , 97 ] , mainly in frontal cortical areas [ 98100 ] , interpreted as an index of higher recovery need .
it has been proposed that experience - dependent plasticity is directly linked to local changes in the electrophysiological expression of sleep need , as indexed by increased swa after prolonged wakefulness [ 8 , 9 ] .
an intriguing question is whether and how prolonged periods of wakefulness can affect plastic processes .
different in vitro studies show that sleep loss inhibits ltp in the hippocampus but enhances ltd mechanisms [ 101103 ] .
more recently , it has been observed in cat and mice cortical slices that the amplitude and frequency of miniature excitatory postsynaptic currents increase after wakefulness and decrease after sleep .
moreover , an increase in number and size of central synapses was observed in drosophila melanogaster after prolonged wakefulness , and a subsequent decrease was possible only after sleep . in this study ,
qualitative characteristics of wakefulness were also evaluated ; richer experiences during wake were followed not only by a higher sleep need , but also by a greater synaptic growth .
vyazovskiy and co - workers found that synaptic strength , in terms of amplitude and slope of local field power ( lfp ) , increases after a period of sustained wakefulness in rats , and that the induction of ltp is easier after sleep rather then after a waking period .
furthermore , cortical neurons fire at higher frequency and cortical excitability is increased after sleep deprivation . at molecular level
, these changes involve the delivery of postsynaptic glutamatergic ampa receptors ( ampars ) containing glur1 subunit .
in particular , glur1-containing ampar levels increase with time spent awake and decrease during sleep . these morphological and functional changes are likely connected with the variations in the firing rates of cortical and hippocampal neurons recently described for wake - sleep cycle and sleep deprivation in rats .
furthermore , high levels of different pre- and postsynaptic proteins and proteins involved in neurotransmitters release have been found in drosophila melanogaster after sleep deprivation , while their levels were low after sleep . considering that brain metabolism accounts for 20% of all the body rest metabolism and that around 75% of brain 's energy consumption is due to glutamatergic synaptic signalling ( action potentials , post - synaptic potentials , and repolarization ) , it is reasonable to assume that a widespread cortical increase of firing rate during wakefulness combined with a rapid and progressive increase of cortical extracellular glutamate levels results in a raising of brain metabolic costs .
in contrast , nrem sleep , characterized by low firing rate and low cortical extracellular glutamate levels , is associated with a reduction in energy demand . taken together
, these findings suggest that synaptic strength progressively increases with time awake , leading to high energy costs and saturating learning process .
sleep seems to be necessary for a homeostatic renormalization of cortical synapses , but it remains unclear how sleep propensity is accumulated during wakefulness . in recent years , adenosine assumed increasing importance as mediator of connection between brain activity during wake and sleep regulation , whereas basal forebrain seems to be the adenosine sensor of the brain responsible for the adenosinergic modulation of sleep - wake states ( for review see ) . in brief ,
adenosine , through its action on a1 receptor , promotes the transition from wakefulness to sws by inhibiting wake - active neurons in basal forebrain , which are connected to cortical regions .
sleep begins when the activity of the wave - active cells decreases sufficiently . during sleep ,
a sufficient reduction of extracellular adenosine makes wake - active cell in basal forebrain free from adenosine inhibition resulting in the initiation of a new waking period .
consistent with this hypothesis , an experimentally induced energy depletion by 2,4-dinitrophenol ( dnp , molecule which prevents the synthesis of atp ) infusions in basal forebrain ( but not outside ) increases subsequent sleep need . taken as a whole
, results from animal studies suggest that sleep deprivation has detrimental effects on synaptic plasticity .
however , it should be borne in mind that processes like neuronal firing , metabolic activity , and synaptic potentiation represent different aspects of neuronal functioning , and the relationship between them is not simple , although the state of knowledge does not provide a complete unifying framework for these different aspects of neural functioning yet . at present , there is no direct evidence in humans about the modification of plastic processes after sleep loss .
nevertheless , changes in cortical excitability have been widely investigated ( mainly by means of tms ) but results are not univocal .
many studies point to an increase of cortical excitability during prolonged wakefulness in healthy subjects , in terms of modulation of motor evoked potentials [ 99 , 113 ] , and tms - evoked potentials .
it should be remembered that an increase of cortical excitability after prolonged wakefulness is usually observed in epileptic patients [ 115 , 116 ] and that sleep loss increases seizures . on the other hand ,
other studies were not able to provide any evidence of a modulation of sleep deprivation on cortical excitability [ 118 , 119 ] or found conflicting results .
although such negative findings can be explained by a lack of statistical power due to the small sample size of these last studies , the mechanisms underlying changes in human cortical excitability in condition of sleep loss remain unclear .
moreover , in most cases only changes in frontal and prefrontal cortical excitability have been investigated .
the only study that assessed how sleep deprivation modulates the responsivity of the somatosensory cortex showed an increase in early seps components amplitude , but it did not account for the potential influence of circadian factors .
as discussed in the previous paragraphs , we still miss a complete understanding of the plastic processes occurring during sleep .
nevertheless , a coherent pattern of empirical findings shows that plastic changes during wake can affect subsequent sleep , which in turn has a beneficial effect on plastic mechanisms and learning processes .
so , the existence of a link between sleep and synaptic plasticity is widely accepted . since
plastic processes are involved in functional recovery from different neuropsychological disorders and after brain damage , the understanding of how swa during sleep can affect rehabilitation - dependent plasticity seems a suggestive issue . if sleep has a role in modulating cortical plasticity , rehabilitative protocols should be designed considering how sleep could improve recovery . in the present section
, we will consider the possible role of sleep - dependent synaptic plasticity in the rehabilitation from different neuropsychological conditions .
animal models show that ischemic stroke can induce a sws increase and a paradoxical sleep decrease in mice and rats .
mice undergoing treatment with -hydroxybutyrate ( ghb ) , a drug used to promote sws in humans , showed a faster recovery of the grip strength in the paretic forelimb , when compared with those treated with vehicle saline . moreover ,
sleep disturbance and sleep disruption negatively affect poststroke recovery in rats [ 123 , 126 ] impairing axonal sprouting and neurogenesis , two cellular processes associated with functional recovery [ 127129 ] .
only few human studies on this issue are available at the moment , but they show promising results .
several experiments have been designed to understand if sleep can affect motor learning in post - stroke patients [ 130132 ] , based on the observation of a sleep - dependent memory consolidation of different motor tasks in healthy subjects [ 133 , 134 ] .
results showed that sleep enhances offline implicit and explicit motor learning of a continuous sequencing task [ 130 , 131 ] and improves spatial tracking accuracy and anticipation of upcoming movements during a continuous tracking task .
sleep seems to induce a selective enhancement in sequential motor learning and performance also in patients with prefrontal lesions , with no improvement in verbal and working memory .
a limitation of these studies is the absence of eeg recordings , so hypotheses on the electrophysiological basis of the influence of sleep on motor performance in post - stroke patients remain at a speculative level .
nevertheless , these findings suggest that an appropriate management of sleep - wake cycle in these patients could promote motor recovery .
siengsukon and boyd stated that sleep between therapy sessions should be supported , with the aim to support off - line learning , and a quiet environment for sleep should be ensured to patients .
moreover , post - stroke patients are often characterized by different sleep disorders like hypersomnia , insomnia , sleep - related breathing disturbances , or restless legs syndrome ( for a review , see ) , and other factors like depression or side - effects of pharmacological treatments could negatively affect sleep in these patients .
obstructive sleep apnea ( osa ) is a common breathing and sleep disorder , characterized by cessations or reduction in respiration due to pharyngeal collapse during sleep that induce intermittent hypoxia and sleep fragmentation [ 138 , 139 ] increasing daytime sleepiness and risk for cardiovascular disease .
osa is associated with neurocognitive impairment , with negative influence on vigilance , attention , executive functioning and memory [ 141 , 142 ] .
nevertheless , the neural basis of cognitive impairment in osa patients is not well understood yet .
animal models show that hypoxia induces apoptosis in cortical and hippocampal neurons , but neural functioning may be already compromised before the beginning of the apoptotic process .
results from recent studies suggest that changes in synaptic plasticity could account for cognitive impairment in osa patients [ 144 , 145 ] .
in fact , xie and co - workers have found that chronic intermittent hypoxia in mice induced an impairment in hippocampal early and late - phase ltp and a reduction of the expression of the brain - derived neurotrophic factor ( bdnf ) , a neurotrophin that modulates synaptic plasticity [ 146 , 147 ] .
moreover , the increase in oxygen and nutrient demand induced by chronic intermittent hypoxia should lead to adaptive homeostatic changes in the blood - brain barrier that , at long - term , could influence brain 's microenvironment , inducing an impairment in plastic processes and cognitive performance .
a better understanding of the plastic changes occurring in osa patients , as well as their possible role in cognitive impairment , is of great importance at a therapeutic level . at present ,
albeit many studies show that the continuous positive airway pressure ( cpap ) , the treatment of choice for osa , improves different cognitive functions [ 149 , 150 ] , a recent meta - analysis points out that only a small recovery in the attention domain can be observed after cpap treatment .
therapeutic strategies based on the enhancement of synaptic plasticity may be useful to improve neurocognitive functioning in osa patients , particularly for what concerns memory consolidation .
for example , treatment with multiple intraventricular injections of bdnf in mice has beneficial effects on the ltp impairment induced by hypoxia and has been proposed as a possible method to reduce neurocognitive impairments .
sleep in patients affected by alzheimer 's disease ( ad ) is characterized by a general accentuation of the sleep modifications which are observed in normal aging : sleep fragmentation , decreased sws and rem sleep , increased percentage of stage 1 , alterations of sleep spindles , and k - complex [ 153155 ] .
moreover , different studies have found an eeg slowing during a condition of resting wakefulness in ad and mild cognitive impairment ( mci ) patients [ 156161 ] . a similar phenomenon of eeg slowing in these patients has been observed also during rem sleep , particularly in temporoparietal and frontal sites , with increased delta and theta frequencies and reduced alpha and beta activity , as compared with normal elderly [ 162 , 163 ] .
recently , melatonin treatment for the management of sleep has been proposed as a possible therapeutic strategy in ad patients , and many studies have shown its beneficial effects on sleep quality , depressive symptoms , and neuropsychological performance in mci patients ( for review see ) . albeit the mechanisms underlying the beneficial melatonin effects in ad and mci remain unclear , kang and co - workers
have found in mice that sleep reduces synaptic anomalies associated with amyloid precursor protein ( app ) , one of the typical synaptic alterations observed in ad .
these data raise the possibility that the positive effects of sleep in ad and mci are associated with an enhancement of synaptic plasticity .
since plastic processes are strongly impaired in ad patients , a reduction of sleep alterations could be useful to restore synaptic plasticity and to limit or to slow down the cognitive decline in such patients .
future studies should be designed to understand if synaptic plasticity in ad patients benefits from the restoration of specific sleep features ( i.e. , sws ) or if a general improvement of sleep quality is needed .
prevalence of sleep disorders in children with autism ranges from 40% to 80% [ 168170 ] .
sleep in autistic children is characterized by long sleep latency , nocturnal awakenings , short sleep duration , low sleep efficiency , circadian rhythm disturbances , increased rem density and stage 1 sleep , reduction of rem sleep and sws , and decreased spindle activity ( for review see ) .
different studies have found a deficit in melatonin secretion in autistic patients [ 173175 ] that seems to represent a risk factor ( and not a consequence ) of autism .
recently it has been proposed that learning disabilities in autisms are related to an abnormally high ltp linked with pineal hypofunction , low serum melatonin levels , and sleep dysfunction . according to the authors , promoting sleep by means of a melatonin treatment
melatonin treatment improves sleep quality in autistic patients [ 178 , 179 ] and secretin , a hormone that stimulates melatonin , induces a temporary improvement of autism symptoms [ 181 , 182 ] .
the promotion of sleep between therapy sessions , the prompt treatment of associated sleep disorders , and the improvement of sleep quality by adequate environment and melatonin administration could be considered as general indications to support the beneficial effects of sleep on synaptic plasticity in different clinical conditions . however , future studies should be designed to develop methods that directly enhance sleep - dependent plasticity , in order to optimize its role in functional recovery .
massimini and co - workers have found that tms at a frequency of < 1 hz applied during nrem sleep triggers slow waves in humans .
it would be interesting to understand if this kind of stimulation has a fallout on memory performance .
recently , it has been observed that the application of a weak electric anodal current at 0.75 hz ( the frequency of the sleep slow oscillations in humans ) during nrem sleep induces an increase in slow oscillations and spindle activity and facilitates declarative memory consolidation .
conversely , transcranial direct current stimulation ( tdcs ) at 5 hz ( theta frequency ) during nrem sleep provokes a general decrease in slow oscillations , a frontal reduction of slow eeg spindle power , and decreases declarative memory consolidation , as well as increases gamma activity ( 2545 hz ) when applied during rem sleep .
slow oscillations and spindle activity can be enhanced also by an auditory stimulation in phase with the ongoing oscillatory eeg activity ( auditory closed - loop stimulation ) during sleep , again with beneficial effects on declarative memory consolidation .
these findings suggest that we can influence subsequent memory performance by modulating different eeg rhythms during sleep , probably affecting synaptic plasticity .
future studies should investigate the plastic process underlying the effect of transcranial stimulation and auditory closed - loop stimulation during sleep on memory , and if such different kinds of stimulations can have long - term beneficial effects on memory performance in patients affected by different clinical conditions characterized by memory impairment .
similar questions arise for what concerns the possible clinical usefulness of the previously - quoted ( see section 3 ) phenomenon of memory consolidation improvement induced by reexposure to odor cues during sws .
an implication of the link between sleep and plasticity is that monitoring swa during sleep in patients undergoing a rehabilitative treatment may represent a useful method to better understand how that specific rehabilitative protocol works .
for example , sarasso and co - workers have recently used the quantitative analysis of sleep high - density eeg , in post - left hemisphere stroke patients with nonfluent aphasia , aimed to assess plastic changes induced by the intensive mouth imitation and talking for aphasia therapeutic effects ( imitate ) , a computer - based therapy for post - stroke aphasia rehabilitation .
results showed that a single intensive imitate session can induce a swa increase during the initial 30 minutes of the first nrem sleep cycle over the left premotor and inferior parietal areas .
a swa increase was also observed in both left and right frontal areas , but with a peak at the right sites . at a behavioural level , imitate induced an improvement in language skills , assessed by the western aphasia battery repetition scale .
albeit these are only very preliminary results ( only 4 patients ) , they are indicative of the possible applications of the sleep eeg topography analysis for the assessment of plastic changes induced by a rehabilitation protocol , opening new perspectives for the comprehension of the neurophysiological basis of rehabilitation .
different processes of synaptic renormalization seem to occur during sleep , but the definition of their functional role needs further investigation .
the induction of plastic changes during wake produces coherent and topographically specific local changes in swa during the subsequent sleep .
moreover , sleep seems to restore synaptic plasticity , with beneficial effects on learning processes , while sleep deprivation induces alteration in ltp / ltd mechanisms , increases cortical excitability , and has negative consequence on learning .
growing evidence suggests that promoting sleep may be useful to restore synaptic plasticity in different pathological conditions .
since plastic processes are essential for functional recovery , a management of sleep - wake cycle in patients and an adequate treatment of associated sleep disturbances could be crucial for the rehabilitation outcome .
moreover , different methods like tms , tdcs , auditory closed - loop stimulation , and odor cues , applied during sleep , can promote memory performance , probably enhancing synaptic plasticity .
future studies should test the possibility to use such techniques to support functional recovery in neuropsychological patients .
finally , monitoring swa during sleep may help to understand how a rehabilitative protocol affects plastic mechanisms . | ### Summary:
: there is a general consensus that sleep is strictly linked to memory , learning , and , in general , to the mechanisms of neural plasticity , and that this link may directly affect recovery processes .
in fact , a coherent pattern of empirical findings points to beneficial effect of sleep on learning and plastic processes , and changes in synaptic plasticity during wakefulness induce coherent modifications in eeg slow wave cortical topography during subsequent sleep . however , the specific nature of the relation between sleep and synaptic plasticity is not clear yet .
we reported findings in line with two models conflicting with respect to the underlying mechanisms , that is , the synaptic homeostasis hypothesis and the consolidation hypothesis , and some recent results that may reconcile them . independently from the specific mechanisms involved , sleep loss is associated with detrimental effects on plastic processes at a molecular and electrophysiological level .
finally , we reviewed growing evidence supporting the notion that plasticity - dependent recovery could be improved managing sleep quality , while monitoring eeg during sleep may help to explain how specific rehabilitative paradigms work .
we conclude that a better understanding of the sleep - plasticity link could be crucial from a rehabilitative point of view . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: serum low - density lipoprotein - cholesterol ( ldl - c ) concentrations are an established risk factor for cad ( 1 ) .
abnormal levels of serum lipids may enhance the rate of atherosclerosis and the development of cad ( 2 - 4 ) .
currently , hmg - coa reductase inhibitors ( statins ) are widely used as a therapeutic agent for reducing ldl - c levels and cardiovascular complications . however ,
identification of new signaling pathways and markers that can regulate ldl - c metabolism might provide a novel strategy for identifying subjects at high risk of developing cad ( 5 ) .
melanoma inhibitory activity 3 is a potential target that has been shown to modulate plasma ldl - c concentration ( 6 , 7 ) .
pcsk9 is a circulating protein that has been suggested as reducing the half - life of the ldl - receptor ( ldl - r ) , thereby controlling the plasma level of ldl - c ( 8) . mutations in the pcsk9 gene are associated with both gene overexpression and gene deficiency .
it has been reported that the upregulation of this gene in mice could reduce the amount of ldl - r in the liver .
conversely , mice deficient in pcsk9 demonstrated a correspondingly increased level of ldl - r ( 9 - 12 ) .
pcsk9 is a glycoprotein with 692 amino acids , and causative mutations in the gene are known to be highly associated with familial hypercholesterolemia ( 5 , 13 ) .
recent genome - wide association studies ( gwas ) have revealed an association between rs3008621 t > g in the mia3 gene and ldl - c levels and risk of cad ( 1 , 2 , 5 , 8 , 14 - 16 ) .
the aim of the present study was to explore the association of the rs3008621 mia3 polymorphism in an iranian population with and without cad .
the research protocol was approved by the ethics committee of the shahid beheshti university of medical sciences .
anthropometric parameters , including height and body weight , were evaluated . body mass index ( bmi )
was determined as body weight ( kg ) divided by squared height in meters ( m ) .
tc , hdl , ldl , tg , and fasting blood glucose ( fbg ) concentrations were determined in all the samples .
genomic dna was extracted using high pure pcr template preparation kits ( roche ; germany ) .
the quantified and purity of dnas were evaluated by nanodrop 1000 ( thermo fisher scientific ; usa ) and gel electrophoresis .
the polymorphism , rs11591147 t > g , was genotyped using taqman probe real - time pcr ( lightcycler 96 ; roche ; germany ) .
descriptive statistics , including mean standard deviation ( sd ) , were determined for normally distributed variables .
median inter - quartile range ( iqr ) were determined for those variables not normally distributed .
the student s t - test was used for normally distributed variables , and the mann - whitney u - test was used for those not normally distributed .
the statistical differences in genotype distribution and allele frequencies between groups were assessed by the test .
compliance of genotypes was evaluated by hardy - weinberg equilibrium . a 2-sided p < 0.05 was considered significant .
the research protocol was approved by the ethics committee of the shahid beheshti university of medical sciences .
anthropometric parameters , including height and body weight , were evaluated . body mass index ( bmi ) was determined as body weight ( kg ) divided by squared height in meters ( m ) .
tc , hdl , ldl , tg , and fasting blood glucose ( fbg ) concentrations were determined in all the samples .
genomic dna was extracted using high pure pcr template preparation kits ( roche ; germany ) .
the quantified and purity of dnas were evaluated by nanodrop 1000 ( thermo fisher scientific ; usa ) and gel electrophoresis .
the polymorphism , rs11591147 t > g , was genotyped using taqman probe real - time pcr ( lightcycler 96 ; roche ; germany ) .
descriptive statistics , including mean standard deviation ( sd ) , were determined for normally distributed variables .
median inter - quartile range ( iqr ) were determined for those variables not normally distributed .
the student s t - test was used for normally distributed variables , and the mann - whitney u - test was used for those not normally distributed .
the statistical differences in genotype distribution and allele frequencies between groups were assessed by the test .
the cad subjects had significantly higher bmis and significantly higher sbp , dbp , triglycerides , fasting blood sugar , and ldl , while their level of hdl was lower compared to the control group .
all the cad patients were homozygous for the g allele , while the genotype frequencies of the mia3 polymorphism for aa , ag , and gg in the control group were 0% , 19% and 81% , respectively ( table 2 ) .
the cad subjects had significantly higher bmis and significantly higher sbp , dbp , triglycerides , fasting blood sugar , and ldl , while their level of hdl was lower compared to the control group .
all the cad patients were homozygous for the g allele , while the genotype frequencies of the mia3 polymorphism for aa , ag , and gg in the control group were 0% , 19% and 81% , respectively ( table 2 ) .
to the best of our knowledge , this is the first study evaluating the association of the rs3008621 mia3 polymorphism in an iranian population with cad .
results showed that this genetic polymorphism was not associated with cad . in agreement with these findings
, several other studies have shown the lack of an association between this genetic polymorphism and cad ( 17 ) .
accumulating evidence shows an association between the mia3 polymorphism and cad ( 2 , 15 , 18 - 20 ) . in particular , benn et al . showed a protective value of rs11591147 in ischemic heart disease and myocardial infarction ( mi ) patients ( 21 ) .
in addition , guella et al . showed a positive association between rs11591147 and lower ldl - c , as well as the reduced risk of developing mi in an italian population ( or = 0.67 ; 95% ci = 0.46 - 0.97 ; p = 0.036 ) ( 2 ) .
another study revealed a correlation between circulating level of pcsk9 and ldl level in 5,722 subjects in stockholm ( 8) . in line with these observations , several other studies have shown an association between circulating level of pcsk9 and ldl - c levels ( 14 , 15 ) .
they measured the catabolism of ldl particles and the endogenous synthesis of very low density lipoprotein ( vldl ) and/or apolipoprotein b ( apob ) .
in addition , they showed that pcsk9 overexpression inhibited ldl expression and activity in mice and in cultured cells .
furthermore , they suggested that the s127r mutation in patients increased vldl and apob levels ( 11 , 12 ) .
however , the present study did not identify a relationship between the pcsk9 polymorphism and cad , supporting further investigations of the role of this genetic polymorphism in a larger population .
performed a genetic study , evaluating the role of rs3008621 located on chromosome 1q41 from the wellcome trust case control consortium with 1926 cases and 875 cad patients .
they identified snp rs3008621 in mia3 gene as a putative genetic variant on 1q41 locus with a high possibility of an association with cad ( 2 ) .
another study by the myocardial infarction genetics consortium in 2009 confirmed the probability of the existence of an association between this snp with cad ( 7 ) .
similarly , another investigation showed the association of this snp with cad cases ( or = 1.10 [ 1.04 - 1.17 ] , p = 1.02103 ) ( 8) .
this lack of relationship can be explained at least in part by variations in lifestyle , diet , medication , and ethnic background and the small sample size used . in conclusion
, data from the present study suggest that rs3008621 mia3 single - nucleotide polymorphisms are unlikely to play a key role in cad in the iranian population , although further investigations are warranted u a larger sample size in both the iranian population and in other ethnicities to confirm these findings . | ### Summary:
: backgroundmelanoma inhibitory activity 3 regulates the plasma level of ldl cholesterol .
the c.3169 + 315 g > a single - nucleotide polymorphism of the mia3 gene has been reported to be associated with serum coronary artery disease ( cad ) .
however , there have been no studies analyzing the association of this polymorphism with cad in iranian individuals with cad.objectivestherefore , in the present study we have investigated the potential protective effect of the rs3008621 mia3 polymorphism in 188 subjects with and without cad.materials and methodsgenotyping of the mia3 gene was undertaken using taqman real - time pcr in all subjects .
anthropometric and biochemical features , including hdl , ldl , and tg were assessed in all subjects.resultsthe cad patients had significantly ( p < 0.05 ) higher bmi and significantly higher levels of tg , ldl , sbp , and dbp , while the level of hdl was lower compared to that of the control group .
the mia3 gene polymorphism was not associated with cad in our population sample.conclusionsthe mia3 polymorphism is unlikely to play an important role in cad in the iranian population .
however , further studies are needed in a larger population to confirm this . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: | ### Summary:
: aluminum lactate [ al(lact)3 ] ( hydrophilic , hydrolytically unstable ) and aluminum acetylacetonate [ al(acae)3 ] ( lipophilic , hydrolytically stable ) were tested as potential toxicants to rabbits upon iv administration both as aqueous solutions and as liposome suspensions .
both chemicals behaved as cardiotoxic agents when administered as aqueous solutions , but al(acae)3 was at least two orders of magnitude more active than al(lact)3 .
al(acae)3 , but not al(lact)3 , caused myocardial infarcts resembling those in humans ( with contraction bands ) at doses as low as 0.24 mg / kg body weight , as well as a prominent acanthocytosis .
al(lact)3 , when administered as a liposome suspension , was about 300 times more toxic than in aqueous solution , although cardiac damage was not infarctual in character .
both chemical and physical speciation of aluminum(iii ) thus play an essential role in determining the toxicity of the metal.imagesfigure 2.figure 3 . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: penetrating keratoplasty has mainly been performed for the treatment of bullous keratopathy and other diseases with corneal endothelial dysfunction . recently , dsaek ( descemet 's stripping automated endothelial keratoplasty ) has been performed as a primary surgical treatment for such diseases [ 13 ] . and
although dsaek is more advantageous for the recovery of visual acuity than penetrating keratoplasty , its complications include postoperative graft detachment and graft dislocation [ 17 ] .
several studies have been conducted to identify a means of preventing the graft - host interface from being detached or being dislocated intraoperatively or postoperatively [ 810 ] .
two of these studies reported that anterior segment optical coherence tomography ( oct ) is useful to assess the status of the graft - host interface [ 8 , 10 ] . in this study , therefore , we prospectively examined the graft - host interface during a dsaek with a handheld oct .
we included 8 eyes of 8 consecutive patients ( 3 men and 5 women ) who underwent dsaek for the treatment of bullous keratopathy at toyama university hospital between october 2010 and february 2012 .
the study protocol was approved by the institutional review board of the university of toyama , and the procedures used conformed to the tenets of the declaration of helsinki .
each patient provided written informed consent after hearing a detailed explanation of the study protocol . in this study ,
the cornea and the anterior segment were examined with a handheld oct during the dsaek surgery and followed up for more than one month after the surgery .
the mean age at the time of surgery was 63.0 18.3 years ( mean standard deviation ) .
we examined the relationship between the intraoperative conditions of the graft - host interface and the postoperative conditions .
eight consecutive eyes with vision loss resulting from corneal edema from bullous keratopathy were selected for the study . only patients with pseudophakia or aphakia were included .
the patients had been diagnosed with pseudophakic bullous keratopathy ( pbk ) ( 2 eyes , 25% ) , fuchs corneal endothelial dystrophy ( 2 eyes , 25% ) , laser iridotomy - induced bullous keratopathy ( libk ) ( 2 eyes , 25% ) , aphakic bullous keratopathy ( 1 eye , 13% ) , and pseudoexfoliation syndrome ( 1 eye , 13% ) .
each patient was treated with dsaek surgery alone , and all surgeries were performed by the same surgeon ( atsushi hayashi ) .
we used an ivue-100 ( ver.1.7 ) as a handheld oct and performed anterior segment oct scans while the patient was in a supine position during the surgery ( figure 1 ) .
a corneal anterior module was attached , and the eyes were scanned using a corneal pachymetry scan pattern .
eight radial scans of 6 mm diameter were obtained at a speed of 1024 a - scans / second .
we used sclerocorneal tissues provided by the toyama eye bank for surgical transplantation . during the surgery ,
the sclerocorneal tissue was mounted on an artificial anterior chamber , tightened completely , and dissected with a microkeratome equipped with a 350 m cutter head .
the precut donor tissue was trephined with a 7.5 mm diameter corneal punch , and a donor endothelial graft was obtained .
then , sub - tenon 's anesthesia of 2% lidocaine ( 1.52 ml ) was administered .
a dsaek busin glide spatula was used to insert the graft into the anterior chamber from a 5 mm temporal sclerocorneal incision , while the anterior chamber depth was maintained with an infusion of balanced salt solution ( bss ) by an anterior chamber maintainer . only in the eyes with fuchs corneal endothelial dystrophy ,
a 100 nylon suture was used to suture the sclerocorneal wound , and the air was injected into the anterior chamber using a 30-gauge needle to attach the graft onto the inner surface of the host cornea .
after the graft was attached , the anterior segment was examined with a handheld oct ( ivue-100 ; optovue inc . ,
when interface fluid was detected between the host cornea and the graft , it was drained through corneal stab incisions , and then the oct scans were repeated . when the graft attachment was confirmed by oct scans , the intraocular pressure ( iop ) was set within the normal range , and the surgery was finished .
the patients were asked to remain in a supine position for 3 hours after surgery .
we removed the host descemet 's membrane during the surgery in the 2 patients with fuchs dystrophy and did not remove the host descemet 's membrane in the other 6 patients .
during dsaek in patient 1 , no interface fluid was detected between the host cornea and the graft by a handheld oct after the injection of air ( figure 2 ) .
we did not encounter a postoperative graft dislocation the day after surgery in this patient . during dsaek in patient 2 with fuchs corneal endothelial dystrophy ,
viscoelastic material was used to maintain the anterior chamber during removal of the descemet 's membrane with a reverse hook .
the viscoelastic material was washed out from the anterior chamber after the removal of the descemet 's membrane , and the graft was inserted into the anterior chamber .
the graft was attached to the inner surface of the cornea by an injection of air .
the handheld oct revealed interface fluid between the host cornea and the graft in this patient , and we tried to drain this fluid through corneal stab incisions . however , a small amount of interface fluid remained at the end of the surgery ( figure 3 ) .
a few days after the surgery , a double anterior chamber was observed , and at 7 days after the surgery graft dislocation was noted inferiorly .
we performed a reoperation and the graft was again attached onto the inner surface of the cornea without any interface fluid by the oct examination .
, we performed the dsaek surgery without any viscoelastic material . in patients 3 and 5 , oct examination during the surgery revealed no interface fluid . because patients 4 , 6 , 7 , and 8 showed small amounts of interface fluid by the oct examination after the injection of air , we drained the interface fluid through corneal stab incisions .
we then confirmed that there was no detectable interface fluid by oct examination and finished the surgery ( figure 4 ) .
dsaek is superior to penetrating keratoplasty in terms of the recovery of visual acuity , the survival rates of corneal endothelial cells , and the rejection rates and does not cause strong corneal astigmatism [ 3 , 11 , 12 ] . in patient 2 , the first surgery failed due to the remaining interface fluid detected by the intraoperative oct .
because we used a viscoelastic material to maintain a working space for removal of the descemet 's membrane from the host cornea during the surgery , a small amount of the viscoelastic material may have remained on the inner surface of the host cornea and disturbed the graft attachment .
it was difficult to distinguish whether the remaining fluid was balanced salt solution or viscoelastic material by the oct examination .
hence , it might be important to use only bss for the irrigation of the anterior chamber during the dsaek surgery and to routinely examine for the presence of interface fluid during the dsaek by means of oct examination . in this series , interface fluid was detected in 5 of the 8 eyes ( 62.5% ) after the graft was attached by air injection .
when even some amount of interface fluid is detected , it should be removed through corneal stub incisions for the success of the dsaek surgery .
hyams et al . reported that , in a case where the interface space was present for more than 2 weeks , the growth of fibrous tissue was triggered and corneal opacity remained .
a slit lamp attached to an operating microscope is commonly used to detect interface fluid between the host cornea and the graft .
however , tanawska and wylegala reported that interface space was detected in 32% of their cases when an anterior segment oct was used for the examination , whereas it was detected only in 16% of their cases when slit lamp was used because the examination was performed one day after dsaek .
because the oct detects interface fluid more accurately than a slit lamp attached to an operating microscope , it would be important to check the interface fluid intraoperatively with a handheld oct and to finish the dsaek without any interface fluid .
hence , an anterior segment oct is effective to assess the interface space during the surgery .
the anterior segment oct used in this study appears to help prevent postoperative graft dislocation and graft detachment , since it allows intraoperative confirmation of the presence of interface fluid .
moreover , it reduces retreatment procedures such as postoperative rebubbling and repositioning . price and price jr .
compared 17 cases retreated postoperatively with 246 cases without retreatment and reported that the endothelial cells were significantly decreased in the retreated cases .
this result suggested that intraoperative removal of the interface fluid detected by an anterior segment oct may help to protect the endothelial cells of the graft .
a handheld oct is useful to detect the interface fluid between the host cornea and the graft during a dsaek . | ### Summary:
: purpose . to examine the graft - host interface during descemet 's stripping automated endothelial keratoplasty ( dsaek ) surgery with optical coherence tomography ( oct )
. design .
prospective , interventional case series .
patients and methods .
eight patients who underwent a dsaek were included .
a handheld oct was used intraoperatively to examine the presence of interface fluid between the host cornea and the graft .
results . in 3 patients
, no interface fluid was detected between the host cornea and the graft after the graft was attached by air injection . in 4 patients ,
interface fluid was detected after the graft was attached by air injection .
the remaining interface fluid was drained through corneal stab incisions .
one patient required a second surgery because the first surgery failed due to persistence of the interface fluid .
all patients showed a complete attachment of the graft at one month after the dsaek surgery .
conclusion .
a handheld oct is useful to detect the interface fluid between the host cornea and the graft during a dsaek . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: occupational exposure to benzene in humans has been found to be increasingly associated with acute myeloid leukemia and non - hodgkin 's lymphomas . among the individuals occupationally exposed to such mutagenic agents , petrochemical workers and gas station operators
are considered particularly because they have to manipulate the fuel and consequently inhale fuel vapors during daily work .
micronucleus ( mn ) assay can be applied to measure dna damage in such human populations .
mn are cytoplasmic chromatin masses with the appearance of small nuclei that arise from chromosome fragments or intact whole chromosomes lagging behind in the anaphase stage of cell division .
the mn test has been applied for biological monitoring of human populations exposed to mutagenic and carcinogenic agents .
many studies have been carried out to determine the mutagenic and carcinogenic effects of tobacco since a long time .
this study intends to quantify mn in individuals of control group , with no tobacco habit and no pre - existing lesions , and petrol bunk workers with papanicolaou ( pap ) and acridine orange stains and to evaluate its efficacy as a genotoxic biomarker .
another aspect of this study is to evaluate the urinary phenol levels in control group and petrol bunk workers .
the control group consisted of 30 individuals in the age group of 2065 , without any clinically observable lesions and without any tobacco ( chewing and smoking ) habits .
the petrol bunk workers group consisted of 30 individuals in age group of 2065 who were randomly selected from different petrol stations in and around indore , india .
the slides were separately evaluated for the presence of mn in acridine orange using fluorescent microscope and pap - stained slides under light microscope .
about 100 cells were counted in acridine orange - stained slides and 100 cells counted in the pap - stained slides .
photomicrograph showing micronuclei ( a : acridine orange stain , 400 ; b : pap , 400 ) another aspect of our study was the biochemical analysis in control group and petrol bunk workers .
urinary phenol levels were measured by yamaguchi and hayashi method to evaluate the exposure levels between control group and petrol bunk workers .
urine samples from petrol bunk workers were collected at the end of their 8-hour shift .
the slides were separately evaluated for the presence of mn in acridine orange using fluorescent microscope and pap - stained slides under light microscope .
about 100 cells were counted in acridine orange - stained slides and 100 cells counted in the pap - stained slides .
photomicrograph showing micronuclei ( a : acridine orange stain , 400 ; b : pap , 400 )
another aspect of our study was the biochemical analysis in control group and petrol bunk workers .
urinary phenol levels were measured by yamaguchi and hayashi method to evaluate the exposure levels between control group and petrol bunk workers .
urine samples from petrol bunk workers were collected at the end of their 8-hour shift .
the mean mn was calculated for each group irrespective of stains . for the control group ,
the range of mn in control group when stained with acridine orange stain was 06 .
the range of mn in petrol bunk workers when stained with acridine orange was 013 .
mean micronuclei recorded in groups irrespective of stains used mean micronuclei recorded using two stains irrespective of groups in the control group , mean urinary phenol was calculated as 8.40 3.13 . in the tobacco users group ,
the mean urinary phenol calculated was 9.621 2.52 mg / l . in the petrol bunk workers , the mean urinary phenol was 12.2 5.06 mg / l .
in the control group , mean urinary phenol was calculated as 8.40 3.13 . in the tobacco users group ,
the mean urinary phenol calculated was 9.621 2.52 mg / l . in the petrol bunk workers , the mean urinary phenol was 12.2 5.06 mg / l .
it is also well established that genomic damage is produced by environmental exposure to genotoxins , medical procedures ( e.g. , radiation and chemicals ) , micronutrient deficiency ( e.g. , folate ) , lifestyle factors ( e.g. , alcohol , smoking , drugs , and stress ) , and genetic factors such as inherited defects in dna metabolism and/or repair .
it is essential to have reliable and relevant minimally invasive biomarkers to improve the implementation of biomonitoring , diagnostics , and treatment of diseases caused by , or associated with , genetic damage .
the mn assay in exfoliated buccal cells is potentially an excellent candidate to serve as such a biomarker.[624 ] the analysis of mn has gained increasing popularity as an in vitro genotoxicity test and a biomarker assay for human genotoxic exposure and effect .
the mn assay can be performed in buccal and other exfoliated cells originating from rapidly dividing epithelial tissue without the need for ex vivo nuclear division , so that the cell cultures required for cytogenetic assays based on analysis of metaphase chromosomes , such as chromosome aberrations and sister chromatid exchanges , are not needed .
the collection of buccal cells has been stated as the least invasive method available for measuring dna damage in humans , especially in comparison to obtaining blood samples for lymphocyte and erythrocyte assays , or tissue biopsies .
the buccal cell mn assay was first proposed in 1983 and continues to gain popularity as a biomarker of genetic damage in numerous applications .
most of the literature that has been published focus primarily on either broad evaluation of noninvasive methods for biomonitoring , the associations of mn or other markers with cancer in various types of exfoliated cells , or are limited to effects of a specific type of exposure , such as smoking and smokeless tobacco or formaldehyde . in this study ,
the mean mn value in petrol bunk workers was 9.80 4.29 when stained with pap and in tobacco users who were nonexposed , the mean mn was 8.57 4.75 and was consistent with the findings of rajkokila et al .
gas station workers showed higher mn in exposed group ( 12.07 4.9 ) when compared with control group ( 2.53 2.05 ) . in our study , the mean calculated was 3.83 3.07 in the petrol bunk workers group and was higher when compared with the control group 2.40 1.40 .
our findings are also in agreement with those of hogstedt et al . , who detected a significant increase in the frequency of mn in the lymphocytes of petrol station workers .
an increased level of chromosomal deletions in brazilian station workers was also shown by santos - mello and cavalcante .
detected an increase in dna strand breaks in mononuclear blood cells of nonsmoker petrol station attendants .
similarly , andreoli et al . also found that dna damage in peripheral lymphocytes of petrol station workers increased , using the single - cell gel electrophoresis method .
the turnover rate for the appearance of mn in exfoliated buccal cells in an otherwise normal cell after exposure to an acute genotoxic event , such as ionizing radiation , is estimated to be a minimum of 57 days .
interindividual variation during this time course of mn expression , however , has been observed so that peak expression of mn may be delayed up to 21 days .
multiple sample times are required to identify optimal timing between 7 and 21 days after exposure because peak expression may vary depending on the effects of the particular dna damage or chromosomal exposure on basal cell turnover rate .
it is possible that certain genotoxic exposures could cause an inhibition or an enhancement of the basal cell proliferation and thus confound the kinetics of mn expression .
our results reveal that petrol station workers could be under risk of significant cytogenetic damage .
the mn test in exfoliated epithelial cells seems to be a useful biomarker of occupational exposure to genotoxic chemicals .
our study also emphasizes on the fact that dna - specific stain is more sensitive in evaluating the mn frequencies when compared with dna nonspecific stain . some nuclear anomalies ( karyorrhexis , karyolysis , binucleates , and condensed chromatin ) with nonspecific stains are sometimes difficult to interpret and may be misclassified as mn . another possible confounding factor in mn studies is the formation of keratin granules that are found in degenerated cells with nuclear anomalies .
these round cytoplasmic bodies , which are formed as a consequence of cell injury , do not contain dna but may be classified as mn with nonspecific stains .
therefore , phenol concentration in the urine of exposed workers can be used as a biomarker of external exposure .
biological monitoring of petrol station attendants showed substantially higher levels of urinary phenol when workers were compared with subjects with no known exposure to either gasoline or benzene.[3638 ] on the other hand , it should also be emphasized that petrol station attendants are not only exposed to hydrocarbons present in petrol vapors but also to the emissions produced by engines during fuel combustion .
khoschsorur and peter reported that urinary phenol concentration in petrol station workers ( 17.28 mg / g / l creatinine ) was higher than in control subjects ( 4.4 6.6 mg / g / l creatinine ) . in this study
, they also found significantly higher urinary phenol levels in petrol station workers ( 19.85 mg / g / l creatinine ) than in control subjects ( 7.25 mg / g / l creatinine ) .
our results are in accordance with the above mentioned studies ; urinary phenol in petrol station attendants was found to be increased ( 12.208 5.061 ) when compared with control subjects ( 8.40107 3.13467 ) .
however , benzene exposure of petrol station attendants can vary widely due to several factors , such as quantity of fuel pumped , type and number of vehicles filled , protective measures , and total content of benzene in the petroleum . according to the data obtained from the petrol stations around the world , each worker pumps an average 2000 l of petroleum , containing 5% ( w / v ) benzene , during their 8-h work shift .
therefore , these factors must be taken into account before the petrol station attendants are subjected to biomonitoring in order to evaluate the exact amount of exposure they are subjected to .
this study supports the use of mn as a biomarker for neoplastic progression but only when dna - specific stains are used .
mn can also be used as a biomarker for genotoxic studies for screening huge populations .
the use of biochemical analysis along with mn evaluation highlights the exposure of the population to genotoxins and adds to the efficiency of our study . | ### Summary:
: background : benzene , which is a major organic product , on chronic exposure can result in many malignant disorders , and therefore exposure to gasoline vapors is classified by the international agency for research of cancer as possible carcinogenic to humans .
petrol station attendants are chronically exposed to petroleum derivatives through inhalation of petrol during vehicle refuelling.aim:this study is aimed to investigate cytogenotoxic damage in exfoliated buccal cells obtained from petrol station workers and control subjects using micronucleus ( mn ) test.materials and methods : this study was carried out on 30 petrol station attendants working at different petrol stations located in indore .
the control group consisted of 30 healthy subjects who were not exposed to benzene .
buccal cell samples were collected at the end of the work shift .
slides were stained and were evaluated to determine the mn frequencies .
exposure monitoring was performed by the detection of phenol excreted in the urine .
urinary phenol measurements were performed following the colorimetric quantitative determination method of yamaguchi and hayashi.results:variations in mn frequencies were seen in control and petrol bunk attendants.conclusion:the mn test in exfoliated epithelial cells seems to be a useful biomarker of occupational exposure to genotoxic chemicals .
phenol is the principal metabolite of benzene .
therefore , phenol concentration in the urine of exposed workers can be used as a biomarker of external exposure . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: seven participants with type 1 diabetes ( 3 women , 4 men ) with an average diabetes duration of 18.7 ( range 735 ) years were matched with 7 nondiabetic healthy participants ( nd ) ( 3 women , 4 men ) .
the study protocol and sample collections were approved by the institutional review board and have been reported previously ( 21,22 ) . on the day before tracer infusion , participants were admitted at 5:00 p.m. and insulin infusion was started at 6:00 p.m. in type 1 diabetic participants on each of two separate visits .
the insulin regimen of type 1 diabetic participants changed during the 3 days before the study in those who were taking long - acting insulin ( n = 4 of 7 participants ) .
they were instructed to use ultra rapid - acting insulin ( aspart or lispro , recombinant insulins ) before each meal and bedtime based on their blood glucose .
participants on an insulin pump ( n = 3 ) using ultra rapid - acting insulin continued their regimen .
all participants maintained their blood glucose between 4.4 and 6.6 mmol / l . on the evening before the study , all participants were admitted to the clinical research unit . on the insulin - treated day in type 1
diabetic participants ( type 1 diabetes insulin - treated state [ i ] ; performed first ) , an intravenous insulin infusion was administered and plasma glucose was maintained between 4.44 and 5.56 mmol / l . on the insulin - deprived day ( type 1 diabetes insulin - deprived state [ i ] ; performed second , 10 days after the first study day ) , insulin infusion was discontinued from 4:00 a.m. to 12:00 p.m. ( 8 h ) and replaced with normal saline . at 4:00 a.m. , after taking baseline arterialized - venous samples for isotopic measurements ( ie ) , a continuous infusion of l[ring - c6]phenylalanine ( cambridge isotope laboratories , andover , ma ) was given for 8 h at a rate of 1.0 mg / kg fat - free mass [ ffm ] per hour preceded by a priming dose ( 1.0 mg / kg ffm ) .
blood samples were then drawn at 2-h intervals in anticoagulant tubes and centrifuged , and plasma was stored at 80c until analysis .
characteristics of study participants data are means se ; n = 7 per group . statistical analyses by 1 2 and 1 3 anova .
i , insulin - deprived state ; i , insulin - treated state . different from nd , p < 0.05 ; different from i , p < 0.05 . an automated turbidimetric method
( roche diagnostics , indianapolis , in ) was used to measure apoa-1 in plasma in the final sample drawn ( after 8 h of tracer infusion ) .
the sample was first incubated with an antibody diluent . after initial incubation and measurement of the sample ,
these complexes produce turbidity in the mixture and increase the amount of light scatter . the decrease in light transmittance resulting from the antigen - antibody reaction
each plasma sample was subjected to affinity chromatography for the depletion of six highly abundant proteins ( albumin , igg , antitrypsin , iga , transferrin , and haptoglobin ) in a single step , with a multiple affinity removal column hu-6 ( agilent technologies , santa clara , ca ) using a biologic hr chromatography system ( biorad , hercules , ca ) running buffers a and b according to specifications of the column manufacturer .
this selective immuno - depletion process provides one enriched pool of low - abundant plasma proteins containing apoa-1 in the column flow - through .
the flow - through was later concentrated using a 5-kda molecular weight cutoff filter , and protein estimation was done by bradford 's method ( biorad ) before being subjected to 2dge .
apoa-1 was isolated from the depleted plasma by performing large , high - resolution 2dge , using 24-cm , ph 310 , 47 , and 4.75.9 immobilized ph gradient ( ipg ) strips ( biorad ) .
duplicate 2dges for each sample were done for ie analyses and one gel per sample for the analysis of posttranslational modifications ( ptms ) .
the method to identify proteins by mass spectrometry is described below . to identify proteins in each gel spot and test for ptms
, apoa-1 spot trains isolated from blood samples drawn at 8 h of isotopic tracer infusion were analyzed .
the silver - stained sds - page gel spots were excised , destained , and subjected to in - gel trypsin digestion .
the extracted peptides were analyzed for protein identification by nano - flow liquid chromatography electrospray tandem mass spectrometry ( nanolc - esi - ms / ms ) using a thermofinnigan ltq orbitrap hybrid mass spectrometer ( thermoelectron , bremen , germany ) coupled to an eksigent nanolc-2d hplc system ( eksigent , dublin , ca ) .
tandem mass spectra ( ms / ms ) were extracted by bioworks , version 3.2 .
all ms / ms spectra were analyzed using mascot ( matrix science , london , u.k .
, version 2.2.04 ) , set to search the swissprot database ( 699,052 entries ) designating the digestion enzyme as trypsin and searching with a fragment ion mass tolerance of 0.80 da and a parent ion tolerance of 10.0 parts per million .
variable modifications chosen were oxidation of methionine and tryptophan , deamidation of asparagine and glutamine , lysine to allysine , lysine to aminoadipic acid , formylation of lysine , dioxidation of tryptophan and methionine , and arginine to glutamic semialdehyde .
mascot - generated data files were manually studied , and any modifications with an ion score below 20 were not considered .
we report the level of a particular modification as the ratio of that modified peptide to that of the total number of unmodified peptides .
the 6 10 cm gel areas corresponding to the location of apoa-1 spot trains ( as identified by the mass spectrometry analyses described above ) were cut and transferred to polyvinylidene fluoride membrane by a semidry electro - transfer apparatus ( biorad ) .
a monoclonal antibody against apoa-1 ( abcam , cambridge , ma ) was used to probe the membrane in 1:200 dilution .
anti - mouse horseradish peroxidase ( hrp)-conjugated antibody was used as the secondary antibody in 1:10,000 dilutions .
the reaction was detected by chemiluminescence ( ecl - plus , ge health care ) . for the detection of carbonylation ,
an oxyblot kit ( millipore , billerica , ma ) was used . briefly , after the ief step in 2dge , the ipg strips were incubated in 1 dnph reagent for 10 min , followed by the second dimension gel separation .
ie measurements were conducted using gas chromatography / tandem mass spectrometry ( gc / ms / ms ) . apoa-1 spot trains isolated from plasma samples obtained at 2 , 4 , 6 , and 8 h were used for gc / ms / ms analysis .
plasma protein gel spots were excised and hydrolyzed using 6 m hcl overnight at 110c to obtain free amino acids .
the free amino acids were isolated using biorad ag-50w 8 cation exchange resin and excess solvent evaporated to dryness .
the amino acid residues were derivatized to their n - heptafluorobutyryl methyl esters and analyzed by tandem mass spectrometry using either a thermofinnigan tsq 7000 ( thermoelectron , waltham , ma ) or a quattro - micro gc ( waters corporation , milford , ma ) under negative ion chemical ionization conditions using isobutane as a reactant gas as described previously ( 23 ) .
free amino acids were extracted from plasma samples using acetic acid as described ( 24 ) and analyzed as their t - butyldimethylsilyl ester derivative ( 25 ) . in the proposed method , plasma amino acid ie is not used in calculations to determine relative protein age , but simply confirms that steady infusion of the [ ring - c6]phenylalanine was successfully performed .
the ie in units of moles percent excess ( mpe ) for [ ring - c6]phenylalanine ( m + 6 ) was calculated above background ( subtracting preinfusion ie ) as previously described ( 24 )
. the relative age of protein isoforms was determined by comparing relative ie between isoforms of the same protein , such as mature isoforms versus precursor isoform ( e.g. , ie ratio of c vs. e ) .
results were analyzed by anova with a fisher protected least significant difference post hoc test . for mixed - model anovas comparing nd , type 1 diabetes i , and type 1 diabetes i
seven participants with type 1 diabetes ( 3 women , 4 men ) with an average diabetes duration of 18.7 ( range 735 ) years were matched with 7 nondiabetic healthy participants ( nd ) ( 3 women , 4 men ) .
the study protocol and sample collections were approved by the institutional review board and have been reported previously ( 21,22 ) . on the day before tracer infusion , participants were admitted at 5:00 p.m. and insulin infusion was started at 6:00 p.m. in type 1 diabetic participants on each of two separate visits .
the insulin regimen of type 1 diabetic participants changed during the 3 days before the study in those who were taking long - acting insulin ( n = 4 of 7 participants ) .
they were instructed to use ultra rapid - acting insulin ( aspart or lispro , recombinant insulins ) before each meal and bedtime based on their blood glucose .
participants on an insulin pump ( n = 3 ) using ultra rapid - acting insulin continued their regimen .
all participants maintained their blood glucose between 4.4 and 6.6 mmol / l . on the evening before the study , all participants were admitted to the clinical research unit . on the insulin - treated day in type 1
diabetic participants ( type 1 diabetes insulin - treated state [ i ] ; performed first ) , an intravenous insulin infusion was administered and plasma glucose was maintained between 4.44 and 5.56 mmol / l . on the insulin - deprived day ( type 1 diabetes insulin - deprived state [ i ] ; performed second , 10 days after the first study day ) , insulin infusion was discontinued from 4:00 a.m. to 12:00 p.m. ( 8 h ) and replaced with normal saline . at 4:00 a.m. , after taking baseline arterialized - venous samples for isotopic measurements ( ie ) , a continuous infusion of l[ring - c6]phenylalanine ( cambridge isotope laboratories , andover , ma ) was given for 8 h at a rate of 1.0 mg / kg fat - free mass [ ffm ] per hour preceded by a priming dose ( 1.0 mg / kg ffm ) .
blood samples were then drawn at 2-h intervals in anticoagulant tubes and centrifuged , and plasma was stored at 80c until analysis .
characteristics of study participants data are means se ; n = 7 per group . statistical analyses by 1 2 and 1 3 anova .
i , insulin - deprived state ; i , insulin - treated state . different from nd ,
an automated turbidimetric method ( roche diagnostics , indianapolis , in ) was used to measure apoa-1 in plasma in the final sample drawn ( after 8 h of tracer infusion ) .
the sample was first incubated with an antibody diluent . after initial incubation and measurement of the sample , blank , undiluted antiserum specific to human apoa-1
these complexes produce turbidity in the mixture and increase the amount of light scatter . the decrease in light transmittance resulting from the antigen - antibody reaction
each plasma sample was subjected to affinity chromatography for the depletion of six highly abundant proteins ( albumin , igg , antitrypsin , iga , transferrin , and haptoglobin ) in a single step , with a multiple affinity removal column hu-6 ( agilent technologies , santa clara , ca ) using a biologic hr chromatography system ( biorad , hercules , ca ) running buffers a and b according to specifications of the column manufacturer .
this selective immuno - depletion process provides one enriched pool of low - abundant plasma proteins containing apoa-1 in the column flow - through .
the flow - through was later concentrated using a 5-kda molecular weight cutoff filter , and protein estimation was done by bradford 's method ( biorad ) before being subjected to 2dge .
apoa-1 was isolated from the depleted plasma by performing large , high - resolution 2dge , using 24-cm , ph 310 , 47 , and 4.75.9 immobilized ph gradient ( ipg ) strips ( biorad ) .
duplicate 2dges for each sample were done for ie analyses and one gel per sample for the analysis of posttranslational modifications ( ptms ) . the method to identify proteins by mass spectrometry
to identify proteins in each gel spot and test for ptms , apoa-1 spot trains isolated from blood samples drawn at 8 h of isotopic tracer infusion were analyzed .
the silver - stained sds - page gel spots were excised , destained , and subjected to in - gel trypsin digestion .
the extracted peptides were analyzed for protein identification by nano - flow liquid chromatography electrospray tandem mass spectrometry ( nanolc - esi - ms / ms ) using a thermofinnigan ltq orbitrap hybrid mass spectrometer ( thermoelectron , bremen , germany ) coupled to an eksigent nanolc-2d hplc system ( eksigent , dublin , ca ) .
tandem mass spectra ( ms / ms ) were extracted by bioworks , version 3.2 .
all ms / ms spectra were analyzed using mascot ( matrix science , london , u.k .
, version 2.2.04 ) , set to search the swissprot database ( 699,052 entries ) designating the digestion enzyme as trypsin and searching with a fragment ion mass tolerance of 0.80 da and a parent ion tolerance of 10.0 parts per million .
variable modifications chosen were oxidation of methionine and tryptophan , deamidation of asparagine and glutamine , lysine to allysine , lysine to aminoadipic acid , formylation of lysine , dioxidation of tryptophan and methionine , and arginine to glutamic semialdehyde .
mascot - generated data files were manually studied , and any modifications with an ion score below 20 were not considered .
we report the level of a particular modification as the ratio of that modified peptide to that of the total number of unmodified peptides .
the 6 10 cm gel areas corresponding to the location of apoa-1 spot trains ( as identified by the mass spectrometry analyses described above ) were cut and transferred to polyvinylidene fluoride membrane by a semidry electro - transfer apparatus ( biorad ) .
a monoclonal antibody against apoa-1 ( abcam , cambridge , ma ) was used to probe the membrane in 1:200 dilution .
anti - mouse horseradish peroxidase ( hrp)-conjugated antibody was used as the secondary antibody in 1:10,000 dilutions .
the reaction was detected by chemiluminescence ( ecl - plus , ge health care ) .
for the detection of carbonylation , an oxyblot kit ( millipore , billerica , ma ) was used .
briefly , after the ief step in 2dge , the ipg strips were incubated in 1 dnph reagent for 10 min , followed by the second dimension gel separation .
ie measurements were conducted using gas chromatography / tandem mass spectrometry ( gc / ms / ms ) . apoa-1
spot trains isolated from plasma samples obtained at 2 , 4 , 6 , and 8 h were used for gc / ms / ms analysis .
plasma protein gel spots were excised and hydrolyzed using 6 m hcl overnight at 110c to obtain free amino acids .
the free amino acids were isolated using biorad ag-50w 8 cation exchange resin and excess solvent evaporated to dryness .
the amino acid residues were derivatized to their n - heptafluorobutyryl methyl esters and analyzed by tandem mass spectrometry using either a thermofinnigan tsq 7000 ( thermoelectron , waltham , ma ) or a quattro - micro gc ( waters corporation , milford , ma ) under negative ion chemical ionization conditions using isobutane as a reactant gas as described previously ( 23 ) .
free amino acids were extracted from plasma samples using acetic acid as described ( 24 ) and analyzed as their t - butyldimethylsilyl ester derivative ( 25 ) . in the proposed method , plasma amino acid ie is not used in calculations to determine relative protein age , but simply confirms that steady infusion of the [ ring - c6]phenylalanine was successfully performed .
the ie in units of moles percent excess ( mpe ) for [ ring - c6]phenylalanine ( m + 6 ) was calculated above background ( subtracting preinfusion ie ) as previously described ( 24 )
. the relative age of protein isoforms was determined by comparing relative ie between isoforms of the same protein , such as mature isoforms versus precursor isoform ( e.g. , ie ratio of c vs. e ) .
results were analyzed by anova with a fisher protected least significant difference post hoc test . for mixed - model anovas comparing nd , type 1 diabetes i , and type 1 diabetes i , the study participant 's identity was set as a random effects variable .
analyses were performed using jmp 7.0 statistical software . statistical significance was set at p = 0.05 .
in 2dge with ipg strips having full ph range ( 310 ph ) down to the narrowest range possible ( 4.75.9 ph ) , apoa-1 produced five distinct protein gel spots horizontally separated from one another based on the pi ( a spot train ) .
we named them spots a , b , c , d , and e from relatively negatively charged isoforms ( toward the positive end of gel [ left ] ) to the more positively charged isoform spots [ toward the negative end of gel ( right ) ] ( fig .
we also further verified the identity of the spots by western blot , which demonstrated immunologic reactivity of each protein isoform ( data not shown ) .
amino acid sequence obtained from the mascot search revealed that the propeptide rhfwqq was present only in spots d and e ( fig .
the propeptide was absent in spots a , b , and c , indicating that these spots were mature versions of apoa-1 .
ipg strips of 24-cm length having various ph ranges ( 310 , 47 , and 4.75.9 ) were used for ief .
the isoforms were named as a to e ( as relatively negative to positive in charge ) .
propeptide rhfwqq ( in the blue box ) for spots d and e , which defines those as apoa-1 precursors .
the propeptide portion was absent in spot - trains a , b , and c , and thus those are mature forms .
( a high - quality digital representation of this figure is available in the online issue . ) figure 2a shows the ies , corrected for preinfusion background ie , measured from all of the five spots of apoa-1 isolated from blood samples collected at times 2 , 4 , 6 , and 8 h during the tracer infusion period .
it demonstrates that spot e is the newest ( higher ie than all other spots , p < 0.05 ) , followed by spot d ( higher ie than a , b , and c , p < 0.05 ) , and then spots a , b , and c are the oldest .
furthermore , it shows real - time incorporation of label , since the ies at 8 h of infusion were significantly higher than those at 2 h ( p < 0.05 ) . in apoa-1 spots 10 days after the isotopic infusion , we found that spots a , b , and c , which are mature forms of apoa-1 , had significantly higher levels of [ ring - c6]phenylalanine enrichment ( ie ) than the newer versions d and e ( p < 0.05 ) ( fig .
2b ) , which indicates that mature forms were synthesized in the past , back when the propeptide contained a higher ie .
a : ie during labeled amino acid infusion was measured in apoa-1 spot trains isolated from plasma .
spot e had the highest levels of ie , indicating that it was the newest isoform , whereas a was the oldest .
main effect of isoform , p < 0.0001 ; main effect of time , p < 0.0001 ; different from 2-h time point , p < 0.05 ; # different from isoform d , p < 0.05 ; * different from isoforms a , b , and c ; p < 0.05 .
b : ie in the apoa-1 spots 10 days after the 8-h infusion of labeled amino acid .
the figure demonstrates that the label accumulated in isoforms a , b , and c. greater decrease or disappearance of the label in spots d and e indicates that proteins representing those isoforms were replaced by de novo synthesis .
* different from isoforms a , b , and c ; p < 0.05 . ( a high - quality digital representation of this figure is available in the online issue . ) since the first dimension separation of proteins in 2dge is based on their pi ( isoelectric ph , or net charge of a protein ) , the separation of a specific protein into a spot train is the result of charge variants in the same protein .
ptms are the main reason for variation in the charge of protein amino acid residues and were detected by changes in the mass spectra such as that shown for deamidation in fig . 3a . as shown in fig .
the presence of histidine ( h ) in the propeptide gives an additional strong positive charge for spots d and e. we believe that this may be the main reason why spots d and e are shifted to the positive side of the gel that attracts negatively charged proteins .
spot e was purely propeptide in all samples , but d sometimes contained some mature peptide in addition to propeptide .
thus , d could be a transition stage between the newer and mature form of apoa-1 .
the ie results support the idea that d represents a transition stage , since the ie for spot d was between that of spots e and c. posttranslational modifications .
a : the ms / ms spectrum of a specific apoa-1 peptide showing deamidation of asparagine .
the lower panel shows the fragment ions of the specific peptide leal kenggar having a 1-da shift starting from the asp residue ( n ) where it is deamidated .
similar addition of 1 da in y ions is shown in the table on the left starting from asp residue n. b : level of deamidation and reversible oxidation in isoforms of apoa-1 .
apoa-1 spots b , c , and e were analyzed by tandem mass spectrometry for deamidation of asparagine ( n ) and glutamine ( q ) and oxidation of tryptophan ( w ) , histidine ( h ) , and methionine ( m ) .
spot b showed higher levels of both deamidation and oxidation when compared with spot c , and c showed higher levels of these modifications than e ( b > c > e ) .
c : extent of protein carbonylation among the isoforms of apoa-1 . the same protein sample ran in parallel , visualized by silver stain .
immunoblot showing the extent of carbonylation that was detectable in spots a , b , and c of apoa-1 as opposed to spots d and e , which are newly synthesized and showed complete absence of carbonyl reaction .
( a high - quality digital representation of this figure is available in the online issue . )
the protein coverage for spots b , c , and e was comprehensive enough to allow for comparison of the number of peptides containing ptms present in each spot , whereas spots a and d were not analyzed for all ptms because of their lower sequence coverage .
deamidation of asparagine and glutamine are two modifications that are believed to represent biologically deleterious protein damage .
these ptms can be detected by a shift of 1 da in the parent ion spectrum , and the position of deamidation in the ms / ms spectra can be determined as shown in fig .
3a for the apoa-1 peptide lealkenggar . the number of peptides with deamidated amino acids ( asparagine and glutamine ) was higher in spots b and lowest in spot e ( b > c > e ) . as shown in fig .
deamidation adds a negative charge under ief conditions , which contributes to the shift of spots within a train toward the positive side of the gel .
similarly , oxidation of tryptophan , histidine , and methionine was determined by the shift of 16 da in the ion fragments of modified peptides .
we observed that oxidation of these amino acids ( letters in bold blue ) in spot b was highest and spot e was lowest ( b > c > e ) ( fig .
although these oxidations do not contribute to the difference in the charge of protein isoforms , oxidation is considered a maker for protein aging and damage that corresponds to the fact that the older proteins showed more of this modification . by western blot analysis
, we found that spots a , b , and c reacted for the presence of carbonylation ( irreversible oxidation ) , whereas spots d and e did not ( fig .
carbonyl formation in certain amino acids ( e.g. , lysine conversion to allysine ) removes their positive charge to make the protein more negative , which in turn will make the spot shift toward the positive end of the 2dge .
together , all these data suggest that ptms are likely responsible for the development of spot trains of apoa-1 .
higher oxidative damage and deamidation are present in the spots of apoa-1 that are relatively older and to the positive side of the gel , which is consistent with the concept that older proteins have experienced more opportunity over time for chemical insults .
4a ) showed higher value during insulin deficiency ( p < 0.05 ) , demonstrating that insulin deficiency triggers the newly formed proteins to be modified into the matured , damaged versions of the protein . a similar trend ,
although not statistically significant , was shown for protein spots b / e ( type 1 diabetes i , 0.060 0.016 ; type 1 diabetes i , 0.083 0.015 ; nd , 0.057 0.010 ) and for spots a / e ( type 1 diabetes i , 0.023 0.008 ; type 1 diabetes i , 0.050 0.014 ; nd , 0.023 0.007 ) .
the pattern reveals that the apoa-1 isoforms that are more negatively charged are older and that insulin withdrawal makes the mature isoforms chronologically younger , but more damaged because of rapid modification of the de novo synthesized isoform .
it should be reiterated here that when applying this methodology , the ratio of ie in aged versus new proteins is important rather than the absolute ies of any individual spot .
a. the ratio of isotopic enrichment ( ie ) in older versus newer ( c / e ) apoa-1 spots demonstrates that the ratio is higher in type 1 diabetic individuals during insulin deprivation .
this shows that during insulin deprivation , newly synthesized apoa-1 is more rapidly modified and thus matures and ages more quickly .
b : extent of carbonylation ( oxidation ) in gel spot c of apoa-1 as measured by mass spectrometry after 8 h of insulin deprivation or treatment in type 1 diabetic individuals and no hormone administration in nd .
the ratio of allysine to lysine was higher in the specific apoa-1 peptides of spot c in type 1 diabetic individuals during insulin deprivation .
( a high - quality digital representation of this figure is available in the online issue . ) as there were no differences between groups ( type 1 diabetes
i vs. type 1 diabetes i vs. nd ) for the relative amount of each isoform ( percentage of total apoa-1 represented by each spot ; data not shown ) , we analyzed for ptms in spot c , the most abundant isoform .
however , we found a significant increase in oxidation as shown by the ratio of carbonylated to total peptides ( modification of lysine to allysine , p < 0.05 ) ( fig .
allysine formation is an intermediate step in the irreversible oxidative damage of carbonylation in the form of aminoadipic acid .
allysine formations also remove the positive charge from the amino acid residue , so that the protein becomes more negatively charged and moves to the left toward the positive side of the gel .
we demonstrated an association between the higher level of oxidative damage in spot c with the old / new ie ratio ( c / e ) in type 1 diabetes during insulin deprivation .
hence , this shows that in application of this novel methodology , important knowledge can be gained by combining a static measure of the amount of damage with a kinetic measurement of the conversion of relatively undamaged de novo synthesized protein into damaged , mature protein isoforms .
in 2dge with ipg strips having full ph range ( 310 ph ) down to the narrowest range possible ( 4.75.9 ph ) , apoa-1 produced five distinct protein gel spots horizontally separated from one another based on the pi ( a spot train ) .
we named them spots a , b , c , d , and e from relatively negatively charged isoforms ( toward the positive end of gel [ left ] ) to the more positively charged isoform spots [ toward the negative end of gel ( right ) ] ( fig .
we also further verified the identity of the spots by western blot , which demonstrated immunologic reactivity of each protein isoform ( data not shown ) .
amino acid sequence obtained from the mascot search revealed that the propeptide rhfwqq was present only in spots d and e ( fig .
the propeptide was absent in spots a , b , and c , indicating that these spots were mature versions of apoa-1 .
ipg strips of 24-cm length having various ph ranges ( 310 , 47 , and 4.75.9 ) were used for ief .
the isoforms were named as a to e ( as relatively negative to positive in charge ) .
propeptide rhfwqq ( in the blue box ) for spots d and e , which defines those as apoa-1 precursors .
the propeptide portion was absent in spot - trains a , b , and c , and thus those are mature forms .
( a high - quality digital representation of this figure is available in the online issue . )
figure 2a shows the ies , corrected for preinfusion background ie , measured from all of the five spots of apoa-1 isolated from blood samples collected at times 2 , 4 , 6 , and 8 h during the tracer infusion period .
it demonstrates that spot e is the newest ( higher ie than all other spots , p < 0.05 ) , followed by spot d ( higher ie than a , b , and c , p < 0.05 ) , and then spots a , b , and c are the oldest .
furthermore , it shows real - time incorporation of label , since the ies at 8 h of infusion were significantly higher than those at 2 h ( p < 0.05 ) . in apoa-1 spots 10 days after the isotopic infusion , we found that spots a , b , and c , which are mature forms of apoa-1 , had significantly higher levels of [ ring - c6]phenylalanine enrichment ( ie ) than the newer versions d and e ( p < 0.05 ) ( fig .
2b ) , which indicates that mature forms were synthesized in the past , back when the propeptide contained a higher ie .
a : ie during labeled amino acid infusion was measured in apoa-1 spot trains isolated from plasma .
spot e had the highest levels of ie , indicating that it was the newest isoform , whereas a was the oldest .
mpe , moles percent excess ; hr , hours of tracer infusion . means se for n = 7 nd participants .
main effect of isoform , p < 0.0001 ; main effect of time , p < 0.0001 ; different from 2-h time point , p < 0.05 ; # different from isoform d , p < 0.05 ; * different from isoforms a , b , and c ; p < 0.05 .
b : ie in the apoa-1 spots 10 days after the 8-h infusion of labeled amino acid .
the figure demonstrates that the label accumulated in isoforms a , b , and c. greater decrease or disappearance of the label in spots d and e indicates that proteins representing those isoforms were replaced by de novo synthesis .
( a high - quality digital representation of this figure is available in the online issue . )
since the first dimension separation of proteins in 2dge is based on their pi ( isoelectric ph , or net charge of a protein ) , the separation of a specific protein into a spot train is the result of charge variants in the same protein .
ptms are the main reason for variation in the charge of protein amino acid residues and were detected by changes in the mass spectra such as that shown for deamidation in fig . 3a . as shown in fig .
the presence of histidine ( h ) in the propeptide gives an additional strong positive charge for spots d and e. we believe that this may be the main reason why spots d and e are shifted to the positive side of the gel that attracts negatively charged proteins .
spot e was purely propeptide in all samples , but d sometimes contained some mature peptide in addition to propeptide .
thus , d could be a transition stage between the newer and mature form of apoa-1 .
the ie results support the idea that d represents a transition stage , since the ie for spot d was between that of spots e and c. posttranslational modifications .
a : the ms / ms spectrum of a specific apoa-1 peptide showing deamidation of asparagine .
the lower panel shows the fragment ions of the specific peptide leal kenggar having a 1-da shift starting from the asp residue ( n ) where it is deamidated .
similar addition of 1 da in y ions is shown in the table on the left starting from asp residue n. b : level of deamidation and reversible oxidation in isoforms of apoa-1 .
apoa-1 spots b , c , and e were analyzed by tandem mass spectrometry for deamidation of asparagine ( n ) and glutamine ( q ) and oxidation of tryptophan ( w ) , histidine ( h ) , and methionine ( m ) .
spot b showed higher levels of both deamidation and oxidation when compared with spot c , and c showed higher levels of these modifications than e ( b > c > e ) .
immunoblot showing the extent of carbonylation that was detectable in spots a , b , and c of apoa-1 as opposed to spots d and e , which are newly synthesized and showed complete absence of carbonyl reaction .
( a high - quality digital representation of this figure is available in the online issue . )
the protein coverage for spots b , c , and e was comprehensive enough to allow for comparison of the number of peptides containing ptms present in each spot , whereas spots a and d were not analyzed for all ptms because of their lower sequence coverage .
deamidation of asparagine and glutamine are two modifications that are believed to represent biologically deleterious protein damage .
these ptms can be detected by a shift of 1 da in the parent ion spectrum , and the position of deamidation in the ms / ms spectra can be determined as shown in fig .
the number of peptides with deamidated amino acids ( asparagine and glutamine ) was higher in spots b and lowest in spot e ( b > c > e ) .
3b . deamidation adds a negative charge under ief conditions , which contributes to the shift of spots within a train toward the positive side of the gel .
similarly , oxidation of tryptophan , histidine , and methionine was determined by the shift of 16 da in the ion fragments of modified peptides .
we observed that oxidation of these amino acids ( letters in bold blue ) in spot b was highest and spot e was lowest ( b > c > e ) ( fig .
although these oxidations do not contribute to the difference in the charge of protein isoforms , oxidation is considered a maker for protein aging and damage that corresponds to the fact that the older proteins showed more of this modification . by western blot analysis
, we found that spots a , b , and c reacted for the presence of carbonylation ( irreversible oxidation ) , whereas spots d and e did not ( fig .
carbonyl formation in certain amino acids ( e.g. , lysine conversion to allysine ) removes their positive charge to make the protein more negative , which in turn will make the spot shift toward the positive end of the 2dge .
together , all these data suggest that ptms are likely responsible for the development of spot trains of apoa-1 .
higher oxidative damage and deamidation are present in the spots of apoa-1 that are relatively older and to the positive side of the gel , which is consistent with the concept that older proteins have experienced more opportunity over time for chemical insults .
4a ) showed higher value during insulin deficiency ( p < 0.05 ) , demonstrating that insulin deficiency triggers the newly formed proteins to be modified into the matured , damaged versions of the protein . a similar trend ,
although not statistically significant , was shown for protein spots b / e ( type 1 diabetes i , 0.060 0.016 ; type 1 diabetes i , 0.083 0.015 ; nd , 0.057 0.010 ) and for spots a / e ( type 1 diabetes i , 0.023 0.008 ; type 1 diabetes i , 0.050 0.014 ; nd , 0.023 0.007 ) .
the pattern reveals that the apoa-1 isoforms that are more negatively charged are older and that insulin withdrawal makes the mature isoforms chronologically younger , but more damaged because of rapid modification of the de novo synthesized isoform .
it should be reiterated here that when applying this methodology , the ratio of ie in aged versus new proteins is important rather than the absolute ies of any individual spot . protein aging .
a. the ratio of isotopic enrichment ( ie ) in older versus newer ( c / e ) apoa-1 spots demonstrates that the ratio is higher in type 1 diabetic individuals during insulin deprivation .
this shows that during insulin deprivation , newly synthesized apoa-1 is more rapidly modified and thus matures and ages more quickly .
b : extent of carbonylation ( oxidation ) in gel spot c of apoa-1 as measured by mass spectrometry after 8 h of insulin deprivation or treatment in type 1 diabetic individuals and no hormone administration in nd .
the ratio of allysine to lysine was higher in the specific apoa-1 peptides of spot c in type 1 diabetic individuals during insulin deprivation .
( a high - quality digital representation of this figure is available in the online issue . )
as there were no differences between groups ( type 1 diabetes i vs. type 1 diabetes i vs. nd ) for the relative amount of each isoform ( percentage of total apoa-1 represented by each spot ; data not shown ) , we analyzed for ptms in spot c , the most abundant isoform .
however , we found a significant increase in oxidation as shown by the ratio of carbonylated to total peptides ( modification of lysine to allysine , p < 0.05 ) ( fig .
allysine formation is an intermediate step in the irreversible oxidative damage of carbonylation in the form of aminoadipic acid .
allysine formations also remove the positive charge from the amino acid residue , so that the protein becomes more negatively charged and moves to the left toward the positive side of the gel .
we demonstrated an association between the higher level of oxidative damage in spot c with the old / new ie ratio ( c / e ) in type 1 diabetes during insulin deprivation .
hence , this shows that in application of this novel methodology , important knowledge can be gained by combining a static measure of the amount of damage with a kinetic measurement of the conversion of relatively undamaged de novo synthesized protein into damaged , mature protein isoforms .
the current experiment clearly demonstrates that the different spots within spot trains of 2dge represent different ages of apoa-1 by differences in the stable isotope - labeled amino acid ( [ ring - c6]phenylalanine ) enrichment and the presence of posttranslational protein modifications .
the highest [ ring - c6]phenylalanine enrichment is shown in pro - apoa-1 , which is newly synthesized , whereas the isoforms of apoa-1 with modifications such as carbonylation and deamidation have lower [ ring - c6]phenylalanine enrichment , supporting the theory that they were synthesized earlier . in support of our hypothesis , the results show that in type 1 diabetes during insulin deficiency , in comparison with insulin treatment , greater oxidative damage occurred to apoa-1 and results in a rapid shifting of de novo synthesized protein to the location of the aged proteins within the spot train in 2dge .
apoa-1 is produced by the liver and intestines ( 26 ) and is released into the circulation as a propeptide ( spots d and e ) , which is converted into the mature isoform while in circulation ( spots a , b , and c ) ( 9,27,28 ) . principles of this proposed methodology dictate that proteins that were most recently synthesized ( i.e. , during the infusion of [ ring - c6]phenylalanine ) should contain higher amounts of [ ring - c6]phenylalanine as was shown for the propeptides , especially isoform e. in contrast , spots d , c , b , and a showed progressively lower ie , indicating that they were more synthesized before the stable isotope exposure ( fig . 2a ) . the half - life of the mature form is much longer than the propeptide form ( 27 ) , which is consistent with the fact that we found higher isotopic enrichment in the mature forms than propeptides in blood samples drawn 10 days after tracer administration ( fig .
2b ) . when we tested spots b , c , and e , the spots with sufficient protein amount for reliable analysis , the spots with lower pi ( toward the positive side of the gel ) showed higher degrees of deamidation and oxidation ( spot b > c >
this higher degree of damage further supported the isotopic results showing different ages of the isoforms , with mature forms having more time to age and thus more time for environmental insults causing damage .
furthermore , the results for deamidation and carbonylation may provide a mechanism for the phenomenon of spot trains . both of these ptms produce a relative decline of pi ( the charge becomes more negative ) and thus would shift the protein spots toward the left , which is positive and attracts negatively charged species . with regard to the physiologic relevance of these modifications
, carbonylation has been shown to reduce enzyme activities ( 29,30 ) , and the ability to sufficiently repair deamidation is important for proper physiologic functions and survival ( 31,32 ) .
accumulations of these types of damage have been shown in many pathologic states , such as in the brains of individuals with alzheimer disease ( 8,33,34 ) and in the aging human lens that is prone to cataracts ( 35,36 ) .
for this isotope - based approach of measuring relative protein age , the important comparison is between the ies ( the ratio ) for any certain isoform versus the most newly synthesized form ( ideally the precursor isoform ) .
thus , for example , we compared between groups spot c 's ie divided by spot e 's ie .
to reiterate , when comparing different individuals , this ratio of ies in older protein versus newest protein isoform ( old / new ) was calculated and analyzed . in people with type 1 diabetes , insulin deprivation increased the ratio of ies in spots a , b , and c versus e , and results for spot c versus e are shown in fig .
this pattern of results clearly indicates that the young form of apoa-1 more rapidly becomes a damaged , aged form .
coincident with this faster pi shift for apoa-1 was a greater accumulation of carbonylation during insulin deprivation ( e.g. , conversion of lysine to allysine as shown in fig .
this provides a mechanism for the association between poor glycemic control chronically and higher levels of protein oxidation in diabetes ( 37 ) .
admittedly , we did not study insulin deprivation in nd participants , so we can not know with certainty that protein damage was caused directly by impacts of insulin or glucose changes per se , as it is possible that long - term diabetes in type 1 diabetic individuals somehow leads to greater susceptibility to the detriments of insulin withdrawal .
nonetheless , apparently each glycemic excursion in people with type 1 diabetes causes an increment of oxidative damage to important proteins such as apoa-1 , and certainly to others as well . a potential reason for this higher oxidative damage is increased oxygen consumption ( 21,38 ) involving increased fatty acid oxidation ( 39 ) , glucose oxidation ( 40 ) , and amino acid oxidation ( 41 ) potentially resulting in increased reactive oxygen species production .
it certainly may be that this rapid aging of apoa-1 , a key protein in lipoprotein metabolism , causes the known higher risk for macrovascular disease in people with type 1 diabetes ( 20 ) .
however , the current study did not directly address whether oxidative damage of apoa-1 causes alterations of apoa-1 function .
the results from this isotope - based approach indicate important information about the mechanism underlying the higher degree of apoa-1 damage in type 1 diabetic individuals with poor glycemic control .
the higher damage appears to be largely related to a more rapid rate at which the damage is incurred .
we have shown for apoa-1 in type 1 diabetic individuals that de novo synthesized protein is actually rapidly converted into the damaged mature forms , and so the high amount of amino acid label incorporated into the damage forms indicates that the problem is not simply inadequate clearance of damaged proteins , but rather the problem is that the environment promotes rapid oxidation and deamidation
. it could be that there was also some impact upon degradation of damaged protein , but it appears that an increased rate of damage was a primary event in the development of altered ptm distribution during insulin withdrawal .
therefore , potential medical interventions in this type of situation , such as that of type 1 diabetic individuals , would appropriately be aimed at creating a less harsh environment in plasma , rather than solely focusing on increasing rates of protein degradation .
we did not find any differences in plasma apoa-1 concentrations in the diabetic participants under the two study conditions and nondiabetic control subjects .
it may also be that long - term changes in circulating insulin levels can affect the absolute concentration of apoa-1 and its isoform distribution , but we have shown that even short - term changes in glycemic control can alter the degree of damage for a given level of apoa-1 and can alter the kinetics of the damage process .
moreover , by applying the current approach , we have generated a hypothesis regarding the etiology of type 1 diabetes related vascular complications , and hopefully this methodology will be useful for studying other conditions as well ( such as alzheimer disease , cataracts , cancer , sarcopenia , etc . ) in which oxidative damage and other modifications have been implicated ( 8,3336,42,43 ) .
the current methodology demonstrates that when new proteins are rapidly damaged , as in type 1 diabetic individuals during insulin deficiency and hyperglycemia , then apparently aged proteins will contain substantial label .
in contrast to the accelerated apoa-1 oxidation observed during insulin deficiency , hyperinsulinemia may result in the accumulation of older and damaged proteins , which contain a lower isotope label .
indeed , insulin is a major in vivo regulator of the rate of protein synthesis and degradation , and insulin deprivation is associated with profound changes in protein metabolism in people with type 1 diabetes ( 41,4446 ) .
although we studied plasma , any tissue can be studied based on this novel methodology . in conclusion , we have developed a methodology to measure the relative age of apoa-1 isoforms , oxidative damage , and other modifications . with this new methodology , using stable isotope - labeled amino acid infusion in vivo , 2dge resolution of spot trains , and mass spectrometry analyses , we demonstrated the effects of acute insulin deficiency and hyperglycemia in type 1 diabetic individuals upon the conversion of the newly synthesized apoa-1 precursor into mature and damaged forms .
this method also allows investigators to identify de novo synthesized protein isoforms , assess the relative age of the older isoforms , and determine whether aged and damaged proteins accumulate in conditions of insulin resistance and hyperinsulinemia , thus contributing to various pathologies and dysfunctions . | ### Summary:
: objectivethe accumulation of old and damaged proteins likely contributes to complications of diabetes , but currently no methodology is available to measure the relative age of a specific protein alongside assessment of posttranslational modifications ( ptm ) . to accomplish our goal of studying the impact of insulin deficiency and hyperglycemia in type 1 diabetes upon accumulation of old damaged isoforms of plasma apolipoprotein a-1 ( apoa-1 )
, we sought to develop a novel methodology , which is reported here and can also be applied to other specific proteins.research design and methodsto label newly synthesized proteins , [ ring-13c6]phenylalanine was intravenously infused for 8 h in type 1 diabetic participants ( n = 7 ) during both insulin treatment and 8 h of insulin deprivation and in nondiabetic participants ( n = 7 ) .
apoa-1 isoforms were purified by two - dimensional gel electrophoresis ( 2dge ) and assessment of protein identity , ptm , and [ ring-13c6]phenylalanine isotopic enrichment ( ie ) was performed by tandem mass spectrometry.resultsfive isoforms of plasma apoa-1 were identified by 2dge including apoa-1 precursor ( pro - apoa-1 ) that contained the relatively highest ie , whereas the older forms contained higher degrees of damage ( carbonylation , deamidation ) and far less ie . in type 1 diabetes ,
the relative ratio of ie of [ ring-13c6]phenylalanine in an older isoform versus pro - apoa-1 was higher during insulin deprivation , indicating that de novo synthesized pro - apoa-1 more rapidly accumulated damage , converting to mature apoa-1.conclusionswe developed a mass spectrometry based methodology to identify the relative age of protein isoforms .
the results demonstrated accelerated oxidative damage to plasma apoa-1 , thus offering a potential mechanism underlying the impact of poor glycemic control in type 1 diabetic patients that affects a patient 's risk for vascular disease . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: | ### Summary:
: the intracellular compartmentation of essential and toxic metals is of intense scientific interest because of its potential for adding to our understanding of both normal homeostatic mechanisms for metals and of the mechanisms which underlie metal - induced cell injury .
high - affinity metal - binding proteins , lysosomes , and precipitates such as inclusion bodies or concretions , play major roles in the regulation of divalent - metal cation bioavailability .
the contribution of a given compartment toward metal homeostasis is dependent upon the level exposure , cell type , organ , species , and life cycle of the organism .
toxic metals may move between these compartments , but the rates and determinants of such exchanges have not been characterized .
available data clearly indicate that sequestration of toxic metals in these specialized compartments can produce profound disturbances in the subcellular handling of essential metals .
further studies of the mechanisms by which metals partition and/or transfer among these compartments are essential to understand and predict toxicity of this important class of toxic agents.imagesfigure 2.figure 3.figure 4 . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: the incidence of caa is about 1 - 2% in angiographic studies of the adult population.1 ) double right coronary artery ( rca ) is a very rare coronary anomaly .
patients are mostly asymptomatic but acute coronary syndrome ( acs ) is a possible , yet uncommon clinical presentation .
we report a rare anomaly , an a2 atypical double rca , which presented as an acute inferior wall myocardial infarction due to a thrombotic occlusion in one of the two rcas , which was successfully managed with primary percutaneous coronary intervention ( pci ) .
a 61-year - old male patient was admitted to the emergency department with retrosternal chest pain at rest for the past hour . he was a chronic smoker and had hypertension for 5 years .
blood pressure was 130/80 mm hg , and pulse rate was 86 beats / minute .
an st segment elevation was noted in leads ii , iii , and avf ; and a reciprocal st segment depression in leads v 1 - 6 on electrocardiography .
two different rcas originating from a common main trunk appeared following a contrast injection to the right coronary orifice ( fig .
tubular eccentric stenosis of 90% was noted in the proximal segment of the main rca trunk , 70% tubular stenosis in the rca1 , and 40% stenosis in the osteal segment of rca2 ( fig .
two bare metal stents ( 3.018 mm and 2.7512 mm ) were successfully deployed to the lesion at 15 atm for 30 seconds in the proximal segment of the main trunks of rca and rca1 , respectively ( fig .
the post - interventional period was uneventful , and the patient was followed up for 2 days at the intensive care unit and discharged without any complications .
most coronary anomalies are detected as incidental findings during coronary angiography . however , a double rca is a very rare coronary anomaly .
so far , only a few cases of double rca have been reported.2 - 5 ) since the second report , this rare anomaly has been accepted as a benign entity . however
, new reports in the last few years have indicated that a double rca may be complicated with atherosclerosis . among 27 cases defined in the literature ,
atherosclerosis was identified in eight patients ; seven presented with acs , and three with inferior myocardial infarction.6)7 ) in most of the reported double rca cases with atherosclerosis , the atherosclerotic segment is usually in the proximal part of the rca that courses on the atrioventricular ( av ) sulcus or in the posterior branch of the rca going to the av sulcus.8 ) in the submitted case of akay et al.9 ) and in our case , a lesion was evident in the ostial part of the anteriorly coursing rca but not in other parts .
also , in their case , an atherosclerotic lesion was found in the posterior course of the rca .
based on these two studies by iacobellis et al.10 ) the authors suggested that an increased quantity of epicardial adipose tissue due to obesity may be a risk predictor for cardiovascular disease . an attempt to classify a double rca was tried ( table 1 ) by an author from turkey , where most of the studies concerning this anomaly have been reported.11 ) we diagnosed our case as an a2 atypical double rca using this classification . only one case has been reported that was admitted with acs and identified as atypical rca by coronary angiography.11 ) in that case , atherosclerotic lesions were only found in the proximal part of the rca but not in the rca1 or rca2 , and the stent was implanted in the main rca .
but in our case , atherosclerosis began proximally and was ongoing in rca1 and rca2 , so we implanted stents proximal to rca and rca1 . to our knowledge no a2 atypical double rca case has been reported that was admitted with acs and had atherosclerosis in the main rca as well as in rca1 and rca2 . in conclusion , although controversy exists about the definition of a double rca , it is generally considered a benign entity , but could be atherosclerotic and cause acss including myocardial infarction and may be associated with other anomalies.12)13 ) coronary anomalies should be recognized to avoid problems during coronary intervention and cardiac surgery . | ### Summary:
: coronary artery anomalies are uncommon and often asymptomatic . a double right coronary artery ( rca )
is an extremely rare coronary artery anomaly , and only a few cases of double rca have been reported .
we report on an atherosclerotic double rca that appeared after primary percutaneous intervention in a patient with an acute inferior myocardial infarction .
this is the second case in the literature in which coronary arteries can be accepted as a double rca , which were hidden by a total atherosclerotic occlusion in the proximal part of the rca . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: vitreous inflammation , or vitritis , may result from many causes , including both infectious and noninfectious .
epidemiologic studies indicate that uveitis accounts for 210% of prevalent blindness in the european and north american population and is therefore an underrated and significant public health problem .
infectious etiologies include bacterial lyme , syphilis , or bartonella ; viruses hsv , vzv , and cmv , and a variety of fungal and parasitic causes .
noninfectious etiologies include rheumatologic and autoimmune processes , examples being sarcoidosis , systemic lupus erythematosus , multiple sclerosis , and behcet 's disease . however , idiopathic vitritis without associated systemic disease is most common .
vitritis is sometimes visionthreatening , due to sequelae such as cystoid macular edema ( cme ) , vitreous opacities , and retinal detachment , ischemia / neovascularization , or pigment epithelium changes .
glaucoma and cataracts may also form . with such serious sequelae , there are multiple methods of systemic treatment for vitritis . on the other hand , mild vitritis without vasculitis or cme
the goal of all types of treatment is to rapidly alter and stop the course of intraocular inflammation but at the same time minimize any side effects from these systemic drugs .
we reviewed these treatment categories last year , but , even over the course of just a year , many therapies have made progress , as we have learned more about their indications and efficacy .
this group of drugs is used to suppress inflammation , either systemically or intraocular . the accepted
algorithm for treatment begins with topical glucocorticoids , with frequency depending upon severity and not necessarily etiology .
however , topical corticosteroids have been shown to have poor penetration into the posterior segment and are thus not used often for posterior segment disease ; they are more commonly used to reduce anterior chamber inflammation and have only a minor effect on vitreous inflammation .
oral or intravitreal corticosteroids are therefore used to treat cases of posterior segment disease . oral prednisone ( 1 mg / kg / day with gradual tapering )
intravitreal delivery systems include injection or implantation of periocular or intravitreal steroid compounds ( triamcinolone acetonide ) .
there are several different types of systems , either nonbiodegradable or biodegradable ; a more extensive review of drug delivery implants is reviewed in our other paper .
although previous studies raised concern for recurrence of inflammation as intravitreal steroid concentration decreases , some recent trials elude that this may no longer be the case .
it has however been reported that localized side effects may occur , such as cataract formation , increased intraocular pressure , and transient vitreous hemorrhage . on the other hand ,
those undergoing systemic corticosteroid therapy often encounter nonocular adverse events , such as arthralgia and hypertension .
other common complications range from those affecting the musculoskeletal system ( osteoporosis , aseptic bone necrosis , and myopathy ) , gastrointestinal system ( ulcers and pancreatitis ) , endocrine ( hyperglycemia and cushinoid features ) , infectious , ( delayed wound healing , secondary infection , and reactivation of latent herpes simplex or tuberculosis ) , or even psychosis . if patients develop adverse effects , or are refractory to treatment with corticosteroid therapy , switching to an intravitreal delivery system or considering systemic immunosuppressive therapy is indicated .
systemic immunosuppressive therapy can either supplement or completely replace corticosteroid therapy , for the reasons touched upon above .
there are several conditions that have been found to be refractory to corticosteroid treatment but instead respond to immunosuppressives .
examples of these conditions ran the gamut of several autoimmune diseases such as behcet 's , wegener 's , or juvenile idiopathic arthritis - associated uveitis .
there are several categories of immunosuppressive agents : antimetabolites , alkylating agents , t - cell inhibitors / calcineurin inhibitors , and biologic agents .
information about these categories is available in table 2 , while newer biologics and investigations are discussed below .
table 3 addresses ocular diseases and which groups of immunosuppressive agents are used to treat them .
in general , treatment with immunosuppressives starts after or with corticosteroid therapy , with local treatment attempted before systemic treatment , if the disease process is amenable .
systemic treatment attempts to start with the least toxic medications in the case of mild - moderate disease ; methotrexate and cyclosporine are most commonly used after corticosteroids , followed by more antimetabolites .
severe , vision - threatening disease may require the use of biologic or cytotoxic agents , although they are avoided whenever possible due to their severe adverse effects .
leflunomide is a noncytotoxic drug that works on both the cellular and humoral immune response .
it is most commonly used for systemic rheumatologic diseases , examples being severe rheumatoid or psoriatic arthritis .
recently , leflunomide was proven as both safe and efficacious for long - term therapy treating chronic anterior uveitis associated with juvenile idiopathic arthritis .
most patients maintained an ocular response to the drug and underwent only a few mild adverse effects .
common adverse effects of leflunomide include hepatotoxicity with known fatalities , myelosuppression with resulting opportunistic infection and anemia , interstitial lung disease , alopecia , and skin reactions ( stevens johnson and toxic epidermal necrolysis ) .
leflunomide is also a teratogen ( pregnancy class x ) , and patients need to be on contraception during treatment .
overall , it is a promising form of treatment , as methotrexate is currently the first and was previously the only choice for patients with juvenile idiopathic arthritis .
they were originally developed for preventing organ transplant rejection but were found to be useful for treating systemic inflammatory diseases as well .
they are now used off label in treating uveitis , and have been used with some success for refractory cases .
biologic agents ' major mechanisms of action all revolve around targeting specific inflammatory molecules , with the goal of inhibiting mediators or cytokines .
examples of these inflammatory mediators include tumor necrosis factor alpha and interleukin-2 . due to their strong immunologic suppression ,
latent and opportunistic infections are especially important to monitor for and include those such as tuberculosis , histoplasmosis , coccidiomycosis and herpes viruses .
monoclonal antibodies are further classified and suffixes named based on their regions ( either human , murine , or a combination of regions ) .
fusion proteins are created by joined genes , and are a combination of a receptor and another protein fragment .
adalimumab is a recombinant , full - length humanized immunoglobulin directed against tumor necrosis factor ( tnf ) .
it is able to bind with both high affinity and specificity to soluble tnf or , thus neutralizing the biological function of tnf , as well as modulating biological responses that tnf is responsible for inducing or regulating .
it is currently used with increasing frequency for treating several autoimmune diseases such as behcet 's , juvenile idiopathic arthritis - associated uveitis , vogt - koyanagi - harada ( vkh ) disease , and birdshot retinochoroidopathy [ 1216 ] . a recent multicenter trial found it to be a useful treatment for patients with refractory uveitis , with a 10-week success rate of 68% . a more recent retrospective analysis of 60 patients , the largest case series to date , showed a positive effect of adalimumab in 82% of these patients with different uveitis types , independent of additional systemic disease .
this study found that those who had been treated with infliximab and etanercept with insufficient response were effectively treated with adalimumab in 92% of cases .
another interesting finding was that patients pretreated with other tnf agents still had good results ; thus , it is reasonable to switch to another tnf agent if the first was ineffective . in this study , no major infections nor serious complications known to tnf inhibitors ( demyelinating disease , reactivation of tb ) occurred .
this is a significant finding , as adalimumab may thus be a better option than infliximab , although follow - up was short and the study 's power would need to be increased in a further study .
another prospective study evaluated the efficacy and outcomes of using adalimumab to treat uveitis associated with juvenile idiopathic arthritis .
ocular symptom improvement was seen in 76% of cases , with anterior uveitis flare rate reduced after starting treatment .
this study also confirmed a lack of serious sideeffects and infections and fewer hypersensitivity reactions than infliximab .
overall , this study concluded that adalimumab was a reasonable adjuvant therapy for treating uveitis .
most commonly used in hematologic and autoimmune disorders , it has been found to be effective as a sole treatment for wegener 's uveitis and retinal vasculitis [ 19 , 20 ] .
the value of rituximab in behcet 's disease is yet to be determined , due to limited evidence .
in addition , it has also been used with intravenous igg to treat ocular cicatricial pemphigoid .
tocilizumab is a humanized antibody that binds both to il-6 receptors , originally used for treating rheumatoid arthritis and systemic juvenile idiopathic arthritis .
il-6 has a role in proliferation and differentiation of t- and b - cells , with persistent production demonstrated in chronic inflammatory diseases .
although ophthalmologic usage is currently limited , patients with active posterior uveitis have been found to have elevated il-6 levels in serum and intraocular , although levels were not specifically correlated with a clinical diagnosis .
in one retrospective study , tocilizumab was found to be efficacious in treating uveitis patients with cystoid macular edema that was refractory to intraocular steroids or other immunosuppressive therapies .
these patients were found to have complete resolution after six months of therapy and were also found to have no recurrence of inflammation at follow - up , suggesting that it is able to maintain disease remission . in another recent case study ,
a patient with severe refractory posterior uveitis improved , with decreasing levels of il-6 after treatment .
it is a new therapy whose indications and efficacy are still being studied ; a recent pilot study for patients with refractory behcet 's disease showed promising results , with only two infusions needed to render patients attack - free for several months .
treatment led to a rapid reduction in manifestations of intraocular inflammation , without the rebound attacks associated with discontinuation of corticosteroid use .
this was thought to be in part due to accumulation of gevokizumab in ocular tissues , thus being able to sustain its therapeutic effect with an infrequent dosing interval .
ifn- 2a , ifn- 2b , ifn- 1a , and ifn- 1b are the classes most commonly used in therapy .
interferons are commonly used to treat conditions ranging from malignancy ( cutaneous melanoma ) , infection ( hepatitis c ) , and inflammatory ( multiple sclerosis ) [ 28 , 29 ] . as far as ophthalmologic uses
, ifn- 2a has successfully treated behcet 's disease , and ifn- 1a reduced uveitis recurrences in multiple sclerosis patients [ 3033 ] . in behcet 's disease , interferon demonstrated significant benefit by decreases in aphthous ulceration and the number of lesions .
several studies consistently reported that many patients had durable remissions of ocular inflammatory disease after discontinuation .
anakinra is an interleukin-1 receptor antagonist , which competitively inhibits il-1 binding to its receptor .
il-1 has been found to have significance in systemic autoinflammatory diseases , where excessive il-1 signaling will occur .
it plays a key role in auto inflammatory diseases such as muckle - wells and neonatal onset multisystem inflammatory disease ( nomid ) , which are rare causes of uveitis in childhood .
it may in the future be used to treat refractory juvenile idiopathic and behcet 's disease , for which it is currently in phase iii clinical trials .
uveitis is a vision - threating group of diseases that encompasses a variety of etiologies , which are either infectious or noninfectious .
uveitis resulting from infection , however , focuses on eradicating the source with antibiotics or antivirals .
these antimetabolites , cytotoxic agents , biologics , and immunomodulators can be used either alone or together , to control inflammation of the vitreous . as with any medication , especially immunosuppressants , side effects
must be balanced with therapeutic benefit a determination still in process for many drugs and indications .
even with its difficulties , research on expanding indications for existing therapies and the discovery of new systemic agents continues to progress . | ### Summary:
: vitreous inflammation , or vitritis , may result from many causes , including both infectious and noninfectious , including rheumatologic and autoimmune processes .
vitritis is commonly vision threatening and has serious sequelae .
treatment is frequently challenging , but , today , there are multiple methods of systemic treatment for vitritis .
these categories include corticosteroids , antimetabolites , alkylating agents , t - cell inhibitors / calcineurin inhibitors , and biologic agents .
these treatment categories were reviewed last year , but , even over the course of just a year , many therapies have made progress , as we have learned more about their indications and efficacy .
we discuss here discoveries made over the past year on both existing and new drugs , as well as reviewing mechanisms of action , clinical dosages , specific conditions that are treated , adverse effects , and usual course of treatment for each class of therapy . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: buerger 's disease is a type of peripheral vascular disease ( pvd ) which commonly affects the small- and medium - sized vessels in upper and lower limbs .
the disease is also known as thromboangiitis obliterans and has a strong association with use of tobacco and is more prevalent in males .
the disease is segmental in distribution and is characterized by skip lesions seen on angiography . this patient also had disease in both upper and lower limbs but the severity was more on the right side .
sympathectomy was widely used in the management of pvd before the era of vascular bypass and angioplasty , later on indications for sympathectomy got limited to those cases where either vascular bypass or angioplasty was not feasible or have failed .
other indications for sympathectomy apart from pvd include hyperhydrosis , causalgia , and neuropathic pain .
this case is reported for the unique post - operative incidence of severe bronchospasm and excessive bronchial secretions resistant to the theophylline group of drugs and rapid resolution with anti - cholinergics and antihistamines . nowadays
thoracoscopic and laparoscopic techniques are used in preference to open surgery for thoracic and lumbar sympathectomy respectively in centers where facilities for these are available ; however , in developing countries open surgery is being done at many centers as facilities for video - assisted thoracoscopic surgery ( vats ) are not commonly available .
advantages of minimally invasive techniques include ( 1 ) bilateral procedure can be done in the same sitting ( 2 ) shorter hospital stay ( 3 ) small incision ( 4 ) lesser postoperative pain ( 5 ) minimal deterioration in pulmonary function .
a 57-year - old male patient known case of pvd presented with pre - gangrenous changes in the right foot .
the patient was diagnosed as a case of buerger 's disease as history , clinical and radiological findings suggested involvement of the small sized arteries of the upper and lower limbs without involvement of the large- and medium - sized vessels .
the patient was a chronic smoker and left smoking after gangrene developed but he did not give any history of dyspnea or angina on exertion and was not on bronchodilators prior to thoracic sympathectomy .
the patient was not suffering from diabetes mellitus , hypertension or any other associated disease .
echocardiogram and chest roentgenogram were normal and pulmonary function tests revealed mild obstructive airway disease .
thoracic epidural analgesia was given along with general anesthesia using a single - lumen endotracheal tube .
t2-t4 segment of the thoracic sympathetic trunk [ figure 1 ] was excised and sent for histopathology examination .
postoperatively , the patient had excessive perspiration , severe bronchospasm and excessive secretions in the respiratory tract .
the patient was afebrile , laboratory parameters for infection were within normal range , and there was no evidence of consolidation / collapse on chest roentgenogram .
the patient was on broad spectrum antibiotics and bronchodilators ( theophylline ) and sympathomimetics ( salbutamol ) with little benefit if any .
patient was later on started anticholinergics ( ipratromium bromide ) and antihistamines in anticipation that sympathectomy might have lead to unopposed cholinergic activity leading to severe bronchospasm and excessive secretions and the symptoms improved rapidly thereafter .
first follow up was after 1 month and the patient was doing well and recovered completely [ figure 2 ] .
histopathology examination confirmed that the specimen was of sympathetic trunk and medical treatment was continued thereafter .
intraoperative photograph showing right thoracic sympathetic trunk post - operative photograph showing incisions of thoracic and lumbar sympathectomy
it is not common to do both lumbar and thoracic sympathectomy in a particular case as was done in this patient .
mortality of both the procedures is negligible using open or minimally invasive approaches and morbidity has further decreased with better anesthetic techniques , drugs and minimally invasive techniques .
complications of lumbar sympathectomy include ureteric injury , paralytic ileus , ejaculation disturbances , neuropathic complications and rarely intestinal infarction .
complications of thoracic sympathectomy include pneumothorax , horner 's syndrome , hyperhydrosis , hemothorax , vascular , parenchymal injuries and rarely chylothorax and skin depigmentation ; however , there are few reports in literature on severe bronchospasm and excessive bronchial secretions post thoracic sympathectomy , resistant to theophyllines and sympathomimetics ( salbutamol ) as was found in this case
. the cause of the severe bronchospasm and secretions in this case could be due to unopposed cholinergic activity after sympathectomy which responded rapidly to anticholinergics drugs ( ipratromium bromide ) .
acute exacerbation of chronic obstructive pulmonary disease ( copd ) was initially thought as a cause for the severe bronchospasm and excessive bronchial secretions but minimal response to theophyllines , sympathomimetics ( salbutamol ) and even steroids and rapid response to anticholinergics drugs ( ipratromium bromide ) lead us to anticipate that sympathectomy might have lead to unopposed cholinergic activity leading to severe bronchospasm and excessive secretions .
although sympathectomy was done on right side bronchospasm , excessive secretions and perspiration was not unilateral which may be difficult to explain . in our experience of thoracic procedures ( excluding thoracic sympathectomy )
, we did not come across such a presentation even in cases who had associated severe copd .
thoracic sympathectomy can lead to severe bronchospasm and excessive bronchial secretions and anticholinergics are the drugs of choice in this condition . | ### Summary:
: a 57-year - old male patient suffering from buerger 's disease presented with pre - gangrenous changes in right foot and ischemic symptoms in right hand . computed tomographic angiography revealed diffuse distal disease not suitable for vascular bypass and angioplasty .
right lumbar sympathectomy was done using a retroperitoneal approach followed 1 year later by right thoracic sympathectomy using a transaxillary approach .
postoperatively , the patient had severe bronchospasm and excessive secretions in the respiratory tract resistant to theophylline and sympathomimetic group of drugs and without any clinical , laboratory and radiological evidence of infection .
the patient was started on anticholinergics in anticipation that sympathectomy might have lead to unopposed cholinergic activity and the symptoms improved rapidly .
the patient recovered well and was discharged on 10th post - operative day . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: it could result from hypoventilation due to leaks , exhausted soda lime , bypassing the absorber inadvertently , or due to a malfunction of unidirectional valves ( udvs ) .
incompetence of expiratory udv , caused by a damaged disc or a disc stuck in an open position , has been reported earlier.[27 ] there have been many changes in the design of anesthesia workstations in recent years .
some manufacturers have changed the design of udvs from the cage and disc to the flexible leaflet type .
flexible leaflet of the expiratory udv was the cause of hypercapnia , which resulted in the rebreathing of carbon dioxide .
an anesthesia workstation with a circle absorber ( signet-615 , av+ulco healthcare , avasarala technologies limited , india ) was used in all the cases reported . an anesthesia ventilator connected to a single flow sensor in the expiratory limb ( ev-700 , av+ulco healthcare ,
avasarala technologies limited , india ) and a multiparameter anesthesia monitor ( starplus , larson and toubro limited , india ) were used in all cases .
a five - year - old girl was scheduled for surgical closure of an atrial septal defect under cardiopulmonary bypass .
after routine preuse check , anesthesia was induced by inhalation of sevoflurane , using jackson rees modification of the ayre 's t - piece ( jrmatp ) .
the lungs were ventilated using a circle breathing system and volume - controlled ventilation ( vcv ) .
the capnogram showed an increasing trend of end - tidal carbon dioxide ( etco2 ; 45 mmhg ) with high inspired carbon dioxide ( fico2 ; 12 mmhg ) .
soda lime in the canister was fresh and did not show any change in color . increasing the flow of fresh gas
as the source of the problem could not be identified , the breathing system was changed to jrmatp and anesthesia was continued .
later , the anesthesia machine was replaced and further management of the case was uneventful .
a nine - year - old boy was scheduled for the release of a burn contracture in the leg .
anesthesia was induced with propofol and a size 2.5 laryngeal mask airway ( lma ) was inserted .
anesthesia was maintained with isoflurane using a circle breathing system , with the patient breathing spontaneously .
the capnogram showed a progressive increase in etco2 with elevated fico2 ( up to 8 mmhg ) , not altered by increasing the flow of fresh gas .
anesthesia was continued with assisted ventilation and further management was uneventful . on close inspection ,
after the end of the procedure , the udv was tested and found to be incompetent .
a four - year - old boy was scheduled for cleft palate repair , as the third patient on the list .
after managing two adult patients earlier , the corrugated tubing of the circle breathing system was changed to the pediatric type and tested for leaks .
after tracheal intubation , the circle breathing system was used with pressure - controlled ventilation ( pcv ) .
the flow rate setting in the ventilator ( i.e. , the flow rate used to achieve the set inspiratory pressure , an equivalent of pramp or rise time ) was increased and fico2 became zero .
with manual ventilation , fico2 increased whenever the tidal volume was delivered slowly and decreased with rapid delivery of tidal volume .
we noted that the leaflet of the expiratory udv was deformed and part of it remained open during inspiration [ figure 2 ] .
the valve was closing fully with rapid delivery of tidal volume ( or higher flow rate ) .
the flow waveform on the ventilator showed minimal flow during inspiration [ figure 3 ] .
the flow sensor was not direction sensitive , and was showing both the normal expiratory flow and the abnormal reverse flow on the same side of the y - axis ( the ventilator was not equipped with any alarm to indicate reverse flow ) .
the problem recurred after a few days and the new leaflet was also found to be deformed .
flexible leaflet of expiratory unidirectional valve ( shown after removing the covering dome ) ventilator display showing the abnormal reverse flow through expiratory unidirectional valve during inspiratory phase ( i ) and the normal flow during expiration ( e ) on checking all anesthesia machines with similar udvs , the inspiratory udvs were found to be deformed and incompetent in some machines , although no problem was reported during clinical use .
the matter was reported to the manufacturer and they concluded that the problem was caused by the thinness of the valve leaflet ( 0.3 mm ) .
a five - year - old girl was scheduled for surgical closure of an atrial septal defect under cardiopulmonary bypass .
after routine preuse check , anesthesia was induced by inhalation of sevoflurane , using jackson rees modification of the ayre 's t - piece ( jrmatp ) .
the lungs were ventilated using a circle breathing system and volume - controlled ventilation ( vcv ) .
the capnogram showed an increasing trend of end - tidal carbon dioxide ( etco2 ; 45 mmhg ) with high inspired carbon dioxide ( fico2 ; 12 mmhg ) .
soda lime in the canister was fresh and did not show any change in color . increasing the flow of fresh gas
as the source of the problem could not be identified , the breathing system was changed to jrmatp and anesthesia was continued .
later , the anesthesia machine was replaced and further management of the case was uneventful .
a nine - year - old boy was scheduled for the release of a burn contracture in the leg .
anesthesia was induced with propofol and a size 2.5 laryngeal mask airway ( lma ) was inserted .
anesthesia was maintained with isoflurane using a circle breathing system , with the patient breathing spontaneously .
the capnogram showed a progressive increase in etco2 with elevated fico2 ( up to 8 mmhg ) , not altered by increasing the flow of fresh gas .
anesthesia was continued with assisted ventilation and further management was uneventful . on close inspection ,
after the end of the procedure , the udv was tested and found to be incompetent .
a four - year - old boy was scheduled for cleft palate repair , as the third patient on the list .
after managing two adult patients earlier , the corrugated tubing of the circle breathing system was changed to the pediatric type and tested for leaks .
after tracheal intubation , the circle breathing system was used with pressure - controlled ventilation ( pcv ) .
the flow rate setting in the ventilator ( i.e. , the flow rate used to achieve the set inspiratory pressure , an equivalent of pramp or rise time ) was increased and fico2 became zero .
with manual ventilation , fico2 increased whenever the tidal volume was delivered slowly and decreased with rapid delivery of tidal volume .
we noted that the leaflet of the expiratory udv was deformed and part of it remained open during inspiration [ figure 2 ] .
the valve was closing fully with rapid delivery of tidal volume ( or higher flow rate ) .
the flow waveform on the ventilator showed minimal flow during inspiration [ figure 3 ] .
the flow sensor was not direction sensitive , and was showing both the normal expiratory flow and the abnormal reverse flow on the same side of the y - axis ( the ventilator was not equipped with any alarm to indicate reverse flow ) .
the problem recurred after a few days and the new leaflet was also found to be deformed .
flexible leaflet of expiratory unidirectional valve ( shown after removing the covering dome ) ventilator display showing the abnormal reverse flow through expiratory unidirectional valve during inspiratory phase ( i ) and the normal flow during expiration ( e ) on checking all anesthesia machines with similar udvs , the inspiratory udvs were found to be deformed and incompetent in some machines , although no problem was reported during clinical use .
the matter was reported to the manufacturer and they concluded that the problem was caused by the thinness of the valve leaflet ( 0.3 mm ) .
each time the valve opened , only a portion of the leaflet was lifted , allowing movement of gas , and after repeated use , this portion of the leaflet remained deformed in an open position .
the deformed portion closed only at higher flow rates ( or a higher upstream pressure ) .
low flow rates and smaller tidal volumes used in children were probably not generating sufficient upstream pressure to close the deformed portion of the leaflet , thereby causing rebreathing of carbon dioxide .
standard flow sensors should be able to identify the direction of flow and be able to give an alarm if the flow is reversed due to incompetent valves .
the flow sensors used in the above patients were not direction sensitive and did not have a reverse flow alarm .
although inspiratory udvs in some machines were found to be incompetent during testing , the same had not been detected during clinical use .
an incompetent inspiratory udv results in the prolongation of the alveolar plateau of the capnogram which might be indistinguishable from a normal waveform and can be missed easily .
special tests to identify problems with udvs may not be practically possible given the time constraints in modern operating rooms.[912 ] continuous revision of acceptable machine standards ( e.g. , making reverse flow alarm mandatory for flow sensors in the circle breathing system ) and quality control of medical equipment must be undertaken , to ensure standards of anesthesia delivery systems . | ### Summary:
: rebreathing of carbon dioxide caused by incompetent cage and disc unidirectional valves has been reported earlier .
some manufacturers have changed the design of unidirectional valves to
flexible leaflets. we report a series of cases where a deformed membrane leaflet in expiratory unidirectional valves led to rebreathing of carbon dioxide . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: an elderly , 79-years - old man with history of chronic , stable ischemic congestive heart failure ( class ii according to the new york heart association , 35% ejection fraction ) and atrial fibrillation was hospitalized with persistent fever ( up to 38.5c ) , progressive appetite and weight loss , vague abdominal and lumbar pain since three weeks .
one month earlier , he had a percutaneous interventional procedure including double coronary artery stenting . at physical examination
urgent laboratory tests disclosed abnormal acute phase markers including 12.780/mmc neutrophils , 62 mg / l c - reactive protein .
dorso - lumbar radiographs [ figure 1a ] and magnetic resonance imaging ( mri ) [ figure 1b ] did not disclose spinal changes consistent with clinical suspicion of spondylodiscitis .
unenhanced ct ( c ) showed normal - caliber aorta with mural calcifications , surrounded by sub - circumferential soft - tissue density ( arrowhead ) .
post - contrast ct ( d ) showed patent aortic lumen , eccentric periaortic tissue with peripheral enhancement ( arrow ) , distally reaching the bifurcation as seen on ct - angiographic reformations ( e and f ) .
t1 ( g ) and t2-weighted ( h ) mri follow - up showed increasing thickness of mixed t1- and t2-hyperintense periaortic tissue ( arrowheads ) , persistently sparing the posterior aspect of the vessel thoracoabdominal computed tomography ( ct ) was requested to investigate possible acute aortic abnormalities , because of progressively worsening pain radiating to the back .
unenhanced [ figure 1c ] scans depicted a normal - caliber , heavily calcified atheromatous abdominal aorta partially surrounded by a confluent soft - tissue periaortic density with peripheral enhancement on ct - angiographic [ figure 1d - f ] images , raising suspicion of aortitis .
vascular surgery was deemed contraindicated by the patient 's poor conditions and cardiopulmonary function . during intensive antibiotic treatment , with worsening renal function unenhanced mri [ figures 1 g and h ] showed progressively increasing , eccentric periaortic inflammatory collection sparing the posterior aspect . after hospital discharge in critical conditions
seven months later , during hospitalization because of unrelated reasons , repeated ct - angiography [ figure 2a - c ] showed post - treatment reduction of the periaortic tissue , and appearance of a focal luminal dilatation of the infrarenal aorta that was attributed to postinflammatory damage to the arterial wall .
( a - c ) : contrast - enhanced ct obtained seven months later show reduction of treated inflammatory periaortic tissue ( arrowheads ) , and appearance of a focal luminal dilatation of the infrarenal aorta ( arrows ) .
note l1 vertebral body fracture following fall in b aortitis is a broad term that includes a spectrum of different disorders characterized by inflammatory changes of one or more layers of the aortic wall , regardless of the underlying mechanism . in most cases ,
aortitis is non - infectious in origin , such as with takayasu or giant - cell arteritis .
conversely , infectious aortitis is a very rare , life - threatening disease that exposes the patient to uncontrolled sepsis and aortic rupture , and conveys a poor prognosis if unrecognized .
pathologically , aortic infection is defined by bacterial contamination of the arterial wall , most usually resulting from hematogenous dissemination , or uncommonly from secondary invasion of the aorta by adjacent spondylodiscitis .
the most common causative organisms include staphylococcus aureus , salmonella , escherichia coli , and pseudomonas .
infectious aortitis typically affects elderly and/or immunocompromised people with high - grade bacteremia , such as those with endocarditis , septic embolism , or intravenous drug abuse .
most usually , infection is associated with pre - existing aneurismal dilatation , although in some cases it can occur in a normal - caliber vessel in association with other abnormalities such as severe atherosclerotic disease , cystic medial necrosis , diabetes , medical devices or surgery.[146 ] clinical manifestations are vague and nonspecific , including fever , variable pain in the chest , back or abdomen , malaise , and elevated biochemistry acute phase reactants . in patients with prolonged signs and symptoms of systemic infection , a high clinical suspicion index
probably underdiagnosed , aortic infection is in most cases unsuspectedly detected at imaging . establishing the diagnosis is challenging but is essential in preventing the devastating complications such as uncontrolled sepsis and rupture .
intensive , prolonged antibiotic treatment plus complete surgical removal of infected tissue , aneurysm repair , and restoration of distal blood flow are crucial for survival.[46 ] universally available and extremely fast , multidetector ct is almost invariably the preferred modality to investigate acute aortic conditions .
however , uncommonly , aortic inflammatory changes can be identified at cross - sectional imaging in an early stage before luminal dilatation .
ct signs include periaortic increased fat density or hypoattenuating , variably enhancing soft - tissue aortic wall thickening , whereas presence of air in the vessel wall is characteristic yet exceptional .
the differential diagnosis of this early - stage appearance includes retroperitoneal fibrosis , periaortic hemorrhage from contained bleeding , syphilitic or tuberculous aortitis , lymphomatous tissue , or adenopathies .
a useful sign is the asymmetrical distribution of periaortic abnormalities , which typically spare the posterior aspect of the aorta . in a later stage ,
the infected aorta undergoes a rapid luminal enlargement or the development of a saccular pseudo - aneurysmal dilatation , with characteristically absent mural calcifications .
further complications that are detectable at ct imaging include obstructive hydronephrosis , distant or iliopsoas abscess formation , aortoenteric fistulization , and retroperitoneal rupture.[24 ] although its imaging appearances have been very scarcely reported , mri may help to characterize mural or endoluminal abnormalities of the aorta , by demonstration periaortic inflammation and/or adventitial fibrosis with better contrast resolution .
increased uptake in the inflamed periaortic tissue may be even demonstrated by positron emission tomography . as this case demonstrates , cross - sectional imaging provides early detection , confident characterization , and follow - up of unsuspected aortic infection in septic patients . | ### Summary:
: in patients without history of vascular surgery , infectious aortitis is a very uncommon , life - threatening condition with nonspecific clinical manifestations , which exposes the patient to uncontrolled sepsis and to the risk of retroperitoneal rupture .
state - of - the - art cross - sectional imaging with contrast - enhanced multidetector computed tomography and magnetic resonance imaging allows confident diagnosis and characterization of unsuspected aortitis in septic patients at an early stage before the development of aneurysmal dilatation .
the asymmetric distribution of periaortic inflammatory tissue is helpful for the differentiation of this exceptional disorder from other periaortic abnormalities such as retroperitoneal fibrosis or lymphoma . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: today tuberculosis ( tb ) still remains a major infectious cause of morbidity and mortality worldwide , one - third of the world 's population is latently infected with mycobacterium tuberculosis .
bacille calmette - gurin ( bcg ) is the only available vaccine against tuberculosis presently , and the protective efficacy of it is variable from 0 to 80% in many field trials and is unclear in pulmonary tb in adults , but it prevents miliary tuberculosis in newborns and toddlers [ 2 , 3 ] .
the cause of these large differences in vaccine - induced protection is poorly understood , and some of its limitations may involve short - lived bcg - induced immune reactivity .
this raises an issue that a novel tb vaccine which can protect adults against tuberculosis is urgently needed [ 3 , 4 ] , while bcg vaccination of newborns should be continued as it is effective .
previous tb vaccines are classified into 4 main groups : ( 1 ) dna vaccines , ( 2 ) recombinant bcg vaccines , ( 3 ) subunit vaccines , and ( 4 ) attenuated vaccines , and currently most efforts to improve the protective immunity of bcg are focused on strategies that incorporate priming with bcg , recombinant bcg , or other attenuated mycobacteria followed by a heterologous booster immunization that aims to improve the duration and efficacy of the responses [ 57 ] .
considering all kinds of reasons , we decide to choose the heterologous prime - boost vaccination strategy comprised of priming with bcg and boosting with a novel vaccine candidate [ 8 , 9 ] .
cellular immune responses are critical for the control of mycobacterium tuberculosis infection , which depends on polyfunctional cd4 and cd8 t - cell responses [ 10 , 11 ] .
t helper type 1 ( th1 ) cd4 t cell can primarily secrete interferon- ( ifn- ) , which is important in m. tuberculosis infection and disease prevention .
cd8 cytolytic t lymphocytes ( ctls ) are essential for clearance of intracellular m. tuberculosis infection by secreting perforin , granulysin , and extracellular enzymes into the immunological synapse .
heterologous prime - boost strategy has been used in many models of pathogenic infections , and some studies demonstrate that prime - boost strategies using bcg as prime and heterologous constructs such as recombinant dna , recombinant adenovirus , and recombinant poxviruses as boosting immunogens can enhance cd4 and cd8 t - cell responses against tb [ 6 , 7 , 1618 ] . to search for a novel effective vaccine candidate to improve the protection of bcg ,
many strategies have been attempted and a number of antigens have been studied . in our research , we choose two bcg substrains ( bcg - pasteur1173 and bcg - china ) which are different in two deletions called rd14 and n - rd18 [ 19 , 20 ] , which are present in bcg - china , but absent in bcg - pasteur1173 .
we notice two genes ( rv1769 and rv1772 ) in rd14 deletion , which have been studied superficially , and some research has indicated that rv1769 and rv1772 should be considered for potential subunit vaccines [ 21 , 22 ] . in previous work , researchers paid much attention to esat-6 , cfp-10 , and ag85 [ 7 , 16 , 2325 ] , and little attention has been paid to the rd14 deletion .
maybe the genes located in this deletion are responsible for different immunogenicity between the bcg - pasteur and bcg - china .
based on all of the reasons above , we have constructed several vaccination strategies primed with bcg - c or bcg - p and boosted with recombination plasmid pcdna3.1-rv1769 or pcdna3.1-rv1772 to immunize balb / c mice and evaluated its immunogenicity .
this study shows that this strategy can elicit potent humoral and cellular immune responses comprising both cd4 and cd8 t cells against tb in mice , but its protective efficacy was not to be demonstrated in this study .
m. bovis bcg - pasteur and bcg - china were kindly provided by the chengdu biological products institute .
bcgs were maintained in sauton 's medium ( mgso4 0.5 g , k2hpo4 0.5 g , citric acid 2 g , sodium glutamate 8 g , glycerol 60 ml , znso4 0.01 g , and ferrum - ammonium citrate 0.05 g in 1000 ml , ph1.47.5 ) .
the plasmid was originally conserved in our laboratory . the rv1769 and rv1772 genes were amplified from the bcg - china genome and cloned into pcdna3.1(+ ) plasmid to generate recombinant pcdna3.1-rv1769 and pcdna3.1-rv1772 .
endotoxin - free plasmids were prepared using an endofree plasmid purification kit ( omega , usa ) .
plasmids were adjusted to a final concentration of 1 mg / ml in pbs and stored at 20c .
4 - 5-week - old pathogen - free balb / c male mice were purchased from the laboratory of animals institute in sichuan university ( chengdu , china ) .
groups of balb / c ( n = 18 ) were primed with pbst , bcg - china , or bcg - pasteur1173 at week 0 and boosted with plasmid dna or control plasmid at week 3 and week 6 .
mice were immunized subcutaneously with 510 cfu of bcg in a volume of 0.1 ml per mouse and intramuscularly with 50 g dna in a volume of 0.1 ml each time per mouse .
mice were put to death at 10 , 14 , 18 , and 22 weeks ( four mice for each group at each time point ) .
blood was collected from retroorbital sinus and the sera were stored at 20c after separation until used .
each sera sample was tested in three replicates , and the results are expressed as mean standard errors .
the splenocytes were prepared and cultured as previously described [ 27 , 28 ] , and the splenocytes were plated in 6-well flat - bottom plates ( 510 cells in 2 ml of crpmi per well ) with 100 l tb - ppd ( 1 g / ml ; xiangrui biotech , ltd . , beijing , china ) in each well and incubated for 72 h ( 37c , 5%co2 ) .
the cells were collected and washed three times with 0.1 m pbs ( ph = 7.2 ) , and then rabbit anti - mouse cd4-pe and anti - mouse cd8-fitc ( ebioscience , usa ) were added into ep tube for a 30 min incubation in an ice - bath keep out of the sun .
finally , the cells were washed twice again and the proportions of cd4 and cd8 t cells were determined by flow cytometry ( facscalibur , bd ) .
the splenocytes were dealt with in the same way as flow cytometry assay previously described , and concentrations of ifn- and il-4 in the medium were measured by an elisa kit ( ebioscience , usa ) according to the manufacture 's protocol .
measurements of these data are expressed as the mean standard errors ( s.e . ) .
we used one - way anova to analyze the differences among the groups and post hoc test to analyze the differences between two groups .
the antibody titers were detected by elisa assay to reflect the humoral immune response against tb .
the levels of antibody response in the sera of the immunized mice at different time points are shown in figure 1 .
the results show that firstly the titers of igg and igg2a antibodies in the group immunized with bcg - c+3.1 - 69 and bcg - c+3.1 - 72 were higher than those in the other 7 groups at the 8th week ( p < 0.01 ) ; secondly the igg titers in group bcg - c+3.1 - 69 were higher than those in the bcg - p+3.1 - 72 , pbst , plasmid controls , and positive controls at the 4th and 12th weeks ( p < 0.05 ) and were higher than those in the other 8 groups at the 16th week ( p < 0.05 ) ; thirdly the titers of igg2a antibodies in the group immunized with bcg - c+3.1 - 69 and bcg - c+3.1 - 72 were higher than those in the bcg - p+3.1 - 72 , pbst , plasmid controls , and positive controls at the 12th week ( p < 0.05 ) . besides , the titers of igg1 antibodies in the group immunized with bcg - c+3.1 - 69 were higher than those in the other 8 groups at the 4th , 8th , and 16th weeks ( p < 0.05 ) .
figure 1(d ) shows that groups bcg - c+3.1 - 69 , bcg - c+3.1 - 72 , bcg - p+3.1 - 69 , and bcg - p+3.1 - 72 all indicated a shift towards a th1 immune response at the 12th week .
to detect the cell - mediated immune response , the splenic lymphocyte proliferation was assessed by mtt assay .
the results show that the proliferation of splenocytes in the bcg - c+3.1 - 69 , bcg - c+3.1 - 72 , bcg - p+3.1 - 69 , and bcg - p+3.1 - 72 groups were higher than those in the pbst , plasmid controls , and positive controls at the 12th week ( p < 0.01 ) , but there were no significative statistical differences between the above four groups ( bcg - c+3.1 - 69 , bcg - c+3.1 - 72 , bcg - p+3.1 - 69 , and bcg - p+3.1 - 72 ) , while the group bcg - c+3.1 - 69 showed greater proliferation of splenocytes than the other 8 groups at the 4th week ( p < 0.05 ) and than the bcg - c+3.1 - 72 , pbst , plasmid controls , and positive controls groups at the 8th week ( p < 0.05 ) .
the si value in the bcg - c+3.1 - 69 and bcg - c+3.1 - 72 groups peaked at the 12th week , and the proliferation level decreased after this time .
importantly , the proliferation reaction of group bcg - c+3.1 - 72 still maintains at a high level at the 16th week ( figure 2 ) .
, the bcg - c+3.1 - 72 group induced a significantly greater ratio of cd4 t cells at the 8th week compared with bcg - p+3.1 - 69 , bcg - p+3.1 - 72 , pbst , plasmid controls , and positive controls groups ( p < 0.05 ) .
in addition , the bcg - c+3.1 - 69 , bcg - c+3.1 - 72 , bcg - p+3.1 - 69 , and bcg - p+3.1 - 72 groups induced a significantly greater ratio of cd4 t cells at the 12th week compared with pbst , plasmid controls , and positive controls groups ( p < 0.01 ) , and the status of bcg - c+3.1 - 69 , bcg - c+3.1 - 72 , and bcg - p+3.1 - 69 groups lasted to the 16th week except the group bcg - p+3.1 - 72 .
finally , the proportions of cd8 t cells in the bcg - c+3.1 - 69 group was higher than that in the other 8 groups at the 12th week ( p < 0.05 ) ( figure 3 ) . to determine th1- and th2-type immune response , the ifn- and il-4 were detected from restimulated spleen cells by elisa .
according to figure 4 , the results clearly showed that the concentrations of ifn- in the group bcg - c+3.1 - 69 and bcg - c+3.1 - 72 were higher than those in the other 7 groups at the 12th week ( p < 0.05 ) , and the ifn- concentrations of the bcg - c+3.1 - 72 were higher than those of the groups bcg - c+3.1 - 69 , bcg - p+3.1 - 69 , pbst , plasmid controls , and positive controls at the 8th week ( p < 0.05 ) ( figure 4 ) . il-4 maintained at a low level , and there were no significantly changes among any groups including pbst group ( p > 0.05 ) ( data not shown ) .
heterologous prime / boost vaccination strategies employing recombinant bacteria , viruses , proteins , and naked dna have been shown to elicit stronger and more diverse cellular immune responses than bcg vaccine alone [ 57 , 22 ] . in humans ,
dna vaccines alone have not provided satisfactory results , whereas dna vaccines produced better outcomes when immunized as a prime - boost strategy [ 29 , 30 ] . according to these former observations
, we built this work to evaluate the immunogenicity of two genes ( rv1769 and rv1772 ) by a heterologous prime / boost strategy .
the data of this paper supports the theory that heterologous prime - boost vaccination significantly induces more robust cellular immune responses than bcg vaccine alone .
previously , numerous prime - boost vaccination protocols have demonstrated varying success when carried out in various infectious disease models . in tuberculosis experiments ,
prime - boost vaccination protocols include bcg / protein prime - boost [ 8 , 22 ] , dna / protein prime - boost , dna / adenovirus 5 prime - boost , dna / bcg prime - boost , and bcg / mva prime - boost vaccination schedules , and these prime - boost protocols used ag85a [ 5 , 8 ] , mt_1721 , esat-6 , rv1769 , and rv1772 as antigens . considering a bcg immunization is done in early childhood , our study has begun with a bcg prime .
antigens rv1769 and rv1772 are interesting because the coding genes are present in the genome of bcg - china , only deleted from the bcg - pasteur .
we suppose that overexpression of the genes enhances the immune response of the existing bcg .
more importantly , we succeeded in improving the vaccine immunogenicity of the bcg by using a prime - boost vaccination .
the pathogenic bacterium of tb is mycobacterium tuberculosis , which is intracellular bacteria and cell immune is very important in clearance of it . in the early infection ,
the cd4 t cell can release ifn- , il-2 , and tnf- , which can activate macrophages to fight against m. tuberculosis . in this paper , ifn- , as the representative , was detected by elisa , and the results show that groups bcg - c+3.1 - 69 and bcg - c+3.1 - 72 were of the highest levels of ifn- concentrations .
in addition , flow cytometry results show that groups bcg - c+3.1 - 69 and bcg - c+3.1 - 72 can induce the greatest ratio of cd4 t cells . according to the data of flow cytometry
, we have observed that cd4 t cells and ifn- levels of bcg - c+3.1 - 72 rise from 8th week and down after the 12th week ; however , great ratio of cd4 t cells of bcg - c+3.1 - 69 lasted to even the 16th week .
so , we suppose that the group bcg - c+3.1 - 69 may enhance a stronger and longer - lasting t - cell immune response against m. tuberculosis early infection .
recently , numerous studies indicate that cd8 t cells are critical for the induction of protective tb immunity in humans , nhps , rodents , and cattle .
the cd8 t cells can secrete perforin , granulysin , and extracellular enzyme to promote bacterial schizolysis [ 13 , 34 ] . in our research ,
flow cytometry results show that the proportions of cd8 t cells in the bcg - c+3.1 - 69 group was the highest at the 12th week with p < 0.05 . considering these ,
we have thought about the group bcg - c+3.1 - 69 not only induced polyfunctional cd4 t cells , but also a robust cd8 t - cell response in mice . to measure the th1-type immune response better
the results reveal that groups bcg - c+3.1 - 69 and bcg - c+3.1 - 72 can elicit high levels of igg and igg2a antibodies and also last a long time .
besides , the ratio of igg2a / igg1 shows a shift towards a th1-type immune response .
lastly , the proliferation rate of splenocytes increased consistently with the other experimental results ; the splenocytes proliferation rate in group bcg - c + 3.1 - 69 rises in the 4th week and reaches the peak value in the 12th week . due to the arguments above
, we believe that the group bcg - c + 3.1 - 69 can induce stronger and longer - lasting th1-type immune response than native bcg or other prime - boost groups in mice having cd4 and cd8 t cells .
some research has demonstrated that bcg and recombinant bcg can induce central memory cd8 t - cell differentiation in vivo [ 6 , 39 ] .
because cd4 t helper cells are important for driving memory cd8 t - cell differentiation [ 40 , 41 ] , the ability of bcg to generate memory cd8 t cells could make it have the propensity to stimulate cd4 t helper cells growth .
it has been suggested that the functional heterogeneity of t - cell responses may be associated with successful containment of microbial infections .
the extent of t - cell polyfunctionality has been correlated with the protection against leishmaniasis in mice , hiv-1 in humans [ 42 , 43 ] , and siv in nonhuman primates . in this study , a prime bcg - boost dna strategy can induce cd8 t - cell differentiation as well as cd4 t cell ; we suppose that this vaccination strategy may obtain success against tb in humans and gene rv1769 may be an excellent vaccine candidate .
the prime bcg - boost plasmid rv1769 strategy improved the vaccine immunogenicity of bcg , and the subunit vaccination can be used to improve preexisting immunogenicity evoked by bcg and even be used in future clinical trials .
more recent protocols show that naked dna performs better in macaques and humans as part of a prime - boost regime .
therefore , bcg prime and naked dna boost vaccination should be used for several reasons : firstly bcg needs to be included in future vaccine trials against tuberculosis ; secondly naked dna vaccination has been shown to be effective as a submit vaccine in prime - boost vaccination protocols ; lastly this vaccination regime can improve bcg - induced immunogenicity . in summary , our results provide evidence that a bcg - naked dna prime - boost vaccination protocol represents a valuable candidate ( gene rv1769 ) for future vaccine trials targeted at one of the major health problems worldwide . in the future , we would consider building an in vivo challenge model to extend our findings to an infection / disease protection system . | ### Summary:
: mycobacterium tuberculosis infection is still a major global public health problem . presently the only tuberculosis ( tb ) vaccine available is bacille calmette - gurin ( bcg ) , although it fails to adequately protect against pulmonary tb in adults . to solve this problem ,
the development of a new effective vaccine is urgently desired .
bcg - prime dna - booster vaccinations strategy has been shown to induce greater protection against tuberculosis ( tb ) than bcg alone .
some studies have demonstrated that the two genes ( rv1769 and rv1772 ) are excellent t - cell antigens and could induce t - cell immune responses . in this research , we built bcg - c or bcg - p prime - recombination plasmid pcdna3.1-rv1769 or pcdna3.1-rv1772 boost vaccinations strategy to immunize balb / c mice and evaluated its immunogenicity .
the data suggests that the bcg - c+3.1 - 72 strategy could elicit the most long - lasting and strongest th1-type cellular immune responses and the bcg - c+3.1 - 69 strategy could induce the high level cd8 + t - cell response at certain time points .
these findings support the ideas that the prime - boost strategy as a combination of vaccines may be better than a single vaccine for protection against tuberculosis . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: a catalytic cm protocol that converts an alkene to an alkenyl halide directly would be complementary to the existing methods ( offer a distinct disconnection ) and especially advantageous if a commercially available , easy - to - handle ( i.e. , liquid at ambient conditions ) and relatively inexpensive reagent could be used in a highly stereoselective process ( fig .
for instance , a transition metal complex that catalyzes cm of an abundant substrate such as methyl oleate and an easily accessible organo - chloride reagent , would afford separable z - alkenyl halide compounds ( fig .
1a ) ; one ( 1b ) could be converted to anti - inflammatory agent ( s)-coriolic acid methyl ester by an ensuing catalytic cross - coupling .
ring - opening / cross - metathesis ( rocm ) of cyclooctene with an alkenyl bromide would deliver z , z - dibromoalkene 2 , an intermediate utilized to access anti - tumor and immunosuppressive agent tetrahydrosiphonodiol ( fig .
the feasibility of a cm that furnishes alkenyl fluorides would allow for late - stage fluorination of complex molecules , such as potassium channel activator isopimaric acid in a catalytic , chemo- and stereoselective fashion ( 3 , fig .
development of efficient alkenyl halide - generating cm reactions is anything but straightforward however . unlike ru carbenes or mo or w alkylidenes with alkyl , aryl , boryl or alkoxy substituents , those bearing a halogen atom are either unstable ( ru )
, their transformations inefficient ( ru ) or there is hardly anything known about them ( mo / w ) .
fluoro- , chloro- , or bromo - substituted fischer - type ru complexes show negligible activity ( ru-1b , fig . 1b ) . with phosphine - containing systems ( e.g. , ru-1a ) inactive species such as phosphoniomethylidene ru-1c and
there is some improvement with phosphine - free complexes ( e.g. , ru-2 , fig .
1b ) , but reactions are low yielding and minimally stereoselective despite elevated temperatures ( e.g. , 50 c ) and long reaction times ( e.g. , 24 h ) .
the central issue , therefore , was whether high - oxidation - state ( mo / w ) halo - substituted alkylidene complexes would be sufficiently robust yet appropriately reactive . since alkoxy - substituted mo alkylidenes are more active than the related ru carbenes , we hoped that the same might apply to halogen - containing olefins , but we did not know of any data on the structure , stability or reactivity of a halo - substituted mo or w alkylidene . adding to the uncertainty
is a computational study suggesting that fluoro - substituted mo alkylidenes would be less stable than even the methylidenes .
equally discouraging were the outcome of our attempts to prepare halo - substituted alkylidenes of mo monoaryloxide pyrrolide ( map ) species ( cf .
i ) with two equivalents of 4a resulted in < 2% transformation ( 4 h , 22 c ; 400 mhz h nmr analysis ) .
the more reactive methylidene ( generated from ethylene ) was consumed completely , but a halo - substituted alkylidene was not found spectroscopically .
our remaining hope was that , although undetected , the putative complex might be sufficiently long living to fuel the catalytic cycles ( cf .
if so , reaction of a neophylidene with a terminal alkene could generate the less congested ii , which in turn might react with a z - dihaloalkene ( vs. the more volatile vinyl halide ) , affording the desired product and halo - substitued alkylidene ( iv ) via all - syn metallacyclobutane iii .
complex iv and the olefin could then combine to afford v , which would in turn release alkylidene ii and vinyl halide .
alternatively , the halo - substitued alkylidene could react with another substrate molecule to furnish , by means of vi , the z - alkenyl halide product and methylidenes vii and viii , which are precursors to ii .
we probed the ability of several complexes to effect z - selective cm between 8-bromo-1-octene and commercially available and easy to handle and dispense z - dichloroethene 4a ( boiling point , 60 c vs. 13 c for vinyl chloride ) .
reaction with dichloro complex ru-2 required 50 c to reach 82% conversion after four hours ( table 1 , entry 1 ) , affording 5a as a near equal mixture of stereoisomers ; there was no transformation with z - selective ru-3 or ru-4 ( entries 2 - 3 ) .
use of bis - alkoxide mo-1 led to 70% conversion ( 4 h , 22 c ) but mostly to the corresponding homocoupling product without any detectable alkenyl halide ( entry 4 ) .
experiments with complexes w-1 and mo-2 were similarly disappointing ( entries 5 - 6 ) as again there was only alkene homocoupling ( < 2% 5a ) .
adamantylimido mo-3 provided the first hopeful data : we isolated 5a in 27% yield and > 98% z selectivity ( entry 7 ) .
efficiency improved with perfluoroimido complex mo-4a : z-5a was obtained in 60% yield with none of the alternative e isomer being observable ( h nmr analysis , 4 h , 22 c ; entry 8) .
we then reasoned that a larger aryloxide ligand , although likely less active , might translate into longer catalyst lifetime and better efficiency ; we therefore examined the cm with mo-4b , but , while high stereochemical control could be retained ( 98:2 z : e ) , conversion and yield were reduced ( 62% conv . , 40% yield ; entry 9 ) .
; entry 10 ) but with some diminution in stereoisomeric purity ( 93:7 z : e ) , probably caused by post - metathesis isomerization . to achieve a better balance between robustness and reaction rate without forfeiting stereocontrol
, we examined 2,4,6-triethyl - substituted aryloxide complex mo-4c ( entry 11 ) ; 5a could thus be secured in 75% yield and > 98:2 z : e selectivity after four hours at room temperature .
an array of z - alkenyl chlorides can be prepared ; yields were in the 50 - 91% range with uniformly high stereoselectivity ( 95:5 to > 98:2 z : e ; fig .
2 ) ; the dichloroethene reagent ( 4a ) was used without purification . commonly occurring and versatile functional groups such as a silyl ether ( 5b , fig .
2a ) , a sulfide ( 5c ) , an alkyne ( 5d ) , an epoxide ( 5e ) , an ester ( 5f ) or a phthalimide ( 5 g ) were tolerated . an aryl or a heteroaryl moiety at the allylic position did not hinder the cm process ( 5j , k ) , but reactions with styrenes ( regardless of its electronic attributes ) were inefficient ; this is probably due to steric hindrance within the requisite trisubstituted all - syn metallacyclobutane intermediate ( cf .
hence , stilbenes , which do not re - enter the catalytic cycle easily ( vs. the homocoupling product of an aliphatic alkene ) , were produced predominantly ( see below for further discussion ) ; however , in the reactions with -branched aliphatic alkenes , which do not as undergo homocoupling rapidly for steric reasons , cm is efficient . z - selective synthesis of polycyclic compound 5n demonstrates applicability to alkenes with a homoallylic quaternary carbon center .
2b ) was isolated in 66% yield and > 98:2 z : e selectivity ; this product , similar to allyltin compound 5h and allylsilane product 5i , may be used as a reagent for c c bond formation .
two representative cases are shown ; in one , allyl chloride 6a was obtained in > 98% - and diastereoselectivity , and in the other , performed in the presence of 10 mol % aminophenol 7 , alkenyl chloride 6b was generated with high selectivity without any loss in z : e ratio ( > 98:2 ) .
as noted , access to several of the aforementioned cm products , such as sulfide 5c , stannane 5h , indole 5k as well as allyl boron compound 5o , by means of the two - step protocol involving vinyl
treatment of commercially available z-5-decene and z - dichloroethene with 1.0 mol % mo-4c for two hours followed by the addition of alkyne 8 ( 5.0 mol % pdcl2(phcn)2 , 10 mol % cui , piperidine , 15 h ) , afforded 9 in 67% overall yield and 97:3 z : e selectivity .
these processes were performed without the need for isolation of volatile z - alkenyl chloride 5p ( fig .
2b ) , and the enyne product has been used in the synthesis of marine metabolite clathculin b. reactions can be easily carried out on gram scale : cm of methyl oleate and 4a in the presence of 3.0 mol % mo-4c afforded z - alkenyl chlorides 1a and 1b in 86% and 91% yield and with 97:3 z : e selectivity , respectively ( fig .
subsequent catalytic cross - coupling with alkenylboronate 10 , obtained from site- and e - selective catalytic protoboryl addition of the commercially available propargyl alcohol , completed the two - step synthesis of ( s)-coriolic acid methyl ester from a renewable resource in 65% overall yield and 97:3 z : e selectivity ( vs. 5 steps previously ; see the supplementary information for bibliography ) .
z - selective synthesis of alkenyl bromides brings with it the added complication that stereoisomerically pure z - dibromoethene ( 4b ) is not readily available and difficult to prepare , but a 64:36 z :
although map complexes prefer to react with z-1,2-disubstituted alkene isomers , our concern was possible interference by e-4b , leading to diminution in stereoselectivity .
it was also unclear whether the more sizeable dibromoethene would cause significant lowering of efficiency . in the event ,
a range of z - alkenyl bromides were obtained in 5783% yield and 87:1391:9 z : e selectivity ( 11a - f , fig .
3a ) . with the more volatile vinyl bromide ( vs. 4b ) , yields were significantly lower ( < 25% ) because the increased amount of ethylene boosts the concentration of the comparatively unstable methylidene complexes ( cf .
the lower z selectivity in the case of bromoalkene products ( vs. alkenyl chlorides ) may be attributed to a minor pathway involving metallacyclobutanes derived from the e isomer of the dibromo - alkene reagent ( see the supplementary information for details ) .
z , z - dibromoalkene 2 was obtained in 88% yield and 89:11 z , z : z , e selectivity ( 10 mol % mo-4c , 1 h ) ; as mentioned ( cf .
the need for larger amounts of the more active pentafluoroimido mo-4c is so that maximum amounts of the ring - opening polymerization ( romp ) byproduct can be converted to monomeric 2 .
z , z - dichloroalkene 12 was isolated in 75% yield as a single stereoisomer ; adamantylimido complex mo-3 proved optimal , as this less active catalyst ( vs. mo-4c ) is sufficient for the faster rocm involving the less hindered z - dichloroethene to compete with romp for attaining maximal z selectivity . when the milder mo-3 was used in the more demanding transformation leading to bromo - alkene 2 ,
there was > 98:2 z , z : z , e selectivity but with less conversion to the desired product ( 35% , 20% romp ) .
development of z - selective cm reactions that afford organofluorine products posed a new complication ( fig .
4 ) . vinyl fluoride has a notoriously low boiling point ( 72 c vs. 13 c for vinyl chloride ) ; z - difluoroethene is exorbitantly expensive , similarly difficult to handle as well as explosive ( fig .
we thus envisioned using z - bromo - fluoroethene ( 4c ) , a commercially available , economically viable and substantially less volatile organohalide ( boiling point , + 36 c ) , an option that raises a selectivity problem : the bromo - fluoroethene compound must interact with a mo alkylidene according to the regiochemical mode of addition i in fig .
if the transformation were to proceed through ii , a z - alkenyl bromide would be formed .
firstly , h nmr spectrum ( cdcl3 ) of 4c contains a significantly more upfield signal for the proton at the base of the c br bond , indicating electron density is higher at this carbon ( stronger donation and withdrawing inductive effect by fluorine ) , favoring its association with the lewis acidic mo center ( cf .
additionally , the metallacyclobutane generated via ii would suffer from steric repulsion between the more sizeable halogen and the alkylidene subsituent ( g ) .
the catalytic cm affording z - alkenyl fluoride 13a indeed generated bromide 11b as the minor product ( 72:28 fluoro : bromo ; fig .
consistent with the suggested model ( i vs. ii ) , with an -branched terminal alkene , the product mixture is less contaminated by the corresponding bromoalkene : pure 13b , formed from a cm reaction that proceeded with 96:4 fluoro : bromo selectivity , was isolated in 70% yield and > 98:2 z : e ratio after distillation .
contrary to transformations of styrenes with dichloro- or dibromoethene ( 4a , b ) , cm with 4c and aryl olefins proceeds readily and stereoselectively : -(z)-fluorostyrenes 13c - f were obtained in 93:796:4 fluoro : bromo selectivity , 6472% yield of the pure z - alkenyl fluoride and 93:797:3 z : e selectivity .
these variations in efficiency might be associated with the lower steric repulsion ( eclipsing interaction of fluorine with g in the all - syn metallacyclobutane ) versus the larger chlorine and bromine atoms , such that cm with 4c competes better with homocoupling of styrene . to the best of our knowledge
, there are no reports regarding the synthesis of aryl - substituted z - alkenyl fluorides by catalytic cross - coupling of 4c , and such transformations ( e.g. , 13e , f ) would likely suffer from chemoselectivity complications .
the present processes would offer an attractive pathway for accessing a variety of organofluorine compounds .
z - alkenyl fluoride 13 g has been converted to the afore mentioned gaba transaminase inhibitor 14 ; product 13 g was obtained in 55% overall yield and > 98:2 fluoro : bromo and z : e selectivity by cm with the silyl - amide substrate followed by deprotection .
there was < 5% conversion with the parent amide probably due to internal association of the lewis basic amide with the mo center in the intermediate alkylidene complex .
a corollary to the present approach is the possibility of implementing net stereoselective olefinic c h / c f bond exchange within a complex molecule ; this would allow rapid access and screening of well - defined fluorine - tagged derivatives for possible desirable properties . in this context ( fig .
4c ) , formation of z - alkenyl fluoride 15 ( > 98:2 fluoro : bromo , 63% yield , > 98:2 z : e ) demonstrates relevance to processes involving a relatively hindered allylic ether .
tricyclic product 3 ( 94:6 fluoro : bromo , 70% yield in the pure form , 96:4 z : e ) is derived from the challenging cm with the isopimaric acid methyl ester ( cf .
1a ) ; here , the alkene is next to a sterically demanding all - carbon quaternary center .
4d illustrate that the method is tolerant of a range of functional units commonly found in biologically active molecules .
z - alkenyl fluoride 16 ( from anti - depressant perphenazine ) was obtained efficiently and stereoselectively ( 91:9 fluoro : bromo , 78% yield , > 98:2 z : e ) , underscoring tolerance toward aryl or alkyl amines and aryl sulfides .
synthesis of z - fluoro - alkene 17 ( from -lactamase inhibitor sulbactam ) by the two - step sequence of z - selective cm with vinyl
b(pin ) followed by conversion of the c b unit to a c f bond , according to the only available reported procedure , led to outright substrate decomposition .
, > 98:2 z : e ) ; but attempts to generate 17 by treatment with naoh and agotf and then selectfluor yielded an unidentifiable mixture of compounds , likely due to sensitivity of the substrate 's bicyclic core .
in contrast , z - alkenyl fluoride 17 was obtained through direct cm in 80% yield ( > 98:2 fluoro : bromo ) as a single stereoisomer ( > 98% z ) .
this report introduces halo - substituted mo alkylidenes as highly reactive and difficult - to - detect but viable intermediates in olefin metathesis .
the matter of efficiency is especially noteworthy because , regardless of stereochemical control , heretofore there did not exist a catalytic cm protocol that generates halo - alkenes in useful yields .
the ability of map catalysts to provide a solution to this central problem lies in their distinct electronic attributes , striking a balance between high reactivity and sufficient longevity .
the catalytically active halo - substituted alkylidenes derived from mo-4c can thus deliver the necessary activity ( e.g. , vs. ru-2 - 4 or w-1 ) but not at the expense of catalyst lifetime [ e.g. , vs. bis(alkoxide ) mo-1 ] .
the mo center in a map system is likely electron - deficient enough to prevent metal - carbide formation , and yet , unlike ru carbenes , -electron donation by a halide alkylidene substituent does not hamper reactivity . another noteworthy aspect is the design of reactions where the use of a dissymmetric z - bromo - fluoroethene leads to the predominant or exclusive formation of fluoro - substituted alkenes ( vs. the bromo derivatives ) ; this way , an easy - to - handle and readily accessible reagent can be used instead of the costly and impractical fluoro - olefin alternatives ( e.g. , vinyl fluoride or z-1,2-difluoroethene ) .
the advances outlined here serve as the foundation for future progress involving this intriguing set of halogen - containing mo alkylidenes . the transformations should facilitate considerably the preparation of an assortment of desirable molecules for research in chemistry , biology and medicine , particularly since easy - to - handle ( no glove box needed ) paraffin - wrapped map complexes are becoming commercially accessible .
| ### Summary:
: olefin metathesis has made a significant impact on modern organic chemistry , but important shortcomings remain : for example , the lack of efficient processes that can be used to generate acyclic alkenyl halides .
halo - substituted ruthenium carbene complexes decompose rapidly or deliver low activity and/or minimal stereoselectivity , and our understanding of the corresponding high - oxidation - state systems is very limited . in this manuscript , we show that previously unknown halo - substituted molybdenum alkylidene species are exceptionally reactive and are able to participate in high - yielding olefin metathesis reactions that afford acyclic 1,2-disubstituted z - alkenyl halides .
transformations are promoted by small amounts of an in situ - generated catalyst with unpurified , commercially available and easy - to - handle liquid 1,2-dihaloethene reagents and proceed to high conversion at ambient temperature within four hours .
many alkenyl chlorides , bromides and fluorides can be obtained in up to 91 percent yield and complete z selectivity .
this method can be used to easily synthesize biologically active compounds and to perform the site- and stereoselective fluorination of other organic compounds . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: a population - based prospective study of cardiovascular disease and its risk factors has been underway since 1961 in the town of hisayama , a suburb of the fukuoka metropolitan area on japan 's kyushu island . in 1988 , a screening survey for the present study was performed in the town .
a detailed description of this survey was published previously ( 15 ) . in brief , of the total of 3,227 residents aged 4079 years based on the town registry , 2,587 residents ( participation rate , 80.2% ) consented to take part in a comprehensive assessment .
after exclusion of 82 subjects who had already had breakfast , 10 subjects who were receiving insulin therapy , and 15 subjects who complained of nausea or general fatigue during the ingestion of glucose , a total of 2,480 subjects completed a 75-g oral glucose tolerance test . among these , 297 subjects with diabetes , 52 subjects for whom there was no measurement of waist circumference , and 2 subjects who died before the start of follow - up were excluded , and the remaining 2,129 subjects ( 894 men and 1,235 women ) were enrolled in the baseline examination .
the baseline subjects were followed - up prospectively from december 1988 to november 2002 by repeated health examinations . of the baseline subjects ,
1,935 subjects ( 793 men and 1,142 women ) who underwent reexaminations were finally selected for the present study ( follow - up rate , 90.9% ; mean follow - up period , 11.8 years ; mean frequency of follow - up examinations , 6.9 times ) .
one subject who developed overt type 1 diabetes clinically during the follow - up period was censored at the time . in the baseline and follow - up examinations ,
the study subjects underwent an oral glucose tolerance test between 8:00 and 10:30 a.m. after an overnight fast of at least 12 h. blood for the glucose assay was obtained by venipuncture into tubes containing sodium fluoride at fasting and at 2-h postload .
plasma glucose concentrations were determined by the glucose oxidase method . according to the american diabetes association criteria in 2003 ( 16 ) ,
waist circumference was measured by a trained staff member at the umbilical level with the subject standing .
blood pressure was obtained three times using a mercury sphygmomanometer with the subject in a sitting position ; the average values were used in the analyses .
each participant completed a self - administered questionnaire covering medical history , antidiabetes and antihypertension treatments , alcohol intake , smoking habits , and physical activity at the screening .
diabetes in first- or second - degree relatives was taken to indicate a family history of diabetes .
subjects engaging in sports at least three times per week during their leisure time were defined as the regular - exercise group .
the criteria set for metabolic syndrome used in this study was defined by the updated 2005 national cholesterol education program ( ncep ) adult treatment panel iii ( atp iii ) ( 17 ) . by this definition ,
metabolic syndrome includes the presence of at least three of five factors : elevated fpg ( 5.6
mmol / l ) , central obesity for asians ( waist circumference 90 cm in men and 80 cm in women ) , elevated triglycerides ( 1.68 mmol / l ) , reduced hdl cholesterol ( < 1.03 mmol / l for men and < 1.29
mmol / l for women ) , and elevated blood pressure ( blood pressure 130/85 mmhg and/or current use of antihypertension agents ) .
the sas software package ( version 8.2 ; sas institute , cary , nc ) was used to perform all statistical analyses .
multivariate - adjusted hazard ratios ( hrs ) and their 95% cis were estimated with the use of the cox proportional hazards model .
this study was conducted with the approval of the ethics committee of the faculty of medicine , kyushu university , and written informed consent was obtained from all participants .
a population - based prospective study of cardiovascular disease and its risk factors has been underway since 1961 in the town of hisayama , a suburb of the fukuoka metropolitan area on japan 's kyushu island . in 1988 , a screening survey for the present study was performed in the town .
a detailed description of this survey was published previously ( 15 ) . in brief , of the total of 3,227 residents aged 4079 years based on the town registry , 2,587 residents ( participation rate , 80.2% ) consented to take part in a comprehensive assessment .
after exclusion of 82 subjects who had already had breakfast , 10 subjects who were receiving insulin therapy , and 15 subjects who complained of nausea or general fatigue during the ingestion of glucose , a total of 2,480 subjects completed a 75-g oral glucose tolerance test . among these , 297 subjects with diabetes , 52 subjects for whom there was no measurement of waist circumference , and 2 subjects who died before the start of follow - up were excluded , and the remaining 2,129 subjects ( 894 men and 1,235 women ) were enrolled in the baseline examination .
the baseline subjects were followed - up prospectively from december 1988 to november 2002 by repeated health examinations . of the baseline subjects ,
1,935 subjects ( 793 men and 1,142 women ) who underwent reexaminations were finally selected for the present study ( follow - up rate , 90.9% ; mean follow - up period , 11.8 years ; mean frequency of follow - up examinations , 6.9 times ) .
one subject who developed overt type 1 diabetes clinically during the follow - up period was censored at the time .
in the baseline and follow - up examinations , the study subjects underwent an oral glucose tolerance test between 8:00 and 10:30 a.m. after an overnight fast of at least 12 h. blood for the glucose assay was obtained by venipuncture into tubes containing sodium fluoride at fasting and at 2-h postload .
plasma glucose concentrations were determined by the glucose oxidase method . according to the american diabetes association criteria in 2003 ( 16 ) ,
waist circumference was measured by a trained staff member at the umbilical level with the subject standing .
blood pressure was obtained three times using a mercury sphygmomanometer with the subject in a sitting position ; the average values were used in the analyses .
each participant completed a self - administered questionnaire covering medical history , antidiabetes and antihypertension treatments , alcohol intake , smoking habits , and physical activity at the screening .
diabetes in first- or second - degree relatives was taken to indicate a family history of diabetes .
subjects engaging in sports at least three times per week during their leisure time were defined as the regular - exercise group .
the criteria set for metabolic syndrome used in this study was defined by the updated 2005 national cholesterol education program ( ncep ) adult treatment panel iii ( atp iii ) ( 17 ) . by this definition ,
metabolic syndrome includes the presence of at least three of five factors : elevated fpg ( 5.6 mmol / l ) , central obesity for asians ( waist circumference 90 cm in men and 80 cm in women ) , elevated triglycerides ( 1.68
mmol / l ) , reduced hdl cholesterol ( < 1.03 mmol / l for men and < 1.29
mmol / l for women ) , and elevated blood pressure ( blood pressure 130/85 mmhg and/or current use of antihypertension agents ) .
the sas software package ( version 8.2 ; sas institute , cary , nc ) was used to perform all statistical analyses .
multivariate - adjusted hazard ratios ( hrs ) and their 95% cis were estimated with the use of the cox proportional hazards model .
this study was conducted with the approval of the ethics committee of the faculty of medicine , kyushu university , and written informed consent was obtained from all participants .
during the follow - up , 286 subjects ( 145 men and 141 women ) developed type 2 diabetes .
the baseline clinical characteristics of subjects by the presence or absence of incident type 2 diabetes are shown in table 1 .
the mean values of fasting and 2-h postload glucose , waist circumference , triglycerides , and systolic and diastolic blood pressures and the frequencies of men , family history of diabetes , elevated blood pressure , alcohol intake , and smoking habits were higher in subjects who developed type 2 diabetes than in those who did not develop it , and subjects with incident type 2 diabetes had lower hdl cholesterol and lower frequency of regular exercise .
baseline characteristics of subjects by the presence or absence of incident type 2 diabetes , 1988 data are means sd , % , or geometric means ( 95% ci ) for triglycerides ( because of the skewed distribution ) .
elevated blood pressure was defined as blood pressure 130/85 mmhg and/or current use of antihypertension agents .
the multivariate - adjusted hrs for the development of type 2 diabetes associated with metabolic syndrome and its individual components were estimated by sex ( table 2 ) .
the multivariate analysis showed that metabolic syndrome was a significant risk factor for type 2 diabetes in men and women , even after adjustment for the following confounding factors : age , family history of diabetes , total cholesterol , alcohol intake , smoking habits , and regular exercise ( men : multivariate - adjusted hr , 2.58 [ 95% ci 1.853.59 ] , p < 0.001 ; women : 3.69 [ 2.585.27 ] , p < 0.001 ) .
all components of metabolic syndrome in both sexes , except for reduced hdl cholesterol in men , were significantly associated with future type 2 diabetes . among the individual components of metabolic syndrome , ifg was the strongest predictor of incident type 2 diabetes in both sexes ( men : 3.76 [ 2.575.52 ] , p < 0.001 ; women : 3.50 [ 2.455.00 ] , p < 0.001 ) . compared with that of ifg ,
the multivariate - adjusted hr of metabolic syndrome for developing type 2 diabetes was slightly lower in men and similar in women .
individuals was used ( > 102 cm in men and > 88 cm in women ) in the metabolic syndrome criteria instead of the cutoff point for asians , the hr of metabolic syndrome for incident type 2 diabetes was substantially unchanged ( men : 2.48 [ 1.763.51 ] , p < 0.001 ; women : 3.22 [ 2.274.55 ] , p < 0.001 ) .
multivariate - adjusted hrs for the development of type 2 diabetes associated with metabolic syndrome and its individual components data are n or hr ( 95% ci ) .
ifg , fpg levels of 5.66.9 mmol / l ; central obesity , waist circumference of 90 cm in men and 80 cm in women ; reduced hdl cholesterol , hdl cholesterol levels of < 1.03 mmol / l in men and < 1.29 mmol / l in women ; elevated triglycerides , triglyceride levels of 1.68
mmol / l ; elevated blood pressure , blood pressure 130/85 mmhg and/or current use of antihypertension agents .
multivariate adjustment was made for age , family history of diabetes , total cholesterol , alcohol intake , smoking habits , and regular exercise . because ifg is a strong predictor of future type 2 diabetes
, the associations between the number of the other metabolic syndrome components and the development of type 2 diabetes were examined among individuals with or without ifg in men and women together ( table 3 ) . in subjects with normal fpg levels ,
the multivariate - adjusted hrs for type 2 diabetes rose significantly as the number of metabolic syndrome components increased ( one component : multivariate - adjusted hr 1.76 [ 95% ci 0.883.50 ] ; two components : 2.49 [ 1.225.06 ] ; three components : 3.71 [ 1.728.02 ] ; and four components : 5.90 [ 2.2415.53 ] ; ptrend < 0.001 ) .
similar relationships were also observed in subjects with ifg ( one component : 2.38 [ 1.304.35 ] ; two components : 2.98 [ 1.625.47 ] ; three components : 4.61 [ 2.488.56 ] ; and four components : 4.22 [ 2.018.83 ] ; ptrend < 0.001 ) .
multivariate - adjusted hrs for the development of type 2 diabetes associated with the number of metabolic syndrome components excluding ifg by the presence or absence of ifg data are n or hr ( 95% ci ) .
multivariate adjustment was made for age , sex , family history of diabetes , total cholesterol , alcohol intake , smoking habits , and regular exercise .
normal , fpg levels of < 5.6 mmol / l ; ifg , fpg levels of 5.66.9 mmol / l . finally , we examined the combined as well as separate effects of metabolic syndrome and ifg on the development of type 2 diabetes .
in this analysis , metabolic syndrome was defined as the presence of at least three metabolic syndrome components , not including the component of elevated fpg . as shown in the figure 1 ,
the multivariate - adjusted hr for future type 2 diabetes was significantly higher in subjects with metabolic syndrome alone and in those with ifg alone than in those with neither metabolic syndrome nor ifg ; the former was slightly lower than the latter , but there was no significant difference between the two ( metabolic syndrome alone : multivariate - adjusted hr 2.37 [ 95% ci 1.453.88 ] , p < 0.001 ; ifg alone : 3.49 [ 2.574.74 ] , p < 0.001 ) .
furthermore , the subjects who had both metabolic syndrome and ifg had a markedly higher hr for the development of type 2 diabetes ( 6.76 [ 4.759.61 ] , p < 0.001 ) .
the risk of future type 2 diabetes was also significantly higher in subjects with both metabolic syndrome and ifg than in subjects with metabolic syndrome alone ( 2.82 [ 1.744.57 ] , p < 0.001 ) as well as in those with ifg alone ( 1.94 [ 1.442.62 ] , p < 0.001 ) .
multivariate - adjusted hrs for the development of type 2 diabetes according to the presence or absence of metabolic syndrome and ifg .
metabolic syndrome ( mets ) was defined as the presence of at least three metabolic syndrome components other than that related to fpg .
multivariate adjustment was made for age , sex , family history of diabetes , total cholesterol , alcohol intake , smoking habits , and regular exercise .
using data from a 14-year follow - up study of a defined general japanese population , we demonstrated that metabolic syndrome determined by the updated 2005 ncep atp iii criteria was an independent risk factor for the development of type 2 diabetes in both sexes even after adjustment for comprehensive risk factors .
the hr of metabolic syndrome for developing type 2 diabetes was slightly lower in men and similar in women compared with that of ifg .
when subjects were stratified by the presence or absence of ifg , the risk of future type 2 diabetes rose significantly as the number of metabolic syndrome components increased in both fpg level groups .
furthermore , metabolic syndrome that did not include the ifg component was also a significant risk factor for developing type 2 diabetes , and the coexistence of metabolic syndrome and ifg greatly increased the risk of future type 2 diabetes .
these findings suggest that the diagnosis of metabolic syndrome as well as that of ifg is a valuable tool to identify individuals at increased risk of type 2 diabetes . in japan , there has been only one prospective study to date that found a significant association between metabolic syndrome determined by the world health organization definition and incident type 2 diabetes among japanese male workers ( 18 ) . to our knowledge , the present study is the first report to indicate that metabolic syndrome was associated significantly with future type 2 diabetes for individuals of both sexes in a general japanese population .
several epidemiological studies examined the relationship between metabolic syndrome determined by the updated 2005 ncep atp iii criteria and incident diabetes ( 3,4,911 ) , and the risks of incident diabetes associated with metabolic syndrome have differed among these investigations . in the framingham offspring study ,
subjects with metabolic syndrome had an 8.6-fold higher risk of future type 2 diabetes than those without metabolic syndrome ( 4 ) .
the san antonio heart study , which consisted predominantly of hispanics , also showed that the diabetes risk was 6.9-fold higher in subjects with metabolic syndrome than that in subjects without metabolic syndrome ( 3 ) .
a similar increased risk of diabetes was observed among subjects with metabolic syndrome in an italian population study ( 6.2-fold ) ( 11 ) . on the other hand ,
metabolic syndrome increased the risk of diabetes two- to fourfold in studies of chinese populations ( 9,10 ) . in the present analysis , the risk of developing type 2 diabetes was nearly threefold higher in men and fourfold higher in women with metabolic syndrome than in those without it , and these figures were much lower than the figures in western populations but comparable to those of other asian populations . furthermore , even when the definition of waist circumference for u.s .
individuals was used ( > 102 cm in men and > 88 cm in women ) in the metabolic syndrome criteria set , the risk of future type 2 diabetes among subjects with metabolic syndrome was hardly altered .
taken together , these findings suggest that metabolic syndrome is less strongly associated with increased risk of type 2 diabetes in asian populations than in western populations .
although the reason for this difference is unclear , the diversity of etiology for type 2 diabetes among races could explain it .
that is , an epidemiological study has shown that the levels of insulin secretion and resistance differed among various ethnic groups in the u.s . (
19 ) ; asians had lower levels of insulin secretion than other ethnic groups , whereas whites , especially hispanics , were more insulin resistant than asians .
in addition , japanese diabetic individuals were found to have lower bmi levels than western diabetic individuals ( 20 ) .
thus , we speculate that insulin resistance may play a lesser role than impaired insulin secretion in the development of type 2 diabetes among asian populations .
these findings may indicate one reason that the impact of metabolic syndrome , which has features of insulin resistance , on the development of type 2 diabetes is lower in asian populations , including ours , than in western populations .
there has been controversy over whether metabolic syndrome is better than ifg for detecting subjects at high risk of type 2 diabetes .
the san antonio heart study revealed that metabolic syndrome was a better predictor of diabetes than ifg ( 3 ) , whereas other epidemiological studies including ours ( 2,6,7 ) showed that metabolic syndrome was comparable or inferior to ifg as a predictor of diabetes .
this discrepancy also may result from the difference in the degree of insulin resistance among the populations , because the study subjects in the san antonio heart study were more obese than those in other studies .
thus , metabolic syndrome might be less effective in predicting incident type 2 diabetes in relatively lean ethnic groups . in our study , however , the risk of type 2 diabetes rose progressively as the number of the other metabolic syndrome components increased , not only in subjects with ifg but also in those with normal fpg levels .
moreover , our stratified analysis indicated that metabolic syndrome defined without the fpg component was also a significant risk factor for future type 2 diabetes in individuals both with and without ifg .
these results imply that metabolic syndrome excluding the fpg component is also an independent risk factor for incident type 2 diabetes . on the other hand , in our study , the coexistence of metabolic syndrome and ifg appeared to increase the risk of future type 2 diabetes compared with either one alone .
other epidemiological studies have also shown that type 2 diabetes prediction was greatly enhanced by adding information on metabolic variables to that of ifg ( 2123 ) .
thus , metabolic syndrome would provide additional information beyond that provided by ifg alone in regard to the development of type 2 diabetes . in our study ,
reduced hdl cholesterol was not a significant risk factor for developing type 2 diabetes in men , although lower hdl cholesterol has often been shown to be a strong predictor of diabetes in other epidemiological studies ( 2,6,7,9,2123 ) .
the reasons for this discrepancy are not precisely known , but a higher prevalence of drinking habits in our men ( 61% ) relative to our women ( 9% ) may contribute to this phenomenon .
it is known that heavy alcohol intake augments the risk of diabetes ( 24 ) , whereas it increases serum hdl cholesterol levels ( 25 ) .
these effects of alcohol intake could weaken the association between hdl cholesterol levels and the risk of diabetes .
the strengths of our study include a longitudinal population - based design , a long duration of follow - up , a sufficient number of type 2 diabetes events , a high follow - up rate , and the use of an oral glucose tolerance test for the diagnosis of diabetes . however , two limitations of the present study should be discussed .
one is that the diagnosis of metabolic syndrome was based on a single measurement of its components at baseline , as was the case in other epidemiological studies .
the risk factor levels might have changed during the follow - up because of modifications in lifestyle or medication .
the other limitation is that the present study lacked information on antilipidemic drugs , such as fibrates and nicotinic acid , which could have affected the metabolism of hdl cholesterol and triglycerides , although these medications were rarely used in our country by 1988 , the time of the baseline .
these biases have the potential to underestimate the association between metabolic syndrome and incident type 2 diabetes , and thus the true impact of metabolic syndrome on the occurrence of type 2 diabetes may be stronger than that shown in our findings .
for this reason , we believe that these limitations would not have substantially altered our conclusions . in summary , the present analysis clearly demonstrated that metabolic syndrome was a significant risk factor for developing type 2 diabetes in both sexes in a general japanese population .
although the ability of metabolic syndrome to predict type 2 diabetes was comparable or inferior to that of ifg , the effects of metabolic syndrome on the development of type 2 diabetes were independent of ifg .
these findings suggest that the diagnosis of metabolic syndrome is useful and valuable for predicting type 2 diabetes even in relatively lean asians . | ### Summary:
: objectivewe examined whether metabolic syndrome predicts incident type 2 diabetes more effectively than impaired fasting glucose ( ifg ) in a general japanese population.research design and methodsa total of 1,935 nondiabetic subjects aged 4079 years were followed - up prospectively for a mean of 11.8 years.resultsduring the follow - up , 286 subjects developed type 2 diabetes . compared with those without metabolic syndrome , the multivariate - adjusted hazard ratio ( hr ) for incident type 2
diabetes was significantly higher in subjects of both sexes with metabolic syndrome , even after adjustment for confounding factors , age , family history of diabetes , total cholesterol , alcohol intake , smoking habits , and regular exercise ( men : hr 2.58 [ 95% ci 1.853.59 ] ; women : 3.69 [ 2.585.27 ] ) .
the multivariate - adjusted hr of metabolic syndrome for type 2 diabetes was slightly lower in men and similar in women compared with that of ifg .
the multivariate - adjusted hr for type 2 diabetes rose progressively as the number of metabolic syndrome components increased in both subjects with and without ifg .
in stratified analysis , the multivariate - adjusted risk of type 2 diabetes was significantly higher in subjects with metabolic syndrome alone ( 2.37 [ 1.453.88 ] ) or ifg alone ( 3.49 [ 2.574.74 ] ) and markedly increased in subjects with both metabolic syndrome and ifg ( 6.76 [ 4.759.61 ] ) than in subjects with neither metabolic syndrome nor ifg .
furthermore , the multivariate - adjusted risk for type 2 diabetes was also significantly higher in subjects with both metabolic syndrome and ifg than in those with either one alone ( both p < 0.001).conclusionsour findings suggest that metabolic syndrome significantly increases the risk of incident type 2 diabetes , independent of ifg , and is therefore a valuable tool to identify individuals at high risk of type 2 diabetes . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: every year , approximately 2.2 million persons develop tuberculosis , of which about one million are new - smear positive highly infective cases and about five lakh people die of tuberculosis every year .
although extrapulmonary tuberculosis is rare , occurring in 10 - 15% of all the cases , it can affect any part of the body , including the oral cavity .
secondary oral tuberculosis , on the other hand , is common and is usually seen in older adults , involving the tongue , palate , lips , buccal mucosa and gingiva .
but , as the incidence of tuberculosis in our country is quite high , all atypical manifestations of tuberculosis are likely to be seen occasionally .
the clinical presentation of tuberculosis may take many forms . here , we report a case of tuberculosis presenting first as periodontal loss of tooth support leading to loose teeth and gingival enlargement without pulmonary involvement .
a female patient aged 17 years presented to the dental clinic with chief complaints of pain , loose back teeth in both arches since 6 months and space between upper and lower teeth .
she was treated by local doctors with antibiotics and vitamins supplements . as there was no improvement , she presented to this clinic .
the patient had a history of mild intermittent increasing temperature over the last 3 months .
she had generalized weight loss of 8 - 10 kg over a period of 8 months along with loss of appetite .
she had dental history of extraction of the right third molar ( 48 ) under local anesthesia . on examination ,
intraoral examination showed generalized inflammatory gingival enlargement and periodontal pockets with all posterior teeth in both the arches with moderate to severe mobility .
a red indurated soft swelling was present palatally in relation to the 24 , 25 and 26 regions , extending near to the midpalatal suture [ figures 1 and 2 ] .
buccal view of periodontal changes in relation to posterior teeth occlusal view of showing palatal swelling and periodontal changes buccally the patient was advised antibiotics and analgesics , chest x - ray , orthopantomogram and mantoux test .
opg revealed moderate to severe bone loss in relation to the molars on both the arches and a palatal radiolucency in relation to the 24 , 25 and 26 regions [ figure 3 ] .
opg showing moderate to severe bone loss in relation to posterior teeth on both the arches and a palatal radiolucency an incisional biopsy was performed on the labial gingiva in relation to the maxillary right molars .
histopathological examination showed papillomatous hyperplasia of the stratified squamous epithelium along with parakeratosis . in the sub - epithelial tissue
, there were granulomas formed by epitheloid cells , langerhans - type giant cells , lymphocytes and some caseous necrosis [ figure 4 ] .
the granulomas were present in the upper part of the sub - epithelial tissue and even intra - epithelially .
she reported after 2 days with a complaint of stomach fullness and unable to take medicines and food , for which she was then referred to a gastroenterologist .
the gastroenterologist advised abdominal ultrasonography and quantitative adenosine deaminase activity mycobacterium tuberculosis ( ada mtb ) test of serum , plasma and biological fluids .
the report of ultrasonography revealed ascitis with mucosal thickening of the segment of small bowel and bilateral ovarian enlargement .
the ada mtb test revealed positive for abdominal koch , with a total ada value of 83.3u / l h. the report from the gastroenterologist suggested abdominal tuberculosis with bilateral ovarian enlargement . on the basis of the biopsy report , abdominal ultrasonography and ada mtb test
, the patient was diagnosed as a case of abdominal tuberculosis presenting first in the oral cavity as periodontal involvement .
histologic image showing papillomatous hyperplasia along with parakeratosis and granulomas formed by epitheloid cells , langerhans - type giant cells , lymphocytes and some caseous necrosis on consultation with the physician , the patient was admitted in the hospital and 14 l of ascitis fluid was removed and anti - tubercular therapy was initiated with isoniazid ( 10 mg / kg of body weight ) , rifampicin ( 10 - 20 mg / kg of body weight ) and pyrazinamide ( 10 - 20 mg / kg of body weight ) for 2 months , followed by isoniazid and rifampicin for the following 4 months . during the period , the patient was instructed not to undergo any surgical procedure within the oral cavity and was warned of transmitting the disease to others
physicians in ancient greece called this illness phthisis to reflect its wasting character .
the vulnerability to tuberculosis in developing countries results from poverty , economic recession and malnutrition .
extrapulmonary tuberculosis , like tuberculosis of periodontal tissue , is an uncommon condition . even in our country where tuberculosis is very common , involvement of periodontal tissue with tuberculosis has probably been reported very rarely .
oral tuberculosis is usually post - primary and occurs in patients affected with advanced pulmonary tuberculosis .
the sites most frequently affected are the tongue , hard and soft palate , tonsils and pharynx .
it may occur in the buccal mucosa , gingiva and at the commissures of the lips .
the reason for its rare occurrence in the oral cavity may be intact squamous epithelium resisting direct penetration by bacteria .
this resistance may also be attributed to the thickness of the oral epithelium and protective action of saliva .
thus , it has been suggested that organisms enter the oral mucosa through a small breach on the surface or any local trauma .
the organism is likely to be carried to the oral tissue by the hematogenous route .
the case documented here may be one of the first cases of oral tuberculosis to be presented as periodontal involvement instead of appearing as ulcer or any mass . in this case , the patient was unaware of the systemic involvement and the periodontal finding , and the follow - up of the patient suggested us to opt for further investigation .
the patient was referred to a gastroenterologist for complaints of stomach fullness , for which various tests were advised .
the diagnosis was supported by histopathological presentation of granulomatous lesion , radiographic finding , abdominal ultrasonography finding and ada mtb positive test .
results of complete blood count were within normal limits , except for hemoglobin 9.6% and an elevated esr of 46 mm / h , which ruled out leukemia - associated enlargement and raised the possibility of one of the more common causes of elevated esr , suggesting tuberculosis infection.hiv test was negative .
we presume that due to the extraction of the lower right third molar ( 48 ) , the patient might have developed breach in the epithelium or by hematogenous spread , favoring the entry of the organism .
periodontal finding as an initial manifestation of tuberculosis is a relatively uncommon occurrence , and this case report emphasizes the need for the clinician to include tuberculosis in the differential diagnosis of various types of oral lesions .
dental clinicians need to be aware of this possibility and play a role in early detection and prompt treatment in the management of this highly infectious and communicable disease . | ### Summary:
: tuberculosis is a chronic , specific granulomatous disease and a major cause of death in developing countries .
we report a case of tuberculosis presenting first as periodontal loss of tooth support leading to loose teeth and gingival enlargement affecting a 17-year - old female patient without any pulmonary lesion .
diagnosis was based on histopathological examination and positive adenosine deaminase activity mycobacterium tuberculosis test .
the clinical presentation of tuberculosis may take many forms .
however , with the decline in numbers , tuberculosis lesions of the oral cavity have become so rare that they are frequently overlooked in the differential diagnosis of oral lesions .
also , this case report emphasizes the need for dental clinicians to be aware of the possibility of tuberculosis presenting first in the oral cavity , and contribute in control of tuberculosis through early detection and referring the patients to physicians for proper treatment . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: data for this cross - sectional analysis come from the 19992002 national health and nutrition examination survey ( nhanes ) .
this ongoing survey conducted by the national center for health statistics uses a stratified , multistage , probability cluster design that results in a nationally representative sample of the noninstitutionalized , civilian u.s . population .
the sampling design oversamples non - hispanic blacks , mexican americans , individuals aged 60 years , and low - income individuals to provide more precise estimates for these specific groups .
we included 843 adults aged 20 years with valid measures of a1c who were not pregnant and who reported during an interview that a health care professional had told them they have diabetes .
the nhanes 19992002 underwent institutional review board approval , and written informed consent was obtained from participants .
sociodemographic characteristics and information on diabetes , health , and insurance status were ascertained during interviews .
income - to - poverty ratio was defined as the ratio of reported total family income to the u.s .
diabetes medication was categorized as use of insulin ( with or without oral agents ) , use of oral agents only , and no use .
bmi was calculated as weight in kilograms divided by the square of height in meters , and weight status was categorized as underweight or normal weight , overweight , obese , and severely obese with bmi cut points of < 25 , 2529.9 , 3039.9 , and 40 kg / m ( 17 ) .
a1c was assessed by boronate affinity high - performance liquid chromatography using primus clc330 and primus clc 385 ( primus , kansas city , mo ) , and values were standardized according to the method of the diabetes control and complications trial ( 18,19 ) , yielding interassay coefficients of variation of < 3.0% .
the mean difference provides a measure of disparity among different groups within a population ( 20 ) .
we used the mean difference to assess differences in a1c threshold attainment by various population groups within potential case mix factors . for each factor , we calculated a mean difference to provide a summary of the difference in proportion of people with diabetes whose a1c was > 7 , > 8 , and > 9% .
the mean difference is expressed in percentage points , across any number , p , of population groups .
the referent for each threshold , rref , was selected as the proportion exceeding the threshold among the overall population .
these referent proportions are constant at a given threshold and provide an intuitive standard from which to gauge differences across groups . for each population group ,
j , we calculated the proportion , rj , exceeding the threshold , and the absolute difference in that proportion from that of the referent , rref .
1\documentclass[10pt]{article }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{pmc }
\usepackage[euler]{upgreek }
\pagestyle{empty }
\oddsidemargin -1.0 in
\begin{document }
\begin{equation*}{\mathrm{mean\;difference}}=\frac{\begin{matrix}p\\ { \sum}\\ j=1\end{matrix}\;{\vert}(r_{j}-r_{{\mathrm{ref}}}){\vert}}{p}\end{equation*}\end{document } all calculations were made with wesvar ( version 5 ; westat , rockville , md ) using the 4-year examination sample weights to account for the sample design and nonresponse .
sampling variance was calculated using the jackknife procedure , appropriate for the complex , multistage sample design ( 21 ) , and 95% confidence limits were calculated by taking the natural logarithm of the mean difference , estimating the standard error of the transformed estimate , deriving confidence limits , and back - transforming the confidence limits via exponentiation .
student 's t tests were used to test whether the differences between the mean differences for the 7 and 8% thresholds relative to the 9% threshold were equal to 0 .
sociodemographic characteristics and information on diabetes , health , and insurance status were ascertained during interviews .
income - to - poverty ratio was defined as the ratio of reported total family income to the u.s .
diabetes medication was categorized as use of insulin ( with or without oral agents ) , use of oral agents only , and no use .
bmi was calculated as weight in kilograms divided by the square of height in meters , and weight status was categorized as underweight or normal weight , overweight , obese , and severely obese with bmi cut points of < 25 , 2529.9 , 3039.9 , and 40 kg / m ( 17 ) .
a1c was assessed by boronate affinity high - performance liquid chromatography using primus clc330 and primus clc 385 ( primus , kansas city , mo ) , and values were standardized according to the method of the diabetes control and complications trial ( 18,19 ) , yielding interassay coefficients of variation of < 3.0% .
the mean difference provides a measure of disparity among different groups within a population ( 20 ) .
we used the mean difference to assess differences in a1c threshold attainment by various population groups within potential case mix factors . for each factor , we calculated a mean difference to provide a summary of the difference in proportion of people with diabetes whose a1c was > 7 , > 8 , and > 9% .
the mean difference is expressed in percentage points , across any number , p , of population groups .
the referent for each threshold , rref , was selected as the proportion exceeding the threshold among the overall population .
these referent proportions are constant at a given threshold and provide an intuitive standard from which to gauge differences across groups . for each population group ,
j , we calculated the proportion , rj , exceeding the threshold , and the absolute difference in that proportion from that of the referent , rref . for each factor , the mean difference was calculated using equation 1 .
1\documentclass[10pt]{article }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{pmc }
\usepackage[euler]{upgreek }
\pagestyle{empty }
\oddsidemargin -1.0 in
\begin{document }
\begin{equation*}{\mathrm{mean\;difference}}=\frac{\begin{matrix}p\\ { \sum}\\ j=1\end{matrix}\;{\vert}(r_{j}-r_{{\mathrm{ref}}}){\vert}}{p}\end{equation*}\end{document } all calculations were made with wesvar ( version 5 ; westat , rockville , md ) using the 4-year examination sample weights to account for the sample design and nonresponse .
sampling variance was calculated using the jackknife procedure , appropriate for the complex , multistage sample design ( 21 ) , and 95% confidence limits were calculated by taking the natural logarithm of the mean difference , estimating the standard error of the transformed estimate , deriving confidence limits , and back - transforming the confidence limits via exponentiation .
student 's t tests were used to test whether the differences between the mean differences for the 7 and 8% thresholds relative to the 9% threshold were equal to 0 .
the proportion of individuals whose a1c concentrations were > 9 , > 8 , and > 7% are presented by various patient factors ( table 1 ) .
frequency distributions for each factor across the overall population are provided for reference . of the overall ( unstratified ) population ,
18.4% exceeded an a1c threshold of 9% , 32.8% exceeded an a1c threshold of 8% , and 52.6% exceeded the ada recommended target a1c of 7% .
these proportions provide the referent to which subgroup threshold attainment is compared . we first present differences in threshold attainment within factors and then describe the effects of lowering the a1c threshold on these differences .
for sociodemographic factors , important differences existed across groups of age , race / ethnicity , and insurance status at each of the a1c thresholds , whereas differences across sex and education were minor .
the proportion with a1c > 9% declined steadily with increasing age , such that 32.7% of those aged 2044 years but only 13.4% of those aged 6574 years and only 5.8% of those aged 75 years surpassed the threshold .
the age gradient was not explained by a shorter reported duration of diabetes or a lower proportion of insulin use among elderly individuals ( data not shown ) . in comparing each of the five age - groups to the overall population , the mean difference in the proportion with a1c
the difference across race / ethnic groups was of a magnitude similar to that for the age difference at this threshold . among race / ethnic groups ,
the proportion exceeding any threshold was much lower for non - hispanic whites than for any minority race / ethnic group .
almost one - third of those most economically disadvantaged ( income - to - poverty ratio 0.8 ) had a1c > 9% , but the proportions of individuals in the other income - to - poverty ratio categories with a1c > 9% were much lower and ranged from 14.9 to 17.5% , resulting in a mean difference of 5.4 ( 3.09.8 ) percentage points .
uninsured individuals were more likely to have a1c > 9% than those with any insurance .
the lower proportion with a1c > 9% among those with public insurance ( and among those with additional private insurance ) appears to be explained by the medicare eligibility of individuals aged 65 years , who have a lower probability of poor control ( data not shown ) . lowering the threshold to a1c
the age gradient persisted , and mean differences across age and insurance status were modestly reduced as the threshold was lowered from > 9 to > 7% .
lowering the threshold to a1c > 8% did not significantly reduce the disparity across income - to - poverty groups , but lowering the threshold to a1c > 7% reduced the mean difference to 2.5 ( 95% confidence limits 0.79.0 ) percentage points , a significant decline from the estimate at > 9% ( p < 0.05 ) .
although our analysis was framed in terms of the effect on the mean difference across various groups of lowering the threshold for poor control , the results are similar if framed in terms of raising the a1c threshold for good control . among health status factors , the largest difference at the > 9% threshold was found across diabetes medication categories . compared with 18.4% overall , more than one - quarter of individuals taking insulin , 16% of those taking oral medications , and 13% of those using no medications had concentrations above this level , yielding a mean difference of 5.7 ( 95% confidence limits 2.313.8 ) percentage points .
the relation of poor glycemic control by diabetes duration was u - shaped , as a lower proportion among those with duration of diabetes < 5 and at least 20 years had a1c > 9% ; the mean difference was 4.9 ( 2.211.1 ) percentage points .
the mean difference for weight status was small at 3.3 ( 1.011.3 ) percentage points .
only 9.8% of individuals who reported good or excellent health had a1c > 9% , whereas 20% of those reporting good or fair to poor health had concentrations above the threshold , yielding a mean difference of 4.2 ( 2.09.1 ) percentage points for self - reported health . at a1c
> 9% , mean differences across categories of number of prescription medications and number of health care interactions and hospitalization in the last year were small , at 3.1 ( 0.811.9 ) , 4.1 ( 1.511.1 ) , and 2.1 ( 0.134.5 ) percentage points , respectively .
lowering the threshold to a1c > 8 or > 7% had a large and significant effect on the mean difference across categories of diabetes medication . compared with 32.8% of the overall population , nearly half of those who used insulin had a1c > 8% , and compared with 52.6% overall , > 70% of insulin users had a1c > 7% .
mean differences were 10.1 ( 95% confidence limits 6.515.7 ) percentage points at a1c > 8% and 14.7 ( 10.820.1 ) percentage points at a1c > 7% ( p < 0.05 and p <
the increase in the mean difference for diabetes medication categories at sequentially lower a1c thresholds reflects a differential increase by type of medication in the proportion exceeding the lower thresholds ( fig .
1 ) . when the threshold is lowered to a1c > 8% , the proportion of insulin users exceeding the threshold increased by 20 percentage points ( to include those with a1c > 89% ) , compared with increases of 13 and 9 percentage points for those taking oral agents and those not using medication , respectively .
when the threshold is lowered to a1c > 7% , the increase in the proportion above this threshold was 23 percentage points for the insulin users and those taking oral agents ( after including those with a1c > 78% ) , but only 6 percentage points for those using no medication .
the mean differences for the remaining health status factors were not significantly affected by lowering the a1c to > 8 or > 7% . in table 2 ,
patient factors were ranked by mean differences at each a1c threshold . considering a mean difference of 5 percentage points as noteworthy , important disparities
were consistently observed across all three a1c thresholds for age , race / ethnicity , insurance , and diabetes medication , but their rank varied by threshold . at a1c > 9% , insurance ,
age , and race / ethnicity contributed the greatest mean differences in threshold attainment . at lower thresholds ,
diabetes medication exhibited the greatest disparity with mean differences of 10 and almost 15 percentage points .
the average mean difference across all factors was consistent ( 4.74.8 ) among all thresholds .
for sociodemographic factors , important differences existed across groups of age , race / ethnicity , and insurance status at each of the a1c thresholds , whereas differences across sex and education were minor .
the proportion with a1c > 9% declined steadily with increasing age , such that 32.7% of those aged 2044 years but only 13.4% of those aged 6574 years and only 5.8% of those aged 75 years surpassed the threshold .
the age gradient was not explained by a shorter reported duration of diabetes or a lower proportion of insulin use among elderly individuals ( data not shown ) . in comparing each of the five age - groups to the overall population , the mean difference in the proportion with a1c
the difference across race / ethnic groups was of a magnitude similar to that for the age difference at this threshold .
among race / ethnic groups , the proportion exceeding any threshold was much lower for non - hispanic whites than for any minority race / ethnic group .
almost one - third of those most economically disadvantaged ( income - to - poverty ratio 0.8 ) had a1c > 9% , but the proportions of individuals in the other income - to - poverty ratio categories with a1c > 9% were much lower and ranged from 14.9 to 17.5% , resulting in a mean difference of 5.4 ( 3.09.8 ) percentage points .
uninsured individuals were more likely to have a1c > 9% than those with any insurance .
the lower proportion with a1c > 9% among those with public insurance ( and among those with additional private insurance ) appears to be explained by the medicare eligibility of individuals aged 65 years , who have a lower probability of poor control ( data not shown ) .
lowering the threshold to a1c > 8 or > 7% did not significantly affect most sociodemographic disparities .
the age gradient persisted , and mean differences across age and insurance status were modestly reduced as the threshold was lowered from > 9 to > 7% .
lowering the threshold to a1c > 8% did not significantly reduce the disparity across income - to - poverty groups , but lowering the threshold to a1c > 7% reduced the mean difference to 2.5 ( 95% confidence limits 0.79.0 ) percentage points , a significant decline from the estimate at > 9% ( p < 0.05 ) .
although our analysis was framed in terms of the effect on the mean difference across various groups of lowering the threshold for poor control , the results are similar if framed in terms of raising the a1c threshold for good control .
among health status factors , the largest difference at the > 9% threshold was found across diabetes medication categories . compared with 18.4% overall , more than one - quarter of individuals taking insulin , 16% of those taking oral medications , and 13% of those using no medications had concentrations above this level , yielding a mean difference of 5.7 ( 95% confidence limits 2.313.8 ) percentage points .
the relation of poor glycemic control by diabetes duration was u - shaped , as a lower proportion among those with duration of diabetes < 5 and at least 20 years had a1c > 9% ; the mean difference was 4.9 ( 2.211.1 ) percentage points .
the mean difference for weight status was small at 3.3 ( 1.011.3 ) percentage points .
only 9.8% of individuals who reported good or excellent health had a1c > 9% , whereas 20% of those reporting good or fair to poor health had concentrations above the threshold , yielding a mean difference of 4.2 ( 2.09.1 ) percentage points for self - reported health . at a1c
> 9% , mean differences across categories of number of prescription medications and number of health care interactions and hospitalization in the last year were small , at 3.1 ( 0.811.9 ) , 4.1 ( 1.511.1 ) , and 2.1 ( 0.134.5 ) percentage points , respectively .
lowering the threshold to a1c > 8 or > 7% had a large and significant effect on the mean difference across categories of diabetes medication . compared with 32.8% of the overall population , nearly half of those who used insulin had a1c > 8% , and compared with 52.6% overall , > 70% of insulin users had a1c > 7% .
mean differences were 10.1 ( 95% confidence limits 6.515.7 ) percentage points at a1c > 8% and 14.7 ( 10.820.1 ) percentage points at a1c >
7% ( p < 0.05 and p < 0.001 , respectively , compared with a1c > 9% ) .
the increase in the mean difference for diabetes medication categories at sequentially lower a1c thresholds reflects a differential increase by type of medication in the proportion exceeding the lower thresholds ( fig .
1 ) . when the threshold is lowered to a1c > 8% , the proportion of insulin users exceeding the threshold increased by 20 percentage points ( to include those with a1c > 89% ) , compared with increases of 13 and 9 percentage points for those taking oral agents and those not using medication , respectively .
when the threshold is lowered to a1c > 7% , the increase in the proportion above this threshold was 23 percentage points for the insulin users and those taking oral agents ( after including those with a1c > 78% ) , but only 6 percentage points for those using no medication .
the mean differences for the remaining health status factors were not significantly affected by lowering the a1c to > 8 or > 7% . in table 2 ,
patient factors were ranked by mean differences at each a1c threshold . considering a mean difference of 5 percentage points as noteworthy , important disparities
were consistently observed across all three a1c thresholds for age , race / ethnicity , insurance , and diabetes medication , but their rank varied by threshold . at a1c
> 9% , insurance , age , and race / ethnicity contributed the greatest mean differences in threshold attainment . at lower thresholds ,
diabetes medication exhibited the greatest disparity with mean differences of 10 and almost 15 percentage points .
the average mean difference across all factors was consistent ( 4.74.8 ) among all thresholds .
this study demonstrates the extent to which disparities in glycemic control by patient subgroups are mitigated or exacerbated by choice of a1c thresholds of > 9 , > 8 , and > 7% . for 11 of the 13 factors examined ,
choice of a1c threshold did not significantly affect the magnitude of population subgroup differences in glycemic control .
for example , we observed pronounced race / ethnicity differences in achievement of glycemic control at all three thresholds , a finding consistent with previous research ( 23 ) .
we found no evidence , however , that establishing a lower a1c cutoff as a performance measure would exacerbate this disparity or that selecting a less stringent threshold would obviate the disparity .
diabetes medication is the major patient factor for which differences in threshold attainment would be exacerbated by lowering the current ndqia and nqf glycemic control performance measure of a1c > 9% .
the importance of diabetes treatment for good ( a1c < 7% ) glycemic control has been shown to be independent of sociodemographic characteristics , abdominal obesity , and health care access and utilization ( 15 ) .
the magnitude of this difference at the lower thresholds has implications for pay for performance quality improvement models being considered by the centers for medicare & medicaid services and other payers .
practices that include a greater proportion of patients receiving insulin may have proportionately more patients exceeding a1c thresholds .
a quality improvement system that includes an incentive to achieve a performance measure for glycemic control may not recognize appropriate care given by physicians whose practice includes a larger proportion of people needing insulin for glycemic control , unless the system accounts for this factor
. reporting performance measure attainment specific to diabetes medication use , and insulin use in particular , might be one means to account for this difference in case mix , although implementing this recommendation may not currently be practical under most systems .
as health systems move forward with electronic medical records , however , capturing information on medication use will be more feasible .
although automated review of electronic medical records may not consistently capture data on prescription medications ( 24 ) , performance measures stratified by prescription medication may be a viable solution as long as measures receive adequate field testing ( 25 ) .
differences across other patient health factors examined ( self - reported health , number of prescription medications taken , and history of hospitalization ) were not greatly influenced by the choice of glycemic control performance measure threshold .
of the 13 factors studied , only socioeconomic status ( as measured by the income - to - poverty ratio ) had a reduced disparity in threshold attainment with a lower a1c threshold .
we observed a sizable difference in threshold attainment by age , with improved glycemic control across increasing age - groups .
the effect may be one of survivorship bias whereby life - threatening complications are reduced among individuals with well - controlled diabetes or may reflect milder disease with more -cell function in elderly individuals . the poorer control in younger patients is ominous as they will have a longer duration of diabetes and thus greater risk of complications .
our findings also suggest that the current ndqia and nqf performance measure of a1c > 9% is unlikely to drive major improvements in glycemic control in the medicare population as only 13.4% of those aged 6574 and 5.8% of those aged 75 had a1c > 9% .
our analysis of these national data offers a response to a specific health policy question being debated among groups committed to establishing national health care quality measures .
recent evidence suggests that differences in a1c by race may reflect physiological differences such as rates of glycation and erythrocyte survival ( 26 ) .
fair implementation of threshold - based performance measures will depend on determining whether small differences in a1c threshold attainment truly indicate differences in quality diabetes care after adjustment for case mix .
diagnosed diabetes status was assessed with a validated question that nonetheless has a sensitivity of 81% and a positive predictive value of 89% ( 27 ) .
another limitation is that our analysis relied heavily on self - reported case mix factors .
the nhanes surveys are designed to result in a representative sample of the noninstitutionalized u.s .
population but may underrepresent noninstitutionalized persons with mental health and substance abuse conditions , a group shown to have poor glycemic control ( 28 ) .
we conclude that implementing an a1c performance measure to indicate poor control that is more stringent than the current measure of a1c > 9% would not increase disparities across most patient factors including age , race / ethnic group , and socioeconomic status . to account for a case mix that includes more insulin users ,
however , stakeholders considering the selection of a performance measure threshold for glycemic control that is 8% should consider reporting of threshold attainment specific to diabetes medication use .
stratified reporting would allow more rigorous goals for glycemic therapy in groups for whom a benefit has been established . in
so doing , lowering the a1c performance measure threshold may advance the overall quality of diabetes care , without magnifying overall differences among population groups and without discouraging physician acceptance of insulin - requiring patients whose diabetes is more difficult to manage . | ### Summary:
: objective performance measures are tools for assessing quality of care but may be influenced by patient factors .
we investigated how currently endorsed performance measures for glycemic control in diabetes may be influenced by case mix composition .
we assessed differences in a1c performance measure threshold attainment by case mix factors for a1c > 9% and examined how lowering the threshold to a1c > 8% or > 7% changed these differences.research design and methods using data from the 19992002 national health and nutrition examination survey for 843 adults self - reporting diabetes , we computed the mean difference in a1c threshold attainment of > 9 , > 8 , and > 7% by various case mix factors .
the mean difference is the average percentage point difference in threshold attainment for population groups compared with that for the overall population.resultsdiabetes medication was the only factor for which the difference in threshold attainment increased at lower thresholds , with mean differences of 5.7 percentage points at a1c > 9% ( reference ) , 10.1 percentage points at a1c > 8% ( p < 0.05 ) , and 14.1 percentage points at a1c >
7% ( p < 0.001).conclusions as 87% of u.s .
adults have a1c < 9% , a performance measure threshold of > 9% will not drive major improvements in glycemic control .
lower thresholds do not exacerbate differences in threshold attainment for most factors .
reporting by diabetes medication use may compensate for heterogeneous case mix when a performance measure threshold of a1c > 8% or lower is used . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: influenza a ( flu a ) viruses belong to the orthomyxoviridae family of rna viruses and are the causative agent of influenza , a contagious respiratory viral disease of birds and humans . they possess a negative - sense viral rna genome packed into 8 individual gene segments which code for at least 11 functional proteins needed for infection , replication , and evasion of antiviral responses .
however , recent studies suggest that there could be more viral protein products depending on the virus strain .
flu a viruses can be further subdivided into distinct subtypes based on the genetic and antigenic properties of their hemagglutinin ( ha ) and neuraminidase ( na ) , the envelope glycoproteins express on the surface of virus particles responsible for virus binding to relevant hosts and releasing of newly formed infectious virions , respectively .
sixteen ha and 9 na subtypes have been detected in wild aquatic birds and poultry throughout the world while new strains ( h17 - 18 and n10 - 11 ) have been additionally identified in bat species .
generally , flu a viruses are found in migratory waterfowls , the principal natural reservoirs .
part of their genetic variability is due to the absence of a proof - reading mechanism of the flu a viral rna polymerase leading to faulty replication cycles .
similarly , the segmented nature of the rna genome is also fundamental to the genetic evolution of flu a viruses .
co - infection of a single host with two or more viruses facilitates genetic reassortment , the rearrangement of genetic material by the exchanging of gene segments , creating progeny viruses with novel gene constellation one of which may have the ability to infect new hosts .
thus , even if they are generally host - specific and not readily transmissible to other species , a wide array of flu a viruses have been found in other animals which include sea mammals , domestic poultry , horses , dogs , pigs , and people
. moreover , flu a viruses are responsible for the annual global influenza epidemics and occasional pandemics in human populations . in recent years ,
number of flu a viruses crossing the animal - human host species barrier have been increasing . this article provides a general overview of these zoonotic infections and the constant threat of a looming pandemic .
avian influenza viruses ( aivs ) recognize specific sialic acid receptors of susceptible cells lining the intestinal gut of avian hosts .
however , specific modifications in ha through adaptation shifts receptor recognition , which in turn effectively switches binding preferences to specific receptors expressed by mammalian hosts , including humans . further genetic alterations at the ha cleavage motif of some subtypes ( e.g. , h5 and h7 ) could make ha readily cleaved by ubiquitous cellular proteases .
accumulation of polybasic residues on this site , typically seen among highly pathogenic avian influenza ( hpai ) h5 and h7 viruses , promotes efficient biological activation facilitating growth in various organs outside the respiratory tract .
other viral factors are also found in the remaining gene segments which altogether promote propagation at different temperatures , efficient replication of the viral genome , attenuation of host immune responses , and resistance to antiviral drugs .
collectively , these features account for the virulence , expansion of host range , and interspecies transmission of aivs .
various aiv subtypes have occasionally crossed the animal - human interface commonly occurring after close contact to infected birds ( table 1 ) .
of note , humans also possess aiv - susceptible cells in the lower respiratory tract ( e.g. , lungs ) apart from mammalian - specific receptors ; such receptors are not expressed by upper respiratory tract tissues ( e.g. , nasal passages and trachea ) .
thus , it is not surprising that extensive or prolonged exposure to affected poultry increases the chances of interspecies transmission . among the vast pool of aivs in nature ,
hpai a / h5n1 viruses have been considered to present the greatest concern to cause the next flu pandemic ( table 1 ) . since its first appearance in guangdong , china in 1996
, it has already spawned various clusters of antigenically divergent hpai h5 lineages that spread widely in asia towards europe and africa , causing devastating poultry outbreaks along its path . in humans , more than 640 hpai a / h5n1 infections
worldwide have been recorded since 1997 by the world health organization wherein about 60% were fatal .
aberrant innate immune responses have been shown to be a hallmark of the atypical virulence of the hpai a / h5n1 virus that results in the high incidence of mortality . in 2014 alone , new cases have been already reported in asia with vietnam and cambodia recording fatalities for the year .
the first imported case in north america was also recently confirmed in a resident of alberta , canada who returned from beijing , china in december 27 , 2013 , was hospitalized , and died after few days due to viral infection . at present
, there are no imminent indications that contemporary hpai a / h5n1 viruses have the capacity to support efficient viral transmission in humans .
however , two independent studies have simultaneously demonstrated how few changes in the hpai a / h5n1 viral genome could confer airborne transmission between mammals . human infection with a / h9n2 aivs
retrospectively , it was postulated that the hpai a / h5n1 virus , which caused the 1997 human outbreaks also in hong kong , acquired most of its gene segments from avian a / h9n2 subtypes that were circulating in 1997 .
sporadic cases of aiv a / h9n2 zoonoses followed ever since with at least 16 human total infections as shown in the influenza virus sequence database ( http://www.ncbi.nlm.nih.gov/genomes/flu/flu.html ) , including a recent hong kong case in late december 2013 , the first in four years .
serologic studies also showed that some poultry workers in china and india were positive for a / h9n2 virus infection through ha inhibition and virus micro - neutralization assays .
notably , avian a / h9n2 infections only induced relatively milder clinical disease with no mortality in contrast to its more virulent hpai a / h5n1 cousin . prior to 1996 ,
human infections with the h7 aiv subtype have been primarily due to laboratory or occupational exposures .
direct avian - to - human transmission of a low pathogenic avian influenza ( lpai ) a / h7n7 was first confirmed in 1996 on an english woman while tending to her apparently infected pet ducks . in 2002 ,
lpai a / h7n2 virus was detected in virginia and isolated in an immunocompromised new york resident ; this subtype was also found among poultry workers in wales , england .
similarly , an lpai a / h7n3 was recovered from a poultry attendant in the uk whereas retrospective serologic analysis of workers who responded during the 2002 - 2003 h7n3 italian poultry outbreak identified 7 persons seropositive .
in contrast to these lpai h7 strains , hpai a / h7n3 variants were responsible for zoonotic infections among poultry workers in british columbia , canada and jialisco , mexico . before 2013 , the largest human h7 outbreak occurred in the netherlands caused by an hpai a / h7n7 tallying over 80 cases including one fatality .
up to that point , all of the h7 patients have only presented generally mild respiratory disease commonly accompanied by conjunctivitis , except for the united states cases . however , pathobiology of h7 aivs changed when human cases caused by an a / h7n9 virus emerged since late march 2013 killing a quarter of those infected .
unlike its a / h5n1 and a / h9n2 relatives , a / h7n9 does not induce remarkable influenza - like disease signs in afflicted poultry albeit efficient replication .
the pathogen , a product of multiple reassortment between strains found in migratory birds and prevailing a / h9n2 viruses in chinese poultry , does not contain the pathotypic ha cleavage motif but show indications that it can infect and replicate well in mammalian species . as of writing , more than 350 cases have been confirmed with over 70 casualties mostly from mainland china .
imported cases in hong kong , taiwan and a chinese visitor in malaysia are the only other reports outside the chinese territory , indicating that it hasn't yet gone global dissemination .
notably though , human infections with a / h7n9 viruses have been characterized by rapid progression to severe pulmonary disease and acute respiratory distress syndrome , reminiscent of human hpai a / h5n1 disease .
the scale of these zoonotic infections also highlights the need for enhanced surveillance in neighboring countries .
the geographic location of south korea puts it well within the east asian flyway of migratory waterfowls .
in addition , exchange of tourists between china and korea are constantly growing due to close proximity and improved air travel .
thus , a / h7n9 could be carried over by infected migratory wild birds and/or human traveler / visitors as what happened in the imported case of malaysia .
apart from the more popular strains above , h6 and h10 aiv infections have been also recorded . in may 2013 , the first human case of a / h6n1 aiv infection was reported .
the woman patient , who in worked in a deli shop and has not visited or had any contact with poultry , was hospitalized after developing high fever , cough and shortness of breath , but fully recovered upon early medication .
occurrences of a / h10n7 infections were also separately recorded in egypt and australia . although those patients had minor symptoms and eventually recovered , two of three a / h10n8 aiv infections in china since december 2013 succumbed to death due to infection . like its a / h7n9 predecessor ,
a / h10n8 does not cause remarkable disease in birds and harbor segments from a / h9n2 virus segments in chinese poultry .
with the inherent capacity of flu a viruses to evolve and adapt , it is only a matter of time before novel aiv variants capable of sustaining person - to - person transmission arise .
the role of pigs as a focal point in the generation of novel flu a viruses with pandemic potential has been constantly highlighted .
the presence of mixed populations of sialic acid viral receptors that line the pig respiratory tract epithelia make pigs susceptible to avian and human flu strains , apart from their own viruses .
hence , infection of pigs with aivs could facilitate adaptation to mammalian hosts particularly humans via accumulation of adaptive mutations ( fig .
meanwhile , simultaneous infection of a pig with at least two viruses from different sources and lineage could promote genetic reassortment . through natural and experimental conditions ,
some of the notable aivs mentioned above have the capacity to infect and become established in swine populations .
although domestic pigs appear to have low susceptibility , hpai a / h5n1 viruses have been isolated from pig herds in china and indonesia .
serologic exposure to hpai a / h5n1 viruses was also detected in asymptomatic pigs in vietnam . since 1998
, several a / h9n2 viruses have been also isolated from pigs in hong kong and other provinces of china .
somehow , a more recent study predicted that a / h9n2 viruses may have become endemic among domestic pigs .
variants of the a / h7n9 virus have been also shown to productively infect pigs in experimental settings but were unable to transmit to other animals .
it is also noteworthy that the internal gene constellations of the newly emergent a / h7n9 and a / h10n8 viruses contain corresponding segments from a / h9n2 virus subtypes prevailing in chinese poultry . given the general reputation of pigs with regards to virus ecology and evolution , their role in the genesis in either or both of these aivs that are making ripples for pandemic concerns can not be ruled out .
regardless , introduction of these aivs in swine populations could provide alternative means to hasten genetic evolution ( fig .
vaccination remains the most effective countermeasure against the spread of novel and potentially pandemic flu a viruses .
for the past decade , several vaccine strategies and preparations for humans have been developed and are being tested ranging from inactivated , live - attenuated , recombinant protein - based , virus - like particles to dna - based and adenovirus - vectored vaccines . since the world 's population is expected to have no pre - existing immunity against a / h5n1 strains , the use of efficacious and safe adjuvants to maximize vaccine coverage is also being considered and evaluated .
there are also increasing efforts in developing universal vaccines that target conserved domains of various viral proteins . acknowledging the probability of a future a / h5n1 pandemic , the world health organization global influenza programme for its part has recommended the development of representative pre - pandemic h5n1 vaccine candidate viruses that represent antigenically and genetically distinct h5 strains , particularly those that have infected humans through contact with ill or dead infected birds , for stockpiling .
such pre - pandemic vaccines have been prepared by reverse genetics , and safety tested prior to distribution for pilot vaccine production that may be used for experimental studies and for stockpiling . because a / h7n9 infection of humans is very rare , it is not surprising to find that no pre - existing immunity was detected against the a / h7n9 virus in any of the age groups tested in serologic assays .
apparently , receipt of current seasonal human flu vaccines did not also induce detectable cross - reactive antibodies suggesting that even current seasonal vaccination will not afford protection . in a more promising note
though , few groups have shown that some h7-specific vaccine preparations , developed by applying strategies learned from the h5 and 2009 pandemic vaccine development efforts , could offer protection from a / h7n9 virus challenge in animal models .
although pre - pandemic h5 and h7 vaccines are in the pipeline for development , there is also a dire need for other subtype - specific candidate vaccines ( e.g. , h6 , h9 , and h10 ) .
furthermore , strategies that can augment vaccine coverage will be invaluable in the event of a pandemic to meet global demands .
antiviral drugs provide an important alternative public health intervention for preventing and treating influenza when a vaccine is not available .
currently , two major classes of anti - flu drugs are available which inhibit the release of infectious viruses ( na inhibitors ) and block the matrix protein 2 ion - channel ( adamantane derivatives ) , respectively . however , given the plasticity of the flu a viral genome , the emergence of drug - resistant strains against these classes of prophylactic agents could arise . apart from that ,
notably , emerging variants of the human - infecting a / h7n9 virus already gained na inhibitor resistance without losing their viability and pathogenicity . altogether ,
these underscore the need for the development of new antiviral drugs and other novel preventive and therapeutic measures .
at present , none of the zoonotic aivs above indicated efficient human - to - human dissemination beyond index cases . however , the growing number of cases sparks continuing worries that they could eventually evolve into variants that will cause global concern .
recent evidence suggest that after the initial outbreaks , the human - infecting flu a ( h7n9 ) and local avian a / h9n2 strains had undergone further reassortment which may be responsible for the sudden increase in human cases in early 2014 .
it should be noted that hpai a / h5n1 took about five years to attain the number of cases a / h7n9 is currently racking up .
such impressive disease burden catapults a / h7n9 alongside hpai a / h5n1 , if not ahead , as the next potential human pandemic contender . unlike hpai a / h5n1 viruses which cause massive die - offs in affected poultries , a / h7n9 and a / h10n8 do not induce noticeable clinical disease indicators
. such feature would make virus tracking and surveillance more difficult and challenging . in another light ,
the constant inclusion of a / h9n2 viral components into the zoonotic a / h5n1 , a / h7n9 , and a / h10n8 strains raises the question whether a / h9n2 viruses predominantly circulating in chinese poultry could have adapted to support human infections when mixed with the right combination of segments ( e.g. , ha and na ) .
overall , these zoonotic transmissions validate the potential of aivs to cause the next human pandemic . with the continued circulation of these viruses ,
the generation of more virulent and human - transmissible variants , however remote at the moment , remains a possibility given the right conditions and appropriate hosts .
hence , these concerns collectively call for continued virus monitoring and surveillance in humans and animal populations alike , worldwide . coupled with virus characterization and pathobiologic assessment
, these will help identify which strains we should be particularly worried about and set focus on in the future .
finally , the recent incursions of variant flu strains in humans , apart from h5 and h7 viruses , also require the need for appropriate virus - specific or efficacious universal vaccines that can induce broad cross - protective responses which can be made available and administered in the event of or even before a pandemic happens . | ### Summary:
: various direct avian - to - human transmissions of influenza a virus subtypes upon exposure to infected poultry have been previously observed in the past decades .
although some of these strains caused lethal infections , the lack of sustained person - to - person transmission has been the major factor that prevented these viruses from causing new pandemics . in 2013 , three ( a / h7n9 , a / h6n1 , and a / h10n8 ) novel avian influenza viruses ( aivs ) yet again breached the animal - human host species barrier in asia .
notably , roughly 20% of the a / h7n9-infected patients succumbed to the zoonotic infection whereas two of three a / h10n8 human infections were also lethal .
thus , these events revived the concerns of potential pandemic threats by aivs in the horizon .
this article reviews the various human incursions with aiv variants and provides insight on how continued circulation of these viruses poses perpetual challenge to global public health . as the world anticipates for the next human pandemic , constant vigilance for newly emerging viruses in nature
is highly encouraged . with the various numbers of aivs demonstrating their capacity to breach the animal - human host interface and apparent limitations of current antivirals
, there is a need to broaden the selection of pre - pandemic vaccine candidate viruses and development of novel alternative therapeutic strategies . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: primary angle closure glaucoma ( pacg ) is one of the leading causes of visual loss in asians [ 13 ] .
previous studies have reported the several anatomical features of the eyes with pacg including short axial length and shallow anterior chamber [ 47 ] . in the past ,
gonioscopic examination is still the reference standard for primary angle closure ( pac ) diagnosis , but recent advances in imaging devices have allowed various anterior segment ( as ) parameters to be measured . as optical coherence tomography ( as - oct )
quantitatively measures as parameters using a noncontact method with the subject in a sitting position [ 8 , 9 ] . among the several as parameters ,
wang et al . reported that iris curvature ( ic ) , iris area ( ia ) , and iris thickness ( it ) are independently associated with the existence of a narrow angle [ 10 , 11 ] .
furthermore , in several recent papers the peripheral iris thickness was reported as an important predictor of the successful outcome of laser peripheral iridotomy ( lpi ) [ 12 , 13 ] .
the area of the peripheral iris insertion into the ciliary body is very close to the trabecular meshwork , and , thus , characteristics of iris insertion may affect the configuration of the anterior chamber angle and the amount of pupillary block .
lpi is performed to open the closed anterior chamber angle by resolving the pupillary block in pac eyes .
hence , we intended to evaluate whether the effect of lpi is different in subgroups of pac based on iris insertion configuration using as - oct images .
pac suspect ( pacs ) or pac patients who visited the glaucoma clinic of asan medical center , seoul , korea , were seen by a single glaucoma specialist ( kyung rim sung ) and met the inclusion criteria below which were consecutively included in this study based on a medical record review .
the study was approved by the institutional review board of asan medical center and followed the tenets of the declaration of helsinki .
all participants underwent a complete ophthalmic examination , including a review of their medical history , measurement of best - corrected visual acuity ( bcva ) , slit - lamp biomicroscopy , goldmann applanation tonometry , gonioscopy , fundoscopic examination using a 90- or 78-diopter lens , stereoscopic optic disc photography , retinal nerve fiber layer photography , a visual field ( vf ) test ( humphrey field analyzer , swedish interactive threshold algorithm ( sita ) 24 - 2 ; carl zeiss meditec , dublin , ca ) , cirrus hd - oct ( carl zeiss meditec ) , and as - oct ( visante oct , carl zeiss meditec ) .
eyes with appositional contact between the peripheral iris and the posterior trabecular meshwork of greater than 270 were included in the pacs group .
eyes with an occludable angle and exhibiting features indicating trabecular obstruction by the peripheral iris were considered to have pac .
pac was considered present when an eye had an occludable angle ( appositional contact between the peripheral iris and the posterior trabecular meshwork of > 270 ) and exhibited features indicative of trabecular obstruction by the peripheral iris , such as elevated intraocular pressure ( iop ) , iris whorling ( distortion of radially orientated iris fibers ) , glaukomflecken lens opacity , or excessive pigment deposition on the trabecular surface , but without the development of a glaucomatous optic disc or any vf change .
we combined both pacs and pac eyes and defined them as having angle closure for our current analysis in particular . only reliable vf test results ( false - positive errors < 15% , false - negative errors < 15% , and fixation loss < 20% ) were included in the analysis .
eyes with peripheral anterior synechiae ( pas ) in anterior chamber ( ac ) angle were excluded .
we excluded patients with a history or current use of topical or systemic medications ( antihistamines , antiepileptics , antiparkinsonian agents , antispasmolytic drugs , mydriatic agents , and sympathetic agents ) that could affect the angle or the pupillary reflex ; those with a history of previous intraocular surgery ( including cataract surgery , laser trabeculoplasty , laser iridoplasty , and laser iridotomy ) ; and those unable to fixate prior to the as - oct examination . among the abovementioned criteria for pac ,
patients with a history of acute pac , defined by the presence of ocular or periocular pain , nausea , or vomiting , and a history of intermittent blurring of vision with haloes ; an intraocular pressure ( iop ) > 30 mmhg ; and the presence of at least three of the following : conjunctival injection , corneal epithelial edema , middilated unreactive pupil , and shallow ac , were also excluded .
eyes diagnosed with secondary angle closure , such as those with neovascular or uveitic glaucoma , were also excluded .
all eyes were newly diagnosed cases , and as - oct imaging was performed before starting any glaucoma medication , laser treatment , or intraocular surgery . prior to as - oct imaging , all patients underwent a slit - lamp examination and gonioscopy , conducted by an independent observer ( kyung rim sung ) who has extensive experience in the performance of such examinations .
all eyes were examined using a sussman lens in a darkened room ( 0.5 cd / m ) .
both static gonioscopy and dynamic gonioscopy were performed using a sussman lens with the eye in the primary gaze position .
indentation gonioscopy was performed to determine whether angle closure was attributable to apposition or to pas .
care was taken to ensure that light did not fall on the pupil during the examinations .
all participants were imaged in terms of the nasal and temporal angle ( 0180 ) using as - oct ( visante oct , version 2.0 ; carl zeiss meditec ) operating in the enhanced as single mode ( scan length 16 mm ; 256 a - scans ) . to confirm the consistency of the iris root insertion according to the pupillary reaction ,
four sessions using four different standardized lighting conditions ( 3.25 , 100.8 , 426 , and 1420 cd / m ) , grading from dark to light , was performed by a single well - trained operator . the room in which as - oct imaging was performed had four - graded lighting controlled by four - leveled switches .
participants were asked to sit back after imaging and wait for 30 seconds , during which the lighting conditions were changed .
thus , four images , obtained under four different lighting conditions , were obtained from each participant . among the four images obtained in each session , the images obtained at 3.25 cd
were evaluated by an independent examiner ( ji wook hong ) who was blind to all other test results and the clinical information for the participants .
anterior chamber depth ( acd ) was defined as the distance from the corneal endothelium to the anterior surface of the lens .
the scleral spur was defined as the point at which a change in curvature of the inner surface of the angle wall became apparent and often presented as an inward protrusion of the sclera .
after determination of the scleral spur location , iris thickness 750 m from the scleral spur ( it750 ) was measured .
iris area ( ia ) was defined as the cross - sectional area of the iris .
anterior chamber area ( aa ) was defined as the cross - sectional area bordered at the corneal endothelium and anterior surface of the lens and iris .
iris curvature ( ic ) was defined as the maximum perpendicular distance between the iris pigment epithelium and a line connecting the most peripheral to the most central point of the epithelium .
the lens vault ( lv ) was defined as the perpendicular distance between the anterior pole of the crystalline lens and a horizontal line joining the two scleral spurs .
angle opening distances ( aod750 ) which were defined as the linear distance between the point of the inner corneoscleral wall ( 750 m anterior to the scleral spur ) and the iris , were also assessed .
the corners of the triangle were the angle recess ( the apex ) , the iris surface , and the inner corneoscleral wall .
tisa750 was defined as the trapezoidal area with the following boundaries : anteriorly , the aod750 ; posteriorly , a line drawn from the scleral spur perpendicular to the plane of the inner scleral wall to the opposing iris ; superiorly , the inner corneoscleral wall ; and , inferiorly , the iris surface .
measurement variability of the parameters was checked prior to the full analysis by calculating the intraclass correlation coefficients ( iccs ) .
the image acquisition procedure and analysis methods have been previously described in detail [ 2022 ] .
all parameters except for acd , lv , aa , and pupillary distance ( pd ) were measured on both nasal and temporal sides and the average of the two values was used for analysis .
iris root insertion configuration was independently assessed by two glaucoma experts ( kyung rim sung and jin young lee ) who were blind to other as - oct parameters and all other test results including the clinical information of the participants .
iris root insertion was categorized into two groups , a nonbasal group ( nbg ) and a basal insertion group ( bg ) , according to the presence of a space between scleral spur and iris root ( figure 2 ) .
if the opinions of the two observers differed , the eye in question was excluded .
lpi was performed in the superior region of the iris ( from 10 to 2 o'clock ) by sequential argon and neodymium - yttrium - aluminum - garnet laser after pretreatment with 2% pilocarpine instilled into the eye one hour before the lpi .
the power settings used were 5001000 mw with a spot size of 50 m for a duration of 0.05 seconds with the argon laser and 25 mj with the yttrium - aluminum - garnet laser .
topical medications that could affect the angle measurement were not prescribed at the post - lpi .
the wilk - shapiro test was used to explore the distribution of the numerical data .
an unpaired student 's t - test was used for comparisons between nbg and bg of age , baseline iop , spherical equivalent ( se ) , cirrus hd oct measured retinal nerve fiber layer ( rnfl ) thickness , and pd .
we used a mixed - effects regression to calculate the pre - post as - oct parameter 's mean difference and relative mean difference , the latter defined by ( preparameter postparameter)/preparameter 100 . for each outcome
we also calculated pre - post outcome change adjusted for age , gender , se , pd , and the pre - post pd difference .
exploratory analyses of the residuals suggested that the chosen models were appropriate for all parameters .
univariate and multivariate regression analysis was performed to evaluate the factors associated with ac angle narrowing in each group .
variables with a probability value 0.20 in univariate analyses were included in the multivariate analysis .
reported p - values were two - sided , and a value of p < 0.05 was considered statistically significant . sas software , version 9.2 ( sas institute , inc .
, cary , nc ) and spss version 15.0 ( spss inc . , chicago , il ) , was used for the statistical analyses .
ninety - two pac ( 60 ) or pacs subjects ( 32 ) were imaged and subcategorized as nbg ( 39 eyes ) or bg ( 53 eyes ) .
three eyes were excluded due to different opinions between graders regarding the assessment as - oct image .
there was a significant difference in age between the groups , with nbg subjects being older ( 62.7 5.7 versus 59.8 7.3 years , p = 0.043 ) .
nbg eyes were more hyperopic ( 1.29 1.17 versus 0.813 1.00 diopter , p = 0.039 ) .
the baseline iop was marginally higher in bg eyes ( 16.6 5.2 versus 14.8 3.4 mmhg , p = 0.063 ) .
the average rnfl thickness and vf mean deviation were not different between the two groups .
the demographic features and baseline status of the study subjects are listed in table 1 .
the mean differences of the as - oct parameters obtained at pre- and post - lpi were not significantly different between the bg and nbg eyes .
in addition , there were no differences in the percentage changes in any parameter between the two groups after lpi ( table 2 ) . in both groups ,
aod750 was affected by acd ( nbg ; p < 0.001 , bg ; p = 0.044 ) before lpi ( tables 3 and 4 ) .
however , anatomical factors affecting the aod750 did show a difference between the two groups after lpi .
aod750 was affected by lv ( p = 0.012 ) in nbg ( table 5 ) but by acd ( p < 0.001 ) and it750 ( p = 0.039 ) in bg after lpi ( table 6 ) .
recent studies of anterior chamber parameters obtained by as - oct have led to the identification of several novel anatomic risk factors for angle closure , such as increased iris thickness and area , greater lens vault , and smaller anterior chamber width [ 10 , 11 , 19 , 23 ] . moreover
, physical variations of the iris and ciliary body structures may play a role in the development of angle closure .
it is conceivable that basal iris insertion contributes to angle crowding more than nonbasal insertion and , thus , predisposes an eye with crowded anterior chamber characteristics ( such as a short axial length [ 24 , 25 ] , smaller anterior chamber width , or greater lens vault ) to pupillary block and subsequent pac . in our current study
, we aimed to categorize pac eyes according to the configuration of iris insertion into the ciliary body and to analyze whether the effect of the lpi is different in pac subgroups based on iris insertion . also , we investigated anatomic risk factors for angle closure in such subgroups based on iris insertion characteristics .
iris insertion was categorized in our study into two groups , nbg and bg , according to the presence of a space between the scleral spur and the peripheral side of the basal iris .
nbg and bg subjects had some different features ; that is , nbg cases were older and hyperopic .
interestingly , the mean change after an lpi was not significantly different between our two groups in any as - oct parameter , nor did the percentage changes differ between the two groups in any parameter . in other words , pupillary block is considered to exist in both groups , and thus the effect of pupillary block on angle closure might not be different between the two groups , since lpi was expected to resolve the pupillary block .
additionally , factors that affect the angle narrowing were rather similar in the two groups prior to the lpi , showing that acd was the most important factor for angle narrowing .
however , factors affecting angle narrowing were different between the two groups after the lpi . in the nbg cases ,
a greater lv was associated with angle narrowing while a thicker peripheral iris was associated with the bg .
aging is reported to significantly increase lv , and a higher lv may play an important role in the mechanism of angle closure .
this effect may result from the induction of the forward movement of the lens due to zonular laxity or increases in lens thickness , which can cause an elevated lv .
also , increased lv can directly induce narrowing of the peripheral angle or increase pupillary block by expanding iridolenticular contact .
a thicker peripheral iris was found to be associated with a narrow angle in the bg eyes after a resolution of the pupillary block , indicating that this would contribute to angle crowding in these cases .
a thicker peripheral iris is likely to contribute to angle closure , because the peripheral iris would be in closer proximity to the angle .
this finding supports the concept that increased thickness and bulk of the iris root anterior to the plane of the scleral spur push the peripheral iris against the trabecular meshwork , thereby worsening angle crowding in an already predisposed eye .
the outcomes of lpi differed between angle closure subgroups with different anatomical characteristics , suggesting that the pathogenic mechanism of angle closure may differ among subgroups . in previous studies ,
a considerable portion of the pac eyes analyzed showed a closed angle despite a successful lpi , and those eyes that underwent lpi showed progressive narrowing afterwards [ 22 , 25 , 27 ] .
hence , predicting which factor is more important in the development of angle closure in specific eyes would be beneficial .
our current results may provide some clue that the contributing factors may be different according to the iris insertion configurations .
first , although two experienced clinicians qualitatively graded iris insertion and peripheral iris configuration , subjective identification of anatomic landmarks could lead to inaccurate determination of reference points and may result in misclassification .
however , we tried to minimize the variability by using standard photographs for comparison and to create a consensus between the two graders . in a dilated state ,
the iris root insertion was not differentiated in some eyes , so we acquired 4 serial images with different lighting conditions and reviewed all 4 images to determine the location of the iris root insertion . by performing image acquisitions at 4 light levels , we believe that we reduced the possibility of misclassification .
second , as - oct images have a limited resolution and some features such as the position of the ciliary processes and iris angulation are thus difficult to identify with this modality . in this context , ultrasound biomicroscopy ( ubm ) offers better imagery , and several previous publications have nicely categorized pac using ubm [ 2729 ] .
those studies categorized iris insertion configurations into three categories ( apical , mid , and basal configuration ) . since as - oct does not show the whole feature of the ciliary body , discerning an apical versus mid insertion was difficult .
finally , the relatively small sample size we used may have affected our ability to detect subtle differences in the as - oct parameters .
our current findings indicate that the outcome of the lpi shows no significant difference between angle closure subgroups classified according to the iris root insertion into the ciliary body . however , anatomical factors affecting the aod750 do show a difference between these two subgroups after lpi .
this suggests that identification of the iris insertion may provide some clues to further understanding the anatomical factors that contribute to angle closure after lpi . | ### Summary:
: purpose . to investigate the effect of laser peripheral iridotomy ( lpi ) in subgroups of primary angle closure based on iris insertion configuration
. methods .
anterior segment optical coherence tomography ( as - oct ) images were obtained before and two weeks after lpi . qualitative classification of angle closure eyes according to iris insertion ( basal insertion group ( bg ) and nonbasal insertion group ( nbg ) ) was performed .
anterior chamber depth ( acd ) , lens vault ( lv ) , iris curvature , iris area , iris thickness ( it750 ) , and angle opening distance ( aod750 ) 750 microns from scleral spur were calculated .
uni- and multivariate regression analysis was carried out to evaluate factors associated with aod750 before and after lpi .
results .
ninety - two eyes of 92 subjects were categorized as nbg ( 39 eyes ) or bg ( 53 eyes ) . the mean change after lpi was not significantly different between two groups in all parameters . in both groups ,
aod750 was affected by acd ( p < 0.001 , p = 0.044 ) before lpi .
aod750 was affected by lv ( p = 0.012 ) in nbg , but by acd ( p < 0.001 ) and it750 ( p = 0.039 ) in bg after lpi .
conclusions .
the outcomes of lpi are not significantly different between angle closure subgroups with different iris insertions .
however , factors affecting aod750 show differences between two subgroups after lpi . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: mdmaassisted psychotherapy employs single doses , administered under continuous medical supervision on two to three occasions a month apart .
drug administration is preceded by preparatory sessions and followed by psychotherapy sessions supporting integration of therapeutic changes into daily life ( figure
1 ) .
mdma was placed in schedule 1 by the drug enforcement administration ( dea ) in 1985 on the basis of widespread nonmedical use and concerns of abuse potential , despite a schedule 3 recommendation by an administrative law judge .
the results indicate promising therapeutic applications , but mdma remains in schedule 1 , defined as having no accepted medical use , high abuse potential , and lack of accepted safety .
data from phase ii randomized controlled trials ( rcts ) exploring mdmaassisted psychotherapy were submitted to the fda as initial indications of safety and efficacy .
these studies build on published case reports on clinical use of mdma prior to dea scheduling.1 completion of successful phase iii trials is the remaining requirement for fda approval of mdma as a therapeutic agent .
an array of chronic psychiatric disorders share a common core of intractable symptoms that respond favorably to mdmaassisted psychotherapy , which has been studied in clinical trials treating ptsd , anxiety associated with lifethreatening illness , and social anxiety in autistic adults.2 these studies demonstrate the success of careful approaches to therapeutic set and setting designed to minimize adverse events and maximize benefits with minimal targeted exposure to drug .
all recent mdmaassisted psychotherapy registration studies are rcts , meeting rigorous standards for drug development regulated by the fda and overseen by institutional review boards ( irbs ) .
furthermore , due to the schedule 1 status of mdma , compliance with dea and statelevel controlled substance review committees is required , placing these studies in the most regulated area of drug development , and introducing a disincentive to potential researchers .
researchers who are willing to take on the challenge of managing compliance with this complex oversight often only do so because of the potential to relieve suffering that has not responded to existing established treatments , and the hope of providing the field of psychiatry with methods of effectively combining psychopharmacology with psychotherapy in a patientcentered approach that respects and fosters the innate healing capacity of the individual .
mdma potentiates the release of monoamines through reversal of transporter proteins and reuptake inhibition , with the greatest effects on serotonin and norepinephrine.3 effects on dopamine release , secondary to serotonin release , are dose and speciesdependent , with less dopamine involvement in humans.3 downstream targets include 2adrenergic and serotonin receptors .
serotonergic signaling triggers a cascade of oxytocin , vasopressin , prolactin , and corticosteroids.2 , 3 , 4 mdma also modulates glucocorticoids through the hypothalamic pituitary
adrenal ( hpa ) axis,4 which may have important implications for ptsd treatment , as glucocorticoid hypersensitivity and hpa axis dysregulation are hallmarks of ptsd .
mdma decreases amygdalar and hippocampal activity , and increases prefrontal cortex activity , correlating with subjective effects.2 in a mouse ptsd model , mdma administered before training facilitated fear extinction learning , dependent on brain derived neurotrophic factor ( bdnf ) expression in the amygdala.1 recovery from ptsd and extinction learning is dependent on bdnf , which regulates memory reconsolidation after recall in the amygdala
hippocampus circuit.1 these neurobiological effects are not specific to ptsd , as reduced emotional impact of fear memories was corroborated in healthy volunteer imaging studies,2 and bdnf elevations were also observed in recreational mdma users .
mdma promotes neuroplasticity through bdnf and regulates the hpa axis , improving functional outcomes through effects on learning and memory , which are reinforced in the context of psychotherapy . in mdma studies , participants report improved selfknowledge , sleep regulation , accuracy in perceiving mental states of others , coping strategies , emotion regulation , and cognitive insights.3 objective measures support attenuated impact of social rejection and reduced amygdalar response to angry or fearful faces.3 these changes provide insight into potential indications for mdmaassisted psychotherapy , which may enhance secure attachment and engagement of cognitive and positive valence systems , with corresponding reduction in negative valence .
mdmaassisted psychotherapy could be useful in the treatment of disorders associated with attachment insecurities , including ptsd , depression , anxiety disorders , obsessivecompulsive disorder , suicidality , substance use disorders , and eating disorders.5 in phase ii ptsd studies , 2 months after two to three activedose mdma treatments , 55% of chronic ptsd subjects no longer met the ptsd diagnostic criteria ( n = 100 ) and 66.2% were in remission at least 12 months postdrug ( n = 65 ) .
clinical effects are rapidonset but not rapid offset , with durable treatment outcomes reported long after mdma had been eliminated from the body . outcomes of mdma use are contextdependent , as seen by elevations in bdnf in both recreational settings and fear extinction studies , as well as phase ii trial results . while it is true that mdma has moderate abuse potential and
has seen widespread use in nonmedical settings , studies have shown this is selflimiting and typically ceases when life circumstances change , suggesting selfmedication or intentional selfexploration as probable motivations for use .
neuroplasticity triggered by bdnf supports the beneficial effects of mdma in a treatment context , similar to other medicationassisted therapies for treatment of substance use disorders .
consistent with this concept , an upcoming study of mdmaassisted psychotherapy is planned for treatment of alcoholism .
these observations , as well as current phase ii results , support utilizing mdma as a probe of social behavior and the psychopathology of fear , depression , stress , and anxiety .
following promising results from multiple fda and deaapproved phase ii studies of mdmaassisted psychotherapy for ptsd , permission has been requested for a phase iii program .
these trials utilize a goldstandard objective primary outcome measure and incorporate secondary exploratory measures to better assess benefit in complex clinical cases .
several measures of depression , anxiety , and ptsd are recognized by the fda , and development of improved objective functional outcome measures is ongoing .
recently , the european medicines agency ( ema ) revised its opinion on rcts , advising activecontrolled trials rather than placebocontrolled , justifying approvals based on added value rather than absolute superiority .
provided trials are randomized and outcomes are assessed by an objective centralized group , and bias can be effectively minimized . in line with fda recommendations , proposed phase iii
success criteria for mdmaassisted psychotherapy include statistical superiority over psychotherapy with placebo in reducing ptsd symptoms as assessed objectively by a blinded centralized independent rater group at 2month followup . unlike most fdaapproved drugs that require a chronic daily dosing regimen for efficacy , with maintenance treatment required to prevent relapse , mdma is administered as two to three singledose treatments , frequently with a strong response after the first session .
in contrast to maintenance dosing , which can place significant burden on metabolic pathways and increase potential adverse effects , singledose treatments have a more favorable risk / benefit profile . therefore , singledose toxicity studies with assessments for delayed toxicity and reversibility after washout appear more appropriate than repeateddose toxicology studies .
likewise , prepostnatal development studies with daily dosing covering development up to sexual maturity , currently required in all countries to support marketing approval , may be beyond the scope of what should be required to demonstrate safety of singledose treatments .
this is especially true if highly effective methods of birth control and a negative pregnancy test just prior to each treatment continue to be required postapproval . in cases of unmet medical need
, the fda has provided special programs with accelerated pathways for approval that may apply to mdma , as effect size estimates for ptsd are large , relapse rates are low , and administration under strictly controlled conditions improves compliance over available treatments . in addition , risk evaluation mitigation strategies ( rems ) will allow sponsor oversight of certification of treatment providers , to assure that they have the necessary experience and qualifications to administer mdmaassisted psychotherapy .
appropriate mechanisms to prevent abuse and diversion will likely preclude takehome prescriptions , and may involve restricting use to licensed clinics .
based on coadministration studies with psychiatric medications typically prescribed , mdmaassisted psychotherapy is unlikely to cause safety concerns within an integrated medication management model , but washout of other medications may be needed for optimal results .
the outcome of negotiations with the fda regarding phase iii clinical trials and subsequent marketing remain to be determined . as mdma is not patentable and will be difficult to commercialize with singledose treatments , the most suitable avenue is nonprofit drug development . the nonprofit organization funding and sponsoring clinical trials of mdmaassisted psychotherapy has made substantial progress using rigorous scientific approaches complying with cautious regulatory requirements .
this progress demonstrates that it is possible to study schedule 1 drugs under the current regulatory structure , but that progress in this area has been undesirably slow . meticulously establishing safety and
efficacy is crucial to evaluating the risk / benefit profile of singledose treatments as an adjunct to psychotherapy , which may offer improved safety and compliance over available treatments . fostering open science principles , e.g. , prioritizing publishing in peerreviewed journals and data transparency , will ultimately prove beneficial in shaping and expediting the regulatory environment that applies to mdmaassisted psychotherapy and similar models with other compounds .
implementation of novel mdmaassisted therapies could hold the promise of lasting improvements in social and psychological function for patients , and of deeper understanding of psychiatric disturbances across multiple disorders .
| ### Summary:
: phase ii trials of 3,4methylenedioxymethamphetamine ( mdma)assisted psychotherapy have demonstrated initial safety and efficacy for treatment of posttraumatic stress disorder ( ptsd ) , with potential for expansion to depression and anxiety disorders . in these trials ,
single doses of mdma are administered in a model of medicationassisted psychotherapy , differing from trials involving daily drug administration without psychotherapy .
this model presents an opportunity to utilize accelerated regulatory pathways , such as the us food and drug administration ( fda ) breakthrough therapy designation , to most effectively and expeditiously test such novel approaches . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: it has been well established that artificial nerve grafts filled with nave schwann cells ( scs ) from neonatal [ 1 , 2 ] and adult rats [ 35 ] stimulate peripheral nerve fiber regeneration .
the growth - promoting effect is thought to occur as a result of the scs ability to provide basal membrane components and to secrete a range of trophic factors including fibroblast growth factor-2 ( fgf-2 ) [ 6 , 7 ] . in the central nervous system ( cns ) , fgf-2 could cause demyelination and it is also known to protect different neuronal cell types from damage - induced death .
one example is the developing and adult nigrostriatal system , where applied exogenous fgf-2 promotes survival and neurite outgrowth of dopaminergic neurons and protects them from neurotoxin - induced death in vitro and in vivo . in the peripheral nervous system ( pns )
for example , entrapment of fgf-2 in synthetic nerve guidance channels enhances the growth of myelinated and unmyelinated axons across long gaps [ 12 , 13 ] , which are a major challenge in peripheral nerve repair .
furthermore , transgenic mice overexpressing fgf-2 have considerably faster regeneration of peripheral axons and remyelination compared to wildtypes . as another example , genetically modified sc overexpressing the 21- and 23-kd - fgf-2 isoforms ( fgf-2 ) have turned out to be a useful tool to bridge long gaps ( 15 mm ) after sciatic nerve injury , a mixed peripheral nerve . our group has addressed the problems inherent in pns regeneration using transection and suture of the infratemporal portion of the facial nerve in rats .
one of our major recent findings was that brief manual stimulation ( ms ; 5 minutes per day , 5 days per week for 2 months ) of the whisker pad muscles can over - ride the functional deficit after facial nerve injury and end - to - end anastomosis and restore normal whisking .
manual stimulation neither reduces branching at the injury site nor , consequently , restores myotopic organization in the facial nucleus . rather , manual stimulation appears to affect the periphery by shifting the balance from abnormal polyinnervation of the motor end - plates to the more normal monoinnervated state .
given the effectiveness of manual stimulation in over - riding the detrimental effects of collateral branching and its resultant polyinnervation of motor endplates after facial nerve injury , we asked whether a combinatorial therapy would also improve function . since the different fgf-2 isoforms ( fgf-2 and fgf-2 ) promote encouraging effects after injury in other peripheral nerves , namely , the sciatic [ 15 , 18 ] , we first asked here whether these isoforms would also benefit the outcome after facial nerve injury .
then we asked whether fgf-2 treatment combined with manual stimulation might also influence an outcome .
we , therefore , compared the extent of sprouting , degree of polyinnervation , and whisking function after facial nerve transection followed by entubulation of both ends into a silicone tube filled thereafter either with collagen type i , or with collagen plus scs genetically modified to overexpress the low- ( 18-kd ) or high- ( 21/23-kd ) molecular - weight isoforms of fgf-2 in animals either receiving ms or not .
144 female adult ( 175200 g ) rats ( sprague - dawley , harlan - winkelmann , borchen , germany ) divided into one intact and 8 experimental groups were used .
animals were kept on standard laboratory food ( ssniff , d-59494 soest , germany ) and tap water ad libitum with an artificial light - dark cycle of 12 hours light on , 12 hours off .
german law for animals protection and were approved by the local animal care committee ( bezirksregierung kln , az .
normal , intact rats were used while all animals in the 8 experimental groups had their right facial nerves transected and were treated as follows ( n = 16 in each ) : group 1 : intact rats , group 2 : entubulation into a conduit containing collagen type i , group 3 : entubulation into a conduit containing ( nave ) nonmanipulated neonatal schwann cells ( scs ) ; group 4 : entubulation into a conduit containing scs overexpressing fgf-2 ( sc - fgf-2 ) ; group 5 : entubulation into a conduit containing scs overexpressing fgf2 ( sc - fgf2 ) ; group 6 : as for group 2 + manual stimulation ( ms ) of the right whisker pad muscles group 7 : as for group 3 + manual stimulation ( ms ) group 8 : as for group 4 + ms group 9 : as for group 5 + ms at 2 months postoperatively we quantified ( i ) vibrissal motor performance , ( ii ) the degree of axonal branching , and ( iii ) the pattern of motor endplate reinnervation .
data from each experimental group ( groups 29 ) were compared to those from intact rats ( group 1 ) .
vibrissal motor performance was analysed in all rats using video - based motion analysis ( table 1 ) whereupon half ( n = 8 per group ) of the animals in all groups were used to quantify collateral axonal branching using triple retrograde neuronal labeling ( table 2 ) .
the remaining rats ( n = 8 per group ) were used to determine the proportion of mono- and polyinnervated motor endplates ( table 3 ) in the ipsilateral levator labii superioris muscle using immunocytochemistry .
all surgery was performed unilateraly under an operating microscope and with surgical anesthesia ( ketamin / xylazin ( 100 mg ketanest and 5 mg rompun per kg body weight ; ip ) as already described .
the main trunk of the facial nerve was transected and the two stumps inserted into a silicone precision tube with an inner diameter of 1.47 mm and an outer diameter of 1.96 mm ( aromando medizintechnik , cat .
the empty space between the proximal and distal nerve stumps with a volume of approximately 8 mm ( 5 mm 1,47/2 mm ) was filled carefully with the following .
10 l collagen type i for groups 2 and 6 ; 10 l taken from a gel consisting of 66 l collagen type i ( serva , cat .
47254 ) plus 33 l of a suspension containing nave nonmanipulated sc for groups 3 and 7 ; 10 l taken from a gel consisting of 66 l collagen type i plus 33 l of a suspension containing genetically modified scs overexpressing fgf-2 for groups 4 and 8 ; 10 l taken from a gel consisting of 66 l collagen type i plus 33 l of a suspension containing genetically modified scs overexpressing fgf-2 for groups 5 and 9
. the collagen gel was obtained from a stock solution ( 100 g / ml , serva , heidelberg , germany , cat .
47254 ) which was mixed with 10 phosphate buffered saline ( pbs ) and 0.1 m naoh till the ph reached 7.4 .
thereafter , 106 l of this pure collagen gel were mixed with 54 l collagen ( ratio 2 : 1 ) which contained a suspension of schwann cells so that a total of 160 l gel ( collagen plus sc ) was obtained .
this volume was then divided in 16 tubes ( for 16 rats ) each containing 10 l , that is , the portion for each animal . to polymerize in a 3-dimensional gel ,
the collagen / sc mixture was left at 37c for 2 hours [ 22 , 23 ] .
primary physiological schwann cells were prepared as described earlier . in brief , sciatic nerves were dissected from neonatal sprague - dawley rats .
after enzymatic dissociation and primary seeding , most of contaminating fibroblasts were erased by addition of arabinoside c ( 1 mm ) for 2 days and subsequent removing form the cultures using -thy1 antibody - coupled magnetic beads ( dynabeads , dynal , denmark ) .
overexpression of fgf-2-isoforms was induced by transfection of scs using metafectene ( biontex , germany ) , transfection rate approximately 20% , and plasmid constructs with fgf-2 isoform or fgf-2 isoforms in pci - neo .
all sc populations transplanted in this study were freshly prepared and transfected . as described earlier , transfected scs were positively selected for their coexpressed resistance to geneticin ( g418 ) and successful transfection was monitored in western blot analysis with regard to fgf-2 isoform overexpression in the different cell groups ( figure 2 ) : nontransfected scs ( scphysiol ) , scs overexpressing either 18kd - fgf-2 ( sc - fgf-2 ) or 21/23-kd - fgf-2 ( sc - fgf-2 ) .
transfected cells were grown to confluence and withdrawn from fetal calf serum prior to transplantation .
scs were detached from culture flasks and stored on ice . directly prior to implantation of the silicon nerve guides
, scs were resuspended in the collagen solution ( see above ) and injected in the sterile silicone tubes used . transplanted
scs overexpressing fgf-2 - 18kd or fgf2 - 21/23kd increase the amount of these proteins inside a peripheral nerve gap after entubulation surgery . using the elisa technique we previously found higher concentrations of free fgf-2 isoforms for at least one week after entubulation .
the amounts of free fgf-2 one week after surgery were ( 1 ) nonmanipulated neonatal schwann cells ( sc ) : 0.56 ng/l ; ( 2 ) sc overexpressing the fgf-2 - 18kd : 0.90 ng/l ; ( 3 ) sc overexpressing the fgf-2 - 21/23kd : 0.66 ng/l .
identification of scs after transplantation could be achieved by cell surface labeling prior to grafting .
exemplarily , prelabeling was performed by the incubation of scs with pkh26-gl cell linker ( sigma , germany ) .
after sacrifice , tissue was fixed ( 4% paraformaldehyde ) , cryo - preserved ( 30% sucrose ) , and cryo - embedded .
transplanted scs were identified by their red fluorescence using a bx60 microscope ( leica , germany ) in longitudinal cryo sections of regenerated peripheral nerve tissue ( figure 4 ) .
to mimick natural active vibrissal movements during whisking , groups 69 received daily gentle rhythmic forward stroking by hand , while letting the whiskers retract backwards unassisted , of the right vibrissae and whisker pad muscles ( 5 min / day , 5 days / week for 2 months ; figure not shown , see ) .
we evaluated ( i ) protraction ( forward vibrissal movement ) ; ( ii ) whisking frequency , ( cycles of protraction and retraction , that is , backward movement ) ; ( iii ) amplitude ( difference between maximal retraction ; maximal protraction and ( iv ) angular velocity ( degrees per second ) .
briefly , one day after videotaping animals were anesthetized and crystals of dii ( 1,1-dioctadecyl-3,3,3,3-tetramethylindo - carbocyanine perchlorate ; molecular probes , the netherlands ) , fluoro - gold ( fg ; fluorochrome inc . , denver , colo , usa ) and fast blue ( fb ; ems - chemie gmbh , gro - umstadt , germany ) instilled , respectively , into the zygomatic , buccal , and marginal mandibular branches of the facial nerve ( figure 3 ) .
ten days later , animals were terminally anaesthetized and transcardially perfused ( 4% formaldehyde in 0.1 m phosphate buffer , ph 7.4 ) .
sections were observed using an epifluorescence microscope ( axioskop 50 ; zeiss oberkochen , germany ) fitted with a custom - made band pass - filter set ( ahf analysentechnik , tbingen , germany ) to eliminate fluorescence cross - talk between tracers .
separate color images of retrogradely labeled facial motoneurons were generated ( ccd video camera system : optronics dei-470 , goleta , calif , usa ) and combined using image analysis software optimas 6.5 .
all cells stained by diionly , fgonly , fbonly , as well as those double - stained ( i.e. , dii+fg or dii+fb ) were counted using an optical dissector technique .
the counts therefore allowed us to quantify the degree ( index ) of axonal branching ( i.e. , sum of the percentages given in the third and fourth column in table 2 ) .
double - labeled motoneuronal perikary with fg+fg ( in green colour ) was not counted .
this was a pity , because since fg and fb were both simultaneously visualized with the same uv epi - fluorescence excitation filter ( zeiss , filter set 01 ) , such a measurement would be rather easy .
however , earlier own work has shown that the blue emission of fb obscured the yellow emission of fg .
in other words , the number of fb+fg - labeled perikarya would be always lower than its real value .
as described previously , we quantified the ratio of monoinnervated to poly - innervated motor endplates in the levator labii superioris muscle .
cryoprotected muscle tissue was cut on a cryostat ( longitudinal ; 30 m thick sections ) and sections immunostained ( rabbit polyclonal antibody against neuronal class iii -tubulin ; covance , richmond , calif , usa , no .
prb-435p , 1 : 1000 and cy3-conjugated antirabbit igg ; 1 : 400 ; sigma as a secondary antibody ) .
the boundaries of the motor end - plates were visualized using acetylcholine receptor staining ( alexa fluor 488-conjugated alpha - bungarotoxin ; molecular probes , 1 : 500 ) .
data were analyzed using one - way anova with post - hoc tukey test and significance level of 0.05 ( statistica 6.0 software ; statsoft , tulsa , ok , usa ) .
examination of tissue after sacrifice showed that transplanted neonatal sc integrated well into regenerating peripheral nerve tissue ( figure 4 ) .
as described by us and others , normal animals explore the environment by coordinated sweeps of individual vibrissae ( whisking ) with a frequency of about 6 hz .
vibrissal movements occur via muscle contractions which produce active rostral protraction and , to a lesser extent , active caudal retraction ; that is , some of the backward movement is passive .
the amplitude of the movement from maximum protraction to maximum retraction was approximately 50 ( table 1 , first row ) . compared to normal animals , vibrissal motion was poor in rats receiving entubulation alone ( i.e. , no manual stimulation ) of the facial nerve in collagen ( group 2 ) or collagen plus nave sc or plus sc - fgf-2 or sc - fgf-2 ( groups 35 ) with the amplitude and angular velocity being reduced by about 70% ( table 1 ) .
furthermore , ms following entubulation in collagen ( group 6 ) or collagen + nave and fgf - overexpressing sc ( groups 79 ) also failed to improve whisking of the vibrissae ( table 1 ) . as previously described by us and others , in intact animals , motoneurons with axons entering the zygomatic , buccal or marginal mandibular ramus ( figure 3(a ) )
were myotopically organized in the dorsal , lateral , and intermediate facial subnuclei , respectively .
no double- or triple - labeled motoneurons were observed because intact motoneurons send only one unbranched axon into each of the facialis rami ( figure 3(b ) ) .
thus , for intact animals the index of axonal branching in the facial nerve trunk , calculated by examining the zygomatic motoneurons , was 0% ( table 2 ) .
after facial nerve cut and entubulation with collagen or collagen plus scs but without ms ( figure 3(c ) ) , myotopic organization into specific subnuclei was no longer observed , that is , all retrogradely labeled motoneurons were scattered throughout the facial nucleus ( figure 3(d ) ) .
a similar lack of myotopy was observed when manual stimulation was combined with entubulation with collagen or collagen plus nave scs or those overexpressing fgf-2 or fgf-2 .
the lack of myotopy was presumably due to individual transected axons sprouting to produce numerous collateral branches which grew into different facial nerve rami , persisted in the long - term and retrogradely transported the three fluorescent dyes to their parent motoneurons in the facial nucleus .
we also commonly observed double and triple labeling of motoneurons ( figure 3(d ) ) .
multiple labeling of individual motoneurons can be explained by injury - induced collateral axonal branches projecting into different facial nerve rami ( i.e. , in this experiment , the ones that were labeled , namely , the ramus zygomaticus , ramus buccalis or ramus marginalis mandibulae ) .
such branches would have retrogradely transported two or three fluorescent dyes simultaneously to the parent perikarya .
the final observation is that based on elevated motoneuron numbers in the facial nucleus for all experimental animals , each of the individual facial nerve rami contained axons or axonal branches of more motoneurons than in intact animals .
retrograde tracing also revealed that transection and entubulation of the facial nerve significantly changed the fiber composition of the different rami ( table 2 ) .
in intact rats ( group 1 ) , the total number of single - labeled ( i.e. , dii - only + fg - only + fb - only ) cells in the facial nucleus was about 2000 but increased to 40005000 following entubulation with collagen , with neonatal sc and with scs overexpressing fgf-2 or fgf-2 isoforms ( last column in table 1 ) .
a similar scenario was observed following ms in groups 69 in which the total numbers of single - labeled cells were significantly increased compared to those in intact rats ( table 1 ) .
axons in individual rami do not branch in intact animals , and therefore retrograde labeling from specific rami ( zygomatic , buccal , and marginal mandibular ) yields consistent motoneuron numbers with little variation ( table 2 ) .
the elevated numbers of motoneurons after labeling the buccal ( fg - only ) and marginal mandibular ( fb - only ) , but not the zygomatic , branches ( table 2 ) indicate that other axons must have sprouted and entered these rami .
the sources of these additional axons were presumably the two other branches of the facial nerve ( posterior auricular and cervical ) .
thus , while not labeled in intact animals , such axons must presumably have also sprouted into the zygomatic , buccal , and marginal mandibular rami and , therefore , have become labelled ( table 2 ) . across all treatment groups ,
the index of axonal branching ( i.e. , sum of the percentages of dii+fg and dii+fb retrogradely labeled perikarya in the third and fourth column of table 2 ) was 4667% and none of the procedures significantly influenced the projection patterns ( figure 3(d ) ) .
thus , to summarise , there was a complete lack of myotopic organization , increased total numbers of projecting motoneurons and a consistently elevated degree of axonal branching regardless of whether the animals were subjected to any of the paradigms or not .
reinnervation of individual skeletal target muscle fibers revealed that in contrast to intact animals , in which all motor endplates were monoinnervated , nerve transection followed by treatments with collagen , nave scs or those overexpressing fgf-2 or fgf-2 resulted in 4549% of the motor endplates being polyinnervated ,
that is , innervated by two or more axons ( groups 25 ; figure 5 ; table 3 ) . furthermore ,
manual stimulation did not reduce the degree of polyinnervation ( groups 69 ; 4251% , table 3 ) .
here we show that regardless of the post - operative treatment following facial nerve injury , the index of collateral branching at the lesion site remained high ( 4667% ) , the proportion of polyinnervated motor endplates in the musculature rose from 0% to 4251% and the amplitude of vibrissal whisking remained low , ranging from 25% to 30% of that in intact animals .
thus , although axonal sprouting occurred , it appeared to be invariant and occurred to a similar extent for each of the treatment groups and none was functionally useful .
furthermore , in contrast to previous findings , daily ms of whiskerpad muscles failed to harness
growth of lesioned peripheral axons is vigorously supported by a large number of trophic factors expressed locally ( review in ) . within an earlier experimental set we tested the hypothesis that neutralization of diffusable neurotrophic factors at the lesion site in rats could reduce the collateral branching of transected axons and thus improve quality of reinnervation .
we inserted both ends of the transected facial nerve into a silicon tube containing collagen gel with neutralizing concentrations of antibodies to several growth factors including fgf-2 .
two months later , retrograde labeling was used to estimate the proportion of motoneurons with branched axons projecting into the three major branches of the facial nerve . neutralizing concentration of anti - fgf-2 significantly reduced the index of collateral axonal branching to 22% .
thus , by manipulating the local environment using neutralizing antibody to fgf2 , we achieved a strong reduction in collateral axonal branching from the proximal stump and a significant improvement of the reinnervation quality in several groups of rats . in the same animals ,
however , the function of the reinnervated vibrissae muscles remained as poor as in nontreated injured animals . as a potential reason for the ineffectiveness of the treatment we identified the well - known posttransectional polyneuronal innervation of the motor endplates , a phenomenon which was not directly manipulated in our experiments .
these results raise questions of fundamental importance with regard to the mechanisms limiting functional recovery and to the perspectives for identifying new efficient treatment strategies .
so far we have no evidence that the observed pattern of reinnervation and recovery of vibrissae whisking after treatment with collagen , nave scs , or those overexpressing fgf-2 or fgf-2 represent an endpoint , and not just a delayed recovery .
this is why we can not exclude that an improvement might take palce in these animals .
however , based on several long term clinical data and own observations [ 16 , chapter 3.1.5 . ]
the persisting axonal misguidance and poly - innervation of muscles ( in contrast to the events during embryonic development , there occurs no retrieval of excessive axonal terminals from the nmj in adults ) cause a wasting palsy ( paresis and atrophy of the muscles ) and progressive functional deterioration . anyway , to clear this issue definitely , new experiments with longer postoperative survival periods have to be performed . within the cns , transplantation of supportive cells , such as schwann cells ,
significantly increases the extent of regeneration within the bands of bngner long chains schwann cells of cells , which bridge the interfragmentary gap and form guiding channels for the regenerating branches on their way to the target(s ) [ 2 , 35 , 36 ] .
schwann cell transplantation is used within the pns to bridge larger nerve gaps that axons lacking physical and trophic support are not able to cross .
similar to autologous peripheral nerve grafts , transplanted scs in synthetic nerve bridges provide regrowing peripheral axons with supportive environmental conditions to overcome large nerve defects .
a further advantage is that synthetic bridges avoid the problem of removing nerve tissue for transplantation , which in turn would induce its own defect . in particular ,
scs have been considered to be useful because of the large range of neurotrophic factors that they naturally secrete [ 17 , 38 ] .
the efficacy of bridges containing neurotrophic factors alone is limited by short half - life .
schwann cells , however , could in addition to secreting their own range of growth factors be genetically engineered exvivo to induce long - term release of selected neurotrophic factors in a site - directed manner . indeed , we have previously demonstrated that transplantation of genetically modified scs overexpressing fgf-2 into a large gap ( 15 mm ) in the rat sciatic nerve supported functional recovery .
however , the type of recovery was depended on the fgf-2 isoform . whereas sensory recovery was accelerated by fgf-2 , motor recovery seemed only to be influenced by fgf-2 . additionally , it has recently been demonstrated that fgf-2 deficient mice show a faster sensory recovery after sciatic nerve crush injury .
however , synergistic beneficial effects on promoting axonal regrowth could be demonstrated for fgf-2 , and not fgf-2 , gene therapy after sciatic nerve entubulation surgery followed by motor - enriched rehabilitation , such as voluntary wheel running .
today there is no clear evidence if motor axonal regeneration and functional recovery of a mixed peripheral nerve could be supported by any fgf-2 isoform alone . in contrast , we have shown here , for the purely motor facial nerve , that neither fgf-2 isoform , delivered via an ex vivo gene therapy approach , increased the amount of regeneration , as measured by the extent of sprouting , nor enhanced functional recovery .
thus for both fgf-2 isoforms , the index of collateral axonal branching , that is , sum of the percentages of dii+fg ( third column , table 2 ) plus dii+fb ( fourth column , table 2 ) labeled neurons was 48% and 50% , respectively , and did not differ significantly from collagen alone ( 54% ) or nave scs ( 46% ) .
the present data thus suggest that although fgf-2 supports bridging of the 5 mm gap , this growth factor does not improve the accuracy of regrowth of facial nerve axons over and above that induced by collagen alone or nave scs .
interestingly , the extent of collateral branching at the lesion site in the current study may be somewhat less than that induced by facial nerve transection and end - to - end re - anastomosis ( 67% in , that is , without the ~5 mm gap inherent during the silicone tube grafting procedure .
this indicates that the extent of collateral axonal branching at the lesion site is somehow limited when the gap is large .
one possible reason could be found in the lack of a suture - caused tight apposition between the regrowing neurites and the approximated bngner 's bands of the distal fragment undergoing walerian degeneration .
whereas it is evident that neither fgf-2 isoform confers an advantage for bridging large defects in a pure motor nerve like the facial nerve , fgf-2 is clearly advantageous within the mixed sciatic nerve : functional recovery is improved to differing degrees by the different fgf-2 isoforms .
furthermore , synergistic beneficial effects of fgf-2 gene therapy with regard to promoted axonal growth was demonstrated for sciatic nerve entubulation surgery followed by motor - enriched rehabilitation , such as voluntary wheel running .
the reasons for the difference in outcomes for the sciatic and facial nerve are unknown but could include differences in the types of readouts and assessments naturally associated with two such functionally different nerves . in addition , depending on different stimuli applied , differences in target tissue signaling after reconstructive surgery could have accounted for the different outcome in the discussed models : denervated muscles have been shown to produce short - range diffusible sprouting stimuli [ 42 , 43 ] .
various growth factors have been identified as possible candidates for this role ; described in what follows ) .
a future set of experiments would be needed to determine if ex vivo gene therapy with other single or combined growth factors could beneficially affect the outcome of facial nerve entubulation repair .
it is puzzling why a gap of only 5 mm , which is after all bridged successfully and located far from the target , would hamper the effects of manual stimulation of the vibrissal muscles .
what is the reason for the lack of reduced polyinnervation of the motor end - plates ?
we do not know that so far , but will try to answer this question using the time course of target reinnervation .
let us assume that mechanical stimulation simulates sufficient muscle activity and normal ( i.e. , nonincreased ) local production of growth factors only for a limited period of time , immediately after the nerve lesion
. this would allow the regrowing axons to reach their motor targets slowly , accurately and with less intramuscular terminal sprouting .
after a 5 mm nerve gap , this time schedule can not be followed anymore : the regrowing axons need more time to bridge the gap .
the synchronously increased production of trophic factors urges them to grow rapidly , with more intramuscular sprouts .
thus it seems that though relative short , the gap of 5 mm is a serious hurdle for the effects of manual mechanical stimulation . in summary
, we show that although a gap of 5 mm in the facial nerve lesion paradigm can be successfully bridged by entubulation , in terms of axonal sprouting , regeneration across the gap is the same regardless of whether scs are present and also regardless of whether they overexpress fgf-2/fgf-2 .
comparison with end - to - end suturing as a repair technique shows that the amount of sprouting might be reduced , the larger the gap , possibly due to the lack of support and increased guidance errors . furthermore , manual stimulation , which is able to restore normal function if the gap is small , fails to do so for any of the treatments involving entubulation in which the gap is long .
we conclude that although entubulation of a transected peripheral ( facial ) nerve in suspension of schwann cells whcih overexpress fgf-2/fgf-2 supports the axon regeneration through a large ( 5 mm ) gap , the procedure induces excessive collateral branching at the lesion site and massive terminal sprouting in the mimic muscles .
furthermore , under these circumstances , the therapeutic procedure of manual stimulation of denervated muscles had no beneficial effect . | ### Summary:
: purpose . to determine whether transplantation of schwann cells ( scs ) overexpressing different isoforms of fibroblast growth factor 2 ( fgf-2 ) combined with manual stimulation ( ms ) of vibrissal muscles improves recovery after facial nerve transection in adult rat
.
procedures .
transected facial nerves were entubulated with collagen alone or collagen plus nave scs or transfected scs .
half of the rats received daily ms .
collateral branching was quantified from motoneuron counts after retrograde labeling from 3 facial nerve branches .
quality assessment of endplate reinnervation was combined with video - based vibrissal function analysis .
results .
there was no difference in the extent of collateral axonal branching .
the proportion of polyinnervated motor endplates for either nave scs or fgf-2 over - expressing scs was identical .
postoperative ms also failed to improve recovery .
conclusions .
neither fgf-2 isoform changed the extent of collateral branching or polyinnervation of motor endplates ; furthermore , this motoneuron response could not be overridden by ms . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: gc analyses were performed on a capillary gas chromatograph equipped with a fused silica column ( l : 25 m , i.d . : 0.20 mm , film thickness : 0.33 m ) at a helium pressure of 200 kpa , split less / split injector and flame ionization detector .
dart - ms spectra were obtained using peg as an internal standard under positive ionization mode with a tof mass analyzer .
h and c nmr spectra were recorded on instruments operating at 400 and 150 mhz , respectively .
the microwave - assisted experiments were performed with a biotage initiator sixty exp microwave system operating at 0400 w at 2.45 ghz .
the instrument operates in the temperature range 40250 c , a pressure interval of 020 bar ( 2 mpa , 290 psi ) with reactor vial volumes of 0.220 ml .
multiple attempts to grow crystals of nhc-1 and nhc-2 suitable for x - ray analysis were performed in various solvent systems , but unfortunately only amorphous material was obtained in most cases .
imidazole ( 0.10 g ) and pd(oh)2/c ( 15 % w / w ) were transferred to a round - bottom flask ( 50 ml ) equipped with a magnetic stir bar .
meoh ( 25 ml ) was added , and the flask was evacuated under reduced pressure and flushed with h2 from a balloon three times .
the reaction mixture was stirred vigorously at room temperature for 24 h. the post - reaction mixture was filtered through a pad of celite that was subsequently washed with multiple small portions of meoh . the solvent was evaporated to give the product as a tan oil in 92 % yield ( purity : 95 % as determined by gc ) without need for further purification .
h nmr ( cdcl3 ) : =7.91 ( s , 1 h ) , 7.79 ( d , 2 h , j=8.0 hz ) , 7.34 ( d , 2 h , j=7.0 hz ) , 2.48 ( t , 2 h , j=7.4 hz ) , 1.57 ( 2 h , m ) , 1.23 ( 8 h , m ) , 0.86 ppm ( t , 3 h , j=7.1 hz ) ; c nmr ( cdcl3 ) : =146.1 , 136.3 , 135.4 , 130.5 , 127.4 , 112.9 , 31.9 , 29.3 , 29.1 , 28.7 , 28.3 , 22.7 , 21.8 , 14.2 ppm ; hrms ( dart ) : m / z [ m+h ] calcd for c17h25n2o2s : 321.16367 , found : 321.16367 .
imidazole ( 2.94 mmol , 0.20 g ) was dissolved in meoh ( 20 ml ) in a round - bottom flask ( 25 ml ) .
hcl ( concd , 1 ml ) was added to this mixture in one portion .
the reaction mixture was held at reflux for 2 h , whereupon the meoh was evaporated and hcl ( 3 m , 10 ml ) was added .
the resulting mixture was extracted with et2o ( 220 ml ) , and the organic phases discarded .
the aqueous phase was made alkaline with naoh ( 4 m ) and again extracted with et2o ( 320 ml ) .
the organic extracts were combined , dried over anhydrous na2so4 , filtered , and concentrated under reduced pressure to provide the product at high purity .
h nmr ( cdcl3 ) : =11.07 ( 1 h , m , br ) , 7.64 ( 1 h , s ) , 6.76 ( 1 h , s ) , 2.59 ( t , 2 h ) , 1.61 ( m , 2 h ) , 1.26 ( m , 8 h ) , 0.85 ppm ( t , 3 h ) ;
c nmr ( cdcl3 ) : =137.0 , 134.2 , 117.7 , 31.9 , 29.4 , 29.4 , 29.2 , 26.6 , 22.8 , 14.2 ppm ; hrms ( dart ) : m / z [ m+h ] calcd for c10h19n2 : 167.15482 , found : 167.15466 .
general procedure for pd - catalyzed n - arylation coupling reaction between 4-(5)-alkyl-1h - imidazoles and bromobenzene.27 to an oven - dried tube was transferred imidazole ( 1.2 mmol ) , k3po4 ( 424 mg , 2.0 mmol ) , and bromobenzene ( 2.0 mmol ) .
the vial was sealed with a septum and carefully flushed with argon through the septum .
a second oven - dried tube was charged with pd2(dba)3 ( 0.0125 mmol ) and me4tbuxphos ( 0.025 mmol ) before it was sealed with a septum and flushed with argon .
the catalyst was dissolved in a mixture of anhydrous toluene ( 0.83 ml ) and anhydrous 1,4-dioxane ( 0.17 ml ) , and the resulting dark - purple mixture was stirred at 120 c for 3 min , at which point the color of the mixture turned to red brown .
the catalyst was then transferred to the first vial , and the reaction mixture was heated at 120 c for 5 h. at the end of the reaction time , the mixture was cooled to room temperature , diluted with etoac ( 10 ml ) , washed with brine ( 2 ml ) , and dried over mgso4 .
the drying agent was filtered off , and the organic solvent was removed under reduced pressure .
the crude product was then purified by flash chromatography with the eluent systems specified below .
isolated as a yellow oil by silica gel column chromatography [ etoac / hexanes ( 4:6)(1:1 ) ] in 87 % yield .
h nmr ( cdcl3 ) : =7.74 ( 1 h , s ) , 7.44 ( 2 h , t , j=7.6 hz ) , 7.33 ( 3 h , m ) , 6.99 ( s , 1 h ) , 2.29 ppm ( s , 3 h ) ; c nmr ( cdcl3 ) : =139.6 , 134.6 , 134.7 , 129.9 , 127.1 , 121.1 , 114.7 , 13.8 ppm .
the product was isolated by flash silica gel chromatography [ etoac / hexanes ( 1:9)(1:1 ) ] as pale crystals in 78 % yield .
rf=0.58 [ etoac / hexanes ( 1:1 ) ] ; mp : 53.955.0 c ; h nmr ( cdcl3 ) : =7.77 ( s , 1 h ) , 7.45 ( t , 2 h , j=7.5 hz ) , 7.33 ( m , 3 h , j=8.3 hz ) , 7.00 ( s , 1 h ) , 2.62 ( t , 2 h , j=7.8 hz ) , 1.69 ( t , 2 h , j=7.4 hz ) , 1.31 ( m , 8 h ) , 0.87 ppm ( t , 3 h , j=7.4 hz ) ; c nmr ( cdcl3 ) : =144.8 , 137.7 , 134.7 , 129.9 , 127.2 , 121.3 , 114.2 , 320 , 29.5 , 29.5 , 29.5 , 29.3 , 28.6 , 22.8 , 14.3 ppm ; hrms ( dart ) : m / z [ m+h ] calcd for c16h23n2 : 243.18558 , found : 243.1860 .
general procedure for n-3-methylation of n-1-phenyl-4-alkylimidazole.28
n - phenyl-4-alkylimidazole ( 2.0 mmol ) was dissolved in thf ( 15 ml ) .
methyl iodide ( 4.00 mmol ) was added in one portion , and the reaction mixture was held at reflux for 4 h. the post - reaction mixture was allowed to cool , resulting in crystallization of the product which was filtered , washed with small portions of hexane , and air - dried to furnish the product .
h nmr ( cdcl3 ) : =10.12 ( s , 1 h ) , 7.65 ( d , 2 h , j=7.8 hz ) , 7.60 ( s , 1 h ) , 7.42 ( m , 3 h ) , 3.98 ( s , 3 h ) , 2.37 ppm ( s , 3 h ) ; c nmr ( cdcl3 ) : =135.2 , 134.5 , 132.8 , 130.7 , 130.3 , 122.0 , 117.8 , 34.9 , 9.7 ppm ; hrms ( esi ) : m / z [ m ] calcd for c11h13n2 : 173.10787 , found : 173.10779 ; [ m2i ] calcd for c22h26n4i : 473.12021 , found : 473.12594 .
h nmr ( cdcl3 ) : =10.60 ( s , 1 h ) , 7.74 ( d , 2 h , j=7.9 hz ) , 7.54 ( m , 3 h ) , 4.12 ( s , 3 h ) , 2.69 ( t , 2 h , j=8.0 hz ) , 1.71 ( m , 3 h ) , 1.35 ( m , 7 h ) , 0.87 ppm ( t , 3 h , j=6.9 hz ) ; c nmr ( cdcl3 ) : =137.3 , 135.9 , 134.7 , 130.8 , 130.4 , 122.1 , 116.7 , 34.9 , 31.7 , 29.3 , 29.0 , 27.3 , 23.9 , 22.8 , 14.2 ppm ; hrms ( dart ) : m / z [ m+hi ] calcd for c17h25n2 : 257.20177 , found : 257.20179 .
general procedure for the synthesis of imidazole - based silver complexes.29 imidazolium salt ( 1.77 mmol ) was dissolved in ch2cl2 ( 15 ml ) , and silver(i ) oxide ( 0.89 mmol ) was added in one portion .
the black reaction mixture was stirred for 2 h 25 min , at which point the mixture became pale brown .
the solution was poured into a beaker containing hexanes ( 100 ml ) , resulting in precipitation of a crystalline solid .
h nmr ( cdcl3 ) : =7.52 ( m , 2 h ) , 7.39 ( m , 3 h ) , 6.98 ( s , 1 h ) , 3.82 ( s , 3 h ) , 2.29 ppm ( s , 3 h ) ; c nmr ( cdcl3 ) : =140.4 , 131.3 , 129.8 , 1286 , 124.1 , 119.0 , 36.9 , 10.0 ppm ; hrms ( dart ) : m / z [ m+hagi ] calcd for c11h13n2 : 173.10732 , found : 173.10215 .
h nmr ( cdcl3 ) : 7.54 ( d , 2 h ) , 7.42 ( m , 3 h ) , 6.95 ( s , 1 h ) , 3.84 ( s , 3 h ) , 2.58 ( m , 2 h ) , 1.65 ( m , 2 h ) , 1.30 ( m , 8 h ) , 0.89 ppm ( t , 3 h ) ; c nmr ( cdcl3 ) : =182.6 , 140.4 , 136.0 , 129.9 , 128.7 , 124.0 , 118.1 , 36.7 , 31.8 , 29.3 , 29.1 , 27.8 , 24.5 , 22.8 , 14.2 ppm ; hrms ( dart ) : m / z [ magi ] calcd for c17h25n2 : 257.20177 , found : 257.20156 .
the human cell lines molm-13 and hl60 were purchased from american type culture collection ( atcc ; manassas , va , usa ) and cultured in rpmi 1640 ( invitrogen ) , containing 10 % heat - inactivated fetal bovine serum ( ge healthcare , life sciences ) , 2 mm l - glutamine , and 50 u ml penicillin / streptomycin ( sigma aldrich ) .
evaluation of viability / apoptosis was performed as described previously.32 , 33 cell analysis after drug treatment ( 210 cells per ml ) was carried out by fixing cells in 8 % formaldehyde in pbs , dna - specific staining with hoechst 33342 ( invitrogen ; 10 g ml ) , followed by counting of normal and fragmented / condensed cell nuclei in an inverse fluorescence microscope ( zeiss axio vert.a1 ) , or by flow cytometric analysis and annexin staining .
annexin staining ( invitrogen ) was performed in accordance with the manufacturer s recommended procedure and run on the guava easycyte flow cytometer ( emd millipore ) .
the wst1 assay cell proliferation reagent ( life sciences ) was used in accordance with the manufacturer s procedure , followed by respective reading of luminescence and absorbance ( spectra max gemini em , molecular devices ) .
all cell viability assays were performed in flat - bottomed 96- or 24-well tissue culture test plates .
gc analyses were performed on a capillary gas chromatograph equipped with a fused silica column ( l : 25 m , i.d . : 0.20 mm , film thickness : 0.33 m ) at a helium pressure of 200 kpa , split less / split injector and flame ionization detector .
dart - ms spectra were obtained using peg as an internal standard under positive ionization mode with a tof mass analyzer .
h and c nmr spectra were recorded on instruments operating at 400 and 150 mhz , respectively .
the microwave - assisted experiments were performed with a biotage initiator sixty exp microwave system operating at 0400 w at 2.45 ghz .
the instrument operates in the temperature range 40250 c , a pressure interval of 020 bar ( 2 mpa , 290 psi ) with reactor vial volumes of 0.220 ml .
multiple attempts to grow crystals of nhc-1 and nhc-2 suitable for x - ray analysis were performed in various solvent systems , but unfortunately only amorphous material was obtained in most cases .
imidazole ( 0.10 g ) and pd(oh)2/c ( 15 % w / w ) were transferred to a round - bottom flask ( 50 ml ) equipped with a magnetic stir bar .
meoh ( 25 ml ) was added , and the flask was evacuated under reduced pressure and flushed with h2 from a balloon three times .
the reaction mixture was stirred vigorously at room temperature for 24 h. the post - reaction mixture was filtered through a pad of celite that was subsequently washed with multiple small portions of meoh . the solvent was evaporated to give the product as a tan oil in 92 % yield ( purity : 95 % as determined by gc ) without need for further purification .
h nmr ( cdcl3 ) : =7.91 ( s , 1 h ) , 7.79 ( d , 2 h , j=8.0 hz ) , 7.34 ( d , 2 h , j=7.0 hz ) , 2.48 ( t , 2 h , j=7.4 hz ) , 1.57 ( 2 h , m ) , 1.23 ( 8 h , m ) , 0.86 ppm ( t , 3 h , j=7.1 hz ) ; c nmr ( cdcl3 ) : =146.1 , 136.3 , 135.4 , 130.5 , 127.4 , 112.9 , 31.9 , 29.3 , 29.1 , 28.7 , 28.3 , 22.7 , 21.8 , 14.2 ppm ; hrms ( dart ) : m / z [ m+h ] calcd for c17h25n2o2s : 321.16367 , found : 321.16367 .
imidazole ( 2.94 mmol , 0.20 g ) was dissolved in meoh ( 20 ml ) in a round - bottom flask ( 25 ml ) .
hcl ( concd , 1 ml ) was added to this mixture in one portion .
the reaction mixture was held at reflux for 2 h , whereupon the meoh was evaporated and hcl ( 3 m , 10 ml ) was added .
the resulting mixture was extracted with et2o ( 220 ml ) , and the organic phases discarded .
the aqueous phase was made alkaline with naoh ( 4 m ) and again extracted with et2o ( 320 ml ) .
the organic extracts were combined , dried over anhydrous na2so4 , filtered , and concentrated under reduced pressure to provide the product at high purity .
h nmr ( cdcl3 ) : =11.07 ( 1 h , m , br ) , 7.64 ( 1 h , s ) , 6.76 ( 1 h , s ) , 2.59 ( t , 2 h ) , 1.61 ( m , 2 h ) , 1.26 ( m , 8 h ) , 0.85 ppm ( t , 3 h ) ;
c nmr ( cdcl3 ) : =137.0 , 134.2 , 117.7 , 31.9 , 29.4 , 29.4 , 29.2 , 26.6 , 22.8 , 14.2 ppm ; hrms ( dart ) : m / z [ m+h ] calcd for c10h19n2 : 167.15482 , found : 167.15466 .
general procedure for pd - catalyzed n - arylation coupling reaction between 4-(5)-alkyl-1h - imidazoles and bromobenzene.27 to an oven - dried tube was transferred imidazole ( 1.2 mmol ) , k3po4 ( 424 mg , 2.0 mmol ) , and bromobenzene ( 2.0 mmol ) .
the vial was sealed with a septum and carefully flushed with argon through the septum .
a second oven - dried tube was charged with pd2(dba)3 ( 0.0125 mmol ) and me4tbuxphos ( 0.025 mmol ) before it was sealed with a septum and flushed with argon .
the catalyst was dissolved in a mixture of anhydrous toluene ( 0.83 ml ) and anhydrous 1,4-dioxane ( 0.17 ml ) , and the resulting dark - purple mixture was stirred at 120 c for 3 min , at which point the color of the mixture turned to red brown .
the catalyst was then transferred to the first vial , and the reaction mixture was heated at 120 c for 5 h. at the end of the reaction time , the mixture was cooled to room temperature , diluted with etoac ( 10 ml ) , washed with brine ( 2 ml ) , and dried over mgso4 .
the drying agent was filtered off , and the organic solvent was removed under reduced pressure .
the crude product was then purified by flash chromatography with the eluent systems specified below .
isolated as a yellow oil by silica gel column chromatography [ etoac / hexanes ( 4:6)(1:1 ) ] in 87 % yield .
h nmr ( cdcl3 ) : =7.74 ( 1 h , s ) , 7.44 ( 2 h , t , j=7.6 hz ) , 7.33 ( 3 h , m ) , 6.99 ( s , 1 h ) , 2.29 ppm ( s , 3 h ) ; c nmr ( cdcl3 ) : =139.6 , 134.6 , 134.7 , 129.9 , 127.1 , 121.1 , 114.7 , 13.8 ppm .
the product was isolated by flash silica gel chromatography [ etoac / hexanes ( 1:9)(1:1 ) ] as pale crystals in 78 % yield .
rf=0.58 [ etoac / hexanes ( 1:1 ) ] ; mp : 53.955.0 c ; h nmr ( cdcl3 ) : =7.77 ( s , 1 h ) , 7.45 ( t , 2 h , j=7.5 hz ) , 7.33 ( m , 3 h , j=8.3 hz ) , 7.00 ( s , 1 h ) , 2.62 ( t , 2 h , j=7.8 hz ) , 1.69 ( t , 2 h , j=7.4 hz ) , 1.31 ( m , 8 h ) , 0.87 ppm ( t , 3 h , j=7.4 hz ) ; c nmr ( cdcl3 ) : =144.8 , 137.7 , 134.7 , 129.9 , 127.2 , 121.3 , 114.2 , 320 , 29.5 , 29.5 , 29.5 , 29.3 , 28.6 , 22.8 , 14.3 ppm ; hrms ( dart ) : m / z [ m+h ] calcd for c16h23n2 : 243.18558 , found : 243.1860 .
general procedure for n-3-methylation of n-1-phenyl-4-alkylimidazole.28
n - phenyl-4-alkylimidazole ( 2.0 mmol ) was dissolved in thf ( 15 ml ) .
methyl iodide ( 4.00 mmol ) was added in one portion , and the reaction mixture was held at reflux for 4 h. the post - reaction mixture was allowed to cool , resulting in crystallization of the product which was filtered , washed with small portions of hexane , and air - dried to furnish the product .
h nmr ( cdcl3 ) : =10.12 ( s , 1 h ) , 7.65 ( d , 2 h , j=7.8 hz ) , 7.60 ( s , 1 h ) , 7.42 ( m , 3 h ) , 3.98 ( s , 3 h ) , 2.37 ppm ( s , 3 h ) ; c nmr ( cdcl3 ) : =135.2 , 134.5 , 132.8 , 130.7 , 130.3 , 122.0 , 117.8 , 34.9 , 9.7 ppm ; hrms ( esi ) : m / z [ m ] calcd for c11h13n2 : 173.10787 , found : 173.10779 ; [ m2i ] calcd for c22h26n4i : 473.12021 , found : 473.12594 .
h nmr ( cdcl3 ) : =10.60 ( s , 1 h ) , 7.74 ( d , 2 h , j=7.9 hz ) , 7.54 ( m , 3 h ) , 4.12 ( s , 3 h ) , 2.69 ( t , 2 h , j=8.0 hz ) , 1.71 ( m , 3 h ) , 1.35 ( m , 7 h ) , 0.87 ppm ( t , 3 h , j=6.9 hz ) ; c nmr ( cdcl3 ) : =137.3 , 135.9 , 134.7 , 130.8 , 130.4 , 122.1 , 116.7 , 34.9 , 31.7 , 29.3 , 29.0 , 27.3 , 23.9 , 22.8 , 14.2 ppm ; hrms ( dart ) : m / z [ m+hi ] calcd for c17h25n2 : 257.20177 , found : 257.20179 .
general procedure for the synthesis of imidazole - based silver complexes.29 imidazolium salt ( 1.77 mmol ) was dissolved in ch2cl2 ( 15 ml ) , and silver(i ) oxide ( 0.89 mmol ) was added in one portion .
the black reaction mixture was stirred for 2 h 25 min , at which point the mixture became pale brown .
the solution was poured into a beaker containing hexanes ( 100 ml ) , resulting in precipitation of a crystalline solid .
h nmr ( cdcl3 ) : =7.52 ( m , 2 h ) , 7.39 ( m , 3 h ) , 6.98 ( s , 1 h ) , 3.82 ( s , 3 h ) , 2.29 ppm ( s , 3 h ) ; c nmr ( cdcl3 ) : =140.4 , 131.3 , 129.8 , 1286 , 124.1 , 119.0 , 36.9 , 10.0 ppm ; hrms ( dart ) : m / z [ m+hagi ] calcd for c11h13n2 : 173.10732 , found : 173.10215 .
h nmr ( cdcl3 ) : 7.54 ( d , 2 h ) , 7.42 ( m , 3 h ) , 6.95 ( s , 1 h ) , 3.84 ( s , 3 h ) , 2.58 ( m , 2 h ) , 1.65 ( m , 2 h ) , 1.30 ( m , 8 h ) , 0.89 ppm ( t , 3 h ) ; c nmr ( cdcl3 ) : =182.6 , 140.4 , 136.0 , 129.9 , 128.7 , 124.0 , 118.1 , 36.7 , 31.8 , 29.3 , 29.1 , 27.8 , 24.5 , 22.8 , 14.2 ppm ; hrms ( dart ) : m / z [ magi ] calcd for c17h25n2 : 257.20177 , found : 257.20156 .
the human cell lines molm-13 and hl60 were purchased from american type culture collection ( atcc ; manassas , va , usa ) and cultured in rpmi 1640 ( invitrogen ) , containing 10 % heat - inactivated fetal bovine serum ( ge healthcare , life sciences ) , 2 mm l - glutamine , and 50 u ml penicillin / streptomycin ( sigma aldrich ) .
evaluation of viability / apoptosis was performed as described previously.32 , 33 cell analysis after drug treatment ( 210 cells per ml ) was carried out by fixing cells in 8 % formaldehyde in pbs , dna - specific staining with hoechst 33342 ( invitrogen ; 10 g ml ) , followed by counting of normal and fragmented / condensed cell nuclei in an inverse fluorescence microscope ( zeiss axio vert.a1 ) , or by flow cytometric analysis and annexin staining .
annexin staining ( invitrogen ) was performed in accordance with the manufacturer s recommended procedure and run on the guava easycyte flow cytometer ( emd millipore ) .
the wst1 assay cell proliferation reagent ( life sciences ) was used in accordance with the manufacturer s procedure , followed by respective reading of luminescence and absorbance ( spectra max gemini em , molecular devices ) .
all cell viability assays were performed in flat - bottomed 96- or 24-well tissue culture test plates .
as a service to our authors and readers , this journal provides supporting information supplied by the authors .
such materials are peer reviewed and may be re - organized for online delivery , but are not copy - edited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors | ### Summary:
: computational chemistry has shown that backbone - alkylated imidazoles ought to be efficient ligands for transition metal catalysts with improved carbene - to - metal donation . in this work ,
such alkylated imidazoles were synthesized and complexed with silver(i ) by means of an eight / nine - step synthetic pathway we devised to access a new class of biologically active silver complexes .
the synthesis involves selective iodination of the imidazole backbone , followed by sonogashira coupling to replace the backbone iodine .
the installed alkyne moiety is then subjected to reductive hydrogenation with pearlman s catalyst .
the imidazole n1 atom is arylated by the palladium - catalyzed buchwald n - arylation method . the imidazole n3 position was then methylated with methyl iodine , whereupon the synthesis was terminated by complexation of the imidazolium salt with silver(i ) oxide .
the synthetic pathway provided an overall yield of 20 % .
the resulting complexes were tested in vitro against hl60 and molm-13 leukemic cells , two human - derived cell lines that model acute myeloid leukemia .
the most active compounds exhibiting low ic50 values of 14 and 27 m , against hl60 and molm-13 cells , respectively .
the imidazole side chain was found to be essential for high cytotoxicity , as the imidazole complex bearing a c7 side chain at the 4-position was four- to sixfold more potent than the corresponding imidazole elaborated with a methyl group . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: the role of alternative medicine in general and phytotherapy in various diseases in particular has been of extreme interest to various scientific and non - scientific communities throughout the world .
phytotherapy is broadly defined as the use of natural therapeutic agents derived from plants or crude herbal drugs .
herbal medicine has a long and respected history and holds a valuable place in the treatment of cardiovascular diseases as well as the vast majority of health problems . utilizing the leaves , flowers ,
stems , berries , and roots of plants to both prevent and treat illness , herbal medicine not only helps to alleviate symptoms but also helps to treat the underlying problem , as well as strengthen the overall functioning of a particular organ or body system.1 , 2 cardiovascular diseases are now considered a major cause of mortality not only in the developed world but also in the developing countries . in the age of genomics , nanotechnology , and proteomics ,
cardiovascular diseases continue to remain a major challenge to therapeutically manage ; and the search for a viable evidence - based alternative continues .
saffron ( crocis sativus ) is a spice derived from the flower of the saffron crocus ( crocus sativus ) , a species of crocus in the family iridaceae .
the flower has three stigmas , which are the distal ends of the plant s carpels . together with its style ,
the stalk connecting the stigmas to the rest of the plant , these components are often dried and used in cooking as a seasoning and coloring agent .
saffron , which has for decades been the world s most expensive spice by weight , is native to iran ; it was first cultivated in the persian empire.2 , 3 saffron is characterized by a bitter taste and an iodoform- or hay - like fragrance ; these are caused by the chemicals picrocrocin and safranal .
it also contains a carotenoid dye , crocin , which gives food a rich golden - yellow hue .
saffron also has medicinal applications.3 , 4 saffron tastes bitter and contributes a luminous yellow - orange coloring to foods . because of the unusual taste and coloring it adds to foods , saffron is widely used in persian , arab , central asian , european , indian , moroccan , and cornish cuisines .
medicinally , saffron has a long history as part of traditional healing ; modern medicine has also discovered saffron as having anticarcinogenic ( cancer - suppressing ) , anti - mutagenic ( mutation - preventing ) , immuno - modulating , and antioxidant - like properties .
saffron has also been used as a fabric dye , particularly in china and india , and in perfumery.1 , 2 recent studies have shown the beneficial effects of saffron in depression , premenstrual syndrome ( pms ) , and alzheimer s disease.39 antioxidants in saffron tea can reduce the risk of cardiovascular diseases .
a clinical trial at the department of medicine and indigenous drug research center showed positive effects of saffron on cardiovascular diseases.10 the study involved 20 participants , including 10 with heart diseases . according to the indian journal of medical sciences , all the participants showed improved health , but
in addition , saffron has been found to be the richest source of riboflavin.1 , 2 due to the presence of crocetin , it indirectly helps to reduce cholesterol level in the blood and severity of atherosclerosis , thus reducing the chances of heart attacks .
it may be one of the prime reasons that in spain , where saffron is consumed liberally , the incidence of cardiovascular diseases is quite low .
the crocetin present in saffron is found to increase the yield of antibiotics.11 two compounds of safranal are supposed to increase antibacterial and antiviral physiological activity in the body.12 in 2005 , zheng et al .
administered crocetin , the natural carotenoid antioxidant , to rabbits to determine its effect on the development of atherosclerosis .
the authors randomly assigned new zealand white rabbits to three different diets for eight weeks : a standard diet , a high lipid diet ( hld ) , or a high lipid + crocetin diet .
the hld group developed hypercholesterolemia and atherosclerosis , while the crocetin - supplemented group decreased the negative health effects of a high lipid diet.13 the results did not show a significant difference in the plasma lipid levels ( total , low density lipoprotein ( ldl ) , and high density lipoprotein ( hdl ) cholesterol ) between the hld and crocetin groups but did show a significant decrease in the aorta cholesterol deposits , atheroma , foam cells , and atherosclerotic lesions in the crocetin - fed group .
they suggested that nuclear factor kappa b ( nf-b ) activation in the aortas is suppressed by antioxidants such as crocetin which in turn decreases the vascular cell adhesion molecule-1 ( vcam-1 ) expression.13 a 2006 study by sheng and colleagues looked at an alternative mechanism for crocin s atherosclerotic properties.14 crocin inhibited an increase in serum triglycerides , total- , ldl- , cholesterol compared to the control group as seen before ; however , the results also showed a significant increase in the fecal excretion of fat and cholesterol in the crocin group ( 100 mg / kg / day).14 further studies determined that crocin inhibited pancreatic and gastric lipase activity , although a potential mechanism was not offered . since pancreatic lipase is responsible for fat absorption by hydrolyzing fat
, the inhibition of pancreatic lipase activity resulted in low lipid absorption . with a lack of potential pancreatic lipase inhibitors available , crocin shows promise as a drug for treating hyperlipidemia.14 in conclusion , saffron helps reduce the risk of heart diseases by strengthening the blood circulatory system .
rich in minerals like thiamin and riboflavin , saffron promotes a healthy heart and prevents different cardiac problems .
a clinical trial at the department of medicine and indigenous drug research center showed positive effects of saffron on cardiovascular diseases.10 the study involved 20 participants , including 10 with heart diseases . according to the indian journal of medical sciences , all the participants showed improved health , but
in addition , saffron has been found to be the richest source of riboflavin.1 , 2 due to the presence of crocetin , it indirectly helps to reduce cholesterol level in the blood and severity of atherosclerosis , thus reducing the chances of heart attacks .
it may be one of the prime reasons that in spain , where saffron is consumed liberally , the incidence of cardiovascular diseases is quite low .
the crocetin present in saffron is found to increase the yield of antibiotics.11 two compounds of safranal are supposed to increase antibacterial and antiviral physiological activity in the body.12 in 2005 , zheng et al .
administered crocetin , the natural carotenoid antioxidant , to rabbits to determine its effect on the development of atherosclerosis .
the authors randomly assigned new zealand white rabbits to three different diets for eight weeks : a standard diet , a high lipid diet ( hld ) , or a high lipid + crocetin diet .
the hld group developed hypercholesterolemia and atherosclerosis , while the crocetin - supplemented group decreased the negative health effects of a high lipid diet.13 the results did not show a significant difference in the plasma lipid levels ( total , low density lipoprotein ( ldl ) , and high density lipoprotein ( hdl ) cholesterol ) between the hld and crocetin groups but did show a significant decrease in the aorta cholesterol deposits , atheroma , foam cells , and atherosclerotic lesions in the crocetin - fed group .
they suggested that nuclear factor kappa b ( nf-b ) activation in the aortas is suppressed by antioxidants such as crocetin which in turn decreases the vascular cell adhesion molecule-1 ( vcam-1 ) expression.13 a 2006 study by sheng and colleagues looked at an alternative mechanism for crocin s atherosclerotic properties.14 crocin inhibited an increase in serum triglycerides , total- , ldl- , cholesterol compared to the control group as seen before ; however , the results also showed a significant increase in the fecal excretion of fat and cholesterol in the crocin group ( 100 mg / kg / day).14 further studies determined that crocin inhibited pancreatic and gastric lipase activity , although a potential mechanism was not offered .
since pancreatic lipase is responsible for fat absorption by hydrolyzing fat , the inhibition of pancreatic lipase activity resulted in low lipid absorption . with
a lack of potential pancreatic lipase inhibitors available , crocin shows promise as a drug for treating hyperlipidemia.14 in conclusion , saffron helps reduce the risk of heart diseases by strengthening the blood circulatory system .
rich in minerals like thiamin and riboflavin , saffron promotes a healthy heart and prevents different cardiac problems . | ### Summary:
: herbal medicine can be a valuable source of assistance for traditional medicine .
there are a number of herbs that can be used in conjunction with modern medicine .
herbs can also be taken to aid recovery from serious diseases .
although one should never aim to treat diseases such as cardiovascular disease solely with herbal medicine , the value of herbs used in tandem with modern medicine can not be ignored .
saffron has been reported to help lower cholesterol and keep cholesterol levels healthy .
animal studies have shown saffron to lower cholesterol by as much as 50% .
saffron has antioxidant properties ; it is , therefore , helpful in maintaining healthy arteries and blood vessels .
saffron is also known to have anti - inflammatory properties , which are beneficial to cardiovascular health .
the people of mediterranean countries , where saffron use is common , have lower than normal incidence of heart diseases . from saffron
s cholesterol lowering benefits to its anti inflammatory properties , saffron may be one of the best supplements for cardiac health .
this paper reviews the studies regarding the beneficial effects of saffron in cardiovascular health . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: computed tomography ( fdg - pet / ct ) findings in a 53-year - old woman , a case of ductal breast carcinoma , post - modified radical mastectomy status .
six years after surgery , she was found to have skeletal metastases and pet / ct was performed to evaluate baseline pre - chemotherapy disease status .
pet / ct , along with skeletal metastases , revealed a hypermetabolic stomach thickening [ figure 1 ] , which was reported as a possible primary gastric neoplasm .
endoscopic biopsy of this lesion demonstrated presence of breast carcinoma metastasis with estrogen receptor positivity [ figure 2 ] .
our case suggests that it is difficult to distinguish a stomach metastasis of breast cancer from a primary gastric cancer on the basis of clinical and imaging features .
however , this differential diagnosis must be kept in mind , and it is important to make such distinction because of its implications on patient management . the pet / ct ( a ) showed increased fdg uptake in d3 vertebra ( black arrow ) and right iliac bone ( black arrowhead ) , consistent with bone metastases .
non - specific tracer retention seen in right pelvicalyceal system is non - specific ( red arrow ) .
focal fdg uptake ( suvmax = 4.6 ) was seen in stomach ( b , arrow ) , which on ct and fused pet / ct localized to enhancing thickening along the lesser curvature of stomach extending 3 cm ( c , d , arrows ) .
endoscopy revealed elevated lesion along lesser curvature of the stomach ( e , arrow ) on histopathology , along with results of immunohistochemistry tests , the biopsied lesion was found to be metastasis of carcinoma breast , with strong expression of estrogen receptors .
the neoplastic cells marked with arrows in b and c demonstrate positive staining for cytokeratin-7 ( ck-7 ) and estrogen receptors ( er ) , respectively .
final diagnosis of stomach metastasis of breast carcinoma was made and the patient was started on hormonal therapy photomicrograph of the pathology slides ( a ) shows ductal carcinoma of the breast .
the neoplastic cells marked with arrows in b and c demonstrate positive staining for cytokeratin-7 ( ck-7 ) and estrogen receptors ( er ) , respectively .
final diagnosis of stomach metastasis of breast carcinoma was made and the patient was started on hormonal therapy . | ### Summary:
: we present fluorodeoxy glucose positron emission tomography
computed tomography ( fdg - pet / ct ) findings in a case of breast carcinoma .
the pet / ct findings in this case were suspicious of second primary neoplasm in the stomach .
however , on endoscopic biopsy , the lesion was found to be stomach metastasis of breast carcinoma with estrogen receptor positivity .
stomach is a rare site of breast carcinoma metastasis .
our case suggests that it is difficult to distinguish a stomach metastasis of breast cancer from a primary gastric cancer on the basis of clinical and imaging features .
however , this differential diagnosis must be kept in mind and it is important to make such distinction because of its implications on patient management . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: thalamic lesions give rise to a variety of clinical syndromes such as pure sensory stroke , ataxic hemiparesis , and rarely involuntary movements including chorea .
generally and classically , lacunar infarction in the subthalamic nucleus has been regarded as the lesion mainly responsible for hemi - chorea and hemi - ballismus , on the basis of previous anatomical studies .
this report describes the case of an 81-year - old man who developed sudden - onset pure hemi - chorea in the right limbs resulting from an acute phase of left thalamic lacunar infarction detected on a diffusion - weighted image ( dwi ) in an mri study .
a single - photon emission computed tomography ( spect ) study using the tc - ecd patlak plot method demonstrated significant perfusional asymmetry between the right and left thalami ( p = 0.0035 ) , consistent with the left thalamic lesion on dwi .
it is speculated that this perfusional asymmetry , in particular the hypoperfusion in the left thalamus , detected by spect might play the most important role in the contralateral pure hemi - chorea as a rare neurological manifestation in this case .
thalamic lacunar infarction resulting from arteriosclerotic thrombosis of a single penetrating artery gives rise to a variety of clinical syndromes such as pure sensory stroke , ataxic hemiparesis , painful ataxic hemiparesis , hypesthetic ataxic hemiparesis and rarely involuntary movements including tremor , asterixis , athetosis , dystonia , pseudochoreoathetosis and chorea [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 ] .
in many previous reports , various forms of hyperkinetic or hypokinetic disorders have been described following focal cerebrovascular lesions [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 ] .
however , involuntary movement disorders are very uncommon clinical manifestations in the acute phase of ischemic stroke , and particularly hemi - chorea is regarded as one of the rarest neurological symptoms [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 ] . therefore , the mechanism responsible for hemi - chorea following a cerebrovascular lesion is not yet completely understood [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 ] .
this report describes the case of an 81-year - old man who developed sudden - onset pure hemi - chorea in the right limbs resulting from an acute phase of left thalamic lacunar infarction .
this report includes a discussion of the anatomical basis for the clinico - radiological correlation and the pathophysiological mechanism of this rare condition , referring to previous literature [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 ] .
an 81-year - old right - handed man with a history of hypertension was admitted to our hospital because of involuntary movements in his right arm and leg , which had suddenly developed 5 days before admission .
his medical and familial histories were unremarkable , except for a surgical operation for a gallbladder stone at the age of 64 . on neurological examination ,
the patient had no visual field deficit and a full range of eye movement without nystagmus .
sensory evaluations including pinprick , vibratory and joint position sense were almost normal in his face , on the trunk and four limbs . other sensory disturbances including hypo- and hyperesthesia were not observed .
his right arm was affected more severely than his leg , but his face was spared .
the fine finger movements of his right hand were clumsy due to the involuntary movements ; therefore , cerebellar function tests were difficult to evaluate . while finger - to - nose testing was performed with his left hand , choreiform movements were noted in his right hand .
owing to right hemi - chorea , he tilted to the right when standing , and he was unable to walk without assistance as a result of severe gait instability .
the neuropsychological examination showed an almost normal overall cognitive state ( mini - mental state examination score = 22 ) with a mild decline in abstractive and constructive abilities .
the results of initial routine laboratory examinations were almost normal , except for slight anemia .
the blood examinations for connective tissue diseases such as rheumatoid factor and antinuclear , anticardiolipin , antiphospholipid and anti - double - strand - dna antibodies , wilson 's disease , vitamin e deficiency and acanthocytosis were all negative or unremarkable .
plaques at the origin of both internal carotid arteries , with stenosis of 30% on the right and 40% on the left , were demonstrated by echo doppler examination .
surface electromyography ( semg ) recordings were performed to evaluate his involuntary movements at the distal part of both upper limbs at rest ( fig .
the semg recordings demonstrated several synchronized grouping discharges in the right musculus brachioradialis and musculus extensor carpi ulnaris .
these grouping discharges appeared irregularly and had a relatively long duration ( > 1 s ) .
in addition , the frequency and amplitude of the grouping discharges increased remarkably under the calculation task .
these semg features were consistent with typical choreiform movements . in an initial brain magnetic resonance imaging ( mri )
study ( 1.5 tesla ) , diffusion - weighted images ( dwi ) revealed a small lesion with high signal intensity at the left thalamus suggesting an acute phase of lacunar infarction ( fig .
there was no hyperintense lesion at the striatum , subthalamic nucleus ( stn ) or globus pallidus ( gp ) on simultaneous dwi .
, the patient immediately received anti - platelet therapy ( sodium ozagrel at 160 mg / day and edaravone at 60 mg / day ) for the acute left thalamic lacunar infarction .
moreover , for the involuntary movements in his right limbs , haloperidol was administered at 0.75 mg / day . as a result of appropriate treatment
, his right hemi - chorea improved gradually . on follow - up brain mri study performed in the post - acute phase on day 14 after admission
, his left thalamic lesion had disappeared on dwi , but it remained as a chronic lesion on t2-wi ( fig .
in addition , the simultaneous t2-wi revealed diffuse and pale lesions with high signal intensity in the bilateral basal ganglia and remarkable brain atrophy in the bilateral frontotemporal lobes , suggesting chronic deficiency of cerebral blood flow ( cbf ) ( fig .
a single - photon emission computed tomography ( spect ) study using the tc - ecd patlak plot method was performed on day 18 , at the time when his right hemi - chorea had completely disappeared .
2c ) , a prominent perfusional asymmetry was observed between the right and left thalami .
the regional ( r ) cbf in the thalamus , quantified by a fully automated analysis software ,
finesrt [ mean standard deviation ( sd ) in milliliters per 100 grams per minute ] , significantly decreased by about 43.7% ( p = 0.0035 ) in the left ( 23.57 1.02 ) compared with the right ( 41.85 0.78 ) .
on the other hand , a relative increase of rcbf was revealed in the left head of the caudate nucleus ( 45.23 0.69 ) compared with that in the right head ( 39.56 0.36 ) or the left thalamus . a diffuse decline of rcbf in the bilateral frontal cortexes was observed .
thalamic lesions have been associated with various forms of involuntary movement disorders including focal dystonia , hemi - dystonia , tremor , asterixis , athetosis , ballismus , pseudochoreoathetosis and chorea [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 ] . in general , these involuntary movement disorders after ischemic stroke are regarded as really uncommon neurological manifestations [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 ] .
reported that in their study 9 patients with movement disorders were identified among 908 ischemic stroke cases ( 1% ) .
in addition , arboix et al . reported on 39 patients with atypical lacunar syndrome including movement disorders who accounted for 2.1% of all cases of acute ischemic stroke ( 1,840 ) , and only 2 patients presented with hemi - chorea and hemi - ballismus .
certainly , these involuntary movement disorders are unusual conditions in thalamic lacunar infarction compared with other common consequences such as pure sensory stroke , ataxic hemiparesis and hypesthetic ataxic hemiparesis [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 ] .
in particular , choreiform movement is one of the rarest neurological symptoms of thalamic lacunar syndrome in current clinical practice [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 ] .
generally and classically , lacunar infarction in the subthalamic nucleus has been regarded as the lesion mainly responsible for hemi - chorea and hemi - ballismus , on the basis of previous anatomical studies [ 2 , 12 , 13 , 15 ] .
fisher described delayed - onset hemi - dystonia in the distal part of the limbs as a common form of movement disorder following a focal lesion in the thalamus .
however , d'olhaberriague et al . reported that hemi - chorea and hemi - ballismus were the most common types of movement disorders and the thalamus was the most frequently damaged cerebral structure .
dejerine and roussy were the first to report on a patient with a thalamic lesion with various neurological features as having the thalamic syndrome. the typical thalamic syndrome is clinically characterized by persistent superficial hemianesthesia with deep sensory disturbance , recoverable mild ataxic hemiparesis with choreiform movements and severe spontaneous thalamic pain in the hypesthetic side . in the thalamic syndrome , damage of proprioceptive sensation is crucially important for choreiform movements [ 1 , 3 , 4 , 5 , 6 , 8 ] . in previous studies ,
hemi - chorea or pseudochoreoathetosis , which is characterized by piano - playing movements of the fingers on an outstretched hand , has been directly attributed to the proprioceptive sensory disturbance resulting from various lesions involving the sensory cortex , spinal cord , dorsal root ganglion or thalamus [ 1 , 3 , 4 , 5 , 6 , 7 , 8 , 9 ] . however , our patient had no ataxic hemiparesis or sensory defects including proprioceptive sensory disturbance , and he developed sudden - onset right hemi - chorea as the only initial manifestation of left thalamic lacunar infarction .
d'olhaberriague et al . described 2 patients who presented with hemi - chorea and hemi - ballismus without hemiparesis and hypesthesia caused by lateralized thalamic lacunar infarction .
the right pure hemi - chorea resulting from an acute phase of left thalamic lacunar infarction in our patient may be similar to the pathological conditions of these 2 patients .
the mechanism responsible for the significantly rare and interesting neurological features observed in our patient is very difficult to speculate on in terms of its anatomical basis . at present ,
the most widely accepted hypothesis , which was proposed by delong , to explain hyperkinetic disorders such as chorea or ballismus highlights the loss of stn control on the internal segment of the gp ( gpi ) , followed by the disinhibition of thalamic neurons . in this case , besides mri findings , functional neuro - imaging was obtained by tc - ecd - spect as additional information .
the remarkable hypoperfusion in the left thalamus on spect revealed a more extensive ischemic lesion than the acute lacunar infarction on the initial dwi .
these findings suggest that the damage of cerebral autoregulation and the decline of neurofunctional activity affect the periphery of the left thalamus .
the structural and functional damage in the periphery involving the thalamus suggests disruption in the various thalamic connecting fibers from the stn , gp , posterior limb of internal capsule and cerebellum , and consequently would lead to crucial derangement in the basal ganglia
therefore , it was considered that the crucial location of the thalamic peripheral damage is directly responsible for the pure hemi - chorea in this case .
in addition , the relative cbf increasing in the left head of the caudate nucleus observed on simultaneous spect reflects the activation of neuronal function in the left striatum .
this interesting phenomenon suggests that the striatal inhibitory effect toward the gp is strengthened . as a result ,
the degradation of gp , in particular gpi , activity would lead to the disinhibition of thalamic neurons .
the authors considered that the abnormal thalamo - cortical neuronal inputs due to disinhibition from gpi control would advance the appearance of the pure hemi - chorea .
in this case , the left thalamic lesion due to acute lacunar infarction detected by an initial dwi was too small to cause major neuronal manifestations of the thalamic syndrome such as ataxic hemiparesis and sensory disturbances .
in addition , it was speculated that the hypoperfusion in the periphery of the left thalamus and the hyperperfusion in the left head of the caudate nucleus observed on spect study suggested a fiber disruption and derangement in the basal ganglia
cortical circuit , and therefore these abnormal cbf alterations in the basal ganglia including thalamus and striatum would be responsible for the appearance of the contralateral pure hemi - chorea .
however , it is still unknown why only a small proportion of patients with thalamic infarction develop such involuntary movements .
the pathophysiological mechanism responsible for the choreiform movements following thalamic infarction is extremely difficult to understand and complicated ; therefore , further research and an accumulation of cases are necessary to obtain a good understanding of this issue .
| ### Summary:
: backgroundthalamic lesions give rise to a variety of clinical syndromes such as pure sensory stroke , ataxic hemiparesis , and rarely involuntary movements including chorea .
generally and classically , lacunar infarction in the subthalamic nucleus has been regarded as the lesion mainly responsible for hemi - chorea and hemi - ballismus , on the basis of previous anatomical studies.case presentationthis report describes the case of an 81-year - old man who developed sudden - onset pure hemi - chorea in the right limbs resulting from an acute phase of left thalamic lacunar infarction detected on a diffusion - weighted image ( dwi ) in an mri study .
the patient had no other neurological symptoms such as ataxic hemiparesis and sensory disturbance .
a single - photon emission computed tomography ( spect ) study using the 99mtc - ecd patlak plot method demonstrated significant perfusional asymmetry between the right and left thalami ( p = 0.0035 ) , consistent with the left thalamic lesion on dwi.conclusionit is speculated that this perfusional asymmetry , in particular the hypoperfusion in the left thalamus , detected by spect might play the most important role in the contralateral pure hemi - chorea as a rare neurological manifestation in this case . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: penetrating keratoplasty ( pk ) is the standard treatment for most corneal diseases that require surgical management.1 in low - risk clinical situations , pk is one of the most successful transplantations , with a 10-year success rate of 72%80%.24 certain conditions , however , including recurrent graft failure,5 congenital corneal opacities,6 aniridia , limbal stem cell deficiency,78 herpes zoster,910 ocular cicatricial pemphigoid ( ocp ) , stevens - johnson syndrome ( sjs),11 and ocular burns1213 have a poor prognosis with standard pk .
the risk of graft rejection and failure increases with each failed corneal transplant.14 in other words , the outcome of keratoplasty varies markedly with the underlying disease , availability and quality of donor tissue , number of previous grafts , and other undetermined factors .
this uncertainty led to decades of effort to develop a modern keratoprosthesis ( kpro ) to treat patients with corneal blindness and poor prognosis for pk .
one of the most commonly used devices in the united states is the boston type i kpro.15 outcomes of the first series of patients who underwent boston type i kpro were reported in 1974 , and the device was eventually approved by the fda ( food and drug administration ) in 1992.1617 the boston kpro provides a clear visual axis without astigmatism and with rapid visual recovery postoperatively.18 it consists of polymethyl methacrylate optic ( front ) and back plates , with donor corneal tissue clamped in between .
a recent modification to the design has incorporated 16 fenestrations in the back plate to improve nutrition to the donor corneal tissue .
also , the new threadless design has made the assembly of the device simpler and less traumatic .
the assembled donor and kpro unit is sutured into a trephined host as in a traditional pk.19 although a few case series of boston type i kpro have been reported,56 the first multicenter study was published in 2006 by zerbe et al.20 zerbe et al.20 evaluated the indications , practices , complications , and outcomes of type i boston kpro in 141 surgical procedures performed at 17 centers worldwide .
they showed that kpro is a viable option for patients with multiple failed corneal grafts or in situations of poor prognosis for primary pk .
the purpose of our study is to report the indications , outcomes , and complications of the boston type i kpro in jordan and to compare our findings with the initial multicenter reports . to the best of our knowledge ,
the boston type i kpro was obtained from the massachusetts eye and ear infirmary ( boston , usa ) .
details of the device and the surgical technique for implantation have been described in detail by zerbe et al.20 briefly , a donor button ( 8.5 mm ) is prepared and a central 3-mm hole is trephined . the donor button
is then placed over the stem of the front plate , and the back plate is then pressed into place on top .
a titanium locking ring is then snapped into place to prevent loosening of the back plate .
the recipient cornea is prepared as for a traditional pk ( the usual host trephine is 0.250.50 mm less than the donor ) .
if the patient is pseudophakic , the intraocular lens can be left in place ; in phakic patients , a lensectomy and sometimes a core vitrectomy is performed .
the donor graft with kpro is then sutured in place with multiple interrupted 10 - 0 nylon as with the standard pk . at the completion of the procedure , 400 g of intracameral dexamethasone
is often administered and a soft kontour contact lens ( kontour contact lens , richmond , ca , usa ) is placed .
all our patients had the adult type i boston kpro except for one 10-year - old male with a chemical burn who underwent a pediatric boston kpro procedure .
a retrospective chart review was conducted to identify all patients who had undergone type i boston kpro implantation from november 2007 to march 2010 at king abdullah university hospital , the only referral hospital in jordan for kpro procedures .
the study was approved by the institutional review board ( irb ) of king abdullah university hospital and jordan university of science and technology .
data gathered included demographics , diagnosis , prior surgeries , preoperative comorbidities , preoperative and postoperative visual acuities , and complications .
the boston type i kpro was obtained from the massachusetts eye and ear infirmary ( boston , usa ) .
details of the device and the surgical technique for implantation have been described in detail by zerbe et al.20 briefly , a donor button ( 8.5 mm ) is prepared and a central 3-mm hole is trephined . the donor button
is then placed over the stem of the front plate , and the back plate is then pressed into place on top .
a titanium locking ring is then snapped into place to prevent loosening of the back plate .
the recipient cornea is prepared as for a traditional pk ( the usual host trephine is 0.250.50 mm less than the donor ) .
if the patient is pseudophakic , the intraocular lens can be left in place ; in phakic patients , a lensectomy and sometimes a core vitrectomy is performed .
the donor graft with kpro is then sutured in place with multiple interrupted 10 - 0 nylon as with the standard pk . at the completion of the procedure , 400 g of intracameral dexamethasone
is often administered and a soft kontour contact lens ( kontour contact lens , richmond , ca , usa ) is placed .
all our patients had the adult type i boston kpro except for one 10-year - old male with a chemical burn who underwent a pediatric boston kpro procedure .
a retrospective chart review was conducted to identify all patients who had undergone type i boston kpro implantation from november 2007 to march 2010 at king abdullah university hospital , the only referral hospital in jordan for kpro procedures .
the study was approved by the institutional review board ( irb ) of king abdullah university hospital and jordan university of science and technology .
data gathered included demographics , diagnosis , prior surgeries , preoperative comorbidities , preoperative and postoperative visual acuities , and complications .
twenty eyes of 19 consecutive patients ( 14 males , 5 females ) between 10 years and 80 years of age ( mean age : 51.7 19.9 years ; median age : 57 years ) were included in this study .
mean postoperative follow - up was 18.1 9.5 months ( range : 336 months ; median : 17.5 months ) .
the patient who presented for the 3 months follow - up visit , died 1 month after this visit .
the median number of prior corneal transplants was 2.0 ( range : 03 ; mode : 2.0 ) the primary corneal pathologies are presented in table 1 .
vascularized corneal opacity secondary to herpetic keratitis was the most common ( eight eyes , 40% ) , followed by keratoconus ( four eyes , 20% ) [ table 1 ] .
preoperative comorbidities included glaucoma in five eyes ( 25% ) , limbal stem cell deficiency in four eyes ( 20% ) , and optic atrophy ( that was diagnosed postoperatively ) in three eyes ( 15% ) .
primary corneal pathology preoperative visual acuity was light perception in two eyes , hand motion in eleven eyes and counting fingers in -seven eyes . figure 1 shows the best corrected visual acuity ( bcva ) in patients with kpro .
postoperatively , bcva improved significantly in 85% of cases ( 17 eyes ) , and this was maintained in 70% of cases ( 14 eyes ) throughout the follow - up period .
one quarter of eyes ( five eyes ) had postoperative bcva of 20/50 or better .
bcva 20/50 was achieved in 55.6% of patients aged 55 year but in none of the patients > 55 years ( p=.008 ) .
the percentage of eyes with improved postoperative vision and the percentage of eyes achieving bcva 20/200 did not differ significantly according to age - group [ table 2 ] . in the subgroup of 15 eyes followed for at least 1 year ( median follow - up : 20 months ;
range : 1236 months ) after kpro implantation , vision improved in 86.7% of eyes ; it was 20/200 in 66.7% of eyes and 20/50 in 26.7% of eyes .
postoperative best corrected visual acuity in eyes with the boston type i keratoprosthesis the percentage of eyes with visual improvement after boston type i keratoprosthesis implantation , according to age and preoperative diagnosis the most common complication was retroprosthetic membrane ( rpm ) formation which occurred in nine eyes ( 45% ) .
other complications included extrusion of the implant in two eyes ( 10% ) , glaucoma and progression of a preexisting glaucoma in four eyes ( 20% ) , keratitis in two eyes ( 10% ) , endophthalmitis in one eye ( 5% ) and sterile vitritis in one eye ( 5% ) .
the boston kpro was developed for patients in whom a traditional full - thickness corneal transplant would likely fail.19 all the patients in our study had multiple prior failed grafts except for one patient with ocp who had a primary kpro . a previous study of boston kpro patients demonstrated that eyes with prior transplant failure due to noncicatricial causes had the best prognosis ( 83% of those achieving vision of at least 20/200 , which was maintained at 2 years ) , followed by ocp ( 72% ) , chemical burns ( 64% ) , and sjs ( 33%).15 zerbe et al.20 also reported good outcomes for patients with chemical burns and noncicatrizing graft failure [ 94% and 90% , respectively , of eyes achieving at least 20/200 vision maintained at the last follow - up ( average : 8.5 months ) ] .
we found that the best maintained outcome was in patients with noncicatrizing graft failure [ table 2 ] . with refinements in the manufacturing technique and improvements in surgical and postoperative management , patient outcomes have improved.2122 our results are consistent with previous reports .
for example , most patients had significant improvement in vision after the kpro ( 85% ) ; bcva reached 20/200 or better in 13 eyes ( 65% ) , and 5 eyes ( 25% ) had postoperative bcva of 20/50 or better .
those without significant improvement or worsening of vision generally had underlying advanced glaucoma or retinal pathology . in our series , the three eyes that showed no significant improvement in vision were found to have optic atrophy .
all eyes retained their prostheses during the follow - up period except for two ( 10% ) : one with ocp and another eye that developed melting . in both cases , there was extrusion of the kpro ( at 12 and 15 months after the implantation , respectively ) and further surgery was required to restore the integrity of the globe .
this outcome was more frequent than in the boston kpro multicenter study ( 25%),20 in prior published data ( 27%35%),23 and with alphacor keratoprosthesis ( 9.3%).24 all cases of rpm in our study were successfully treated with yag laser only .
one hypothesis is that rpm is caused by inflammatory cells reacting to the polymethyl methacrylate material of the kpro.18 however , no studies to date have proved this hypothesis .
glaucoma is a common complication after keratoprosthetic procedures.20232526 glaucoma constitutes a challenging problem that significantly affects the outcome of kpro .
some patients may have preexisting glaucoma that may progress postoperatively and others may develop glaucoma after the kpro procedure .
another challenge comes from the difficulty in assessing the intraocular pressure postoperatively as this is dependent on digital palpation .
modalities for imaging of the optic nerve head and retinal nerve fiber layer may allow reproducible surveillance of optic nerve head changes in the future.18 in our series , five eyes had prior glaucoma that was controlled with antiglaucoma medications . however , the condition in two of these eyes continued to progress and required cyclodestruction ( cyclodiode ) .
another two eyes ( 10% ) developed high intraocular pressure , which was controlled medically .
the vitreous tap showed gram - positive organisms and the patient responded to intravitreal antibiotics .
the rate of endophthalmitis has been higher in prior series ( 10.8% in the series by chew et al.18 and 12% in that by nouri et al.22 ) .
we routinely prescribe 14 mg / ml topical vancomycin to all patients undergoing kpro as previous studies have reported that this can reduce the incidence of endophthalmitis.202729 two eyes ( 10% ) developed keratitis that was treated successfully with fortified antibiotics .
one patient developed sterile vitritis ( 5% ) that was treated initially as endophthalmitis ; this patient was later found to have a negative vitreous tap and responded well to periocular steroids to the best of our knowledge , this is the first study from the middle east that reports the outcomes of boston kpro implantation over this range of follow - up .
one of the limitations of this study is the small sample size and the short follow - up of some of the cases .
this number should increase in the near future since our center is now established as a referral center for kpro procedures in the region .
boston kpro appears to be a reasonably safe and effective solution for patients with corneal blindness in whom the prognosis for natural corneal grafting is poor . | ### Summary:
: purpose : to report the indications , outcomes , and complications of the boston type i keratoprosthesis ( kpro ) from the first jordanian study on the subject.materials and methods : a retrospective chart review was conducted on 20 eyes of 19 consecutive patients who had boston type i kpro implantation at king abdullah university hospital .
surgeries were performed by the same surgeon ( ws ) from november 2007 to march 2010 .
data collected included age , sex , primary indication , number of previous grafts , preoperative comorbidities , visual acuity before and after surgery , and complications.results:the mean age of the participants was 51.719.9 years ( range : 1080 years ) .
the mean follow - up was 18.19.5 months ( range : 36 months ) .
the most common primary corneal pathology was vascularized corneal opacity ( 40% ) .
best corrected visual acuity ( bcva ) improved significantly in 85% of eyes ; 65% had a bcva of 20/200 or better and 25% had a bcva of 20/50 or better .
the most frequent complication was retroprosthesis membrane ( rpm ) formation , which occurred in 45% of eyes .
two eyes ( 10% ) had implant extrusion and required further surgery.conclusion:boston kpro offers a reasonably safe and effective solution for patients with corneal blindness in whom the prognosis for natural corneal grafting is poor . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: this justifies the constant creation of specialist diagnostic tools and development of primary and secondary preventive measures .
frailty exerts detrimental effects not only on a disease outcome but also on treatment compliance .
the term frailty syndrome ( fs ) has been existing for a long time in american geriatrics , to describe the presence of multiple comorbidities and deteriorated physical fitness in older persons .
the current definition of fs was proposed by fried who described this condition as a biologic syndrome of decreased reserve and resistance to stressors , resulting from cumulative declines across multiple physiologic systems , and causing vulnerability to adverse outcomes.1 according to the american geriatrics society , 3 principal determinants of fs are increased vulnerability to stressors , decline in physiological reserve , and malfunction across multiple organ systems , including endocrine disorders and immune dysfunction.1 while the prevalence of fs among european patients is estimated at ~17%20% , it has been shown to increase with age , to up to ~40% in subjects older than 85 years .
fs is more common in women , persons living alone , and those presenting with worse educational levels and/or lower socioeconomic status .
approximately 50% of individuals older than 65 years are at an increased risk of fs and classified as the so - called pre - frail.2 fs coexists with many aging - associated diseases , including arterial hypertension.3 the prevalence of arterial hypertension is increasing with time .
according to the global world health organization report , up to 40% of individuals older than 25 years present with an elevated arterial blood pressure , and the total number of hypertensive patients exceeds 1.5 billion.4 treatment compliance is a key determinant of efficient antihypertensive treatment .
however , the proportion of patients who comply with their medication plans is estimated at no more than 30% worldwide ; in poland , this fraction is even lower and does not exceed 5%15%.5,6 the terms compliance and adherence , used interchangeably in medical nomenclature , refer to some determinants of successful treatment outcomes , such as patient
physician cooperation , compliance with medication and dietary plans , and lifestyle modifications.7 the fact that fs may contribute to noncompliance puts a special emphasis on understanding the specific needs of patients affected by this condition .
the influence of older age and concomitant fs on treatment compliance and adherence in patients with arterial hypertension is an important issue and as such has been frequently addressed in literature . bastos - barbosa et al emphasized the influence of concomitant fs and other cardiovascular risk factors on the outcome of antihypertensive treatment.8 in addition , other authors pointed to frequent prevalence of fs in older patients with arterial hypertension.9,10 however , to the best of our knowledge , the association between fs and compliance in older patients with hypertension has not been a subject of any published studies .
the aim of this study was to analyze the effect of fs on treatment compliance in older hypertensive patients .
this study included 300 patients hospitalized at the university clinical hospital in wroclaw due to hypertensive emergencies .
the study protocol was approved by the local bioethics committee at the wroclaw medical university ( decision no 144/2016 ) .
each patient s right to withdraw from the study at any stage and the confidentiality of their responses was emphasized .
basic sociodemographic and clinical data of the study subjects were extracted from their medical documentation .
furthermore , participants were surveyed with the following 2 validated instruments :
tilburg frailty indicator ( tfi)hill - bone high blood pressure compliance scale .
tfi , developed by gobbens et al,11 consists of 2 parts with a total of 15 questions .
part a refers to physical determinants of fs ( 8 questions ) , and part b to the psychological and social determinants ( 4 and 3 questions , respectively ) .
therefore , aside from the global tfi score ( maximum 15 points ) , the values of physical , psychological , and social subscales can also be determined . a global score of 5 points or more corresponds to fs.11 in this study
, we used the polish version of tfi.12 hill - bone high blood pressure compliance scale is a measure of antihypertensive treatment compliance .
the instrument includes 14 items grouped into 3 subscales : salt intake , appointment keeping , and medication taking .
each item is scored on a 4-point scale : none of the time , some of the time , most of the time , and all the time .
the global score may range between 14 and 56 points ; the higher the score , the lesser the treatment compliance . in this study
, we used the polish version of the hill - bone high blood pressure compliance scale.13 statistical characteristics of quantitative variables are presented as means , standard deviations ( sds ) , lower and upper quartiles ( q1 and q3 ) , and minimum and maximum values ( min and max ) , and the characteristics of qualitative variables are presented as numbers and percentages . power and direction of the associations between the pairs of quantitative variables were assessed on the basis of spearman s coefficients of rank correlation ( r ) .
quality of obtained models was verified on the basis of their coefficients of determination ( r ) .
the influence of fs on treatment compliance was studied in 300 hypertensive patients ( 167 women and 133 men ) aged between 65 and 91 years ( mean 71.757.79 years ) .
the most significant relative contributor of frailty was the social component of tfi ( mean score 1.85 out of possible 3 points , that is , 61.67% of the maximum score ) , followed by physical ( 3.95 out of 8 points , 49.33% ) and psychological component ( 1.3 out of 4 points , 32.42% ) ( table 2 ) .
the mean global score of the study subjects was 20.754.11 ( range : 1434 ) with a median value equal to 20 ( interquartile range : 1823 ) .
the salt intake subscale consists of 3 items , and its maximum score may range between 3 and 12 points ; mean score of the study subjects was 4.791.17 . the maximum score of the 2-item appointment keeping subscale ranges between 2 and 8 points ;
the medication taking subscale includes 9 items ( maximum score 936 points ) ; mean score of our respondents was 12.493.3 ( table 3 ) .
the analysis of correlation demonstrated that frailty , determined with the tfi , exerted a significant effect on both the global score of the hill - bone high blood pressure compliance scale and the scores of its 2 subscales : appointment keeping and medication taking ( p<0.05 ) .
all these correlations were positive ; that is the higher the tfi score ( the more frail a given person ) , the lesser the treatment compliance ( table 4 ) .
the linear regression analysis demonstrated that the global scores of the hill - bone scale were modulated by the following ( p<0.05 ) :
sex : compared to women , the global scores of the hill - bone scale for men were 1.156 points higher on average.education : compared to subjects with primary education or lack thereof , global scores of the hill - bone scale for individuals with higher vocational or university education were 1.872 points lower on average.tfi score : a 1-point increment in the tfi score was associated with a 0.292-point increase in global score of the hill - bone scale .
sex : compared to women , the global scores of the hill - bone scale for men were 1.156 points higher on average .
education : compared to subjects with primary education or lack thereof , global scores of the hill - bone scale for individuals with higher vocational or university education were 1.872 points lower on average .
tfi score : a 1-point increment in the tfi score was associated with a 0.292-point increase in global score of the hill - bone scale .
r coefficient for this model was 40.01% , which means that variables included in the model explained 40.01% of variance in global scores of the hill - bone scale .
the remaining 59.99% of variance resulted from the influence of other variables that were not included in the model , as well as from random effects ( table 5 ) .
the linear regression analysis demonstrated that the salt intake scores were modulated by the following ( p<0.05 ) :
sex : compared to women , the salt intake scores of men were 0.288 points higher on average.occupational status : compared to occupationally active persons , the salt intake scores of retired subjects were 0.572 points lower on average.diabetes mellitus : presence of concomitant diabetes mellitus was associated with a 0.362-point increase in salt intake score.tfi score : a 1-point increment in the tfi score was associated with a 0.089-point decrease in salt intake score .
sex : compared to women , the salt intake scores of men were 0.288 points higher on average .
occupational status : compared to occupationally active persons , the salt intake scores of retired subjects were 0.572 points lower on average .
diabetes mellitus : presence of concomitant diabetes mellitus was associated with a 0.362-point increase in salt intake score .
tfi score : a 1-point increment in the tfi score was associated with a 0.089-point decrease in salt intake score .
r coefficient for this model was 13.43% , which means that variables included in the model explained 13.43% of variance in salt intake scores .
the remaining 86.57% of variance resulted from the influence of other variables that were not in the model , as well as from random effects ( table 6 ) .
no significant determinants of appointment keeping scale were identified in linear regression analysis ( p>0.05 ) .
r coefficient for this model was 23.12% , which means that variables included in the model explained 23.12% of variance in appointment keeping scores .
the remaining 76.88% of variance resulted from the influence of other variables that were not in the model , as well as from random effects ( table 7 ) .
the linear regression analysis demonstrated that medication taking scores were modulated by the following ( p<0.05 ) :
sex : compared to women , the medication taking scores of men were 0.792 points higher on average.education : compared to subjects with primary education or lack thereof , the medication taking scores of individuals with higher vocational or university education were 1.579 points lower on average.tfi score : a 1-point increment in the tfi score was associated with a 0.335-point increase in medication taking score .
sex : compared to women , the medication taking scores of men were 0.792 points higher on average .
education : compared to subjects with primary education or lack thereof , the medication taking scores of individuals with higher vocational or university education were 1.579 points lower on average .
tfi score : a 1-point increment in the tfi score was associated with a 0.335-point increase in medication taking score .
r coefficient for this model was 41.48% , which means that variables included in the model explained 41.48% of variance in medication taking scores .
the remaining 58.52% of variance resulted from the influence of other variables that were not included in the model , as well as from random effects ( table 8) .
the most significant relative contributor of frailty was the social component of tfi ( mean score 1.85 out of possible 3 points , that is , 61.67% of the maximum score ) , followed by physical ( 3.95 out of 8 points , 49.33% ) and psychological component ( 1.3 out of 4 points , 32.42% ) ( table 2 ) .
the mean global score of the study subjects was 20.754.11 ( range : 1434 ) with a median value equal to 20 ( interquartile range : 1823 ) .
the salt intake subscale consists of 3 items , and its maximum score may range between 3 and 12 points ; mean score of the study subjects was 4.791.17 .
the maximum score of the 2-item appointment keeping subscale ranges between 2 and 8 points ; mean score of the study participants was 3.471.09 .
the medication taking subscale includes 9 items ( maximum score 936 points ) ; mean score of our respondents was 12.493.3 ( table 3 ) .
the analysis of correlation demonstrated that frailty , determined with the tfi , exerted a significant effect on both the global score of the hill - bone high blood pressure compliance scale and the scores of its 2 subscales : appointment keeping and medication taking ( p<0.05 ) .
all these correlations were positive ; that is the higher the tfi score ( the more frail a given person ) , the lesser the treatment compliance ( table 4 ) .
the linear regression analysis demonstrated that the global scores of the hill - bone scale were modulated by the following ( p<0.05 ) :
sex : compared to women , the global scores of the hill - bone scale for men were 1.156 points higher on average.education : compared to subjects with primary education or lack thereof , global scores of the hill - bone scale for individuals with higher vocational or university education were 1.872 points lower on average.tfi score : a 1-point increment in the tfi score was associated with a 0.292-point increase in global score of the hill - bone scale .
sex : compared to women , the global scores of the hill - bone scale for men were 1.156 points higher on average .
education : compared to subjects with primary education or lack thereof , global scores of the hill - bone scale for individuals with higher vocational or university education were 1.872 points lower on average .
tfi score : a 1-point increment in the tfi score was associated with a 0.292-point increase in global score of the hill - bone scale .
r coefficient for this model was 40.01% , which means that variables included in the model explained 40.01% of variance in global scores of the hill - bone scale .
the remaining 59.99% of variance resulted from the influence of other variables that were not included in the model , as well as from random effects ( table 5 ) .
the linear regression analysis demonstrated that the salt intake scores were modulated by the following ( p<0.05 ) :
sex : compared to women , the salt intake scores of men were 0.288 points higher on average.occupational status : compared to occupationally active persons , the salt intake scores of retired subjects were 0.572 points lower on average.diabetes mellitus : presence of concomitant diabetes mellitus was associated with a 0.362-point increase in salt intake score.tfi score : a 1-point increment in the tfi score was associated with a 0.089-point decrease in salt intake score .
sex : compared to women , the salt intake scores of men were 0.288 points higher on average .
occupational status : compared to occupationally active persons , the salt intake scores of retired subjects were 0.572 points lower on average .
diabetes mellitus : presence of concomitant diabetes mellitus was associated with a 0.362-point increase in salt intake score .
tfi score : a 1-point increment in the tfi score was associated with a 0.089-point decrease in salt intake score .
r coefficient for this model was 13.43% , which means that variables included in the model explained 13.43% of variance in salt intake scores .
the remaining 86.57% of variance resulted from the influence of other variables that were not in the model , as well as from random effects ( table 6 ) .
no significant determinants of appointment keeping scale were identified in linear regression analysis ( p>0.05 ) .
r coefficient for this model was 23.12% , which means that variables included in the model explained 23.12% of variance in appointment keeping scores .
the remaining 76.88% of variance resulted from the influence of other variables that were not in the model , as well as from random effects ( table 7 ) .
the linear regression analysis demonstrated that medication taking scores were modulated by the following ( p<0.05 ) :
sex : compared to women , the medication taking scores of men were 0.792 points higher on average.education : compared to subjects with primary education or lack thereof , the medication taking scores of individuals with higher vocational or university education were 1.579 points lower on average.tfi score : a 1-point increment in the tfi score was associated with a 0.335-point increase in medication taking score .
sex : compared to women , the medication taking scores of men were 0.792 points higher on average .
education : compared to subjects with primary education or lack thereof , the medication taking scores of individuals with higher vocational or university education were 1.579 points lower on average .
tfi score : a 1-point increment in the tfi score was associated with a 0.335-point increase in medication taking score .
r coefficient for this model was 41.48% , which means that variables included in the model explained 41.48% of variance in medication taking scores .
the remaining 58.52% of variance resulted from the influence of other variables that were not included in the model , as well as from random effects ( table 8) .
this justifies the constant creation of specialist diagnostic tools and development of primary and secondary preventive measures .
fs may develop concomitantly to many aging - related diseases , including arterial hypertension , and exerts detrimental effects on both their outcomes and treatment compliance.14 our study included 300 hypertensive patients aged 65 years or older , with an average 13-year history of arterial hypertension .
up to 65.67% of our patients were diagnosed with fs . in the study conducted by fried et al , fs
was found in 7% of patients older than 65 years and in up to 30% of subjects above 80 years of age .
individuals with fs had a 59% greater rehospitalization risk and 28% greater risk of fall , and showed a 34% deterioration in physical fitness over a 3-year follow - up period.15 in lasa ( longitudinal aging study amsterdam ) trial , fs was diagnosed in nearly 20% of subjects older than 65 years.16 more than 50% of our study subjects presented with concomitant diabetes mellitus , and up to 30% with ischemic heart disease . according to the literature , older age is associated with a higher prevalence of comorbidities and cardiovascular risk factors , which may unfavorably affect treatment compliance .
individuals with multiple comorbidities need to take more medications , which makes them less likely to comply with their treatment plans.17,18 this was inter alia confirmed by the results of pace ( pennsylvania pharmaceutical assistance contract for the elderly ) analyzing the influence of comorbidities on treatment compliance . in this study , older patients with multiple comorbidities , including arterial hypertension , were found to be less compliant than their peers without concomitant diseases.17 presence of multiple comorbidities and lesser - level independence predispose hypertensive patients to fs . a link between arterial hypertension and frailty
was first reported by bastos - barbosa et al.8 these authors compared blood pressure levels and cardiovascular risk profiles of frail and non - frail subjects .
compared to non - frail individuals , patients with fs had a higher blood pressure over the 24 h ( 135/74 vs 122/68 mm hg ) and during sleep ( 134/72 vs 120.67 mm hg ) .
moreover , they more often presented with cardiovascular risk factors , such as abdominal obesity , dyslipidemia , and fasting hyperglycemia.8 furthermore , according to other authors , arterial hypertension frequently coexists with fs in older patients.2,18 fattori et al examined a group of brazilian patients older than 65 years , and demonstrated frequent coexistence of fs with arterial hypertension . in their study , the prevalence of fs was higher in women than in men .
moreover , frail subjects more often reported weight loss and fatigue ( 18.3% vs 12.5% , p=0.034 and 22.5% vs 11.9% , p<0.001 , respectively).2 the prevalence of fs in geriatric patients ( n=761 ) was also analyzed by ricci et al .
arterial hypertension was the most common cardiovascular risk factor , present in more than 80% of the study participants .
individuals with fs were exposed to multiple cardiovascular risk factors significantly more often than non - frail subjects.18 in our study , the most significant contributor to frailty was the social component of tfi ; this might reflect the deteriorated physical fitness of frail subjects and their greater dependence in activities of daily living .
the mean global score of the hill - bone high blood pressure compliance scale was 20.75 points ( range : 1434 ) ; based on the median value , ~50% of the subjects scored less than 20 points on this scale .
the lower the global value of the hill - bone high blood pressure compliance scale , the lesser the treatment compliance . as emphasized by cessak and spawiski , adequate compliance ( up to 100% )
in contrast , the treatment compliance of outpatients is alarmingly low.19 according to literature , the proportion of outpatients who refill their prescriptions after 6 months of treatment is lesser than 50%.20 multivariate analysis demonstrated that patients sex exerted significant effects on the global scores of the hill - bone scale as well as on the medication taking scores ; the levels of treatment compliance in men turned out to be significantly lower than in women
. published data on sex - specific differences in treatment compliance are inconclusive . in natpol study
, women showed better compliance than men and less often discontinued therapy.21 better compliance of female patients has also been documented by zaghloul and goodfield.22 slightly different results were published by gokdemir et al who did not find a significant association between patients sex and treatment compliance.23 the study conducted by matschay and turostowska included 103 patients aged 3070 years .
the subjects were divided into 2 groups : group i younger ( 3049 years ) and group ii older ( 5070 years ) .
adequate compliance was found in 47% and 69% of women from groups i and ii , respectively , as well as in 55% and 71% of younger and older men , respectively.24 our study demonstrated that higher education was associated with lower global scores of the hill - bone scale and with lower medication taking scores ; this means that subjects with higher education showed better compliance than those with only primary education or lack thereof .
while many previous studies documented better compliance and adherence in patients with higher education,2528 some authors did not observe this association.2934 intuitively , it may be expected that patients with higher educational level should have better knowledge about the disease and therapy , and therefore , be more compliant .
our study showed that the presence of fs was associated with worse compliance , namely with higher global scores of the hill - bone scale and higher medication taking scores . in medicaid study , only 20% of hypertensive patients older than 65 years showed adequate treatment compliance , which was attributed to the process of aging , inter alia to concomitant fs.35 our multivariate analysis demonstrated that aside from male sex which contributed to a significant decrease in salt intake scores , values of this scale were also significantly modulated by occupational activity .
subjects who did not work due to retirement presented with significantly lower salt intake scores than occupationally active individuals , which points to better compliance of the former .
perhaps , this phenomenon should be explained by the fact that retired persons pay more attention to their health , including energetic value of their meals . in turn
, occupational activity frequently enforces consumption of processed foods with a higher content of salt .
treatment compliance of our subjects turned out to be negatively affected by concomitant diabetes mellitus .
unfavorable effect of comorbidities on the outcome of antihypertensive treatment has been previously emphasized by bastos - barbosa et al.8 interestingly , the presence of fs was associated with better compliance of our patients in terms of salt intake .
equally surprising findings have been previously published by other authors as well.36,37 the results of these studies imply that older persons with fs may be more concerned about their health and realize that medication intake is necessary , which makes them more motivated for treatment compliance.36,37 to our best knowledge , studies on the association between fs and adherence in patients with hypertension have not been conducted to date . treatment compliance is a prerequisite of efficient antihypertensive therapy .
noncompliance may result in deterioration of health status , life - threatening complications , or even death . chronically diseased patients require extensive education and complex medical care .
medical and nursing interventions are equally important for the prevention of unfavorable consequences of frailty in older persons , and for the improvement of their treatment compliance .
the most important of these stem from the fact that our study sample was relatively small and recruited from a single center .
the most important of these stem from the fact that our study sample was relatively small and recruited from a single center .
the higher the tfi score , that is , the greater the frailty , the lesser the treatment compliance .
furthermore , treatment compliance was modulated by patients sex ( worse compliance in men ) , education ( better compliance in subjects with higher education ) and tfi scores ( worse compliance in patients with frailty syndrome ) . | ### Summary:
: backgroundfrailty syndrome ( fs ) is an important problem in older persons .
it may develop concomitantly to many aging - related diseases , including arterial hypertension , and exerts detrimental effects on both their outcomes and treatment compliance.objectiveto analyze the effect of fs on treatment compliance in older hypertensive patients.materials and methodsthis study of 300 hypertensive patients ( 167 women and 133 men ) aged between 65 and 91 years ( mean 71.757.79 years ) was based on the analysis of medical documentation and survey with the tilburg frailty indicator ( tfi ) and hill - bone high blood pressure compliance scale.resultsmean systolic and diastolic blood pressure values of the study subjects were 141.97 and 85.16 mm hg , respectively .
mean time elapsed since the diagnosis of arterial hypertension was 13.74 years .
fs was diagnosed in 65.67% of the study subjects .
mean global score of the hill - bone high blood pressure compliance scale was 20.75 points .
tfi scores correlated significantly with the global score of the hill - bone high blood pressure compliance scale ( r=0.509 , p<0.001 ) and the values of its 2 subscales : appointment keeping ( r=0.34 , p<0.001 ) and medication taking ( r=0.537 , p<0.001).conclusionfs exerts a significant effect on treatment compliance of older hypertensive patients .
treatment compliance is modulated by patients sex ( worse compliance in men ) , education ( better compliance in subjects with higher education ) , and tfi scores ( worse compliance in patients with fs ) . |
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text:
: many centers are struggling to find the resources to start services . making morphine freely available to patients
is an uphill task . a recent review studied palliative care service availability in different parts of india and found that in some states there is a ratio of one service for 1 , 66 , 198 people .
we undertook this study on the needs of informal caregivers because the role of the family in the indian setting is paramount considering the availability of palliative care services .
they usually have no training , experience or preparation for this task which is enormously taxing .
responsibilities of caregivers have extended beyond functions such as transporting patients to hospital , keeping appointments with physician , and helping patients in the activities of daily life .
more technical jobs such as intravenous injections , maintaining oxygenation of patient at home , and wound care are few stressful but routine jobs for family caregivers .
the caregiver can be seen as holding a unique position of both providing and needing support .
the world health organization promotes the importance of families receiving input from palliative care services , identifying the patient and family as the unit of care .
clinicians need to recognize that patients and their caregivers react to cancer as a unit and , as a result , they both have legitimate needs for help from health care professionals .
when caregivers needs are not addressed , their mental and physical health is at risk , and patients are denied the opportunity to obtain optimal care from a well - prepared family caregiver .
programs of care directed only toward patients are seldom sufficient to meet patients needs because so much of the patient 's care depends on family caregivers . to provide optimal comprehensive cancer care ,
the literature shows that little is known about indian family member 's experiences of being caregivers , as well as their expectations of the palliative care services . in a dutch study , osse et al
. found that most caregivers would like professional attention for four or five specific issues usually related to their competence as caregivers .
reported that five most valuable services that the caregivers would like to have are in home nursing care ( 90.7% ) , medical specialist ( 46.4% ) , family physician ( 45.6% ) , housekeeping ( 23.6% ) , and religious support ( 11.3% ) .
clayton et al . noted a desire to restrict the patient 's access to information on the part of the caregiver .
after ethics committee approval for the study , all caregivers of patients registered with the palliative care medicine department in the last 15 months were screened for the study . for the purpose of this study an informal caregiver ( icg )
was defined as a family member who provides care for a terminally ill loved one .
the department of palliative care medicine is run by the department of anesthesia through outpatient , day - care , and inpatient services .
three senior physicians , seven resident doctors , a dedicated palliative care nurse , and a counselor / social worker comprise the department .
all caregivers of patients who were registered with the clinic for at least 6 months prior to the death of the patient.patients living in jaipur city.the interview was conducted between 3 and 6 months of the death of the patient .
all caregivers of patients who were registered with the clinic for at least 6 months prior to the death of the patient .
the interview was conducted between 3 and 6 months of the death of the patient .
sixty interviews were conducted through a 4560 min interaction with an experienced counselor ( tm , mc ) who was not involved in the care of the patient or his family . of these
a semistructured questionnaire format was used to ensure that all domains were covered . the conversation with the caregivers
the interviewer also maintained field notes to increase the value of the interview , the context of certain answers or comments and comfort level of interviewees .
the caregivers were given enough time to speak on the issues so that so that themes hitherto unobserved or unexplored could emerge and be analyzed .
the interviews were conducted by an experienced counselor who was not involved in the care of the patient and the interviews were conducted in a safe place outside the premises of the palliative care unit . the interviews were recorded verbatim .
this record along with the field notes were analyzed by the team immediately after the interview .
the interviews were conducted by an experienced counselor who was not involved in the care of the patient and the interviews were conducted in a safe place outside the premises of the palliative care unit . the interviews were recorded verbatim .
this record along with the field notes were analyzed by the team immediately after the interview .
most of the informal caregivers ( 36 in the 30 to 60 year range ) and patients ( 36 in the 20 to 60 years range ) were middle aged .
twenty icg were the spouse of the patient , fourteen were children , four were parents , and two were siblings .
the needs were classified as medical , social , information , financial , and psychological needs .
while 82% were satisfied with the services of the palliative care department 17% felt the lack of home - care services .
families requested for home care by our hospital team , that is , a dedicated palliative home care service . it would really have helped if dr .
a and nurse s could have seen my wife at home ( icg 7 ) .
( icg 13 ) 95% of our caregivers had a plan of action for an emergency .
seventy - one percent felt the need of some training in care giving mainly in nursing issues ( 65% ) .
i want to spend every minute with my mother ( icg 46 ) . of the 22 icgs who wanted institutional care ,
14 thought their patient would receive better professional care , six had to travel too far for medical aid , and two felt unable to stand the deteriorating condition .
the care - giving experience drained them of energy and enthusiasm ( 45% ) and affected interactions with other family and friends .
they also had a disruption in personal routines and restriction on leisure time ( 42% ) .
fourteen felt they were irritable , ten got annoyed more easily , and twelve complained of fatigue .
i keep getting up at night to see if she is still breathing ( icg 46 ) . to the question what was your psychological / emotional reaction to your patient 's condition .
thirty - nine percent felt they were tense most of the time , 17% were anxious , and 32% were low / depressed .
to the question , did you sometimes lose hope and interest in caring ?
( icg 22 ) said i felt my mother should be relieved of suffering and pain by any means thirty icgs said no
i wanted to help as much as possible , whatever i could do(icg 11 ) .
to the question , did you sometimes feel that you wanted to be relieved of this duty ?
ten respondents said yes : during the last days ( 4 ) when her condition deteriorated ( 4 ) when he seemed to be really suffering ( 2 ) .
the icgs shared their worries and anxieties with family ( 24 ) friends ( 20 ) and their spouse ( 12 ) .
thirty patients were living in nuclear families and 24 in a joint family set - up .
the source of strength for the patient and family was mainly religion ( 36/30 ) and family ( 20/14 ) , respectively .
twenty five percent of caregivers also felt that they had reduced opportunities of career advancement due to their care - giving role .
ninety percent caregivers felt they were aware of the patient 's condition and 96% felt they were informed of all treatment options .
to the question do you think the patient should know the status of disease and prognosis ?
ten felt that the information given should depend on the individual and 18 felt that the informed patient will be better prepared mentally for end of life .
fifty percent felt that it worsens the patient 's condition in that it could cause depression ( 12 ) psychological disturbance ( 8) premature death ( 8) .
thirty - five percent icgs needed help in problems of communicating disease status and prognosis with their loved one .
the visit of family and relatives were a source of help to 40 of our icgs .
it helped in psychological support ( 24 ) , boosting the morale ( 16 ) , and preventing depression ( 16 ) .
eighteen icgs received support from socioreligious organization . during the terminal phase of the illness , the icgs of 34 patients were able to organize a family
they felt their care - giving role had affected their children 's studies ( 10 ) general care ( 8) health ( 2 ) .
similarly 14 of 20 caregivers felt they could not spend enough time with their spouses .
twenty - four icgs felt their care - giving role affected their other relationships and interactions .
fifty - two of 56 respondents felt that the patient would benefit from more counseling .
eighteen icgs were of the opinion that improved nursing care and availability of nurses would have improved patient care .
forty icgs felt the need for training in different aspects : nursing care ( 26 ) how to handle / position the patient ( 14 ) .
while 82% were satisfied with the services of the palliative care department 17% felt the lack of home - care services .
families requested for home care by our hospital team , that is , a dedicated palliative home care service . it would really have helped if dr .
a and nurse s could have seen my wife at home ( icg 7 ) .
( icg 13 ) 95% of our caregivers had a plan of action for an emergency .
seventy - one percent felt the need of some training in care giving mainly in nursing issues ( 65% ) .
i want to spend every minute with my mother ( icg 46 ) . of the 22 icgs who wanted institutional care ,
14 thought their patient would receive better professional care , six had to travel too far for medical aid , and two felt unable to stand the deteriorating condition .
the care - giving experience drained them of energy and enthusiasm ( 45% ) and affected interactions with other family and friends .
they also had a disruption in personal routines and restriction on leisure time ( 42% ) .
fourteen felt they were irritable , ten got annoyed more easily , and twelve complained of fatigue .
i keep getting up at night to see if she is still breathing ( icg 46 ) .
to the question what was your psychological / emotional reaction to your patient 's condition .
thirty - nine percent felt they were tense most of the time , 17% were anxious , and 32% were low / depressed .
to the question , did you sometimes lose hope and interest in caring ? twenty - six said yes .
( icg 22 ) said i felt my mother should be relieved of suffering and pain by any means thirty icgs said no
i wanted to help as much as possible , whatever i could do(icg 11 ) .
to the question , did you sometimes feel that you wanted to be relieved of this duty ?
ten respondents said yes : during the last days ( 4 ) when her condition deteriorated ( 4 ) when he seemed to be really suffering ( 2 ) .
the icgs shared their worries and anxieties with family ( 24 ) friends ( 20 ) and their spouse ( 12 ) .
thirty patients were living in nuclear families and 24 in a joint family set - up .
the source of strength for the patient and family was mainly religion ( 36/30 ) and family ( 20/14 ) , respectively .
only one patient had reimbursement from his employer for treatment and medication . twenty five percent of caregivers also felt that they had reduced opportunities of career advancement due to their care - giving role .
ninety percent caregivers felt they were aware of the patient 's condition and 96% felt they were informed of all treatment options . to the question
ten felt that the information given should depend on the individual and 18 felt that the informed patient will be better prepared mentally for end of life .
fifty percent felt that it worsens the patient 's condition in that it could cause depression ( 12 ) psychological disturbance ( 8) premature death ( 8) .
thirty - five percent icgs needed help in problems of communicating disease status and prognosis with their loved one .
the visit of family and relatives were a source of help to 40 of our icgs .
it helped in psychological support ( 24 ) , boosting the morale ( 16 ) , and preventing depression ( 16 ) .
eighteen icgs received support from socioreligious organization . during the terminal phase of the illness , the icgs of 34 patients were able to organize a family
they felt their care - giving role had affected their children 's studies ( 10 ) general care ( 8) health ( 2 ) . similarly 14 of 20 caregivers felt they could not spend enough time with their spouses .
twenty - four icgs felt their care - giving role affected their other relationships and interactions .
fifty - two of 56 respondents felt that the patient would benefit from more counseling .
eighteen icgs were of the opinion that improved nursing care and availability of nurses would have improved patient care .
forty icgs felt the need for training in different aspects : nursing care ( 26 ) how to handle / position the patient ( 14 ) .
caregivers experience physical , psychosocial , and economic burdens as a result of their care giving . in osse 's study ,
identified six categories : psychological , informational , patient care , personal , spiritual , and household .
significant correlations between certain caregiver characteristics and caregiver needs and between caregiver needs and patients activity levels were found .
their findings indicated the urgent need for nurses , who usually provide support for caregivers , to establish specific programs and services to meet the identified and unmet informational and psychological needs of caregivers of at - home patients with cancer .
population 82% were satisfied with the services of the palliative care department 17% felt the lack of home care services .
seventy - one percent felt the need of some training in care giving mainly in nursing issues ( 65% ) and some ( 35% ) needed help in problems of communicating disease status and prognosis with their loved one .
the care giving experience drained them of energy and enthusiasm ( 45% ) and affected interactions with other family and friends ( 42% ) .
found that the family caregivers of advanced cancer patients undergo anxiety and depression associated with stress leading to increased oxidative stress and glomerular permeability to proteins .
yousafzai et al . in the study on 200 caregivers of cancer patient in pakistan observed that a significant number of caregivers were suffering from severe stress . in our study , many caregivers also had a burden of feeling that they were unable to take care of their children / spouses due to their responsibilities as a caregiver emmanuel et al .
reported that in ten households ( of 11 ) children were obliged to miss school due to the illness . in the same study ,
all respondents indicated they would use trained caregivers to help with the care burden if available .
nine respondents thought that use of trained caregivers would have reduced or prevented some of the household 's illness - related changes . in a pilot study on patient caregiver dyads conducted in trivandrum by emmanuel et al .
researchers found that all eleven patients were obliged to give up work as a result of illness . in many families
all respondents stated illness had forced them to sell assets . according to a 1994 report from the study to understand prognoses and preferences for outcomes and risks of treatment , or support study , one - fifth of all family members of seriously ill patients had to quit work or make another major life change in order to care for their family member .
almost one - third reported the loss of all of their family savings , and 29% reported the loss of the major source of family income . in india
, this could vary in view of the different systems of health - care provision by the government and private hospitals . in our study , only one patient had reimbursement from his employer and 30 icgs had significant financial issues . a qualitative systematic review on knowledge and information needs of informal caregivers in palliative care settings revealed that the strongest inadequacy was in information regarding pain management . the significance of effective communication and information sharing between the patient , doctor , and caregiver was emphasized .
the difficulty of negotiating the concerns of the family members while also respecting the needs of the patient adds complexity to the task of discussing prognosis and end of life care issues with terminally ill cancer patients .
the informational needs of caregivers may be different from those of the patients themselves with regard to these topics .
a desire to restrict the access of the patient to information was reported by the health professionals they interviewed .
about half of our respondents also were in favor of restricting information to the patient .
twenty - two interventions were identified , comprising home nursing care ( four ) , respite services ( three ) , social networks and activity enhancement ( two ) , problem solving and education ( three ) , and group work ( 10 ) .
they concluded that carers interventions should aim to be feasible ( grounded in the theory and evidence of interventions ) acceptable ( in a format seen as useful and appropriate by carers ) accessible ( carers must be able to access services should they wish to do so ) and effective ( shown to improve intended outcomes for carers using rigorous evaluation methods ) .
the literature has also begun to identify which carers are likely to experience negative outcomes : particularly younger carers , women , and those caring for patients at diagnosis and end stages . with limitation of resources interventions
patients description of their emotional status was recorded verbatim therefore anxiety , distress , or being tense was not measured by a standardized tool .
this study has been conducted in a tertiary care private hospital on an urban population and the result may not be generalized .
ultimately people connecting in a real and meaningful way with other people is probably the only way that each of us can confront suffering and not have it destroy us . creating an environment where people can begin to , or continue to connect with others at a level that is meaningful for all concerned is a pivotal starting point in dealing with suffering in any encounter with people at the bedside and a sense of helplessness to relieve not only the patient 's suffering but also that of the people to whom the dying person is close .
the ability of a family to take care of a terminally ill cancer patient is contingent on material , social , and professional support .
this is not counting the million of hidden patients to whom the dying patient is close .
this small research provides some insight into caregiver needs : physical , medical , psycho social , and communication / information components .
palliative care services need to think of evolving a icgs program that includes basic nursing skills and emergency medical plans .
the psychosocial support of patient and their caregivers should also be given priority especially as families grow smaller and nuclear . | ### Summary:
: aims : to assess the needs of informal caregivers of terminally ill cancer patients.materials and methods : fifty four informal caregivers of patients registered in our palliative care service were interviewed 36 months after the death of the patient with the help of a semistructured questionnaire covering the physical , medical , psychological , social , and information domains.results:most of the caregivers were middle aged and had no prior experience of care giving .
the caregivers were satisfied by the information and medical support provided to them by their treatment team .
most had an emergency plan .
caregivers had unmet needs including homecare , psychological support , and financial help.conclusions:informal caregivers provide most of the nursing and psychological support to the patient
. however , palliative care services need to recognize that the caregiver too may need psychological and technical support . |