Datasets:

BEE-spoke-data
/

fineweb-synergy-20k

Dataset card Viewer Files Files and versions

Split (1)

train · 20k rows

text stringlengths 231 622k
THE WELCH COMPANY 440 Davis Court #1602 San Francisco, CA 94111-2496 415 781 5700 S U M M A R Y DIARY: October 6, 2001 11:22 AM Saturday; Gary letter on alliance to advance SDS. .....KM Not Making Progress because Not Understood .....Innovation Resisted by Big Organizations .....Productive KM Development Path Collaborate .....SDS Problem Display on Internet One Long Text String .....SDS Advantage Growing Development Synergy with Using KM .....KM Advances Information Management to Organize and Access .....Collaboration Not Effective Model for KM on Broad Global Scale ................Personal and Organizational Integrated Management .....Deployment Challenge of KM Not Development .....Little Intelligence Goes Long Way to Help Big Organizations. .....Discouraged, Disillusioned, Giving Up Needs Experience with SDS .....Organizational Memory Opportunity for Improvement Killer App .....Staff Changes Complicate Communication Reduce Productivity .....Giving Up on Improving Productivity, Hopeless Task .....Improvement Software Engineering Hopeless Task Giving Up .....Hopeless Task to Improve General Productivity 2...Trying to Understand Why Management Degrades to Entropy .........Meaning Drift Compounds Error in Large Organizations .........Uniformity from Economy of Large Scale Stiffles Innovation .........Culture of Knowledge Breakthrough Solution Killer Application ..................communication is the biggest risk in enterprise .........Good Management Must be Specified .........Wait 50 Years for Failure to Turn Market toward Improvement .....Enabling Forces Must Coalesce to Discover Opportunity Intelligence .....Bright Opportunity for Adding Intelligence to Information .....Culture of Knowledge Opportunity for Killer Application .........Throw a Match on SDS Ready to Explode on the Scene .........Killer Apps Require Being Prepared When the Light Turns Green Click here to comment! KM Progress Slow Not Understood KM Difficult Design Not Enough Known about Knowledge Need Experience Language Shapes Thoughts Alphabetic Mind Not Understood Difference, G Writing Fear Don't Know What to Write Struggle Resisted Engineers, Ma Alphabet Most Powerful Technology, Improved by SDS KM Collaboration Wide Scale Wrong Focus Needs to Start with Individua 4808 - .. 4809 - Summary/Objective 481001 - Follow up ref SDS 53 0000, ref SDS 46 0000. 481003 - Gary wants to contribute on KM. ref SDS 0 JQ6K Feels strongly a 481004 - different approach is needed that strives first to leverage personal 481005 - competence, then think about collaboration. ref SDS 0 M24K Argues 481006 - small operations can be aided by KM, but is discouraged about 481007 - improving big organizations. ref SDS 0 MO6F I am disappointed that 481008 - this strong interest did not lead to the call requested on 010719, but 481009 - understand that things get lost in the shuffle by busy people. Since 481010 - we seem to start from agreement on a wide range of issues, next step 481011 - is to figure out next steps for moving forward on a productive 481012 - alliance. ref SDS 0 KW6N At a minimum would like to get details on 481013 - the problems Gary reports encountering using SDS records on the 481014 - Internet, so that it can be fixed. ref SDS 0 TC4H 481016 - [On 011206 sent Gary copy of letter to Jack Park outlining steps 481017 - required to move forward, ref SDS 64 0001 as shown in another 481018 - record. ref SDS 63 0001 481020 - .. 481021 - [On 011214 Gary called and discussed opportunities. ref SDS 70 481022 - 0001 481024 - .. 481025 - [On 030717 suppressed indexing on this record for confidentiality. 481026 - ref SDS 90 DG4I 481032 - .. 4813 - Progress 481401 - Received ref DRT 1 0001 from Gary on frustrations trying to advance 481402 - KM. 481404 - .. 481405 - This letter supplements prior work with Gary... 481407 - Ltr suggests alliance with Gary.........011004, ref SDS 53 T86O 481408 - Analysis, writing resisted..............011004, ref SDS 53 TV3G 481409 - Letter to Gary on alliance for SDS......010719, ref SDS 46 OL8I 481410 - Gary asked about SDS....................010719, ref SDS 46 0001 481411 - Tried to create KM several times........010719, ref SDS 46 GH7I 481412 - Requests theory of knowledge............010719, ref SDS 46 YR9J 481413 - KM begin with personal management.......010408, ref SDS 40 FT4N 481414 - Background on Gary's KM efforts.........010408, ref SDS 40 0001 481418 - .. 481419 - KM Not Making Progress because Not Understood 481422 - Gary says today..... 481424 - I am intensely interested in some aspects of KM. It seems that 481425 - most of what I encounter in the area completely misses what I 481426 - consider to be the major points about the subject. ref DRT 1 0001 481428 - ...dumping all of the ideas of a huge group of people into a big 481429 - pile and hoping that the good ideas will somehow float to the top 481430 - is naive and runs counter to my experience. Therefore, I submit 481431 - that KM starts at the personal level - how can we enable an 481432 - individual to make sense of his own knowledge and the vast amount 481433 - of information that is potentially available to him and allow that 481434 - without it taking all of his time. ref DRT 1 VD5L 481436 - .. 481437 - See, also, "collaboration" below. ref SDS 0 536J 481439 - Gary made this point in his letter on 001220, ref SDS 39 TQ4H 481440 - which is why I contacted him on 010719 to suggest alliance, 481441 - after he asked about SDS. ref SDS 46 OL8I 481443 - POIMS explains this design, and SDS implements it, so why 481444 - hasn't Gary commented on POIMS? ref OF 1 6221 481446 - [On 011010 SDS records manage complexity of human memory. 481447 - ref SDS 56 TP6G 481449 - .. 481450 - [On 011206 sent Gary copy of letter to Jack Park 481451 - outlining steps required to move forward, ref SDS 64 0001 481452 - as shown in another record. ref SDS 63 0001 481454 - .. 481455 - SDS enables people to grab up information that comes in a 481456 - continuous stream and add "intelligence" to create knowledge 481457 - (structure based on chronology that shows causation) that is 481458 - managed within a framework of evolving context based on human 481459 - needs, objectives, requirements and commitments. This 481460 - planning and taking action. Good things like listening, 481461 - understanding and follow up are enabled by SDS, which are 481462 - vital to saving time and money on the job, as reported on 481463 - 890809. ref SDS 1 CJ9J Innovation Stifled Big Organizations Big Organizations Stiffle Innovation Clueless Big Organizations about What they are Doing Aerospace company torola Big Companies Reject Welch, Too Small Inoculated by Success Blinds Executives, Managers, Engineers to Need Grove Walking Through Valley of Death Leaders Overcome Fear, Ignoranc Change Fear Resisted Ignorance Denial, Overcoming Walking Through Val Bad Management Fools Gold Attractive Fast Easy of Conscious Response 721101 - .. 721102 - Innovation Resisted by Big Organizations 721105 - Gary relates weakness of big organizations... 721107 - My experience indicates that large groups rarely accomplish what 721108 - they set out to do. A "skunk works" level project is the most 721109 - likely to achieve its goals if it works as is should. The major 721110 - requirements for a "skunk works" are that the group be small 721111 - enough for full collaboration, and that nobody in the group is in 721112 - a position where his ideas have to be accepted for any reason 721113 - other than their value in advancing the solution of the problem(s) 721114 - under investigation. ref DRT 1 JE6K 721116 - .. 721117 - See also Gary's discussion of "collaboration" below. 721118 - ref SDS 0 536J 721120 - .. 721121 - I work as a contractor at places like Motorola, Rockwell, and 721122 - Aerospace company. These groups are uniformly clueless abut what 721123 - they are doing, and show little to no interest in doing a better 721124 - job of any part of it. ref DRT 1 YE7J 721126 - Reflects experience showing success inoculates people against 721127 - improvement, cited by Grove in his book "Only the Paranoid 721128 - Survive" reviewed on 980307. ref SDS 21 3740 and ref SDS 22 721129 - 1660 721131 - [On 020608 Jim Reekes is delayed responding on his 721132 - initiative due to information overload. ref SDS 82 0001 721134 - .. 721135 - Aligns with Clay Christensen's book on Innovator's Dilemma, 721136 - reviewed on 990527. ref SDS 25 1300 721138 - .. 721139 - Lockheed's Skunk Works is an effort to empower people to use 721140 - project management effectively, as set out in professional 721141 - publications like PMBOK and ISO 10006 reviewed on 950721. 721142 - ref SDS 11 0001 Social pressure of large scale organizational 721143 - culture prevents using good management, as related previously 721144 - on 990527. ref SDS 25 1233 721146 - [On 020504 government regulations for federal acquisitions 721147 - (FAR) calling out good management practices are not 721148 - implemented nor enforced by the government, because there 721149 - isn't enough time using the tools and methods everybody 721150 - likes. ref SDS 80 IY4I 721152 - .. 721153 - Gary's feeling that the major requirement for productive work 721154 - is using small groups willing to entertain ideas to improve is 721155 - not supported by the record, which shows that complexity and 721156 - the increasing pace of information are much bigger factors 721157 - that paralyze productivity in a hopeless quagmire that makes 721158 - communication the biggest risk in enterprise, as reported on 721159 - 011003. ref SDS 52 EC5N and further at ref SDS 52 O76L 721161 - .. 721162 - Intelligence is the only remedy. 721164 - [On 020114 an example is that Gary wants addressability in 721165 - daily information, yet resists linking to addressability 721166 - that strengthens communication on the grounds that linking 721167 - is too hard, yet further fails to get free assistance to 721168 - discover that linking is fast and easy. ref SDS 75 3H7J 721170 - .. 721171 - [On 020710 Skunk Works or any other project management 721172 - method will exceed an unlimited budget if the underlying 721173 - science is not known. ref SDS 84 0001 721175 - .. 721176 - [On 020718 Eric Armstrong relates ingredients for Manhattan 721177 - Projects to be successful, which employ aspects of Skunk 721178 - Works, on a larger scale. ref SDS 85 PQYP Alliance on Advanding SDS Wants to Collaborate on KM Development Path Johnson, Gary Reports Problem Reviewing SDS Records on the Internet Johnson, Gary Wants to Develop Dialog on Productive Path Culture of Knowledge Johnson, Gary Reports One Long String of Text Records on Internet 801001 - .. 801002 - Productive KM Development Path Collaborate 801005 - Gary says... 801007 - I would like very much to develop a dialog that would lead to a 801008 - productive path in this area. ref DRT 1 VE7O 801010 - .. 801011 - I really want to thank you for getting back to me. I would love to 801012 - explore how and with whom productive collaborations could evolve. 801013 - There are numerous problems that could be addressed effectively if 801014 - approached from a workable perspective, and I would like to be a 801015 - part of such an effort. ref DRT 1 01DR 801017 - .. 801018 - Seems to provide basis for making progress on development and 801019 - deployment, responding favorably to the letter on 011004, 801020 - ref SDS 53 T99J, and the record on 011003 showing SDS is the 801021 - strongest KM technology. ref SDS 52 Y18H 801023 - [On 011207 sent Gary copy of letter to Jack Park 801024 - outlining steps required to move forward, ref SDS 64 0001 801025 - as shown in another record. ref SDS 63 0001 801027 - .. 801028 - [On 011210 Gary inquires about SDS and alliance to 801029 - advance KM. ref SDS 65 ZS9K 801031 - .. 801032 - [On 011222 Gary reviews SDS publications. ref SDS 72 0001 801034 - .. 801035 - [On 020108 Gary contacts Morris about SDS. ref SDS 74 801036 - V55N 801038 - .. 801039 - This follows up the letter on 010719 explaining need to bring 801040 - people together who are ready, willing and able to move ahead. 801041 - ref SDS 46 004K 801043 - .. 801044 - The letter on 010719 gave my phone number and asked Gary to 801045 - call, but he did not follow up. ref SDS 46 00FL Hopefully, 801046 - this time we can can least explore getting something done. 801048 - .. 801049 - Planning a first step is in the record on 011004. ref SDS 53 801050 - OL5J 801052 - .. 801053 - Moving forward requires an agenda to take action. Some 801054 - possible actions we can take are.... 801056 - 1. Telephone call to explore personalities, and kick 801057 - around big picture issues. 801059 - [On 011214 Gary calls about SDS. ref SDS 70 OY7M 801061 - .. 801062 - 2. Translate Gary's general support of POIMS concepts into 801063 - a specific letter on SDS and POIMS for OHS/DKR. There 801064 - is little likelihood this will help anybody on OHS/DKR, 801065 - for reasons in Gary's letter today, ref DRT 1 01BP, but 801066 - it will give Gary a chance to develop his thinking 801067 - about SDS and POIMS in relation to his view of things 801068 - and nominal objectives of KM and OHS/DKR. 801069 - .. 801070 - 3. Meet for demonstration of SDS, similar to meeting 801071 - with Pat Lincoln at SRI on 100517. ref SDS 42 0001 801072 - .. 801073 - 4. Develop deployment scenarios for using SDS in 801074 - Gary's work per his point on this matter. ref SDS 0 801075 - KA4H 801077 - .. 801078 - 5. Consider development and ownership arrangements to role 801079 - Gary's experience and expertise into SDS capability so 801080 - he has a way to realize his goals for KM. 801082 - .. 801083 - [On 011207 sent Gary copy of letter to Jack Park outlining steps 801084 - required to move forward, ref SDS 64 0001 as shown in another 801085 - record. ref SDS 63 0001 801087 - .. 801088 - [On 011210 received letter from Gary concurring with deployment 801089 - strategy, asking about how to implement. ref SDS 65 9H6H 801091 - .. 801092 - [On 020108 Gary contacts Morris with questions about updating SDS 801093 - program. ref SDS 74 V55N SDS Problem One Long Stream of Text Johnson, Gary Reports Problem Reviewing SDS Records on the Internet Long String of Text Records on Internet, Gary Reports Problem HTML Conversion Not Displaying Correctly in Opra Browser, Gar 840701 - .. 840702 - SDS Problem Display on Internet One Long Text String 840705 - Gary reports problem using SDS on the Internet.... 840707 - I have difficulty following the SDS pages. Perhaps there is 840708 - something I don't know about navigating them, but I get one long 840709 - stream of text with embedded links. It looks like it depends on a 840710 - formatting engine for effective use? ref DRT 1 5F8I 840712 - Need details of this problem to investigate and correct. 840714 - .. 840715 - [On 011210 Gary reports using Microsoft IE solves the problem. 840716 - ref SDS 65 K54K 840718 - .. 840719 - [On 020106 received explanation of problem. ref SDS 73 ZS3G 840721 - .. 840722 - [On 021114 improvements to SDS fixed problems. ref SDS 86 0001 SDS Useful Capability Explained in POIMS Software Engineers Don't Know How to Design Programs that Enable Comp Unique Design because Faith Needed to Try SDS New Way of Working Peop SDS Secret Industry Doesn't Know How to Design KM Experience SDS Understand Architecture Computers to Design KM, 000531 Programmer Using SDS Provided Immediate Feedback to Refine Design for Innovation Loop Knowledge Avoids Mistakes Brings Accountability Feare Unique Character of Communication Metrics KM Only SDS Design a Secret, 000425 SDS Design Aided by Synergy from Daily Use Programmers Don't Know What to Program to Improve Management KM Development Stalled by Lack of Experience Doing KM Need Synergy be AN1501 - .. AN1502 - SDS Advantage Growing Development Synergy with Using KM AN1504 - Follow up AN1506 - Gary recognizes advantage of synergy between developing and doing AN1507 - KM.... AN1509 - What I did get is that several large companies have given up on AN1510 - KM, and that at least part of the problem is that the engineers AN1511 - who develop the software are sufficiently disconnected from the AN1512 - problem and from the people for whom they are trying to solve it AN1513 - that most of what they produce is unsuitable for the task AN1514 - intended. This has certainly been my experience. AN1516 - [On 030525 Gary reports progess improving technology and AN1517 - the quality of management by using SDS for Com Metrics. AN1518 - ref SDS 89 FL5K AN1520 - .. AN1521 - Gary does not mention nor link the SDS record he reviewed that AN1522 - led to his comments. The letter to him on 011004, ref DIP 6 AN1523 - DY6O, cited the record on 010924 where the disconnect he AN1524 - mentions is discussed. ref SDS 51 NK4J KM Advances Information Management Organize Present Access Intelligence Collection Aligns Organizational Memory Continual Learni Collaboration Provisions in Augment, 1984 Paper Collaborative Document System, Email, Eric, 000505 Personal Level Starts KM Aligns with POIMS Organization Everything in Right Place at Right Time SDS Utopia for O Organizational Memory Finding Every Little Thing SDS Enables Finding Technology Useful Interface SDS KM Structure Time Subjects Useful to AZ1101 - .. AZ1102 - KM Advances Information Management to Organize and Access AZ1103 - Collaboration Not Effective Model for KM on Broad Global Scale AZ1106 - Gary continues point KM starts at personal level. ref SDS 0 M24K AZ1108 - Here again, I believe that at least part of the problem that KM AZ1109 - faces is that it is trying to figure out how to allow thousands to AZ1110 - millions of people to collaborate in some meaningful way, and that AZ1111 - is largely absurd. ref DRT 1 DD9F AZ1113 - .. AZ1114 - Restated later, ref DRT 1 EG6O, and again because problem is very AZ1115 - clear to Gary. ref DRT 1 015Q AZ1117 - .. AZ1118 - POIMS argues collaboration is not the primary objective of KM, AZ1119 - ref OF 1 K84L, and further agrees with Gary that improvement AZ1120 - begins with individual people at the personal level.... AZ1123 - .. AZ1124 - Personal and Organizational Integrated Management AZ1127 - ....is an effective model, per above. ref SDS 0 XR4I AZ1129 - This adjusts Doug Engelbart's idea of collective IQ, reviewed AZ1130 - on 991222, ref SDS 29 8064, and, also, on CODIAK, ref SDS 29 AZ1131 - 0784, based on consideration of scale, which Doug urges. AZ1132 - ref SDS 29 1596 So, there may not be a lot of disagreement AZ1133 - with Doug on this point. AZ1135 - .. AZ1136 - Gary says.... AZ1138 - There is an aspect of KM that grows out of information management AZ1139 - that deals with how to organize and present information for ease AZ1140 - of access and use. This scales up to global level, except that AZ1141 - there is very little that is globally interesting. Global AZ1142 - accessibility is useful, but the fact is that the vast majority of AZ1143 - people won't be using any such tools. This is essentially a AZ1144 - publishing and library model. It supports collaboration only in AZ1145 - the sense that it makes it possible to discover who else is AZ1146 - working in the same area so that efforts can support one another AZ1147 - and evolve into collaborations. ref DRT 1 5171 AZ1149 - .. AZ1150 - I may disagree slightly based on experience using SDS. AZ1152 - .. AZ1153 - Alphabet technology scales up nicely by enabling a lot of AZ1154 - people to leverage native intelligence. AZ1156 - .. AZ1157 - On 010811 set out opportunity for lifting performance of a lot AZ1158 - of people a little, and of a few people a lot, ref SDS 47 AZ1159 - SE6J, that has the net effect of lifting civilization, as AZ1160 - called out in POIMS. ref OF 1 5418 Same point was made on AZ1161 - 000624. ref SDS 33 QX7N AZ1163 - .. AZ1164 - We are trying to help millions of people think, remember and AZ1165 - communicate, which will strengthen the ability to collaborate. AZ1166 - Enhancing alphabet technology by integrating time management AZ1167 - with information management is accomplished by SDS, explained AZ1168 - by POIMS. ref OF 1 1299 AZ1170 - .. AZ1171 - So, we agree information management is part of the issue to be AZ1172 - addressed. We agree KM does not enable anyone to collaborate AZ1173 - with everyone; but, it does greately increase the ability to AZ1174 - collaborate. That is a big improvement. AZ1176 - .. AZ1177 - My sense is that organizational memory can be captured on a AZ1178 - much wider scale, and this can be used effectively by people AZ1179 - individually and in teams to improve productivity, as shown in AZ1180 - the record on 010907. ref SDS 48 KX3L AZ1182 - .. AZ1183 - Implementation is aided by a professional role to facilitate AZ1184 - using SDS by teams, which I call a Communication Manager, as AZ1185 - explained in NWO. ref OF 2 6369 This combination of tools, AZ1186 - practices and support has demonstrated ability to improve AZ1187 - performance in large organizations, and to gain acceptance, AZ1188 - once on the job, per below. ref SDS 0 KX7O AZ1191 - .. AZ1192 - Gary continues... AZ1194 - When KM starts to talk about collaboration, it seems to think that AZ1195 - collaboration has to do with the interaction of huge numbers of AZ1196 - people. I disagree. Problems are not solved by groups, AZ1197 - particularly large groups. ref DRT 1 KF5F AZ1199 - Re-states point above. ref SDS 0 CQ4J AZ1201 - .. AZ1202 - There is a component of the solution to global problems that has AZ1203 - more to do with getting agreement than with any technical or AZ1204 - knowledge aspects of solving the problem. Many of the global AZ1205 - problems admit of some sort of technical solution - it is getting AZ1206 - that solution implemented that is the issue. One of the major AZ1207 - components of several of these issues is the "Commons Problem" - AZ1208 - how to manage a common shared resource where there is short term AZ1209 - gain to be had by misusing or dominating the resource while the AZ1210 - only long term gain involves some sort of balance among the AZ1211 - participants. There are local solutions to this problem, but I AZ1212 - have never seen an approach that purports to treat the general AZ1213 - case. ref DRT 1 4F5K AZ1215 - .. AZ1216 - This sounds in part like the binary tension between sequential AZ1217 - and parallel action discussed in POIMS. ref OF 1 8774 AZ1219 - .. AZ1220 - SDS pilot testing might help address the "general case" that AZ1221 - Gary has in mind. AZ1223 - The record on 010907 lists experience indicating SDS aids AZ1224 - productivity for individuals, teams, projects, departments AZ1225 - agencies and across organizations. ref SDS 48 KX3L AZ1227 - .. AZ1228 - Gary may be able to comment on whether this applies to his AZ1229 - objective for a "general case." AZ1231 - .. AZ1232 - Collaboration enabled by SDS is taking complementary rather AZ1233 - than conflicting action, which increases productivity by an AZ1234 - order of magnitude. see POIMS. ref OF 1 2301 and NWO AZ1235 - ref OF 2 4077 Disillusioned GUI Interface Hopeless Quagmire Information Overload An Giving Up Computers Productivity Managers Reduced by Computers, Lost Software Projects Get Fouled Up at Aerospace company Due to Changing Pe onnel Deployment Experience Needed for KM before Further Development Pilot Test to Discover Technology Useful to Managers Improve Large Organizations Hopeless, Gary Intelligence Natinal Security Survival Performance Exceeds Care About Bumbling Caused by Meaning Drift Murphy's Law Find Everything Memory Amazing SDS Mechanisms Obviously Work, Eric Ar Aerospace company Case Study Example Failed Commercial Management Techn ogy Pro Overwhelming Tendency Bad Management Technology Examples Mizolla Linu Communication Fails Personnel Changes Productivity Falls Until New St Specify Good Management Contract Requirements Because Nobody is Ever Management Fails Projects Get Fouled Up Because Big Organizations Big CP1701 - .. CP1702 - Deployment Challenge of KM Not Development CP1705 - Gary notes.... CP1707 - At one time Doug said that the tools he had available were such CP1708 - that further improvement was not useful until it was possible to CP1709 - figure out how to develop the communities of people who could use CP1710 - them effectively. It seems to me that this is still the case. CP1711 - ref DRT 1 00EK CP1713 - I agree. Alliance with Bootstrap was investigated on 991222 CP1714 - for developing alliances on deployment of SDS that implements CP1715 - Doug's ideas. ref SDS 29 3072 CP1717 - .. CP1718 - Deployment requires testing across a broad range to discover CP1719 - what to develop next, and to give technologists experience CP1720 - needed to create useful tools. This has been presented to CP1721 - OHS/DKR, to Doug Engelbart and to SRI.... CP1723 - Notified Doug need education on KM...000301, ref DIP 7 0001 CP1724 - Deployment gain experience doing KM..000327, ref SDS 32 4420 CP1725 - Use SDS to learn KM..................001121, ref DIP 9 01BS CP1726 - SRI use SDS research KM..............010711, ref DIP 4 0162 CP1728 - .. CP1729 - The effort has not paid off because engineers trying to create CP1730 - KM don't want to learn how to create KM; and, people are CP1731 - afraid of trying a new way of working for reasons on 890809, CP1732 - ref SDS 1 U87H, cited more recently on 010522. ref SDS 43 3T5K CP1734 - [On 011102 met with Pat Lincoln to install SDS on his CP1735 - computer for trying KM. ref SDS 58 5N6G CP1737 - .. CP1738 - [On 011120 discussed deployment with Doug. ref SDS 62 XC9H CP1741 - .. CP1742 - Little Intelligence Goes Long Way to Help Big Organizations. CP1743 - Discouraged, Disillusioned, Giving Up Needs Experience with SDS CP1744 - Organizational Memory Opportunity for Improvement Killer App CP1746 - Follow up ref SDS 52 EC5N. CP1748 - Gary worries about leveraging help for individuals in large groups... CP1750 - Part of what keeps me from pursuing this as intensely as I would CP1751 - like, aside from limited time and resources, is that I can't see a CP1752 - way past the problems of large organizations on the one hand and CP1753 - the limited resources of small groups on the other. ref DRT 1 018M CP1755 - .. CP1756 - On 010719 Gary made a similar report about difficulty managing CP1757 - large organizations. ref SDS 46 YR9J CP1759 - [On 020315 Gary explains management challenges that occur CP1760 - in large organizations. ref SDS 79 CP5K CP1762 - .. CP1763 - Experience shows that large organizations are most susceptible CP1764 - to being helped by SDS because...... CP1766 - 1. Adding intelligence to management reduces meaning drift, CP1767 - explained in NWO. ref OF 2 4077 A small improvement to CP1768 - maintaining shared meaning is compounded in a large CP1769 - organization like compound savings in a bank, discussed CP1770 - on 011005 to overcome fear about being "pinned down." CP1771 - ref SDS 54 9V5G CP1773 - .. CP1774 - [On 011212 letter to Gary makes this point. ref SDS 69 CP1775 - MX5K CP1777 - .. CP1778 - [On 011222 Gary requests evidence that mistakes can be CP1779 - reduced. ref SDS 72 319L CP1781 - .. CP1782 - Since people only remember about 5% of the gist of CP1783 - things, multiplying 95% loss of memory across a large CP1784 - organization increases the rate of error by an order of CP1785 - magnitude, resulting in continual bumbling for the CP1786 - reasons set out in NWO. ref OF 2 4077 CP1788 - .. CP1789 - This presents a huge opportunity for improvement because CP1790 - a little intelligence makes a big difference, as noted CP1791 - in a letter yesterday. ref SDS 54 YL6H CP1793 - [On 030416 Gary's record on 030413 reports progress CP1794 - learning SDS for performing 8 steps of Com Metrics CP1795 - to save time and money by working intelligently. CP1796 - ref SDS 88 7P5F CP1798 - .. CP1799 - [On 040330 Gary receives "good to go" on using SDS CP1800 - for Com Metrics to deliver "intelligence" anytime, CP1801 - anywhere on the Aerospace company network. ref SDS 95 OP5I CP1803 - .. CP1804 - 2. Bumbling is so rampant in large organizations that any CP1805 - improvement in maintaining shared meaning is multiplied CP1806 - many times over, as listed in the record on 010907. CP1807 - ref SDS 48 KX3L CP1809 - .. CP1810 - 3. Experience shows people fight hard to avoid using SDS in CP1811 - the beginning because good management requires CP1812 - accountability which is feared based on experience using CP1813 - "documentation," reported on 980405, ref SDS 23 3307, CP1814 - and lack of experience with intelligence, as reported on CP1815 - 890809. ref SDS 1 U87H CP1817 - .. CP1818 - [On 020131 Don Rumsfeld, Secretary of Defense, cites CP1819 - cultural forces that resist improvement in big CP1820 - organizations, and offers ideas to make progress. CP1821 - ref SDS 76 0001 CP1823 - .. CP1824 - However, once on the job, application is endless with CP1825 - people lining up begging for intelligence. It is a CP1826 - veritable epiphany because people hunger for better CP1827 - listening, understanding and follow up, as explained in CP1828 - the letter yesterday. ref SDS 54 9V5G CP1830 - .. CP1831 - See for example the meeting at USACE on 961101, CP1832 - ref SDS 15 8888; and results reported by the president CP1833 - of Dutra on 970107. ref SDS 16 4953 CP1837 - .. CP1838 - Staff Changes Complicate Communication Reduce Productivity CP1839 - Giving Up on Improving Productivity, Hopeless Task CP1840 - Improvement Software Engineering Hopeless Task Giving Up CP1841 - Hopeless Task to Improve General Productivity CP1843 - Gary notes projects get fouled up due to changing personnel.... CP1851 - .. CP1852 - I already know enough to be able to revolutionize the way work is CP1853 - conducted at the Aerospace company group where I work, for CP1854 - example, but getting any sort of improvement in the general CP1855 - operation is essentially a hopeless task. ref DRT 1 2Q6I CP1857 - On 010719 Gary made a similar report about difficulty managing CP1858 - large organizations. ref SDS 46 YR9J CP1860 - [On 060905 subject index sharing model for multi-level CP1861 - organic structure is a "hopeless task." ref SDS 99 HZ4O CP1863 - .. CP1864 - [On 070904 Gary Johnson cites need for "testbed" software CP1865 - platform to experiment developing Knowledge Management CP1866 - support based on feedback from routine use for CP1867 - accomplishing daily work. ref SDS 90 DV4R CP1869 - .. CP1870 - Would like to get sense of Gary's ideas to revolutionize work. CP1872 - .. CP1873 - SDS provides a new way of working reported on 001219, CP1874 - ref SDS 38 QT6F, and it has demonstrated ability to provide CP1875 - intelligence, ref DRP 4 6172 that yields savings in the range CP1876 - of 10:1, reported by USACE. ref DRP 5 0001 CP1878 - [On 011210 Doug Engelbart reports SDS provides unique and CP1879 - comprehensive system and associated methodologies. CP1880 - ref SDS 66 JL5I CP1882 - .. CP1883 - [On 011210 report SDS enables KM, unique capability that CP1884 - has eluded experts. ref SDS 67 0001 CP1886 - .. CP1887 - [On 020114 Gary wants addressability in daily information, CP1888 - yet resists linking to addressability that strengthens CP1889 - communication on the grounds that linking is too hard, yet CP1890 - fails to get free assistance to discover that linking is CP1891 - fast and easy. ref SDS 75 3H7J CP1893 - .. CP1894 - [On 020131 Don Rumsfeld, Secretary of Defense, cites CP1895 - cultural forces that resist change in big organizations, CP1896 - and offers ideas to make progress. ref SDS 76 0001 CP1900 - .. CP1901 - Trying to Understand Why Management Degrades to Entropy CP1903 - Gary continues... CP1905 - I am trying to understand how such a project (Aerospace company CP1906 - Space Station software) gets so fouled up in the first place. The CP1907 - combined decisions made by the (constantly changing membership) CP1908 - group over time are worse than those that would be made by nearly CP1909 - any single individual. This tends to select for people who will CP1910 - put up with the idiocy, resulting in a large number of people who CP1911 - are less than competent, and a far larger group who have given up CP1912 - trying to improve matters to the level they know could be done CP1913 - because of the massive inertia. ref DRT 1 DQ6N CP1915 - .. CP1916 - [On 011105 Jeff says SDS support for Com Metrics under the CP1917 - POIMS technology specification, ref SDS 61 4S6H, is a step CP1918 - in the right direction to implement management standards CP1919 - for documenting accurate communications, ref SDS 41 QZ3O, CP1920 - because SDS work product "walks the talk" of organizational CP1921 - memory that enables people to work intelligently. CP1922 - ref SDS 61 6T6O CP1924 - .. CP1925 - [On 011213 Gary called and discussed need for better way CP1926 - to organize information and plan the work. ref SDS 70 YB4G CP1928 - .. CP1929 - [On 011222 Gary submits review of USACE report that CP1930 - explains why problems occur, and how Com Metrics helps. CP1931 - ref SDS 71 OM3G CP1933 - .. CP1934 - [On 011222 Gary wants evidence mistakes can be reduced. CP1935 - ref SDS 72 319L CP1937 - .. CP1938 - [On 020114 Gary wants addressability in daily information, CP1939 - yet resists linking to addressability that strengthens CP1940 - communication on the grounds that linking is too hard, yet CP1941 - fails to get free assistance to discover that linking is CP1942 - fast and easy. ref SDS 75 3H7J CP1944 - .. CP1945 - [On 020217 DOD program manager explains need to support CP1946 - FAR requirements for documenting work showing accurate CP1947 - communications that save lives, time and money, CP1948 - ref SDS 78 1332; when people cannot point to an accurate CP1949 - record they point fingers in accusation and blame to avoid CP1950 - accountability for mistakes. ref SDS 78 9360 SDS offers a CP1951 - direct solution to make management productive. ref SDS 78 CP1952 - 3105 CP1954 - .. CP1955 - [On 020315 Gary reports ISS project started late and so CP1956 - work was begun already behind schedule, which forced people CP1957 - to try taking short cuts on good management, which CP1958 - increases mistaks that escalate rework, delay and extra CP1959 - cost. ref SDS 79 PD6N and ref SDS 79 0113 CP1961 - .. CP1962 - [On 020504 study shows professional standards for CP1963 - communication practices and requirements on good management CP1964 - specified in FAR, ISO, Health Care, Covey, Drucker, law, CP1965 - contract notice provisions, and 2,000 years of literacy for CP1966 - contemporaneous documentation for alignment and feedback to CP1967 - work intelligently, quickly, and accurately are ignored in CP1968 - government, business, health care, every sector. CP1969 - ref SDS 80 NS6F CP1971 - .. CP1972 - [On 020522 huge gaps between requirements and design and CP1973 - implementation. ref SDS 81 T29G CP1975 - .. CP1976 - [On 020618 Gary comments on challenges improving CP1977 - productivity on ISS project. ref SDS 83 PQRW CP1979 - .. CP1980 - [On 030123 new project at Aerospace company starting out late, already CP1981 - behind schedule, reduces time for using good management. CP1982 - ref SDS 87 Y55G CP1984 - .. CP1985 - [On 030416 Gary's record on 030413 reports progress CP1986 - learning SDS for performing 8 steps of Com Metrics to save CP1987 - time and money by working intelligently. ref SDS 88 7P5F CP1989 - .. CP1990 - [On 040826 testimony before Congress by Sean O'Keefe cites CP1991 - culture of denial that prevents communication speaking CP1992 - truth to power in bureaucracy, cause for loss of the CP1993 - Columbia space shuttle. ref SDS 91 8K4G CP1995 - .. CP1996 - [On 031008 Morris Jones writes to Gary on using SDS for CP1997 - analysis to support strategy and planning to set direction CP1998 - Communication Metrics is a new way of working that adds CP1999 - value to the traditional role of meeting minutes. CP2000 - ref SDS 92 H18H CP2002 - .. CP2003 - [On 040203 bureaucracy resists speaking truth to power, CP2004 - causing continual bumbling, mistakes, conflict, crisis, and CP2005 - calamity. ref SDS 93 E44K CP2007 - .. CP2008 - [On 041015 same problem at same organizations on another CP2009 - big project. ref SDS 96 CE6H CP2011 - .. CP2012 - [On 050722 example common scenarios comedy of errors on big CP2013 - DOD project getting fouled up; management degrades to CP2014 - entropy because nobody has command and control of the CP2015 - record. ref SDS 97 PK6Y CP2017 - .. CP2018 - [On 051006 example medical practice communication, CP2019 - collaboration, team care staff fears speaking truth to CP2020 - power, risks patient to avoid risking personal reprisals. CP2021 - ref SDS 98 6H8M CP2023 - .. CP2024 - [On 040312 laws of nature yield order, structure, pattern CP2025 - of cause and effect for logical analysis, ref SDS 94 RP6K; CP2026 - locality principle requires adding energy to connect cause CP2027 - and effect that converts information into the power of CP2028 - knowledge; Knowledge Management takes a lot of hard work CP2029 - (i.e., energy) without tools for intelligence support; CP2030 - without "knowledge," however, information overload drives CP2031 - management toward entropy, which makes email a "killer CP2032 - application" that kills productivity, from lectures on 21st CP2033 - century science. ref SDS 94 YH4G CP2036 - .. CP2037 - Meaning Drift Compounds Error in Large Organizations CP2038 - Uniformity from Economy of Large Scale Stiffles Innovation CP2039 - Culture of Knowledge Breakthrough Solution Killer Application CP2041 - Work routinely gets "fouled up," as Gary describes on ISS, per CP2042 - above, ref SDS 0 O99K, because in the same way that a little CP2043 - intelligence makes a big difference in productivity, per CP2044 - above, ref SDS 0 W56K, so, too, little deviations that are CP2045 - routinely ignored, because people do not have time to think, CP2046 - while attending constant meetings to work on big problems. As CP2047 - a result, small problems that seem inconsequential at the CP2048 - time, escalate over time into big problems causing loss, CP2049 - conflict, crisis and calamity, i.e., into another big problem, CP2050 - noted by Morris on 921127. ref SDS 4 0674 CP2052 - .. CP2053 - Aristotle learned this lesson earlier in 400 BC, cited in NWO. CP2054 - ref OF 2 JV3G Professional events regularly repeat the CP2055 - lesson, reported on 970910. ref SDS 19 3479 Experts regularly CP2056 - decry that management is an Alice in Wonderland of continual CP2057 - bumbling, noted by Kissinger on 940609. ref SDS 7 4238 CP2059 - [On 020131 Don Rumsfeld, Secretary of Defense, cites CP2060 - cultural forces that resist change in big organizations, CP2061 - and offers ideas to make progress. ref SDS 76 0001 CP2063 - .. CP2064 - Communication Metrics theory and practice holds that failure CP2065 - to routinely align communication in meetings, calls and CP2066 - correspondence with objectives, requirements and commitments, CP2067 - then the chances that affected work will fail when performed CP2068 - days, weeks, months and years later is 100%. Research shows CP2069 - that when understanding and follow up fail due to information CP2070 - overload, cited in the study by the US Air Force Institute of CP2071 - Technology, reported on 970707, ref SDS 18 0108, then shared CP2072 - meaning drifts away, causing people to take conflicting, CP2073 - rather than complementary, action. Continual mistakes due to CP2074 - failed communication cause delay, extra cost and anger that CP2075 - reduce cooperation necessary to get things done on time and CP2076 - within budget. People say the work is "fouled up" because CP2077 - nobody is listening, reported on 890809. ref SDS 1 CJ9J But, CP2078 - when its too noisy from information overload it is hard to CP2079 - listen because there is not enough time to think, as reported CP2080 - on 970910. ref SDS 19 3479 Without thinking, the work gets CP2081 - fouled up causing continual bumbling, noted by Kissinger on CP2082 - 940609. ref SDS 7 4238 CP2084 - [On 040312 laws of nature yield order, structure, pattern CP2085 - of cause and effect for logical analysis, ref SDS 94 RP6K; CP2086 - locality principle requires adding energy to connect cause CP2087 - and effect that converts information into the power of CP2088 - knowledge; Knowledge Management takes a lot of hard work CP2089 - (i.e., energy) without tools for intelligence support; CP2090 - without "knowledge," however, information overload drives CP2091 - management toward entropy, which makes email a "killer CP2092 - application" that kills productivity, from lectures on 21st CP2093 - century science. ref SDS 94 YH4G CP2095 - .. CP2096 - SDS helps solve this problem, as explained in POIMS. CP2097 - ref OF 1 6221 CP2099 - .. CP2100 - On 010719 Gary reported difficulty managing big organizations. CP2101 - ref SDS 46 YR9J Like today, he noted inherent difficulties of CP2102 - large-scale collaboration, and requested ideas for a remedy. CP2103 - ref SDS 46 S485 CP2105 - .. CP2106 - A letter to Gary on 010719 disclosed meaning drift is CP2107 - accelerated in the modern age of information technology (IT), CP2108 - and that this new reality, intended to improve productivity, CP2109 - actually makes some kinds of human activity more prone to CP2110 - error, with the result that... CP2112 - .. CP2113 - communication is the biggest risk in enterprise CP2116 - ...which is the cause of difficulties in management, cited by CP2117 - Gary, and in other forms of knowledge work, because in a CP2118 - modern society, communiation is the engine of productivity. CP2119 - When the engine fails so does productivity, as explained in CP2120 - POIMS. ref OF 1 R69H CP2122 - .. CP2123 - SDS enables Communication Metrics that reduces this problem by CP2124 - adding intelligence to information, as set out in in POIMS. CP2125 - ref OF 1 2300 CP2127 - .. CP2128 - Without SDS, a quagmire of complexity paralyzes productivity CP2129 - due to information overload, reported recently on 011003. CP2130 - ref SDS 52 EC5N Review at that time showed conventional CP2131 - communciation methods that people like, e.g., meetings, calls CP2132 - email, Powerpoint, sow the seeds of continual bumbling, CP2133 - ref SDS 52 O76L, that worried Henry Kissinger in the record on CP2134 - 940609. ref SDS 7 4238 A US Air Force study of procurement CP2135 - reviewed on 970707 showed delay and costs accelerate because CP2136 - management degrades to entropy as the complexity of CP2137 - information grows over time. ref SDS 18 0108 CP2139 - .. CP2140 - On 990527 Morris noted cultural forces that prevent improving CP2141 - management. ref SDS 25 1233 POIMS explains dynamics of CP2142 - culture, social pressures and biology that restrain good CP2143 - management. ref OF 1 3385 An example is email. On 010908 CP2144 - Jack Park cited overwhelming tendency to use bad management CP2145 - rather than work intelligently. ref SDS 49 YF5O On 001101 CP2146 - Aerospace company's problems are common throughout industry, ref SDS 34 CP2147 - 4O5K, because leadership is restrained by laziness from using CP2148 - good management, as reported by Fortune on 990625. ref SDS 26 CP2149 - 4914 Andy Grove at Intel noted successful people are overcome CP2150 - by denial that work practices using meetings, calls and email CP2151 - which brought success are no longer effective because changes CP2152 - in the business environment from success using information CP2153 - technology increases information overload, reviewed on 980307. CP2154 - ref SDS 22 1657 CP2156 - .. CP2157 - Gary's concern aligns with the report on 991001 about NASA's CP2158 - space probe crashing on Mars due to an evident error using CP2159 - email. ref SDS 27 3077 Earlier on 921021 an engineer with JPL CP2160 - related continuing frustration with communication, ref SDS 3 CP2161 - 4390, despite management audits mandated to correct problems CP2162 - disclosed by the explosion following take-off of the Columbia CP2163 - Space Shuttle in 1986. ref SDS 3 4499 CP2165 - [On 020131 Don Rumsfeld, Secretary of Defense, explains CP2166 - cultural forces that resist innovation in big CP2167 - organizations, and offers ideas to make progress. CP2168 - ref SDS 76 0001 CP2170 - .. CP2171 - There is a long record showing that developing software and CP2172 - everything else gets "fouled up" because meaning drift in CP2173 - communication causes endless bumbling.... CP2175 - POIMS.................................. ref OF 1 8774 CP2176 - NWO.................................... ref OF 2 4077 CP2177 - Drucker........................ 931130, ref SDS 6 3851 CP2178 - Ship sinks at sea.............. 940611, ref SDS 8 8239 CP2179 - USAFIT study................... 970707, ref SDS 18 0108 CP2180 - Moscone Center................. 980929, ref SDS 24 3099 CP2181 - PG&E files bankruptcy.......... 010529, ref SDS 44 L2EM CP2182 - Enron files for bankruptcy..... 020204, ref SDS 77 0001 CP2183 - Unproductive meetings waste CP2184 - 70% of the day................. 960205, ref SDS 14 5902 CP2185 - Too many people having too many CP2186 - problems cause productivity, CP2187 - earnings, stock prices to fall. 001207, ref SDS 37 V54M CP2188 - Bumbling is pandemic........... 011003, ref SDS 52 O76L CP2190 - [On 020315 Gary mentions other projects that suffered CP2191 - bad management. ref SDS 79 ZK6G CP2193 - ...because people do not have tools, expertise nor leadership CP2194 - to capture organizational memory that is essential to be CP2195 - prepared for working productively, explained on 950327. CP2196 - ref SDS 10 8822 Since big organizations have more meetings, CP2197 - calls and email, loss grows in big organizations like compound CP2198 - interest. Lt General Henry Hatch cited this concern based on CP2199 - experience commanding the U.S. Army Corps of Engineers, shown CP2200 - in the record on 951230. ref SDS 12 4884 CP2202 - .. CP2203 - Recurring experience of top people being discouraged about CP2204 - improving communication supports Drucker's view that people CP2205 - have given up, as shown on 931130. ref SDS 6 3851, CP2207 - .. CP2208 - Large organizations are useful for economies of scale that CP2209 - provide goods and services people want at low cost, including CP2210 - government. This requires uniformity through repetitive jobs CP2211 - that are boring, like driving a truck to make deliveries; but, CP2212 - everybody is grateful someone will do it, so the price is CP2213 - cheap. Big organizations are designed to do things over and CP2214 - over they already know how to do. They are not designed to be CP2215 - innovative in figuring out what to do, because customers and CP2216 - competition directs all their energy into being the best at CP2217 - not deviating in order to gain and maintain market share. Once CP2218 - customers settle on a value, they want it to be delivered as CP2219 - expected, like softdrinks, Corn Flakes, Tide, Windows 95, etc. CP2220 - It is another binary tension between uniformity and CP2221 - creativity, cited by Clay Christensen in his book Innovator's CP2222 - Dilemma, reviewed on 990527. ref SDS 25 1300 CP2224 - .. CP2225 - Andy Grove, former CEO of Intel (now Chairman), commented in CP2226 - an interview on 971222 on the challenge for big organizations CP2227 - to balance control and creativity. ref SDS 20 6695 So, it is CP2228 - not an easy task. CP2230 - .. CP2231 - Large scale operations are productive to the extent they can CP2232 - eliminate the need for communication and collaboration by CP2233 - having tasks done over and over. An assembly line requires CP2234 - minimal communication, since the steps have already been CP2235 - designed into the process and proven through trial and error. CP2236 - Communication, however, will always be a big factor on some CP2237 - work in any organization. If it is small enough, then CP2238 - bumbling will not impact overall productivity and earnings. CP2240 - .. CP2241 - Adding "intelligence" has proven to be effective in reducing CP2242 - the level of bumbling, per above. ref SDS 0 W56K CP2244 - [On 011212 letter to Gary makes this point. ref SDS 69 CP2245 - MX5K CP2247 - .. CP2248 - There is great difficulty, perhaps in most cases making it CP2249 - impossible to help big organizations recognize opportunity to CP2250 - improve, for reasons Gary notes, ref SDS 0 QS5F, that compound CP2251 - cultural forces, cited above. ref SDS 0 KX7O However, as CP2252 - further noted, at least in the case of SDS, where it has been CP2253 - deployed in large organizations the improvement is dramatic CP2254 - and widespread. ref SDS 0 K18K CP2256 - [On 020131 Don Rumsfeld, Secretary of Defense, explains CP2257 - cultural forces that resist innovation in big CP2258 - organizations, and offers ideas to make progress. CP2259 - ref SDS 76 0001 CP2261 - .. CP2262 - As organizations eventually suffer consequences of bumbling CP2263 - that reduces productivity, earnings and stock prices with CP2264 - attendant job loses, pressure builds for capability to solve CP2265 - the communication problem, per above. ref SDS 0 3Q3H CP2266 - Experience of loss, conflict, crisis and calamity provides an CP2267 - opening for improvement using a disruptive technology and a CP2268 - Killer Application, per Drucker's report that nobody else CP2269 - knows how to improve communication. CP2271 - [On 011031 economy biggest decline in 10 years. CP2272 - ref SDS 57 0001 CP2274 - .. CP2275 - [On 011102 biggest job losses in 20 years. ref SDS 60 CP2276 - 0001 CP2278 - .. CP2279 - Good Management Must be Specified CP2280 - Wait 50 Years for Failure to Turn Market toward Improvement CP2282 - Gary's letter today, per above, ref SDS 0 KA4H, illustrates CP2283 - the marketing challenge is waiting for a critical mass of CP2284 - bumbling to form that causes failure, which creates loss of CP2285 - confidence and faith in popular methods everybody likes. When CP2286 - people question capabilities, as Eric Armstrong reported on CP2287 - 011006, ref SDS 52 EC5N, and so are willing to try SDS without CP2288 - understanding and being 100% convinced it will work, which is CP2289 - impossible without first getting experience, per discussion on CP2290 - 890809, ref SDS 1 U87H, this will provide sufficient enabling CP2291 - force for the market place to improve management to improve CP2292 - productivity, earnings and stock prices. CP2294 - [On 020204 Enron collapse focuses market attention on CP2295 - need for accountability using traceability to original CP2296 - sources. ref SDS 77 P49F CP2298 - .. CP2299 - The only alternative to waiting until failure is to specify CP2300 - good management in contracts and by law, as for example occurs CP2301 - with requirements for contractors to use cost and schedule CP2302 - control, and for all businesses and government agencies to CP2303 - follow accounting rules for reporting taxes. On 960105 Max CP2304 - Blodgett proposed specifying Com Metrics as the the most CP2305 - direct way to empower contractors to use good management. CP2306 - ref SDS 13 1008 CP2308 - [On 011210 Gary cites Buckminster Fuller arguing 50 years CP2309 - are required for enabling a mature culture to adopt CP2310 - improved methods. ref SDS 65 R66K CP2312 - .. CP2313 - On 950202 the idea was raised to add support for communication CP2314 - that complements specified cost and schedule requirements. CP2315 - ref SDS 9 0333 Software Projects Get Fouled Up at Aerospace company Due to Changing Pe onnel Deployment Experience Needed for KM before Further Development Experience KM on DKR Project to Gain Experience for Creating KM Tools Uniformity for Economy Stifles Innovation Binary Tension Killer App Opportunity Solve Information Overload Enabling Forces IT Failure Loss Confidence Aids Funding SDS for Conve Creeping Toward Future Rushing Toward Us, Must Act to Accomodate New Be Prepared Com Metrics Organizational Memory Intelligence SDS KM Avo Sunshine Profits Invest Experiment Better Methods Cost of Business Improve Not Enough Time to Learn about Saving Time Money Using SDS D71301 - .. D71302 - Enabling Forces Must Coalesce to Discover Opportunity Intelligence D71303 - Bright Opportunity for Adding Intelligence to Information D71304 - Culture of Knowledge Opportunity for Killer Application D71307 - Gary concludes with optimistic perspective.... D71309 - I believe that mankind is at or near a stage where if at least D71310 - some people do not learn to think and to cooperate to solve some D71311 - of the problems that we have created for ourselves, that our D71312 - survival as a species is doubtful. On the other hand, the future D71313 - is incredibly bright if enough people can learn to think and they D71314 - can organize and collaborate to solve some of our very real D71315 - problems. For a glimpse into the nature of the problem, just look D71316 - at the discussions on UNREV for a time. This group, all of whom D71317 - are interested in the solutions to complex socio-technical D71318 - problems, mostly can't agree on what the problems are, what D71319 - approach would be useful in solving them if they could agree, and D71320 - how to get tools that will assist in their solution. ref DRT 1 D71321 - 01BP D71324 - .. D71325 - Throw a Match on SDS Ready to Explode on the Scene D71326 - Killer Apps Require Being Prepared When the Light Turns Green D71328 - Gary's reference to survival connotes cultural alerts from D71329 - scenarios posed by Armageddon, Malthus and others that reflect D71330 - urgency to improve, because we cannot continue creeping toward D71331 - a future that is rushing toward us, framed in NWO. ref OF 2 D71332 - 8303 D71334 - .. D71335 - SDS support for "intelligence" that converts information into D71336 - knowledge may be is a "Killer Application" that arrives just D71337 - in time when necessity dictates transformation to a stronger D71338 - form of support for human cognition to save us from ourselves, D71339 - as explained in POIMS. ref OF 1 HO4H D71341 - .. D71342 - Instant success, however, is an illusion, especially for D71343 - fundamental advance, reported on 000315. ref SDS 31 4932 and D71344 - ref SDS 31 7800 D71346 - .. D71347 - The challenge and opportunity for advancing from information D71348 - to a culture of knowledge is aptly summarized by Bill D71349 - Benkevitch's comment on 970611, who urged that SDS is ready to D71350 - explode when enabling forces come into alignment. At that D71351 - time Bill used the metaphor -- asking why doesn't somebody D71352 - just... D71354 - .. D71355 - Throw a match on it!! D71357 - ...while, also, asking about frustrations from failing to D71358 - deploy SDS. ref SDS 17 0007 D71360 - .. D71361 - The history of civilization is very telling about the need to D71362 - be patient, strong and ready to go... D71364 - When the light turns green!! D71366 - ...allowing new tools and methods to advance, as noted on D71367 - 000309. ref SDS 30 UW6L A few months later, on 000716 D71368 - Professor Ransdell pointed out that Communication Metrics D71369 - implemented by SDS is ambitious, and so we must expect that D71370 - acceptance will be slow, ref SDS 34 7838, as it has been for D71371 - all foundational advances, reported on 991108, reviewing D71372 - alphabet technology. ref SDS 28 2277 D71374 - [On 040330 Gary receives "good to go" -- the "light D71375 - turns green" on using SDS for Com Metrics to deliver D71376 - "intelligence" anytime, anywhere on the Aerospace company network. D71377 - ref SDS 95 OP5I D71379 - .. D71380 - When times are good with money coming in, vigilence wains and D71381 - withers under the attitude that good management is redundant, D71382 - unnecessary overkill. It is difficult to concentrate on D71383 - improvement because success creates a paradigm that there is D71384 - nothing to improve. Everybody is living in the moment, like D71385 - the infamous, lazy grasshopper, who ignored warnings of the D71386 - industrious ant to invest sunshine profits for a rainy day, D71387 - because the top consultants said it is faster, easier and D71388 - cheaper to use "feel good" management, reported on 911123. D71389 - ref SDS 2 1331 As noted on 001101 there is an overwhelming D71390 - tendency toward laziness that uses bad management, ref SDS 35 D71391 - 4O5K, reviewed more recently on 010908. ref SDS 49 YF5O D71393 - [On 011010 ant and grasshopper need to discuss D71394 - intelligence to avoid future calamities. ref SDS 56 PG4K D71396 - .. D71397 - [On 011211 sunshine profits guide lazy grasshopper to D71398 - ignore industrious ant. ref SDS 68 T641 D71400 - .. D71401 - Survival motivates change. D71403 - .. D71404 - National security threats reported on 010911, ref SDS 50 0001, D71405 - and a declining economy are presenting problems people cannot D71406 - solve with current practices, reported on 001207, ref SDS 37 D71407 - V54M, and so provide enabling forces to transition from an D71408 - information age to a culture of knowledge, as called out on D71409 - 001105, ref SDS 36 H54K, and explained in POIMS. D71411 - [On 011121 discussed with Doug Engelbart enabling forces D71412 - gathering for KM. ref SDS 62 H67I D71414 - .. D71415 - Enabling forces for KM were listed on 010420 in connection D71416 - with reviewing efforts by Jeff Conklin to promote D71417 - organizational memory. ref SDS 41 YY5J Loss of confidence in D71418 - IT was cited in discussions with DOD on 010912 as enabling D71419 - condition for SDS. ref SDS 45 Q96H D71420 - .. D71421 - This supports Gary's optimism for the future. D71423 - [On 011102 explained need for leadership with broader D71424 - vision to help people overcome ignorance, fear and denial D71425 - that blocks the path through a window from the box of IT D71426 - to a culture of knowledge. ref SDS 59 UG6F D71428 - [On 011120 enabling forces discussed with Doug. D71429 - ref SDS 62 H67I
The "New Associationalism" in agriculture: Agro-food diversification and multifunctional production logics MetadataShow full item record As an alternative to the negative externalities created by agro-industrialism adopted over the latter half of the twentieth century, the European Union has now adopted a policy of agro-food diversification. While this policy has been viewed as a gateway to a sustainable agriculture development, it presents unique challenges to agricultural business owners as they attempt to switch production ethics. This research follows the transition of farmers in England as they attempt to take advantage personal social assets, contacts incentives and resources offered by the government in this process. Incorporating methodologies from the recent "relational turn" in economic geography, the research follows how individuals utilize personal networks and existing business contacts as they move into more diversified production systems. Agro-food diversification is characterized as a dynamic and challenging process that requires a significant shift in outlook from a specialization and yield maximization to a more substantive investment in social networks to build business economies of scope and synergy for a diversified agribusiness.
The Benz Micro line go with SME arms like peanut butter and jelly, Fred and Ginger, The Three Stooges, etc. They have good synergy together. 6 responses Add your response I bought my new SME 10/A with a Sumiko Celebration new in 2003. Great combination. The cartridge has great bass and is just slightly warm of neutral, IMO. I have since upgraded to an SME V arm and AirTight PC-1 cartridge. I also found that replacing the stock cable helps. I first tried a Harmonic Technology Copper Phono cable and now have the Hovland MG2. Also, given that the SME 10 is unsuspended, a used Townshend Seismic Sink will do wonders for isolation. Congratulations. IMO, the SME 10 is one of the great values in turntables today. It's a very good table/arm combination and the Sumiko cartridge was developed and voiced on an SME 30/V arm combination, so it is an excellent match. There are a few reviews on the net.
Theater Barn brings back the '50s with Grease GREASE HAD ITS Broadway premiere in 1972 and was an immediate hit with audiences, if not with critics. People: Diddy makes a plea for free oil OK, you know gasoline prices are out of control when Sean "Diddy" Combs is bellyaching about them. Grease slips into the number one spot for festival Grease is the word - " for Portsmouth film fans and it's coming to the city. The legendary musical, which this year celebrates its 30th anniversary, has been chosen by readers of The News for the city's very ... Heidi Montag Causes "Physical" Reaction After all The Hills drama, Heidi Montag just wants to work it out. In the new video for her song "Overdosin'," the Hills honey plunders the pop-cultural past for inspiration. John Travolta and Nicholas Cage in Face/Off. Face/Off surgery not sci-fi Trading faces ... surgery like that depicted in Face/Off may become a standard procedure. Fred's Weather: Face transplants coming Not enough people are willing to donate a body organ for transplanting, and now doctors are worried not enough will donate their faces. De good, de bad, De Palma When news first came of Brian De Palma making "The Black Dahlia" based on James Ellroy's fictionalised account of the sensational murder of starlet Elizabeth Short, it seemed like the perfect fit. Alan Peppard on John Travolta, Fergie, Lea Thompson, Fred Ward and John Tesar Out at Love Field, the big boy Gulfstreams and Falcon 900s of billionaires Harold Simmons, Kenny Troutt and others make it easy to ignore the tiny Eclipse 500 VLJ that has been buzzing in and out of Love this ... Marty's movie night! - Hairspray' is nod to diversity In addition to being a toe-tapping treatment of integration, "Hairspray" is also the story of two oversized divas, played by John Travolta and Queen Latifah. Cruise Takes Control WHEN YOU HEAR the name Tom Cruise, what descriptions spring to mind? Fervent Scientologist? Self-proclaimed psychotherapy expert? Oprah couch-jumper? Wait, doesn't the guy act or something, too? That is ... Photo Credit: John Travolta's picture is courtesy of Kip Addotta. Photographic illustrations of John Travolta are copyright © by their respective holders. The images are published with permission or as allowed by the copyright law's fair use or quotation provisions. If any copyright holder objects to an image being included, please notify us and it will be removed immediately. Top Synergy reveals the methods and means that have led to the development of the popular Relationships Analyst. While some aspects are more suited to experienced astrologers, you will find a lot of fascinating topics that may sway you from any conservative views you may have about relationships. Find out why Astro Profile has become such an important self-improvement tool. And now, you can also get your own report, just like the ones we prepared for all the famous people on our database. With thousands of famous relationships and their Astro Profiles, you can analyze your relationships with your mentors and favorites and find out what types of relationships work best for you . You can also learn in great detail how they handle their relationships and other aspects of their lives, and what makes them tick. A knowledgebase about common topics is growing thanks to your inquiries and in-depth exploration of the workings of the Relationships Analyst. Enjoy your reading and help to further boost the FAQ section by posting your questions and comments. Tell me who your friends are and I will tell you who you are. This ancient saying is also true when it comes to our love-, business-, and other relationships. This is why we are here; to make the most of ourselves, a courageous choice that enhances all aspects of life, relationships included. So come and join us, your friends who respect your imperfections, love your resolute, and embrace you for the wholesome being that you are! Top Synergy's popular Relationships Analyst calculates the intensity of the commitment, intimacy, passion, and synergy in your relationships. With this free yet powerful tool, you will also understand what types of relationships are most likely to work for you and your partner. The report also features your RQ (Relationship Quotient) score for the most common types of relationships, such as love, business, friendship, intellectual, sensual, etc. Enjoy practical articles about building and enhancing relationships, improving our self-awareness, and other interesting topics. Dr. Brenda Shoshanna - our anchor author and a world-renowned relationships psychologist - offers you the benefit of her vast professional experience. We seek more articles about more topics by more authors. Are you the one or know of any? Here you will find up-to-date news from around the world about relationships. Hundreds of hand-picked links are neatly organized by categories such as: dating, relationship support, sensual relationships, self improvement, and more. There is a special section dedicated to relationships in the new age: astrology, psychic, tarot, dreams, spells, etc.
I did the Showdown at Boot Hill quest then went to the tomb , went got the key , went through the crypts , and logged out. I logged back in yesterday and I cannot get Don Rafaels ghost to spawn outside the crypt to continue the quest. I redid the crypts twice , relogged , changed realms , ect. I checked my quest log and the quest is nowhere in it. I went back to try and restart it from the quest giver but cannot. Anyone else having any similar issues? Oh and I did submit a ticket but just cant continue on very upset. Hello and thanks for your report! Other players have reported an issue as well. Because of these reports we've identified the bug and will be fixing this issue soon; however, you will still need Support's help in the meantime to get you past this point in the quest until it is fixed. Sorry for the inconvenience! Thanks for that part but now I have a new problem. My main quest is set to talk to Tonka but hes not there and I can goto Scorpion Rock Cave to do the ring part but I cannot get the ring now. I went back into the instance but the quest wont even start up again. I am submitting another ticket as well. Also I didnt get my companion from talking to Tonka at the crypt. It seems my quest line is out of synergy with the game.
Synergy – free mouse/keyboard sharing across operating systems Any sufficiently advanced technology is indistinguishable from magic I love technology. I especially love discovering and using technology that makes me more productive. I’m writing about a piece of software called Synergy that allows you to use one mouse and keyboard to control multiple computers, each of which may be running different operating systems. In my case, my primary display is for my Mac, and a secondary display off to the right is connected to a Windows PC. Previously, any time I needed to use the Windows machine I had to unplug the USB cable powering the keyboard/mouse combo and physically plug it into the windows machine. (Alternatively I could have bought an extra keyboard and mouse and had to juggle with the physical hardware.) If I needed to transfer text (e.g. a sourcecode snippet) from one machine to the other, I would have to resort to shuttling files or e-mailing it to myself. By using Synergy, the mouse no longer stops at the right edge of my Mac display. Instead, the cursor continues to move to the right, onto the Windows desktop. Suddenly both your mouse and keyboard control the PC. If you copy text from a file on Windows and revert to controlling the Mac by moving the cursor back to the left, the text is in your Mac clipboard. That’s not to say that Synergy is perfect. The main problem is that certain key combinations on the Windows side do not transfer correctly. For instance, Ctrl + Alt + Delete is pretty necessary in Windows land, but pressing those keys does not trigger the corresponding action. The Synergy FAQ page has this issue at the very top, but none of the workarounds work for me. I’ve noticed the following keys do not get sent over correctly: \|Ctrl Alt Delete\|\|Bring up task manager\| \|Print screen\|\|Take a screen shot of desktop\| \|Windows + Any other key\|\|(Windows L = Lock, Windows D = show desktop/hide all windows)\| Other limitations I’ve seen are as follows: - Pasting is limited to plain text (e.g. you can’t copy an image from one computer to the other). - You can’t drag and drop files between the screens (this would be awesome); instead best workaround I can find is to have a networked folder accessible to both computers and use it as a dropbox to ferry around files. It’s a bit kludgy but it works. Each computer will need to install the software and be accessible on the same network. The computer into which the mouse and keyboard are plugged should be the Server. Each of the computers that you wish to control via the mouse and keyboard need to be running the Client software and connect to the server, and the server needs a configuration file which tells it how the screens are physically located (which computer is to the left of which, which is above, etc.) Finally, there’s a bit of work you need to do to get it to work on windows vista/ 7 – see here for the details. This is a really great piece of free software, and it allows me to do my job more effectively. I hope you find it useful as well.
The global virtual team (GVT) has become a common business practice for multinational companies. The boundaries of the workplace have expanded across countries and continents, enabling multinational companies to leverage the skills and expertise of a diverse workforce in order to remain competitive on the global stage. These virtual teams consist of members who are geographically distributed, yet are expected to interact to accomplish the business goals of their shared employer. Often, their interdependent tasks and responsibilities are limited to electronic resources. The price to pay for having GVTs is steep if companies do not effectively manage the factors that can make or break success: cultural differences, conflict resolution, communication, trust, technology, leading, motivation and recruitment of globally-minded people. Effectively managing GVTs also requires a hands-on collaboration from human resource professionals to provide strategic training, performance management and incentives. Global teams began to increase in prominence following the September 11 attacks. Most business people were leery about flying and companies were looking for more cost-effective solutions to conduct business. Change always introduces new challenges. The most notable challenge and possibly the catalyst for the other challenges, is cultural differences. First, we must recognize that differences between cultures, whether it is with companies, professions or countries, will always exist. The goal for a company and its human resources department is not to change the diverse culture within GVTs, but to find effective ways to synergize the differences. Cultural differences are a good thing and often can be used to balance the strengths and weaknesses of the team. Symons and Stenzel suggest that two types of conflict exist within GVTs: dysfunctional affective conflict where conflict is personal and cognitive conflict that is directed towards the effective performance of a team. Even the meaning of the word team translates differently across country and culture lines. If this difference is not made clear, team members’ actions and reactions will be misinterpreted. For example, the way one approaches problems, decision making and attitudes about hierarchy differs with Germans and Americans from that of Mexicans and the Japanese. In Mexico and Japan, a “good” team player will help his or her teammate. However, in Germany and the U.S., a good team player will focus on and fulfill his or her specific roles and responsibilities. In order to create synergy, each team member will have to adopt new behavior patterns that are different from their own, and that best fit the needs of the team as a whole. Communication is paramount to effectively managing GVTs. The obvious communication challenge is the language barriers because team members are accustomed to speaking their native language. However, even more akin to communication challenges is having unanimous decisions on the acceptable protocol when communicating. Not having the right processes in place can lead to misunderstandings and hinder a team’s progress. There are common characteristics of communication challenges for both global and colocated teams. These may include the use of email and voicemail. Conducting virtual meetings greatly reduces the business travel expense for companies. However, to effectively manage communications, having face-to-face meetings, especially during the initial formation of a team, is greatly encouraged. Face-to-face meetings help to foster trust and positive interpersonal relationships among team members. Establishing email and voicemail protocols at the onset of team formation also eliminates unexpected confusion. The goal is to select the proper tool for the message that needs to be communicated. Team members must clearly define their objective for communicating and follow the established rules. For example, voicemail messages should include what to do if there is a misunderstanding; when to respond; and, what to do if a team member is unable to provide the information requested in the voicemail, or within the requested timeframe. Similar to voicemail, email protocol should address effective written communication practices. Following naval practices, email among GVTs is effective when: requested actions are in the final paragraph, rather than throughout the message; and, emails should not include a thread of previous emails, only the information that is pertinent and mission critical to the project. Do you know what I am saying? Companies not only must consider these electronic tools, but also the communication behaviors that differ from country to country. For example, the physical gesture of shaking one’s head means “no” in the Western culture. However, this gesture is interpreted to mean “yes” in Bulgaria. This challenges companies to provide consistent communication so that everyone receives the same message according to their culture. Employees should not be required to “get it” the same way that someone in a different country does. Effective use of communications tools Multinational companies have various technology tools to help facilitate global team communications. Each tool has its own individual advantages and disadvantages, but when used collectively, these tools are an integral function for effective team collaboration. Companies are encouraged to consider five interdependent factors related to technology: availability, reliability, capability, supportability and individual ability to master the tool. This enables multinational companies to leverage its global workforce through the use of technology for communication and training purposes. Email accounts, instant messaging, and a collaboration tool are good examples. Making full use of these technologies through the Internet helps supervisors communicate with employees anywhere in the world. Additionally, a talent management system can be used for tracking global training and succession planning. Examples of communications tools Telephone conferences are the least expensive and easiest communication tool for GVTs. However, landline telephone conversations do not provide visual contact and team members cannot collaborate on a single document. Most multinationals use online instant messaging to get quick turnaround in responses and to instantly communicate with several people at the same time. Unfortunately, instant messaging may also hinder team collaboration and people may respond sooner than a question is asked. To combat the issue of collaborative work on a single file, document sharing applications such as Microsoft NetMeeting allows for real-time application and file sharing among several team members. However, only one person at a time is able to work on a document. Multinational companies that are equipped with video conferencing facilities can use software such as Smartboard, an interactive digital whiteboard, where all team members can edit simultaneously. Video conferencing is expensive and may cause a bit of paranoia of being watched by other team members during a meeting. Shared, web-based activities and discussion areas are essential to facilitate the sharing of knowledge expertise among team members. These tools are also valuable to bringing new team members up to speed on a project. Trust and team relationship building is also strengthened through information sharing and group discussions. What multinationals are doing to remain relevant Shell International Exploration and Production has a dedicated intranet for discussion groups consisting of “communities of expertise.” A challenge for shared, web-based discussion groups is having disciplined team members who are willing to keep the information fresh and relevant. According to one of Shell’s human resource professionals, Arjan van Unnik, each community has approximately 25 global members who make daily postings and encourage local participation. As a result, colleagues in Australia and Malaysia benefited from a gas compressor issue in the U.S. Van Unnik estimates that at least 15,000 employees exist in each global community. The importance of effective leadership and human resources management should not be underestimated. Both are a vital part of the infrastructure for a successful global company. Human resources must adapt some of its traditional practices and policies to the global environment by respecting local differences. Line managers and team leaders must build a sense of unity within GVTs through trust and open communication. Leaders must articulate the vision and purpose of the team with the guidelines for how the project will be executed. Team leaders are responsible for motivating global team members through mentoring, enforcing norms and rewarding members individually and collectively. Leaders must learn a different management approach that fully appreciates the benefits and challenges of GVTs. BT director of people networks Caroline Winters notes how BT’s managers had to change from a command-and-control approach to a style that was based on coaching, outputs and timelines. The results were more cooperative work between international colleagues. Human resources is responsible for ensuring that line managers receive the proper training to lead successful global teams. Often, this requires changing complicated management structures and eliminating multiple lines of reporting. Otherwise, team members will experience conflicts with work priorities, loss of accountability, and very little knowledge sharing opportunities. One way multinational companies are meeting the challenge of GVTs is by recruiting and hiring globally minded staff. Nokia’s global marketing and product development teams are successful for this very reason. Nokia’s human resources department selects people who are willing to collaborate on teams with a broad range of ages, nationalities and education. Ongoing training is necessary to keep globally minded staff motivated. Accenture spent $700 million in 2006 to provide collaboration training for 38,000 consultants. Additionally, Accenture has a special leadership development program where it trains managers for 10 months in areas such as finance, marketing and technology. The teams meet in different locations throughout the program to collaborate on completing a project. It takes a village Multinational companies must have local human resource representatives within each country or region where they conduct business. Local laws, hiring, terminating and training practices will differ based on what is culturally and legally acceptable. There is no one-size-fits-all model where, for example, HR can use U.S. policies and practices in China. In particular, HR compensation practices must align with local expectations. The cost of living is different for each location; therefore, salary structures must be regionally competitive. HR also shares the responsibility of motivating team members through the types of training and benefits packages that are offered. Standardized benefits no longer exist to retain top talent. GVTs are drastically different from local teams in terms of time zones, geography and culture norms. Creating a seamless workforce is challenging under most circumstances, not to mention a global workforce. However, a collective commitment from line managers, HR and employees can bring harmony and success. Armstrong, D. (2000). Building teams across borders. Executive Excellence, 17(3), p. 10.. Bell, S. (2003). Remote control. Human Resources, p. 44-46. Bergiel, B.J., Bergiel, E.B., & Balsmeier, P.W. (2008). Nature of virtual teams: A summary of their advantages and disadvantages. Management Research News, 31(2), p. 99-110. Bolch, M. (2008). Going global. Training, 45(1), p. 28-29. Engardio, P. (2007). A guide for multinationals: One of the great challenges for a multinational is learning how to build a productive global team. Business Week, (4047), p. 48. Jackson, S.E., Schuler, R.S., & Werner, S. (2009) Managing human resources. Mason, OH: South-Western Cengage Learning. Laroche, L. (2002). Keeping global teams going. Chemical Engineering Progress, 98(2), p. 91. Making virtual collaborations work. (2002). Research Technology Management, 45(2), p. 6-7. Malhotra, A. Majchrzak, A., & Benson, R. (2007). Leading virtual teams. The Academy of Management Perspectives, 21(1), p. 60-69. McLean, J. (2007). Managing global virtual teams. The British Journal of Administrative Management, p. 16. Smith, P.G. (2001). Communication holds global teams together. Machine Design, 73(14), p. 70-74. Symons, J. & Stenzel, C. (2007). Virtually borderless: An examination of culture in virtual teaming. Journal of General Management, 32(3), p. 1-17. Weil, N. (2008). Global team management: Continental divides; more and more CIOs find themselves managing global virtual teams. The European members of CIO’s Executive Council have pulled together a playbook of best practices. CIO, 21(8).
Fills the Existing Gap of Mathematics for Data Fusion Data fusion (DF) combines large amounts of information from a variety of sources and fuses this data algorithmically, logically and, if required intelligently, using artificial intelligence (AI). Also, known as sensor data fusion (SDF), the DF fusion system is an important component for use in various applications that include the monitoring of vehicles, aerospace systems, large-scale structures, and large industrial automation plants. Data Fusion Mathematics: Theory and Practice offers a comprehensive overview of data fusion, and provides a proper and adequate understanding of the basic mathematics directly related to DF. The material covered can be used for evaluation of the performances of any designed and developed DF systems. It tries to answer whether unified data fusion mathematics can evolve from various disparate mathematical concepts, and highlights mathematics that can add credibility to the data fusion process. Focuses on Mathematical Tools That Use Data Fusion This text explores the use of statistical/probabilistic signal/image processing, filtering, component analysis, image algebra, decision making, and neuro-FL–GA paradigms in studying, developing and validating data fusion processes (DFP). It covers major mathematical expressions, and formulae and equations as well as, where feasible, their derivations. It also discusses SDF concepts, DF models and architectures, aspects and methods of type 1 and 2 fuzzy logics, and related practical applications. In addition, the author covers soft computing paradigms that are finding increasing applications in multisensory DF approaches and applications. Data Fusion Mathematics: Theory and Practice incorporates concepts, processes, methods, and approaches in data fusion that can help you with integrating DF mathematics and achieving higher levels of fusion activity, and clarity of performance. This text is geared toward researchers, scientists, teachers and practicing engineers interested and working in the multisensor data fusion area.Vom Verlag: In a focused, in-depth study, this book explores the mathematical tools used in this increasingly widespread and important technical field. It includes the theory, methods and tools used for creating a synergy of the information acquired from multiple sources, sensors, databases, and direct-information by human – this synergy is much more than the concept of data aggregation. Researchers, scientists and engineers working in the multi-sensor/data fusion area will find this book a valuable tool for design and analysis; especially in areas like Aerospace Engineering, Defense Systems, and Environmental Monitoring, where data fusion is critically important. „Über diesen Titel“ kann sich auf eine andere Ausgabe dieses Titels beziehen.
Interest Rate Behaviour in Europe Interest rates are considered center-pieces of macroeconomics because of the impact that they have on the social, economic and political aspects of a nation. The recent recession in many developed countries in the America and Europe saw an unprecedented level of coordination and swiftness in the manner in which central bank engaged in interest rate cuts. Such actions are founded on the economic justification that the reduction of interest rates stimulates the economy through monetary expansion. The inter-woven nature of different countries in the globalised era comes to the surface during turbulent economic times such as these. This research attempts to study the relationships that exist among the different European countries' monetary policies by studying the co-movements among their interest rates. An attempt is also made to study the relationship between the interest rates in the UK and the US, the two long-time economic partners. This research uses quantitative methods and modelling techniques to study the causal effect of certain critical factors on the interest rates of different monetary policy regimes in Europe. Get your grade or your money back using our Essay Writing Service! The recent coordinated acts by the central banks of the world drive home the importance of taking the interdependence of countries into account. Ever since Euro Area was created and all the 16 countries adopted a common monetary policy and a single Central bank, the significance of Euro Area has increased in global economics. In regional economics, its importance is second to none. It is to be expected that such a large monetary area would have significance influence upon the interest rate changes in other states in the region. This perceived importance of Euro Area and the importance of studying the inter-dependence of different countries' monetary policies form the underlying rationale for this study. Euro Area was primarily created to ensure that the synergy of the members would lead to better economic strength. It would be appropriate to assess this factor through measurement of the impact of Euro Area's monetary policy on other states'. 1.3 Aims and Objectives The aim of this research is to ascertain the extent of inter-relationships among the monetary policies of different monetary regimes in Europe. The primary objective of this research is to study the relationships among the interest rates in Euro Area and other member states of the European Union. Besides, this research also strives to establish the causal impact of changes in Euro Area's interest rates upon the interest rates in other European Union states. The overall purpose underlying this research is that it would provide some insights into relative behaviour of interest rates in Europe. This research is based on empirical research methodology where real historic data are used to build models and validate hypotheses. Quantitative research methods are used to explore the relationships among the critical variables whose characteristics are purported to be studied by this research. Two main quantitative methods used are - Correlation and Regression. Correlation is a measure of the extent of co-movement between two data series. Correlation measures both the direction and the magnitude of changes in two variables (Levin and Rubin, 1997). The most popular measure of correlation is based on the covariance between the data series. The formula is presented below: r = Sxy / [Sx2 X Sy2]0.5 x and y represent the two data series and r is the correlation coefficient. In this research correlation analysis is used to ascertain the relationship - between pairs of different kinds of short term interest rates in Euro Area - between interest rates of pairs of other European Union economies - between interest rate of each one of the member of EU and the interest rate of Euro Area - between LIBOR and US Fed rate Correlation coefficient, as calculated above, takes a value between -1 and +1. A value of -1 denotes that the two variables move exactly in opposite directions while a value of +1 indicates that the movement of the two variables are perfectly matched. A value of zero denotes the presence of no significant correlation between the variables. Correlation shows only the extent of co-movement and not causation. Always on Time Marked to Standard The other quantitative technique used in this research is linear regression. Linear regression models the changes in dependent variable as functions of changes in one or more independent variables. Regression is used to measure the causal impact that changes in one or more variables have on the dependent variable (Newbold et al., 2003). In this research regression is used to measure the causal impact of money supply and inflation on the interest rate of Euro Area. This can be expressed in an equation as follows: Ii = ai + ß1 . Mi + ß2 . Ci Ii is the rate of interest during the period i Mi is the quantity of money supply during period i with coefficient ß1 Ci is the rate of inflation during period i with coefficient ß2 The values of betas are tested for null hypotheses that ß1=0 and ß2=0 using a t-test. The regression function is also evaluated using a F-test. If the null hypotheses of t-tests get rejected it would be concluded that money supply and inflation have significant impact on the changes in interest rates during the period under consideration. If the null hypotheses are not rejected then the conclusion would be that money supply and inflation do not determine the changes in interest rates. It is expected that both money supply and inflation would have significant impact. Also, it is expected that money supply and inflation would have positive coefficient values. The next chapter of this dissertation reviews a cross-section of literature that have studied the behaviour of interest rates in Euro Area and greater Europe and makes observations on the basis of the conclusions drawn in those researches. The third chapter is concerned with the study of correlation between different sets of data, which has been explained in the earlier section of this chapter. The fourth chapter builds a simple model to forecast interest rate of Euro Area from two variables - money supply and inflation. Finally the conclusion chapter summarises the discussion in the dissertation and spells out the conclusions arrived at on the basis of the observations made using various analysis methods. 2. Literature Review The objective of this research is to study the behaviour of interest rates in Europe. A number of researchers have conducted various different researches on the same topic and have made valuable contributions to the academic knowledge. A review of the conclusions made by some of these researchers would help to pre-empt the results of the empirical research that will be conducted as part of this study and would also help to compare the results of this research to those of the earlier researchers. This chapter of this dissertation studies a cross-section of academic researches that have studied the nature and inter-relationships between different interest rates in Europe. The first part of this section focuses on the relationship between interest rate and inflation rates in different countries of EMU; the second part is focussed on financial and monetary integration within the EMU and the third section reviews literature that have studied the linkages between EMU and the other countries, particularly the US. 2.1. Interest Rate and Inflation rates in EMU The most prominent feature of Economic and Monetary Union (EMU) of European Union is that the fiscal policy of each country is determined by the national governments that rule the particular state while the monetary policy is determined centrally for all the countries in the EMU. The monetary policy aims to achieve a stable monetary condition through appropriate control of the inflation and interest rates. However inflation and general economic growth is affected by fiscal policies followed by each government. When a government engages in expansionary fiscal policy funded mostly by borrowed capital, it could result in poor quality of growth coupled with high inflation. Thus the success of central monetary policy is dependent upon the fiscal discipline of the member states. Knowing this fully well, the EMU created a 'Stability and Growth Pact' that requires that the deficit to GDP ratio should not exceed 3% for any member state. Any state that violated the requirements is handed out punishments in the form of sanctions. The idea of creating a stability and growth pact is to ensure that the minimum level of fiscal prudence may be ensured so that monetary policy can be focussed on stability of the economy as well as growth. A number of researchers have enquired into the relationship between fiscal conditions of members of EU and the impact of fiscal excesses on the inflation rate. When inflation rate changes in the state, the real interest rates could vary across different states in the EU even though the nominal interest rates are all fixed at same level. This Essay is a Student's Work This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.Examples of our work Honohan and Lane (2003) study the inflation rates in different countries of the Economic and Monetary Union (EMU) of the European Union. The authors find that the inflation rates have been significantly different during the period under study. Particularly, the inflation rates in the countries in the periphery such as Ireland have had consistently high inflation while Germany's inflation has been below the Euro Area average. The authors identify that most of the researchers in this area have tended to focus on the productivity factor. However the authors argue that the productivity factor differentials have not yet been taken into account. The ongoing differences in inflation rates across different states with the EMU are attributable to the differential impact of Euro weakness on the external sectors of each one of the member states of the EMU. The authors assert that the productivity differentials are yet to be reflected in the inflation rates and when they get accounted for, the inflation rates will vary even widely and the real interest rates in different states of EMU will diverge even further. Thus, even though the ECB fixes a single interest rate for all of EMU, the real interest rates could be different in each country depending on the inflation rates prevailing. In an important research paper, Faini (2005) shows how the imprudent fiscal policies followed by some members of the EMU could cause the interest rates of the entire union to rise. The author observes that the punishment meted out to the countries that violate the stability and growth pact by incurring larger than allowed fiscal deficits is not adequate. He states that the impact of a member country running a large fiscal deficit could be two - firstly, the overall country spread increases and secondly, the interest rate of the entire EMU also increases. 2.2. Financial and Monetary Integration in EMU Poghosyan and Haan (2007) remark that one of the main objectives of the EMU is to achieve financial integration. The authors study the extent of financial integration using threshold vector error-correction model. In this model the transaction costs are analysed and any indication of co-movements in financial environments are noted. This is applied on interest rates from different financial markets in a number of EMU countries. Based on the results the authors conclude that "only for some country pairs and financial market segments there is evidence in support of financial integration". Borio and Fritz (1995) study the response of short-term lending rates to changes in policy rates using a sample of 12 developed countries. The authors identify that the degree of competition in lending market and clarity of signal are the two important factors that determine the extent of relationship between these two rates. Besides, the authors find that there was no asymmetric relationship between these two with respect to increases and decreases. Codogno et al. (2003) state that EMU is expected to create a substantially integrated government debt market in Europe. However it is noted that the interest rates on Euro-denominated bonds issued by different governments in EMU have not converged. Substantial spreads are found between them due to reasons such as liquidity and fiscal conditions prevailing in respective countries, which affect their creditworthiness. Gerlach and Schnabel (2000) find from their research that between 1990 and 1998, excluding the period of market turmoil during 1992-1993, the interest rates in EMU moved very closely with average output gaps and rates of inflation. The authors refer to the Taylor rule, which is vindicated by these findings. Toolsema et al. (2001) examine the extent of monetary policy transmission among 6 EMU countries - Belgium, France, Germany, Italy, the Netherlands and Spain. They conclude that there was little evidence to prove that monetary policy transmission was working. They find that major differences exist in the sample both in the short-term and long-run changes in interest rates caused by monetary policy changes. Gerlach and Smets (1999), on the basis of their study of relationships between inflation and output gaps in different countries in the EMU area, suggest that the ECB should react to changes in output gap in the entire region, even if the bank cares only about inflation as the authors find significant relationship between inflation and output gaps in different countries of the region. Martin (2001) studies various kinds of convergence that have taken place among different countries of the Europe region and conclude that the central bank has a very important to play in ensuring that real convergence develops among the different members states of the EMU region. The author finds significant scope for growth of convergence among the countries. Prior to EMU, Europe had a functional monetary cooperation among a number of states in the form of Europe Monetary System (EMS). EMS was introduced in 1979 after the collapse of Brettonwoods system. Under EMS, the members countries agreed to peg their currencies on the basis of a pre-determined calculation. There was no specific anchor country chosen even though Germany, with its Deutsche Mark, was considered the leader of the system, as its currency was one of the strongest and most stable at that time. EMS restricted the movements in currency exchange rates within the range of 2.25%. EMS is considered the trial run for the greater cooperation in the form of EMU, which replaced EMS later down the line. One of the most important aspects of studying EMS in comparison to today's EMU is that under EMS, the monetary policy was determined independently by the central banks of the members of the union. Karfakis and Moschos (1990) study the relationships among interest rates of different members of the old EMS system. The author conducts Granger Causality tests to identify the dependence of interest rate of each state on that of the other state. The tests show that there existed a unidirectional causality between German interest rate and the interest rates of other states. Thus the states followed the changes in monetary policy of Germany, which was the largest economy in the Union. The author asserts that when a number of countries enter into a union, they tend to follow the trend set by the largest player in the union even though they may have the freedom to choose their own policies. The authors on the basis of their findings suggest a German dominance theory, which asserts that Germany played the pivotal role even in EMS where the individual states could actually choose their own policies. Fratianni and von Hagen (1990) find simple Granger causality tests to be inadequate to make the conclusions that Karfakis and Moschos (1990) have made in their research. They use a system of equations, which employ the short term interest rate variable to capture changes in the monetary policy of individual states. They also use United States short-term interest rates as proxy for the interest rates in other countries outside the EMS. The authors observe that the changes in short term interest rates of the states of EMS respond to a number of different factor including changes in inflation and output growth rates in domestic economy, changes in short term interest rates in other states in EMS and also outside the EMS besides other factors. On the basis of these observations, the authors conclude that "in the short-run, the EMS is best portrayed as an interactive web of monetary policies, where Germany is an important player but not the dominant one" (p. 21). Koukouritakis and Michelis (2005) study the linkages between the term structures of two of the early entrants into EU (Germany and France) and 10 latter entrants (Cyprus, the Czech Republic, Estonia, Hungary, Latvia, Lithuania, Malta, Poland, the Slovak Republic and Slovenia). The authors decompose terms structures into transitory and permanent components. They attempt to analyse the short-term and long-run linkages among the interest rates. They find that there existed weak short-term but strong long-term relationships among the term structures of different countries in the EU. On the basis of these observations the authors conclude that the countries even before they entered into the EU had a habit of closely following the two larger economies on Europe - Germany and France. 2.3. Relationship between Interest Rates in Europe and Other countries Cumby and Mishkin (1987) study the relationship between the interest rates in the US and the UK and ascertain the reasons for this relationship. The authors observe that the interest rates in the US and Europe increased substantially during the 1970s and 1980s. This rise was seen not only in nominal interest rates but also in real rates. The authors conclude that "There is a positive association between movements in U.S. real rates and those in Europe. However, European real rates typically do not move one-for-one with U.S. real rates, still leaving open the possibility that European monetary policy can influence domestic economic activity". Bremnes et al. (2001) study the relationships among the long-term interest rates in Norway, Germany and the United States using large samples. The authors use a Johanssen multivariate cointegration procedure to achieve the research objectives. They observe that US interest rates have a significant includes on the changes in Norwegian interest rates as well as EU interest rates, which are applicable to Germany. The authors also find that Norway's interest rates were closely associated with those of Germany. Thus the authors conclude that small countries tend to associate their monetary policies to that of the large countries. Ehrmann and Fratzscher (2004) acknowledge that there has been a strong degree of interdependence between the economic and monetary policies and performances of the European Union and US. However the authors investigate if the nature of this interdependence has undergone any significant change after the creation of EMU within EU. The authors, instead of using historic data, use real-time data to ascertain the changes in the interest rates of these two monetary regimes. The authors observe that the interdependence has increased significantly after the creation of EMU. It has always been the case that changes in important macroeconomic variables in the US have an important impact on the changes in interest rates in the EU. However after the advent of EMU into picture, it is noted that certain important macroeconomic news from the EU have begun to have causal impact on the changes in macroeconomic variables in the US as well. Thus the authors identify that the one-way causality has slowly been transformed into bi-directional relationship between these two regions. This, according to the authors has led to the apparent increase in the degree of interdependence between the two economic regimes. The authors take this relationship to the next level by stating that "US macroeconomic news have become good leading indicators for economic developments in the euro area". 2.4. Chapter Summary The detailed review of literature that have studied the relationship among the monetary variables of the states within the EU and also outside the EU clearly shows that there are strong linkages visible among the interest rates. There are also very strong monetary linkages visible between the EMU and UK. This shows that the normal interest rates are to a great extent inter-linked not only within Europe but also outside Europe as there are strong relationships found between Interest rates in EMU and US. However, it is observed that are differences in inflation rates within the states that are members of EMU. Besides, the fiscal policies of the states in EMU are also quite different with some states engaging in active deficit financing of the economies. Due to these inherent variations, inflation rates differ, which in turn cause wide spread variations in real interest rates. These observations could prove valuable while conducting empirical enquiries into the nature and relationships between interest rates in Europe, within and outside the EMU and EU. The observations made from empirical research in the next chapters of this dissertation will be compared to the observations made from literature review in this chapter. 3. Co-movements of interest rates The objective of this research is to ascertain the behaviour and nature of interest rates in the European countries. It is seen that the Europe is dominated by the European Union which comprises 27 countries. 16 of these countries have unified to form a single monetary union under which they share a single central bank, monetary policy and Euro currency. This group is officially known as Euro Area (ECB, 2009). It is also referred to as Euro Area in contemporary literature. For the countries in Euro Area, because of single monetary policy and currently, there is only one set of common interest derived from the money market (Gali, 2004). On the other hand, the other members of the European Union have individual monetary policies and interest rates. The first part of this section is concerned with the study of co-movement of different kinds of interest rates within the Euro Area. It is followed by an analysis of the co-movement of interest rates in other EU states. The third part studies using quantitative methods, the extent of co-movement of interest rates between EA and each one of the EU countries. Finally, the co-movement of interest rates between UK and US in the form of a study of relationship between LIBOR and US Fed rate is performed. It is believed that the above mentioned studies would help to understand the relationship in interest rates of three important groups or countries - EA, other states in EU and US. The outcomes of these studies are useful in the next chapter which ascertains the impact of other variables on interest rates of these zones or countries. The studies related to the co-movements of interest rates, as mentioned above, are conducted using correlation method which is explained in the earlier chapter of this dissertation. 3.1 The Co-movement of interest rates in Euro Area nations Following table shows the results of correlation between pairs of different short and medium term interest rates in the Euro Area. The above table shows both correlation coefficients and corresponding p-values for a null hypothesis test that the correlation is zero between the pairs of series. It can be seen that all of the interest rate series have very strong correlation with each other. The strongest correlation is found between 3 months Euribor and 1 month Euribor as well as between 1 year Euribor and 6 months Euribor. The p-values are 0.000 for all pairs indicating that the null value that correlation is zero is rejected for each one of the pairs. 3.2 Co-movement of Interest Rates in Other EU states Following table shows the results of correlation analysis conducted using short term interest rates in different countries which are part of the EU but not part of EA. In the above table, p values are shown below the correlation coefficients. It can be seen that there are wide spread differences among the different states with respect to the relationships between their interest rates. The interest rates of Romania and Poland correlate 0.917 and a p-value of 0.000 means that the null hypothesis that correlation is zero can be rejected at 99% confidence level. Similarly, Poland and Estonia have a very strong positive correlation between their interest rates as indicated by a coefficient value of 0.81 and a p-value of 0.000. Latvia and Estonia share a very strong relationship and so do Chezh and Denmark. The interest rates of Sweden and Hungary share insignificant negative relationships with that of Denmark. These results clearly show that the relationships between pairs of states in EU which are not part of EA are mixed at best. While some of their share significant positive relationships, some have insignificant but negative relationships. Quite surprisingly, the interest rates in Estonia, Latvia and Poland share the strongest relationships with the interest rate in UK. These results partly support the observations made in the literature review. Researchers have noted that the states in EA area tend to have strong relationships among their nominal interest rates. 3.3 The Co-movement of interest rates in Euro Area and other EU member states Estonia shares a very strong positive relationship with Euro Area. It is indicated by the correlation coefficient of 0.946 and p-value of 0.000. UK and Euro Area share strong positive relationship between their interest rates. The correlation coefficient between these interest rates is 0.694. P-value of 0.000 shows that the null hypothesis that correlation coefficient is equal to zero is rejected at 99% confidence level. The interest rates of Hungary and Sweden share insignificant negative relationships with the interest rate of Euro Area. 3.4 The relation between EURIBOR and US interest rates This part of the chapter is concerned with the analysis of co-movement between interest rates in Europe and the US economies. The objective is to identify the relationship between the 3 months Euribor and 3 months US Treasury. The output of the correlation analysis is provided below. Pearson correlation of 3m Euribor and 3m US Treasury = 0.430 P-Value = 0.000 It can be seen that the correlation coefficient between Euribor and US Treasury bill is 0.43. A p-value of 0.000 shows that the null hypothesis equating correlation coefficient to zero is rejected at both 99% and 95% confidence levels. This shows that the short term interest rates at Europe and US share a very strong positive relationship. It is observed from the review of a number of researchers including Bremnes et al. (2001), Cumby and Mishkin (1987) and Ehrmann and Fratzscher (2004) that US and Europe tend to share very strong monetary relationships. Researchers have attributed this to the fact that the two continents have had very strong financial and political relationships. 3.5. The relation between LIBOR and US interest rates It is necessary to obtain the correlation coefficient between the interest rates in UK and US. This is done by using the 3 month US LIBOR and 3 month US Treasury. Following is the result of the correlation analysis Pearson correlation of 3m Libor USD and 3m US Treasury = 0.966 P-Value = 0.000 As can be observed, the correlation coefficient is 0.966 and the p value is 0. This shows that the null hypothesis that there is no significant correlation can be rejected at 95% and 99% confidence levels. In other words, there is a very strong correlation between short-term interest rates in US and UK. This matches the observations made in literature review section where it is noted that a number of researchers have found empirical relationship between these two countries' monetary polices. This stems from the long-term political and economic association of US and UK. Particularly the monetary policies of both these countries have been long known to move in lock-steps with each other. 3.6. Chapter Summary This chapter analyses the relationship between pairs of interest rates of different states in EU, EA and outside Europe. It is observed that there is very strong relationship between interest rates pertaining to different time periods as measured by 1 month, 3 months, 6 months and 1 year EURIBOR. An analysis of short-term interest rate of different states in Europe shows that some states such as Poland, Latvia and Lithuania share very strong correlation with UK LIBOR which indicates that small states tend to follow the monetary policies of larger economies in order to ensure monetary and economic stability in the countries. Among the countries outside the EA, Estonia shares the strongest relationship with EU. LIBOR and US Treasury rates are very closely correlated as may be expected on the basis of the strong economic ties that these two countries share with each other. 4. Interest Rates Modelling and Forecasting in Europe This section of the report is concerned with ascertaining the impact of some important factors on the changes in short term interest rates in Europe. The first part of this section is concerned with factors affecting interest rates in Euro Area and the second part deals with the impact of changes in Euro Area interest rates upon other EU states' interest rates. 4.1 Factors affecting Interest rates in EA This section attempts to model the interest rate changes in Euro Area using linear regression with two predictor variables - money supply changes and inflation (which is the equivalent of changes in general price level). Following table shows the results obtained from the regression function. It can be observed that the both money supply (M3) and inflation have negative coefficients indicating that negative changes in these variables cause a positive change in interest rates. This is quite unlike the macroeconomic theory which states an increase in inflation is countered by the central banks through an increase in interest rates so that the extra supply of money gets sucked back into the system. However the results presented here are contradictory to conventional economic wisdom. It may be necessary to ascertain the significance of these variables. It is seen that the P-values of these two variables are 0.023 and 0.159. Both values are more than 0.01 indicating that at 99% confidence level, the null hypotheses, that the coefficient of the two predictor variables are equal to zero, are not rejected. This means that there is no significant impact of M3 and inflation on the interest rates. The overall strength of the regression function is observed from the P-value associated with F-test which is 0.033 in this case. As this value is also more than 0.01 it can be concluded that at 99% confidence level, the two predictor variables do not have any significant impact on the changes in short term interest rates. The adjusted R-squared value of 4.5% means that the change in money supply and inflation could together define only 4.5% of the total changes in the interest rates. In short, it can be concluded that money supply and inflation do not influence interest rates. The reason for this odd conclusion could be that the interest rates do not change in tandem with money supply and inflation. The interest rates have a tendency to lag behind the macro economy as the central bank typically watches the macro economic variables over long term to make changes in monetary policies (Gali, 2008). 4.2 Factors affecting Interest rates in other EU states It is seen in the earlier section of this chapter that money supply and inflation do not seem to have any direct impact on the changes in short term interest rates in the EA. This part of the chapter checks the impact of changes in Euro Area interest rates upon the changes in interest rates in other EU states. Following table shows the results of 11 regression functions performed with interest rates series of each one of the 11 other states in EU as the regressed variable and the 3m Euribor as the regressor variable. The results as given above show that the interest rate changes in EA have had significant impact on the interest rates of only some countries. The interest rates of Estonia, Latvia, Poland, Romania and UK have significant positive relationships with the interest rate changes in the Euro Area as observed from the positive value of their respective coefficients and the p-value of less than 0.01. This observation is based on t-tests performed at 95% confidence level. On the other hand some countries including Bulgaria, Hungary and Sweden have negative coefficients but with insignificant values as their p-values are all greater than 0.01. Thus for these countries interest rate changes in EA have insignificant but negative impact. For other countries such as Denmark, Chezh Republic and Lithuania, the impact is positive but insignificant. Thus from the above regression results it can be concluded that short term interest rates in EA have significant positive impact only on a handful countries in EU that are not part of the EA. 5. Time series Analysis The analysis so far has focussed on the relationships between interest rates of different economies or better different kinds of interest rates within the same country. This section is focussed on the time series aspect of the data. Since the data represent the value of the macroeconomic variable for a specific time period, the continuous set of data can be considered a time series. This section analyses the time series data using trend analysis. The presence of stationarity in time series is tested using autocorrelation function. 5.1. Trend Analysis It is essential to understand the nature of time series data in order to enter it into forecast models. Most of the forecast models assume that the time series follow a linear trend. However it may not be true. Linear regression models assume that the independent variables have a linear causal impact on the dependent variable. However time series models are built on the basis of the historic values of the same series. The purpose of these models is to forecast the future course of the data series. Some of the most popular methods of forecasting used are linear, quadtratic and exponential. It is customary to begin with the linear model to ascertain the nature of the model. The accuracy of the model is ascertained by comparing modelled data to the actual data. Some of the key measures of accuracy of the forecast model are MAPE (Mean Absolute Percent Error), Mean Absolute Deviation (MAD) and Mean Squared Deviation (MSD). When these measures of error are minimised the model is stated to be get better. This section builds the forecast models for UK interest rate and EU interest rates. 5.1.1. 3m LIBOR First, linear model is attempted for UK interest rates. Following is the typical structure of a linear model Xt = b0 + b1t + e Xt = Data value for period t t = time period The value of b0 and b1 are ascertained using Minitab procedures for linear trend analysis. Following chart shows the equation and the graph for interest rate data series for UK As can be observed, the forecasted value when fitted against the actual value, is quite off and does not represent the underlying trend in the data. The negative coefficient means that the slope of the line is negative and so the data is decreasing over time. However as can be observed from the data, the data series is actually an increasing function and not a decreasing function. Besides, the high values of MAD and MSD clearly indicate that the linear forecast model may not be appropriate for the UK interest rate data series. Quadratic forecast model is used to ascertain if the data series of UK interest rates fit well into the quadratic function. A quadratic model is built on the basis of the following structure. Xt = b0 + b1 t + b2 t2+ e Xt = Data value for period t t = time period t2 = squared value of time period. Following chart shows the quadratic model of the data series representing UK interest rates. As it can be observed easily from the graph shown above, the quadratic model is able to predict the movement of the time series quite accurately. The MAD and MSD error measures are both significantly lower than that while using linear trend model and so quadratic model is chosen as the proper fit the UK interest rate data series. Following is the model that is obtained using quadratic modelling Yt = 6.758 - 0.10561t + 0.001045t2 Yt is the 3 month LIBOR during time period t Exponential smoothing can be used to generate better fit for the data than quadratic modelling and linear modelling. Exponential smoothing is a process, which learns from the differences between the forecasted value and the actual value and adjusts the forecasting factor to represent the difference. Thus with every subsequent data item the model evolves and produces better forecasts. This is the reason for the wide popularity of exponential smoothing as the forecasting method. It is also observed that this method has the ability to take into account the changes that take place in the external environment and so the exponential smoothing method always includes the latest set of data in its forecasting model. Exponential smoothing typically takes the following form Yt = a.xt-1 + (1-a) Yt-1 a is the smoothing factor Following chart shows the alpha value as calculated using the exponential smoothing method. It also shows the close correlation between the fitted values and the actual values. It can be observed that the Alpha value is positive at 1.4891 and the MAD is 0.0810.This MAD can be compared to the MAD value of 0.3406 obtained from quadratic model method. Thus it is easy to note that exponential smoothing does a better job of matching the actual values. Using an alpha value of 1.4891 it may be possible to accurately forecast the future changes in 3 month LIBOR. 5.1.2. 3m EURIBOR The trend analysis of EURIBOR is also performed to ascertain the nature of underlying trend in the time series. As with the case of LIBOR, the EU interest rates are first fit into a linear model. Following is the result obtained. The linear model estimated from the time series of 3 month EURIBOR is as follows Yt = 3.754 - 0.0105t Yt is 3 month EURIBOR. It is noted that the MAD and MSD values are significantly high. Besides, the above graph clearly shows that the fitted line is quite different from the actual line and so the model is not capable of forecasting the future movements in EURIBOR accurately. Quadratic modelling method is used to obtain a different model for the same data series. Following is the chart, which shows the quadratic model and its fit with the actual data. It can be noted that the MAD and MSD for quadratic model is significantly less than those for the linear model estimated. Thus the forecast model for 3 month EURIBOR interest rate data series can be stated as follows: Yt = 5.323 - 0.10467t + 0.000951t2 Yt is the 3 month LIBOR during time period t As seen in the case of LIBOR, it may be possible to obtain beter forecasting by usng the exponential smoothing method for EURIBOR as well. Therefore it is necessary to obtain alpha values for Euribor for the period under consideration. Following chart shows the exponential smoothing alpha value as well as the fit between the actual data and fitted values of the data series. The smoothing constant obtained for EUROBOR is 1.89234. It can be noted that the MAD value for the forecasting done using exponential smoothing method is 0.06214 while it was 0.4845 for the quadratic model used earlier. Thus it is evident that the exponential smoothing method can produce more accurate forecasts. The alpha value to be used for accurate forecasting of EURIBOR is 1.89234. Another property, which is necessarily studied while analysing the time series data is autocorrelation. Since the data series represents the changes in underlying variables over time, there is a very high probability that the subsequent changes may be dependent upon the previous changes in the series. Thus in the series, there may be significant correlation between one data item and subsequent data items. In order to ascertain if this property is present, typically the data series is correlated with itself at specific lags. It is noted that at lower lag levels, autocorrelation tends to be higher than at higher lag levels. It is possible to conduct hypotheses tests to check if the data involves any significant autocorrelation at a specific lag level. Lung-Box test is commonly used to ascertain the extent of autocorrelation and its statistical significance. Following is the formula used for Ljung-Box test. N is the sample size R2t is the autocorrelation at lag t k is the number of lags that are tested Following are the hypotheses that are tested H0 : autocorrelation at various lags is equal to zero Ha: autocorrelation at various legs is not equal to zero Following graphs show the autocorrelation values of LIBOR and EURIBOR at different lag levels. The red lines denote the statistical significance limits. Any value of autocorrelaiton which is outside the limit means that the autocorrelation is statistically significant till that lag level. At Lag level of 1, LIBOR has an autocorrelation coefficient of 0.9647 while EURIBOR has 0.9808. It can be noted that EURIBOR has a higher rate of autocorrelation than LIBOR. It is also noted that the autocorrelation for both the interest rates are statistically significant till lag level 7. The fact that EURIBOR has a higher degree of autocorrelation denotes that the changes in EURIBOR are highly dependent upon the previous values of the data series. On the other hand, the changes in LIBOR appear to be more random than EURIBOR. 5.3. Chapter Summary Interest rate modelling in EA shows that both money supply and inflation rate do not have any significant relationship with short-term interest rates. This may be due to the lag that is observed between the changes in monetary variables and the changes in interest rate as induced by the central bank. A set of regression function carried out to ascertain the impact of changes in EURIBOR on changes in interest rates in different states in Europe shows that some countries such as Estonia, Latvia, Poland, Romania and UK show significant impact of EURIBOR in their interest rate decisions. Other countries have insignificant relationships. It is observed that exponential smoothing provides the best fit of the historic data for both LIBOR and EURIBOR. An analysis of the autocorrelation of these data series clearly shows that there is significant autocorrelation in both these data series with LIBOR exhibiting slightly more random changes than EURIBOR. One of the most important objectives of the formation of EU is to create financial and monetary stability in the region. Besides, the recent behaviour of central banks to act in tandem while making significant changes to monetary policies inspired this research which attempts to study the behaviour of interest rates in Europe using popular quantitative techniques. Correlation analysis shows that the different short term interest rates within Euro Area have very high degree of correlation among themselves. On the other hand, only some countries have strong correlations among their interest rates among the other states of EU. The short term interest rates in UK and EA correlate significantly and so do the short term interest rates in UK and US. Regression analysis shows that money supply and inflation do not have any significant predictive values for the short term interest rates as the interest rates typically tend to move on the basis of long term changes to the macro economic variables. Finally, it is seen that the interest rates in some countries such as UK, Estonia, Latvia, Poland and Romania exhibit high degree of sensitivity to changes in the EA interest rates. The results overall lead to a conclusion that the al the interest rates in Europe do not move together or get influenced by each other. Only a handful of countries including EA, UK, Estonia, Latvia, Poland and Romania appear to have achieved measureable levels of monetary integration. This shows that EU still has a long way to go in their ambition to achieve financial and monetary integration. EA, UK and US share strong monetary relationships as expected on the basis of literature review. The time series analysis of LIBOR and EURIBOR shows that alpha value of 1.4891 and 1.8923 respectively can be used to obtain accurate forecasts using exponential smoothing methods. It is noted that EURIBOR has a higher degree of autocorrelation than LIBOR. In other words, LIBOR is more random than EURIBOR. The conclusion that can be drawn from this observation is that BOE has a habit of making some quick unexpected changes in monetary policy than ECB. This conclusion is hardly surprising, given the fact that BOE does not even publish a detailed report whenever the short-term discount rates are left unchanged by the Monetary Policy Committee (MPC). The final conclusion that can be drawn from the statistical tests conducted in this brief research is that the interest rates in Europe exhibit mixed relationships. While some states such as EU, Poland, Latvia and UK share very strong relationships among their monetary policies, other countries appear to be mostly independent. Even within the European Union there are states such as Denmark and Bulgaria, which do not have any significant relationships in terms of interest rates. Thus, the observation made in the literature review, that EU states tend to have strong monetary relationships appears only partly justified by the actual data. However it should be noted that this research is based on a limited set of data and the results may be different when a longer time horizon is involved. One conclusion, which emerges strong and resounding, is that both EMU and UK share very strong monetary relationships, which are reflected in the empirical analysis. This also matches the observations made by a number of researchers earlier. Bremnes, H., Gjerde, O. and Scettem, F. (2001) 'Linkages among Interest Rates in the United States, Germany and Norway', The Scandinavian Journal of Economics, 103(1), 127-145. Borio, C. E. V. and Fritz, W. (1995) 'The response of short-term bank lending rates to policy rates: a cross-country perspective', Bank for International Settlements, BIS Working Papers 27. Codogno, L., Favero, C. and Missale, A. (2003) 'Yield Spreads on EMU Government Bonds', Economic Policy, 18(37), pp.503-532. Cumby, R. E. and Mishkin, F. S. (1987) 'The International Linkage of Real Interest Rates: The European - U.S. Connection', NBER Working Paper No. W1423. ECB (2009) Map of euro area 1999 - 2009, http://www.ecb.int/euro/intro/html/map.en.html, Date accessed 30/11/09. Ehrmann, M. and Fratzscher, M. (2004) 'Equal Size, Equal Role? Interest Rate Interdependence Between the Euro Area and the United States', FRB International Finance Discussion Paper No. 800. Faini, R. (2005) 'Fiscal policy and interest rates in Europe', presented at 41st Panel meeting of Economic Policy in Luxembourg, March 2005. Fratianni, M. and von Hagen, J. (1990) 'German dominance in the EMS: The empirical evidence', Open Economies Review, 3(1), 127-128. Gali, J. (2004) The monetary policy strategy of the ECB reconsidered, CEPR. Gali, J. (2008) 'Introduction to Monetary Policy, Inflation, and the Business Cycle: An Introduction to the New Keynesian Framework', In Gali, J. (2008) Monetary Policy, Inflation, and the Business Cycle: An Introduction to the New Keynesian Framework, Princeton University Press. Gerlach, S. and Schnabel, F. (1999) 'The Taylor Rule and Interest Rates in the EMU Area', CEPR Discussion Paper no 2271. Gerlach, S. and Smets, F. (1999) 'Output gaps and monetary policy in the EMU area', European Economic Review, 43(4-6), pp.801-812. Honahan, P. and Lane, P. R. (2003) 'Divergent Inflation Rates in EMU', Economic Policy, 18(37), pp.357-394. Karfakis, C. J. and Moschos, D. M. (1990) 'Interest Rate Linkages within the European Monetary System: A Time Series Analysis', Journal of Money, Credit and Banking, 22(3), 389-94. Koukouritakis M. and Michelis, L. (2005) 'Term structure linkages among the new EU countries and the EMU', University of Crete, Discussion Paper. Levin, R. I. and Rubin, D. S. (1997) Statistics for Management, Prentice Hall. Martin, R. (2001) 'EMU versus the regions? Regional convergence and divergence in Euroland', Journal of Economic Geography, 1, pp.51-80. Poghosyan, T. and Haan, J. D. (2007 ) 'Interest rate linkages in EMU countries: A rolling threshold vector error-correction approach', CESIFO working paper 2060. Toolsema, L. A., Sturm, J. Haan, J. D. (2001) 'Convergence of Monetary Transmission in EMU New Evidence', CESifo Working Paper Series, CESifo Working Paper no 465.
Project 3: This project on Family Caregiving in Lung Cancer in conducted in concert with Projects 1 and 2 focused on Early Stage and Late Stage disease. The burden on caregivers of patients with lung cancer, both early and late stage, has been documented as very significant and few studies have addressed the specific needs of family caregivers in this population. Conducting this project simultaneously has great synergy allowing access to family caregivers of lung cancer patients, a group rarely studied. The aims of this research are: Aim 1 : Test the effects of a Family Caregiver Palliative Care Intervention (FCPCI) for informal caregivers of patients with early and late stage lung cancer on caregiver burden and caregiving skills preparedness as compared to a group of FC in a usual care situation. Aim 2 : Test the effects of a FCPCI for informal caregivers of patients with early and late stage lung cancer on FC quality of life and psychological distress as compared to a group of FC in a usual care situation. Aim 3 : Describe early and late stage FC self care behavior, comparing the usual care and FCPCI groups. Aim 4 : Describe resource use by early and late stage FC in the two FCPCI and usual care groups. Aim 5 : Identify subgroups of FC who benefit most from the FCPCI in relation to sociodemographic characteristics, clinical/functional factors. A two group, prospective sequential, quasi-experimental tandem enrollment design will be used for this study in which the usual care group is accrued and followed during Phase 1 and the intervention group is accrued and followed during Phase 2. Family caregivers will be accrued (N=533) in conjunction with the Early and Late Stage patient projects. The study will examine the effects of the FCPCI on critical caregiver outcomes and in unique in addressing not only emotional support and informational needs but also skill preparedness and self care. The FCPCI builds upon >20 years of related research by the investigators and a recently concluded pilot test of QOL and symptom concerns in lung cancer. This project has great significance to public health given the significant numbers of people diagnosed with lung cancer and the associated individual and societal costs. Lung cancer impacts elderly patients, creates extensive family and social burden and both psychosocial and financial consequences are substantial. Integration of palliative care into quality lung cancer care can serve as a public health model to maximize both quality of life and health care resources. \|Fujinami, Rebecca; Sun, Virginia; Zachariah, Finly et al. (2015) Family caregivers' distress levels related to quality of life, burden, and preparedness. Psychooncology 24:54-62\| \|Kernstine, Kemp H; Moon, James; Kraut, Michael J et al. (2014) Trimodality therapy for superior sulcus non-small cell lung cancer: Southwest Oncology Group-Intergroup Trial S0220. Ann Thorac Surg 98:402-10\| \|Otis-Green, Shirley; Sidhu, Rupinder K; Del Ferraro, Catherine et al. (2014) Integrating social work into palliative care for lung cancer patients and families: a multidimensional approach. J Psychosoc Oncol 32:431-46\| \|Koczywas, Marianna; Cristea, Mihaela; Thomas, Jay et al. (2013) Interdisciplinary palliative care intervention in metastatic non-small-cell lung cancer. Clin Lung Cancer 14:736-44\| \|Koczywas, Marianna; Williams, Anna Cathy; Cristea, Mihaela et al. (2013) Longitudinal changes in function, symptom burden, and quality of life in patients with early-stage lung cancer. Ann Surg Oncol 20:1788-97\| \|Grant, Marcia; Sun, Virginia; Fujinami, Rebecca et al. (2013) Family caregiver burden, skills preparedness, and quality of life in non-small cell lung cancer. Oncol Nurs Forum 40:337-46\| \|Borneman, Tami; Bluman, Olga F; Klein, Linda et al. (2013) Spiritual care for Jewish patients facing a life-threatening illness. J Palliat Care 29:58-62\| \|Ferrell, Betty; Koczywas, Marianna; Grannis, Fred et al. (2011) Palliative care in lung cancer. Surg Clin North Am 91:403-17, ix\|
Boards of Canada, ‘The Campfire Headphase’ (Warp) As Boards of Canada, Marcus Eoin and Mike Sandison take strangely hypnotic wanderings through a monochromatic, ethereal haze. Listening to the Scottish duo’s third full-length, The Campfire Headphase, is like dreaming in fuzzy, sepia-tinted tones through blinked-back tears. While their humid wasteland of sonic blips and processed textures verges on the monotonous, there is enough illuminating grandeur that makes their album lifting, and even cathartic. With track titles like “’84 Pontiac Dream” and “Constants Are Changing” it might seem like the Scottish duo don’t pen the smartest of songs, but their syrupy techno-rock hybrid adeptly incorporates acoustic, electric, and electronic instruments with ambient synergy. There are, however, missteps: “Dayvan Cowboy” begins promisingly, but as BoC peel back the echoing overcast to reveal melancholy layers of digitalia, the track morphs into Moby-inspired filler. When the duo doesn’t unduly flirt with dance excessiveness, though, their electronic stammerings bubble benignly just beneath the surface. These synthetic throbs aren’t waiting to explode or even unfold — they’re just waiting. Standout cuts “Oscar See Through Red Eye” and “Slow This Bird Down” make these manufactured pulses more oblique and obtrusive, pitter-pattering them out like percussively lapping waves or a gentle heartbeat that gives life to the abysmal calm.
Licensed Real Estate Salesperson - 1754 Rt. 9, Parkwood Plaza Clifton Park, NY 12065 I specialize in New Home Construction and marketing. I also develop property. Welcome to my Website Thank you for visiting my website. My background includes 15 years in the lumber industry, where I learned about materials and met many of the builders and remodelers I work with today. I also worked 9 years for a home builder and was responsible for the construction of over 500 homes. During my time as a home builder, I also worked to develop large properties into residential subdivisions. I am pleased to offer my 30 plus years of industry experience to help you in your real estate endeavors. I am married and have two children. I grew up in the Captial District and graduated from Catholic Central High School in 1977. I also attended HVCC and have an Associates Degree in Math Science. The newest Rousseau The "No Grinch" December 2012 Market Snap Shot "Holiday Edition" I have an Associates degree from HVCC in Math/Science and have earned the NAHB certification in New Home Sales (CSP). - Member of the Board of Directors - National Association of Home Builders - Member of the Board of Directors - New Your State Builders Association - Member of the Board of Directors - Capital Region Builders and Remodelers Association - Vice President - Capital Region Builders and Remodelers Association - Chairman - Time to Buy Committee - Member - Greater Capital Association of Realtors - Member - New York state Association of Realtors - Member - Capital region Multiple Listing Service - Member - Malta Business Professional Association - Director of New Construction Sales - Coldwell Banker Prime Properties - Owner of Synergy Realty Group - Vice President - Rosewood Home Builders - Owner - Adirondack Manufacturing Corporation - General manager - Wickes Lumber Company - Coach - Burnt Hills Baseball - Volunteer - Clifton Park Soccer - Antique Autos
October 19, 2012 3:00 AM \| John Polson Three members behind last year's survival driving sensation Nitronic Rush are gauging interest for their spiritual follow up Distance on Kickstarter and Steam Greenlight. Notable additions to Distance so far will be LAN and online multiplayer functionality in classic racing, tag, capture the flag, stunt mode, and more. The team will also add a level editor and modding tools. These additions may sound like Distance is just trying to catch up to all the latest AAA racing game features, but much innovation is planned and is already rooted in its Nitronic Rush foundation. For instance, the exploration mode sounds more exciting than the traditional Grand Theft Auto style, since the car can jump, rotate, ride up building sides, and generally defy gravity. Players will be able to explore the city to find hidden paths and find secrets that reveal the city's past. For $15 players can get access to the early beta and the released game on PC or Mac, and even get their name in the credits. The team may consider Linux once Unity4 is released, too. The developers behind Distance are fresh out of DigiPen and calling themselves Refract Studios. The team collectively has worked on some internationally recognized titles: Sowlar, Solstice, Solace, and The Fourth Wall. Distance will be their first commercial effort. Will the use of Kickstarter and Greenlight create a form of synergy so both campaigns succeed? I'm curious to see the results!
MEVANTAGE believes that Sales (revenue generation) is not an art but Science. And that this science of sales is based on certain logics if executed in a process-oriented manner will definitely yield decent results. Working along this belief, MEVANTAGE has earned a reputation in the market in building result-oriented-sales-processes that is in line with our Client's Vision. MEVANTAGE helps to drive improvements in productivity and growth beginning with an assessment of a Company's selling system. We then work with the Company to develop a pragmatic, actionable implementation schedule that can reliably increase sales without disrupting the Company's current revenue streams. Mevantage approach to sales enablement is grounded in the field experience of our Consultants. It's not the usual academic approach that strikes veteran sales people as irrelevant to their needs. Mevantage brings together the often fractured approach to sales enablement into one unified program that bridges marketing, sales, product management, learning and development, and human resources. We teach your sales team how to close more of the most important deals by creating synergy between executives and those on the front line. We are able to help you double or even triple your sales by engineering strategies and behavior changes that incorporate sales force best practices. MEVANTAGE's Consulting services include working closely with you, your Company & Management to define and develop your sales processes, identify best practices within your organization, build models that easily and automatically replicate these processes and practices, and measure the results to ensure there's an acceptable ROI (Return-On-Investment). MEVANTAGE follows below best practices for sales-consulting in order to cultivate maximum results for our Customers:First Phase is Sales Auditing: MEVANTAGE will conduct a thorough diagnosis to identify on the prevailing 'gaps' in the sales department. Second Phase is Consulting: Once the 'gaps' are identified, they would be mitigated with certain solutions as consulted and executed by us. And that these 'solutions' should provide tangible results to the Prospects. View more at website
Complementary Solutions Enable Optimized Mail Production and Processing March 13, 2014, Cambridge, MA and Mt. Laurel, NJ Window Book, Inc., a leading provider of mailing, shipping and post-presort data management software, and GrayHair Software, Inc., a leader in delivering best practices for address hygiene and postal management, today announced an expanded relationship that enables mailers to achieve the full range of benefits available through the Intelligent Mail® barcode. “Window Book and GrayHair together offer complementary solutions for mailers so everyone can benefit from expanded presort and post-presort systems. By having software and services from both of these industry-leading companies integrated in your mailing operation, everyone will be able to automate their daily process and fully optimize their mailing operations,” said Jeffery Peoples, Window Book’s CEO. “We are extremely pleased with this new partnership and look forward to expanding it even more in the future as we work together to make it easier for our mutual clients to pass data through each other’s solutions,” said Jeffery Peoples, Window Book’s CEO. “We look forward to a fast growing and successful partnership. This agreement with Window Book enables GrayHair to offer its current and prospective clients advanced options to optimize their mail production,” said Raymond Chin, Vice President of Product Management and Marketing, GrayHair Software. “We consider ourselves the leader in services that provide mailers methods to optimize data visibility with their vendors and customers. This partnership will close the loop on how that data is delivered into the Postal Service.” The business synergy between Window Book and GrayHair products will result in improved production and workflow processes that can benefit many of the companies’ mutual customers. This workflow integration will make it even easier for GrayHair customers to utilize Window Book capabilities and vice versa, providing added benefits and efficiencies before, during and after presorting mail. For more information about Window Book and/mailing and shipping software, visit www.WindowBook.com, call 1-800-524-0380 or email PostalSpecialist@WindowBook.com. For more information about GrayHair, visit www.grayhairsoftware.com or call 1-856-727-9372. For more information about Window Book and/or DAT-MAIL, visit www.WindowBook.com, call 1-800-524-0380 or email PostalSpecialist@WindowBook.com. For more information about GrayHair, visit www.GrayHairSoftware.com or call 1-856-727-9372. About Window Book: Window Book is currently celebrating its 26th year helping clients manage their operations more profitably. Why should you talk to Window Book? Because we help you to: Streamline mail processes to reduce operational costs! Implement Full-Service and Seamless Acceptance to minimize the risk of downstream quality issues and be in a better position to defend your preparation processes. Grow with Emerging Technologies. Automate Your PostalOne! Submissions. Move to the Cloud to Optimize Your Operations. Use Your Data to Make More Money. Are you Keeping Up With Your Competition? Learn the KEY Shifts You Can Make… We Can Help YOU in Ways No Other Company Can! Call 1-800-524-0380 and talk with a Postal Expert Now. www.WindowBook.com GrayHair is an innovator and industry leader in the development of solutions that improve the return-on-investment of business mail. GrayHair Advisors is the source for strategic and tactical consulting services. The company’s experience on the cutting edge of postal issues for the largest companies is key to helping mailers increase response rates, manage postal expenses, optimize mailing operations and integrate mail with digital communications. GrayHair Software provides critical services through its cloud platform SelectSolutions® including address quality (domestic and global), IMb™ assignment, mail tracking, mail monitoring, presort analysis, postage reconciliation, and global hybrid mail. For more information, visit www.GrayHairSoftware.com and www.GrayHairAdvisors.com. Intelligent Mail, PostalOne!, FAST, USPS, Express Mail, Priority Mail Open and Distribute and Delivery Confirmation are registered trademarks owned by the United States Postal Service in the United States and/or other countries. Mail.dat and Mail.XML are trademarks owned by the International Digital Enterprise Alliance (IDEAlliance). Window Book, Inc. 300 Franklin Street Cambridge, MA 02139-3781 ©2014 Window Book, Inc. All rights reserved. DAT-MAIL and eDocs Monitor are trademarks of Window Book, Inc. The following trademarks are owned by the United States Postal Service: Intelligent Mail, IMb and PostalOne! The information contained herein is subject to change without notice. Contact Window Book for current information. ©2014 GrayHair Software, Inc. All rights reserved. GrayHair Software, the GrayHair Software logo and SelectSolutions are trademarks or registered trademarks of GrayHair Software. Intelligent Mail, IMb and PostalOne! are trademarks of the United States Postal Service®. All other trademarks and service marks are the property of their respective owners. Specifications are subject to change without notice. Performance and results may vary depending upon specifications, user environment and other variables. If you no longer wish to receive our emails, click the link below: 300 Franklin Street Cambridge, Massachusetts 02139-3781
"Cenega, in a short amount of time, has proven themselves to be one of the best storytellers in the computer and console games industry. They continue to create and provide games with ground breaking content that appeal to the worldwide gaming community," said Tamra Nestler, CEO of Tri Synergy, Inc. "We believe this distribution partnership brings both companies closer to attaining a shared desire of providing quality game play and content to gamers world wide." The titles covered in the distribution agreement are: UFO: Aftermath; Turn/Real time strategy/action game. Korea: The Forgotten Conflict; Squad based strategy/action game Shade: Wrath Of Angels; 3D action-adventure/horror "We have been impressed with Tri Synergy, Inc.'s already proven track record of success, which presents Cenega Publishing with a seamless and instant profile and advancement in one of the most important markets in the world," Sonia Khebere, International Marketing Manager, Cenega Publishing
Death threats leveled against Rush Limbaugh Dan Riehl at Breitbart.com hears the warm purr of liberal tolerance rumbling from the Left, which is growing somewhat vexed that radio host Rush Limbaugh hasn’t ceased to exist yet: The death threats to Rush are captured in several screen grabs of his Facebook page. “Execute Rush, now!” states one; “Don’t just drop sponsorship someone kill this pig now please!!!!,” reads another. These and others are documented below, with images and names obscured, so as to not be guilty of fueling the same targeted hatred the White House and Democrats have now gone to great lengths to stoke. […] “I think karma got a death grip on breitbart, I think his passing is inspirational. Hopefully rush will die next,” reads another message directed at Limbaugh. Meanwhile, in comments posted at the L.A. Times Facebook wall, still undeleted as this article is written, readers state that it “would be nice to see that fat douche taken down but I’m not holding my breath”; “crossing fingers for a huge heart attack,” and so on. Lovely people, aren’t they? Well, at least they never, ever say rude things to women. Just ask Michelle Malkin! As Riehl notes, we’re watching a pressure cooker of Limbaugh hatred boil over, fueled by a level of political and media synergy conservatives can only marvel at. In what appears to be overt coordination with the White House, the Democratic Party, and organizations such as Media Matters for America, the left has pressed home what it sees as a sudden political opportunity provided by Rush’s provocative reaction–despite his apology. The goal is not to protect women–who are frequently mocked by liberal talk show hosts without protest–but to force Rush, one of the most effective forces in conservative media, off the airwaves. This is the sort of thing the rise of Fox News only hints at for the Right. Liberals aren’t really mad at Fox for dishonesty – they can never produce any examples of it during their anti-Fox rants, and they turn purple when reminded of blatant liberal journalistic frauds like RatherGate. What drives the Left nuts is that Fox can pick up and amplify stories the Left would rather ignore, reducing the time lag from blogosphere chatter to water-cooler conversation. Political and media synergy is a function of time, and the Right simply cannot reproduce anything like the Democrats’ synchronized war on religious liberty, beginning with bizarre out-of-nowhere questions from political operative George Stephanopolous at a Republican debate, and ending with the high-speed snowball of the Fluke affair. In a matter of hours, Democrat political operatives coordinated with media allies to create a set of entirely false “facts” that “everybody knows” – Sandra Fluke is a wide-eyed 23-year old innocent college student testifying before Congress, she’s trapped in a cruel educational institution that is bankrupting her by refusing to pay for her contraception, and powerful media figure “called her a slut” on the air. The Democrats’ dopey “War on Women” campaign was launched almost immediately after this narrative was chiseled in media stone. Now that the Left has been worked into a frenzy, however, they are being denied climax. Limbaugh’s not going anywhere. He announced today that he’s signing new advertisers, and said that two of those who earlier pulled out of his show are “begging to come back.” People are starting to buzz about the odious misogynistic garbage some of those other, supposedly pious advertisers are happy to support. A great deal of attention has been focused on Limbaugh, and the Left keeps forgetting that he’s very good at retaining attention. This leaves inarticulate hatemongers quivering with rage as they post death threats, while the more sober elements of the liberal coalition look for productive ways to invest the unpleasant energy they have harvested – ideally before people come back around to the absurd nonsense Sandra Fluke was actually peddling, in a photo op deliberately misrepresented as a congressional hearing, or the broader outrage against economic and religious liberty she was trying to defend. They might also remember that no one was particularly worried about the cost and availability of contraception before this little circus began. Besides pumping out fundraising letters, the other obvious ploy for Democrats is to use the evanescent anti-Limbaugh rage against political targets. The Hill reports on one such example: Democrats are seeking to turn the recent controversy over Rush Limbaugh into a problem for GOP presidential candidate Mitt Romney, with one House Democrat suggesting this week that Romney is at fault for Limbaugh’s ability to stay on the air. Rep. Steve Cohen (D-Tenn.) said it is “unquestionably” fair to tie Limbaugh to the GOP candidates, especially Romney. “The fact is, Bain Capital owns Clear Channel, he’s got a conflict of interest, and you can’t have a leader like that,” he told Current TV’s “The Young Turks” on Tuesday night. Bain Capital, the private-equity firm Romney co-founded in 1984, acquired Clear Channel, which hosts Limbaugh’s syndicated show, in 2008. Yes, Cohen said this on the tiny TV network founded by Al Gore, which continues to employ the odious woman-hater Keith Olbermann, whose misogynistic remarks come in the form of spittle-flecked personal tirades, not satirical misfires. No, Cohen doesn’t get the irony, and neither does any other liberal. All they know is that a very tenuous connection between Limbaugh and Romney has been established – Romney co-founded a firm 28 years ago that purchased the network hosting Limbaugh’s program 4 years ago – and they’re going to tug on that frayed thread until it snaps. Rage must be consumed quickly, before it turns rancid.
What Westinghouse Wrought One of the better pieces out there anywhere in the nexus of journalism and history was the PG series looking at the whole sordid tale: Who Killed Westinghouse? My summary is just a bit shorter. Jordan wanted the big media lights, but was stuck running what some thought was merely an old industrial company. He wanted to run CBS, so Westinghouse bought CBS, became CBS, and then just ditched the residual which was what Westinghouse had been for a century. Business hubris run amok. It gets to some real questions of how Pittsburgh survived the recent decades. Westinghouse's dissection was not the result of any of the same structural forces that did in the steel industry here. Some maybe, but not the bulk of it. Many of the parts of Westinghouse were and in some cases still are competitive enterprises, but the collective Westinghouse and its synergy in technology was taken apart by Jordan and Co. never to be put back together. The impact on Westinghouse on the the region is recognized by many, but the memory is fading. What we have of a technology base in the owes much of its existance to the people and enterprises brought here by Westinghouse in one way or another. From the remnants of Westinghouse Nuclear (no need for the qualifier anymore) to a long list of companies that would take too long to go through.. the common thread is W. The Westinghouse R&D complex was one of the best in the world for decades at what it did creating technology and was in and of itself one of the main draws of migrants (international and domestic) into the region for decades when there were few other economic reasons to move here? Many communities of folks are here because Westinghouse brought them here and the vast Pittsburgh transfromation we talk about would not have been possible if they were not here. So if Pittsburgh was able to rebuild itself with what Westinghouse left us, imagine the history if Westinghouse had not been torn apart. Sorry for the rant. BP may be in the news, memories of Enron are fading... but what Jordan destroyed for such inconsequential gain is unmeasureable. When it comes to sheer business ego that ignored the consequences, the story of Westinghouse and CBS may top them all.
Last night brought the cult-sitcom reunion you’ve all been waiting for: Henry Pollard and Lydia Dunfree, sans bowties and pigs in a blanket, transferring the frayed chemistry from their days at Los Angeles’ Party Down Catering to humble Pawnee. Okay, fine. Adam Scott and Megan Mullally don’t even have any scenes together. But this did mark an anticipated reunion in that last year’s “Ron and Tammy” episode — in which we learned the lurid details of Ron Swanson’s tortured, sexually depraved relationship with his evil-librarian ex-wife — is on anyone’s short list of moments when Parks and Rec found its voice and its footing last season. Ron Fuckin’ Swanson, the libertarian ideal of what happens when free will meets self-control, was rendered defenseless and partially mustache-less. (The fact that Nick Offerman and Mullally are married In Real Life gooses the joke.) It was only a matter of time before she’d be back. And now she is. There’s a lot to love in this episode, but maybe nothing more simple or sublime than the look on Ron’s face in the very first scene, when the comptroller informs him of the late charge levied for the popular self-help tome It’s Not the Size of the Boat: Embracing Life With a Micropenis — he’s amused and impressed and vaguely terrified and definitely turned on, all told with a cock of an eyebrow and the a smile. (Has any comic actor worked the brow this well since Belushi?) Leslie accompanies Ron to Tammy’s office at the — shudder — library, for moral support, but it’s not needed. Ron calmly tells Tammy that he’s in a happy, stable, non-insane relationship with Wendy. Which is all fine and well until Wendy announces that she’s moving back to Canada, and no, Ron isn’t interested in moving to Canada. Spit take. (Hello, 30 Rock joke synergy.) Tom, though, is still bitter about their relationship, and now that he no longer has Lucy to distract him, takes revenge by bringing Tammy to a pizza party for the Pawnee police force, intended to butter them up so they’ll volunteer their services for the Harvest Fest. “I know Tammy seems scary,” says Leslie, “but she’s just a manipulative, psychotic, book-peddling, sex-crazed she-demon.” What follows is nothing short of disaster. You know, one minute you’re trying to reach closure with your emotionally manipulative ex-wife at a pizza party, the next you’re in jail with your hair in cornrows, wearing a filthy kimono, a half a mustache, and a wedding band on your penis. The montage detailing the events leading up to this is one of the most confidently giddy and economic sequences you’ll see on this or any other television show — the fight, the hair salon, the wedding-registry spree, breaking in and stealing a license, the ceremony that takes the “you may now kiss the bride” part to a dangerous extreme. (Thanks, NBC promo department, for spoiling the genius “It rubbed off, from friction” punch line. And pity that last night’s episode of The Office centered around public displays of affection in the workplace, because this pretty much made Michael and Holly’s childlike canoodling look like a non-topic.) The dazed grin on Ron’s face during both the wildly ineffective intervention and the shower at the library is Emmy-worthy on its own. And just as the previous pairing of the Mullally-Offermans was as memorable for showing the compassion between Ron and Leslie as it was for Ron and Tammy’s fearless/fearsome chemistry, this episode had heart that was every bit the equal of the montage or the intervention. The thing that snaps Ron out of his stupor isn’t the inanity of a bridal shower, but Tammy kicking the shit out of l’il Tom, who has to get thrown full-speed into a library bookcase before Ron snaps out of it, carrying Tom out of the library Bodyguard-style. We’d be remiss not to mention that other stuff happened in this episode, too. April was temporarily reassigned to Chris’s desk and tried to sabotage a lunch date between him and Ann, and wound up parlaying that into an offer to accompany Chris back to Indianapolis — an offer Ann’s surprised she hasn’t received herself. Tip of the hat to Aubrey Plaza, who lets April thaw the slightest bit upon hearing Chris’s compliments and considers the offer, despite the urgent letter from Agent Macklin of the FBI demanding she return to the parks department to handle an emergency. Finally, a theory of no particular import or substance: If Pawnee is becoming the new Springfield, with its ever-expanding cast of oddball residents and recurring characters, is Tammy Swanson-Swanson its Sideshow Bob Terwilliger? Stunt casting: Check. Evil nemesis of the show’s protagonist: Check. Presence guaranteed to elevate an already great show into Holy shit, did you see that? territory? Check. If anything, the writers have painted themselves into a corner as far as being able to top the shenanigans here, but that’s a challenge, not a death sentence. If Parks and Rec can find a way to bring Tammy back even just once a season, that’s reason enough to renew this for another twenty.
The LeAnn Rimes of mariachi music Olivia Rojas knew she was in trouble when she saw the look on her 10-year-old daughter's face that morning. In the annals of the age-old power play between parents and their children, her suggestion that Nydia get up and sing at a little taco stand not too far from their Los Angeles home would not go down as brilliant strategy. She had meant for her daughter to see that it wasn't easy--becoming a mariachi singer--and had hoped her plan would put an end to her daughter's dream. Olivia had always known that her talented daughter would end up doing something big--the kid was just too smart. At age five, Nydia left Guadalajara with her mother and moved to Los Angeles, where it only took her three months to start reading, writing, and speaking English. When plans were being made for Nydia to return to Guadalajara for her all-important first communion celebration, Olivia discovered that her daughter could no longer remember Spanish, and Nydia relearned it in a matter of weeks. Olivia was proud of her daughter, but she just didn't understand her current infatuation with singing mariachi music. Her family had always known she was artistic, but thought of her as a dancer; she'd been taking dance lessons since she was a little girl and really seemed to throw herself into it. And you expect a young girl to have dreams of being a glamorous pop star, like Selena. But mariachi? The theme music of Mexican restaurants across America? Yes, it was the folkloric heartbeat of Mexico, but it was the music of a different generation, one whose time had passed. Olivia never thought that the family's favorite movie--the old charro flick Nosotros los Pabres (We the Poor)--would lead to this. Nydia had always loved "Amorcito Corazon," the song in the scene where the little boy has been burned to death, and his mother is holding him, and she and the great Pedro Infante are singing with tears in their eyes. That was the only song she'd ever bothered to really learn. Now, however, this mariachi thing had become more than just a matter of a favorite song from a beloved movie. At some point, Olivia thought that the harsh reality of performing in front of folks--the condescending smiles, the conversations that continue even through your best work, the heckling--would show her daughter how hard the life of a singer would really be. Clearly, Olivia had been dead wrong about the effect her strategy would have on her daughter. Instead of backing down from her mother's suggestion that she perform at the taco stand, the headstrong Nydia was already on her feet, a look of triumph in her eyes. It was obvious: This was the kind of opportunity she'd been waiting for. "She was just playing around," Nydia, now 17, recalls with the laughter of a triumphant child. "But I was like, 'Don't dare me, Mom, you know I'll do it,'" and Olivia found herself in the unenviable parental position of trying to argue against accepting a scheme she herself had devised. "No, no, no," Nydia remembers telling her mom. "You already said it." She pauses. "I was real stubborn back then," she admits, then pauses for a longer time before laughing again. "I still am." At the restaurant, Nydia asked the band playing there if it was familiar with the only song she knew well enough to attempt in public. "I sang 'Amorcito Corazon,'" she recalls. "When the owner heard me, he hired me right there to sing a weekly gig on Sundays." Nydia sang during the restaurant's most laid-back and contemplative time, Sunday from 11 a.m. to 4 p.m. "I even got paid," she says with a pride familiar to most musicians. In many ways her own journey--bouncing back and forth between her roots in Guadalajara and the great melting pot of Southern California--parallels the early development of the music she loves, albeit in reverse. While Nydia traveled from urban L.A. to the simpler environment of Guadalajara, mariachi began in the rural area centered around the southern part of the state of Jalisco at the end of the 19th century and benefited from the cultural changes wrought by the development of a unified Mexico. Much of this change arose from the Mexican Revolution, a period of turmoil that began with a bloody revolt in 1911. Previously, mariachis had been groups of five to six musicians who provided the soundtrack to fiestas, barroom revelry, and general celebration; they usually consisted of violins, a harp, and a guitarra de golpe--a five-string variant of the guitar. They often added a flute, clarinet, saxophone, cornet, or trombone to carry the melody line, and their repertoire consisted of the sones (usually a lively vocal/instrumental tune that accompanies dancing), corridos (narrative ballads that usually have a factual or historical component), and canciones ranchera (Mexican country music) of the region. Before the revolution, accomplished groups might go to the big city to play, but they always returned home. With the ascension of "revolutionary capitalists," however, rural Mexico became cool as the popular culture enjoyed a surge in cachet. The government was definitely a motivating force in making mariachi a national music. One of the first bands to make the transition from the sticks to the big city--Cuarteto Coculense--had come to Mexico City in 1905 to play for dictator Porfiro Diaz's birthday celebration. Then came the revolution, and Diaz was deposed; the group, by now called Mariachi Coculense, was getting gigs in Guadalajara as well as Mexico City, where the group relocated in 1920. In 1925, Mariachi Coculense nabbed an opening act at the famed Tenampa Bar on Garibaldi Square, which was already the center of the then-coalescing mariachi universe. The band was the first mariachi to perform in legitimate theater, the first to play on a sound film, and the first to record "electronically." At the cutting edge, Mariachi Coculense established the template for all of the bands that would follow it. Although enormously popular, it was hard for a mariachi band to exist, even in Mexico City, where all the greatest groups had official patrons. Mariachi Tapatio--led by Jose Marmolejo, nephew of Cirilio Marmolejo, who led Mariachi Coculense--was backed by the wealthy owner of a bus line. Mariachi Vargas--perhaps the greatest and certainly the most "pop" of the grupos--had a regular, salaried gig with the Mexico City Police Department. In 1933, after visiting the Chicago World's Fair as a member of Mariachi Coculense, Jose Marmolejo formed Mariachi Tapatio, which pioneered the kind of cross-media synergy taught nowadays in marketing classes, as the band appeared in movies, on the radio, on records, and live. It further refined the popular mariachi sound, cementing the trumpet--which gradually replaced the cornet (and other, more tenuous instruments like flute or clarinet)--as the carrier of a tune's melody line. The trumpet would continue virtually unchallenged in this role until the '60s, when modern composers started to use French horns and re-introduce the flute. Dominant throughout the '30s, Mariachi Tapatio was gradually overtaken by Mariachi Vargas. More rhythmically complex, Mariachi Vargas produced music that boasted more variety. Leader Silvestre Vargas had a keen ear for what the people wanted to hear, and his continual--but subtle--updating of his band's style secured its domination during World War II. Mariachi Tapatio settled down into a role as Mexico's musical ambassadors, anchored by a series of residencies at restaurants as well as movies where the band appeared but did not play the soundtrack. Jose died in 1958, and other members took over as leader. Before the group disbanded a decade later, it was often joined by a young singer named Vicente Fernandez. Mariachi Vargas marked the beginning of modern, sophisticated mariachi. The music of Cuarteto Coculense--dating back to 1908--was so badly recorded that it's hard to imagine what it really sounded like. But on songs like "Las Abajanas" and "El Tecolote," the music is rough--close to its aboriginal roots--and more rhythmic, with melody carried by flute and violin. Mariachi Coculense keeps that rhythmic foundation--still lacking the dominant voice of the cornet or trumpet--and harkens back to its folkloric roots with the inclusion of hoots and calls (gritos) from participating musicians. The group's occasional "raking," or strumming in a circular pattern, of the guitarron (bass guitar variant) part--which produces not a linear bass line but a drone sound--provides a distinct link with the earlier music of the Cuarteto. With Mariachi Tapatio, brass appears, as does real precision in arrangements and complexity. There are fewer gritos or whistles (silbidos) from the musicians, and it is easy to imagine this as "city music." This sharpened edge reaches its apex with Mariachi Vargas, which features multi-part harmonies and other modern touches like muted horns. The group is slicker and starts to get into clever tricks like the train motif that runs through "El Tren." It was Mariachi Vargas that accompanied Linda Ronstadt on her cross-cultural triumph, the Canciones de Mi Padre ranchera tour of 1988 and '89. That was the music that Nydia Rojas grew up listening to. Although born in Los Angeles, her mother took her to Guadalajara when she was a year old, and she first heard mariachi music when she was two. "We didn't listen to much music," she recalls of their simple existence there. "There was really no stereo, and little TV." While in Guadalajara, she first saw Nosotros los Pabres, one of the Mexican-made charro movies that paralleled the rise of the western in Hollywood in the '30s and '40s. (The charro, or horseman, is a heroic figure very much like our cowboy, and the highly decorated suit that is so often seen in restaurants--el traje de charro--is his ceremonial uniform.) After Nydia returned to L.A. and quickly learned English, she was in the greatest danger of losing touch with her roots. "I wanted to fit in," she remembers. "You know, be one of the group, so I just kind of forgot about my Mexican roots and culture. I was listening to R&B and hip-hop. Everything was in English, and I even forgot Spanish, which was very embarrassing later on." Dance had taken the place of mariachi in her life, but when she returned to Guadalajara at age 10 for her first communion, she began to reimmerse herself in the culture she had left behind. "I didn't even realize that I could sing," she says. "I was really more of a dancer, but there was this woman who was a vocal teacher, who taught mariachi and all these other kinds of music, and I went to her. She asked me to sing a song, so I sang the only song that I knew--"Amorcito," from Nosotros los Pabres. My mother said, 'Mariachi? Why do you want to sing that?' She thought of it as music for restaurants, but she was just uninformed; she didn't know how to listen to the music." Nydia first performed in public not long thereafter, at a benefit for a home for the elderly. "I've been doing mariachi ever since," she says. Nydia's mom shouldn't feel too embarrassed about being--as her daughter puts it--"uninformed" about mariachi. Few people know much about the music, and what they do know is often wrong. The word "mariachi" itself, which has long been attributed to a derivation of the French word for marriage, actually pre-dates the French occupation of Mexico in the 1860s. As is often the case with folkloric music, however, the exact genesis of the word is still unclear: Many point to the raised wooden platform--called a mariche--that musicians often utilized as a possible root for the word. Regardless of the term's origin, Olivia Rojas' Waterloo at the taco stand was the turning point for her daughter and mariachi. "Eventually my mom understood," Nydia says. "Mariachi is diverse within itself. There are so many combinations of song, of rhythm, and of costume, that there's really no set standard." In the realm of mariachi, Rojas comes off as mature and assured, definitely the LeAnn Rimes of the genre, but she retains an innocence that Rimes has lost (or perhaps never wanted to present). When she talks about "educating" her mother, it's without arrogance or rebellion: It's more about fact, just as when she talks of returning to Southern California at age five. "I was in kindergarten, but I was so far ahead of those kids..." she trails off, aware of how the words must sound. Still, there's no other way to say it, and she continues: "In Mexico, I was in school since I was maybe one and a half." Nydia is prematurely pragmatic, perhaps, but she also retains most of the attributes of teenage femininity. As she speaks about her music, she warms to her subject, talking with an adolescent girl's bubbly, rapid-fire patterns. However, when--moving even faster in her excitement--she utters the word "crap," she halts for a second before giggling nervously, and you can almost see her eyes darting back and forth, making sure Mom didn't hear. After the taco stand incident and her mom's ultimate conversion to her cause, Nydia began studying under Heriberto Molina, who was a longtime member of Mariachi Vargas and a contemporary of the great, defining artists of mariachi: female stars like Lucha Villa and Lola Betran, the great songwriter Jose Alfredo Jiminez, Jorge Negrate, the trumpeter Miguel Martinez, and of course Infante. Classic mariachi training involves learning a staggering number of standards (there is little written music) in every key, with every instrument in the ensemble. As Nydia underwent this rigorous schedule, the commitment of both daughter and mother grew. Not long thereafter, Nydia was discovered by Jose Hernandez, a fifth-generation mariachero who leads the contemporary Mariachi Sol de Mexico and is the founder of the Mariachi Heritage Society. Hernandez eventually cast her as the lead singer with his Mariachi Reyna de Los Angeles, an all-female group, but she retained an identity apart from the group. "I've always considered myself a soloist," she explains. "I like to stand out; I'm always telling jokes and stuff so that people would notice me first. I was a big ham." When not with Mariachi Reyna, she appeared as a solo act. In 1993, she left Mariachi Reyna in favor of a full-time solo career, winning first place three times in a row on Spanish-language TV channel Univision's Sabado Gigante's talent search and becoming the first female artist signed to the newly formed Austin-based Arista/Latin label. Hernandez produced her self-titled debut album Nydia, which was released in 1996. The album managed to deliver enough pop signifiers to guarantee commercial appeal while retaining roots sufficient to lend an authority--a sense of meaning something--that much Latin pop quite frankly lacks. The ranchera-flavored songs on Nydia like "Mexico y Su Musica" and "No Te Quiero Ver" are the best examples of this blend, but Nydia also scored commercially with its poppier confections, all of which placed well on the regional Mexican and Tejano charts: "Hay Unos Ojos," a duet with Ricardo Castillon; "Cuando Estoy Contigo," a laid-back cut that could almost pass for mid-'60s countrypolitan balladeering--muted horns and all; and "No Me Amenaces," which uses accordion and trumpet to good effect. Her monster crossover, however, was "La Numero Uno," her version of Blondie's "The Tide is High." Putting a tropical lilt behind the mariachi trumpets that supported her lush Spanish vocals was an inspired stroke that made the cut sound more authentic than the somewhat wan reggae of the 1980 hit. Nydia says that she regards what she does as something of a "game," but she stops herself, again dissatisfied with how the word sounds out loud. "Not a game," she says, "but a challenge, I guess--let's see if I can learn that instrument, sing this song." Or move from one genre to another. Her latest release, Florecer ("to bloom") is a much more pointed bid for the kind of dance-pop-love-song dominance that Selena enjoyed. For every mariachi-punctuated number like "Te Equivocas" or "Quiero Estar Contigo," there's a corresponding pop number--the soft-jazz burble of "Di cmame Mas" or the anthemic ballad "Paso Las Noches." While her debut featured pictures of her in charro regalia, most of the photos on Florecer show her in street clothes--she only appears in el traje on the album's back cover. Still, perhaps to ease the shock of transition, the album's first single, "Que Te Vava Bien," is perhaps the most mariachi-sounding of the bunch. Nydia's desire to widen her appeal wasn't the only motive behind Florecer's pop slant. As she grew hotter with each hit off of Nydia, she began to attract attention from established Latin artists like Ana and Juan Gabriel. In fact, Carlos C. Junior--Ana Gabriel's longtime collaborator--was even brought on board as Florecer's producer. Ana herself contributed two songs, the disc-starting "Llevame Contigo" and "Amor con Desamor." "When I heard that Ana Gabriel wanted to work with me, I was like, 'cool, all right!'" Nydia recalls. "She has a lot of songs, and she went through her files looking for the ideal song for me. She found two. "I listened to them, and I thought they were great, but I had to go back to Carlos and say that the only problem was that there was no way to do the songs within the confines of mariachi. He said, 'I know. Are you willing to take that risk?' I said that they were Ana Gabriel songs, and I had to record them." The gamble appears likely to pay off. The pop craft behind songs like Juan Gabriel's "Di Amame Mas" is impeccable, and Nydia's hybrid sound adapts itself to Tejano tastes as well, which is something of a happy accident: Even though Texas is her second-biggest market--behind Southern California--she knew nothing of Tejano culture before a recent visit to Texas. "Before I came to Texas, I'd never heard Tejano music in my life," she exclaims. "I didn't know Jay Perez, or Emilio [Navaira], Shelley Lares, or La Tropa F. I don't think most people in California--L.A. especially--do; all that stuff is called norteno." Naturally (although somewhat surprisingly to those of us here in the thick of the culture), Tejano--primarily a regional definition--doesn't mean a whole lot in California. "In Texas," Nydia says, "it seems that Mexicans want to be called Tejano and nothing else. In California, we don't consider ourselves "Californians"--we're Mexican-Americans. "I consider myself fairly open-minded," Nydia adds. "I like to look at other cultures, and my own. I think that every culture has it flaws, just like every culture has its good things." If, at times like this, Nydia comes off as a bit scripted or studied, consider that study has always been something she's been good at. Right now she's apologizing for being tired and a bit worn out after studying all night for the classes in philosophy and Mexican-American history that she takes at Mount San Antonio Junior College in L.A. "I think I may be the only 17-year-old there," she says with a giggle. Although remarkably self-possessed and determined, she seems in no hurry to become an adult. "This is my childhood," she says. "I'm still living my childhood. I take everything seriously, but only up to a point. As far as I'm concerned, this is my hobby, what I love doing. That's anyone's dream, isn't it? To work at what you love doing." She's aware of the power that a pop figure--never mind a star--can wield, but rejects the idea of being an out-and-out role model. "Eventually I want to have a role like that, but right now, what I'm learning, I'm learning for me. For Latinos--especially Mexican-Americans--there's been a lot of hardship and oppression, and we tend to limit ourselves. We've been brought up to believe that we can only rise to a certain level and never go beyond that. What I want to demonstrate is how that's not the case, how you don't have to be afraid to go for it. It's different for us, because we live our lives in two different worlds--our Mexican roots and our lives here in the U.S." As during the Mexican Revolution, mariachi lives and grows at the edge of two overlapping cultures. Then, it was the fusion of rural Mexico and cosmopolitan Mexico City. Now, those two cultures are that of native Mexico and a new life in a land where foreign concepts like dance-pop and Tejano can capture both the imagination and the industries that feed off of it. Mariachi exists not only in its quasi-Disney restaurant identity, but in the cross-pollinated realms of regional Mexican music, Tejano, and international pop, based perhaps upon an essential identity that can survive any mixing. "The whole point behind what I do," Nydia says, "is to remind people that not only mariachi, but also the charro, are things to be proud of." Nydia Rojas will perform at the Austin Rodeo with La Tropa F at the Travis County Expo Center on March 22. If you're interested in the archival recordings of Mariachi Vargas, Mariachi Coculense, or Mariachi Tapatio, check out Arhoolie Records' excellent three-volume series Mexico's Pioneer Mariachis. For more information call Arhoolie at (510) 525-7471. Get the Music Newsletter Keep your thumb on the local music scene each week with music news, trends, artist interviews and concert listings. We'll also send you special ticket offers and music deals.
Rovell's show, "CNBC Sports Biz: Game On," will air Fridays at 7 p.m. Both CNBC and the NBC Sports Network fall under a Comcast umbrella. The soon-to-be former Versus -- the NBC Sports Network name comes Jan. 2 -- will debut Sept. 8 with a block of live programming on weeknights in the 6 p.m. hour. Shows will come under the "NBC SportsTalk" brand used on the Web, covering multiple sports, notably the successful ProFootballTalk. The Monday and Friday shows will focus on football, with ProFootballTalk guru Mike Florio on Mondays, while the other shows will delve into newsworthy topics. In another example of corporate synergy, Russ Thaler, an anchor with a Comcast regional sports network, will serve as host. Other NBC Sports talent will also appear. Rovell's half-hour show will include interviews with leading sports business figures and a rundown of the winners and losers of the week. Rovell is a Twitter standout with some 115,000 followers; his tweets will be integrated into the show. On Mondays during the hockey season, the NBC SportsTalk show will be shortened to a half-hour leading into an NHL pre-game show.
90 Day Business Planning Workshop How did you do against your business plan for 2016? You do have a business plan, don't you? Ask anyone who runs a business and they’ll tell you that its important to have a clear business plan...ask if they have one and 9/10 will have a longer list of excuses than plans! Yes, it is hard to find the time, yet a plan is vital for growth and stability. The GrowthCLUB 90 Day Planning Workshop is a powerful and highly focussed one day workshop that combines the synergy of your local business coaching team with like-minded business owners to create a practical and easy to implement one page action plan for the next 90 days in your business At your GrowthCLUB 90 Day Planning Workshop you will: • Get crystal clear clarity on your goals for the next 90 days in your business • Create a one page action plan to enable you to achieve your goals • Develop energy, vision and focus for the next quarter for your business • Make contacts with local business people - many attendees end up doing business together Your investment in GrowthCLUB includes: • A briefing on how to prepare for the event so that you get the most out of the day • Attendance at the event and assistance from our team to help you create your plan • A set of materials to guide you through the planning process • A wallchart to create your 1 page 90 Day Plan • Business book or audiobook of the quarter • Lunch and refreshements through out the day
Walgreen Co. Reports Fiscal 2013 Fourth Quarter and Full-Year Results Walgreen Co. Reports Fiscal 2013 Fourth Quarter and Full-Year Results - Adjusted fourth quarter earnings per diluted share increase 15.9 percent to 73 cents, compared with adjusted earnings per diluted share of 63 cents in year-ago quarter; GAAP earnings per diluted share increase 75.9 percent to 69 cents compared with 39 cents in last year's fourth quarter - Adjusted fourth quarter earnings increase 26.9 percent to $702 million, compared with adjusted earnings of $553 million in year-ago quarter; GAAP earnings increase 86.4 percent to $657 million compared with $353 million in last year's fourth quarter - Fiscal 2013 sales reach a record $72.2 billion compared with $71.6 billion in prior year, with adjusted earnings per diluted share of $3.12 compared with $2.93 in previous year; GAAP fiscal year earnings per diluted share total $2.56 compared with $2.42 in previous year - Company generates operating cash flow of $4.3 billion and record free cash flow of $3.1 billion, in fiscal year 2013, returning more than $1 billion to shareholders through dividends - Joint synergy program with Alliance Boots delivers combined first-year net synergies of $154 million, exceeding the previously stated range of $125-$150 million Net earnings determined in accordance with generally accepted accounting principles (GAAP) for the fiscal 2013 fourth quarter were $657 million, an 86.4 percent increase from $353 million in the same quarter a year ago. Net earnings per diluted share for the quarter increased 75.9 percent to 69 cents, compared with 39 cents per diluted share in the year-ago quarter. Adjusted fiscal 2013 fourth quarter net earnings were $702 million, a 26.9 percent increase from $553 million in the same quarter a year ago. Adjusted net earnings per diluted share for the quarter increased 15.9 percent to 73 cents, compared with 63 cents per diluted share in the year-ago quarter. This year's adjusted fourth quarter results exclude the negative impact of 5 cents per diluted share in acquisition related amortization, 4 cents per diluted share in Alliance Boots related tax, 1 cent per diluted share in other acquisition related costs and 1 cent per diluted share in costs associated with the company's change in prescription drug wholesalers. Also excluded is the positive impact of 6 cents per diluted share in fair value adjustments and amortization related to the company's warrants to purchase AmerisourceBergen's common stock, and 1 cent per diluted share from the quarter's LIFO income. GAAP and adjusted net earnings in this year's quarter include 3 cents per diluted share in net gains from certain litigation matters. Last year's adjusted fourth quarter results exclude the negative impact of 9 cents per diluted share related to the company's transaction with Alliance Boots GmbH, 10 cents per diluted share from the quarter's LIFO provision and 5 cents per diluted share in acquisition-related amortization costs. "We had a solid quarter across our entire business. We saw improvement in our daily living business resulting from the investments we made and enhanced execution. We also saw continued strength in our pharmacy business as we increased our retail pharmacy market share for the fiscal year to 19.1 percent, and we continued to make great progress on controlling selling, general and administrative costs," said Walgreens President and CEO Greg Wasson. "We closed the year with record sales and record free cash flow, and we were pleased to be able to return more than $1 billion to shareholders during fiscal 2013 as we increased our dividend for the 38th consecutive year." Fiscal Year Results Net earnings for fiscal 2013 ended Aug. 31 determined in accordance with GAAP were $2.5 billion, an increase of 15.2 percent compared with $2.1 billion in fiscal 2012. Net earnings per diluted share for fiscal 2013 increased 5.7 percent to $2.56, compared with $2.42 per diluted share in fiscal 2012. Adjusted net earnings for fiscal 2013 ended Aug. 31 were $3.0 billion, an increase of 16.3 percent compared with adjusted net earnings of $2.6 billion in fiscal 2012. Adjusted net earnings per diluted share for fiscal 2013 increased 6.5 percent to $3.12, compared with $2.93 per diluted share in fiscal 2012. This year's adjusted fiscal-year results exclude the negative impact of 25 cents per diluted share in acquisition related amortization, 16 cents per diluted share from the LIFO provision, 13 cents per diluted share in Alliance Boots related tax, 6 cents per diluted share in other acquisition related costs, 5 cents per diluted share related to a legal settlement with the DEA, 3 cents per diluted share in costs related to Hurricane Sandy and 1 cent per diluted share in costs associated with the company's change in prescription drug wholesalers. Also excluded is the positive impact of 12 cents per diluted share in fair value adjustments and amortization related to the company's warrants to purchase AmerisourceBergen's common stock and 1 cent per diluted share in additional proceeds from the 2011 sale of the company's pharmacy benefit manager business. Walgreens joint synergy program with its strategic partner, Alliance Boots, delivered combined first-year net synergies of $154 million, exceeding the previously stated range of $125-$150 million. Alliance Boots contributed 8 cents per diluted share to Walgreens fourth quarter adjusted results. During fiscal 2013, the company delivered fiscal year operating cash flow of $4.3 billion and record free cash flow of $3.1 billion, while increasing its quarterly dividend rate in July 2013 by 14.5 percent to 31.5 cents per share, consistent with the company's goal of returning cash to shareholders. "Our solid results, especially in the latter part of the quarter, round out a year of steady progress on our long-term growth strategies to create a well experience, transform community pharmacy and establish an efficient global platform with our strategic partner Alliance Boots and with our long-term relationship with AmerisourceBergen," Wasson said. "We are very pleased to have exceeded our joint synergy target with Alliance Boots. We also are pleased with the successful distribution transition of branded drugs to AmerisourceBergen. Extraordinary customer response to our Balance® Rewards loyalty program, now with more than 85 million enrollees, gives us a wealth of new insights to increase customer delight. In addition this year, we expanded our Healthcare Clinic and pharmacy services, and we forged long-term contracts with fair and predictable reimbursement rates with the major commercial pharmacy payers, bringing greater stability and certainty to our pharmacy book of business. We also began participating as part of the preferred pharmacy networks of three of the top national Medicare Part D plans, giving us a leading role in serving the growing number of Medicare-eligible Americans." Fourth quarter sales increased 5.1 percent compared with the prior-year quarter to $17.9 billion, while sales for fiscal 2013 increased 0.8 percent to a record $72.2 billion. Front-end comparable store sales (those open at least a year) increased 1.6 percent in the fourth quarter, customer traffic in comparable stores decreased 1.9 percent and basket size increased 3.6 percent, while total sales in comparable stores increased 4.6 percent. Prescription sales, which accounted for 63.9 percent of sales in the quarter, increased 6.1 percent, while prescription sales in comparable stores increased 6.4 percent. The company filled 203 million prescriptions in the quarter, an increase of 8.2 percent over last year's fourth quarter. Prescriptions filled in comparable stores increased 7.1 percent in the quarter. In fiscal 2013 Walgreens filled a record 821 million prescriptions, representing a retail prescription market share of 19.1 percent, an increase of 0.4 percentage point over the previous year. Gross Profit and SG&A GAAP total gross profit dollars increased $356 million, or 7.4 percent, compared with the year-ago fourth quarter, with gross profit margins increasing 60 basis points versus the year-ago quarter to 28.9 as a percentage of sales. Adjusted gross profit dollars increased $216 million, or 4.3 percent, compared with the year-ago fourth quarter. The growth in GAAP margins was driven by an increase in generic prescription drugs dispensed, while front-end margins slightly declined. Fiscal 2013 fourth quarter LIFO was a benefit of $8 million, compared with a $132 million charge in the year-ago quarter, primarily driven by lower than anticipated prescription drug inventory levels in advance of the transition to AmerisourceBergen. GAAP selling, general and administrative expense dollars increased $37 million, or 0.9 percent, compared with the year-ago quarter, including a 1.0 percentage point benefit of lower SG&A expenses for acquisition-related costs, offset by 0.3 percentage point related to the company's change in prescription drug wholesalers and 0.1 percentage point of acquisition related amortization costs. Adjusted selling, general and administrative expense dollars increased $60 million, or 1.5 percent, compared with the year-ago quarter. Both GAAP and adjusted selling, general and administrative expense dollars include a net benefit of 1.1 percentage points from certain litigation matters. The company opened or acquired 33 new drugstores in the fourth quarter compared with 54 in the year-ago quarter. In fiscal 2013, Walgreens added a net gain of 186 new drugstores including 76 net new drugstores through acquisitions. Interest expense increased to $55 million in this year's fourth quarter compared with $37 million in the year-ago quarter. The increase in interest expense was primarily attributable to the $4.0 billion issuance of notes associated with the Alliance Boots transaction and also includes a $16 million negative impact from a non-cash fair market value adjustment to the company's previously outstanding interest rate swaps on its $1.3 billion notes. These notes were repaid in August and the swaps were settled. Milestones and Looking Ahead Walgreens achieved several key milestones since the beginning of fiscal 2013 in executing its vision to be the first choice in health and daily living, including: - Following the announcement in March that Walgreens and Alliance Boots reached a strategic, long-term relationship with AmerisourceBergen, Walgreens and AmerisourceBergen successfully began implementation in early September of their 10-year agreement for pharmaceutical distribution. AmerisourceBergen also will collaborate with Walgreens and Alliance Boots on global supply chain opportunities, and Walgreens and Alliance Boots together have rights to acquire a minority equity position in AmerisourceBergen. - Alex Gourlay, Chief Executive of the Health & Beauty Division, Alliance Boots, was appointed as Walgreens Executive Vice President, President of Customer Experience and Daily Living, effective Oct. 1. Gourlay's appointment represented another important step forward in advancing the company's strategic partnership with Alliance Boots. - In September, Walgreens announced a partnership with Theranos, Inc. to bring access to Theranos' new lab testing service through Walgreens pharmacies nationwide. Consumers will be able to access less invasive and more affordable clinician-directed lab testing from a blood sample as small as a few drops, or 1/1,000th the size of a typical blood draw. - Last month, Walgreens also announced its acquisition of Kerr Drug's 76 retail drugstores and its specialty pharmacy business, with the transaction expected to close later this year. During fiscal 2013, Walgreens also completed its acquisition of the USA Drug chain. - Walgreens and Express Scripts launched Smart90® Walgreens, a new option for Express Scripts clients interested in 90-day prescription drug programs that drive lower costs and improve health outcomes for people with chronic diseases. Plan sponsors that choose to include Walgreens as part of the Smart90 program for their pharmacy benefit will provide their members who have chronic conditions the choice to receive 90-day supplies of maintenance medications through home delivery from Express Scripts or directly at a Walgreens retail pharmacy for the same copayment. - Walgreens Balance® Rewards loyalty program has grown to more than 85 million enrollees. The company announced that members can participate in additional health-related activities and goal tracking to earn more points through walking, running and weight management goals that can be logged and tracked through Steps with Balance Rewards. - Walgreens provided more than 8.5 million immunizations in fiscal year 2013, compared with 6.7 million the prior year. Walgreens is the largest retail provider of flu immunizations in the country. This flu season, Walgreens is partnering with the United Nations Foundation to help provide up to 3 million life-saving vaccines to children in developing countries through a donation to the Foundation's Shot@Life campaign. - Earlier in the fiscal year, Walgreens opened its 8,000th store nationwide with its flagship store in Hollywood, Calif. The company also continued expansion of its Well Experience stores and now operates more than 500 locations with the new format, in addition to 12 flagship stores. "Looking ahead, we begin the new fiscal year well positioned to build on the momentum we have coming out of a solid fourth quarter. We are advancing our key strategies with a continued focus on disciplined execution, and are addressing the challenges ahead in a difficult consumer environment and changing health care system," Wasson said. "While we are pleased with our progress and momentum, we recognize there is more to do to achieve our vision of being the first choice for health and daily living for everyone in America, and beyond." At Aug. 31, Walgreens operated 8,582 locations in all 50 states, the District of Columbia, Puerto Rico and Guam. The company has 8,116 drugstores nationwide, 186 more than a year ago. Walgreens also operates worksite health and wellness centers, infusion and respiratory services facilities, specialty pharmacies and mail service facilities. Its Take Care Health Systems subsidiary manages more than 700 in-store convenient care clinics and worksite health and wellness centers. Walgreens e-commerce business includes Walgreens.com, drugstore.com, Beauty.com, SkinStore.com and VisionDirect.com. Walgreens will hold a one-hour conference call to discuss the fourth quarter results beginning at 8:30 a.m. Eastern time today, Oct. 1. The conference call will be simulcast through Walgreens investor relations website at: http://investor.walgreens.com. A replay of the conference call will be archived on the website for 12 months after the call. A podcast also will be available on the investor relations website. The replay also will be available from 11:30 a.m. Eastern time, Oct. 1, through Oct. 8 by calling 855-859-2056 within the U.S. and Canada, or 404-537-3406 outside the U.S. and Canada, using replay code 69675446. Cautionary Note Regarding Forward-Looking Statements. Statements in this release that are not historical, including, without limitation, estimates of future financial and operating performance, including the amounts and timing of future accretion and synergies, are forward-looking statements made pursuant to the safe harbor provisions of the Private Securities Litigation Reform Act of 1995. Words such as "expect," "likely," "outlook," "forecast, "would," "could," "should," "can," "will," "project," "intend," "plan," "goal," "target," "continue," "sustain," "synergy," "on track," "believe," "seek," "estimate," "anticipate," "may," "possible," "assume," variations of such words and similar expressions are intended to identify such forward-looking statements. These forward-looking statements are not guarantees of future performance and involve risks, assumptions and uncertainties, including, but not limited to, those relating to our commercial agreement with AmerisourceBergen, the arrangements and transactions contemplated by our framework agreement with AmerisourceBergen and Alliance Boots and their possible effects, the Purchase and Option Agreement and other agreements relating to our strategic partnership with Alliance Boots, the arrangements and transactions contemplated thereby and their possible effects, the parties' ability to realize anticipated synergies and achieve anticipated financial results, the risks associated with transitions in supply arrangements, the risks associated with international business operations, the risks associated with governance and control matters, whether the option to acquire the remainder of the Alliance Boots equity interest will be exercised and the financial ramifications thereof, the risks associated with potential equity investments in AmerisourceBergen including whether the warrants to invest in AmerisourceBergen will be exercised and the financial ramifications thereof, changes in vendor, payer and customer relationships and terms, changes in network participation, levels of business with Express Scripts customers, the implementation, operation and growth of our customer loyalty program, changes in economic and market conditions, competition, risks associated with new business areas and activities, risks associated with acquisitions, joint ventures and strategic investments, the ability to realize anticipated results from capital expenditures and cost reduction initiatives, outcomes of legal and regulatory matters, and changes in legislation or regulations. These and other risks, assumptions and uncertainties are described in Item 1A (Risk Factors) of our most recent Annual Report on Form 10-K and Quarterly Report on Form 10-Q, each of which is incorporated herein by reference, and in other documents that we file or furnish with the Securities and Exchange Commission. Should one or more of these risks or uncertainties materialize, or should underlying assumptions prove incorrect, actual results may vary materially from those indicated or anticipated by such forward-looking statements. Accordingly, you are cautioned not to place undue reliance on these forward-looking statements, which speak only as of the date they are made. Except to the extent required by law, Walgreens does not undertake, and expressly disclaims, any duty or obligation to update publicly any forward-looking statement after the initial distribution of this release, whether as a result of new information, future events, changes in assumptions or otherwise. Please refer to the supplemental information presented below for reconciliations of the non-GAAP financial measures used in this release to the most comparable GAAP financial measure and related disclosures. \|WALGREEN CO. AND SUBSIDIARIES\| \|CONSOLIDATED CONDENSED STATEMENTS OF EARNINGS\| \|(In Millions, Except Per Share Amounts)\| \|Three Months Ended\|\|Twelve Months Ended\| \|August 31,\|\|August 31,\|\|August 31,\|\|August 31,\| \|Cost of sales (1)\|\|12,750\|\|12,238\|\|51,098\|\|51,291\| \|Selling, general and administrative expenses\|\|4,286\|\|4,249\|\|17,543\|\|16,878\| \|Equity earnings in Alliance Boots\|\|124\|\|-\|\|344\|\|-\| \|Gain on sale of business\|\|-\|\|-\|\|20\|\|-\| \|Interest expense, net\|\|55\|\|37\|\|165\|\|88\| \|Earnings Before Income Tax Provision\|\|1,017\|\|549\|\|3,895\|\|3,376\| \|Income tax provision\|\|360\|\|196\|\|1,445\|\|1,249\| \|Net earnings per common share:\| \|Average shares outstanding\|\|945.7\|\|889.8\|\|946.0\|\|874.7\| \|Dilutive effect of stock options\|\|11.6\|\|5.5\|\|9.2\|\|5.4\| \|Average Diluted Shares\|\|957.3\|\|895.3\|\|955.2\|\|880.1\| \|Percent of Sales\|\|Percent of Sales\| \|Cost of sales\|\|71.1\|\|71.7\|\|70.7\|\|71.6\| \|Selling, general and administrative expenses\|\|23.9\|\|24.9\|\|24.3\|\|23.6\| \|Equity earnings in Alliance Boots\|\|0.7\|\|-\|\|0.5\|\|-\| \|Gain on sale of business\|\|-\|\|-\|\|-\|\|-\| \|Interest expense, net\|\|0.3\|\|0.2\|\|0.2\|\|0.1\| Earnings Before Income Tax Provision \|Income tax provision\|\|2.0\|\|1.1\|\|2.0\|\|1.7\| \|(1) Fiscal 2013 fourth quarter LIFO includes a benefit of $8 million versus a provision of $132 million in the previous year.\| \|Fiscal 2013 twelve months ended includes a LIFO provision of $239 million versus $309 million in the previous year.\| \|WALGREEN CO. AND SUBSIDIARIES\| \|CONSOLIDATED CONDENSED BALANCE SHEETS\| \|(UNAUDITED AND SUBJECT TO RECLASSIFICATION)\| \|August 31,\|\|August 31,\| \|Cash and cash equivalents\|\|$\|\|2,106\|\|$\|\|1,297\| \|Accounts receivable, net\|\|2,632\|\|2,167\| \|Other current assets\|\|284\|\|260\| \|Total Current Assets\|\|11,874\|\|10,760\| Property and Equipment, at cost, less accumulated depreciation and amortization \|Equity investment in Alliance Boots\|\|6,261\|\|6,140\| \|Alliance Boots call option\|\|839\|\|866\| \|Other non-current assets\|\|1,959\|\|1,497\| \|Total Non-Current Assets\|\|23,607\|\|22,702\| \|Liabilities and Shareholders' Equity\| \|Trade accounts payable\|\|4,635\|\|4,384\| \|Accrued expenses and other liabilities\|\|3,577\|\|3,019\| \|Total Current Liabilities\|\|8,883\|\|8,722\| \|Deferred income taxes\|\|600\|\|545\| \|Other non-current liabilities\|\|2,067\|\|1,886\| \|Total Non-Current Liabilities\|\|7,144\|\|6,504\| \|Total Liabilities and Shareholders' Equity\|\|$\|\|35,481\|\|$\|\|33,462\| \|WALGREEN CO. AND SUBSIDIARIES\| \|CONSOLIDATED CONDENSED STATEMENTS OF CASH FLOWS\| \|(UNAUDITED AND SUBJECT TO RECLASSIFICATION)\| \|Twelve Months Ended\| \|Cash flows from operating activities:\| Adjustments to reconcile net earnings to net cash provided by operating activities -
Zeppelin Luftschifftechnik lands largest contract in its history Goodyear has ordered the new Zeppelin NT model LZ N07-101 at costs of approximately 14.5 mio. Euro. The first Zeppelin NT will commence its Goodyear operation in January 2014. Besides the airship sale the deal also includes a close co-operation between the partners. Thomas Brandt, CEO of Zeppelin Luftschifftechnik said: „The Goodyear contract is a milestone in our company history. With this three airship sale we double the worldwide Zeppelin NT fleet.“ In close co-operation with Goodyear, Zeppelin Luftschifftechnik will develop further technical modifications for the airships ordered. Amongst others Goodyear and Zeppelin Luftschifftechnik have closed agreements on the joint development of a LED nightsign and a new cockpit display system besides the sale of airships. These improvements will also be available for future Zeppelin NTs. In addition and beyond the delivery of the airships, Zeppelin Luftschifftechnik will supply technical support to Goodyear for the introduction of the Zeppelin NT as well as for the operation, maintenance and repair of the airships. The airships will be delivered to Goodyear over the coming six years. The first airship will commence its Goodyear operation in January 2014. This first real manufacture to order contract is the basis for synergy effects in Zeppelin’s manufacturing and an optimization of the manufacturing cost through bulk procurement of parts and components. Finally Zeppelin Luftschifftechnik was able to receive the backing of the German Federal Government by way of a Hermes guaranty for the sale of the airships. Managed by Zeppelin Luftschifftechnik, the three airships will be assembled by Zeppelin and Goodyear airship teams at Goodyear’s Wingfoot lake airship hangar near Akron, Ohio; there the airships will also perform their first flight. Procurement and production will be managed in Friedrichshafen. Parts and components will be preassembled by Zeppelin Luftschifftechnik before shipment to Akron Ohio. As Goodyear’s fleet of airships has been a fleet of blimps for decades, Goodyear’s decision for the Zeppelin NT is prove for the excellent properties of the Zeppelin NT. In addition, Thomas Brandt sees Goodyear’s’ decision for the Zeppelin NT as honor as well. “Since 1925 Goodyear has continuously been manufacturing and operating fleets of airships became the leader in Blimps in the airship industries. The decision for our airship makes the Zeppelin NT the leading product in its industry.” With the expiry of the type certificate for the Goodyear Blimps „Spirit of America“, „Spirit of Goodyear“ and „Spirit of Innovation“ the Zeppelin NT will then be flying from Goodyear’s US airship bases in Ohio, California and Florida. Goodyear has no intention for commercial passenger flying, but will utilize the Zeppelin NT for its own corporate advertising and VIP passenger flights to support local and national charities.
Meeting:Community Architecture 2009-06-08 Max, Greg, Jack, Harish, Mel - Report on FAD Malaysia - About 80 people showed up. - Talks about FEL, JBoss on Fedora. - Bits of synergy w/ Red Hat Malaysia. - F11 Singapore launch on Wednesday -- 200 people signed up, mostly students. - Fedora Ambassadors helping to make it happen. - Demos, joining the community, etc. - Tomorrow is Fedora 11. Red Hat website? - What's happening @ HFOSS & SELF? - POSSE -- logistics are all in-hand. Brand team and website question. - Education update to mrc, will be done via email. - Managerial stuff - New deliverables page. - If you haven't read the Cookbook, read it this week. - Ian Weller joins us next week. - June is a big travel month.
Weekend roundup 6/17 This weekend is jam-packed. Tonight is yoga walking & wine because I've been I am a major gym slacker, but things start pretty bright and early on Saturday, when my (local) bridesmaids and I take a road trip to Elizabethtown and Hershey on the hunt for a suitable dress for my best gals. We'll lunch in Hershey (I haven't narrowed down where just yet …), and wrap things up in Harrisburg. This, unfortunately, will leave no time to attend this year's Day of Wine & Roses at Hershey Gardens, one of my favorite events there. I remember fondly losing the grape-stomping competition to WHP21's Tom Russell (c'mon he has bigger feet) several years ago. Saturday evening, we're going to check out the summer fun that is Mountain View Food & Spirits at Roundtop. Live music, crab legs — hope the weather holds for us. And Sunday is Dad's day. I've offered to take Pa to lunch and then to Starbucks, but we haven't narrowed down that location – open to suggestions, west shore preferred. By night, the fiance and I tackle a second engagement photo session with Klose Photography at Hersheypark – cool, right? If you're schedule is bit more laid-back this weekend, read on for ways to fill up your days and nights: - Tonight, check out the Sex and the City Party at Level 2 with Changes Salon & Day Spa. - Enjoy a wine tasting at Zia's at Red Door from 5:30-7:30 p.m. - Tomorrow, Harrisburg's "All Star" band, The Refugees, take on the night at ABC. - Ceoltas hosts Jonnie Chimpo. - Ye Old Ale House celebrates 25 years with Jager & VegasFuel promotion. - I can still remember my sister performing in our middle school's version of "1776." A grown-up version starts its run at Fishing Creek Playhouse on Friday. - Of course, Saturday is Troegs' Harrisburg Brewers Fest. - Find the Kenton Shelley Band at Flinchy's on Friday and at the Grotto Pub on Saturday. - You know it's summer when … By Saturday, Acoustic Synergy hits the stage at the Caddyshack. - Cafe Zooka in Hershey has a new menu. - The Cornlickers liven the stage at the Midtown Tavern Saturday night. - Arooga's is hosting the Ultimate Fighter Finale on Saturday night with no cover at any location. - The Greatest Funeral Ever, with guests Ten Tigers, rock the HMAC house. - Sunday is Father's Day. Get him a steak and beer at Brew 22. - Don't miss furniture, firearms, jewelry and tools at Cordier Antiques Estate Auction this Sunday.
Today in Startup Talk, we are bringing story of a woman who started her career with teaching school students and is now running a successful recruitment firm in Ahmedabad. “Woman is no less than a man”; she wishes to change perception about woman in India. Have a look at our conversation with Dimple Khubchandani. Who is Dimple Khubchandani? Introduce yourself. Dimple Khubchandani is an aspiring entrepreneur. Currently I am in a helping profession. I run a recruitment firm and consult startups. I help you find the right people for your business and help you refine, refocus and redirect with hiring and goal strategies for your business. Tell us something about your company, Synoverge. Started in year 2011, we are an end to end IT and non IT recruitment solution, human resource staffing and consultancy firm; which provides innovative out of the box turnkey solutions to customers for addressing their complex hiring challenges. Synoverge Consultants provides customized recruitment solutions based on needs of our client, our bouquet of offerings cover permanent staffing, RPO, executive search, technical assessments, background verifications, corporate trainings and much more. Our goal is to be recognized by our clients as a business partner that gives each and every assignment the requisite attention and focus in helping them in their pursuit for performance. Synoverge name is quite unique. How did you come up with the name? Synoverge Consultants – Synoverge is a combination of two words, Synergy and Verge. Which means- in combination of action at the edge. I thought of this name when I was consulting most of the media and PR clients and loved working with one of my client whose name was “Synergy”. Since we are into consulting, we just matched 2 different words and made one name out of it. It matches our profession as well Synergize with right people. When and how did you start your business? I have had worked in various professions. I started my career with Aegis BPO while I was in college doing my BCA; which is a complete disconnect to my profession which I am in right now. Then I worked as a teacher in my college vacations and taught students up to 10th standard. After which I Had worked as a Charity Ambassador for C.R.Y – Child rights and you an NGO and Collected donations across Gujarat. Later after my graduation I had joined GTPL with reference of my parents as an HR where I learned all the Human resources concepts, mainly hiring. My last job was as a recruitment consultant in a consulting firm, where I was taught nothing and I had to learn it at my own. I was one of the highest performers there and was always in top 2. That’s when I thought I am getting pennies and I should be doing something on my own. I belong from a business class family and always wanted to start a business of something which I was trying to figure out. After having my career stagnant in recruitment for about 3 years that’s when Synoverge came in picture. How much time and money did it cost to initiate this venture? It required almost 6 months to a year to run it smoothly. I had only 2 clients when I started. Investment was about 2 lakh rupees which I had saved from my past work. My business is completely self funded. How Synoverge is different from other HR consultants? Well, other consultants would only do a tele-calling job just to close the position. We don’t consider ourselves as telecallers. We are all recruitment consultants. We actually interview people. Other consultants will not give any replacement even after signing a contract. We do give replacements and suggestions to our clients on growth, hiring strategies. We consult them 360 degrees, I’d say! It’s not just about recruiting. We love working with them as business HR partners rather than normal recruiters. Job gives you limited knowledge and dreams. In business, you get a full sky and wings to fly at your own will and potential. Why did you choose business over job? Because, I am not a 9-5 person. Having own business gives you independence to work at your own will, to work with your own choice and I am someone that does not like to be controlled by others. I like making money that too is a motivation. Job gives you limited knowledge and dreams. In business, you get a full sky and wings to fly at your own will and potential. There are some perks of entrepreneurship that simply can’t be quantified. Like taking off for the day just to unpack and organize your closet or may be take a small vacation too if need be. What are the biggest challenges of starting up a business? Starting a Business Isn’t for weak people, irresponsible people, undisciplined people, unprofessional people , forgetful people, lazy people, irrational people, impatient people or people who blame everything on Narendra Modi. I would just say one line, Starting a business is easy, keeping it open is a task; needs lot patience, investment of time, money and just everything! Starting a business is easy, keeping it open is a task; needs lot patience, investment of time, money and just everything! What are the pros and cons of being a woman entrepreneur? I don’t call myself an entrepreneur yet, I only run one business. I am no feminist. I count all men and women as equal. Both perform better in all aspects of life. But there is a perception about women: When a woman says she is starting a business people envision her making jewellery or food in her kitchen. We have to work on changing the perception people have about women in business and it first starts with us taking ourselves, our craft and each other serious and equal. I see people hating on each other even before they be friends. I see people comparing their 3rd, 5th attempts with peoples 100th attempt. You gotta support others in order to grow; it all starts with you! What advice would you like to give to aspiring entrepreneurs? To be successful, you don’t need an MBA, a certificate, a fancy suit, a briefcase or an above-average tolerance for risk. Or a fancy lavish infrastructure. You just need an idea, a touch of confidence to get started. You can’t have a new life doing the same things or travelling in the same circles. Get some people in your circle who are better than you, smarter than you and richer than you, who don’t speak your language , who aren’t of similar age group, who act their wage. Then climb up. Stick on one thing. Pick a niche. Work on it then pick up something else if need be! What’s your opinion on BuddyBits? BuddyBits is doing well. It’s gonna rock bigtime. Thank you Dimple. Your story is really inspiring. We wish you all the best for all your future endeavours.
The Clippers are about a month and a half away from the NBA playoffs, and after a year of lamenting their loss to the Spurs, the narrative remains the same. One of the prime reasons the Clippers couldn’t manage to pull out just one victory in the second round was because they struggled to score in the slowed down environment that the post-season seemingly induces on teams. This time around, the concern remains the same. “Can the Clippers hope to make a deep playoff run without a myriad of transition baskets? What can they do to consistently score in a half court setting? What is scoring? Who is ‘clipper’?” Before taking a shot at these questions, there’s one thing I’d like to make clear. I’m not a supporter of the premise that transition offense completely stops once the playoffs begin. There are obvious factors that come into play, such as heightened effort on the defensive end — which is often enough to stop a fast break play — and a more concerted effort to avoid turnovers. That doesn’t change the simple fact that if one team is faster than the other, it’s likely that they’ll take a noticeable edge in scoring fast break baskets. Nevertheless, the adage does hold some truth to it, so it’s important that the Clippers are prepared to execute an effective half court offense come May. According to NBA.com, the Clippers lead the league in the percentage of points they get off of turnovers at 19.8 percent and they’re sixth in fast break points at 15.7%. According to Synergy Sports, the Clippers are 11th in transition attempts. Needless to say, pushing the ball is a dominating trait of Lob City. Fortunately, the statistics bode well for notorious non-transition categories as well. In spot-up opportunities, which constitute 19.4% of their attempts, the Clippers’ 1.03 points per possession (ppp) ranks them fifth in the league. In isolation, the Clippers rank eighth in the league (0.85 ppp). They have Chris Paul to thank for a great deal of that, considering he’s ranked 15th in the league in isolation at 0.96 points per possession. LA is fifth in the league in points produced by the pick-and-roll ball-handler and eighth in points produced by the pick and roll roll-man. In that same light, Paul is 16th among all players in the league as a pick and roll ball-handler. Taking a look at these numbers may provide some insight, but not nearly enough. That’s why I decided to keep track of every half court set that the Clippers ran against the Indiana Pacers with both Griffin and Paul on the floor, since that’s the duo that will be anchoring the teams playoff hopes. The bench, meanwhile, will have its minutes severely reduced and something gives me a feeling that the Bledsoe-led crew won’t have too much of a hard time getting out on the break. Why Indiana? Well, they are the league’s best ranked defense. If there’s anything close to defensive playoff intensity in the regular season, it’s playing against the Pacers at the Bankers Life Fieldhouse. Here’s what I saw: LA’s first quarter execution was more than appreciable. In 19 halfcourt possessions, they managed to put the ball in the basket a total of nine times. This was despite the fact that the Clippers missed seven of their eight three-point attempts, six of which were relatively uncontested. As more and more teams make the decision to hedge on the pick and roll, movement preceding the pick and roll in order to get the defense off its feet has become the norm. Or at least it should, in my eyes. With the Clippers nearly always sporting a lineup featuring two ball handlers, Del Negro has done a good job of implementing this. Here, Billups takes the ball up as Odom and Griffin set up a double screen in a modified horns set, with Paul lingering above the corner three area. This sets up a side pick and roll between CP3 and Blake, with Mahinmi too far out of position to hedge. Paul’s penetration leads to a wide open three for Butler. He misses the shot, but Butler generally shoots 56.4 percent from the right corner (per NBA.com), so that’s a shot that should generally produce a ppp of 1.69. Moving on, when Griffin posts up with his back to the basket, his ppp ranks in the lower 350th players in the league. What that doesn’t account for though, is the fact that post up opportunities generally put him in great position for offensive rebounds, as displayed here: We all know how savvy Jamal Crawford can be on the offensive end. Here, he curls off a screen set by Ronny Turiaf and gets an extra step on Paul George. For Crawford, that extra step is often enough to wreak havoc. In total, the Clippers went 9-for-18 in their first quarter half court sets, despite going just 1-for-8 from beyond the arc. Of those 3-point attempts, just one was contested, signifying more of a rough shooting night than a lapse in execution. Perhaps even more impressive is the fact that they turned it over just twice. Unfortunately, things took a turn for the ugly in the following twelve minutes. In the second quarter, the Clippers — remember, with Paul and Griffin on the floor — went 3-for-8 from the field and missed all three of their 3-point attempts. Here’s a play that the Clippers ran a few times against the Pacers. Chris Paul posts up, and Blake Griffin sets a screen for him. Due to the proximity to the basket, and Griffin’s affinity to be… well, absolutely destructive in that area, the Pacers are forced to switch. This creates a mismatch in the post with George Hill stuck on Griffin and another mismatch on the perimeter with the slower Mahinmi on an island against Paul. Hesitation, pull-up, splash. It’s like clockwork. The third quarter provided a plethora of good and bad sets combined. All in all, the Clippers went 9-for-15 from the field, 2-for-4 from behind the arc and added four free throws. We’ll start with the bad stuff first: Initially, Griffin’s lane to the rim gets cut off thanks to a good rotation from David West. This does, however, put him in good position for a post-up. That’s good, right? … Right? As you can see here, the Clippers’ spacing is terrible. There is very little movement going on, aside from Lamar Odom creeping around the painted area, which really does nothing except make it easier for West to help off of him. Griffin manages to get it to Billups, who misses a contested three. Luckily, Butler crashes the boards and gives the Clippers a second chance. Ah… once again, the importance of movement before the actual movement. Billups gets the ball to Griffin in the post, who then hands it off to Chris Paul. This puts them in perfect position to run a pick and roll, as Mahinmi is already out of position to hedge. As Griffin rolls to the rim, he sets a pseudo-screen for Billups right before he makes his move to the 3-point line. This little adjustment may have only provided an extra half-second for Billups to get his shot up, but that’s often the difference between a make or a miss in the NBA. Anyways, back to the bad stuff: The problem here is that after setting a pick for Billups, Odom doesn’t make a pronounced decision. He hangs around at the free throw area, where Billups doesn’t have a passing lane to get him the ball. Say he pops a little further, that’s a wide open shot. Better yet, if he rolls, it probably ends in a layup or put-back for Blake. Speaking of Blake Griffin… there was also this: “BOOOOOM! OH MY GOODNESS!” That was fun. To begin, Turiaf and Billups run a pick and roll 30 feet away from the basket. For starters, I can’t understand why Stephenson didn’t go under, but he didn’t, for whatever reason. Anyway, Turiaf dives to the rim — this is important, since it forces Mahinmi to pay attention to him — and Billups hands the ball to Griffin. Paul and Griffin get into another pick and roll set on the other side of the rim, West is again out of position to hedge and you know the rest. Oh hey, look… another screen from 30 feet out! Why? Why not just set a screen that’s say… 24 feet from the basket? Anyway, Chris Paul gets blocked and Turiaf is so far behind that he’s not even close to being in position to contest for an offensive rebound. By the way, here’s a breakdown of a crunchtime “play,” if you can call it that. Well for starters, there’s little action before Paul and Blake run a pick and roll… and surprise, surprise! It doesn’t work out too well. Anyway, Stephenson makes a great defensive play by almost stealing the ball from Odom once he turns away, but with just three seconds left on the clock, it was a lost possession for the Clippers regardless. The first CP3/Blake pick and roll doesn’t amount to much, so they run it again. With Hill trailing him, Paul has ample time to get off a step-back fadeaway jumper against Hansbrough. Side note: It’s good to have Chris Paul on your side at the end of games. In total, the Clippers went 24-for-44 from the field, and 3-for-16 from beyond the arc in halfcourt sets including both Chris Paul and Blake Griffin. Of course, this should be taken with a bit of a grain of salt, since Hibbert was out. However, Indiana still sports one of the most disruptive defensive systems in the league. The Clippers did alright for themselves, especially considering the amount of open threes they missed. Here’s the thing with the Clippers offense. Sometimes, it’s great. It looks like a lot of what we saw above. Other times, everyone decides they want to stop moving. That’s something that happened against the Thunder. The key to LA mastering its halfcourt offense isn’t implementing new sets. Rather, it’s consistently executing the things they already know how to do. There are two things working in the Clippers favor here. First of all, an offense that rests its foundation on CP3/Griffin pick and rolls has the proper tools for success. Second of all, the secondary ballhandler that the Clippers seemingly always have on the floor maximizes the pick and roll’s probability for success. With the majority of defenses being locked and loaded to offset even the most potent of pick and roll combinations, the secondary ball-handler has taken on an even more important role. Luckily, Vinny Del Negro seems to understand this — on some nights, at least.
TAMPA — A British company is moving its local headquarters and 100 employees into downtown Tampa from west Hillsborough County. Synergy Health of the United Kingdom bought Tampa-based SRI/Surgical Express last summer for $25 million, and in April Synergy Health announced it would relocate its Americas division to the Tampa Bay area from San Diego. The latest move came Wednesday when Synergy Health announced it would move that local headquarters operation from its current location on Race Track Road into the SunTrust Financial Centre in downtown Tampa. One hundred existing Synergy Health employees will move with the company, and it will create another 40 new jobs in Hillsborough County within 12 months, a news release from the Tampa Hillsborough Economic Development Corp. said. Synergy Health provides sterilization services and surgical supplies to healthcare providers.
Douglas Halladay, B.A., T. Cert., M.A. - President & Founder Mr. Halladay has +25 years experience as a Senior Leader in new and established public and private schools, including schools that are co-ed, all-girls, boarding, equestrian (only one in Canada), International/multi-cultural community, ESL, the largest learning disability school in Western Canada, and a founding Head. He has held positions as Superintendent, Head of School, Deputy Head, Director of Senior School, Senior Curriculum and Resources Coordinator for the Ministry of Education, K to 12 teacher, and project leader. He has accreditation experience with NAIS, CAIS, ISA, WASC, IBO, and BC. Mr. Halladay has taught over 40 different courses at the K-12 level. In addition, he has been a Department Head, Chaired numerous Accreditation Committees, Staff Committees, and Professional Development Committees, as well as a background in Training in Clinical Supervision for new teachers. Mr. Halladay's credentials include a B.A. from SFU; a Teaching Certificate from UBC, and a M.A. in Educational Administration from SDSU; along with a Fund Raising Certificate from the Institute of Charitable Giving and a Peer Counselor Certificate from SDSU. Mr. Halladay has a comprehensive knowledge of K to 12 educational trends with his experience developing 20% of the current BC curriculum and policies. We provide customized solutions, including: - Independent-Private School Formation - Mergers and Acquisitions of Schools - Government Education Regulatory Relations - School Management Services - Strategic Planning - Board Governance - Head of School Evaluation & Support - Executive & Faculty Searches - Institutional Assessments & Audits - Publication Development & Admissions - International Marketing & Recruiting - Policy, Handbook, & Bylaw Development - Fundraising & Development Bill Wan, B.Com., C.A. - Senior Associate - Finance, Real Estate, and Formation Specialist Mr. Wan is a Chartered Accountant by profession, who graduated from the University of British Columbia with a Bachelor of Commerce degree, majoring in accounting and management information systems. Mr. Wan joined the public sector, specializing in commodity taxes for more than 10 years. In 1995, Mr. Wan assisted a group of parents in the formation of an independent school on the West side of Vancouver. Since then, he has developed a keen interest in school administration and has been actively involved in the formation and management of more than 8 university preparatory, independent schools in Canada and USA. Mr. Wan has donated his time and services to a number of professional and charitable associations, including the University of British Columbia Alumni Association as the Director of the Board. Mr. Wan was a member of the Board of TEC The Education Company, and Chair of its Audit and Finance Committees. He formed and developed a consulting practice and investment portfolio with extensive interests in real estate development and education (including co-founding West Point Grey Academy in Vancouver). In addition, Mr. Wan co-founded TEC, a dynamic, profitable company in the post-secondary education industry. TEC owns 3 accredited colleges in the health care (nursing), animation, film and recording industries with campuses in Vancouver, Kelowna, and Halifax, and Fredericton. - Business Plan development - Land acquisition - Financing and land development - School formation - K to 12 and post secondary (US, Canada, and International) - Advise school mergers and expansions - Feasibility studies - Head of School searches Mr. Clint Wilkins, B.A., M.Ed. ‑ Special Adviser - US-Based Program, CAIS, WASC School Formation Specialist Clint was founding Head of Sage Hill School, Orange County's (CA) first non-denominational independent high school, which today serves 450 diverse and motivated students. Clint worked closely with the board of trustees to raise $30 million in to fund the construction of a state-of-the-art campus and the school’s first five-year operating budget. Clint's early career is highlighted by his service at Sidwell Friends School in Washington, DC, where he was the Principal of the Upper School for many years and Assistant Head. In addition, he was a Principal of the Upper School at Friends School in Baltimore. Clint was also the CEO of Moorestown Friends School in New Jersey, as well as the CEO of the College Preparatory School in Oakland. He has been a Visiting Scholar at Stanford University School of Education, specializing in charter schools and most recently an Associate with the Skoll Centre for Social Entrepreneurship at the Said Business School, University of Oxford. He is experienced in starting and leading US-based schools and accreditation with WASC, NEASC, and CAIS, MSACS. - US-based school formation - Board/CEO synergy - Governance as leadership - Securing transformational gifts - Service as a way of learning and citizenship - Recruiting a staff of uncommon excellence - Innovative curriculum design - Effective faculty and staff evaluation Mr. Jim Hopson, B.A., Graduate Work - Senior Associate - US-Based & Christian School Formation Specialist Jim is the founding Head of Santa Ynez Christian School in California. It is a PreK-8 independent, co-ed, preparatory school of 175 students. Jim has +40 years of Christian Educational experience, with 34 years as a Principal of Junior and Middle Christian Schools, and Superintendent of three of the largest Grade PreK-12 Christian Schools on the US west coast. In addition, Jim has served on the Association of Christian School International board, a District Reprehensive for ACSI and the NGOS Board of Directors, and a Seminar Leader for ACSI conventions. He has a thorough understanding of all aspects of Christian Education from the Board level down to the plant management. He has served on 5 accreditation teams for ACSI and a 4-year term on the ACSI National Board. He has taught a masters level course on Christian Philosophy for Biola University. Jim has provided oversight to budgets ranging from start-up to +$45 million projects. He has completed the DMA training course for Development Directors and worked with over 25 different schools in the Strategic Planning Process. Ms. Carole Al-Kahouaji, B.A., M.A. - Senior Associate - International Baccalaureate International School Formation Specialist Carol is an effective project and program manager, director, and mentor, with extensive experience in starting and leading international schools. She was the founding Director of two K-12 International IB schools in Syria and a Head of an International school in the US. She is an experienced IB trainer, as well as working on authorizing accreditation teams for IBO, MSACS, CIS, NEASC, and WASC. - International School Formation in the Middle East - Admissions, Marketing, and Publication Analysis - International Curriculum Implementation and Assessment (International Baccalaureate, International Curriculum Project) - Curriculum Standards and Alignment - Language Program Development (Bilingual, Dual-language, Foreign Language, ESL) - International Faculty and Staff Recruitment, Evaluation, and Compensation review - Institutional Assessment and Accreditation (IBO Authorization, Middle States and CIS Accreditation) Mr. Carl Savage, B.A., M.A. – Senior Associate - BC-Based Program, International School Formation Specialist Carl has 42 years experience as a teacher and public and private school administrator. He has worked in Ireland, England, Canada, China, and Egypt. He was the key Administrator and BC-Agent for Dalian Maple Leaf International School in Dalian, China, and the International School of Cairo. He has a wealth of experience as a public BC-certified school Principal at the elementary, junior, and secondary levels. He is experienced with starting BC-based international schools in China and the Middle East and accreditation requirements, and recruiting teachers for offshore schools. - International School Formation - BC-Based school development - Strategic Planning Mr. Jerry Zank, B.A., M.A. – Special Adviser - US-Based School Formation Specialist Jerry is the founding Head of Fisher Island Day School (FIDS) in Miami, Florida. Fisher Island is a PreK - 5 Day School that serves a gated community on Fisher Island in Miami. Jerry has also been the Headmaster of a number of US-based independent college PreK-12 prep schools in Florida and Arizona with +125 staff and an annual operating budget of +$9 million. He is experienced with starting and leading US-based schools and accreditation with WASC, NEASC, and CAIS, MSACS. - US-based school formation in Southeast US sector - Board governance Mr. Royce Shook, B.A., M.A. - Special Adviser - Curriculum Development, Educational Technology Specialist Royce has +33 years experience as a teacher-leader in the pubic school system. He has been a Senior Curriculum and Resources Coordinator with the B.C. Ministry of Education, a K-12 teacher and project leader. Royce is currently the Area Chair and Senior Faculty for the College of Education, Curriculum, and Instruction program with the Vancouver Campus of the University of Phoenix. He has taught in the Masters of Education program, the MBA program and the undergraduate program at the Vancouver Campus. Royce has also created a number of non-profit societies to work with disadvantaged youth and facilitate school-to-work transitions. Royce is currently on the Board of Directors of SHARE, a non-profit society in Coquitlam. Royce has taught +30 different courses at the K-12 level. In addition, he has been a Department Head, a Career Facilitator, chaired numerous Staff Committees, Advisory committees and Professional Development Committees. He has also worked in the private sector, as a Director of Training, and has considerable experience helping small business owners set up and market their businesses, having written 3 books on these topics. Mr Shook has given numerous workshops on school leadership and integration of technology. Royce understands and has considerable knowledge of K-12 educational trends, not only in educational technology but also in curriculum development, specifically in technology and vocational educational training (TVET). Royce developed the Business and computer curriculum being taught in all K-12 BC schools and has worked to develop many of the other current BC curricula being taught in BC K-12 schools. - Curriculum development - School leadership seminars - Organizational management - Educational Technology - Mentoring and training staff - School community partnerships - Development of post secondary programs Chris Wright – Cert. Ed, B. Ed – Senior Associate – International School Development Chris is an experienced educator who has worked in a range of schools with students from the ages of 3 –18 in the UK and Middle East (UAE, Saudi Arabia, Qatar, Libya, Kuwait). A school Principal for 16 years in the UK and UAE, he has led inner-city, multicultural and international schools with a very successful track record of school improvement and high academic achievement. In recent years Chris has held a senior position with two established, international education companiesin the MENA and GCC region to oversee the development and the implementation of operational and instructional procedures and policies for their new start-up schools. With involvement in 22 new school projects Chris is able to provide the complete ‘one-stop shop’ approach to the set-up of a new school be IB, British, Canadian, or local. This includes leading on the educational aspects of the school design and fit out, staff recruitment, induction and curriculum development. Having worked as a school inspector with the UK Government inspection agency OFSTED he is able to advise international schools wishing to offer a ‘British Style’ education based on the English National Curriculum. - Business Plan development - Feasibility studies - Architect briefs - School formation - K to 12 (International) - Advise school mergers and expansions - Head of School and teacher recruitment - Quality Assurance Alfred Rodrigues (President of Rodrigues and Associates) – Tribal Specialist Al is primarily a strategic planning consultant and has worked with various organizations throughout the Pacific Basin in identifying, developing and implementing long-term solutions to strategic issues. His clients include a range of businesses, non-profits and governments throughout the U.S. Mainland, Asia and the Pacific Basin. Specifically, he was worked with native and local indigenous groups including the Tulalip Tribes and Port Gamble S’klallam Tribe in Washington State; the Yapese, Chuckese, Pohnpeian, Kosraean and Palauan groups in Pacific Micronesia region; Chamorro’s of Guam; native Hawaiian groups on the various islands of Hawaii; and various provincial tribes and communities throughout the Philippines. He has served as a consultant to the Tulalip Tribes of Washington since 1993. His work with them has steadily increased since then such that as of 2004, he spends approximately 6 months of the year living on the Reservation and serving as the primary consultant to the Tulalip Tribal Government. His work with them is aimed at improving the effectiveness and efficiency of a wide range of Tribal Government services. This includes planning, developing and evaluating programs in the areas of education, health, social services, drug abuse, natural and cultural resources, public utilities and housing. Dr. Mark Hopkins, B.S., M.ED., PH.D. – US International University Development Specialist Mark has 21 years experience as the President of a number of prestigious regional US-based University and Community Colleges in South Carolina, Illinois, and Iowa. Dr. Hopkins’ has been the Executive Director of a US-based consulting firm supporting the development of Universities in the US and Internationally. Mark’s areas expertise include: administration, admissions, and fund raising. His major experience has been in starting colleges to full operation. He has now completed five, including several in India, Sri Lanka, and Korea. - US Offshore Universiy Formation - Post Secondary Accreditation - Student Recruiting Sidney Rose – Senior Associate - International Schools Formation Specialist Sidney is a senior administrator and consultant who has worked in International Education for more than 30 years. He has experience with international schools in the UK, Hong Kong, Singapore, Dubai, Qatar, India and Sweden, with a proven track record as the founding Director/Principal of three highly prestigious international Schools in Sweden, Qatar, and India, beginning each school from initial start-up through to staff recruitment, curriculum design and development, marketing, opening and running the multi-million dollar projects. - School Formation - School Accreditation - Non-Profit Development
Patent application title: R. rhodochrous and Linoleic Acid As Bioremediation Agents of Polycyclic Aromatic Hydrocarbons (PAH) in Diesel-Contaminated Soil Morgan Walker Sinko (San Antonio, TX, US) IPC8 Class: AA62D302FI Class name: Chemistry: molecular biology and microbiology process of utilizing an enzyme or micro-organism to destroy hazardous or toxic waste, liberate, separate, or purify a preexisting compound or composition therefore; cleaning objects or textiles destruction of hazardous or toxic waste Publication date: 2012-04-26 Patent application number: 20120100598 Different bioremediation agents' effectiveness against concentrations of diesel fuel in soil were tested. The purpose of this experiment is to find a quick, clean, and cost-effective alternative to current remediation techniques using new bioremediation techniques. Analysis indicated that the use of a mixture of Linoleic acid and R. rhodochrous generated the greatest, quickest, and longest lasting degradation rate. The mixture provided a 51.23% drop in PAH and data suggests that it will to remediate after the end of the 4th week. In second place came the Linoleic acid with an immediate drop of 36.61% before leveling out in the 2nd week. The bacteria (R. rhodochrous) started slow but moved into a greater rate every week bringing it to an overall 46.65% change. The hypothesis that the mixture of the R. rhodochrous and Linoleic acid would yield the greatest PAH degradation was supported by the data. 1. A method of degrading a contaminate in soil or water, the method comprising the steps of: maintaining a bioremediation mixture comprising a contaminated soil, at least one natural microorganism source, and at least one oxidizable lipid source for a period of time sufficient to convert at least a portion of the diesel-contaminated soil into reduced derivative compounds to give a bioremediation product; and maintaining the bioremediation mixture under conditions for a period of time sufficient to produce a remediated soil product in which at least some of the reduced derivatives compounds have been converted into water and 2. The method of claim 1, wherein the natural microorganism source is R. rhodochrous bacteria. 3. The method of claim 2, wherein the lipid source is Linoleic acid. 4. The process of claim 3, wherein the remediated soil is a PAH contaminated soil. 5. The process of claim 3, wherein the remediated water is a PAH contaminated salt water. 6. The process of claim 3, wherein the remediated soil is diesel-contaminated soil. 7. The process of claim 3, wherein the remediated water is diesel-contaminated salt water. 8. The process of claim 1, wherein the weight of contaminants in the remediated soil is at least 50% less than the weight of the contaminants found in the contaminated soil. 9. The process of claim 1, wherein the bioremediation mixture includes from about 5% to about 50% by weight of the natural microorganism source. 10. The process of claim 1, wherein the bioremediation mixture includes from about 5% to about 50% by weight of the lipid source. 11. The process of claim 1, wherein the bioremediation occurs in a container. 12. The process of claim 1, wherein the percent of oleic acid in the contaminated soil increases over a period of time sufficient to produce a remediated soil product 13. A material for bioremediation against PAHs in soil or water comprising of a mixture of: at least one natural microorganism source; and at least one oxidizable lipid source. 14. The material of claim 11, wherein the natural microorganism source is R. rhodochrous bacteria. 15. The material of claim 11, wherein the lipid source is Linoleic acid. 16. The material of claim 11, wherein the bioremediation mixture includes from about 5% to about 50% by weight of the natural microorganism source. 17. The material of claim 11, wherein the bioremediation mixture includes from about 5% to about 50% by weight of the lipid source. 18. The material of claim 1, producing water as well as methyl esters as the result of a converting PAHs located in contaminated soil. 19. A material for bioremediation of soil or water, consisting of a mixture of at least one natural microorganism source wherein the natural microorganism source is R. rhodochrous bacteria; and at least one oxidizable lipid source wherein the lipid source is Linoleic acid. 20. The material for bioremediation of soil or water of claim 1, wherein the ratio of the Linoleic acid to the R. rhodochrous bacteria is three parts Linoleic acid to one part R. rhodochrous bacteria. CROSS REFERENCE TO RELATED APPLICATIONS This application claims priority from U.S. Patent Application Ser. No. 61/406,187, entitled "R. rhodochrous and Linoleic Acid As Bioremediation Agents of Polycyclic Aromatic Hydrocarbons (PAH) in Diesel-Contaminated Soil", filed on 25 Oct. 2010. The benefit under 35 USC §119(e) of the United States provisional application is hereby claimed, and the aforementioned application is hereby incorporated herein by reference. FEDERALLY SPONSORED RESEARCH Not Applicable SEQUENCE LISTING OR PROGRAM Not Applicable TECHNICAL FIELD OF THE INVENTION The present invention relates generally to the degradation of contaminates. More specifically, the present invention relates to the bioremediation of contaminates of Polycyclic Aromatic Hydrocarbons (PAH) in Diesel-Contaminated Soil. BACKGROUND OF THE INVENTION One of the most dangerous contaminates in our world is right under our feet. Polycyclic Aromatic Hydrocarbons, otherwise known as PAH, are a collection of hundreds of organic chemicals that are extremely carcinogenic and mutagenic. PAH are the second most dangerous contaminates in the world and the third leading cause of cancer in the United States. Until recently, attempts at remediation of PAH from natural and unnatural sources have been costly, complicated and have had mixed results. The rising number of PAH sources makes PAH increasingly difficult to remove from urban and more rural environments. Polycyclic Aromatic Hydrocarbons (PAH), a byproduct of incomplete combustion, is a serious global environmental problem. The carcinogenic/mutagenic effects of PAH were first discovered after WWII when gas plumes from manufacturing plants in England resulted in the near destruction of their fishing industry. Several years and millions of dollars were spent on chemical remediation but few advances in these techniques have occurred in the last 60 years. PAH come from many sources both natural (biogenic) and unnatural or manmade (anthrogenic). PAH is generated by the incomplete combustion of carbon-based substances such as wood, oil, coal, tar and gasoline. The top contaminate source of PAH is the exhaust of automobiles. PAH travel in the air and eventually settle into soil. PAH can leach into waterways and choke out entire ecosystems, threatening both the environment and humans. Aquifers and swamps are in danger. Ingestion or inhalation of PAH can cause blindness, hair loss, internal hemorrhaging, lung cancer and birth defects, making city dwellers particularly vulnerable. PAHs are a normal part of life, but with current industrialization, and the increased number of cars on the road today, PAH levels are at an all-time high. PAH are classified by their molecular weight, or the number of carbon rings in their structure. There are multiple types of PAH that we come in contact with on a daily basis. We often come into contact with high molecular weight (HMW) PAH such as benzo[a]pyrene that contain five rings and are particularly carcinogenic. PAH with very high molecular weight are dangerous, but are too large be absorbed by the body and are simply excreted out. Low molecular weight (LMW) PAH contain 1-3 molecular rings and are hazardous and small enough to be absorbed into your bloodstream during every day activities. The most common form of natural PAH is LWM Naphthalene. Sixteen extremely carcinogenic PAH are targeted and monitored by the Environmental Protection Agency and members of the European Union and are commonly known as "target" PAH. Governments around the world have begun to take action to prevent and reverse PAH pollution. For example, in the late 1940's Britain conducted an unprecedented clean up of the oceans surrounding the factories on its West Coast, which were so contaminated that the fish populations were drastically depleted. The chemicals used were so expensive that the government was forced to use funds that could have been used for post-war reconstruction, but people were starving due to the lack of fish. In late 2007, the Chinese government ordered the first attempted large-scale PAH cleanup of the lakes and swamps around Hong Kong using bacteria that feed on these organic chemicals, similar to the function of nematodes. Germany requires that all household products be tested for PAH levels before they are put on the market. Bacteria have been found that reduce PAH. Unfortunately, Inventors have found that after introducing R. rhodochrous, and Sphingomonas to heavily contaminated swampland, they did not reduce the levels of PAH fast enough to be immediately effective. But these bacteria could serve as a slow acting, long-term solution to the world's PAH conundrum. R. rhodochrous is unique among other mycobacterium, in that it is benign to humans, and that it excretes lipids to cover its surface. PAH are fat-soluble due to a non-polar structure, so as the bacteria comes into contact with more PAH, more fatty lipids are excreted dissolving the PAH and then converting it into food for R. rhodochrous. Afterward the R. rhodochrous transforms the now homogeneously mixed PAH/lipids into water, biodiesel, and naturally occurring steroids. In other studies, strawberries were planted in batches of spiked soil to identify the capability of naturally secreted Linoleic acid to degrade PAH. Linoleic acid research is rare and has not gone through large enough scale testing. (i.e. deep soil testing, unfavorable growing conditions in polluted areas, etc.). Linoleic acid can be found in all plants, fruits, and vegetables but especially in potatoes, strawberries, safflowers, carrots, and even radishes. The safflower oil used in this experiment is 76.7% Linoleic acid. Linoleic acid is a fatty acid form of lipids. PAH (which are fat soluble due to nonpolarization) cannot dissolve in water, but can dissolve in lipids. The Linoleic acid does so by being oxidized by the PAH. The downside of Linoleic acid is that one of the byproducts is the known carcinogen 4-Hydroxynonenal (4-HNE). Fortunately 4-HNE is consumed by R. rhodochrous because of its chemical structure being similar to the food created by R. rhodochrous' lipid shield. Inventors all over the world have taken strides toward PAH prevention and protection. The use of purely electric cars is a way to cut off the source of PAH, but still leaves us to worry about current PAH levels. MGP (Manufacturing Gas Plants) are areas that were used in the 19th and 20th century powered by coal, which produced gas plumes that have rendered areas (usually in prime real estate) completely unlivable. The land is devoid of life and the air inside and around the abandoned facilities is nearly toxic. As a result of this unchecked industrialization, PAH has choked the life out of these formerly pristine areas. SUMMARY OF THE INVENTION The inventor performed an experiment to determine the effect of distance from the source on PAH concentrations in roadside soil. The data revealed that PAH concentrations in soils decrease as sample sites get farther from the source. The experiment tested for heavy, total, and target (hazardous) PAH. The inventor found that dangerous levels of anthrogenic PAH in roadside soil that decreased at an average rate of 0.54 ppm/10 ft. The inventor's early experimentation proved that as you got farther from the source of a PAH emitter (cars), the levels decreased. 5, Findings such as these have lead scientists and engineers to look toward bioremediation as a way of fixing the PAH problems. Bioremediation is the process of returning nature that has been contaminated to its original condition through the use of natural materials such as bacteria or plants. Inventors have used bacteria and other bio sources such as wheat or plants containing Linoleic acid to degrade PAH. Using the new TD-500 and UVF-3100 PAH testing kits different bioremediation agents' effectiveness against concentrations of diesel fuel in soil were tested. The purpose of this experiment is to find a quick, clean, and cost-effective alternative to current remediation techniques using new bioremediation techniques. The hypothesis is that the R. rhodochrous/Linoleic acid mixture will yield the highest decrease in PAH concentration. The null hypothesis is that the R. rhodochrous/Linoleic acid mixture will have no effect on the PAH concentration. Four containers of soil were spiked with diesel fuel, a PAH source, to a concentration of 1,000 ppm. Container 1 (control) had no additions, while 1.575 ml of Linoleic acid was added to container 2, and R. rhodochrous to container 3. A combination of the agents was added to container 4. Three samples were collected from each container weekly for four weeks and tested for PAH concentration using UV fluorescence spectroscopy. The Linoleic acid/R. rhodochrous mixture resulted in the highest degradation (51.23%) of PAH followed by R. rhodochrous alone with 46.65% degradation, and Linoleic acid alone with an initial 36.61% remediation before leveling out. PAH concentration in the control remained relatively static. This implies that R. rhodochrous metabolized the PAH. Future research will be conducted over longer periods with varying soil types and temperatures to determine the best applications for these agents. Therefore it is an objective of the present invention to develop a quick, clean, and inexpensive bioremediation solution to PAH pollution. It was hypothesized that a combination of Linoleic acid and Rhodococcus rhodochrous (R. rhodochrous); would yield the greatest degradation of PAH. The hypothesis that the mixture of the R. rhodochrous and Linoleic acid would yield the greatest PAH degradation was supported by the data. BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings, which are incorporated herein an form a part of the specification, illustrate the present invention and, together with the description, further serve to explain the principles of the invention and to enable a person skilled in the pertinent art to make and use the invention. FIG. 1 depicts the percent decrease in PAH concentrations produced by each of the three bioremediation agents and in the control; FIG. 2 shows the levels of PAH over the four weeks when no bioremediation agents were introduced into the container; FIG. 3 represents the PAH concentrations in the container that was introduced to safflower oil, also known as Linoleic acid; FIG. 4 portrays the effects of R. rhodochrous bacterium after it had been introduced to a diesel-spiked container; FIG. 5 shows the effects when a mixture of both R. rhodochrous and safflower oil (Linoleic acid) are introduced to a container of diesel-spiked soil; FIG. 6 depicts the Concentration of Diesel over Time; FIG. 7 depicts the Percentage of Oleic acid over Time; FIG. 8 is Red Clay Chromatograms; FIG. 9 is Limestone Chromatograms; FIG. 10 is Sand Chromatograms; FIG. 11 is Topsoil Chromatograms; and FIG. 12 is Contractor Mix Chromatograms. DETAILED DESCRIPTION OF THE INVENTION In the following detailed description of the invention of exemplary embodiments of the invention, reference is made to the accompanying drawings (where like numbers represent like elements), which form a part hereof, and in which is shown by way of illustration specific exemplary embodiments in which the invention may be practiced. These embodiments are described in sufficient detail to enable those skilled in the art to practice the invention, but other embodiments may be utilized and logical, mechanical, electrical, and other changes may be made without departing from the scope of the present invention. The following detailed description is, therefore, not to be taken in a limiting sense, and the scope of the present invention is defined only by the appended claims. In the following description, numerous specific details are set forth to provide a thorough understanding of the invention. However, it is understood that the invention may be practiced without these specific details. In other instances, well-known structures and techniques known to one of ordinary skill in the art have not been shown in detail in order not to obscure the invention. Referring to the figures, it is possible to see the various major elements constituting the apparatus of the present invention. Polycyclic aromatic hydrocarbons (PAH) are a collection of chemical compounds, which are created from the incomplete combustion of carbon-based materials. PAH are extremely carcinogenic, and can lead to (among other things) kidney failure, internal hemorrhaging, and death. Over the last two years the Inventor has studied PAH and means of remediating them. In 2008, the Inventor performed an experiment to determine the effect of distance from the source on PAH concentrations in roadside soil. The data revealed that PAH concentrations in soils decrease as sample sites get farther from the source. The experiment tested for heavy, total, and target (hazardous) PAH. The Inventor found that dangerous levels of anthrogenic PAH in roadside soil decreased at an average rate of 0.54 ppm/10 ft. The Inventor proved that as you got farther from the source of a PAH emitter (cars), the levels decreased. The present invention is a Linoleic acid/Rhodococcus rhodochrous mixture designed to develop a reliable and economically feasible bioremediation method against PAH. The present invention, discovered through experimentation by the Inventor, proved that bioremediation could be equally or more effective than current remediation techniques. After two months of remediation there was a 97% decrease of PAH in the treated soil. The ratio of the Linoleic acid to the R. rhodochrous bacteria believed to be the best mode of the present invention is three parts Linoleic acid to one part R. rhodochrous bacteria. A ratio wherein the bioremediation mixture includes from about 5% to about 50% by weight of the natural microorganism source and a corresponding amount of about 5% to 50% by weight of the Linoleic acid may also be used in alternative embodiments. Linoleic acid was chosen on the basis that it is cost efficient and can be found in abundance at any health food store. Linoleic acid is a polyunsaturated fatty acid, which goes through a free radical reaction to create extra food for the bacteria. Linoleic acid has been tested as a PAH bioremediation tool and was rejected due to a hazardous byproduct known as 4-hydroxynonenal (4-NHE). 4-HNE is very volatile and hazardous to human health. However, once coupled with the R. rhodochrous the 4-NHE is metabolized and replaced with safe water and methyl esters. R. rhodochrous was chosen on the basis that it is stable and safe. It is not considered a pathogen and is one of the only bacteria that can effectively metabolize the PAH, and does not cause tuberculosis. R. rhodochrous is also native to a large portion of North America allowing it to survive the temperature of many distinct regions. R. rhodochrous also has many unique devices at its disposal to protect itself from the toxicity of PAH and other diesel additives. R. rhodochrous is capable of creating a lipid coating around itself when it comes into contact with PAH, acting similar to a shield. This reaction yields chemicals similar to 4-NHE that are then metabolized into water and methyl esters. Thus the synergy of Linoleic acid and R. rhodochrous remediates the diesel with unprecedented results. The 5 different soil types were chosen based on the variety of environments that the bioremediation agent might be deployed in, from the sands of Saudi Arabia to the clay landscapes of Arizona. Now referring to the Figures, the purpose of the study, and the best mode of the present invention, was to develop a quick, clean, and inexpensive bioremediation solution to PAH pollution. It was hypothesized that a combination of Linoleic acid and Rhodococcus rhodochrous (R. rhodochrous); would yield the greatest degradation of PAH. Prior to the experiment, R. rhodochrous was grown in a Petri dish. When the bacterium was prepared, 757.5 g of soil were loaded into each of four 8-liter containers. The containers were labeled "Control," "Bacteria," "Linoleic Acid," and "Mixture" respectively. 2.755 ml of diesel fuel were then stirred into the soil for five minutes to ensure even dispersal and the release of all benzene gasses from the diesel. Four containers of soil were spiked with diesel fuel, a PAH source, to a concentration of 1,000 ppm. Container 1 (control) had no additions, while 1.575 ml of Linoleic acid was added to container 2, and R. rhodochrous to container 3. A combination of the agents was added to container 4. In the tank labeled "Bacteria" the R. rhodochrous was transferred from the Petri dish to the tank, distributing the microbes as evenly as possible across the surface of the soil. In the container labeled "Linoleic Acid," 1.575 ml of safflower oil were distributed evenly across the soil. In the tank labeled "Mixture," 1.575 ml of safflower oil were distributed evenly across the soil and then a layer of R. rhodochrous microbes was placed on top of the soil. No bioremediation agent was introduced into the "Control" container. Three soil samples were taken from each container over a four-week period on days 0, 7, 14, and 21 and 28. The first sample taken on each day was from the bottom of the container, the second was from the center, and the third was from the surface. The samples were tested in a TD-500 ultraviolet analyzer according to the standard user guide and the results were recorded. The Linoleic acid/R. rhodochrous mixture resulted in the highest degradation (51.23%) of PAH followed by R. rhodochrous alone with 46.65% degradation, and Linoleic acid alone with an initial 36.61 remediation before leveling out. PAH concentration in the control remained relatively static. This implies that R. rhodochrous metabolized the PAH. Future research will be conducted over longer periods with varying soil types and temperatures to determine the best applications for these agents. FIG. 1 depicts the percent decrease in PAH concentrations produced by each of the three bioremediation agents and in the control. The Linoleic acid/R. rhodochrous mixture proved 4.58% more effective on remediating PAH then the R. rhodochrous alone and 14.62% more effective than the Linoleic acid alone. FIG. 2 shows the levels of PAH over the four weeks when no bioremediation agents were introduced into the container. With nothing to counteract the diesel, the concentration of PAH remained at around 1200 parts per million. The overall change was a negligible 9.4 percent, which is the result of improper proportions during the second to last test of sample I. Now referring to FIG. 3, the graph represents the PAH concentrations in the container that was introduced to safflower oil, also known as Linoleic acid. Then in the first week Linoleic acid yielded a greater drop than any other agent. The overall change from day 0 to day 28 was 36.61 percent. Based on the "leveling out" of the graph is not likely that the acid would yield further results. Further results could be produced if plants containing Linoleic acid were grown in the soil. FIG. 4 portrays the effects of R. rhodochrous bacterium after it had been introduced to a diesel-spiked container. During the first week the degradation rate of the PAH seemed negligible, but immediately afterward the rate increased. This most likely showed a growth in the amount of bacteria. Week 3 (day 14-21) showed the greatest jump, and will continue to show results as a more long-term solution. Over the 3 weeks the R. rhodochrous showed an average 46.65% degradation. Now referring to FIG. 5, the graph shows the effects when a mixture of both R. rhodochrous and safflower oil (Linoleic acid) are introduced to a container of diesel-spiked soil. The first week showed excellent result similar to that of the Linoleic acid container. But then switching to the trend of bacteria and using the acid as a lipid auger, the bacteria showed an almost exponential degradation rate per week. The mixture technique will most likely be a viable option for fast acting and long term relief. The overall percentage was the greatest of the containers with a whopping 51.23%. FIG. 6 depicts the percent decrease in PAH concentrations produced by each of the three bioremediation agents and in the control. The Linoleic acid/R. rhodochrous mixture proved 4.58% more effective on remediating PAH then the R. rhodochrous alone and 14.62% more effective than the Linoleic acid alone. Table 1 portrays the levels of every sample along with the average per week. The average change per week is easily available by comparing the shaded areas for every column. The Linoleic made the quickest and most abrupt drop from 10.47 to 7.23 ppm ((100×) 3.24 drop)). The second week's largest drop was produced by the R. rhodochrous container, which dropped from 10.33 to 9.43, which is equivalent to a 9% degradation. The third week's most profound drop of 9.27 to 6.47 was prevalent in the R. rhodochrous/Linoleic acid mixture with a difference of 2.9 ppm. The fourth and final weeks largest drop was produced by the R. rhodochrous from 8.10 to 5.87 (-2.23 change). TABLE-US-00001 TABLE 1 The concentration levels of every sample along with the per week average. ##STR00001## Analysis indicated that the use of a mixture of Linoleic acid and R. rhodochrous generated the greatest, quickest, and longest lasting degradation rate. The mixture provided a 51.23% drop in PAH and data suggests that it will to remediate after the end of the 4th week. In second place came the Linoleic acid with an immediate drop of 36.61% before leveling out in the 2nd week. Finally the bacteria (R. rhodochrous) started slow but moved into a greater rate every week bringing it to an overall 46.65% change. The hypothesis that the mixture of the R. rhodochrous and Linoleic acid would yield the greatest PAH degradation was supported by the data. In a second experiment, the effectiveness of a Linoleic acid/R. rhodochrous mixture as a bioremediation agent of Polycyclic Aromatic Hydrocarbons (PAH) in a real-world, uncontrolled setting. Ten tanks, each two containing one of 5 different soil types, were spiked with diesel fuel. One of each soil type was introduced to the Linoleic Acid/R. rhodochrous mixture. Three samples were taken from each tank every 7 days. Each of the three samples was homogenized, prepared, and then analyzed through a gas-chromatograph-mass-spectrometer using standard EPA Method 8207C. Although originally targeting PAH specifically, the bioremediation mixture in reality converts the entirety of diesel fuel into water as well as environmentally friendly methyl esters, the main ingredient of bio-fuel. The overall diesel concentration decreased by an average decrease of 29.45%. The most efficient soil was the sand, with an overall remediation of 53%. Future studies using pure controlled compounds, and re-inoculating the soil at set intervals, as well as simulated oil spill cleanup using the agents are also being investigated. These results show that the R. rhodochrous/Linoleic acid mixture has the capability to help construct a sustainable planet in a fossil fuel dominated world. Prior to the beginning of the experiment, five Petri dishes of R. rhodochrous were grown for 7 days. Ten 1.133 m containers were laid outside and marked to identify which soil they would hold. Two containers each were filled with crushed limestone, sand, red clay, contractor mix, and topsoil. Each container held about 200 kg of soil. Every container was spiked with diesel fuel to a concentration of 2000 ppm by weight. One container of each soil type was treated with the Linoleic acid/R. rhodochrous mixture. Soil temperatures were taken every night at 7:00 pm and daily high/low air temperatures were recorded to document the environmental conditions impacting the bioremediation mixture. Three samples were taken from each container on days 1, 7, and 14. The three samples were homogenized (to create an average) and prepared through the extraction process for a GC-Mass Spectrometer standard EPA Method 8207C. Results were gathered and analyzed. FIG. 6 represents the overall drop in diesel percentage by soil type over time. The lower the percentage, the more diesel fuel has been converted into water and methyl esters. While red clay and topsoil show the least remediation, their bioremediation rate closely resembles data from previous samples in an earlier lab experiment that were treated only with R. rhodochrous. This finding suggests that the denser soils absorb the Linoleic acid slower than the less compact soils, retarding the availability of the growth medium to the bacteria. Less compact soils such as the sand absorbed the Linoleic acid more quickly resulting in faster remediation. FIG. 6 indicates slight remediation in the first week followed by constantly increasing amounts of remediation in later weeks. The average remediation of diesel across all soil types after two weeks was 29.9%. FIG. 7 depicts the percent of oleic acid by soil type over time. Oleic acid is the metabolite of the bacteria. An increase in the metabolite suggests an increase in bacterial activity in the soil. FIG. 7 represents oleic acid as a percentage of the overall sample. While the percentages appear small, they are relatively large within the sample and consistent with other diesel compounds. The contractor mix in FIG. 7 is shown at a 1/10 scale in order to give detail to the graph. The contractor mix's unusually high levels of oleic acid are most likely due to the mixture's reactions with other compounds found in the soil itself. Each individual spike in the chromatogram of FIG. 8 is a relative representation of a chemical within the sample. The top row of chromatograms represents the control group, while the bottom shows the treated group. While the control group shows the standard evaporation of the low weight, highly volatile compounds, the treated group shows significant reduction in both singular PAH level as well as overall diesel concentration, up to a 13.9% degradation. The increase in bacterial metabolite level, marked below, between days 1 and 14 signifies significant growth of bacteria within the soil. The boxed peaks represent the level of Linoleic acid in comparison to the levels of diesel. Because the levels of Linoleic acid cannot go up, the image of the chromatogram is scaled to match the new levels of peaks. The Chromatogram of FIG. 9 shows the total concentration of each chemical compound found within the sample. The increasing levels of Linoleic acid and oleic acid metabolite within the treated set of data show significant remediation up to 32%. The increasing levels of the oleic acid metabolite also show continuing and increasing reaction with the diesel. The sand chromatograms of FIG. 10 show the expectable evaporation of volatile chemicals at the far left of each chromatogram, the Linoleic acid quickly becomes the most prominent of the peaks. The metabolite on the other hand remains relatively low in comparison to other soil types. This could be attributed to lower temperatures recorded in sand during the testing period, retarding the activity of the R. rhodochrous. Despite this sand resulted in being the most successful, with a final remediation of 53%. The top soil samples shown in FIG. 11 illustrate a decrease in diesel concentration consistent with that of the other soil types. Topsoil had a final remediation of 22.7% of the diesel. Topsoil is unique in the rate in which the R. rhodochrous produces oleic acid, metabolizes, and reproduces. The oleic acid metabolite becomes far more apparent than most other soil types. The contractor mix chromatograms shown in FIG. 12 represent an abnormality between the other soil samples. It has an extremely large initial drop in diesel concentration; there is a small increase on the 14th day's diesel concentration. This is mostly attributed to human error as well as mass spectrometer error. Despite this, the contractor mix maintained a final remediation of 40%. The Linoleic acid and the R. rhodochrous metabolite continue to be very outstanding compared to other peaks. Red Clay and Topsoil, while being the best for bacterial growth, had the lowest remediation over the two weeks, 13.9% for Red Clay and 22.4% for Topsoil. These rates may be attributed to the sorption coefficient of the soil, which causes the mixture to permeate the soil more slowly. The highest remediation rate could be found in sand with a 53% total remediation into water and methyl esters. The presence of metabolite throughout all bioremediated samples is a sign of continuing bacterial survival and consumption of PAH and other hydrocarbons. The mixture shows promise not only as a PAH remediator, but as a remediation tool for oil, diesel, and similar environmental threats based on these results. In an alternative embodiment of the present invention, the PAH or diesel contaminated soil is replaced by PAH or diesel contaminated water or salt water. The present invention is adaptable to cleaning soil and contaminated fresh water such as lakes and streams as well as salt water lakes, oceans, or even brackish water areas. In yet another embodiment, the present invention may be practiced in a container where the contaminated soil or water is process or stored. Although the invention, as first discovered and tested was directed to open field or open water locations, it is feasible, as testing has shown that contaminated soil or water can be gathered up and stored in containers from contaminated locations or used in contaminated locations that provide for retention or storage of contaminated spills, accidents, or production by-products. Whereas particular embodiments of this invention have been described above for purposes of illustration, it will be evident to those skilled in the art that numerous variations of the details of the present invention may be made without departing from the invention as defined in the appended claims. Furthermore, other areas of art may benefit from this method and adjustments to the design are anticipated. Thus, the scope of the invention should be determined by the appended claims and their legal equivalents, rather than by the examples given. Patent applications in class Destruction of hazardous or toxic waste Patent applications in all subclasses Destruction of hazardous or toxic waste
June 26, 2008– Walnut Creek, CA– The Mix Foundation for Excellence in Audio, presenters of the Technical Excellence&Creativity Awards, and G.A.N.G. (Game Audio Network Guild) have announced that the San Francisco-based group will sponsor the award for Creative Achievement in Interactive Entertainment Sound Production at the 24th Annual TEC Awards. Award winners will be announced at a ceremony on Friday, October 3rd at San Francisco’s Westin St. Francis Hotel. The TEC Awards is the world’s most prestigious forum for recognizing outstanding achievement in professional audio production and product innovation. The nine categories of Creative Achievement, to which the Interactive Entertainment Sound category was added in 2007, recognize the producers, engineers, sound designers, production faciities and others behind the sound of hit recordings, tours, films, TV shows and other entertainment media. “Since launching the Interactive Entertainment category, we have been building bridges to the game sound community,” said Hillel Resner, president of the Mix Foundation.“G.A.N.G. is a highly respected organization that speaks to and for this important group of professionals, and we are honored to have their participation.” G.A.N.G. is a global non-profit organization working to advance the interactive audio industry by providing information, instruction and policy to its members and enthusiasts around the world. G.A.N.G. empowers game development communities by establishing resources and recognition for education, business and development professionals. G.A.N.G. also supports career development for students and aspiring game audio professionals and utilizes sponsorships and partnerships to empower like-minded organizations. For more information, www.audiogang.org "There is a natural synergy between G.A.N.G. and the Mix Foundation’s TEC Awards", says Paul Lipson, President of the Game Audio Network Guild. "Working through our Program Partnership framework, we are able to support the Awards and bring the world of audio for interactive media to a larger, shared constituency. We’re delighted to see the TEC Awards acknowledge the importance of sound for interactive media". Nominees for this year’s award for Interactive Entertainment Sound Production are: Bioshock, 2K Games Call of Duty 4: Modern Warfare, Activision Halo 3, Microsoft Game Studios The Orange Box, EA Games Uncharted: Drake's Fortune, SCEA The 24th Annual TEC Awards will be held on the second night of the Audio Engineering Society Convention (AES) at the Moscone Center Oct. 2-5. The awards ceremony is expected to draw more than 700 top sound and music professionals from around the world. Funds derived from the banquet and ceremony are donated to organizations working to promote safe listening practices in the music environment, including House Ear Institute’s outreach campaign to teenagers and various audio education scholarships. For tickets and sponsorship information, contact Executive Director Karen Dunn at 925-939-6149 or Karen@tecwards.org. The Mix Foundation for Excellence in Audio is a 501?(3) non-profit, charitable organization headquartered in Walnut Creek, California. The TEC Awards is sponsored by Mix magazine, the professional audio industry’s leading international monthly, published by Penton Media. Other top-tier sponsors include the Gibson Foundation (Sponsor of the Les Paul Award), Sustaining Sponsor Harman Pro Group, Guitar Center Professional, North American Music&Sound, RODE Microphones/Event Electronics, Sennheiser Electronics and Universal Audio, sponsor of Video pre- and post-production. Event sound will be provided by Meyer Sound Labs and subsequent webcast by Broadjam.com. For a complete list of the 2008 TEC Awards Creative Achievement Nominees, please visit http://mixfoundation.org/tec/08nomineescreat.html For more details about the Mix Foundation and TEC Awards, please visit www.mixfoundation.org.
Originally posted at Stop Big Media on July 17, 2007. View the original post here. This morning the Wall Street Journal reported that News Corp. has reached a tentative deal to buy Dow Jones. News Corp. CEO Rupert Murdoch has led the media consolidation charge, buying up prime media properties, homogenizing content, and spinning the news to serve his business interests and personal ideology. Now one of America’s most widely read and respected financial journals may be about to get the Murdoch treatment. Free Press founder Robert W. McChesney issued a statement in response to the latest news: “Rupert Murdoch’s takeover of the Wall Street Journal may not be illegal, but it’s certainly wrong. The cost of giving one company — and one man — this much media power is simply too high.” The $5 billion deal would give Murdoch control of three of the main outlets that shape the nation’s news agenda: the Fox network, Fox News Channel and the Journal. And this tentative agreement comes on the heels of another big announcement from News Corp. Just last week the company heralded their forthcoming Fox Business Network – with which Murdoch hopes to challenge CNBC. One can only imagine how the Fox News model might be translated into a business news channel – and even worse to think about how the “Fox Effect” might creep onto the Journal’s news pages. Synergy may make money, but it’s no substitute for serious reporting. So far, nothing is set in stone. The proposed deal will be presented to the full Dow Jones board later tonight, before going before the Bancroft family for a final vote in the next week or so. McChesney says: “If they want to protect the editorial integrity of the institution they built, the Bancroft family can still stop this deal from going through. But even if Murdoch’s Journal takeover is derailed at the 11th hour, it should be a wake-up call to anyone who cares about media and democracy. We’re at a critical juncture. We have to understand that our democracy is premised on the existence of an informed citizenry. As the framers understood, that requires a media system that produces quality journalism. We cannot abandon our noble tradition and allow the Murdochs of the world to run the Republic into the ground in their quest for endless profits.” News Corp.’s bid to acquire Dow Jones Co., whether it is successful or not, reminds us that the battle to Stop Big Media has to continue. We may not be able to change the outcome of this merger, but we can change the policies that allow mergers like this to occur.
Alistar Build Guide by Pelikins This build has been archived and is for historical display only. PLEASE NOTE: This build has been archived by the author. They are no longer supporting nor updating this build and it may have become outdated. As such, voting and commenting have been disabled and it no longer appears in regular search results. Not Updated For Current Season This guide has not yet been updated for the current season. Please keep this in mind while reading. You can see the most recently updated guides on the browse guides page. Not Updated For Current Season Alistar Top Laner? I know this sounds far fetched, but this is legit. I've been playing around with Alistar in 3s and Dominion, testing this build with similar items...and its been working really really well... Alistar is literally the best suited solo top champion in the game with the new items...bar none. Alistar is incredibly hard to gank. He brings his own sustain. He can freeze a lane easily. He accepts ganks really really well. He pushes his lane really well. With the addition of a sheen he can even knock down towers well. AND HE'S A GREAT DUELIST. Alistar is just plain annoying to duel. He can deny CS like its his job. He can whittle down anyone who doesn't have enough sustain and he can accept and escape ganks with ease. He's like Malphite...but he's an malphite who gets his ult at level 1/2 instead of 6... Once he leaves lane he brings crazy utility to his team. He initiates team fights well. He is a solid solid solid anchor for the team. His CC is uncleansible. AND NOW HE BRINGS A TON OF DAMAGE TO A TEAM FIGHT. That's right...a damaging Alistar... What's even better is that Alistar doesn't steal kills like many tops, he's all about feeding and supporting carries. He even boasts huge advantages in build freedom past his core. He can literally pick up any item for his team and make it effective once he has his core built. I'll go into each of these topics individually. First off general build concept. Two broken items with crazy synergy. S3 introduces two awesome items for Alistar. First, the iceborn gauntlets. *****http://edge2.mobafire.com/images/item/iceborn-gauntlet.gif**** Iceborn Gauntlet 40 Ability Power, 60 Armor, 15 Cooldown Reduction, 500 Mana. UNIQUE Passive: Spellblade: After using an ability, your next basic attack deals bonus physical damage equal to 125% of your base attack damage to surrounding enemies and creates a field for 3 seconds that slows enemies inside by 35% (2 second cooldown). You stick the new tank Sheen on him. It gives him armor value against his top lane. 15% CDR for more damage and utility. Some bonus mana is always good. Some AP is cool. But now he has a super sheen (25% better than normal sheen) that AoE slows. Second Liandry's Torment: ***http://edge1.mobafire.com/images/item/liandrys-torment.gif****** Liandry's Torment 70 Ability Power, 200 Health. UNIQUE Passive: Eyes of Pain: +15 magic penetration Unique Passive: Dealing spell damage burns enemies for 5% of their current health as magic damage over 3 seconds. If their movement is impaired, they take double damage from this effect. Half duration for multi-target or periodic effects. 300 max damage vs monsters. You rush this item on Alistar. Now all his spells, including his triumphant roar are going to burn the hell out of his enemies because of his trample passive. When coupled the two items deal a devastating amount of damage by simply spamming skills regardless of how much AP you have, or your AP ratios. Also notice that Liandry's deals double damage when your target's movement is impaired...while the gauntlets impair movement making a natural synergy. Also notice that Liandry's will proc off of Alistar's trample...so now not only does a rank 1 triumphant roar give an AoE sheen proc. It gives an AoE slow and an AoE dot that deals 10% of someone's current life over 3 seconds. Oh...and it heals Ali and all his friends too... So by purchasing these two items we cover Alistar's one weakness. His lack of damage... CDR and Ali As you can see, this build build reaches 40% CDR (the hard cap) in it's first 3k gold. This is pretty incredible, first off...and its crazy strong secondly. Ali is all about spamming his skills to make him effective. His kit provides massive CC, sustain, and durability. With full CDR he simply gets more of it. In addition. All his damage is based off spamming skills. Liandry's is on spell cast as is Sheen procs. So his main DPS stat is going to be CDR. Which is really convenient since all his utility is based off CDR as well. Dueling the cow. The cow is an exceptionally strong duelist. Think Malphite but with harder CC and more sustain. Basically, the cow can deny creeps in two ways. He can use triumphant roar to heal the creep that the opponent is trying to last hit causing last hitting issues. Or he can headbutt his opponent away from the creep so he can't reach it to last hit. Both are really annoying and effective ways to deny CS to your opponent. With the addition of Sheen the cow can harass down an enemy pretty easily. The AP ratio on the skill is .7, which is solid and then by right clicking as you headbutt, you'll auto attack the enemy when you collide with him for a sheen proc+melee damage. This is pretty heavy harass and if they are without a lot of sustain, you'll actually be able to kill you're lane opponent using it. The cow also can disengage his opponent with ease, making him a very safe top laner. He's also really hard to gank because he can jump to enemies ganking from behind with Headbutt, and disengage enemies with Headbutt and Pulverize. Alistar also brings a lot of sustain with just a philo stone and utility masteries. He can very easily out heal/regen enemy poke by spamming roar and still keep full mana while doing it. He also accepts ganks well. You can feed your jungler kills and turn one that scales well into a carry. His headbutt/pulverize combo is a malphite ult available at level 2. And its very easy to secure a kill by flashing on the opponent with pulverize and headbutting them into your jungler's hands. By running ignite, your killing power increases further. One of the great things about Ali is that his build is really open. You get your core build of boots, gauntlets, and Liandry's (and some form of MR) and then you can pretty much build auras for your team. Some good core items to look at are aegis of the legion and the new upgrade runic bulwark. You could get an Ohmwrecker for tower diving. You could get a sight stone or an oracles elixir for vision advantage. You could get a WotA or an Abyssal scepter for yourself and your AP carry or a Zeke's for your AD carry. If they have a strong engage that's catching your carries, why not a Mikael's Crucible. Do they have a pesky stealther? Twin Shadows! Or if they have a lot of healing you can get a Morellonomicon. No matter what you build, you are going to be effective...because your build is done...and now you are just filling out any weaknesses in your team. Alistar is a feeder...not a KSer. This is the best thing about Alistar top. He feeds his team...he isn't selfish. He's fully capable of killing...don't get me wrong...and I'll usually have a positive KDA. But he can afford to defer kills and his damage is front loaded rather than back loaded. Liandry's deals damage based off how much hp the currently have. So he deals more damage to healthy targets than weak ones. You of course have ignite and base spell damage and sheen procs to secure kills if need be...but in general you want your carries to have them... So you deal a ton of trickling AoE damage in a team fight and disable the enemy team while doing it... but let your carries get the bulk of the gold. IT WORKS PERFECTLY. Meanwhile you are this big disruptive damaging annoyance to their team... You can't be bursted down due to your ult. You break loose of CC due to your ult. You're CC is uncleasible and unceasing and 2/3rds AoE...plus you are pumping out healing to your teammates in decent doses making it even harder to kill them.
How to set goals? Like all things, its actually quite simple – once you’ve done the ground work, which is: Get the ‘Big-Picture’ first, and always keep your eye on it. Work out what you REALLY want, not what you think you want. Work out what you can realistically do and achieve. These are the foundations or the ‘rocks’ of your goal setting process. They set the direction for your goals, so it’s really important to put the time into working them out properly. And they are unique to you, which is why only you can do it. Once you’ve worked this out, you can prioritize and set your goals! You’ve probably heard of SMART Goals, well ours are , which guarantees your goals contain all the necessary components to maximise your goal setting success. Goal setting is of course an on-going and dynamic process. Your priorities and therefore your goals will change from time to time (for example if you start a family) and when this happens, it’s important to sit down and go through the goal setting process again. Also as you grow older and mature, your motivators and drivers will change so on-going review is necessary to make sure your goals are still relevant to you. What you want when you’re 20 will not be the same as what you want when you are 40. But armed with these skills, it is a tool for life – no matter what stage you’re at or how old you are. Get the ‘Big-Picture’ first The first and most important step in how to set goals - what is YOUR ‘Big-Picture’? This is one of those philosophical questions that go in the same boat as “What’s the meaning of life?" and "Why are we here?”, and you may never be able to truly answer it for yourself. But if you want to try to define it, your ‘big-picture’ is your one guiding principle, your shining light, that forms the basis for all your decisions and actions. If you were a company, your ‘big-picture’ would be the Vision or Mission Statement. So, it is a statement outlining an idealised description of your life’s outcome. It will inspire you and create your target. It can apply to different parts of your life – your family, your career – and it is the end target that you want to achieve, and where your goals need to take you. To help you work out exactly what your ‘big-picture’ is, think about your tomb-stone. Macabre I know, but your tomb stone is a concise summary of your life – what you have achieved, and how people remember you. How do you want to be remembered? Of course, you may want to be remembered in several ways – as a career woman, family man, skilled professional – there are many aspects of your life that you need to consider. Too much focus on one aspect of your life could leave you feeling empty in another. The classic example here is people who focus too much on their career driven by ‘empty’ goals of power, ambition and making money, only to neglect their family. Most of these people when on their death bed wish that they had spent more time on the ‘important’ things in life – an indication that they didn’t get a handle on their personal ‘big-picture’. It’s a question of balance, and you’re the only one who knows the perfect balance for you. You may not be able to put your ‘big-picture’ in words, but try to visualize what your life would be like if it was perfect in every way - this is your ‘big-picture’, and your goal setting needs to reflect it. This is critical for how to set goals. So what do you really WANT? Now that you have an eye on your ‘big-picture’, what do you REALLY want? Remember that goals must be personal and meaningful, otherwise you’ll have no reason to achieve them. So you need to work out what YOU really want, not what other people think you want. This is the key to how to set goals. The best way to work out what you really want is to brainstorm your thoughts to come up with a wish-list for each of your relevant This is the chance for you to let loose by picturing your perfect life, and putting down in writing what that perfect life would look like. Mind-Mapping is a great way to get to the heart of all your dreams and desires - just what you need for how to set goals. What’s a Mind Map? It’s an attempt to de-jumble your mind into some logic, and allows you to set the scene for what you really want. The importance to goal setting is that by using the Mind Mapping concept, you can cover all of your life aspects on the same piece of paper instead of traditional brainstorming where you’ll end up with a separate list for each life aspect you want to consider. And since life aspects are heavily connected, using a Mind Map gives you a considerable advantage for how to set goals. Personal Strategic Plan The Personal Strategic Plan offered by GoalsGuy is a step-by–step program that leads you through the goal setting process, and delivers a strategic plan of attack for your to achieve YOUR goals. It is based on the premise that life will not go according to plan, if you do not have a plan to begin with. The Personal Strategic Plan also helps you identify what’s really important to YOU – and that’s what’s REALLY important. So what can you really ACHIEVE? The Mind Mapping process will give you a really good idea of what you really want, but in how to set goals you also need to know what can you really achieve? Well, hypothetically, you can achieve anything you want to – but that’s not always the case. Resources, natural skill and ability, time – these all factor into whether we can achieve something or not. The aim of goal setting is to set achievable goals, even if that means taking a larger goal or dream and breaking it down into bite-size chunks. A personal SWOT analysis is a great way to work this out – it’s a detailed look at you and your life and will help you identify the most beneficial goals worth pursuing right now based on your current situation, and to identify goals that will help you prepare for the future. For the purposes of goal setting, it is useful to perform a on each life aspect as it will help you identify where you need to improve, and therefore help you set goals to make these improvements. More importantly though, the SWOT analysis allows you to identify your internal strengths that you can capitalize on to seize your opportunities and thwart any external threats. A template for your personal SWOT analysis is available in the ToolBOX, as part of the FREE Life Planning Workbook. Print out a separate page for each life aspect you want to analyze, and summarise the results on the SWOT Summary page, also available in the ToolBOX. So you should now have your ‘big-picture’ [as a tombstone inscription], a wish-list of what you really want [from your Mind Map] and an analysis of what you can actually achieve [from your personal SWOT analysis]. It’s now time to pick the first goal or couple of goals to focus on. Why only 1 or 2? Goal setting is a skill, and like all skills, how to set goals takes time and practice to become proficient at it. So start with a single, easy goal or two to practice on. Once you’ve achieved this one (or made some progress towards it), you’ll feel motivated to try the process on some harder goals and confident in applying the process. In the meantime, don’t throw out all the work you’ve done – just because you’re not actively pursuing a goal doesn’t make it any less important. Just put these on the backburner until you’ve got some successful goal setting under your belt. How to chose which goal? Well you need to consider: How important the goal is to you – prioritise! Starting on high priority goals will keep you more focused and motivated to achieve, than goals that are just considered ‘nice to do’. type of goal – ‘habit’ changing goals are often short-term goals and may therefore be easier to achieve. ‘Skill’ goals can have quite a clear path and may therefore appear easy, but beware that ‘skill’ type goals can take a long time to achieve so its important that they have lots of milestones to make the process manageable. ‘Outcome’ goals can be easy or hard, long or short, depending on exactly what they are. How comfortable are you that you know HOW to achieve the goal – for example, achieving optimum health and fitness may be a Must-Do goal for you and there is heaps of information and guidance on how it can be done, so that would be a good goal to chose as a starting point rather than something like achieving world domination! Make the most of goal synergy – some goals have benefits in several life aspects. How to set goals that synergise? Riding your bike to work for a ‘fitness’ goal will also help the planet and your hip pocket. Kill as many birds as you can with the one stone for maximum goal setting success! In a nutshell, prioritise and synergise! Make your Goal SMART Once you have a set of personal goals that are meaningful to you and will ultimately help you achieve your ‘big-picture’, all you need to do is develop your chosen goals and make sure they’re SMART or SMARTer. How to set goals that are SMART? All you have to do is document the goal in the following easy to follow format: When you’ve documented your goal, read it through – this is the crux of how to set goals and if you don’t believe what you’ve written, now is the time to go back and look at why. You need to commit to what you have written, so ask yourself: Am I really committed to undertaking the actions I have prepared? Am I really committed to achieving the action items within the timeframe I have set? Am I convinced that this is what I really want? Am I excited about the outcome from this goal? Am I prepared to allocate the resources and make the sacrifices I have identified? Am I actually going to do it? If you answered “YES” to all of these questions, great! Continue to the ‘How to Achieve' tab on the NavBar. If you aren’t sure or had some “No’s” in there, then you need to go back and look at ‘why’ - there is no point continuing if the goal you’ve developed and documented has a flaw in it. A template for documenting how to set goals that are SMART is available in the ToolBOX, as part of the FREE Life Planning Workbook. There are 2 versions available for you to chose from, depending on how much information you want to include. The ‘My SMARTER Goals’ template allows you to write several goals on the one page, where as the ‘SMARTER Goal’ template is for a single goal only, but allows you to include more detail. Sculptor3 - Give me 10 Minutes a day and I will show you how to create the life of your dreams. Impossible? Not for Tony Robbins, Louise L. Hay, Deepak Chopra and Wayne Dyer and many others who have discover the power of "Affirmation and Visualization". Sculptor 3 seamlessly integrates 7 technologies to create the most powerful reality creation program available. So while you are sitting in front of your computer you are literally soaking yourself in 7 powerful technologies that have been synergistically combined to produce incredible results.
- A new study found that while cost concerns prevent 18 percent of Americans from getting needed health care, 21 percent delay health care for nonfinancial reasons. - Nonfinancial barriers to health care include getting to the doctor, getting a timely appointment and taking time out of other responsibilities. - Two-thirds of Americans who had trouble affording health care also experienced nonfinancial barriers to accessing medical services. IMPORTANT NOTICE: Health Services Research, the official journal of the AcademyHealth, has delayed release of the study until Monday, August 22. Cost is only one barrier to getting timely medical care, a new study finds. Just getting to the doctor, making appointments and taking time off from work or other responsibilities are also major hindrances for some people to getting the medical care they need. “In the minds of many people, they often equate affordability with access, when in reality there are all kinds of reasons why people can’t get the care that they need when they need it,” said lead author Jeffrey Kullgren, M.D., a primary care physician and a Robert Wood Johnson Foundation Clinical Scholar at the Philadelphia VA Medical Center and University of Pennsylvania. The study appears online in the journal Health Services Research. Kullgren and colleagues looked at data from the 2007 Health Tracking Household Survey, which gathered health information from nearly 18,000 people across the United States. The researchers found that nearly 19 percent of U.S. adults did not get needed medical care or delayed medical care because they were worried about the cost or their health insurance would not pay for treatment. However, even more people — 21 percent, or one in five adults — experienced nonfinancial barriers to getting the care they needed. In addition, financial barriers appear to go hand in hand with nonfinancial barriers for many people: two-thirds of those who had trouble affording care also reported experiencing nonfinancial barriers. The most common nonfinancial reasons for not getting medical care were being too busy with work or other commitments, not being able to get to the doctor’s office when it was open, not being able to get an appointment soon enough and taking too long to get to the doctor’s office. “This is important food for thought in terms of health care reform. It would be naive to think that health insurance is the only factor that affects access to care,” said Rachel Gold, Ph.D., a researcher at the Center for Health Research at Kaiser Permanente in Portland, Ore. She was not associated with the study. As policymakers begin to implement the Patient Protection and Affordable Care Act, Kullgren said, “We need to think about how to organize the existing resources we have in ways that are going to improve access to care.” For example, this might include offering evening and weekend outpatient health services, making it easier to get a timely appointment with a health care provider, increasing the use of email and telemedicine communications and providing incentives for providers to work in underserved areas. “This study indicates a need for providing more federal support rather than less — so not just financially covering people’s care but making sure that the health care systems have enough support that they can provide care in a way that is actually meaningful,” Gold said. # # # For More Information: Reach the Health Behavior News Service, part of the Center for Advancing Health, at (202) 387-2829 or email@example.com. Health Services Research is the official journal of the AcademyHealth and is published by John Wiley & Sons, Inc. on behalf of the Health Research and Educational Trust. For information, contact Jennifer Shaw, HSR Business Manager at (312) 422-2646 or firstname.lastname@example.org. HSR is available online at www.blackwell-synergy.com/loi/hesr. Kullgren JT, et al. Nonfinancial barriers and access to care for US adults. Health Serv Res online, 2011.
Instant Wrinkle Remover As Seen On Tv You May Ask, are There Really Instant Wrinkle Removers? Author: Gordon Hall Are there really instant wrinkle removers? No, sorry to say. Healing wrinkles takes time. It took time to make them and it will take time to erase them. But, you can “cheat” a little. I know, you’ve seen the internet ads, but you must realize that those ads are computer animations. There is no way that a product can perform that quickly. Most of those products that “claim” to be instant wrinkle removers contain an ingredient called “Argireline”. Research evaluating the product was done in Barcelona, Spain, several years ago. The researchers reported a 16-27% “reduction” of wrinkle depth after 30 days of treatment, not instantly. The compound is a synthetic amino acid complex that is supposed to prevent muscle contractions and facial expressions. The company that created the product was not concerned about healing wrinkles. They were looking for a commercially viable alternative to Botox injections. Even Botox is just a temporary fix. If you are really interested in healing wrinkles, you can do it, but not with those heavily advertised instant wrinkle removers. They contain nothing that could be beneficial in the long run. They have never been fully evaluated for safety and there is no way to tell what kind of problems could be caused by long-term use could cause. But, research suggests that it would eventually cause your skin to sag. That’s not what you want. What you do want to look for is an ingredient called Functional Keratin, it is a naturally occurring amino acid peptide sourced from sheep’s wool. It does nothing to paralyze the facial muscles. The idea that habitual facial expressions cause wrinkling is just a theory that cannot be proven. Researchers have proven that older skin cells contain more free radicals and that free radicals damage collagen. They have also shown that levels of proteins and antioxidants, necessary to make new cells and repair free radical damage, are lower. Functional keratin provides the necessary proteins and antioxidants for healing wrinkles, but it also “cheats” a little. For many years, dermatologists have recommended using pigments to feel in deep lines and refract the light, so that the skin looks smoother. Many of the so-called instant wrinkle removers contain these pigments. Functional keratin is a clear solution, but the consistency is something like liquid skin, the new alternative to band-aids. The solution fills in deep lines, without using pigments that could clash with your natural tone, so your face does look smoother with the first application. So, you look better and you know that the solution is healing wrinkles, at the same time. The compound was thoroughly researched in numerous studies. It increases skin cell proliferation by as much as 160% in as little as three days, firmness by as much as 22% overnight and by 44% after 30 days of use. The best companies include other active compounds that work in “synergy” with functional keratin to fade lines, both fine and deep. If you want instant wrinkle removers that also help improve your appearance, as time goes by, you need to look for the best company, around. About the Author Gordon Hall is fervent about enabling you and everyone to live a healthy lifestyle, and is an ardent reviewer of Anti aging Skin Care and Cosmetic products. Visit his website now at : http://www.healthy-natural-skin-site.com to discover which Anti aging skin care products Gordon recommends after far ranging and extensive research. Filed under: Wrinkles Like this post? Subscribe to my RSS feed and get loads more!
News By Tag * More Tags... News By Location Crestron International Residential Integration Award Winners Announced 2011 Crestron International Residential Integration Awards Celebrate the Best in Integration The winners in this hotly contested event were revealed at the Crestron Awards party held at the Novotel Hotel during the recent CEDIA Home Technology Event. With guests enjoying a BBQ at London's Docklands and with the drinks flowing, we proceeded to award the winners. The evening saw us reward twelve of our dealers with trophies for their hard work in creating stunning residential properties full of Crestron technology. Here is the list of this year's winners. • Best Integrated Home System: Kensington Home Technology for London Mews House • Most Distinctive DM Installation: • Home Sweet Home Cinema: Electrickery's MediaCube • Brilliant Lighting Control & Design: Intuitive Homes for Arterbery Road • Most Extreme Makeover: ClearSphere for the Sussex Manor House • Ultimate Connected Home (below €500k): YUBU for Honeywood • Ultimate Connected Home (over €500k): SMC for The Lancasters • Best High Rise Living: Custom Controls for Claridge's Hotel • Best Marine Project: AV Synergy for the MY Vantage • Most Innovative Control Solution: SMC for their product development work at The Lancasters • Most Creative GUI: C3 Custom Code Crafters • Best International Crestron Home: Henri, Integrateur Domotique Robin Van Meeuwen, VP of Sales and Marketing at Crestron International, was the main judge for these awards. When announcing the winners, he explained reasons for the projects being triumphant. Following their win, the below companies expressed their thoughts on the achievement. Malcolm Stewart, Kensington Home Technology "We were delighted to win the best integrated home system at the Crestron Awards, not only due to the prestige of this particular award but also because it was an exciting project. From Sales through to Installation we worked as an efficient team delivering this excellent solution on time, on budget and to the client's expectations. My team deserves all of the praise, as the success of this project was directly proportional to their professionalism and hard work." Stephen Nevison, Intuitive Homes "To win a Crestron award is a fantastic achievement and our whole team is delighted that their hard work has been acknowledged in this way. Our top priority is to make sure our clients love the systems we provide but to also get the recognition from an industry leader like Crestron is the icing on the cake." Paul Milne, YUBU "We are honoured to receive a Crestron Integration Award with our first entry in to the awards (many more to follow!). We will continue to support Crestron on our new projects and really excited about integrating the new DigitalMedia and Sonnex audio system on our latest project." Alistair Ingram, ClearShpere "We are really pleased to win an award for this particular project. Restoration, rather than renovation, was the priority for this beautiful period Sussex Manor House, yet ClearSphere's brief demanded full Multiroom AV and Home Automation system with an emphasis on energy efficiency & security. We met this brief through using Crestron products." To get all the latest news, information and product updates subscribe to our RSS feed, "Like" us on Facebook and follow us on Twitter. # # # For 40 years Crestron has been the world's leading manufacturer of advanced control and automation systems, innovating technology and reinventing the way people live and work. Providing integrated solutions to control audio, video, lighting, computer, IP and environmental systems, Crestron streamlines technology, improving the quality of life for people in corporate conference rooms, hotels, classrooms, auditoriums, and in their homes. Crestron's leadership stems from its dedicated people who are committed to providing the best products, programs and services in the industry.
Sustanon is a product highly prized by sportsmen of high levels because it increases steadily throughout the day testosterone production which causes an increase of the force and the bodily mass. Sustanon 250 created by hi tech Pharmaceuticals is a supplement used by many athletes high levels to develop to the maximum muscle mass and strength. Through 11 this anabolic agents in its formula, Sustanon 250 is one of the preparations of the most sought after testosterone on the market. The first effects of the Sustanon appeared as early as the first day of use and they remain active for three to four weeks. A few days before the end of this period of time, the production of testosterone drop suddenly because of the active principle lack at this time. Benefits of Sustanon? Increased body mass and strength Provides firm and dense muscles Increases the natural production of testosterone Take 1 to 2 pills daily Sustanon is much appreciated by those users as it provides positive results very quickly. Its formula is composed of four different testosterones which on the basis of a well-balanced composition, create a synergy effect. Sustanon begins to act on the first day of the cure and the product remains active for approximately four weeks after taking. The most impressive with this product, it is that from the first day of treatment, the user can observe an increase in strength. High levels many athletes report feeling an incredible muscular abilities increase as soon as first of Sustanon . In addition to this dazzling performance this product, also offers these users an impressive capacity for recovery and regeneration and the peps need to push these limits in training! Sustanon 250 is an oral tablet containing four types of testosterone namely: testosterone propionate, testosterone decanoate, testosterone propionate phenyl and isocaproate testosterone. This mixture has been developed to obtain a result in a very short time. It recognizes to the Sustanon an anabolic effect, which is why athletes use it in order to increase their performance. However the trained Sustanon dysfunction hormone and leads also to water retention. This characteristic has Sustanon is beneficial to anyone who has problems of Gynecomastia and who are looking for a powerful anabolic effect of testosterone. To maintain a stable level of testosterone in the blood, should repeat the use each week. A new user must take fewer doses. While an athlete of high levels of course will need very high doses to achieve the desired effect. Sustanon 250 is a reliable and very powerful steroid. Athletes also run the risk of muscle tear by the dint of increasing doses. Complications of sustanon 250 The increase in blood pressure Risk of cardio vascular accidents A risk of hypocalciuria Renal disorders are also observed Crisis of epilepsy and headache Use of sustanon 250 The use of anabolic such of the sustanon 250, without sufficient knowledge of their effects on your body may cause health problems or may not display the best results that would be obtained if they would be used optimally. Hence the importance of respect for doses that are suitable for everyone. Buy Sustanon is approved for men testosterone deficiency in therapy. Your doctor may prescribe Sustanon 250 for other reasons. The drug was developed as a replacement therapy for hormone (TRH) in solution, and thought at the time that the different esters would be able to provide a constant release of testosterone monthly. Oil containing four types of testosterone has know: testosterone propionate, testosterone decanoate, testosterone propionate phenyl and isocaproate testosterone. This mixture has been developed with the aim of observing a result in a very short time. It recognizes at Sustanon 250 anabolic effect. This is why athletes use it in order to increase their performance. However the trained sutanon dysfunction hormone and leads also to water retention. This characteristic that Sustanon is beneficial for people who have problems of Gynecomastia and who are looking for a powerful anabolic effect of testosterone. To maintain a stable level of testosterone in the blood, should repeat taking this product each week. A new user must take fewer doses. While a top athlete will obviously require very high doses to achieve the desired effect. Sustanon 250 is a reliable steroid, but it is preferable to use an anti-estrogen to be totally safe. Side effects of sustanon deca? Increase in blood pressure Risk of heart problems A risk of hypocalciuria Disorders in the functioning of the kidneys Crisis of epilepsy or migraine Use of sustanon deca The use of anabolic products such as sustanon deca, without sufficient knowledge of their effects on your body may cause health problems or can result in average results compared with those obtained if these products had been used optimally. Where the importance of respect for doses that are suitable for everyone. Sustanon is approved for replacement therapy for fill the testosterone deficiency in men. The drug was developed as a replacement therapy for hormone (TRH) in solution, and it was thought at the time that the different esters would be able to provide a constant release of testosterone monthly. effet sustanon Potential clients who have a certain reluctance to sustanon are very numerous. Indeed they are afraid of the side effects that could have on health sustanon. It is true that in this area, most of the products always have side effects familiar to lovers of steroids. This fear of the consumer towards the side effects of sustanon is not valid according to these users. Indeed, those who tested were satisfied with the expected results, obtained. According to its manufacturers sustanon is a product 100% reliable and who would have no significant side effects. Effects a risk of the sustanon? Risk of tearing of muscles in cases of overdose A high risk of cardio vascular accidents Epileptiform seizures are observed in some patients Heart rhythm problems Complications in the secretion of hormones The fight against the side effects of the Sustanon There are many ways that allow to fight against these side effects of sustanon 250. Consumers can by examples opt for a healthy and balanced diet. This involves the consumption of raw vegetables namely plant products such as fruits. The benefits of a good diet are more a show. Sustanon is composed primarily of products used to increase body mass so some are sceptical about the negative effects that may have this product on their health. Indeed the secondary effects of the sustanon can be overcome by all those who benefit from good health. The sustanon is a steroid that causes the least amount of side effects. Even if the sustanon is not of significant side effects it is nevertheless necessary on the part of the consumer compliance with the dosage. Tag: sustanon 250, sustanon, sustanon 350, sustanon 250 cycle, sustanon 250 for sale, sustanon cycle, sustanon 300, sustanon 250 gains, test sustanon, testosterone sustanon, buy sustanon 250, sustanon side effects, sustanon 250 side effects, sustanon 250 reviews, sustanon steroid, sustanon results, sustanon 250 results, sustanon 400, sustanon 250 pills, organon sustanon 250, sustanon 250 dosage, sustanon 325, sustanon dosage, sustanon 270, sustanon 350 side effects, sustanon 250 before and after, sustanon testosterone, sustanon 500, sustanon half life, organon sustanon, buy sustanon, sustanon steroids, sustanon 250 price, sustanon for sale, sustanon only cycle, sustanon and deca cycle, deca sustanon cycle, sustanon deca cycle, sustanon and deca, where to buy sustanon 250, buy sustanon 250 online, sustanon 300 dosage, testosterone sustanon 350, side effects of sustanon, sustanon stack, steroid sustanon, buy sustanon 250 injection, sustanon 250 cycle for sale, sustanon pct, sustanon 250 stack, injectable sustanon 250 for sale, sustanon 450, sustanon 300 side effects, hi-tech pharmaceuticals sustanon 250, sustanon injection, testosterone sustanon 250, side effects of sustanon 250, sustanone, sustanon 250 organon, sustanon 250 hi tech, deca and sustanon cycle, sustanon flu
IoT Consumer Groups Merge News & Analysis 10/10/2016 2 comments The Open Connectivity Foundation and AllSeen Alliance will blend their open-source environments into a consumer alternative to Apple’s Homekit and Google’s Weave. For IoT, Silicon Labs Buys RTOS Vendor Micrium News & Analysis 10/3/2016 2 comments Silicon Labs announced Monday the acquisition of Micrium, a supplier of real-time operating system software. The move effectively positions Silicon Labs as the only IoT chip vendor offering multiprotocol wireless MCUs complete with an embedded RTOS. Persistent Memory Needs Apps News & Analysis 9/20/2016 6 comments A researcher from Hewlett Packard Enterprise called for apps that use persistent memory on servers although the chips are still more than a year away. Moto, HTC Top Android Report Blog 9/16/2016 Post a comment A new report shows HTC and Motorola are producing the best Android handsets in terms of OS update speeds and app crash rates, although Sony had the lowest overall crash rate. Beware Russia, it’s a bear when it comes to smartphone fragmentation. FCC: Get an App for that Video News & Analysis 9/9/2016 2 comments Pay-TV services would be required to provide free apps to access and search their video content under an FCC proposal aimed to open competition in digital media. Project Ara's Six Errors Blog 9/2/2016 6 comments What exactly failed in Project Ara? Was it the idea of an open hardware community, the very concept of a “modular” phone, or Google "not getting" smartphone users? 19 Views of Hot Chips Slideshow 8/26/2016 1 comment Machine learning, self-driving cars and novel sensors commanded significant attention at this year’s Hot Chips, reflecting a semiconductor industry moving fast in many directions. 19 Views of IDF16 Slideshow 8/19/2016 Post a comment This year’s Intel Developer Forum showed how the x86 giant is seeking ways to pump up and go beyond the PC with new platforms for machine vision, virtual reality, robots, drones and more. 14 Views from the Flash Summit Slideshow 8/12/2016 11 comments The Flash Memory Summit showed shifts NAND flash and other persistent memories including 3D XPoint are making in arrays, accelerators and solid-state drives. Startup Debuts Open Source SoCs News & Analysis 7/11/2016 2 comments Startup SiFive aims to use the open source RISC-V core as the heart of two SoC platforms, enabling a broader set of engineers to build custom processors. Apple Expands in AI, Smart Home News & Analysis 6/13/2016 9 comments Apple announced software upgrades for the iPhone/iPad, Macintosh, Apple TV and Apple Watch, expanding its reach in machine learning and the smart home. Accelerators Unite ARM, IBM, X86 News & Analysis 5/23/2016 2 comments Seven chip companies will define a cache-coherent interface between accelerators and server processors spanning ARM, IBM Power and x86 architectures. Google Designing AI Processors News & Analysis 5/18/2016 23 comments Google has developed and is running in its data centers a custom accelerator for artificial intelligence its calls a tensor processing unit. Flash Rides HPE’s Memory Bus News & Analysis 3/29/2016 2 comments Hewlett Packard Enterprise is shipping NVDIMM-N modules, the first in a new line of persistent memory cards analysts say will bolster servers. Apple v. Samsung: Supreme Decision Ahead News & Analysis 3/18/2016 6 comments Legal experts close to the Apple v. Samsung cases on patent infringement of the iPhone put widely varying results into a broader context of intellectual property law in software. Facebook Likes Intel's 3D XPoint Slideshow 3/10/2016 7 comments Facebook endorsed Intel’s 3D XPoint memories and got Google to join its Open Compute Project at its annual event that included new processors from Intel and networking code from Microsoft. Red Hat Drives FPGAs, ARM Servers News & Analysis 2/12/2016 3 comments Red Hat’s chief ARM architect is rallying FPGA makers to set a software standard for accelerators in between trying to get ARM servers ready for the market. LinkedIn Refines its Network News & Analysis 2/11/2016 4 comments Web giant LinkedIn has defined its own top-of-rack switch for its first mega data center and is studying use of alternative processors for a distributed point-of-presence network. Facebook Gears up for VR Blog 1/21/2016 1 comment Facebook announced today new software techniques for encoding and streaming video including video from 360-degree cameras and for virtual reality goggles. Clearly the Web giant wants to drive more rich content to its data centers, whether or not you think the Oculus Rift and its competitors will be big hits or belly flops this year. AMD’s ARM SoC Seeks Sockets News & Analysis 1/14/2016 1 comment AMD announced production availability for its first 64-bit ARM-based server processor, but it lacks customers and is not competitive with Intel’s Xeon. Samsung Preps $548M Check to Apple News & Analysis 12/4/2015 Post a comment Samsung said it its prepared to pay Apple $548 million in damages for violating iPhone patents but may ask for reimbursement pending appeals at the patent office and U.S. Supreme Court. HPE Melds Servers, Storage News & Analysis 12/1/2015 1 comment Hewlett Packard Enterprise announced Synergy, a server blade system with integrated software to ease the job of managing jobs across arrays of processors and hard and solid-state disks. IoT Groups Merge Efforts News & Analysis 11/23/2015 1 comment The Open Interconnect Consortium and the Universal Plug and Play Forum will combine efforts to gain heft in the battle to define the Internet of Things. Facebook Shifts Switch to 100G News & Analysis 11/19/2015 Post a comment Facebook announced it is designing a 100 Gbit/second top-of-rack switch for its next-generation data centers, reportedly using Broadcom’s Tomahawk chip. 11 Views of Hax Demo Day Slideshow 11/13/2015 1 comment Hax, the first of a crop of hardware startup accelerators, staged its seventh demo day, introducing a handful of new companies addressing the Internet of Things. What are the engineering and design challenges in creating successful IoT devices? These devices are usually small, resource-constrained electronics designed to sense, collect, send, and/or interpret data. Some of the devices need to be smart enough to act upon data in real time, 24/7. Specifically the guests will discuss sensors, security, and lessons from IoT deployments.
National Conference, Social Issues & the Environment, March 6- 8, 2001 Hello Community Gardeners, Why not consider a holiday gift to yourself that your whole community will benefit from? The National Arbor Day Foundation is offering a conference early next year that will inform and inspire you: Social Issues and the Environment: A Green Approach to Improving Our Communities, "How the care, distribution, and use of natural resources impact a community and its people" is scheduled for March 6 - 8, 2001 at the Lied Conference Center on the beautiful Arbor Day Farm in historic Nebraska City, Nebraska. (Conferees use the Center's shuttle from the Omaha airport.) The purpose of this national event is to bring together community leaders to share their experiences and to learn from one another. This type of synergy is a hallmark of Arbor Day Conferences. Presenters will look at how natural resources and the use of green space contribute to the success of communities. Key topics will include community gardens, improving open spaces, business district revitalization, youth projects, and their impact on societal concerns such as crime, economics, and public health. Situations from across the U.S. will be described along with programs designed to address them and show how these programs have led to positive results. A goal of the conference is to provide concepts and materials that are transferable to communities of all sizes. Ample opportunity will be provided for discussions with speakers and for participants to share information from their own community experiences. Community gardening expert, Dr. Pat Hynes of Boston University, will present "Nature In The Neighborhood: Community Gardens In The Inner City." Other presenters well known in the fields of social issues and the environment include Dr. Roger Ulrich, Texas A&M; Dr. Kathy Wolf, University of Washington; Dr. Jerry Schultz, University of Kansas; and Dr. Diane Zahm, Virginia Polytechnic Institute and State College. Additional speakers will present relevant research and case studies of their community programs. All the presenters will provide information and tools that will enhance your own efforts. If you are involved in your community or if you'd like the tools to become more influential in community decisions and actions regarding the environment and natural resources, please see our online brochure and registration information at www.arborday.org/socialissues. If you can pass this information along to others involved in community leadership as an elected official, municipal staff member, citizen organization leaders, educator or concerned citizen, please do. You may call The National Arbor Day Foundation's Conference Services staff at 402-474-5655 or toll-free, 888-448-7337. You can email them at email@example.com. Director of Conference Program Development The National Arbor Day Foundation 211 North 12th Street Lincoln, NE 68508 Phone 402-474-5655, Ext. 205 community_garden maillist - firstname.lastname@example.org
TWEAK (Tumor necrosis factor like WEAK inducer of apoptosis) is highly expressed by different immune cells and triggers multiple cellular responses, including control of angiogenesis. Our objective was to investigate its role in the human endometrium during the implantation window, using an ex-vivo endometrial microhistoculture model. Indeed, previous results suggested that basic TWEAK expression influences the IL-18 related uNK recruitment and local cytotoxicity. Endometrial biopsies were performed 7 to 9 days after the ovulation surge of women in monitored natural cycles. Biopsies were cut in micro-pieces and cultured on collagen sponge with appropriate medium. Morphology, functionality and cell death were analysed at different time of the culture. We used this ex vivo model to study mRNA expressions of NKp46 (a uNK cytotoxic receptor) and TGF-beta1 (protein which regulates uNK cytokine production) after adjunction of excess of recombinant IL-18 and either recombinant TWEAK or its antibody. NKp46 protein expression was also detailed by immunohistochemistry in selected patients with high basic mRNA level of IL-18 and either low or high mRNA level of TWEAK. The NKp46 immunostaining was stronger in patients with an IL-18 over-expression and a low TWEAK expression, when compared with patients with both IL-18 and TWEAK high expressions. We did not observe any difference for TWEAK expression when recombinant protein IL-18 or its antibody was added, or conversely, for IL-18 expression when TWEAK or its antibody was added in the culture medium. In a pro-inflammatory environment (obtained by an excess of IL-18), inhibition of TWEAK was able to increase significantly NKp46 and TGF-beta1 mRNA expressions. TWEAK doesn't act on IL-18 expression but seems to control IL-18 related cytotoxicity on uNK cells when IL-18 is over-expressed. Thus, TWEAK appears as a crucial physiological modulator to prevent endometrial uNK cytotoxicity in human. Citation: Petitbarat M, Rahmati M, Sérazin V, Dubanchet S, Morvan C, Wainer R, et al. (2011) TWEAK Appears as a Modulator of Endometrial IL-18 Related Cytotoxic Activity of Uterine Natural Killers. PLoS ONE 6(1): e14497. doi:10.1371/journal.pone.0014497 Editor: Joseph El Khoury, Massachusetts General Hospital and Harvard Medical School, United States of America Received: July 19, 2010; Accepted: November 8, 2010; Published: January 7, 2011 Copyright: © 2011 Petitbarat et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by University Paris XI and Inserm Research Institute. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. The endometrium is remodelled throughout the menstrual cycle and exhibits only a short period of receptivity, known as the ‘implantation window’, which is crucial both for implantation and gestation and still remains poorly explored in routine reproductive medicine. Endometrium becomes receptive to blastocyst implantation 6 to 8 days after ovulation and remains receptive for 4 days (cycle days 20–24) . Such differentiation of the maternal compartment, under hormonal control, is essential to allow stromal cells to acquire the unique ability to regulate trophoblast invasion, to resist inflammatory and oxidative insults, and to dampen local maternal immune response. In humans, decidualization of the stromal compartment occurs in the mid-luteal phase of the menstrual cycle, independently of pregnancy, in contrast to most of animal models. This raises the possibility that biochemical analysis of timed endometrial biopsy samples taken in a nonconception cycle could be informative of subsequent pregnancy outcome . It has been proposed that uterine natural killer cells (uNK) could exert, directly or not, a positive or negative control of the early steps of implantation , . These cells can secrete and control an array of cytokines which are important in angiogenesis, placental development and in pregnancy establishment. A dysregulation of these cytokines could be in part responsible of embryo implantation failures. In previous studies, we reported that IL-15 and IL-18 expressions were significantly different in patients who failed to implant when compared with fertile control individuals . We also observed that IL-15 and IL-18 expressions were correlated with the local uNK (CD56+) recruitment and subendometrial angiogenesis as reflected by the vascular flow index quantified by 3-D ultrasound with angiography . TWEAK (Tumor necrosis factor like WEAK inducer of apoptosis) is a transmembrane protein, which can be cleaved to function as a soluble cytokine . It's highly expressed by immune cells type (monocytes, dendritic cells, natural killers cells…) and many tissues . First described as a weak apoptosis inducer, TWEAK triggers multiple cellular responses ranging from proliferation to cell death, including control of angiogenesis , , . TWEAK has also been described as a partner to TNF (Tumor Necrosis Factor) playing a « Yin and Yang » function in immunity . We recently reported that TWEAK and IL-18 mRNA expression were correlated in patients with implantation failures . Therefore we investigated whether TWEAK regulates IL-18 expression or at the opposite if IL-18 acts on TWEAK expression. TWEAK mRNA and protein expression does not show variations through the menstrual cycle. However its basal level of expression influence the IL-18 related uNK recruitment and local cytotoxicity. Indeed, IL-18 is a bivalent cytokine which can promote local angiogenesis and immunotrophism at appropriate dose but conversely promote a cytotoxic and thus deleterious commitment of uNK cells if present in excess . Such documentation appears to be essential to define the state of uterine receptivity. Endometrial dispersed cells cannot be used to document the in vivo environment since this technique does not maintain the interactions between epithelial cells, stromal cells, endothelials cells and immune cells (uterine natural killer cells, T regulatory cells and dendritic cells). The development of a human ex vivo model in which the complexicity of endometrium is preserved as well as its functionality is an absolute requirement. In order to study stromal-epithelial interactions in the human endometrium, many authors elaborated culture conditions recombining separated stromal and epithelial cells in different extracellular matrices , , , . In such models, epithelial cells have been cultivated as monolayers on top of matrigel and stromal cells beneath them on plastic or embedded in collagen or Matrigel. Other methods were described using polycarbonate or nitrocellulose culture of tissue insert , and demonstrated human epithelial and stromal cells were viable during 1 to 5 days. In all these models, cells viability was demonstrated but neither of them appears fully appropriate to study the expression and production of cytokines or growth factors in endometrial cells as well as to mimick the complexicity of their interactions with immune and endothelials cells. We thus decided to develop a model of endometrial microhistoculture, adapted from the one elaborated by Menu et al for the placenta, in which the complex interactions between epithelial, stromal and immune cells were preserved and the viability and responsiveness of the cells are verified. Using this model, we investigated whether TWEAK influences the activities of uNK cells by a modification of IL-18 expression or function. Validation of microhistoculture model Cells morphology: The main problem we encountered with endometrium in vitro histoculture was to maintain differentiated cells and avoid they become fibroblastic. We analysed the endometrium structure as well as the morphology of cells by immunohistochemistry using two different antibodies: vimentin (endothelial cells staining) and KL1 cytokeratin (epithelial cells staining). We compared the morphology at different days of culture with or without estradiol and progesterone addition (50 nmol/l) and with or without use of collagen sponge (Figure 1). Revealed by immunohistochemistry with cytokeratin (KL1) and vimentin antibodies (x 6,6). A–B: before culture, C–D: after 2 days of culture without hormones and without sponge, E–F: after 2 days of culture without hormones and with sponge, G–H: after 2 days of culture with hormones (50 nmol/l estradiol +50 nmol/l progesterone) and without sponge, I–J: after 2 days of culture with hormones (50 nmol estradiol +50 nmol progesterone) and with sponge. In culture without sponge use, stromal cells are flat and elongated (Figure 1C and D) compared to those cultured with sponge which remained rounded (Figure 1E and F). But in both case epithelial cells are dispersed. Cells cultured with estradiol and progesterone (Figure 1G–J) displayed a well preserved morphology, where epithelial cells maintain their polarisation. We realised the same experience using endometrium biopsies from proliferative phase and observed the same results (data not shown). Thus, to conserve their morphology endometrial cells must be cultured on collagen sponge with hormones addition in medium. Cells death: Cells viability was evaluated by immunohistochemistry using Annexin V Fluos, an antibody coupled to FITC (Figure 2). The Annexin V assay provides effective method to detect apoptosis at a very early stage. After the induction of apoptosis phosphatidylserine is translocated from the inner (cytoplasmic) leaflet of the membrane to the outer (cell surface) leaflet, phosphatidylserine on the outer leaflet is available to bind labeled Annexin V, providing the basis for a simple staining assay. A–D: after 2 days of culture, E–H: after 5 days of culture. A,E: without sponge and without hormones, B,F: without sponge and with hormones (50 nmol/l estradiol +50 nmol/l progesterone), C,G: with sponge and without hormones D,H: with sponge and with hormones (50 nmol/l estradiol +50 nmol/l progesterone). After two days of culture we only observed Annexin V staining on cells growing without collagen sponge matrix (Figure 2A and B) compared to those culture with Gelfoam sponge (Figure 2C and D). After five days, all cells cultured with or without sponge are labeled (Figure 2E–H). Besides, after five days of culture without sponge cells appeared elongated and fibroblastic whereas cells growing with collagen sponge matrix are round. We didn't observe any difference on cells viability when we added estradiol and progesterone in culture medium. Cells functionality: We assay in supernatants, by Luminex Technology, after 2 and 3 days of culture 8 cytokines and growth factors: interleukine 1β (IL-1b), interleukine 1 receptorα (IL-1Ra), granulocyte colony stimulating factor (G-CSF), interferon inducible protein-10 kilodaltons (IP-10), monocyte chemoattractant protein 1 (MCP-1), macrophage inflammatory protein 1β (MIP1b), platelet-derived growth factor β (PDGFb) and regulated on activation of normal T cell expressed and secreted (RANTES). These molecules were chosen as « markers » of endometrial activity cells because their expression were different between flushing with endometrial cells and flushing with no cells (data not shown). We previously observed that addition of estradiol and progesterone are suitable to maintain a well preserve structure of epithelial cells. Our objective was to validate a model to study expression or production of bio-molecules. So it was important to determine whether estradiol and progesterone supplementation influence cytokines or growth factors production. We realised eight different conditions using 3 estradiol or progesterone concentrations (50 nmol/l, 100 nmol/l, 200 nmol/l) and a control condition without hormone. Cytokines and growth factors production was assayed after 2 and 3 days of culture. Because the cellular mass from endometrium sampling could not be standardised, cytokine/growth factor production by day could not be compared between individuals. So we chose to express our results by the ratio day 3/day 2 cytokines production. This ratio was measured by patients for each cytokine and each hormonal concentration compared to control (without hormones). No significant variation of cytokines and growth factors production was observed according to distinct concentrations of estradiol or progesterone or their comparison to control condition. Figure 3 represents the cytokine/growth factor production for minimal concentration of estradiol and progesterone (50 nmol/l) for each patient. The culture medium was supplemented with 50 nmol/l of estradiol and progesterone. Proteins levels were measured on days 2 and 3. The graph represents for each protein the ratio of day 3 measure on day 2 measure, reported to the control condition. The control condition had no hormone addition. IL-1b and IL-Ra for patient 2 and PDGF for patient 5 were not detectable. Role and regulation of TWEAK in endometrial cells A minimal concentration (50 nmol/l) of estradiol and progesterone was added in each culture condition for all the experiments. Role of TWEAK on the uNK cytotoxic receptor NKp46. We compared the presence of the uNK cytotoxic receptor, NKp46, in patients with an IL-18 over-expression (if compared to the one observed in fertile patients) and either a low or high mRNA TWEAK expression. The NKp46 protein was mainly detectable in the luminal and glandular epithelium and within the stroma around the spiral arteries. The NKp46 immunostaining was stronger in patients with IL-18 over-expression and simultaneously a low TWEAK expression (Figure 4A) if compared with patients with IL-18 and TWEAK over-expression (Figure 4B). No variation in staining localisation was observed. Presence of TWEAK seems to control the potential cytotoxic role of IL-18 on uNK cells, in case of over-expression. Patients with an overexpression of IL-18 and with low (A) or high level of TWEAK (B). Magnification is 20X (first column) and 40X (second column). ep: epithelium, s: stroma, gl: glands, sa: spiral arteries. Does TWEAK regulate IL-18 or the opposite? We compared the expression of TWEAK and IL-18 under different stimulation to determine if TWEAK regulate IL-18 expression or be regulated by this cytokine. Stimulation of recombinant protein IL-18 or its antibody in the culture medium did not influence subsequent TWEAK expression if compared to the control condition. Only addition of ethanolate as known inhibitor of the Map Kinase pathway induced a significant TWEAK mRNA decrease (p = 0.01) (Figure 5A). Likewise, there was no variation of IL-18 expression after 24 h of stimulation with recombinant TWEAK or its antibody in the culture supernatant. As for TWEAK, only addition of ethanolate produced an important IL-18 mRNA decrease (p = 0.07) (Figure 5B). From endometrial microhistoculture in 9 patients. The control medium was only supplemented with 50 nmol/l of hormones (estradiol and progesterone). Ethanolate was added to the medium as an inhibitor of Map Kinase pathway. Estradiol and progesterone were added in all media. TWEAK expression is not regulated by IL-18 and IL-18 has no effect on TWEAK mRNA. These results highlighted TWEAK and IL-18 expression are independent one from the other in human endometrium but are both regulated via a Map Kinase pathway. TWEAK and uNK cells. In order to verify whether TWEAK could counterbalance IL-18 cytotoxic effect on uNK cells, we quantified, in different culture conditions, the expression of two proteins: NKp46, which mediates uNK cells cytotoxic effects and TGF-β1 (Transforming Growth Factor–β) which promote the angiogenic effect of uNK cells. We added in culture media an excess of IL-18 recombinant protein to create an endometrial pro-inflammatory environment in all culture conditions. Excess of recombinant TWEAK protein or its antibody was introduced in the medium too, in the aim to modify IL-18 effects. Addition of TWEAK in the culture medium had no effect on NKp46 or on TGF-β1 expression when compared to the IL-18 basal over-expressed condition. However, in TWEAK antibody supplemented culture medium, we observed a significant increase of both NKp46 (Figure 6A) and TGF-β1expression (Figure 6B). Only an imbalance between IL-18 and TWEAK production has an impact on the two protein expressions. We demonstrated, using a collagen sponge gel support with hormonal substitution, that the endometrial cells are viable during four days, do not dedifferentiated and are able to produce endometrial “markers”. Indeed, the cells conserved their morphology and functionality even with a minimal hormone concentration. Our model was very simple to use and we maintained interaction between the different cellular types (epithelial, stromal, endothelial and immunological cells). It seems to be a good system to study the production or expression of cytokines and growth factors during the window implantation in women. With this model we show that IL-18 and TWEAK expression in endometrium are independent one from the other but share the same way of regulation, the Map Kinase pathway. However, as previously suggested, we confirmed that TWEAK acts on the uNK cells cytotoxicity, induced by IL-18 over-expression, by modifying one of the uNK cells cytotoxic receptor expression, NKp46. The comprehensive functions of uNK cells still remain unclear. The two possibilities that are currently under investigation are that uNK cells influence maternal mucosal and arterial function and/or placental trophoblast invasion . This assumption is further supported by the high levels of angiogenic growth factor (Vascular Endothelial Growth Factor C, Placental Growth Factor, Angiopoietin-1 and 2, Transforming Growth Factor -β) secreted by uNK cells from both non-pregnant endometrium and early decidua . In human, Laird et al observed an increased density of CD56bright (uNK cells) in mid luteal phase endometrium in women suffering from recurrent implantation failures compared with fertile controls but did not evaluate either their cytotoxic potential or cytokines content. As we previously reported that high IL-18/TWEAK endometrial mRNA expression correlated with a significant increase of uNK cells recruitment, we investigated the role of these two cytokines on uNK cells cytotoxicity. Manaster et al, reported that both proliferative and secretory phase uNK cells express NKp46 and NKG2D, but do not express NKp44 and NKp30, at the opposite of NK cells from decidua which express high levels of NKp30, NKp44 and NKG2D . We then decided to choose NKp46 as target to evaluate cytotoxicity of uNK cells in endometrium. Our immunohistochemistry and PCR results show that TWEAK doesn't act on IL-18 expression, but seems to control IL-18 related cytotoxicity on uNK cells when IL-18 is over-expressed. Thus, TWEAK appears as a modulator to avoid endometrial uNK cytotoxicity induced by IL-18 over-expression. Besides we reported that TWEAK also influence TGF-β1 cytokine production, The biology of the TGF-β family is complex and the various roles attributed to TGF-β in the uterus are still unclear. Our results revealed that when IL-18 is over-expressed and TWEAK is inhibited by a specific neutralising antibody, an increase of TGF-β1 is observed. We postulated that the observed TGF-β1 increase could reflect a retro-control loop; as TWEAK could not protect anymore endometrial cells from inflammation, others proteins with anti-inflammatory effect will be produced, like TGF-β. Eriksson et al recently reports that endometrial production of TGF-β regulate uNK cell proliferation but also cytokine production and in particular the IFN-γ production . The combined endometrial IL-18 over-expression with a TWEAK inhibition increase cytotoxic receptors of uNK cells which produce massively pro-inflammatory cytokines like IFNγ. Local TGF-β are produced to counterbalance the cytotoxic activities. In summary, the present study presents IL-18 and TWEAK as two independent proteins possibly acting in synergy to maintain the angiogenic/cytotoxic balance related to uNK cells. Such data should be controlled on larger number of patients. Taken together, these results strengthen the idea that IL-18 on TWEAK mRNA expression should be evaluated as functional biomarkers of an adequate/inadequate uterine receptivity in order to detail the mechanisms of failures. Material and Methods All patients provided informed consent and this investigation was approved by our Institutional Review Board (CCPPRB). 30 women were enrolled in this protocol, 21 were Caucasian, 6 were from North of Africa and 3 from Africa. All subjects were involved in the Assisted Reproductive Technology program for investigations related to their infertility: 13 women experienced unexplained recurrent spontaneous abortion and 17 repeated and unexplained implantation failure following in vitro fertilization (IVF). They have no other remarkable pathological profile. 6 patients in this group had given birth to healthy infants. The inclusion criteria included a normal hormonal reserve (FSH<10 mIU/ml) and patients were less than 38 years old (with a mean of 34,54). 8 patients were included to document NKp46 immunostaining: all patients had a high IL-18 mRNA expression and either a low (4 patients) or a high (4 patients) TWEAK expression. 22 other patients were included for the microhistoculture experiment. Individual analysis of each endometrial immune environment was detailed as previously described and showed either a normal local uNK recruitment and activity or a cytokine–related uNK depletion. None had a pro-inflammatory profile before the microhistoculture in this group. Prior the endometrial biopsy, a systematic endometrial ultrasonic examination was performed to record the endometrial volume, exclude any intra-uterine abnormality of the uterine cavity and document the overall uterine vascularisation. As previously described , , a single operator (N.L.) employed an automated 5–9 MHz transvaginal three-dimensional transducer (Voluson 730 expert, GE Medical System, France) to acquire power Doppler information from the uterus using identical settings and technique in all cases as follows: tissue harmonic imaging, mild; pulse repetition frequency, 0.6 khz; wall motion filter, low; gain, −7.8; high quality, rise 0.2. The volumetric and vascular measurements were undertaken using the Virtual Organ Computer-aided AnaLysis (VOCAL™, GE Kretz) imaging 4-D VIEW program with the 15° rotation step. This allows the user to define the volume of interest manually and applies a shell of variable thickness that parallels the originally defined surface contour, thus allowing delineation of the myometrial-endometrial border. Intensity and quantity of the power signal was defined in the sub-endometrial volume (endometrial volume +5 mm from the border). Endometrial biopsies were performed (without anesthesia) during a monitored natural cycle 7 to 9 days after the ovulation surge (LH) identified by serial blood tests. Biopsies were performed with a standard Cornier pipelle (CCD Laboratories, Paris, France). This method collects material from the superficial layer and not the basal one, minimizing variations due to sampling from different depths. One portion of the sample was embedded in paraffin for immunostaining, another one was immediately placed in a tube with RPMI 1640 Glutamax medium at 4°C for endometrium histoculture. The last portion transferred into RNA Stabilization Solution (RNA Later, QIAGEN, Courtaboueuf, France) was used to quantify the basal level of TWEAK and IL-18 in fresh endometrium by real time PCR. 5 to 9 patients were included in each experiment and each patient was her own control. The experiments were performed in triplicate. During the 2–3 hours following collection, endometrium biopsies were washed with RPMI 1640 medium. Collagen sponge gels (1.5 cm2, Gelfoam®, Pharmacia Upjohn, Kalamazoo, MI, USA) were placed into the wells of 12-well plates containing 1,5 ml per well of RPMI 1640 Glutamax medium supplemented with 15% heat-inactivated fetal calf serum (FBS), 1% penicillin–streptomycin, 1% non-essential amino acids, 1% sodium pyruvate (Gibco BRL, Life Technologies, France). Endometrium were cut into 1–2 mm blocks and placed on top of the collagen sponge gels at the interface between the medium and the air (3 blocks per collagen sponge and per well). To validate the micro-histoculture model, four different conditions were realised with or without collagen sponge gel and with or without 50 nmol/l of β-estradiol and progesterone (Sigma, France). Estradiol and progesterone were added to the medium every day. Micro-histocultures were maintained at 37°C (5% CO2). For the experiments, we used the collagen sponge gel with 50 nmol/l of β-estradiol and progesterone. Antibodies, recombinant protein or inhibitors were added to the medium after 24 hours of culture. Biopsies pieces were collected after 24 hours of incubation with the recombinant proteins, antibodies or inhibitors and transferred into RNA Stabilization Solution (RNA Later, QIAGEN, Courtaboueuf, France) to be stored at −80°C. The RNA extraction was performed several days later. Recombinant human TWEAK (75 ng/ml), anti-human TWEAK antibody (400 ng/ml), recombinant human IL-18 (100 ng/ml) and anti-human IL-18 antibody (900 ng/ml) were from R&D sytems (Lille, France). Ethanolate (5 µmol/l), an inhibitor of MAP Kinase pathway was purchased from Sigma (St Quentin-Fallavier, France). Evaluation of cell death The other part of micro-explants was placed into a well of 24 well plates with 1 ml of collagenase IV (1 mg/ml, Laboratoires Eurobio, Courtaboeuf, France) during 2 hours at 37°C. The dissociated cells were washed with PBS and incubated in a buffer containing 500 µl Hepes and 10 µl Annexin V-Fluos (Roche Diagnostics, Meylan, France) during 10 min at 37°C in darkness. Cells were rinsed with Hepes and observed under a fluorescence microscope. Dapi (4′,6-diamidine-2-phenyl indole) was used to stain nuclear cells (CML, Nemours, France). This experiment was realised using endometrial samples from 5 different patients. The culture medium was collected and fresh medium was added on days 2 and 3. Medium was frozen at -20°C until assay by the Luminex Technology (Bio-Rad®). This technology was used to simultaneously read concentrations of IL-1β, IL-1RA, G-CSF, PDGF, IP-10, MCP-1, MIP-1β and RANTES.The assay was performed according to the manufacturer's instructions. Total RNA extraction and reverse transcription Endometrial fresh biopsy and micro-explants were disrupted in the lysis buffer of a RNeasy kit (QIAGEN, Courtabeuf, France) using an Ultra Turrax T15 (IKA-WERKE). Total RNA was extracted using the RNeasy kit according to the manufacturer's instructions. Additional DNase digestion was performed during the extraction process (RNase-free DNase set, QIAGEN, Courtabeuf, France).RNA was stored at −80°C until use. Total RNA (1 µg) was reversed transcripted into cDNA using random primers and Superscript III (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Controls without reverse transcriptase were systematically performed to detect genomic DNA contamination. The cDNAs were stored at −20°C until use. Real Time PCR Specific primer for TWEAK , IL-18 , TGF-β1 and Ribosomal protein L13A (RPL13A) were previously published. Primers used for NKp46 (NKp46-s: gactagagagcgagccagca and NKp46-as: aagagtctgtgtgttcagccttc) were designed using the Universal Probe Library Assay Design Center (www.roche-applied-science.com) and sequences were searched against GenBank sequences with the BLAST program to ensure the specificity of primers. Real-time PCR was carried out using a LightCycler 480 apparatus (Roche, Meylan, France). Reactions were set up using the following final concentrations: 0.5 µM of sense and antisens primers, 1X 480 SYBER Green master mix and 4 µl of 1/20 diluted cDNA. Cycling conditions were as follows: denaturation (95°C for 5 min), amplification and quantitation (95°C for 10 s, 60°C for 10 s and 72°C for 15 s) repeated 40 times, a melting curve program (65–95°C with a ramp rate of 2,2°C/s) and a cooling step to 4°C. In addition to the no-reverse transcription and no-template controls, an independently inter-run calibrator (IRC) was included in each RT-PCR assay. This IRC was obtained from Blast-cells for TWEAK, TGF-β and NKp46 and from placenta for IL-18, RPL-13. In each assay, an aliquot of the IRC cDNA was 20 times diluted and was submitted to the qPCR protocol as the unknown samples. PCR efficiencies for each quantified target and reference were calculated using known serial dilutions of each specific cDNA. Data were analysed using the LightCycler®480 Software release 1.5.0. Each specific target transcription level was normalized to the geometric mean of the transcription levels of the reference gene, using the Advanced Relative Quantification of the LightCycler®480 Software. Each gene specific amplification efficiency was specified. For each sample, results were expressed in concentration ratio (target/reference mRNAs). Micro-explants (on days 1 and 5) were fixed in 4% buffered formaldehyde (96% Phosphate Buffer Saline or PBS) overnight at 4°C. They were washed with PBS, dehydrated in alcohol (70%, 95% and 100% ethanol) before being embedded in paraffin. Paraffin sections (5 µm thick on Superfrost glass slides) were deparaffined in histolemon and re-hydrated with alcohol. Endogenous peroxydases and biotin activities were inhibited by incubation of the slides in a specific solution (Peroxydase Blocking solution, DAKO, Trappes, France and Avidin/Biotin Blocking Vector kit, Abcys, Paris, France) or by incubation with 0.3% hydrogen peroxide. Protein blocking was achieved by a 20 min incubation in PBS (Phosphate Buffer Saline) with 1% of horse serum and 5% human normal serum (blocking serum). ✓ Morphological evaluation: Cytokeratin staining was made using mouse anti-human cytokeratin pan KL1, dilution 1/40 (Clinisciences, Montrouge, France) and vimentin staining by using mouse anti-human vimentin V9, dilution 1/200 (Biogenex, France). KL1and vimentin immunostaining detection was performed using the appropriated secondary antibody from kit Vectastain (Vector ABC, Abcys, Paris, France) revealed with 3,3′ diaminobenzidine (DAB, DAKO, Trappes, France). ✓ NKp46 experiments: Physiological ranges of IL-18 and TWEAK mRNA expression have been previously established in control fertile women . Briefly, TWEAK and IL-18 expression were normalised using geometric mean of three validated references genes (for the endometrium). We then calculated the mean (+/− SEM) of these ratio in our fertile patient group allowing us to obtain the normal range both for IL-18 (3.8 to 6) and TWEAK (4.2–6.5) mRNa expressions. We retrospectively selected endometrial samples with a high IL-18 mRNA expression (over 6.17) and low (below 4.1) or high TWEAK (over 6.86) mRNA expression to compare their NKp46 and TGF-β protein expression. NKp46 staining was made using a polyclonal goat antihuman NKp46 antibody, concentration 4 µg/ml, (R&D Systems, Lille, France). Between each steps the slides were rinsed three times with PBS. NKp46 immunostaining detection was performed using the appropriated secondary antibody from kit Vectatstain (Vector ABC, Abcys, Paris, France) for 20 min followed by incubation with a peroxydase-conjugated streptavidin for 30 minutes and then by use of substrate buffer supplemented with liquid DAB and hydrogen peroxide substrate solution (DAKO, Trappes, France). Counterstaining was performed with hematoxylin and slides were mounted with Eukitt medium for light microscopy observation. Negative controls were performed both by omission of the primary antibody and by its replacement by an appropriate isotype control. All slides were analysed with a fully automatic virtual slide scanner (DotSlide BX micoscope, Olympus, Hamburg, Germany). Wilcoxon test was used to compare production of cytokines and growth factors (in different conditions of hormones concentration) and TWEAK, IL-18, NKp46 and TGF-β1 mRNA expression in each culture conditions. The statistical assessments were performed using the StatView software (Abacus Concepts, Inc., CA, USA). Significance was set up at p≤0. 05. We thank Dr Salama Samuel, Dr Charbel Harb Dr Antoine Torre and Dr Inchirah Neiffer from CHI Poissy-Saint Germain-en-Laye for the recruitment of patients and the endometrial biopsies. We thanks Dr Anne Louboutin and all the technicians, from the anatomopathology division of the CHI-Poissy-Saint Germain-en-Laye, for the preparation of the slides. Conceived and designed the experiments: MP VS RW PdM GC JMF C. Munaut NL. Performed the experiments: MP MR SD C. Morvan C. Munaut. Analyzed the data: MP MR VS GC C. Munaut NL. Contributed reagents/materials/analysis tools: MP SD C. Munaut. Wrote the paper: MP. - 1. Bergh PA, Navot D (1992) The impact of embryonic development and endometrial maturity on the timing of implantation. Fertil Steril 58: 537–542. - 2. Gellersen B, Brosens IA, Brosens JJ (2007) Decidualization of the human endometrium: mechanisms, functions, and clinical perspectives. Semin Reprod Med 25: 445–453. - 3. Loke YW, King A (1996) Evolution of the fetal-maternal immunological relationship. Am J Reprod Immunol 35: 256–257. - 4. Croy BA, Guimond MJ, Luross J, Hahnel A, Wang B, et al. (1997) Uterine natural killer cells do not require interleukin-2 for their differentiation or maturation. Am J Reprod Immunol 37: 463–470. - 5. Ledee-Bataille N, Bonnet-Chea K, Hosny G, Dubanchet S, Frydman R, et al. (2005) Role of the endometrial tripod interleukin-18, -15, and -12 in inadequate uterine receptivity in patients with a history of repeated in vitro fertilization-embryo transfer failure. Fertil Steril 83: 598–605. - 6. Ledee N, Chaouat G, Serazin V, Lombroso R, Dubanchet S, et al. (2008) Endometrial vascularity by three-dimensional power Doppler ultrasound and cytokines: a complementary approach to assess uterine receptivity. J Reprod Immunol 77: 57–62. - 7. Locksley RM, Killeen N, Lenardo MJ (2001) The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104: 487–501. - 8. Chicheportiche Y, Bourdon PR, Xu H, Hsu YM, Scott H, et al. (1997) TWEAK, a new secreted ligand in the tumor necrosis factor family that weakly induces apoptosis. J Biol Chem 272: 32401–32410. - 9. Burkly LC, Michaelson JS, Hahm K, Jakubowski A, Zheng TS (2007) TWEAKing tissue remodeling by a multifunctional cytokine: role of TWEAK/Fn14 pathway in health and disease. Cytokine 40: 1–16. - 10. Lynch CN, Wang YC, Lund JK, Chen YW, Leal JA, et al. (1999) TWEAK induces angiogenesis and proliferation of endothelial cells. J Biol Chem 274: 8455–8459. - 11. Wiley SR, Winkles JA (2003) TWEAK, a member of the TNF superfamily, is a multifunctional cytokine that binds the TWEAKR/Fn14 receptor. Cytokine Growth Factor Rev 14: 241–249. - 12. Winkles JA (2008) The TWEAK-Fn14 cytokine-receptor axis: discovery, biology and therapeutic targeting. Nat Rev Drug Discov 7: 411–425. - 13. Bell E (2006) TWEAK and TNF: Yin and Yang in innate immunity. Nature Reviews Immunology 6: 91–91. - 14. Petitbarat M, Serazin V, Dubanchet S, Wayner R, Mazancourt PD, et al. (2009) Tumor necrosis factor-like weak inducer of apoptosis (TWEAK)/fibroblast growth factor inducible-14 might regulate the effects of interleukin 18 and 15 in the human endometrium. Fertil Steril. - 15. Bentin-Ley U, Pedersen B, Lindenberg S, Larsen JF, Hamberger L, et al. (1994) Isolation and culture of human endometrial cells in a three-dimensional culture system. J Reprod Fertil 101: 327–332. - 16. Arnold JT, Kaufman DG, Seppala M, Lessey BA (2001) Endometrial stromal cells regulate epithelial cell growth in vitro: a new co-culture model. Hum Reprod 16: 836–845. - 17. Pierro E, Minici F, Alesiani O, Miceli F, Proto C, et al. (2001) Stromal-epithelial interactions modulate estrogen responsiveness in normal human endometrium. Biol Reprod 64: 831–838. - 18. Blauer M, Heinonen PK, Martikainen PM, Tomas E, Ylikomi T (2005) A novel organotypic culture model for normal human endometrium: regulation of epithelial cell proliferation by estradiol and medroxyprogesterone acetate. Hum Reprod 20: 864–871. - 19. Osteen KG, Rodgers WH, Gaire M, Hargrove JT, Gorstein F, et al. (1994) Stromal-epithelial interaction mediates steroidal regulation of metalloproteinase expression in human endometrium. Proc Natl Acad Sci U S A 91: 10129–10133. - 20. Dudley DJ, Hatasaka HH, Branch DW, Hammond E, Mitchell MD (1992) A human endometrial explant system: validation and potential applications. Am J Obstet Gynecol 167: 1774–1780. - 21. Faye A, Pornprasert S, Dolcini G, Ave P, Taieb J, et al. (2005) Evaluation of the placental environment with a new in vitro model of histocultures of early and term placentae: determination of cytokine and chemokine expression profiles. Placenta 26: 262–267. - 22. Croy BA, He H, Esadeg S, Wei Q, McCartney D, et al. (2003) Uterine natural killer cells: insights into their cellular and molecular biology from mouse modelling. Reproduction 126: 149–160. - 23. Ain R, Canham LN, Soares MJ (2003) Gestation stage-dependent intrauterine trophoblast cell invasion in the rat and mouse: novel endocrine phenotype and regulation. Dev Biol 260: 176–190. - 24. Lash GE, Schiessl B, Kirkley M, Innes BA, Cooper A, et al. (2006) Expression of angiogenic growth factors by uterine natural killer cells during early pregnancy. J Leukoc Biol 80: 572–580. - 25. Laird SM, Tuckerman E, Prakash A, Ledger W, Li TC (2005) Endometrial CD56(+) cells and implantation failure after IVF. Placenta 26: A26–A26. - 26. Manaster I, Mizrahi S, Goldman-Wohl D, Sela HY, Stern-Ginossar N, et al. (2008) Endometrial NK cells are special immature cells that await pregnancy. J Immunol 181: 1869–1876. - 27. Eriksson M, Meadows SK, Wira CR, Sentman CL (2004) Unique phenotype of human uterine NK cells and their regulation by endogenous TGF-beta. J Leukoc Biol 76: 667–675. - 28. Petitbarat M, Serazin V, Dubanchet S, Wayner R, de Mazancourt P, et al. Tumor necrosis factor-like weak inducer of apoptosis (TWEAK)/fibroblast growth factor inducible-14 might regulate the effects of interleukin 18 and 15 in the human endometrium. Fertil Steril 94: 1141–1143. - 29. Krussel JS, Casan EM, Raga F, Hirchenhain J, Wen Y, et al. (1999) Expression of mRNA for vascular endothelial growth factor transmembraneous receptors Flt1 and KDR, and the soluble receptor sflt in cycling human endometrium. Mol Hum Reprod 5: 452–458. - 30. Raine-Fenning NJ, Campbell BK, Kendall NR, Clewes JS, Johnson IR (2004) Endometrial and subendometrial perfusion are impaired in women with unexplained subfertility. Hum Reprod 19: 2605–2614. - 31. Raine-Fenning NJ, Campbell BK, Kendall NR, Clewes JS, Johnson IR (2004) Quantifying the changes in endometrial vascularity throughout the normal menstrual cycle with three-dimensional power Doppler angiography. Hum Reprod 19: 330–338. - 32. Phillips TA, Ni J, Hunt JS (2001) Death-inducing tumour necrosis factor (TNF) superfamily ligands and receptors are transcribed in human placentae, cytotrophoblasts, placental macrophages and placental cell lines. Placenta 22: 663–672. - 33. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, et al. (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3: RESEARCH0034.
WASHINGTON (CBS.MW)-- Federal antitrust regulators signed off on Exxon's $81 billion acquisition of Mobil Tuesday, ending nearly a year of negotiations that saw the companies agree to give up nearly 15 percent of their retail gas stations and other properties. The Federal Trade Commission voted 4-0 in a closed meeting to approve a consent decree that will clear the way for the merger to proceed. Recently appointed commission member Thomas B. Leary recused himself from the matter. The FTC represented the final hurdle for the deal. Exxon and Mobil wasted no time finalizing the merger. The new company, which has total assets of nearly $140 billion and will be known as Exxon Mobil, will begin trading under the symbol "XOM" on the New York Stock Exchange beginning Wednesday. In a statement, Exxon Mobil Chairman Lee Raymond said synergy-related savings from the merger may exceed the company's previous estimate of $2.8 billion over three years. The merger reunites the two largest remaining components of the Standard Oil trust, which was busted up by the federal government, in what may have been the landmark antitrust trial of the century, in 1911. As previously reported, the companies must sell more than 2,400 retail gas stations, more than double the amount expected by analysts when the proposed merger was announced last year. A California refinery and interests in several U.S. pipelines will also be put on the block. FTC Chairman Robert Pitofsky, who took an active role in the negotiations over the consent decree, said in a statement that the proposed settlement "should preserve competition and protect consumers from inappropriate and anticompetitive price increases." More than 1,700 of the stations are located in the Northeast and the Mid-Atlantic states, where the two companies have the greatest overlap. The companies must also unload 360 California stations, 319 Texas stations and 12 stations in Guam. Roy Littlefield, executive vice president of the Service Station Dealers of America, told CBS.MarketWatch.com that eight different suppliers, including Tosco TOS, +1.14% Chevron CHV, +0.22% Getty GPM, +0.00% Amerada Hess AHC, -1.45% Sunoco SUN, -1.43% Gulf and Canadian-based Irving Oil, have expressed interest in the stations. The FTC said the consent decree addresses the competitive problems raised by the merger in areas that are already "moderately concentrated," such as the California gasoline-refining market and gas retailing in the Northeast, Mid-Atlantic and Texas. The merger, without concessions, also would have exacerbated the lack of competition in the "highly concentrated" jet turbine oil market. "This agreement will stand as the commission's most significant enforcement effort in moderately concentrated markets in many years," Pitofsky said. Wrangling between Exxon and the FTC over the terms of the concessions dragged out the negotiations over the consent decree. Exxon and Mobil had initially aimed to close the merger by the end of the third quarter. Thirteen states have also approved the merger. Connecticut Attorney General Richard Blumenthal, however, rejected the deal, citing concerns the merger would raise gas prices, undercut competition and threaten gas station dealers. However, he acknowledged it was unlikely that Connecticut alone or a handful of states would be able to effectively block the deal. The state's rejection will, however, keep options open for the future, he said. Public Citizen, a consumer advocacy group, also criticized the merger, charging it would undercut competition. Avoidance of fragmentation The consent decree forbids the new company, which will be known as Exxon Mobil, from selling off the stations piecemeal. Such demands have become commonplace, with the FTC seeking to ensure that the divestitures create viable competitors to merging companies. Except for the refinery, the decree gives the companies nine months to find buyers. Exxon has a year to find a buyer for the refinery. While the FTC wants the company to sell off the stations in short order, the effort may be frustrated by Exxon and Mobil dealers worried about their fate in the wake of the deal. Service-station dealers, which pay as much as $25,000 a month in rent for their stations, are contemplating a lawsuit to block the sale of the stations. The SSDA's Littlefield said dealers fear the FTC is designing the terms of the divestitures to get around a 1978 law that gives a dealer the right to buy a station if its owner plans to sell to a third party. "We're concerned that the licensing agreement (proposed by the FTC) is a clever way to circumvent the law," Littlefield said. Under the terms of the consent decree, Exxon and Mobil would allow the buyers of the station to use the Exxon or Mobil name for as many as 10 years. The consent decree is subject to a 60-day public comment period before becoming final. Littlefield said his association has already filed comments outlining its concerns about the licensing agreement and has retained lawyers in case it decides to file a lawsuit. The decision on whether to attempt to block the divestitures will come once a buyer for the stations has been identified, he said. The SSDA has had talks with several of the prospective buyers, several of whom have indicated they may offer individual dealers the opportunity to buy their stations.
March 2, 2015 Leave a comment Ronny Bjones, Alliances director Trust in Digital Life association. I wanted to share my observations of the TDW event in Madrid on 25-26 of February 2015. At TDW you see three communities coming together. We heard policy makers on the different trust-related programs they are working on such as eIDAS, data protection, NIS, big data, etc. From the other side you see academia and industry explaining their progress in their projects which are frequently connected to these policy programs. This gives a fantastic synergy and a lot of networking. Overall I loved the demonstrations people are bringing forward. I saw some great new 2FA approaches from KUL/COSIC & qKey. The Trustseed digital signature demonstration in which I was involved, was also a high-light. It showed new advances how specialized cloud based trust services can make it easy for relying parties to incorporate complex signature scenarios. Trustseed was the winner of last year’s TDL sprint award. Great points Policy Makers brought forward The EC policy makers informed us very well on their trust related programs. We had Jacub Boratynski on the cybersecurity programs backed by Afonso Ferreira on the strategic research agenda in cyberspace. Afonso had a clear call to be involved in the NIS platforms. Marta Nagy-Rothengass showed the business opportunity on big data and how the EC is enabling these opportunities. I was impressed by one slide which showed how their investment into the “one digital economy” can bring the greatest benefits for the European economy. Way bigger than any of the other programs. She made an interesting point on what she called the ‘Snowden effect”. The “Snowden effect” might slow down business to benefit from big data because of all the regulations around it. Companies are afraid to step into this field. I thought this was interesting because I always believed there would be a great opportunity for European companies in this space. Great points Industry Speakers brought forward From the industry I saw a great session from Paul Wang NEC on Smart Cities. He had this picture of sixteen cameras all inline monitoring one street. These cameras belonged to different organizations and did different operations. Some of them might recognize individuals and map these individuals to the most wanted list, a service operated by the police. Others will see pictures with mosaics to anonymize individuals. These were operated by other services which could not invade the privacy of individuals. He pointed out a very valid point that we need non-repudiation to protect the authenticity of these pictures. He showed an example of a clearly manipulated picture. Imagine the impact to individuals when this happens. Dr. Richard Benjamin from Telefonica gave some great examples of big data. Showing how we can get new insights by overlapping earthquake strengths in a certain area with SMS and telephone usage. This could show where people are in trouble and it would be possible to send ambulances to these areas. Another example was to map people, correlated to demographic statistics to shopping areas to learn who is actually shopping there. He scared me a bit with a quit innocent example. He showed statistics of running football players (speed, location on the field, etc.). He told that Telefonica bought the data and did some analysis on it which showed that Messy was actually not such a big runner. Anyway this reminds me about some behaviors I spot with relatives. We all have relatives who store old stuff such as old VCR’s because who knows, maybe in the future, it might be worth a few bucks. Probably not though but this is exactly the same behavior which is triggering big data. These services are storing this data because maybe somebody will spend some bucks on it. A lot of data is very useful but many services will collect data because maybe in the future it can be monetized. But are they taking the right measures to protect that data and is it really worth it to store the data in the first place? The whole big data industry is fragile. It can be in risk from big incidents, in the same way how the nuclear industry was wiped in the USA by the “three mile island” incident. There is no way that these viewpoint are exhaustive. I probably missed some great sessions but I hope by sharing these, more people will have some food for thought. Read more blogs from Ronny Bjones on the subject of Identity at: http://blog.beejones.net/
Here are some photos from our recently concluded events. In April 2013, Academic Associates PeaceWorks received a grant from Shoreline Natural Resources (SNR) to work in OML 30. SNR is a Nigerian indigenous company that has a 45% interest in OML 30, which is located onshore in the Niger Delta region. It included eight producing fields with a 45% interest in the segment of the Trans Forcados pipeline between the Eriemu Manifold and the Forcados River Manifold. AA PeaceWorks is a well-established Niger Delta NGO best known for its peacebuilding work in Nigeria since 1992 and in the Niger Delta since 1996. Recognizing AA PeaceWorks’ ability to enter and especially work with Uzere and other problematic communities, AA PeaceWorks contract was novated to NPDC as Community Relations Building Consultants in OML 30. AA PeaceWorks was charged with building a more proactive, grassroots based relationship between the community and the company. For example, through its proactive approach to community engagement, AA PeaceWorks was able to use its many years of experience to build cooperation between NPDC and Uzere community, whose flow station had been closed down for two years after a dispute with SPDC. Elections in Nigeria usher in a season of violence, thus, the number of cases of deaths, kidnappings, destruction of public and private properties increases every election season. We are therefore, rolling out this platform to network with Nigerians who truly love this country to build a grassroots support and synergy against violence in the forthcoming elections.
\| Finance minister P. Chidambaram with Punjab National Bank CMD S. S. Kohli in New Delhi on Thursday. (PTI) New Delhi, Nov. 11: Finance minister P. Chidambaram today proposed a series of banking reforms, including amendments to the Securitisation Act, to make it easy for banks to proceed against loan defaulters. He also announced the introduction of legislation to regulate credit information. Addressing a bankers' conference here, Chidambaram said the country's banking system must consolidate operations keeping in mind synergy requirements and warned that its high non-performing assets (NPAs) were eating into the profitability of the industry. Chidambaram's announcements were followed up by a cabinet decision later in the day to clear the amendment to the securitisation act. A bill will be introduced in the winter session of Parliament. The bill, seeking amendments to the Securitisation and Reconstruction of Financial Assets and Enforcement of Security Interest (Sarfaesi) Act, would replace the relevant ordinance. This amendment was necessitated by a Supreme Court order striking down a provision in the existing act that required loan defaulters to deposit 75 per cent of their outstanding dues in an escrow account before seeking legal redress. Top bankers present at the meeting said they want a fresh amendment to the legislation, which would force borrowers to deposit at least 25 per cent of their dues before challenging takeover orders passed under the securitisation law. The minister said, 'Certain amendments to the Securitisation Act have been necessitated. The bill has been finalised and we hope to effect the amendments speedily.' The government is worried about the health of the banking sector as gross NPAs have swelled to Rs 1,10,000 crore. The finance minister also spoke of the need to bring in a new law on lenders' liability to force bankers to adhere to a new RBI code on fair practices, which enjoins them to maintain secrecy on information provided by borrowers. Planned amendments were aimed at dissuading borrowers from adopting 'dilatory' tactics and enabling creditors to launch speedy recovery, Chidambaram said. 'Along with the strengthening of the Sarfaesi Act, we propose to bring credit information companies regulation bill in the winter session of Parliament,' he said. 'A well-established credit information system will minimise financial frauds, which can become problematic for certain kinds of loans, especially home loans,' the minister explained. A legal sanction will be secured for collection, sharing and regulated dissemination of credit information. At the same time, Chidambaram said there was a need to protect citizens' privacy. The law on lenders' liability was consequently being mulled. He said many of the borrowers, especially self-help groups, were not told about the interest rate being charged. In many countries, banks are mandated by law to respect the rights and interests of lenders, depositors and other customers. There is a demand for a similar law in India, the finance minister said. Speaking of plans being made by several PSU banks to consolidate to form larger entities capable of taking on competition from multinational entities, Chidambaram said, 'The consolidation has to be addressed not merely to create behemoths but to benefit from the synergy created by mergers.' Human resources and technological synergies as well as regional and ethnic considerations have to be built into any plans for consolidation, he said.
\| Togetherness pays Mumbai, Oct. 10: The government plans to promote 30-40 manufacturing 'clusters' across the country to help small and medium enterprises compete better overseas. S. Jagadeesan, joint secretary in the department of industrial policy and promotion of the commerce & industry ministry, said states are being roped in to set up clusters specialising in niche industries across regions. More than 30-40 of these will come up in areas that are conducive to the growth of a particular industry. For instance, Hyderabad will have a pharma cluster while Agra and Kanpur will have hubs for leather processing. The Centre will invest around Rs 50 crore in the infrastructure of each cluster. This will entail basic infrastructure like roads and electric sub-stations for power. 'We want to optimise the use of our resources. By injecting funds into these clusters, we will ensure quicker results and reduce wastage of resources,' Jagadeesan said. Industry watchers say the move will help use scarce resources in a manner that is optimal. The decision to promote clusters comes at a time when progress on special economic zones in the country has been tardy. China is a shining example of how clusters have worked wonders for its export-led growth. The Shanghai-Suzhou growth-pole accounts for exports worth $182 billion, three times India's national figure. The need for an export-driven growth thrust has also been enshrined in a recent McKinsey study that says manufacturing can help India sell $300 billion worth of goods overseas by 2015 against $48 billion at present. Industry bodies like CII believe that a cluster approach is essential for the development of small and medium enterprises (SMEs) in the country in view of the increasing competition in the domestic and export markets. Another important objective of the strategy is to encourage small units to use infotech (IT) more widely in their businesses than they do now. Officials say, while Indian IT companies have made a mark abroad, SMEs in the manufacturing sector use little IT. To cajole them into doing it, the government plans incentives that could include measures to subsidise costs by establishing a broadband backbone in the clusters, besides extending hand-outs for computer hardware. Small-scale units account for 35 per cent of the exports. Their share can be increased, if greater synergy is achieved by adopting a cluster approach, experts say. They say clusters can easily be set up if a group of firms in geographical proximity have an interest in going through business processes collectively. Four clusters are in the offing in Maharashtra. The Thane-Belapur zone will have one for chemicals. Ichalkaranji should host a textiles cluster, while Pune and Aurangabad will be home to a hub for engineering and auto firms. In Gujarat, Vapi will get a cluster for chemicals, Rajkot for machine tools and Surat for gems and jewellery. In the Northeast, the government plans to promote two clusters for food processing and bamboo industry. Bengal, which will respond to the cluster proposal soon, could have two manufacturing hubs. In Uttar Pradesh, apart from Kanpur and Agra, Khurja could have clusters for ceramics, Firozabad for glass and Moradabad for handicrafts. Auto clusters are in the works at Pithampur in Madhya Pradesh and Vijayawada in Andhra Pradesh, in addition to one in Chennai. The government believes it is important to leverage the sunrise sectors in manufacturing, such as auto parts and components, and other supply-chain engineering products to propel India as a global economic force. A recent CII study said the Bangalore hub alone contributed 40 per cent to the country's exports of services and 12 per cent to that of goods. Exports from clusters with sectoral specialisation, like Tirupur, hit $800 million.
The world’s top doubles team powered Italy past the United States into its fifth straight Fed Cup semifinal. Sara Errani and Roberta Vinci controlled the center of the court and volleyed brilliantly on big points to sweep Liezel Huber and Varvara Lepchenko, 6-2, 6-2, in today’s decisive doubles match. The 71-minute victory lifted host Italy to a 3-2 victory over the United States, completing a comeback from a 2-1 deficit. Italy will host the two-time defending champion Czech Republic in the April 20-21st semifinals. The Czechs swept Australia, 4-0, in Ostrava to earn their seventh straight Fed Cup victory. The Czech Republic defeated Italy, 4-1, in the 2012 semifinals, avenging a 5-0 thrashing from the Italians in the 2010 semifinals. Making her American Fed Cup debut this weekend, Lepchenko dismissed French Open finalist Errani, 7-5, 6-2, to give the U.S. a 2-1 lead. Vinci roared out to a 5-0 lead in the final set to dispatch American Jamie Hampton, 6-2, 4-6, 6-1 and deadlock the tie, 2-2, forcing the decisive doubles on the red clay of Rimini. Playing the ad side, the left-handed Lepchenko hit a running forehand pass up the line for break point and Huber followed with an angled overhead winner to give the Americans the first break and a 2-1 lead. The deficit seemed to jolt the Italians into action: Errani drilled a backhand winner down the line for triple break point then followed with a slick backhand lob winner as Italy broke back at love to forge a 2-2 tie. That sparked a run of six straight games for the Italians, who sealed the opening set with synergy on their third set point. Errani struck a backhand return crosscourt, forcing Huber to dig out a defensive reply. Moving to her left to cut off the angle, Vinci knifed a forehand volley winner down the middle as Italy took a one-set lead. At net, the reigning Australian Open, French Open and U.S. Open champions often moved in unison as if connected by a cord. They won 21 of 27 trips to the net, compared to the Americans, who converted 18 of 33 front-court opportunities. An Errani overhead winner gave Italy the break and a 3-1 second-set lead, before the teams traded breaks. The Italians fought off two break points before holding for 5-2 on the strength of an Errani backhand volley winner. On match point, a poaching Vinci dug out a low volley and floated the ball over Huber's outstretched racquet as the Italians ended the match with a shared embrace. Vinci raised her Fed Cup doubles record to 18-0 — the best doubles mark in Fed Cup history — with 10 of the 18 victories coming on clay.
Scientists discover a new species of leopard frog from New York City and surrounding region, according to a study published October 29, 2014 in the open-access journal PLOS ONE by Jeremy Feinberg from Rutgers University and colleagues. The frog species was discovered in the New York City metropolitan area and surrounding coastal regions, one of the largest and most densely populated urban parts of the world. Among other data, scientists analyzed acoustic and genetic data to characterize the new species of leopard frog, named Rana kauffeldi. The species inhabits parts of New York City, where it was first identified, but its range also extends to the north and south and follows a narrow and largely coastal lowland distribution from central Connecticut to northeastern North Carolina. The researchers suggest the new species typically occurs in open-canopied wetlands interspersed with upland patches, but centuries of habitat loss may threaten the species. The authors suggest that this discovery demonstrates that new vertebrate species can still be found periodically even in well-studied areas rarely associated with undocumented biodiversity. Jeremy Feinberg added: "The discovery of a new frog species from the urban Northeast is truly remarkable and completes a journey that began six years ago with a simple frog call in the wilds of New York City. This story underscores the synergy that traditional field methods and modern molecular and bioacoustic techniques can have when used together; one is really lost without the other, but together are very powerful tools." In your coverage please use this URL to provide access to the freely available paper: http://dx. Citation: Feinberg JA, Newman CE, Watkins-Colwell GJ, Schlesinger MD, Zarate B, et al. (2014) Cryptic Diversity in Metropolis: Confirmation of a New Leopard Frog Species (Anura: Ranidae) from New York City and Surrounding Atlantic Coast Regions. PLoS ONE 9(10): e108213. doi:10.1371/journal.pone.0108213 Funding: Financial support for field work and analysis was primarily provided by a Rutgers Graduate School of New Brunswick Bevier Dissertation Fellowship and a New Jersey Department of Environmental Protection Conserve Wildlife Matching Grant to JAF, an NIH NIEHS Center grant P30ES005022 to JB, and a Hudson River Foundation grant to JB and JAF. Partial support was also provided by the Rutgers Graduate Program in Ecology and Evolution, Brookhaven National Laboratory, the Foundation for Ecological Research in the Northeast, and the Tiko Fund. Funding for genetics laboratory work for the holotype, performed at the Louisiana State University Museum of Natural Science, was provided by NSF DEB-1146033 (to Christopher C. Austin). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The author has declared that no competing interests exist.
beta-hydroxy-2-hydroxymethylene-17 alpha-methyl-5 alpha-androstan-3-one] Formula: C 21 H 32 O 3 up to 8 weeks Anabolic Ratio: 45:320 has been the strongest, oral steroidal compound, which is a derivative of dihydrotestosterone, which has been currently only available for institutional use in Mexico. Clinically, Anapolon had been often prescribed in efforts to treat anemias that had been caused by deficient red cell production. The androgenic and high anabolic properties of Anapolon have been substandard of Testosterone, which had been perinined this compound to have also been a dramatic muscle building product. Many athletes had claimed the strength and weight increases had been very substantial within is a relatively short period of time. This characteristic had allowed the compound of Anapolon to be a very popular choice of oral steroidal compounds amongst many athletes, primarily those of the male gender. Most athletes had frequently experienced a general weight increase of approximately 10 to 15 lbs or more, within two weeks with the administration of this compound. This of course, had been largely attributed to the tremendous amount of water retention which had immediately increased the muscle diameters, which in turn, had permitted a rapid increased size appearance. Consequently, this retained amount of water in the muscle cells and joints had also additionally provided a smooth appearance, as the size increase had been quantitative, not qualitative. An advantageous effect of the water retention however, had been the ability to eliminate, or having soothed associated joint problems, which had been due to this side effect's subsequent lubricating quality. This had often been appreciated by most athletes, as this characteristic had frequently allowed for intense workouts, which had often been previously somewhat restricted, due to associated aggravated pain in the The Anapolon oral steroidal compound had further increased the number of red blood cells, which in turn, had enabled the muscles to absorb more oxygen. This had generally resulted in the muscle being able to have endured more physical stress, which had been due to the significant increase in blood volume. A "pump" effect had often been experienced when training particular muscles, and had even become somewhat painful to the extent, that the performed exercise had frequently been required to have been abandoned, in order to have alleviated this sensation. However, this perception of increased strength and power had commonly been desired by all athletes who had practiced the self administration of this compound, as this sensation had usually been indicative that the compound of Anapolon had indeed, been performing to it's full capacity. Several athletes had also claimed that another distinguishing trait of Anapolon, had been the increased training duration's, as this compound had been able to have stimulated the regeneration of the body, which often had enabled further muscle building progress, and had stalled the possibility of over training. However, although the substance of Anapolon had been powerful, it unfortunately, also had imposed the highest threat for serious adverse reactions out of any oral or injectable steroids compounds. A few athletes had experienced excessive water retention which had sometimes resulted in high blood pressure. Anapolon had very high DHT levels, and had been very toxic to the liver, due to the characteristics of being C-17 alphaallrylated steroid. Although the Anapolon steroidal compound had been known for quick strength and mass gains, it's utilization had not been suitable for novices, and had only been used by some athletes after a certain development had been achieved; or consequently, the prior use of weaker steroid compounds had been experienced. Anadrol 50(commonly called by athletes "A50" or "A-bombs") was initially developed as a compound to help people with anemia, and has since been used very successfully to aid people who are suffering from many other diseases where weight loss is a concern. Thus, it is clearly an effective agent for promoting weight gain, increasing appetite, gaining strength, and increasing Red Blood Cell count. And, as with most Anabolic/Androgenic Steroids (AAS), it has its downsides as well. Anadrol will inhibit your bodys natural production of hormones (testosterone, etc& ), will negatively affect your blood lipid profile, can cause water retention, is notorious for causing headaches, and is also highly liver toxic (in fact, it has the worst reputation for hepatoxicity out of all steroids). Paradoxically, although one the benefits touted by its original manufacturer (Syntex) is that it can be used to stimulate weight gain through increasing appetite, taking too much may actually inhibit your appetite! Anadrol Effects on Body I think, in order to gain a complete understanding of the Anadrol effects on body, we need to take a look at its advantages contrasted with its disadvantages. Anadrol is a DHT-derived compound, and is 17-Alpha-Alkylated steroid, meaning that it has been altered at the 17th carbon position to survive oral ingestion. Most oral steroids are 17aa, and this helps them make it through your liver in a useful form. Sounds great, right? Lets 17alpha-alkylate everything! Well& as you can imagine, theres a down side. Anadrol Side Effects This 17aa alteration, which makes it possible for Anadrol to survive its first pass through your liver, also makes it very taxing on your liver. How taxing is A50 and how much weight can you gain from its use? Well, there was a 30 week study done on A50 and, as you can expect, a reasonable amount of side effects were noted. The fact that A50 causes some side effects has really never been in debate. But how effective was the drug? Well, first it should be mentioned that this study was done on people with AIDS related wasting, and they actually gained weight (8+kg) while the control group lost weight, and had increased mortality rates. (1). I suppose, if youre in a study because you have a wasting disease which is also a terminal illness, you dont want to end up in the control group& .Anyway, weight gain in this study peaked at 19-20 weeks, though, so the last 10 weeks werent very productive in this respect. Clearly, you wouldnt want to run Anadrol for 20 weeks, given its toxicity, but after that, any effect in terms of weight and strength gains would be negligible. So, with regards to sides from Anadrol, and the sheer fact that this study lasted so long (30 weeks), it should be apparent that they can be kept under control and the drug can be used safely. People are commonly told to limit their intake of A50 to 4 weeks or less& Im a bit less conservative and think you can easily run A50 for 6 weeks or more. From personal experience, however, I can tell you that gains from Anadrol are quite dramatic for the first 3 weeks, and then quickly level off. Unfortunately, I find that the side effects experienced from Anadrol (which include a headache, bloating, elevated blood pressure, and a general "unwell" feeling for me) remain for the entire duration of use& .but I find, as usual, side effects for this drug are pretty much half legend and half truth. Since Anadrol is derived from DHT, it cant actually convert to estrogen (via the aromatase enzyme), and its not a progestin or a compound with progestenic activity& so the estrogenic (?) side effects produced by it are of a very mysterious nature. It has been speculated that perhaps it can stimulate the estrogen receptor without actually being converted to estrogen& thats about as plausible an explanation as Ive heard& However, things really get strange, when Oxymetholone has been used in studies to alter the female reproductive/menstrual cycle; in those cases, it has lowered plasma progesterone levels! (7)One would expect that an AI (aromatase inhibitor) wouldnt be of much use with this drug, but many have found that Letrozole (which has, in some cases been shown to reduce estrogen in the body to an undetectable amount)(6) can greatly reduce or even eliminate many of the more noticeable side effects of Anadrol, such as the bloating. As Ive stated, however, the sides from this drug are certainly no joke, but are easily preventable, and controllable. One study even showed very few sides for subjects using up to 100mgs of Oxymetholone (2). In the original UnderGround Steroid HandBook, Dan Duchaine states that he used it at doses up to 150mgs/day. Clearly, Anadrols hepatoxicity has been a bit exaggerated, in some circles. Be that as it may, my suggestion is still to limit Anadrols use to 6 weeks, at a maximum& even if just to err on the side of caution. Of course, I have personally run this drug for much longer.. How should we use Anadrol? Id probably be willing to include Anadrol in a cycle including injectable st UnhideWhenUsed=eroids, but not other 17aa compounds. Id make any 6-week-run of this compound begin at the start of a cycle, as a form of "jumpstart" towards seeing gains quickly. The quick gains you will get from Anadrol (up to a pound per day for the first 2 weeks are not uncommon in Steroid.com members) are also just as quick to disappear upon cessation of use& .unless you are simply using it as a kickstarter, while waiting for your other compounds to kick-in. Ill go out on a limb here and say that utilizing Anadrol as a "Jumpstart" is the most popular use of this drug for athletes and bodybuilders today. Ill also say that this drug is immensely popular with strength athletes who dont have to worry about weight classes (Field athletes and strongmen), and with powerlifters in the heavier weight brackets. Its also important to note that in one study by Schroder et. Al (2) anadrol showed that it has the ability to lower serum SHBG (Sex Hormone Binding Globulin& which binds to your free test and makes it no longer useful for anabolism, among other things) concentrations by 54.9 25.8 and 45 16.2 nmol/l in the 50- and 100-mg treatment groups. This means there will be more free test circulating around your body when you take this drug& clearly, this would produce some synergy when stacked with other steroids. Given the large amounts of weight and strength which can be gained in a relatively short time span on this drug, Im sure this comes as no surprise to Another important and often understated characteristic of this compound is that Oxymetholone doesnt bind well to the androgen receptor (Relative Binding Affinity = too low to be determined) (3) which is the lowest Ive ever read about. Basically, what this tells me is that there are a lot of non-receptor mediated effects from this steroid, making it a very potent addition to ANY BULKING stack, because it wont be competing for the receptor sites with the other steroids youre using. Its also, as you may have guessed a very poor choice for a cutting stack. What is an Anadrol Cycle? How much should you use? Well, this is actually one of the most interesting facts about Anadrol. You see, most steroids produce what we call a "dose respondent curve" which is a fancy way of saying "the more you use, the more you gain." Anadrol is one of the few steroids where the dose respondent curve flattens out very quickly. When you take 50mgs of Anadrol, youll make some very good gains. When you take 100mgs of Anadrol, youll make even more gains. However, it has been found that 100mgs/day is as effective for weight gain as 150mgs/day but produces less side effects and was less toxic (4). I feel that the jump from 50mgs to 100mgs constitutes an acceptable rise in benefit vs. cost, but this is not the case as dosages get over 100mgs. Now, lets see how 50mgs and 100mgs of Oxymetholone actually effect strength, when compared with each other: Relative (%) changes in strength are shown for the groups receiving placebo (filled bars), 50 mg/day oxymetholone (open bars), and 100 mg/day oxymetholone (gray bars). Nos. above bars represent relative change (%) from baseline to week 12 for the 1-repetition maximum tests of strength. Error bars represent 1 SE from the mean. * Significant difference from placebo, P < 0.05; significant difference from placebo by Wilcoxon test, P < 0.02. See text for additional statistical analyses. As you can see, in this study, doubling the dose of Anadrol nearly doubled the strength gains of the test subjects. Now, when we look at changes in body composition from Oxymetholone (chart below) we can see that although the guys taking the 100mgs (vs. the 50mgs group) had more fat lost and more Lean Body Mass gained, it wasnt as dramatic as the differences in strength gains between the two groups: Changes in body composition are shown for the groups receiving placebo (filled bars), 50 mg of oxymetholone per day (open bars), and 100 mg per day (gray bars). Numbers above the bars represent the mean absolute changes and the error bars are 1 SE. For total lean body mass (LBM) and total fat, differences among the 3 groups were significant (P < 0.0001, one-way ANOVA). * Significant differences from placebo, P 0.001. Although I am usually not inclined to posit speculations on why a particular drug does or doesnt do something, in this case I will. Im guessing that the higher doses of Anadrol cause enough appetite suppression (at least anecdotally) to make eating rather difficult. It can also resistance and glucose intolerance (5). This has the effect of making macronutrient absorption more inefficient, and could also be a factor in reducing gains when the dosage goes over 100mgs/day. Unfortunately, Anadrol also has a reasonably profound effect on your bodys natural hormonal system, on par with most other oral steroids, but not as bad as most injectables, and its certainly not as harsh on your lipid profile as many anabolics are Anadrol Body Building (2). As an interesting side note, some of the medical literature on this compound suggests a dose of 1-5mgs per kg of bodyweight. Ill pause a second here for you to figure out how absurdly high of a dose that would translate to for the average bodybuilder! To Buy Anadrol Liquiad Anadrol and others This steroid is very available on the black market in the form of capsules, tablets (some are even 75mgs!), liquid, and even paper. Prices will vary, and be indicative of many different factors including the form you buy this compound in (paper will usually be the most expensive, and liquid the least), and where you live. In any case, you shouldnt be paying more than $2.50-3.00 per 50mgs. Charts from reference 2: Am J Physiol Endocrinol Metab 284: E120-E128, 2003. First published September 24, 2002; doi:10.1152/ajpendo.00363.2002 0193-1849/03 - Br J Nutr. 1996 Jan;75(1):129-38. et al. Am J Physiol Endocrinol Metab 284:E 120-28 Clin Trials. 2003 May-Jun;4(3):150-63. - J Clin Endocrinol Metab. 1981 Nov;53(5):905-8 Behav. 2004 Apr;5(2):260-3 - Am J Obstet Gynecol. 1973 Sep 1;117(1):121-5. Anadrol cycles are some of the most common cycles in performance enhancing but as with any anabolic steroid or supplement of any form you need to know how to take it if youre going to truly reap a reward. By and large the strong majority of Anadrol cycles will be for the purpose of bulking during off-season periods of use, as this is the steroids primary purpose; to increase size and strength. However, there are those who will include Anadrol cycles into their cutting phase and almost always this is among competitive bodybuilders as they are generally the only ones who will find this useful. Some hardcore gym rats who are not competitors of any kind may do this as well but the effect is so short lived its generally not a worthwhile practice for them. Bulking Anadrol Cycles: For the strong majority Anadrol cycles will be during the off-season and for the strong majority the period of use will be at the front end of the total cycle as part of a kick start to a total stack. As this steroid is very fast acting it will bring results to the cycle very quickly and as it provides synergy among the other anabolic steroids present it gives them a greater ability early on in order to get the ball rolling. For most all 50mg per day Anadrol cycles is the starting point and often all the Anadrol anyone will ever need; however, some more experienced individuals may opt for doses of as much as 100mg per day but you are urged to find out how you respond to a lower dose first before ever experimenting with 100mg. Make no mistake, in either case massive gains can come; if enough food is being taken in 50mg of this steroid per day can easily yield a 20lb gain in a month, perhaps even more. How long should Anadrol cycles last? Generally speaking 4-6 weeks and thats it. Those who extend use past the 6 week mark will more than likely find it to be a waste of a good steroid as this steroids effectiveness is only short lived and breaks must be taken. Once the 4-6 week mark has passed it is time to rely on the other anabolic steroids present to do the work. You will also find this falloff effect to be greatly revolving around dose as well; individuals who break the 100mg per day mark will not find gains to be much more significant and it has been shown that such doses can seriously kill ones appetite making bulking very difficult. For those who are implementing Anadrol cycles you will find it stacks well with most any other anabolic androgenic steroid; most notably testosterone. Common stacks often include testosterone of any form, as well as either Nandrolone of any form. There really isnt a steroid out there that is a poor option to stack with Anadrol. Cutting Anadrol Cycles: Even though primarily a bulking steroid Anadrol cycles can be useful to the dieting competitive bodybuilder. Unlike our bulking use this period of use will take place at the end of the cycle, shortly before the competition is to take place. How it works is simple; the presence of this steroid allows the individual to fill out to a greater degree giving the muscles just that, a rounder and fuller look once on stage. It is very important to note, the individual should have some experience with Anadrol cycles before ever trying this as to know with certainty how they respond to the steroid. Anadrol can cause a fair amount of water retention and for a competitor that is the last thing you want. However, if you understand how to control the steroid, if you are in shape and are supplementing with a good aromatase inhibitor you will enjoy this benefit. For most 50mg per day for 4 weeks will suffice. This should be for the 4 weeks leading up to the show and it cannot be stressed enough, you need to be in shape. If you are behind in your diet this is a method you are going to need to forgo as the results can be horrible and effectively ruin your chances at placing well.
There’s been a lot of talk about how AMC’s new tech drama, Halt and Catch Fire, is getting in the Sunday night elevator just as Mad Men is getting off—at least until the second half of the final season. “Is this the new Mad Men?” we whisper, breathlessly, into the void. It’s easy to draw dotted lines between the shows; both attempt to dramatize the history of two industries—computers and advertising—within two very important decades for commerce and innovation. In fact, Mad Men recently acquired a new cast member, in the form of an IBM System/360 computer. Halt and Catch Fire’s May 18 pilot foreshadowed what the season might bring: Lee Pace plays Joe MacMillan, a Bryan Ferry lookalike and former IBM employee hired at Cardiff Electric, who elbows fellow employee Gordon Clark (Scoot McNairy) into reverse engineering an IBM computer with him, in hopes they can beat the computer giant at its own game. Cameron Howe (Mackenzie Davis) is the smart young student they rope in to help with the coding. Kerry Bishé plays Gordon’s wife, Donna. It’s set in Dallas, Texas, one of the real nexuses of the early ‘80s computer revolution—the “Silicon Prairie.” North Texas's Dell and Texas Instruments were among IBM’s competitors. In the show, Donna works for Texas Instruments; they even have a Speak & Spell, one of the company’s most popular toys, which has been deconstructed by many an aspiring engineer since its debut. Writer and co-creator Christopher Cantwell grew up in Plano, a suburb of Dallas, and had some experience with Texas’s ‘80s tech boom. Cantwell’s father was a software salesman when Christopher was a kid, so he asked his dad to fill in some of the blanks. Cantwell started scripting a new kind of oil boom, one where “closers” and engineers worked together to test the limits of their bubble, to see how far into this brave new world they could venture. “He arrived in ‘82, right when personal computing was taking off," Cantwell explains. "And from there, we started to research what was going on in Texas at the time, and stumbled upon this story of reverse engineering on an IBM PC, which was first done by a company called Compaq. "And we thought, let’s tell the story you don’t know, of what was happening there. Then it became a story of people looking for a second chance, who have maybe been washed out of the bigger hubs of the time. Let’s thrust them together in this wild West.” The show’s engineering took a little more time. Cantwell and co-creator Christopher C. Rogers met in California, where both were working marketing jobs at Disney. In their free time, the two started writing scripts together, though neither had experience in a writers' room. They shopped the pilot for Halt and Catch Fire to several networks, and stared down a lot of dead ends. They finally ended up at AMC, and Cantwell says the vibe was different: The execs had the script "in their hands." AMC gave it a green light in late 2011. The early ‘80s tech revolution mirrors the current Silicon Valley rumpus in many ways, one being gender disparity. The show’s portrayal of women seems promising from the pilot: Donna’s not just the worried wife chasing her husband’s regrets. They seem more like a team, and the pilot hints that they once programmed a computer together. Though Cameron and Joe have an early scene in which his misogyny is exposed mid-tryst, she represents a character not often seen in Silicon Valley boardrooms. Cantwell recently wrote on his Tumblr about how important it was that they didn’t fall into stereotypes: “HALT premieres in five days. Are the female characters perfect? No. Does the first episode pass the Bechdel Test? No (we do in Episode 2, though…). Did I, my partner, our showrunner, our exec producers, the network, our room of seven writers endeavor very, very hard to write authentic women who aren’t mere accessories to a male story? Yes. I believe we did. I love our female characters. Did we screw up with them at times? I’m sure we did. “We created these characters as an attempt to portray realistic human beings who are women.” “From the beginning, we didn’t want Donna Clark to be a mere accessory to [her husband's] story,” Cantwell says. “When we cast Kerry Bishé, and saw what she brought to the character in the pilot, you just wanted to write to her. And you wanted to see someone like Donna struggling with the ‘80s universe of feminism, which is, ‘OK, you want to work? That’s fine, work, but you’re going to be [working at] home too. “Cameron is on the opposite spectrum from Donna. She’s of the new guard, she represents what’s coming. She’s a proto-hacker, a punk. Someone who sees technology a bit more like we do today, and she’s thrust into the hierarchy that’s very foreign to her.” The social media marketing for the show has been inspired. AMC partnered with Tumblr, and screened the show for an exclusive Tumblr audience. AMC is streaming the pilot episode on its Tumblr until May 31. Remember that Fine Bros. video of kids trying to understand old computers? Another bout of synergy from the show’s promotional department. The video has more than 7 million views. Sima Sistani, Tumblr’s new director of media, says it was an organic conversation, and AMC wanted to integrate their Tumblr into the larger community. “It really made a lot of sense for them to try to think of new and interesting ways to promote the show, and fill their fandom on Tumblr,” she says, “given that the show is about technology, and we have such a passionate community of influencers.” Sistani came on with Tumblr in January, with the specific task of partnering with media and entertainment companies. She explains they're currently doing a screening of the new season of Orange Is the New Black for a group of “influencers,” and she hopes the initiative can “connect these artists with the greater creative community on Tumblr.” “I think AMC has done a really fantastic job of building fandoms for their shows: The Walking Dead, Mad Men, Breaking Bad. I don’t think there’s a particular genre you have to be in to build a fandom on Tumblr. … Any niche interest, there’s someone for you to connect with.” While some of the pilot's dialogue felt a bit stiff, the characters are encouraging. The show's debuting in the midst of the Internet and entertainment's love affair with tech and its past. It will be interesting to see whether Halt and Catch Fire's viewers get in the elevator. Photo via AMC
About the Deane Institute The Deane Institute aims to accelerate current research and has enable MGH investigators to launch several new AF and stroke research initiatives. The Deane Institute hopes to alter the landscape of heart and brain study, speeding a new wave of advances that could have a profound impact on the treatment and prevention of both AF and stroke. A Timely Response to a Growing Public Health Problem Atrial fibrillation now affects 3 million Americans and is the most common sustained arrhythmia seen in clinical practice with approximately 350,000 new cases occurring each year. With the aging of the population and the increasing prevalence of contributing risk factors such as hypertension, the incidence of AF will increase significantly in the coming decades. For example, experts predict that one in every four adults now age 40 will develop AF over the next 25 years, creating an even greater public health problem than exists today. Exacerbating these projections is the fact that AF accounts for 15% of all strokes in the general population and close to 30% of all strokes among older individuals. Thus, establishing the Deane Institute at MGH is both timely and vital and will help address a public health need of major significance. MGH: An Ideal Setting for the Institute The Deane Institute's location within the MGH – one of the world's foremost academic medical centers - provides an ideal setting for accomplishing the Institute’s goals. The hospital's Cardiac Arrhythmia Service and the Stroke Service are widely considered among the finest centers of their type, regionally and nationally. AF and stroke research are well-established areas of concentrated interest within both services: The MGH Cardiac Arrhythmia Service Jeremy N. Ruskin, MD, the MGH Cardiac Arrhythmia Service is a leader in several facets of AF treatment and stroke prevention: the service is the region’s only clinical center with an associated basic science program that is addressing the genetics of AF; it sponsors the largest interventional electrophysiology (EP) service in New England; its physicians are the most experienced in the world in applying the latest catheter ablation techniques for treating AF; it is a world leader in the development and use of a left atrial appendage occlusion device for stroke prevention (the Watchman), and its physicians are pioneering the application of a unique image integration system to guide catheter ablation procedures. The system combines MRI images with electro-anatomic maps, producing unprecedented accuracy and clarity in three-dimensional images of the heart. The MGH Stroke Service Directed by Karen Furie, MD, the MGH Stroke Service comprises several faculty who are world leaders in the study of the genetic risk factors for stroke, stroke prevention, identification of disease biomarkers and other facets of stroke study and treatment. The Stroke Service's genetic studies are being conducted in collaboration with the MGH’s Center for Human Genetics Research and Massachusetts Institute of Technology’s Broad Institute. Because the greatest impact on stroke as a public health issue is via preventive measures, MGH Stroke Service physicians have been forerunners in the investigation of anticoagulants, antiplatelet agents, statins and vitamins in stroke prevention. The MGH's extensive intellectual assets, its large and varied patient population, the scope of its research enterprise and its experience and leadership in the treatment and study of diseases affecting the heart and brain define an investigative environment that is ripe with potential for translating laboratory discoveries into improved clinical care. Creating a New Synergy in Heart-Brain Study Establishing the Deane Institute has formalized a new structure that is fostering integrative research among the MGH's heart and brain specialists. Traditionally, cardiology and neurology at the MGH have existed side-by-side with little overlap in clinical services or laboratory research. The Deane Institute serves as the vehicle for bringing the Cardiac Arrhythmia Service and the Stroke Service together to capture the rich research and clinical experience within each specialty and to funnel this knowledge into an accelerated and intensified effort aimed at AF-related stroke prevention and treatment. The Deane Institute is providing the hospital’s top heart and brain specialists with new opportunities for jointly investigating intriguing topics of mutual interest, especially out-of-the-box ideas that challenge con-ventional wisdom. It will also allow rising stars among the MGH's junior faculty to generate data and proof-of-concept for innovative studies that will enable them to apply for National Institutes of Health grants and other external support. Modest investments of this type can leverage millions of dollars in NIH funding while launching the careers of the MGH's most promising young faculty. Educating Physicians and Training a New Generation of Specialists The Deane Institute's research mission is complemented by educational programs for primary care physicians and other caregivers to aid in the diagnosis and treatment of AF and the prevention of its complications. Instructional efforts will include live webcasts demonstrating catheter ablation techniques, left atrial appendage occlusion procedures (implantation of the Watchman) and a series of web conferences on the management of AF. The Deane Institute's research agenda will be further strengthened by a special fellowship program geared to preparing a new generation of clinicians and investigators who are in-terested in studying overlapping facets of cardiology and neurology. Thank you for e-mailing this page. Thank you for your providing feedback. Your comments will be responded to within an appropriate time frame.
In this paper, the proposed idea of producing fully-enclosed composite cable with CFRP coupling of high-tensile steel wires and the forming technology of the fully-enclosed composite cable body were introduced. The coordination mechanism of the fully-enclosed composite cable, the requirement of equal elastic modulus between high strength steel wire bundle and CFRP were investigated theoretically. We have come to the follwing conclusions: (1) Carbon fiber has the same strain with the high-tensile steel wire under the tension of whole anchorage. (2) The distribution of the force of the composite cable is in accordance with the axial stiffness between the carbon fiber with high-tensile steel wire. (3) To achieve a good synergy between the carbon fiber with high-tensile steel wire, similar or equivalent elastic modulus is required. (4) The stress ratio between carbon fiber and high-tensile steel wire in the fully-enclosed composite cable in engineering application should be controlled around 0.5.
Chess is one of the most-liked games played on the iPhone. The sheer amount of brains, tactics and combinations that goes into playing a chess game has, in my opinion, no equivalent. Here are some of the 2D as well as 3D chess games/apps for the iPhone with high graphics and some great animations. Check out these free and some paid apps to find a lot more. Best Chess Games for iPhone and iPad #1. Tall Chess by Friends of the Web, LLC Tall Chess is one of the finest Chess apps on iPhone. You can enjoy this game with very attractive and beautifully designed pieces and chess boards. Allows you to check out your last move very seamlessly just with a swipe. Get the best score and challenge your friends to beat you. Also, you can export your games in algebraic notation. Download Tall Chess #2. Chess by Mastersoft Mobile Solutions If you are looking for full fledged free Chess apps for your iPhone, then this is it. It has one of the best Desktop PC chess engines embedded, not available on any other iPhone chess app. Combination of multiple game sets, animated game boards, and the ultimate retina display gives you a charming chess effect. Download this chess app and have fun! Download Chess by Mastersoft Mobile Solutions Also Read: Best Sudoku Games for iPhone and iPad #3. Chess Premium by Optime Software LLC Chess Premium is one of the best apps available on the IOS app store for iPhone with an effective AI engine. Missing your chess partner? Not more! You can now play against your friends as it supports 1 and 2 player game-play. Excellent sound effects and user interactive layout makes it an interesting Chess app where you can even undo your steps. Download Chess Premium #4. Chess Lite – with Coach by Christophe Theron Bored of reading the manuals on playing Chess?? Not any more. With fabulous HD graphics, sounds and 21 levels of difficulty, you will have a coach who guides you on your every wrong step. You can also play without the coach with a book of rules. Come and experience this incredible chess game. Download Chess Lite #5. Chess Professional by Mastersoft Mobile Solutions Chess Professional is the advanced version of Chess Free supported by Game Center. It supports the same features and engine efficiency with some additional game boards and sets, clean and neat view of boards and pieces with an exclusive retina artwork. And yes, you don’t need to bear all those free ads and pop-ups. Download Chess Professional #6. t Chess Pro by Tom Kerrigan t Chess Pro is rich in quality and is designed perfectly for both the beginners and the masters. Moreover this app has a support for all the Apple devices and it boosts your skills as you have a strong computer opponent here. You cannot miss this amazing Chess app. Download t Chess Pro #7. iChess 3D by Synergy- IT Sp. z o.o. Spolka komandytowa iChess 3D visualizes the chess in 3D graphics with some amazing music, HD resolution and you can play around in 2D view. It’s more of a visual attraction than true game engine capability but it flies if you’re looking for a good game of chess. Download iChess 3D #8. Chess Genius by Lang Software Limited If you are looking for a clean and simple chess app on App store, choose Chess Genius. It is simple yet attractive. It comes with 33 playing levels, saving/loading games in PGN format & importing them from the internet. Features like sending games via email and hints makes this game the most common among all chess fans. Download Chess Genius #9. HIARCS Chess by Applied Computer Concepts Ltd. It is the strongest designed chess program on iPhone. Advanced game navigation, integrated HTML manual, tips, multiple playing modes, ELO rating, compatibility among all class of users with some more extravagant features makes this app a must-have if you’re collecting chess games. Download HIARCS Chess #10. t Chess Lite by Tom Kerrigan This is the most universal app that has a great user interface with a virtual chess board. It is a fun loving game for Chess lovers. Its high end features like real time online gameplay, dual-core chips, retina displays makes it popular among iPhone chess apps. Download t Chess Lite
Building relationships takes time but growing and maintaining them long term takes perseverance, energy and purpose. Jack Trout, Ad Exec and Author of Big Brands, Big Trouble says: “Marketing battles take place in the mind of a consumer or prospect. That’s where you win. That’s where you lose.” We live in seriously disposable times. People outgrow their use for things and each other, sadly rather quickly. I always take note when people talk about following people and companies for a “long time.” That’s really hard to do today. So how do you build a long term following, loyalty and community? How do you win in the minds of the consumer? Here are seven ways that can foster loyalty: Be Authentic and Real Be who you are, walk your walk and do what you tell others to do. People are way more savvy today and pic up on wrong or suspect intentions and motives. Sure we all have something to sell, but let people know you have their back and “get” their pain. Can people relate to you? Deliver Fresh, Fab and Fun It’s all about the experience we create and have with people and companies we interact with. Make sure you are refreshing your sites, visuals, marketing materials and presentation. We all love things that are new, but a different spin on something we like is cool too. Make things easy to follow, entertaining and culturally relevant. Directly Acknowledge Others Nobody achieves success without the support of others. Be vocal and step up in directly acknowledging people, who step up and support you. Use your social media streams to shout out, re-post and let others know that you appreciate them. Rewards, Incentives and Exclusivity Develop ways to give extra value to people who show you loyalty. Make them feel exclusive by creating a separate database for them, that you can extend exclusive offers, content or incentives. Show them an “inner circle” status. Look at all the premium loyalty programs that exist today and follow that model. Network, Connect and Introduce People Always be finding reasons to connect people together for the right reasons and most apparent synergy. When I meet people at conferences or events, I just know who I should be introducing then in my sphere’s. Act on it quickly, while meeting them is current. Feature, Reference and Mention Know your audience, customers and followers. Use them as examples of the things you write about, present on, things you value. Blogging and social media are great ways to do this. Collaborate and Partner In today’s business landscape, adding value to what you offer or deliver can be easily accomplished by joining forces with other companies, products and services that are complementary to yours. Look at all the multi-branding and cross-branding that you see in travel, consumer products, education, sports and entertainment. I can now go to one store or shopping area and get groceries, eyeglasses, flowers, auto supplies, yogurt and stamps. Find ways to collaborate and partner but be very careful to “vet” people and know who you are entering into partnerships with. Loyalty and longevity are the highest compliments a business can be given by their public. They are earned by valuing a deep appreciation for others and maintained by showing others that appreciation consistently. Here are some awesome articles about brand loyalty from BrandChannel. What are some of the ways you are fostering loyalty? Loyalty Photo via Shutterstock
Victoria’s Wood Fired Pizza is the premiere wedding & large party mobile wood fired catering pizza truck in the northeast. We make Neapolitan style pizza which is baked directly on the stone next to the 925 degree wood fire. We hand stretch your fresh dough, top the pies, and bake them all right in front of you. Our pizza truck cuisine focuses on sourcing the freshest organic seasonal produce and integrating the finest imported ingredients to achieve a unique synergy of healthful nutrition and vibrant flavors. Your taste is our priority and we can tailor our pizzas to your diet restrictions such as vegan or gluten free. Chef/Owner Bruce Lyon is a graduate of The Culinary Institute of America with 25 years of experience in restaurants, hotels and catering. He has a passion for cooking – especially Italian cooking! Our pizza truck is a mobile pizzeria and kitchen, with a WoodStone wood fired oven contained within a trailer. Our pizza truck has huge awning windows that allow your guests to watch the the pizzaiolo and pizza action. Just tell us where to park our pizza truck. We fire up the oven and do all the rest. We cater fresh Neapolitan style pizza for private party catering such as anniversaries, weddings, welcome/rehearsal dinner, graduations, birthdays and holidays. We also cater corporate events as well as concerts, fairs, and festivals. Our unique pizza truck and interactive service allows you and your guests to just watch, or involve yourself with the pizza making. Most clients and guests ask questions and order their own custom pizzas, some even choose to get their hands in the dough and bake with us! With the increasing popularity of “rustic chic” barn, farm, beach, and remote location weddings, providing delicious, high quality food becomes a challenge. We offer completely self contained mobile kitchens, rustic, family style Italian cuisine and crews of chefs with years of remote catering experience. Whether it be for your engagement party, bridal shower, wedding welcome party, wedding rehearsal dinner, cocktail party, or wedding reception dinner we are ready to deliver a unique experience with our varied menu options along with your ideas. Please click on Contact Us We respond to inquiries from Monday to Thursday. Victoria’s Wood Fired Pizza Catering is a full service mobile catering pizza truck. As pizza truck caterers we feature authentic gourmet Neapolitan style pizza baked directly on the hearth next to the wood fire, right be fore your eyes. Our pizza truck is ready to go to your awesome location. Our pizza and cuisine focuses on locally grown fresh produce and Italian imports. Please consider our pizza truck party packages. Pricing subject to change without notice. We cater pizza for private parties such as anniversaries, birthdays, weddings, welcome/rehearsal dinners, graduations and the holidays. We are located in Fairfield County, CT. We cater in Connecticut & New York (including Westport, Greenwich, Stamford, Darien, Brookfield, Ridgefield, New Canaan, Washington,West Hartford, and Avon)
- 07-14-2009, 04:23 PM - 07-15-2009, 07:41 AM 07-15-2009, 09:31 AM I am about to review a whole load of test boosters. It'll be a while before I'm more certain about some of the major ones. I'll not be trying BSN Axis HT - its not BSNs big seller and I don't hear much about it. Nice name. Purus labs have released an interesting test booster - but its not cheap. Basically I'm sticking with the big names here: Diesel Hardcore Test Basically some test boosters do nothing, some do alot, some make you think they are doing alot but not doing very much and one managed to give me a bit of gyno (too strong) AnabolicEdge sounds interesting... rings a bell. Might try. Basically I understand all the ingredients in test boosters but certainly with herbs you need to watch the quality of the extract. There are some big test booster users on this board and it'd be nice to get their input. 07-15-2009, 09:42 AM Right I looked up AnabolicEdge. It didn't look impressive and I think either Stoked or Sustain Alpha are better bets. These are sort of test boosters but in this case you'd use them more for PCT. AnabolicEdge may well work, just because the ingredients don't look wow! doesn't mean it ain't a good product. If they get the synergy right there in business. AnabolicEdge seems to have a big fan base. So its got something right. Perhaps the Cordyceps strain is spot on, perhaps the resveratrol is fanatasically bio-available, perhaps the Rhodiola is superb quality. Perhaps they just got the synergy bang on and its a combination of the whole lot. I might may it in the future but not today. My last BSN product Astro-Phex looked great from the ingredients - I didn't notice anything. 07-15-2009, 10:43 AM One thing I'm really interested in is icariin. I'll tracking this herb through Chinese medicine, one or two links forum members have kindly supplied and "Western" preparations, particularly tinctures. Any input on this would be welcome. The idea is some icariin extracts will be solid, some will be rubbish -- they could of course all be the same. My experience with green tea extract EGCG is expect large variation. 07-15-2009, 11:03 AM Right on the icariin front I've a tincture on its way and a TD forumla. Technically its a bit big for TD MW~600 but it might just make it - MW=500 ain't a hard and fast rule. I think I've more or less got my test boosters sorted ... long jack and maca need testing by themself. The one major ingredient is icariin and I'm looking into that from all avenues. 07-15-2009, 01:05 PM Where did you get the icariin tincture? 07-16-2009, 04:03 AM 07-16-2009, 05:14 PM 07-16-2009, 06:20 PM Jungle Warfare has ph in it so beware, many peeps get shutdown post cycle. Some other big names are primal male, zeus, supremacy, bioforge... 07-16-2009, 06:44 PM 07-16-2009, 07:40 PM 07-16-2009, 09:58 PM * T-bol looks interesting along with * T-force and The final one is the Evo Stack - you could pile the entire stack into a 4-week cycle. * Purus I dunno - Their stuff looks okay good but I dunno anyone who has come out and said 'this is great!'. AnabolicEdge has got good reviews but it looks very ordinary. Like what I would take anyway. Purely on ingredients and the Nutra star system I'd go T-bol but I did that with iForce's Max Out and its nothing special for me. DTH has a strong following, as does ActivaTE Xtreme and Mass FX. Prime has a limited but very dedicated following IMO. 07-16-2009, 10:05 PM * JW - thats the big thing. The current opinion is that its gone soft, they might have taken their PH out. To be honest I've not noticed anything from it. * Primal male I spotted this. It didn't excite, but you can never tell. * Zeus, supremeacy and bioforge. I need to look those up. Basically if something looks good, Nutra review okay or its just a massive fan base then I'm all in. I was disappointed with Max Out so I'm not buying every natty test out there. 07-16-2009, 11:21 PM i am like, following your posts, coz i'm a big fan of natural test boosters too... ..thing is AX(divanil) frees test...among the list, which ones really increases base test levels? Thats what i'm more interested in. 07-17-2009, 05:13 AM 07-17-2009, 09:17 AM 07-17-2009, 01:09 PM 07-17-2009, 01:12 PM 07-17-2009, 01:16 PM Seriously, you want strong and effective, Diesel Test Hardcore and Diesel Test Pro Cycle. I have YET to EVER hear a bad review and am buying some myself. Just Get Diesel and be done with it 07-18-2009, 07:37 AM 07-18-2009, 07:41 AM 07-18-2009, 05:18 PM http://www.bodybuilding.com/store/neo/reg.html)...so you guys are basically saying AI's...to raise test. i guess thats why people say stack an AI with something like activate. I've done AX alone, dunno if it did much for me, i will be revisiting it soon enuff as i have some straight divanil and a bottle of AX. 07-18-2009, 07:23 PM Go with DTHC by Diesel nutrition you won't regret it and when it comes to the ingredients Chuck always has the effective ingredients dosed just right so they work and they are not in the supplement just for window dressing he uses strong extracts of the herds so they are more effective than some of the other under dosed natural testboosters out there just look at the icarins it's 60% who else gives you that kind of percentage. As for the Anabolic Edge I ran 3 jars for 60 days and to be honest with you I didn't get much of anything out of that supplement maybe someone did but I didn't so I won't be recommending that one. Similar Forum Threads - By TheMeatus101 in forum SupplementsReplies: 40Last Post: Today, 09:32 AM - By John.R in forum Supplement LogsReplies: 12Last Post: 01-05-2011, 08:31 PM - By bluem3 in forum SupplementsReplies: 13Last Post: 03-28-2010, 09:20 PM - By lun7200 in forum SupplementsReplies: 8Last Post: 03-22-2009, 08:33 PM - By Eunisx in forum SupplementsReplies: 24Last Post: 11-28-2006, 07:10 PM
The refined Clearwave Symphonia 72R - now you can read the new 6Moons complete review here: Incredible speaker, incredible price, made in the USA, played by music lovers worldwide... Accuton, Raal, Clarity Caps, Cardas, ingenious crossover and cabinet design and execution= music maker Stand mount version Symphonia 7R available at $4650 Clearsound Audio- Long Island, New York Exclusive Audiogon Clearwave retailer- Call for room and system synergy by design, not default These speakers are $7200 plus shipping actual selling price, and available in Cherry, Claret, and Black. Professionally packed to ship and arrive safely for your listening pleasure. Email: email@example.com website: clearsoundaudio1.com Lines: Carver Tube amps, dehavilland, Sonist, Acoustic Zen, Marten, Ayon, XTZ, Burson, Wyred4Sound, TRI, Audio Space, LSA, and more...
Mindmatrix excels in channel sales and marketing automation and enablement, completing the consultancy and agency services provided by ChannelSmart in the channel domain. Pittsburgh, PA (PRWEB) December 23, 2015 Mindmatrix and ChannelSmart have announced a partnership to make Mindmatrix Channel Enablement Platform available globally. Speaking about the partnership, Harbinder Khera, Mindmatrix, CEO-, said, “Mindmatrix is one of the best channel enablement platforms in the industry today. We have hundreds of companies using our platform for improving their channel management, channel monitoring and channel marketing capabilities. Mindmatrix has been serving clients in the United States for over 17 years, and as we stepped into our 18th year of business, we felt it was time to enter into the global market. As a leading Channel Development & B2B Marketing Agency, ChannelSmart offers tremendous scope for us to reach out and add value to companies operating via the channel sales model. The Mindmatrix platform helps organizations increase sales by empowering and engaging their channel partners. Companies that focus on engagement, participation and partnerships can dramatically improve channel performance with Mindmatrix. On the channel enablement front, key features of the Mindmatrix platform include: improved channel visibility, channel sales playbooks, mobile access to the platform, social selling, lead generation, personalized collateral creation tools and partner portals”. Gal Biran, CEO, ChannelSmart quoted, “Mindmatrix excels in sales and channel enablement and in channel sales and marketing automation. These elements answer core aspects of channel development and marketing, two services that ChannelSmart uniquely provides. There is a strong synergy between the consultancy and agency services we provide in the channel domain and automation in the same domain done by Mindmatrix. Coming from the channel business and understanding channel organization challenges, we see the value in a sales and marketing automation tool for the partners themselves and for vendors’ channel organizations, who constantly struggle in having their brand and content represented within their distribution channel and enabling their channel workforce. Utilizing the Mindmatrix technology, we believe we can dramatically improve the local marketing of the global brand by leveraging the local partner’s online assets. We can also empower sales channels with playbooks, mobile content and customer interaction data. ChannelSmart complements this offering with the know-how of channel methodology and the capability to consult and implement such a change process within a vendor and its global channel”. ChannelSmart is a leading Channel Development and B2B Marketing Agency based in Tel-Aviv. ChannelSmart caters to global tech companies headquartered in Israel and Europe, and supports their global growth with channel development and sales and marketing automation tools. As a B2B Go to Market powerhouse, ChannelSmart helps companies structure & accelerate their business via multi-channel strategy based on channel partners & distribution, online marketing and remote selling. ChannelSmart assists companies in building & managing a sustainable and effective international go-to-market while reducing time-to-market. Their expertise includes penetrating new territories and market segments, growing brand awareness in sub-markets, lead generation and strengthening distribution channels worldwide. They also offer consultancy, outsourced professional services and technology – combining know-how and execution, supported by methodology, best practices and multi-channel sales & marketing automation.
################################################ +MegaMan Battle Network 5: Team ProtoMan Script+ ################################################ Copyright 2005 Raymond Cheung (memnarch6 on the GameFAQs boards, email@example.com) This document can only be used for private purposes only. It may not be distributed publicly without my permission. Note: All characters and trademarks of Megaman BN 5 Team ProtoMan belong to Capcom. Version 1.0 A FRIENDLY REMINDER: This script was written in order to tell the storyline of the game and everything of the like. There are spoilers in just about every part of this script, so if you don't want to be spoiled, I advise you now to stop and hit the Back button. Either that or press Alt+F4. Index: ====== 1. Version History 2. Battle Network Five Background 3. The Game Script 4. Post-Game Script Information 5. Errors 6. Credits and Thanks * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * \|==================\| \|1. Version History\| \|==================\| v1.0 \| 8/17/2005 \| Basic skeleton script, will edit when I have more time. * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * \|=================================\| \|2. Battle Network Five Background\| \|=================================\| This is the fifth (well, sixth if you count Battle Network 4.5) installment in the Battle Network series. This game connects from the last one, where evil mastermind Dr. Regal "commits suicide" by falling off the NAXA RedSun/BlueMoon Laser. Duo's asteroid has been stopped. Peace has once more returned to the world, and our hero Lan Hikari and his Navi MegaMan are taking a well-deserved break after showing Duo that mankind can control their DarkSoul. The game starts back in ACDC Town, during the summer break. However, before we even go there, we get a cutscene from what seems to be the past. Let's proceed with the script! * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * \|==================\| \|3. The Game Script\| \|==================\| Here is the CONTINUOUS storyline. There will be brief breaks to show the end of one scene and the commencement of the next: Scene 1: Narrator: The year was 19xx. Cyber society was almost completed. Scientists in an old SciLab from BN3 Sci 1: We've done what we can. Now it's up to the next generation to finish the research. Sci 2: Yes? Sci 1: Our offspring will certainly complete what we've started. Sci 2: Yes, let us hope so... Scene 2: Narrator: Years later, in the 21st century...a network keeps society safe from all cyber threats. MegaMan: ...ke up Lan! ...ome on, wake up! Lan!!! Lan: Mmnn...I'm trying to sleep... MegaMan: Lan, you can't fall asleep now! You haven't finished your homework! Lan stretches out and awakens Lan: Yawn!!! Oh, morning, MegaMan. MegaMan: Don't "morning" me! Lan! Every time you start your homework, you fall asleep! Lan: C'mon, MegaMan, it's better than falling asleep during class! (The actual BN5 guide I wrote will contain details between scenes. This script is just for the people who want to get the gist of the story without buying the game. And I don't blame you. Quality in the Battle Network games are declining and BN4 was probably the worst they could have done.) Scene 3: Lan: Hey, how about we jump on the Net? That'll rev me up! MegaMan: Er, OK...But just for a bit! Once we jack out, it's homework time, OK? Lan: Yeah, sure, sure! Jack i... Lan readies to jack in Haruka: Lan! Could you come here for a second? Lan: It's Mom! Wonder what's up? Coming, Mom! Scene 4: Haruka: Lan, could you run an errand for me? I'm tied up at the moment. Lan: Sure, Mom! Haruka: Really? Thank you! Could you please deliver this to my friend's Navi? Lan gets StewRec (StewRecipe). Lan: Where's your friend's Navi? Haruka: She's in the KitchenComp. You can access the KitchenComp from ACDC Area2. Lan: Gotcha! Let's go, MegaMan! MegaMan: OK! Press the R Button in front of your computer to send me to Cyberworld! Lan: You got it! Time to jack in! Haruka: Thank you, dear! Scene 5: MegaMan: ...Uh-oh! Camera pans to three Mettaurs, MegaMan comes up to them. MegaMan: Lan, viruses are invading your web page! Lan: OK, MegaMan! Let's warm up with some virus busting! MegaMan: Right! You operate, I bust! Er, you're not too sleepy to bust viruses, are you? Lan: Are you kidding? Let's roll! MegaMan: Really? OK, then, let's do it! Lan: Battle routine set! MegaMan: Execute! (I won't bother to write the scripting during the Tutorial, that's menial labor and I don't like menial labor. :p Oh yeah, any errors in the script will remain there; I will have a compilation of errors at the end.) [Complete the third battle...] Lan: All right! MegaMan: Excellent! Nice work, Lan! Lan: Nice work, MegaMan! OK, now let's run that errand for Mom! She said the KitchenComp is in ACDC Area2! Let's head out! MegaMan: Roger! Scene 6: MegaMan: Excuse me, Navi. Do you belong to Mom's friend? Navi: Oh, you must be MegaMan, Lan's Navi. I've heard lots of good things about you from Lan's Mom! MegaMan: Mom asked me to give this to you. Megaman gives: StewRec Navi: Heavens, you brought this all this way? I'd heard Lan's Mom cooks a wonderful stew! So, my operator asked her for the StewRec.! Thank you so much! I can't wait to try out the StewRec.! Say hello to Lan's Mom, will you? Navi jacks out MegaMan: OK, Lan, we finished Mom's errand...Now let's get back to your homework. Lan: Are you kidding, MegaMan? That was Mom's errand! Now it's MY time to play on the Net! MegaMan: But, Lan! mail alert MegaMan: Lan, you've got mail! Hm? It's from Dad. I'll read it. "Lan, please round up everybody and bring them to my lab at Scilab. I have something to show you." Wow! Wonder what Dad wants to show us? Lan: I guess "everybody" would be Mayl, Dex, and Yai. OK! Let's jack out and go round up the crew! Jack out, MegaMan! MegaMan: Roger! Scene 7/8/9: Lan: Hey, Mayl! Mayl: Something up, Lan? Lan: Dad wants to show everybody something at SciLab. Let's go! Mayl: Sure! But I have to get ready before I go. Lan: OK, let's meet in 30 minutes in front of the Metroline Station! Mayl: OK, see you then! ---------- Lan: Hey, Dex! Dex: What's up, Lan! Lan: Dad wants to show everybody something at SciLab. Let's go! Dex: Hey, that sounds totally cool! Lan: OK, let's meet in 30 minutes in front of the Metroline Station! Dex: You betcha! Lan: See you then! ---------- Lan: Hey, Yai! Yai: Oh, if it isn't Lan! What brings you here? Lan: Dad wants to show everybody something at SciLab. Let's go! Yai: Sounds fascinating. But I need time to get ready. A lady can't just rush off without getting prepared! Lan: OK, let's meet in 30 minutes in front of the Metroline Station! Yai: 30 minutes? Very well! Lan: See you then! Scene 10: Narrator: 30 minutes later... Lan: It's almost time. Mayl: Lan! Sorry to keep you waiting! Mayl and Yai come up the street Yai: Hey, where's Dex? Lan: Not here yet. Yai: Well, he's got a lot of nerve! I don't have time to wait around for slackers! Mayl: Don't worry, Yai, he'll be here any second. I wonder why your Dad would ask all of us to come? Lan: You know, I actually have no idea. But when Dad wants to show something to "everybody"...You can bet that it's something far out! Dex: Whoa! Dex speeds around the corner, surprising the three of them Dex: wheeze wheeze Sorry, dudes! I was having so much fun doing GutsMan's maintenance...I forgot to leave on time! Yai: You need to download a personal planner, Dex! Mayl: Now, now, we're all here, so let's go see the big surprise! Dex: Yeah, Mayl's right! Follow me, everybody! everyone enters the station Scene 11: Lan: This is SciLab! Should we go inside, then? everyone enters, camera pans to a black car on the street Voice: ...The hour is upon us. Begin the operation... Scene 12: cutscene, elevator bell rings Lan: Dad! Lan runs to his father Dr. Hikari: Ah, you're here, Lan. Did you bring everybody along with you? Lan: Yup! Alright everybody, come on inside! everyone else joins Lan Mayl: Hello! Dex: SciLab, whoopee! Yai: Hello, Dr. Hikari! Dr. Hikari: Great! You're all here! The reason why I've asked you all here today...Is to show you something very special. Lan: Something very special? Dr. Hikari: A program I found when going through some old documents. Dr Hikari turns to his computer Dr. Hikari: ...whoops...I forgot my ID Card. Oh, boy. Gotta love these secure SciLab computers. I can't do a thing without my ID Card anymore. Lan, could you please get my ID? It's in my desk drawer. Lan: OK, I'll be right back. Lan runs to the desk Lan: Dad, which drawer is it? Dr. Hikari: The big one, in the middle. Lan: Thanks, Dad! Let's see, which one is it? Dr. Hikari: ...hm? The Confirm ID screen isn't coming up...It worked fine yesterday. alarms go off Loudspeaker Voice: Emergency! Emergency! A group of Navis has infiltrated the Net...and has occupied several Areas! ...H...Hey! Who are you?! Rgg! Hrggraah!!! Zhk! Zhk! Zh-zh-zh, Zhrrack! Dr. Hikari: The Net's been occupied?! What's happening?! A small device rolls toward the group's feet Yai: Hm? What's this? Dex: Mm? Mayl: What? Dr. Hikari: ...Hrg!!! Everybody, stand back from th... The thing sprays gas around, knocking out everyone Yai: Um...sure... Dr. Hikari: Agh! Sleeping gas...! What in blazes...Is going on h...Thunk camera pans to Lan, on the ground MegaMan: Lan! Wake up, Lan!!! Lan: D...Dad...Everybody... Three guards come through the elevator in gasmasks and approach the four fallen figures, not seeing Lan Guard 1: ...Confirmed: Dr. Hikari. Gas concentration: 0.03%. It is now safe to enter. The guards turn to the elevator, and Dr. Regal comes through Dr. Regal: ...Well, well, Dr. Hikari...Take him away. Guard 1: Yessir! Guard hauls off Dr. Hikari's body Guard 2: Master Regal, what about his friends? Dr. Regal: Confiscate their PETs. Without them, they'll be helpless anyway. Guard 2: Yessir! The guards confiscate the PETs from Yai, Dex, and Mayl Guard 2: All PETs were claimed. Dr. Regal: . . .But I wonder...why Lan isn't here...No matter...Our job is done. We've no time to waste. Let us be gone. Guard 2: Yessir! Regal and his cronies flee Lan: Dad...Dad...Thunk MegaMan: Lan, Lan!!! fade into darkness Scene 13: Lan: Dad...Dad...Dad!!! Lan wakes up Lan is in his bedroom, watched by Haruka Haruka: Lan, thank goodness you've come to. I was worried sick. You've been asleep for three days. Lan: ...Three days? Right, the last thing I remember was the sleeping gas. ...Wait! What about Dad!!! Is he alright?! Haruka: Um... Lan: Dad, kidnapped by Regal...? So, that wasn't a bad dream. I've got to rescue him! Haruka: Lan, you must stay in bed. Lan: But, Mom... Haruka: Now, Lan, you do as I tell you! Lan: ...Aw, Mom... Haruka: Lan, you need to stay in bed. Am I making myself clear? Haruka exits MegaMan: I was very worried about you. Not to mention Dad...... Lan: I know...I know, but...I've got to go rescue Dad! MegaMan: But with Mom all worried...I'll have to stay here for now. From here in my room let's see what info I can gather! Lan: ...Right. By the way, what happened to Mayl and the others? MegaMan: Everybody woke up before you, Lan. They're at home recovering. Everyone's upset about losing the PET. Lan: Right...For everybody's sake...I've got to search for data! Lan gets out of bed, fully dressed Lan: I heard a message about some group taking over the Net. What was that all about? MegaMan: Yeah, I'm worried about that, too. Let's check the Net. We might be able to find some clues that could lead to Dad. Lan: OK, let's do it! Jack in! MegaMan, Execute!!! Enter the Net MegaMan: What...? Camera shifts around ACDC Area1 MegaMan: Things have really changed. Just what's going on? Lan: MegaMan, let's forge ahead. If we're lucky, we'll find some clues. Anything could happen here. Stay on guard! MegaMan: Roger! Scene 14: HeelNavi: Whatcha want, kid? Nebula's in charge of this area now. You know what we do with navis who waltz into our areas? Delete them! Battle Viruses HeelNavi: Hmph! It seems I've underestimated you! I thought all the Navis of your caliber were gone. Enough fooling around! I'll show you my true power! bzzt! bzzt! HeelNavi: Hmph! Fine time for headquarters to recall me! What, the scientist kidnapped from SciLab has awakened? MegaMan: The "scientist kidnapped from SciLab"?! Lan: You mean my Dad!!! Where have you taken him?! HeelNavi: Ah, you're the son of that scientist? Well, don't expect to be seeing him anytime soon. We'll be "borrowing" him until our plan comes to fruition! Keh heh heh! So long, kid! The HeelNavi escapes into ACDC Area3, the door letting him through. MegaMan: Wait!!! MegaMan tries to give chase, but is blocked by the door* MegaMan: Hrk! If only this door would open! Lan: Can't you break it with the MegaBstr? MegaMan: This door is laced with a terrible DarkPower. The Buster is powerless against it. Lan: Right. Shoot! We'll have to think of something else. Yeah. At least we know that Dad is being held somewhere. bee-bee-beep! MegaMan: Lan, you've got mail! It's from SciLab! I'll read it! "News flash. SciLab main system was infiltrated. The invaders must be stopped immediately, before SciLab is taken over!" Wow! Could this be the work of Nebula? Lan: They're always up to no good! MegaMan, let's go! MegaMan: But we have to leave without Mom knowing why we're going... Lan: Right. We don't need to worry Mom any further. We'll have to think of a good excuse! MegaMan jacks out Scene 15: Haruka: Lan, you must take things easy for a while. Lan: I'm fine, Mom! Um, Mom? Dex invited me to play, which sounded kinda fun...Can I go? Haruka: Lan, just promise me one thing. That you absolutely will not go anywhere dangerous. Lan: . . .Of course, Mom...(Forgive me, Mom) Goodbye! Run outside and go to the Metroline Station. Mayl is standing there... Mayl: Lan! Thank goodness you've come to. Lan: Mayl, What am I doing here? Mayl: When I stay inside, it just makes me sad. I cam out for a walk to get my mind off things. Lan, just in case something happens, please keep this with you as an amulet. Receive Roll R Mayl: Oh, and use this, OK? Receive MaylCode Mayl: Take care of yourself, Lan. Scene 16: Lan: ......It sure is quiet. Voice: We're finished! camera pans to the forbidden elevator, an official comes out Official: The main system controls are completely out! What do we do now?! the man zooms by you and out of SciLab Lan: The main system is up those stairs! From what that guy was saying, it sounds like big trouble. Let's go, MegaMan! MegaMan: OK! Get up the stairs and to the elevator... MegaMan: It's locked! It would open with a signature of a SciLab staff member. Go to Dad's office and find his main computer (not the supercomputer he was standing by before) Lan: Let's see, Dad said...There it is! [Receive Dad's ID] MegaMan: Right! With Dad's ID, we can get past all the SciLab security! Lan: Yup! We should be able to open that door! MegaMan: Yup! Let's go, Lan! Lan: You bet, MegaMan! Return to the forbidden elevator, and go upstairs Lan: This is where the main system is! But, why is it deserted? MegaMan: You're right, that is strange...But we've gotta find whoever infiltrated the main system! Lan, send me into the main system! Lan: Yeah, you got it! Scene 17: Lan: MegaMan, find the Navis that invaded the main system! MegaMan: Roger! In MainComp1, go forward, following the path. Talk to the Mr. Prog... Mr. Prog: HEAVENS! WHAT TO DO? THE BACKUP DATA HAS FRAGMENTED! THE DATA MUST BE RESTORED TO CONTINUE IN THIS DIRECTION! COULD YOU PLEASE REORGANIZE THE DATA? CHANGING THAT DATA IS HARDER THAN IT LOOKS! IT's HEAVY! YOU'LL LEND A HELPING HAND, RIGHT? RIGHT? RIGHT? [No problem!] Mr. Prog: THANKS! I KNEW THAT YOU WOULDN'T LET ME DOWN! LET ME EXPLAIN HOW TO RECONFIGURE THE DATA! RESTORING THE DATA IS THE ONLY WAY TO GET THROUGH HERE! THE DATA IS SAVED IN THOSE BLOCKS. PRESS THE A BUTTON TO REMOVE DATA. YOU CAN SWITCH THE DATA WITH THE DATA IN ANOTHER BLOCK, OR INSERT THE DATA INTO AN EMPTY BLOCK. BUT YOU CAN MOVE DATA ONLY A LIMITED NUMBER OF TIMES! IF YOU MAKE MORE MOVES THAN ALLOWED, YOU'LL ACTIVATE THE SECURITY SYSTEM, SO BE EXTRA CAREFUL! IS EVERYTHING CLEAR? ---------- Mr. Prog: THIS DATA IS A BIT COMPLICATED, SO PAY CLOSE ATTENTION, OK? THE LEFT LETTER COMPLETES THIS COIN WORD: " ICKEL". THE MIDDLE LETTER COMPLETES THIS COIN WORD: "QU RTER". THE RIGHT LETTER COMPLETES THIS COIN WORD: " ENNY". GOT IT? ---------- Mr. Prog: CONSIDER THESE FOUR ANIMALS: DOG CAT OWL RAT. ONE DOES NOT BELONG. EVEN I DON'T KNOW THE ANSWER...WHAT A CONUNDRUM... The right Mr. Prog says: Mr. Prog: OK, I NEED DATA FOR AN ANIMAL THAT CAN BE FOUND IN TAR. DO YOU THINK IT'S REFERRING TO THE LA BREA TAR PITS? I DON'T KNOW WHAT TO DO! I CAN'T FIGURE THIS ONE OUT! * * * * * Mr. Prog: I NEED SOME HELP...PART OF MY PLACE DATABASE HAS BEEN CORRUPTED, AND NOW I CAN'T RECALL THE PLACE. THIS IS DESCRIBING: THE PLATFORM FOR GETTING ON/OFF SHIPS...ALL I KNOW IS IT STARTS WITH D... Talk to the other Mr. Prog: Mr. Prog: I NEED SOME HELP...PART OF MY PLACE DATABASE HAS BEEN CORRUPTED. WHAT'S THIS PLACE STARTING WITH H? THE SHIP'S INTERIOR CORRIDOR... * * * * * Mr. Prog: WHAT PART OF YOUR BODY CAN YOU HOP WITH TO MAKE MUSIC? ...THAT'S THE CLUE, BUT I CAN'T MAKE HEAD NOR TAIL OF IT. WHY CAN'T THE ANSWER JUST BE STRAIGHTFORWARD? MUST BE SECURITY, I GUESS. ---------- Second Mr. Prog: EVEN IF I KNEW THE ANSWER I'D RATHER SEE YOU STRUGGLE! BUT I'LL GIVE YOU A HINT! ARE YOU READY? A MOTHER HAD ONE CHILD BUT TEN OF THESE WERE BORN...WELL? ANY IDEAS? ---------- Third Mr. Prog: A BODY PART THAT GOES WITH "FIRE", "BAND" AND "OVER"...DOES THAT GIVE YOU ANY IDEAS? I HAVEN'T A CLUE, MYSELF! SOMEBODY HURRY AND HELP! * * * * * Mr. Prog: OH, MY! MY OH MY! WHAT AM I TO DO? MegaMan: What's wrong? The Prog stops panicking Mr. Prog: I CAN HARDLY BEAR TO SAY! I WAS TOLD TO COME AND REORDER THE DATA BUT THE DATA ORDER HAS ESCAPED MY MEMORY BANK! I TRIED TO CONTACT THE PERSON WHO ASKED ME. BUT HE'S NOT ANSWERING MY PAGES! NOW I JUST DON'T KNOW WHAT TO DO!!! returns to panicking OH, MY! MY OH MY! WHAT AM I TO DO? MegaMan: He's right, Lan. What should we do? We can't proceed. Lan: Leave it to me! I'll find the person who gave the order! MegaMan: Lan, are you forgetting? Nobody is at SciLab now. Lan: Shoot! You're right! Mr. Prog: WAIT! THE PERSON WHO GAVE THE ORDER...HE IS A METICULOUS NOTE-TAKER! PERHAPS HE HAS IT WRITTEN DOWN SOMEWHERE? HE IS A SUBORDINATE OF DR. HIKARI. THERE MAY BE A NOTE WHERE DR. HIKARI MIGHT GO. MegaMan: You get that, Lan? Lan: Sure did. I'll have your memo in no time! Sit tight, MegaMan! MegaMan: Thanks, Lan! Regain control of Lan, and search for the guy. Go to your father's office and check the coffee table. You get WorkMemo. Lan: There it is! I found it, MegaMan! The data order is "5 3 2 1 4." MegaMan: Roger. Thanks, Lan! Now, come back and operate, please! If you forget the order of the memo, view it under "Key Item" on the PET screen! Lan: Roger! Here I come, MegaMan! Scene 18: MegaMan: Lan, the control panel for the main system...is this way! Lan: And I think the infiltrator will be there, too! Be careful, MegaMan! MegaMan: I will! Here goes nothing! MegaMan comes up to the main processor MegaMan: Nobody home?! Lan: You don't know what kind of enemy you're up against! Don't let your guard down, MegaMan! MegaMan: OK! MegaMan looks around Voice: ...Nice work, MegaMan. You, too, Lan. MegaMan: Who's that?! Show yourself!!! Someone jacks in MegaMan: Y...You can't be... ProtoMan appears MegaMan: What are you doing here, ProtoMan?! Oh, you must be here on an Official mission! ProtoMan: Unfortunately, you're wrong. I'm here to fight you! MegaMan: ProtoMan, wait!!! ProtoMan: That I cannot do! MegaMan: Here he comes, Lan! Lan: Battle routine, set! MegaMan: Execute!!! ProtoMan: You're mine! Scene 19: MegaMan: ProtoMan, enough! What are you after, anyway?! ProtoMan: ...Heh. Congratulations, MegaMan. You've passed. MegaMan: Passed? What's going on?! And where's the Navi that infiltrated SciLab?! ProtoMan: Chaud will give you the full story. Jack out and proceed to the innermost room. ProtoMan jacks out MegaMan: ProtoMan! What in blazes is going on here? I guess we should find out. Lan, jack me out! Scene 20: Lan: ...... Voice: What are you standing around for? Come with me. Lan moves up to Chaud Lan: Oh? Chaud...What are you doing here? The Navi that broke into the main system...was that...? Chaud: Heh...Looks like you're a bit confused. Let me explain just what's going on. You know what's happening on the Net, right? Lan: Yeah... Chaud: In response, we're forming a team of Net Navis to defeat the evil organization that's occupying the Net and free cyber space from its grasp. To keep the enemy from catching on to our plan...We're scouting for team members in secrecy. Lan: So, you mean...This whole thing was just... Chaud: That's right. The infiltration of the main system was a test to determine whether you were fit for the team. Lan: A test? Chaud: Correct. And...You've passed. Lan, MegaMan, join our team. Lan: What?! Er, this is all, so sudden...I... Chaud: You don't want to save your father? Lan: Dad? Do you know what's happened to my Dad?! Chaud: Lan...I'll say it again. Join our team! Together, we can defeat Nebula, the DarkChip Syndicate...which kidnapped your father! Lan: Nebula! So the person who kidnapped Dad is... Chaud: ...Dr. Regal, the mad scientist and leader of Nebula. With him involved, you can bet a nasty plot is brewing. Lan: I...I'm in! I'll join the team! I'll make sure my Dad is safe! Chaud: Good, then it's settled. From this moment, you are officially a member of ProtoMan's Anti-Nebula Corps! But there is little time for formalities...You will join a liberation mission tomorrow. Lan: Liberation mission? Chaud: Yes. We must liberate an area held by Nebula. Free it from its suffocating grasp. Tomorrow we're liberating ACDC Area3. Got it? Lan: Got it! Chaud: Good. I'll contact you tomorrow with the mission time. Lan: Understood. Chaud: And Lan, the team is top-secret. Understand? Lan: nod Chaud: Very well. You are excused. Lan: Uh...Chaud? Chaud: Yes, what is it? Lan: Think...Think my Dad is OK? Chaud: That is undetermined. The only thing we know is that defeating Nebula is the one chance we have at saving me (supposed to be 'him'). You understand? Lan: Yeah...MegaMan, let's head home! Lan runs off Scene 21: Narrator: The next day. Lan: Wow, today we fight Nebula...Hope I can handle it. I wonder why he hasn't contacted me yet? RIIING MegaMan: Lan, it's your phone! Chaud: Lan, the ACDC Area3 liberation mission begins now. You must free the area from Nebula's grip. This time you're in charge of Navi operation. Lan: Navi operation? Chaud, you're not going to fight with me? Chaud: Nebula has blocked standard access to the area slated for liberation. Only one person can operate Navis in an occupied area. I would operate them myself...But I have to command Officials at the national level. Lan: Wait, you mean I have to complete this mission alone? Chaud: That is correct. I have also sent ProtoMan into ACDC Area2. ProtoMan will guide you on the mission. Lan: . . .So, you mean...I'll be operating ProtoMan as well? Chaud: That is correct. Lan: But, I'm not even sure if I can handle that...I... Chaud: If you're having second thoughts, get off the team now. We have no time for doubt. But Lan...I know that not just anybody can handle ProtoMan. But you defeated the mad scientist Wily and his WWW, destroyed the netmafia Gospel, and defeated Regal before. You are not "just anybody." Lan: Chaud...OK, I'll give it my best shot. Besides, I've never run away from a NetBattle before! Chaud: That's the spirit. It's almost time. Jack in and head to ACDC Area2. Lan: OK, gotcha! Chaud: It's in your hands, Lan. Lan: Leave it to me, Chaud! Chaud: That's what I like to hear. kchnk bweepbweepbweep... Lan: MegaMan, are you ready? MegaMan: Yeah, let's go, Lan! Lan: First, let's find ProtoMan in ACDC Area2! Jack in! MegaMan, Execute!!! Scene 22: ProtoMan: There you are. This mission will be carried out by the two of us. We'll be liberating ACDC Area3 which lies past here. MegaMan: Roger! ProtoMan: Lan, you tuned in? Lan: Yeah. ProtoMan: Just like Chaud told you on the phone, the success of this mission depends on your operation. I'm in your hands. Lan: No probs, leave it to me! Let's get this party started! ProtoMan: Very well! I'll show you how yo proceed on this liberation mission. You'll learn the ropes after a couple of battles! Lan: Roger! ProtoMan: Let's go, MegaMan! MegaMan: But how can I open that door...? ProtoMan slashes the door open ProtoMan: It's open now! Now, go! MegaMan: Talk about slice and dice! ProtoMan runs into ACDC Area3 Scene 23: Camera pans around ACDC Area3 ProtoMan: Let's begin a "liberation mission"! This area is controlled by BlizzardMan. Defeating him will free the area but...take a look! gestures to DarkPanels ProtoMan: That's a DarkPanel. It's tainted by DarkPower. You must "liberate" those panels to get to BlizzardMan. MegaMan: "Liberate"? ProtoMan: Stand by a panel and press A Button. Select the command "Liberation." A virus will pop out from under the panel. Deleting these viruses is called "liberation." MegaMan: So I've got to delete viruses as I move ahead. ProtoMan: Each navi also has its own unique Liberation command. WideSword for me. LongSword for you. These let you liberate a big area all at once. Take a look at a gauge at the upper right. Those are "Order Points." You use 1 pt every time you use your special command. Some DarkPanels contain Order Pts so you'll be able to replenish them along the way. MegaMan: I'll go and give this liberation thing a try. ProtoMan: All right. Good luck. Lan, you're the operator so stay sharp! Lan: Leave it to me! ProtoMan: Press R Button if you want to operate a different Navi. Except for MegaMan, each Navi lets you use their special chip just once on the Custom Screen. My special chip is "StepSword." Press L Button to check the area map. Press START if you want to cancel the mission. Lan: Roger! ProtoMan: One more thing. Lan: Yes? camera pans to DarkPanels ProtoMan: Don't liberate if you're in a situation like this. points to the middle square Lan: Why? What's the difference? ProtoMan: The more DarkPanels surrounding a Navi, the harder the battle becomes. Get it? I recommend starting this battle from the lower right. Lan: Gotcha. Understood! Ready, MegaMan? MegaMan: You got it! ProtoMan: Your mission is to liberate within 7 phases. If you manage to pull it off, an Official will give you a rare chip as a reward. Good luck! (I'm purposely ignoring the Tutorial text, I'm a lazy bastard.) Scene 24: ProtoMan: Liberation complete. ACDC Area is now safe. MegaMan: Yup! ProtoMan: But we can hardly let our guard down. We've only freed one part of the Nebla controlled Net. Many fierce battles still lie ahead. MegaMan: Right... ProtoMan: I'll contact you as soon as the next mission is planned. ProtoMan jacks out MegaMan: Let's jack out, Lan! Lan: Roger! Nice work, MegaMan! jack out --------- cut to Regal's Base Dr. Regal: So, they've put the Official hounds on the hunt? Little do they know the Net occupation is just one piece...of the grand plan. Just try and stop us! Keh heh heh... Crony runs in Guard: Master Regal, preparations are complete. Dr. Regal: Very well. I'll be right there. Guard: Please excuse me. Crony exits Dr. Regal: ...Keh heh heh. It's all going according to plan! Regal exits Scene 25: Narrator: Several days passed since Nebula claimed the Net. In this age, the Net represents the seams of cyber society, and it's occupation was a very real threat. cut to park with the gang Yai: First, our PETs were stolen, then a few days later, the Net gets occupied, school gets cancelled... Dex: Yeah, there's nuthin' to do anymore. I can't believe I can't do anything to help Roll. THe more I think about it, the more worried I get. I wonder if Roll is alright? Lan: Poor Mayl... Dex: They'll be OK, Mayl! GutsMan is there! He'll protect Roll for you! Yai: Yeah, and Glide is with her, too!!! Mayl: Yeah...I guess you're right. Yai: How about we go somewhere to get our minds off this? Dex; Hey, that sounds like fun! But I only have my SubPET so let's go somewhere unrelated to Cyberworld! yai: Good idea. Let's go swim in the ocean! I know a deserted island. We could go splash up a storm all by ourselves! Sound like fun, Mayl? Mayl: ...Yeah! Yai: Lan, you'll come too, right? We're depending on you and MegaMan if something happens! Lan: Of course! Leave it to me! yai: Great! Then it's on! Gotta make hay while the sun shines! Let's get going! Dex: What?! We're going right NOW?! Yai: That's right we are! It's not like we have anything to do here in town! Dex: Well, that's true, but... Yai: OK, everybody. Go back to your homes, and once your (you're) ready, meet in front of the station! And step on it! Yai exits Dex: Yeah!!! I'll be ready in a flash! Dex exits Mayl: Yeah, I guess I'll go get ready, too... Mayl exits, but stops- Lan: Mayl!!! -Mayl turns around Lan: Mayl...Try to cheer up, OK? Mayl: Yeah...thanks...Yai must be worried about Glide, and Dex about GutsMan...But they're really trying to keep their spirits up. I've got to do my part and try harder. Right, Lan? Lan: Yeah! Mayl: Lan, you'd better get ready quick, too, or Yai will get upset! Lan: Hah hah, too true! See you in a bit! Mayl: OK! Mayl walks off Lan: This is a tough time for everybody. They lost their PETs, and I have Dad to worry about. MegaMan, we've gotta get Nebula...To save Dad and get everybody's PETs back! MegaMan: We can do it, Lan! RIIING! MegaMan: Lan, it's your phone! I'll get it! Chaud: It's me. Good work on the last liberation mission. Lan: What's up, Chaud? Another mission? Chaud: No, not a regular mission. ACDC Area was freed from Nebula's grasp, allowing private Navi's to visit the area at will. Patrol ACDC Area and make sure all Nebula agents are gone. Lan: A patrol? OK! Leave it to me! Chaud: Also, we're restoring the network deep inside ACDC Area3. I want you to report on the status of that project. Talk to the programs working on the restoration to determine the progress of their task. Lan: OK, OK! I'll leave right away! Chaud: It's in your hands. kchnk Lan: OK, MegaMan! Let's go to ACDC Area! MegaMan: Roger! Scene 26: MegaMan: Hello there! Are you the Mr. Prog that's here to restore the network? Mr. Prog: CORRECT! MegaMan: Is the job coming along smoothly? Mr. Prog: AS SMOOTH AS A FRESHLY DEFRAGGED HARD DRIVE! GOING WELL, BUT NOT QUITE FULLY RESTORED AT THIS TIME! MegaMan: I see. Glad to hear it's going well! OK, let's contact Chaud. Lan: Right. I'll call him. Riiing...Riiing... Chaud: Chaud here. Lan: Hello, Chaud? It's me. I checked the Net! I didn't see any Nebula agents, and the ACDC Area3 network restoration is going smoothly! Chaud: I see. Very well. You may return. Good work. kchnk Lan: That's all he has to say? Sheesh, he sure is a man of few words! Well, that finishes my report. Time to get ready to swim! MegaMan: Yeah, we wouldn't want to make them wait! Let's do it! Scene 27: Lan: Mom! Where's my swimming suit? Haruka: In the second drawer, honey! Lan: MegaMan, where're my goggles? MegaMan: In the closet! Lan: Shoot! I'm running late! Let's get a move on, MegaMan! ---------- Lan: Sorry, guys! Yai: Ahem! Lan! I've told you before not to make a lady wait! Lan: I'm sorry, really! I didn't mean it! Yai: Well, okay...I'll let you off this time. Lan: So, where are we going? everyone looks to Yai Dex: Right, I was wondering the same thing. Mayl: Yeah, where to, Yai? Yai: Today we're heading to the deserted island of Oran! A long time ago, Oran Isle prospered...as a source of coal. But with the demand for coal gone, the mines closed, and the island became deserted. With nobody to bother us...we can have all the fun we ever wanted! Dex: A deserted island! That sounds like a real adventure! Yai: Time to cast sail! All: Hooray! everyone enters the station Scene 28: Narrator: 2 hours from ACDC Town, Lan and friends arrived at the tiny island of Oran in the Pacific Ocean Yai: We're here! Dex: Wow! Time to go crazy! Yai: Shoot, Dex! Not just yet! Everyone disembarks Yai: Welcome to Oran Isle! Mayl looks around Mayl: Wow, it's beautiful! The waters are clear, and the air is crisp! Yai: Heh heh, what'd I tell ya? And we're the only ones here...So, all this bounty is ours for the pickin'! Dex: Look over there! The beach! camera pans to the beach and back Lan: Yahoo! Let's take a dip! Dex: Lan, I bet I can swim faster than you! Lan: I bet you can't! Dex: OK! Last one to hit the beach is a rotten egg! Dex runs off Lan: Hey! No fair, Dex! Lan gives chase, then looks behind him Lan: Mayl, Yai, let's go! Yai: My! Boys never stop goofing off, do they? You go ahead by yourself! We'll catch up to you after we change on the ship. Now, go have your silly race! Lan: There's nothing silly about it! Yai: Sure, sure! Better run along! Dex is waiting! Mayl, let's go inside the ship. Mayl: OK! Yai: Lan, what're you standing there for? Can't stand to part from us beautiful ladies? Lan: What! Are you kidding! See you guys later, then! Mayl: Tee hee hee! Lan runs off Yai: Let's go, Mayl. Both of them go back inside to change Scene 29 (the first part is one of the most BS-ly translated scenes IMO): Lan: Yipee! Can you feel this wind? Dex: Lan, my man! Over here! Get a move on! Lan: Gotcha, Dex! Coming your way! Lan meets Dex on the beach Dex: Where's Yai and Mayl? Lan: They're changing on the ship. Let's suit up and start swimming! Let's see...Where's a good place to change? Dex: Heh heh...I know just the thing for changing into a suit... Lan: Oh, no, you can't possibly... Dex: Yup! The forbidden art of suit-changing...Houdini of the Beach! MegaMan: Lan, what's he talking about? Houdini? Lan: It's a forbidden art passed down from father to son...Remove pants, then wear your suit over your underpants. Then, remove underpants out from under suit...This way, you can change into your suit...Without once getting naked! MegaMan: Er, what makes that a "forbidden art"? Dex: Allow me to explain...On the one hand you can safely change into your suit...But not without paying a dear price. When you remove your suit from beneath your underpants, you're forced to stretch your underpants out, and pull them over each leg, one at a time. Now take it from me! That can be a lot of stretching! More stretching, in fact, than most underpants can stand with each use, your underpants take a beating...Before you know it, your overworked underpants will let out a terrible sound and rip in two. What's worse...Oh I can't bear to say it! Lan: Aieek! Quit it, Dex! Yai: What are you two babbling about? Camera pans to Yai and Mayl, who have changed Yai: Ta-dah! OK, guys, we're going to have a swimming race! So hurry up and get changed! Mayl: Lan, Dex, we're going to get in the water. Lan; Dex, let'sget changed! Dex: ...Yeah, time for Houdini of the Beach! fade out ...rrrip! Dex: Aieeeee! fade back in Dex: Yai said we're gonna have a swimming race, didn't she? Lan: Yeah, she did...Hey, what's that? Camera pans to a rapid moving swimmer Mayl: Wow, Yai, awesome! Yai: How's this, guys? My very own jet-powered inner tube! fade out and back in Yai whacking blindly at Dex Dex: Hey! Hit the WATERMELON, not ME! Yai: Go, Yai, go! Lan: Right! Left! Let him have it, Yai! Dex: I'll get you for this, Lan! Mayl: Tee hee hee! fade out and back in, everyone redressed Mayl: phew! That sure was fun! Yai: Don't talk like it's over, Mayl! The fun has just begun! growl Yai: But first, we've gotta get something to eat! Dex: Hmm...I know! We'll catch some fish for ya! Lan, are you up for a fishing battle? Lan: But how're we going to fish without equipment? Dex: Are you kidding? All you need to fish is Bamboo, FishLine and Worm! We can find that much lying around somewhere! Whoever catches the most fish wins! yai, Mayl--you wait here. I'm gonna get a head start! Dex runs off Lan: Sheesh, that Dex never runs out of steam! bee-bee-beep! MegaMan: Lan, you've got mail! It's an order from Chaud. Let's step away and read it out of sight of mayl and Yai... Lan: Right, sure...Hmm, maybe I'll go find some stuff to fish with... Yai: We're NOT counting on you but good luck anyway. Mayl: Be careful! Lan: OK, catch you later, then. Scene 30: ProtoMan: The area this way is the next area slated for liberation. MegaMan: ProtoMan! ProtoMan: But Nebula's not likely to roll out a red carpet for us... Camera pans to three guns ProtoMan: But there's no way through except on this path. MegaMan, let's roll. MegaMan: nod! ProtoMan: Let's roll! They approach the guns, which fire a brutal beating on them MegaMan: What firepower! We can't get through that. They are pushed back ProtoMan: To get through here, we'll have to block that barrage of fire but how can we do that with our present shields? We'll have to pull out and rethink our strategy this time. Jacking out. ProtoMan jacks out MegaMan: We can't begin this mission without a way to handle that barrage of fire. Let's jack out, Lan. We've got to fish with Dex, anyway. Lan: Yeah, no sense in wasting our energy here. Let's jack out and get back to fishing! Hopefully we'll think of a strategy in the meantime. MegaMan jacks out Lan: OK, time to search for fishing supplies! Scene 31: Dex: Looks like you managed to find some fishing supplies! Now you need to find a good fishing spot and cast away! May the best man win! (That's me!) Run to the dead end far to the left. Lan: This looks like a good spot. I'm gonna catch a real whopper! MegaMan: Good luck, Lan! Narrator: 10 minutes later... Lan: Shoot! Not even a nibble! MegaMan: Don't get down, Lan, fishing takes patience! Just relax! They'll come eventually. Lan: Shoot, this really does take a lot of patience...And I don't know how much more patience I have! Dex: Wow! Another one! I've got five already! Lan: Dang that Dex! He's yelling like that on purpose! I won't lose to him! MegaMan: That's the spirit, Lan! Narrator: 30 minutes later... Lan: Dang! Still not a nibble! Dex: Yipee! I got a dozen already! Lan: Shoot, can't just a single fish come my way? MegaMan: Don't worry, Lan, your number'll come up soon enough! Lan: I dunno, I'm beginning to lose hope. Hm? Hey! What's this?! line is tugged hard Lan: Wh-wh-wh-whoa! It's a big one! MegaMan: Lan, reel it in! Lan: Whoooah! It's strong as heck! MegaMan: You can do it, Lan! Lan: Hrrggraah! Line snaps, big fish Lan: Oh, boy... MegaMan: You tried your best, Lan... Lan: Aw, shucks... Scene 32: flash back to the beach Lan: It's true! It was practically a whale! Dex: Heh, you sure it wasn't a chunk of driftwood? Anyway, you LOSE! And now it's time to eat my fish, so it's your job to start the fire! Lan: Aw, man! Dex: Don't complain! You lost! you can't complain to me, the WINNER! I have a lighter, so you get some firewood. Go find some DryGrass, Twig and Board! Lan: Hmph! Yeah, OK, your Majesty, Dex... earthquake Lan: Whoa! Was that an earthquake? Yai: The gods are telling you to hurry up and get firewood! Mayl: Good luck, Lan! Dex: Hah hah hah! Now, off with you, Lan! Lan: Hmph! Scene 33: Lan: OK, guys, here it is. Dex: Wow! Not bad, not bad! Now let's cook up some fish! fades out, back in after they've eaten, a small fire burning Dex: phew! THat was delicious! Food is twice as good when you work for it! Right, guys? Mayl: It was great, even without seasoning! I guess you can't go wrong when the fish is this fresh! Yai: Most of my meals are cooked by world-class chefs. I never knew such primitive food could taste so great! Lan: Dang! I sure wish I'd caught that fish... Dex: Well, know that our stomachs are full, it's time for an island trek! And guess what? I found a path that leads into the forest! Yai: Really? I must say, that's intriguing! Mayl: And a bit spooky, but it sounds like fun! MegaMan: A trek? That does sound like fun, right Lan? Lan: Yeah! Anything to get my mind off that silly fishing! Dex: OK, everybody, follow me! And we're off! Dex sets off Yai: Mayl, let's go! Mayl: OK! Lan, let's go! Lan: OK! Yai: Oh, yeah, Lan? Make sure the fire's out. Got to be safe! Lan: Huh?! Why me?! Yai: You've already forgot who lost the fishing contest? Mayl: She has a point, Lan! Lan: Wait, Mayl?! MegaMan: Let's just get it done, Lan! Lan: If you say so, MegaMan... Yai: We'll run ahead, so hurry up! Mayl: See you soon, Lan! Both Mayl and Yai set off Scene 34: Lan: Dex! Hold up, willya...Whoa! Camera pans to an abandoned mine Dex: Incredible, ain't it? Mayl: Is this the OldMine Yai was talking about? Yai: It sure is! Once an active OldMine, now it's entirely abandoned. The tunnels dug long ago form a vast maze. Dex: I know! This'll be the Dex Expedition Team's next conquest! Yai: Yipee! Mayl: Yay! Lan: I don't remember joining any Dex Expedition Team...But it sounds like fun...Yahoo!!! Dex: Alright, everybody, be ready for anything! Next stop, the dark reaches of the cavernous maze! All: Yaaaay!!! Dex: Fellow explorers, onward march! All proceed to the mine, but stop Dex: ...Huh? Trap hole appears under everyone but Lan, drops them Lan: Yikes! Lan moves to the hole Lan: Are you OK?! Dex: Hellooooo!!! Lan: Dex! Is everybody OK? Dex: Yeah, we're fine! This hole is connected to the OldMine. We'll look for an exit! Lan: OK! I'll come looking for you! We'll need to stay in contact with each other! Is your SubPET working? Dex: It's working! I'll contact you if anything happens! See ya sooN! Lan: Be careful! MegaMan: Lan, then you're going into the OldMine? Lan: Sure am, MegaMan! MegaMan: OK! Be careful! Scene 35/36/37/38: MegaMan: Lan, it's your phone! Lan: Dex?! Where are you?! Dex: We're still in the OldMine! We're heading in the direction of a breeze. Lan: Gotcha. Be careful in there! Dex: You bet! We'll contact you later! Kchnk Lan: MegaMan, time to jack out! Let's find Dex! MegaMan: Roger! ---------- Lan: What's that sound?! gigantic quaking Lan: Yikes! It's an earthquake! subsides Lan: Phew! It stopped. Wait! I wonder if everybody's alright? lays in a call Lan: Dex! Dex! Are you OK? Dex: Yeah, we're still in one piece, dude! Lan: Really? Good! We'd be in big trouble if this place caved in. Dex: That's for sure. Be careful, Lan! Lan: Yeah, you too! ---------- Lan: Alright! Let's get moving! RUMBLE RUMBLE shaking Lan: Whoa! Another earthquake! But why so many? subsides Lan: Phew, it finally stopped. But doesn't their frequency seem strange to you? MegaMan: It sure does, Lan... RIIING! MegaMan: Lan, it's your phone! Dex: Lan, do you read?! Something's wrong with...SubPET...not just...OldMine, even May...d Yai's...not too... kchnk bleep bleep bleep... Lan: Dex! Dex!!! Disconnected? MegaMan, let's hurry and find them! Hold out just a little longer, guys! ---------- RIIING! MegaMan: Lan, it's your phone! It's Dex! The connection's been restored! Lan: Dex! Dex!!! Are you alright? Dex: Yeah, we're OK. But not for long! Lan: Not for long?! What do you mean?! Dex: During that last quake the door shut and trapped us in. It's shut tight with an electronic lock. Lan: Gotcha. Sit tight! I'll be there before you know it! Dex: Cool, Lan! Don't keep us waiting! Lan: You bet! RUMBLE RUMBLE more quakes Dex: Yikes! Lan: Dex, what happened?! Dex: A...A drill just busted through the ceiling! Yeowch, it's raining rocks! At this rate, the ceiling will cave in on us! Lan: A drill came through the ceiling? So, that's what all those "quakes" were! MegaMan: The question is, who's controlling the drill! If we knew that, we could shut it off! Lan: You're right! Dex, hold out just a little longer! Dex: OK, Lan! Ball's in your court! Lan: Leave it to me! Let's go, MegaMan! quakes subside Scene 39: Voice: Aieeek! That CEO just makes me downright mad! What a lousy fool! quake Lan: Who goes there?! camera pans to the drill and an angry woman, Lan moves up and confronts her Lan: Hey you!!! Stop that drill! (Angry woman is Tesla Magnus) Tesla: ...... Lan: Stop that drill right now! Tesla: ...... Lan: Stop that drill, PLEASE! Tesla turns to Lan Tesla: Now, that's better! I'm 29 years old! Maybe twice your age so do pay a little respect! Besides...What are you doing here? I have stress to work off! Just leave me alone! Lan: Wait, listen to me! Er, please! My friends are below that drill! Tesla: Why should I care! Your friends had no business wandering in here anyway! Lan: You're right but they're in danger! PLEASE! Tesla: If you're that set on stopping this electro-drill, then do it yourself! See those control boxes? Camera pans to each of the four control boxes Tesla: If you jack in and press the control switches inside...you'll activate the manual shutdown. There are 4 boxes. To stop the drill, you have to press all 4 switches! Lan: Shoot! This could be trouble. Let's go, MegaMan! MegaMan: Roger. Jack me in! Tesla: Think of it as punishment...For interrupting my de-stress session...and for not saying "please"! RIIING! MegaMan: Lan, it's your phone! Dex: L...Lan! Help us!!! Camera pans to the chamber underneath, where the rest of them are panicking from falling rocks Dex: Aieegh! Mayl: Eeek! Yai: HEEELP!!! Camera pans back up to Lan Lan: Just a little longer! I'll have you out in no time! MegaMan, look for the control switches! Jack in! MegaMan, Execute!!! ---------- MegaMan: The drill's control system... Narrator: MegaMan pressed the control switch!!! The drill slowed down!!! phase to Lan, the thing moves out of the way Lan: OK, we've activated one of the control switches! Any better, Dex? phase to the others Dex: The drill's slowed down a bit, but we're still in big trouble! phase back to Lan Lan: Don't worry, Dex, Mayl, Yai! We'll get through this! MegaMan, jack out! MegaMan: Roger! Jack me in to the next control box! Lan: You bet! ---------- MegaMan: Stopping the drill! Narrator: MegaMan pressed the control switch!!! The drill slowed down!!! phase to Lan, the thing moves out of the way Lan: OK, we've activated another control switch! Are you OK, Dex? phase to the others Dex: We're dancin' for dear life! But we won't hold out for long! phase back to Lan Lan: Just a little more, guys! MegaMan, jack out! MegaMan: Roger! Jack me in to the next control box! Lan: Let's move it! ---------- MegaMan: Stopping the drill! Narrator: MegaMan pressed the control switch!!! The drill slowed down!!! phase to Lan, the thing moves out of the way Lan: OK, we've activated another control switch! Any better, Dex? phase to the others Dex: The drill's slowed down quite a bit, but I can see cracks running across the ceiling! We'll be buried in rubble in no time! phase back to Lan Lan: MegaMan, jack out! We've gotta stop the drill before our friends are hurt! MegaMan: Roger! Jack me in to the last control box! Lan: Let's do it! Scene 40: MegaMan: Stop this drill! MagnetMan turns to you MagnetMan: Who are you? MegaMan: MagnetMan! Lan: MagnetMan? That's Gauss' Navi! Gauss is the netmafia operator we beat before! Tesla: Then it was you! You defeated my father! Lan: What? Tesla: I'm Gauss' only daughter, Tesla! Lan: No way! Tesla: It's your fault! You'll pay for what you did! Lan: OUR fault? But Gauss was the one stirring up trouble?! Tesla: Don't get me wrong! I couldn't care less...about you getting Dad arrested! That was his own fault! It's what you did AFTER he was arrested! I was supposed to succeed my father...running his corporation. I managed to get some work done thanks to MagnetMan, but I was so busy my hair nearly fell out from all the stress! And it's just ruined my beautiful skin! Lan: That sounds a lot like a big excuse to me! Tesla: MagnetMan! Trash taht little blue man! Hee hee! Finally a chance to burn some stress off! MagnetMan: Anything for you, Tesla. MegaMan: Lan, here comes! Lan: Battle routine, set! MegaMan: Execute!!! MagnetMan: Max magnet power! Scene 41: MagnetMan: Hrgg...! MegaMan: MagnetMan, press the switch! MagnetMan: Why you...! You don't have me yet! Tesla: MagnetMan, stop right there! MagnetMan: But, Tesla! Tesla: That was an incredible fight, MagnetMan. I must've worked off a decade of stress! Now, go ahead and push that shutdown switch! MagnetMan: If Tesla so desires...But, MegaMan, don't go thinking you've seen the last of me! MagnetMan presses the shutdown switch MagnetMan: Shutdown switch...activated... vreeeen MagnetMan: The drill was shut down. Tesla: MagnetMan, jack out. MagnetMan: Yes'm! MagnetMan jacks out Tesla: You're name's Lan, right? You'd better hurry and rescue your friends! That nearby path will take you down below! Lan: Right! I've gotta bust them out! MegaMan, jack out! MegaMan: Roger! jacks out Take the path to an elevator down to another area and up to a door. Lan: Dex! Mayl! Yai! Are you guys OK? I'll get you outta there! Dex: Lan! I knew you;d come through for us! Mayl: Lan!!! Yai: I thought we were done for! MegaMan: Lan, jack me in! I'll disable the electronic lock! Lan: OK, MegaMan! There's gotta be a switch somewhere inside! Jack in! MegaMan, Execute!!! Scene 42: MegaMan: This must be the release switch. Pressing the switch now! Alarm: ILLEGAL OPERATION! ACTIVATE SECURITY SYSTEM! gigantic earthquake MegaMan: What?! subsides (Rock barrage moves in, MagnetMan jacks in and shouts "MagnetBarrier!!!") MegaMan: MagnetMan!!! But, why?! MagnetMan: Tesla's orders. You think I'd help you otherwise? rock slide subsides MagnetMan: The security system is off. MegaMan: Thank you, MagnetMan! MagnetMan: Hmph! Thank Tesla, not me. By the way, the electronic lock was released. MagnetMan jacks out MegaMan: Lan, jack me out! Lan: Roger! MegaMan jacks out Lan: Thanks a lot! Tesla: Don't mention it! Hurry and save your friends! Lan: Hey! door opens Lan: Everybody! Dex: Oh! Lan! I knew you could do it! Mayl: Lan...Thank you. Yai: Sheesh, I thought we were in for it! I don't want to stay here another minute! Lan: Wow, I'm sure glad everybody's OK! earthquake Tesla: You kids had better get a move on! The whole thing could cave in at any moment! Yai: Hey, that's the missus of Gauss, Inc.! I saw here (her) before at a party...Why in the world is she here? Lan: I'll explain later! For now, let's jet outta here! Everyone leaves, Tesla stepping aside Tesla: Let's go, too, then. Lan: Oh! RIIING! MegaMan: Lan, it's your phone! Chaud: It's me, The Nebula agents occupying Oran Area, are planning another attack on ACDC Area. Lan: No way!!! Chaud: We must nip Nebula's plans in the bud. We still don't have a strategy for the gun battery...on Oran Area1 but we have no choice except to proceed. Begin mission immediately. Head to Oran Area1 now. It's in your hands. kchnk Lan: But how in the world are we going to guard against...that incredible Nebula gun battery? ...Guard...I know! Tesla, could I ask you a favor? Tesla: A favor? What on earth is it? Lan: The Net's occupied by a group called Nebula. I belong to a team whose job...is to free areas under Nebula control. I'm going into a battle with Nebula forces...But I can't succeed without MagnetMan's help! Tesla: Wow, a team? That explains why you're so strong! Very well. I'll have MagentMan lend you his power. Besides, Nebula has given our company its share of trouble. MagnetMan: But, little missus! Tesla: MagnetMan, pray tell you're not about to disobey me? MagnetMan: ...Why! I would never! Tesla: Well, there you have it, Lan! MagnetMan is all yours! Lan: I owe you one! OK, we're going to Oran Area1! Tesla: OK! My MagnetMan won't fail you! MegaMan: Lan, let's hurry to the Net! Lan: Yeah! fade out Scene 43: ProtoMan: There you are. MegaMan: ProtoMan! I think I know a way we can beat the gun battery! ProtoMan: Is that so? MagnetMan jacks in MagnetMan: Ah, so you want me to block that gun battery? Well, if it isn't the Official Navi, ProtoMan. I wouldn't normally be willing to help you...But I have orders from Tesla... MegaMan: This is MagnetMan. His defense is incredible! ProtoMan: MagnetMan...The ex-Gospel Navi. Quite a surprise! Let's see what you've got, then! MagnetMan: Very well. I'll give you something to talk about! ProtoMan: MegaMan, let's go! MegaMan: Yeah! the three approach the guns ProtoMan: MagnetMan, proceed on my signal! I'll destroy the gun battery while you're absorbing hits! MagnetMan: Don't order me! I only listen to Tesla's orders. ProtoMan: Sheesh! Here goes! 3, 2, 1...Go!!! The three move in MagnetMan: MagnetBarrier! MagnetMan absorbs the gun blasts ProtoMan: Now! StepSwrd! ProtoMan slices the guns to shreds ProtoMan: Quite impressive. MagnetMan: That was nothing! ProtoMan: Heh! Let's go! Begin mission! MagnetMan: This'll be fun! ProtoMan and MagnetMan go Lan: MegaMan, let's go, too! MegaMan: Yup! Scene 44: ProtoMan: This area is controlled by the Darkloids. That guy! Camera pans to ShadeMan MegaMan: ShadeMan! ShadeMan: Long time no see, MegaMan. Heh heh! The DarkPower has resurrected me! ProtoMan: He's the one who spread DarkChips! Get him! Watch out for his flying capability! It lets him attack from any direction during the Darkloids' phase. MegaMan: So we'll be getting hit all the time? ProtoMan: Don't forget. One of us is really strong at defense! MagnetMan: My MagnetBarrier is strong enough to shield the whole team during that phase! ProtoMan: Did you all hear that? Complete the liberation within 9 phases! Good luck! Scene 45: ProtoMan: We managed to free the Net from Nebula this time but many fierce Navis continue to fight on their side. MagnetMan, won't you take up the good fight and join us? Your defensive powers would be a great asset to us. MagnetMan: You must be joking. I would never willingly fight at your side. Even this time, if it weren't for Tesla's orders... Tesla: I think it sounds great, Magnetman. Nebula's given us plenty of trouble. In fact, the prime cause of my stress these days. If it would help punish Nebula, I say, join up! MagnetMan.please.pretty.please? MagnetMan: Y...Yes'm... ProtoMan: Heh. Then it's settled. MagnetMan: Er...Ergg...Very well. MegaMan: Hee hee! MagnetMan: Hmph! ProtoMan: Well, you may not care to hear me say this, but welcome to the team. MegaMan: Good to have you with us, MagnetMan! My soul resonates with your staunch defensive power! Narrator: MegaMan's soul resonated with MagnetMan! MagnetMan: Hmph! ProtoMan: Heh. I shall be contacting you again. jacks out MegaMan: Lan, let's jack out, too. Our friends must be waiting for us. You too, MagnetMan! MagnetMan: Just my luck...jacks out MegaMan jacks out Scene 46: Tesla: I regret what I did. When I get irked, I just can't control myself. I'm really sorry. Dex: Yeah, I thought we were done for! But now, that I think about it, we were partly to blame for wandering into the OldMine in the first place! Mayl: At least nobody got hurt! Yai: And I heard that you lent your power to Lan...so he could come and save us. It was all good fun, now that we're safe and sound! Tesla: Well, thanks for being so kind. You'd better get going soon before the seas get rough. Lan: Let's get going! Dex: OK! See ya around! Mayl: Goodbye! Yai: Farewell! Tesla: Hope to see you soon! Everyone but Lan boards the boat Lan: Until our next mission! Tesla: Indeed! Lan: OK, see you! Lan boards boat flash to a dark screen Regal: There's a band of petty resisters puttering around and liberating the Net areas we've secured. Dr. Hikari: Rrgh... Regal: The research must be completed before we're interrupted. Dr. Hikari, perhaps it's about time you'll tell us? Dr. Hikari: I...I know nothing! Regal: I'm a bit short on time. I'd rather not show you my bad side. Where is the prize that was entrusted to you? Dr. Hikari: I told you, I don't know! Regal: Yes, of course, it's possible that you've forgotten...after all, it has been a while. Will this help you jog your memory? click zzzhhkt! zzzhhkt! Dr. Hikari is shocked Dr. Hikari: Aieeghh! Regal: Impressive resolve. But it could be your downfall! Dr. Hikari: Rrgh... Regal: I'll ask again in 1 hour. For your sake, I hope you remember. CloudMan! CloudMan: Yes, Master! Regal: That pesky team of resisters will breach your area soon. CloudMan: I understand, Master. Regal: Concentrate your forces on the blue Navi. CloudMan: Yes, master, I swear my memory banks on it. Regal: MegaMan...A pity that we must delete you... Scene 47: flash to in front of Yai's house, with the group Yai: Goodbye! Dex: That ultra triple scoop sundae was great! Mayl: It sure was! Thanks Yai! Lan: Sure is nice to have such generous friends! Yai: Hee hee! You're welcome anytime! Dex: See you around! Mayl: Goodbye! Lan: Later! They depart, Lan with Mayl Mayl: Yai's doing her best to stay chipper...But deep down inside I know it's hard for her. Lan: Yeah...Same to you, Mayl...Don't overdo it. Mayl: Lan...Lan, thanks. We're gonna to be fine, I know it. See ya later! Lan: See ya. Mayl walks home Lan: Dad... Voice: Lan the NetBattler... Lan turns toward the voice Lan: Who's that?! The man walks up to Lan, revealing himself to be Charlie. Charlie: You're Lan, right? Lan: Who are you! Are you a Nebula operator? Charlie: Nebula? Shoot, do I really look that evil? Lan: What do you want?! Charlie: Now, now, just calm down. Let's go somewhere we can talk. Lan: nod flashes to the park Lan: What are we doing here? Charlie: Now, just calm down. I'm not going to hurt you. I just have a certain interest in you...the both of you. Lan: The two of us? YOu mean MegaMan and me? Charlie: Exactly! I wish to see your technique in action. Lan: And what makes you think we'll show you? Charlie: Hmm...Tell me, would you have the same attitude...if I told you I had some information on your father? Lan: What?! Charlie: Not that you'd choose to believe me. Lan: What do you want us to do? Charlie: Not much. Jack in to this squirrel and find my navi. He's all the way in the back of the SquirrelCmp. Are you ready to go? Lan: Fine. I'll jack in to your squirrel if that's what it takes. LEt's go, MegaMan. MegaMan: Yeah. We don't know what he's after but he could tell us something about Dad. Gotta try our luck. Lan, let's do it! Lan goes to the squirrel Lan: Jack in! MegaMan, Execute!!! MegaMan logs in and gets an e-mail alert. MegaMan: Lan, you've got mail! It's from Chaud. Lan: Shoot, just as things were getting started. MegaMan: Yeah, I know, Lan! Just let me read it! "At the end of the last liberation mission, a resonance betwen MegaMan and MagnetMan occurred, allowing MegaMan to gain a new ability. According to Dr. Hikari's files, when MegaMan's soul resonates with that of another Navi's, the synchronicity of the souls that is achieved temporarily, gives MegaMan that Navi's abilities. It is called DublSoul, and should be very useful in your battles. I've attached a practice program. Master this new technique immediately!" Wow! I'll open the attachment! Lan: DublSoul? I'm in a rush but this I can't put off for later! Let's do it, MegaMan! (Soul Unison Tutorial. I'm lazy. You know. Good. I hope so.) Scene 47: GyroMan: Ah, there you are! MegaMan: So you're his Navi... GyroMan: Yep! You got here pretty quickly. I'll have to give you credit. MegaMan: What do you guys want?! GyroMan: Heh, wouldn't you like to know! fade out to real world Charlie: Hah hah hah hah! Well done, well done! Lan: Are you satisfied? Now, tell us what you know about Dad. Charlie: Yes, I almost forgot! What I found out is...Nebula kidnapped your father...in order to capture a certain "thing" that he has. Lan: Something my Dad has? But what? Charlie: Couldn't tell you. This is all I know. Lan: That's it?! Charlie: Yes, that's it! Hey, come on home! GyroMan: Roger! Charlie: Lan, you have quite some technique. But you rely too much on your Navi's abilities. Lan: Rrgg! Not even! I'd do just as well, even without MegaMan! MegaMan: Lan, what kind of a thing is that to say? Our strength lies in our synergy! Lan: MegaMan, you're the best Navi I could have but did you hear what he said? Who wouldn't get mad! Charlie: Well, it wasn't hard to cause a rift between you. It only goes to show just how far you are...from being strong enough to defeat Nebula. Until we meet again! Adios! Charlie runs off Lan: W...Wait! Who was that, anyway? And what is this "thing" that Dad has? bee-bee-beep! MegaMan: Lan, you've got mail! It's from Chaud. I'll read it! "Nebula agents still remain in Oran Area. Immediately make your way to Oran Area. However, Oran Area network is unstable. You will not be able to jack in from Oran Isle. Go there by way of ACDC Area." Wow! Nebula's come to occupy Oran Area again! We must hurry, Lan! Lan: Just when I thought we'd finished with that stranger, Nebula agents strike again! This is too much! Scene 48: RIIING! MegaMan: Lan, it's your phone! Chaud: I see you've arrived in Oran Area. There are 6 remaining Nebula agents. They're hidden in Oran Areas 1, 2, and 3. Find all 6 and delete them, then contact me. Good luck. kchnk Lan: MegaMan, let's go find the remaining Nebula agents! MegaMan: Roger! Scene 49: MegaMan: Lan, we've taken care of all the remaining Nebula agents. Let's contact Chaud. I'll call with the phone! Riiing...Riiing... Chaud: I see you've finished. Now go restore the network...in the deep reaches of Oran Area3. We need it to gain access to SciLab Area. On the next mission, you'll be liberating SciLab3. Lan, I want you to check the route to SciLab3. Lan: I understand. But Chaud, can't we just enter SciLab area from SciLab? Chaud: Yes, there is a route to SciLab area in SciLab. However, if we liberate that access route...We'll be inviting agents in SciLab area into SciLab. That's why we're blocking net access from SciLab. We'll have to use the Net to liberate SciLab area. Lan: I see. OK, so I'm to restore the network in Oran Area3 and check the route to SciLab3 for the next mission? Chaud: That is correct. kchnk Lan: MegaMan, we're gonna restore the network in Oran Area3! MegaMan: Roger! Scene 50: MegaMan: This way leads to SciLab Area. Like he said, the network is blocked. OK, let's restore it! Voice: Fat chance! MegaMan looks toward the source of the voice MegaMan: Who's that?! A HeelNavi jacks in in front of him MegaMan: Nebula! HeelNavi: Keh heh! And you know what Nebula does best? Deletes pesky Navis! MegaMan: Lan, here comes! Lan: Leave it to me! Battle routine, set! MegaMan: Execute!!! HeelNavi: You're regret that you ever stepped foot into this area! Battle: 2 BattyEX, MettEX. Win... HeelNavi: Tsk! Why you! I'll get you for this! jacks out MegaMan: Who would've thought we'd encounter more Nebula agents? Lan: I guess you have to stay on guard when you're on the Net. We have to keep forging ahead! MegaMan, restore the network! MegaMan: Roger! phases out then in again MegaMan: Lan, network restoration complete! Lan: OK! Time to enter SciLab Area! MegaMan: Roger! enters link A navi, later revealed to be GyroMan, jacks in GyroMan: ...... jacks out Scene 51: MegaMan: This leads to the next area slated for liberation. Lan: What's that cloud-like thing? Can we make it through? MegaMan: I'll try. Here goes! He charges in, pushing the first cloud back, but it rebounds and shoves him back Lan: MegaMan! Are you OK?! MegaMan: Yeah, I'm fine...But this cloud's DarkPower is blocking the way! RIIING! Lan: It's phone! Chaud: I see you've arrived at your destination. Describe the surroundings to me. Lan: The route to SciLan3 is blocked by a dark cloud. Chaud: A dark cloud...I see. That could be some trouble. The DarkPower is spilling over...Very well. Lan, head back for now. Lan: Roger. kchnk Lan: MegaMan, jack out! MegaMan: OK! jacks out GyroMan flies up to where MegaMan was GyroMan: That was enough to keep them out? Just pitiful. ......Charlie, what do you think? Charlie: Well, no need to rush to a decision. Let's continue observing them. Scene 52: Next day... Lan: We restored the network that leads to SciLab Area but we couldn't make it to the occupied area. MegaMan: Yeah. I guess we'll just have to see how things develop. Lan: I just can't stand knowing that our enemies...Are right around the corner but we're not able to act! MegaMan: I know what you mean. bee-bee-beep! MegaMan: Lan, you've got mail! It's from Tesla. I'll read it! "Lan, I'm afraid I'm in a bit of trouble. A helicopter Navi came and challenged me to a battle, saying he wanted to test my abilities. But he stole some vital MagnetMan programs! Please come to the drill in the OldMine!" Wow! A helicopter Navi? That's the Navi we met in SquirrelCmp! Lan: First us, then Tesla? Just what is he up to? At any rate, we've got to help MagnetMan. She said they were at the drill, right? Let's head for Oran Isle! Scene 53: Lan: Tesla! Is MagnetMan OK? Tesla: Lan, thank goodness you're here! Like I said in the mail, he really got me good! That helicopter jerk stole MagnetMan's programs for thought, speech, movement, and attack. He scattered them inside the DrillComp! Now MagnetMan can't speak, think, move or attack! It's just awful, Lan! Lan: I see... MegaMan: But he chose not to delete MagnetMan, which proves he's not an agent of Nebula. Tesla: Did that Navi visit you, too? Lan: Yeah. Just what are they plotting? MegaMan: I don't know but for now, let's find MagnetMan's program! Lan: Yeah, we can figure out this mystery later. OK, Tesla, we're off! Tesla: Lan, thank you so much! Lan: We'll get those programs back, Tesla! Let's go, MegaMan! MegaMan: OK! Scene 54: Lan: Tesla, we found all 4 programs! Hurry and reinstall them into MagnetMan! Tesla: Yes, of course! phases in and out Tesla: MagnetMan, reboot! . . .MagnetMan, MagnetMan! . . . . . . . . . MagnetMan: Tesla...I am terribly sorry. I have failed to perform my duty! Tesla: You don't have to apologize, MagnetMan. But you should thank Lan and MegaMan! They're the ones who found your stolen programs. MagnetMan: Ngg...Ergg...I never imagined this day would come...Er...Thank You. Lan: Don't mention it! We could do for a teammate! Right, MegaMan? MegaMan: Yup! But shoot, that Navi must be something else, to be able to slip past MagnetMan's tough defenses! MagnetMan: It was all over before I knew what was happening. His incredible speed and agility...he's no ordinary Navi. Voice: Well, what a pleasure to hear such kind words! Camera pans to the entrance, Charlie enters Charlie: Hello! How is everyone? Your team has power and technique but is a bit lacking in speed. The only one on your team who passes on speed is the leader. Lan: You went to Chaud, too?! Charlie: And a very capable leader he is. We almost got in to a bit of trouble but we managed to run! Lan: Just what are you trying to pull, spying on us every chance you get! Charlie: Keh. We're just bored, Lan, just bored! Tah tah! Charlie exits Lan: Wait! pursues, returns He sure knows how to beat a quick retreat! MegaMan: Lan, we'd better report this to Chaud? Lan: You're right. Chaud might know something about them. See you, Tesla. We're going to get going. Tesla: OK. Be careful. I have a feeling we haven't seen the last of him. Lan: Right. Scene 55: Lan runs up to Chaud Lan: Chaud! Did a helicopter Navi come here? Chaud: Yes. He made it all the way here. Then he slipped away in a flash. I take it he paid you a visit as well, then. Lan: Wow, he got through the security of this place? Do you know who they are? Chaud: The operator is Charlie, an ex-ace copter pilot...who once belonged to the Netopia team, the Red Thunders. He's now a freelance pilot who drifts between countries. His Navi, GyroMan, is one of the best in Netopia when it comes to speed and agility. Lan: A helicopter pilot? What reason would he have to bother us? Chaud: Only he would know the answer to that. This is all that we know at this time. Without more data, we'll just have to stay alert. Lan: I'll be careful. alarms go off Scientist: This is ObservRm 7. Chaud, do you read? Nebula is on the move! SciLab Area net corruption will be upon Oran Area! Chaud: Understood. Lan, head for the Net. Nebula is contaminating the Net. The Oran Area net has likely taken a big hit. You'll have trouble jacking in from Oran Isle. Take the route from ACDC Area. Lan: Gotcha! We're right on it! Chaud: Do not underestimate your foe. Lan: nod Scene 56: MegaMan enters Oran Area1 to find GyroMan waiting GyroMan: I knew you'd come, MegaMan! MegaMan: GyroMan! GyroMan: Well, well! You've checked up on me, have you? I suppose you know about Charlie, as well? Lan: We sure do! Charlie the ex-ace copter pilot! Charlie: Well, well! Word certainly gets around these days! Well, shoot, now you know my ordinary background, you can just call me Charlie, I suppose! Lan: Charlie! What are you after? Charlie: Hmm...I'll tell you if you can catch GyroMan! GyroMan! Go! GyroMan: Roger! GyroForm! GyroMan transforms into a copter GyroMan: Catch me if you can! The copter flies off MegaMan: Lan, time for a chase! Lan: Yeah, I've had enough of their games! ---------- GyroMan: Faster than I expected! Next, this way! That is, if you can keep up! GyroMan flies off MegaMan: Wait! Lan, let's keep after GyroMan! Lan: You bet! ---------- GyroMan: I was beginning to wonder if you were coming! Next stop, SciLab Area! GyroMan transforms MegaMan: Wait, GyroMan! GyroMan: Why should I? GyroMan flies off Lan: Shoot! He slips away like a snake! MegaMan: And he's as fast as a cheetah! Lan: No time to stand in awe! We've gotta go after him! MegaMan: Oh, right!!! ---------- MegaMan: pant pant How long are you going to avoid facing us? GyroMan: I'm not avoiding anything. I could take you on right now if I... Charlie: GyroMan, stop. I'm enjoying this game of tag! GyroMan: Yes, I understand. Like master said, time for more tag! GyroMan flies off Lan: Why you...! MegaMan, we're gonna nab GyroMan once and for all! MegaMan: Roger! ---------- GyroMan: You've come far! MegaMan: No more running away for you! GyroMan: Charlie, are you getting this? What's the word? Charlie: Hmm, yes, enough playing around! Let's show them how much more you can do than run! GyroMan: Roger! Lan: MegaMan, is coming! Prepare yourself! MegaMan: OK! GyroMan: This'll be great fun! Lan: Ready, MegaMan! Battle routine, set! MegaMan: Execute! Scene 57: MegaMan: Had enough yet? GyroMan: Yes, impressive in fact. More than we expected, right Charlie? Lan: What are you two talking about? Charlie: Now, do calm down, Lan. You have won. GyroMan, I think they make the grade. GyroMan: OK. That's what I thought you'd say. MegaMan: Make the grade? What grade? GyroMan: We'll become your allies. Lan: Huh? Charlie: He means we're willing to join your team! Lan: No way?! Charlie: Yes way! I came all the way from Netopia to fight Nebula at Chaud's request. ProtoMan jacks in ProtoMan: We didn't want to withhold information from you but Charlie insisted that he be allowed to test you. MegaMan: ProtoMan! ProtoMan: Well, GyroMan, Charlie--did they meet expectations? GyroMan: Over and above! Right, Charlie? Charlie: Yes. A fine operator and an excellent Navi. Hope you welcome us onto the team! Lan: You've got to be kidding me, guys! We're just getting tested all around...Ah, well! Welcome to the team! GyroMan: Shall we go ahead and do our first job? MegaMan: First job? GyroMan: I'll open the route to the next area to be liberated. It's the path that you couldn't get through. MegaMan: You were watching?! GyroMan: Yeah, it really sent you flying! That kind of thing is right up my alley. Let's head out! ProtoMan and GyroMan run off MegaMan: Lan, let's go, too! Lan: Yeah! Scene 58: ProtoMan: GyroMan, can you handle it? GyroMan: Leave it to me. There's a key point that'll take the whole thing out. camera pans to a DarkChip at the end and back GyroMan: Here goes nothing. GyroForm! GyroMan transforms into a copter GyroMan: 3, 2, 1, GO! The copter proceeds and stops above the chip Target located! It's a DarkChip. Be gone! Fire! bombs it, clouds dissipate, GyroMan reforms All done! camera pans back to ProtoMan and MegaMan, MagnetMan jacks in MagnetMan: Am I late for the party? ProtoMan: Not at all! Let's go! ProtoMan and MagnetMan proceed MegaMan: Lan, let's go! Lan: Yeah! Scene 59: ProtoMan: This area is tightly guarded. Check it out! camera pans to a new type of panel MegaMan: What's that? ProtoMan: A BarrierPanel. MegaMan: Barrier...? We can't walk over it? ProtoMan: That's right. We can't liberate it either. And if we go around it, there will be too many DarkPanels to hit. We've got to find a key to unlock the barrier... back to the group GyroMan: That would be my job! MegaMan: Huh? GyroMan; The key must be hidden somewhere deep inside the area. I can jump the DarkPanels and sneak in there! ProtoMan: Good call. The key should be hidden in a remote panel. Good luck! GyorMan: It'll be a piece of cake! No sweat! Use bomb liberation to liberate DarkPanels directly! ProtoMan: Complete the liberation within 9 phases! Good luck! Scene 60: ProtoMan: The team did an excellent job. The recapturing of SciLab Area marks much progress toward our goal. And the addition of our newest member, GyroMan, has greatly strengthened the team. I'm confident that you can handle future missions. MegaMan: GyroMan, my soul resonates with your spirit of flight! Narrator: MegaMan's soul resonated with GyroMan! Lan: Alright! With a team like this, the Net'll be freed in no time! MegaMan: Lan, it's not as easy as you think! Lan: I'm just getting excited, MegaMan! MegaMan: OK, Lan! May our next mission be even more successful! Lan: Yeah! Something overshadowes MegaMan ProtoMan: What?! MegaMan, step aside! MegaMan: What? A dark cloud lands on him MegaMan: Yikes! The other three run to try and free him ProtoMan: No! It's engulfed him! MagnetMan: It's no use. He's immobilized. GyroMan: A dark cloud! Lan: MegaMan!!! The cloud lifts off, abducting MegaMan ProtoMan: Blast! How could this happen! Lan: MegaMan! MegaMaaaaan!!! phases out HeelNavi: Bring him this way! Now! It's all set! Call the doc! phase back into a computer area, MegaMan is set on a table. HeelNavi walks to GutsMan, Glide, and Roll, trapped. HeelNavi: Surprise, surprise! I think we caught somebody you may know! GutsMan: Who? They turn to look Roll: MegaMan! Glide: MegaMan! GutsMan: C'mon, c'mon! Wake up! Wake up! Roll: MegaMan!!! HeelNavi: Scream all you want, he can't hear you. A sleep program has him knocked out cold. You couldn't wake him with a sledgehammer. GutsMan: What're you gonna do with MegaMan!!! HeelNavi: Oh, we're just going to enslave him, that's all! Now, sit back and watch how we make new friends! Gyah hah hah hah hah! HeelNavi returns Roll: Nooooo! MegaMan!!! Master HeelNavi jacks in M HeelNavi: I take it today's guinea pig is this kid? Regal tells me, he is a Navi of the highest caliber and was built based on human DNA data. What a pity that we'll be tainting such perfection! Hee hee hee! HeelNavi: Doc, this time it'll work, I'm sure of it! M HeelNavi: Oh, either way! Let the operation begin! Use this DarkChip... DarkChip appears above MegaMan and implant the DarkPower into this boy! Begin! the DarkChip settles in ...... MegaMan: Eeyaaaahh! Hrggh...Rggghh...Arrgggrrrahh! HeelNavi: That was one of the most powerful sleep programs but the intense pain has cracked it. M HeelNavi: The agony is beyond comprehension, I'm sure! The DarkPower of the DarkChip implanted in him, is seeping into every pore in his body. Any other Navi, and he would've self-deleted by now. MegaMan: Hrrggraaah! Aieeeee!!! HeelNavi: I get goose bumps just thinking about it! Hee hee! Regal: Doctor, how is our MegaMan coming along? M HeelNavi: Ah, Master Regal! Very well, indeed! He is all that you hoped for, Regal! His soul will soon be soaked with DarkPower! Regal: Yes, I see. Once the DarkPower stabilized, boot him up. M HeelNavi: As you say. O DarkPower, seep deeper! Cling stronger! MegaMan: Aieeeeegggh! LAAAAAAN!!! M HeelNavi: Savor the pain! Feel the anguish! And once it finally subsides, you shall be reborn, as the dark warrior, DarkMega! Gyah hah hah hah hah! phases out Scene 61: Voice: Mmn...Mmnph...M...MegaMan...MegaMan!!! Aieegh! thmp Lan wakes up Lan: pant pant...A nightmare? ...MegaMan. RIIING! Lan: The phone...I'd better answer it. MegaMan usually tells me "It's your phone!." RRRRINGclick Oops. Wonder who it was? Lan gets out of bed Lan: There's a message on the answering machine. REPLAYING MESSAGE Chaud: Chaud here. I have something to speak to you about. Meet me at the harbor near SciLab. NO FURTHER MESSAGES Lan: Time to head out, I guess. Scene 62: Chaud: You look terrible. No surprise, with MegaMan kidnapped. Lan: What'd you ask me here for? Chaud: The next mission... Lan: Next mission? I've lost MegaMan, and you're talking about a mission?! I don't even know why you brought me out here! Chaud: I have another Navi ready to go. You can use that one. Lan: You expect me to replace MegaMan with some Navi?! Chaud: Yes. We have no time. Without MegaMan, you have a duty. If you refuse, then you're off the team! Lan: Why you...! screen phases out, pow!* * Chaud: Hrggh! phases back in Lan: If only I'd never joined this team, MegaMan would've never been kidnapped! Keep your team to yourself! I'm through! Chaud: Hmm...What do you think MegaMan would say to you now? Lan: ...... Chaud: I'll be in the SciLab MissionCtrl. You're free to leave the team. If you change your mind, come to the MissionCtrl and I'll give you your new Navi. Think it over, okay. Chaud walks off Lan: If MegaMan were only here...He'd tell me what I should do... (hypothetical advice) MegaMan: Lan, you've gotta be strong! You can do it!!! Lan: ......MegaMan...I don't know what kind of Navi Chaud found for me but I'll use it to save you, MegaMan! Scene 63: Lan walks up to Chaud Chaud: You've come. Lan: Chaud, I'm sorry I hit you. Chaud: Heh. So then, you've realized what you need to do? Lan: I'm determined to save MegaMan! Please let me use the Navi you said was ready for me! Chaud: Certainly. Lan, hand over your PET. Lan hands over his PET Chaud: Hold on a moment. Begin Navi program installation. . . . . . . PLING! Chaud: Installation done. Lan, that Navi is very special to me. Once you get MegaMan back, be sure and return him to me. Lan: OK! Lan gets his PET back, checks it Lan: ...Wait?! Could this be? Er, Chaud?! Chaud: nod Lan: W...Wow! This really is a special Navi! Hope we can get along, . . . ProtoMan!!! ProtoMan: We'll have to work hard to make up for MegaMan's absence. Lan: Chaud, thanks for believing in me! Chaud: Heh. Now, let me explain the next mission... Lan: OK! Chaud: The next area we're liberating is End Area2. End Area is on the west side of DenCity. It's the Net for the town of End City. You can get to End Area from Oran Area2. Begin by paying a visit to check on things. Lan: Roger! Chaud: Best of luck. Scene 64: Lan: Do you think we can open it, ProtoMan? ProtoMan: Not likely... We'll need the right key before we can do that. The door is under SciLab control...Maybe we should head over to SciLab Area? ---------- Lan; What is it, ProtoMan? ProtoMan: Someone is near! Here comes!!! ProtoMan readies himself Voice: Ah, ProtoMan. Nothing gets past you, does it? ProtoMan: Show yourself! A DarkRift opens up in front of him and DarkMegaMan appears ProtoMan: M...MegaMan?! DarkMega: I am DarkMega, and master Regal has placed me in charge of security here! Lan: You're...kidding, right? MegaMan, this is no time to joke, pal?! DarkMega: Ah, is that Lan? A joke this is not. My allegiance is with master Regal. I am a loyal Nebula Navi! And thus I shall not allow the likes of you to pass! ProtoMan: So, you've gone completely over to the other side? DarkMega: How observant of you! ProtoMan: Very well. Then I won't have any qualms destroying you.. Lan: Wait, ProtoMan!!! ProtoMan: Lan, I know this must be hard but...He's a Nebula agent now! DarkMega: He's right, Lan. You can't be soft when you're up against Nebula! ...Hrggh! DarkMega starts flashing MegaMan: ...Proto...Man...d...destroy me...hurry! ..before the....the DarkPower they put inside...me takes...over...hrrggh! DarkMega: ...Hyaah! I...I thought I'd already flushed him out! But his will...still remains?! Blast, stay out of my way!!! ProtoMan: Lan! Now's our chance! Lan: I...I can't! ProtoMan, you saw that too, right?! MegaMan hasn't turned Nebula completely! ProtoMan: But!!! Three HeelNavis jack in HeelNavi: Master DarkMega, leave this to us. DarkMega: Yeah, take care of them. DarkMega jacks out ProtoMan: Wait!!! HeelNavi: Hey there! It's our turn now. ProtoMan: Hmph! You think 3 Navis of your level stand a chance against me? HeelNavi: Keh heh heh heh! Who said there are only 3 of us? ProtoMan: What?! Nine more HeelNavis jack in HeelNavi: Heh heh heh...The individual is weak but the collective is strong! Wanna try us? ProtoMan: Shoot, if we had MegaMan with us, then we'd have a chance! Lan: ProtoMan! Let's retreat for now! Even if we fought and won it could damage you badly! We can't be on a liberation mission in this condition! ProtoMan: Shoot! If only we had an ally strong enough...to fill MegaMan's shoes... HeelNavi: What's wrong? Ready or not, here we come! Lan: Jack out, ProtoMan! Let's go devise a strategy with Chaud! ProtoMan: Shoot! ProtoMan jacks out Scene 65: Chaud: Nebula got MegaMan...I see... Lan: I'm sorry...I shouldn't have stopped ProtoMan. Now it'll be even harder to liberate End Area. Chaud: It's OK. Even if ProtoMan had shut down MegaMan, it wouldn't have stopped the Nebula backup coming. But with the Nebula forces in End Area having overcome MegaMan, we've lost a lot of ground. It's a serious problem... Lan: Yeah. Well how about taking in MagnetMan or GyroMan then? Chaud: They're both great Navis, that's for sure...But we're up against too many. Even if we had MegaMan, we couldn't beat them without casualties...What we need right now is an ally with serious power who can take out a bunch of enemies in a single blow. Lan: Yeah...but who...? Chaud: Anyway, we can't just go into End Area without a plan...For now I need you to work on another task, Lan. Lan: Another task? Chaud: Right now the luxury passenger liner, Queen Bohemia, is in port behind SciLab. I've got wind of a party that's going to be held on board the ship tomorrow by a certain company from Electopia...The guest list is full of the world's top business-people and royals. Lan: ...Sounds pretty important. What's it all about? Chaud: Ubercorp, the company hosting the party, is going to present a booster sytstem it has developed. Apparently it can multiply the power of any program. You should go to the presenta...I mean, auction. Lan: Auction? So they're going to sell this booster system? Chaud: Yes...and we've reason to believe Nebula is after it. Lan: And it's a system that can power up programs, right? If Nebula got hold of something like that... Chaud: That's your task, to stop that happening. Lan: Ok. I'm on it. So I'll have to get on the Queen Bohemia tomorrow then, right? Chaud: Yes. Except you'll need an Invite to board the ship... Lan: Well your Dad's the boss of that big PET-making firm...IPC, isn't it? You must be on the guest list already. Haven't you got an Invite? Chaud: ...Unfortunately not. Ubercorp's long been a competitor of IPC...We're not invited. You'll have to get in yourself somehow. Lan: What?! How? I don't know any bigshot business people...No, wait...I do know a bigshot business person! I'll go ask right now. See ya, Chaud! Lan turns Chaud: Lan! Lan: What is it? Chaud: It's about MegaMan...You know we might come up against him...as an enemy. If we do...Would you be able to take him out? Lan: ...If MegaMan's soul has been completely overrun by darkness, then yes...I'll take him out. I'll have to... Chaud: Really...? Lan: ...Really. Lan exits Scene 66: Go back to Yai's house and talk to her. Yai: An invite to the party on the Queen Bohemia? Silly you! Why would I have one? Only the most elite CEOs of the world's corporations, and a few princesses are invited to that one! Head to Oran Isle and talk to Tesla. Scene 53: Tesla: Ah, Lan! What are you doing here? Lan: Well, actually...I was wondering if you'd got an invite to the party being held on the Queen Bohemia, Tesla? Tesla: An invite? ...Yes, I did get something. Lan: If you don't mind, I was wondering if I could have it...? Tesla: ...Sure. No problem. But why do you want to go to the party? Have you got a date? Lan: No! This is work, okay! Just work! Tesla: Oh, work...Pretty busy, huh? Well, have gun! The food should be good! Obtain the Invite. Lan: Thanks! But...are you sure you don't mind? Didn't you want to go? Tesla: No! Parties like this come up all the time! I just hope it makes your work a bit more interesting. Lan: Thanks. OKay, I'll be on my way then! Scene 67: Lan: What a ship! These rich guys know how to throw a party! Loudspeaker Voice: Ding dong, ding dong. This is a passenger annoucement. We are now departing. A further announcement will be made when the party is about to begin. We wish you all a pleasant voyage. The vessel is now leaving port. Buuuuuuuuuh! Lan: Oh, looks like we're away! Wow! You can't feel it roll at all. Okay, ProtoMan, what's the plan? ProtoMan: First we check if there's anyone suspicious on board. Lan: Roger... Voice: Ah, I see...It'll be done before the part startsss...Yesss, of courssse. Thank you. Camera pans to a foreign man, a guy comes through the door Man: How are you enjoying the cruise? Sorry, but the Engine Room's out of bounds for passengers. Foreigner: Oh, sssorry. Which way is it to the Deck then? Man: You need to go back along this corridor the other way. Foreigner: Oh, right...Thanksss. Camera pans to Lan Lan: A-Already?! He's suspicious! Uh-oh! He's coming this way! Foreigner rushes down the hallway Lan: He's gone! What now, ProtoMan? ProtoMan: Let's just tread water for a while... Lan: "Tread water"? So, there's a pool on board? Or d'you mean diving in the sea? That's dangerous! ProtoMan: I mean, let's let him carry on doing what he wants for a bit. We'll wait and see if he does anything unusual. Lan: Oh, right! Special crime-busting talk, huh...I'll remember that. Guess I'll just be treading in water, then! ProtoMan: N-No, not in! Oh, never mind! Scene 68: Man: Ah, you've collected all the stamps! Here's your prize then...1000 Zennys. Congratulations! Man 2: No way! I'm beat?! Camera pans to the NetBattle Machine Man 2: I-It's not possible! It cost me 10 million Zennys to customize my Navi. How can I be so outclassed?! Tough Guy: Tsk! NetBattles have to be fought from the gut! Spending money to make your Navi look tough on the outside doesn't mean it's got guts.\! Man 2: W-What did you say?! Who let this lowlife on the ship?! Man 2 runs off Tough Guy: Typical! All rich people are pathetic! Let's see someone with a bit more nerve! Man: I invited him to spice up the battle challenge a bit. His name's Fyrefox. No one's ever been able to defeat him. Why don't you give it a go? Lan: Never defeated?! I'll teach him a thing or two! Lan runs off to battle Lan: I'm Lan! You want a challenge? Take me on! Fyrefox: Someone with some guts at last! Mind you don't over-stretch yourself! Lan: If you think you can, bring it on! sudden shake Lan: W-What was that?! ProtoMan: Lan! Nebula's on the move! Lan: What?! ProtoMan: That shaking must mean the Engine Room's been hit...! Lan: Okay! On my way! Sorry! This'll have to wait! Fyrefox: Whatever! Do what you've gotta do! Scene 69: Lan: Well? SECURITY CODE CHECK PASSED. DOOR UNLOCKED. Pshh, clang! Lan: Okay! It's open! ProtoMan: Careful! Anything could be in there! Lan: Okay! Continue through and down into the Engine Room Lan: So...this is the Engine Room...First I better find a place to jack in. Run down to the last machine and jack in. ProtoMan jacks in ProtoMan: A Nebula Navi?! HeelNavi: P-ProtoMan?! But Chaud shouldn't be on board the ship! ProtoMan: You won't get the booster system! ProtoMan takes a battle stance HeelNavi: Hah! You think you can stop me?! The HeelNavi runs Lan: ProtoMan, get after him! ProtoMan: Click! Scene 70: HeelNavi: Tsk! I've had enough of you! ProtoMan: Get ready... ProtoMan takes a battle stance Foreigner: Change of tactics! I'm jacking out! HeelNavi: You're lucky! This isn't over! HeelNavi jacks out Lan: ProtoMan, I'm jacking out too! ProtoMan: Click! ProtoMan jacks out Thud! Lan: What's that?! Camera pans over to the Foreigner Lan: Ah! Foreigner: Uh-oh! Foreigner flees Lan: Wait! Lan starts to give chase ProtoMan: Hold on, Lan! Lan: What, ProtoMan?! He's getting away! ProtoMan: We mustn't rush. The criminal's still on board. And we know what he's after. It could be dangerous to act on impulse. He'll turn up at the party for sure. We'll take our time and make sure we catch him there. Lan: I guess you're right... Loudspeaker Voice: Ding dong, ding dong. This is a passenger announcement. The party preparations are complete. Please make your way to the Fiesta Room. Ding dong, ding dong. Lan: At last the party's going to start! Now we'll get that Nebula guy! Scene 71: Voice: Ladies & Gentlemen! Announcer: I would like to thank you all for attending this party today, where we at Ubercorp are proud to unveil our new booster system! When added to any existing program, this booster system radically enhances the program's performance. Construction work, software R&D...It can be used with anything, including of course, NetNavis! We're offering it for just 300 million Zennys!!! Lan: 300 million?! That's...one, ten, a hunred, a thousand, ten thousand, a hundred thousand, a million, ten million, 100 million, 8 zeros! No way! Man: 300 million...? What a bargain! Let's see the device then! Lan turns to the man Lan: Huh?! D-Did you just say it was a bargain?! Announcer: So! Without further delay...The booster system is currently inside this ViewComp. If everyone would care to take a look...Here it is! flashes into the comp Announcer: This is the booster system our company has developed! Surrounding it are GuardNavis, reinforced with the booster system! They are 10 times more powerful than normal Navis! All: Ooooo! Announcer: And now you will all witness the power of the booster system! Power cuts out Announcer: A-A power cut?! What's going on?! Navi: Gwarrr! Uwarrr! Announcer: W-What's happening?! Is...is the booster system safe?! Turn the lights on! Quickly! Lights are restored, the guard navis are lying on the ground, the booster program gone Announcer: Ah!!! It's gone!!! The booster system! Lan: What the...?! Flashes to the Room Announcer: The booster system's been stolen! Lan: This is Nebula's doing! Where's that guy?! . . .Wait a minute! Camera pans to doorman, Lan runs up to him Lan: Hey mister. When the power cut out, did anyone go in or out of this room? Guard: No way! I was guarding this exit the whole time. A mouse couldn't have got past me! Lan: Then the thief is still in this room... Man: Hey! This guy was hiding under the table! Camera pans to the Foreigner Man: What do you think you're doing?! Foreigner: I-I don't know anything about this... Lan: Quit playing the innocent! Lan approaches the stage Lan: Everyone, this guy's with Nebula! Announcer: What?!!! Announcer jumps off stage and confronts the Foreigner Announcer: Hey! Where's the booster system?! Give it back! Now! Grrrgh! Foreigner: I-It w-wasn't me! Announcer: Oh, come on! Do you expect us to believe that?! You're hiding it under your clothes! Foreigner: Ah! Aaaaah! He is searched Foreigner: Oh, nooooo! Announcer: It's not in his PET...not in his clothes...Where is it?! Foreigner: I already told you, I don't know! I was just about to take it when the lights went down! Lan: What?! S-So...there's another thief at work here?! Foreigner: Yeah! I'm not the only one! Announcer: What?! So we've got another criminal to find amongst these people? ProtoMan: Lan...it seems to me that everyone in the room is innocent. The thief must have somehow jacked in to the ViewComp, defeated the 8 GuardNavis and taken the booster system. Lan: It would have been real hard to operate a Navi in that dark...and near impossible to beat those beefed up GuardNavis. So...it must've been some kind of trick! Let's look for clues! Scene 72: Lan: I think I've figured it out. I know how it was done! ProtoMan: ...Well? Lan: Well... It's the mirror! Lan: It's the mirror! The mirror's rigged somehow! phases out, in, Lan at the mirror ProtoMan: The mirror...? How? Lan: Well...It's... The reflection! Lan: Mirrors reflect things, correct? So when this mirror reflects light, it goes like this... Camera pans to the three mirrors and the path of light ProtoMan: Navis travel over infrared rays when you jack in...That's it! Using a mirror to reflect the rays, you could jack in even from a way off! So if we work back from the ViewComp, we can figure out where the thief is! Lan: E-Exactly! (I-I hadn't quite figured it out that far yet...) So we'll trace the light path back and hunt out the thief! Run to the engine room and find the ladder near the jack in point. Lan: Hm...There's a draft...Ah, it's a ventilation shaft...Maybe the thief goe out that way! Let's take a look! Lan climbs the ladder onto the deck and notices a guy face down. Lan: Are you okay?! Guy: I-I'm...OK... ...... Qu-quick! The Bridge is up ahead...They've hijacked...the ship...Thud! Lan: What?! Scene 73: Lan enters and turns towards the bridge Lan: Hand over the booster system! Hah?! I-It's you! Camera pans to Fyrefox Fyrefox: Aren't you the guy from before?! Lan: Fyrefox...what are you doing?! Fyrefox: What am I doing?! With the booster system, my fireworks will be bigger and more spectacular than anyone else's! Lan: ...What fireworks? Fyrefox: I make cyber fireworks. I'll do whatever it takes to make OldMine bigger! Got it?! If you really want the booster system back, jack in there and take out my navi in the ShipComp! Lan: Doesn't look like talking's going to get me anywhere! If that's how it's got to be! Lan jacks in Scene 74: NapalmMan: So you've come...I am NapalmMan. You'll have to beat me if you want the booster system back. ProtoMan: Then prepare to be defeated! I will get the booster system! Lan: Let's go, ProtoMan! Battle routine, set! ProtoMan: Execute!!! NapalmMan: I'll tear you apart! Scene 75: ProtoMan: NapalmMan. The booster system's mine now! NapalmMan: Wha...?! How?! ProtoMan: I took it back during the battle...There are too many bad losers around to take any chances. Fyrefox: You...! You stole my fireworks dream! Lan: Fyrefox...you'll never impress people with new fireworks if they were made from something you stole. You have to put in the effort yourself. That's how to make fireworks people really enjoy. Fyrefox: ......You're right. I've been so fixated on making the best fireworks...I forgot what should be most important to a craftsman. Lan: ProtoMan! ProtoMan: What? Lan: Can't we overlook what's happened here? The booster system's unharmed, and Fyrefox seems genuinely sorry for what he did. ProtoMan: ...Hah! You really are soft...NapalmMan...This time we'll pretend nothing happened. But try anything like this again and I won't hesitate to wipe you out! Fyrefox: ...Lan, isn't it? Lan: That's right. Fyrefox: You're fighting Nebula, aren't you? Would you mind if we fight with you? Lan: Huh?! Fyrefox: I still have a lot to learn. But in the fireworks of battle, I could improve. Then one day my fireworks will be the best! Right, NapalmMan?! NapalmMan: Battle Nebula...? Give a bunch of bad guys a good pounding...? Sound good to me! Lan: We'd be happy to have you, Fyrefox! Right, ProtoMan? ProtoMan: NapalmMan's power would be useful to the team... Lan: Yeah! With NapalmMan on our side, we can kick those Nebula Navis out of End Area1! Fyrefox! NapalmMan! Welcome to the team! OK! We'll head into the Net as soon as we get back to port. phases out Scene 76: as ProtoMan runs up HeelNavi: You never learn, do you...? You can't pass here! ProtoMan takes a battle stance ProtoMan: Lan, this is it! 12 HeelNavis jack in, one steps forward HeelNavi: Ha ha ha! Fool! Coming alone again! Don't think we'll go easy on you because you're alone! ProtoMan: Hmph! NapalmMan! You're up! NapalmMan jacks in NapalmMan: Tsk! Don't start bossing me around! HeelNavi: You can't win on your own so you brought backup?! So there's one more at the part! You'll still lose! Lan: Hah! We'll see! NapalmMan! Blast him away! NapalmMan: I said stop bossing me around! I know what to do! He's history! Prepare to be blown away! NapalmMan "nukes" the navis HeelNavi: Gaaargh! The 12 HeelNavis are stunned HeelNavi: D-Dr. Regal...forgive me...! Nrrrgh! The 12 navis blow up spectacularly NapalmMan: That's it?! Talk about weak! There'll be some more challenging bad guys later, right? ProtoMan: For sure... NapalmMan: It felt like a fire was lit in my heart with that strike. I wanna fire off a few more rounds! I'll be up ahead! NapalmMan runs ahead ProtoMan: Lan, we haven't got time to sit around! Let's go! Lan: Right! Scene 77: NapalmMan: What happened to our other teammate? ProtoMan: He'll be here any minute... GyroMan and MagnetMan jack in GyroMan: Sorry I'm late! There was a little turbulence! ProtoMan: Everyone! This is NapalmMan! He's in charge of offense. NapalmMan: Carerful, I'm playin' with fire, baby! GyroMan: Whoa, dangerous! Nice to meet ya! Anyway, fill us in about the enemy. ProtoMan: He's strong. No question about that. GyroMan: If you're saying that, he must be... Camera pans to DarkMega DarkMega: Ready to enter a world of pain, are we? Hee-hee! GyroMan: Huh? What the...He looks so different now! MegaMan?! ProtoMan: We must delete him or we can't liberate the area! Keep yourself calm! We must keep the operation running! GyroMan: I g-got it... ProtoMan: One more thing. Look over there. Camera pans to middle of the field ProtoMan: Too many DarkPanels. Too few ItemPanels. MagnetMan: We'll run out of Order Points! ProtoMan: We've got to liberate as wide of an area at once to preserve our Order Points. NapalmMan: A wide-range attack? How about Napalm? Napalm will also destroy any items...But the barrier key should be sturdy. I think it'll be okay. ProtoMan: Hear that, Lan? Lan: Y-Yeah... ProtoMan: Don't worry. We'll try to recover MegaMan without deleting him. But you've got to prepare for the worst. Lan: OK...Let's do it, ProtoMan! ProtoMan: OK! Complete the liberation within 10 phases. Good luck! Scene 78: DarkMega faces the four navis DarkMega: Ngwoar...! The likes of you...can't defeat me! Lan: MegaMan, snap out of it! You can't let the DarkPower control you! MegaMan!!! DarkMega: Gwaaar! W-What is this?! I can feel it welling up inside...M-MegaMan?! No...! You should be firmly sealed in the dark! Lan: MegaMan! MegaMan: L-Lan... DarkMega: Silence! I will make the darkness swallow you again! Nnnnnaaaar! DarkMega convulses briefly and seems to embrace the darkness ProtoMan: The DarkPower has increased...He's at his limit! Lan: MegaMan's soul will never be beaten by the DarkPower! Come on, MegaMan! Snap out of it! DarkMega: Gwaaar...Whoarrr! flash out and in, DarKMega seems to have been the superior force DarkMega: Hah hah...Ha ha ha haah...The dark has him now! Completely! ...You fools! You'd have won if you'd finished me before! You won't get another chance! ProtoMan: S-Such power...! He's in a different league to before! Time to get out! But...! DarkMega: A reward for pursuing me this far...I'll try to make this as painless as possible! Lan: Stop! MegaMan! Can't you hear me?! Are you lost in the DarkPower forever? Come back! Come back, MegaMan! Come back and...give me an earful like you used to! ...MegaMaaaan! DarkMega: Hwa ha ha! Lan! MegaMan can't hear you now! This...is the end! DrkCanon! DarkMega pulls out a DarkCannon, and is stopped DarkMega: Arrgh! MegaMan?! You're a persistent pest...! MegaMan: L-Lan...I-I won't...give in...As long...as I can hear...your voice...I won't give in...to the DarkPower...! Lan: MegaMan!!! You can overcome it! MegaMan!!! MegaMan: ...L-Lan's come to help me...And everyone's here rooting for me... DarkMega: ...Tsk! Stay down where you belong! MegaMan: ...I-I will not...give in! DarkMega: Th-This body belongs to me! MegaMan: Uwaaargh! Lan: MegaMaaaan! flash out and in, MegaMan reappears Lan: ...MegaMan? MegaMan: ...I'm back, Lan! It was hearing your voice...That...let me...come back... Voice: Haaaah... MegaMan collapses, the four check him ProtoMan: ...He's fallen asleep. Well he seems to be back to his old self...He sure is high maintenance! Now MegaMan's back, Lan, he can take over. Transfer him in. Lan: You've been a real help, ProtoMan! ProtoMan: Just doing my job! MegaMan, transfer! MegaMan jacks out, phases out and back in ProtoMan: I owe you all an apology. As soon as MegaMan lost his self will, I should have shut him down...If MegaMan hadn't managed to fight his way back before, you'd all have been in real danger...As leader, I should have been tougher... GyroMan: Well, no harm done. We liberated this area and got MegaMan back too. NapalmMan: All's well that ends well. MegaMan's real tough for beating the DarkPower like that... Narrator: MegaMan's soul has communed with NapalmMan's! MagnetMan: Gee, you're a soft touch too! ProtoMan: You guys...! GyroMan: Okay, time to jack out, I guess. I'm bushed! You get some rest at Chaud's place too, ProtoMan! ProtoMan: ...Rest?! Yeah, I guess it could do with some shut-eye... phases out MegaMan: ...Lan...MUMBLE, MUMBLE... Lan: ...Hi, MegaMan. phases in at Regal's HQ Regal: Dang MegaMan and his friends! . . .It seems I've underestimated them...To have overcome such deep-rooted DarkPower...It'll be a problem if MegaMan can command DarkPower. Tsk! I'll have to get Hikari to talk someho and complete the research. If I can just get his report...Then my ambitions will be realized! Voice: Dr. Regal... Regal: ...Oh, it's you, CosmoMan. CosmoMan: Yes. Regal: Now they've taken MegaMan back, all the Net areas we had captured are being liberated! I'm not happy about it! CosmoMan: I have an idea, Doctor. A way to destroy that meddling Navi team from within! Regal: Interesting...Let it be so...Those fools who try to spoil our righteous plan! Let's see how they like the iron fist of rage! CosmoMan: Ha hah! Regal: Where is that report...? phases out, back in Scene 79: Narrator: Several days have passed since MegaMan came back...Having received a call from Chaud, Lan arrives at SciLab MissionCtrl... phase in with all the team navis' operators standing one next to each other Chaud: MegaMan's operator, Lan...MagnetMan's operator, Tesla...GyroMan's operator, Charlie...NapalmMan's operator, Fyrefox...Good. Everyone's here. Lan: What's going on, Chaud? Don't keep us in suspense! Chaud: There are three reasons I've got you all here today. Firstly, so you can all meet each other. The Navis know one another already but this is the first time all us operators have met. I thought it'd be a good idea for us all to get acquainted. Lan: Okay. So what's the second reason? Chaud: I suppose it'spart of getting to know each other...There's someone new I'd like you to meet. ...Come on in. Raika enters Charlie: Hah?! You...?! Chaud: Commander of the 13th Net Unit of the Sharo Army... Raika: That's me! Raika! Charlie: I-I knew it! Tesla: You know this guy? He's pretty cute! Come on, introduce us! Charlie: I don't think this is a good idea...When I was going around the world by helicopter, I just skimmed inside Sharo airspace once. That's when I met this guy on fighter training. He chased me down and had me deported. I'd never been got by any country's army before then! Raika: The way you fly I could take on 100 of you at once! Charlie: Hmph! He's just a snobby kid! Tesla: Well he hasn't got a bad face for a snob! Raika: Sorry, but I prefer girls with a bit less make-up. So put a sock in it, grandma! Tesla: G-Grandma?! H-H-How dare you be so rude?! I'm only 29! I'm still in my prime! Raika: ...Chaud, isn't it? Just tell us the mission. I haven't got all day! Chaud: ...Fine. The third reason I got you all here today...is to brief you for our next mission... phases out, in Chaud: Our next task is to liberate End Area5. If we succeed, we'll have liberated the entire Net. After liberating End Area, we'll force the leftover Nebula agents into the Undernet and round them up! Tesla: Actually...exactly what Net is End Area part of anyway? Chaud: ...Lan explained it to me briefly once like this...End Area is the Net in End City, a city with a castle that's famous for its giant Gargoyle. Tesla: ...Gargoyle? Chaud: It's a huge fish statue on the castle roof. A charm to protect the castle from fires apparently. Tesla: Oh...right... Lan: So Chaud, are we starting the mission right now? We're not doing a recon mission first? Raika: We don't need any recon. Just leave it to me and SerchMan... Fyrefox: A guy with guts, huh? The big boys just square up and go straight in, right?! Chaud: Exactly...Everyone get ready and send your Navis into End Area4. That's all...And, Lan...I've got something for you, so come by later, okay? Lan: Got it! Scene 80: MegaMan: The area we're liberating is behind here... Lan: Does that door look like it'll open, MegaMan? MegaMan: ...It's got a really sophisticated electronic lock... SearchMan: You won't be able to unlock that. SearchMan jacks in SearchMan: This is my area, MegaMan. Stand aside! MegaMan: SearchMan! Yes! Your analysis abilities can hack the electronic lock...But let's wait until the rest of the crew have got here! SearchMan: That's nothing to do with me...I might be on the team but I've got my own game to play... ProtoMan: We need your skills but I don't want you making decisions. The two turn to face the voice of ProtoMan MegaMan: ProtoMan! phases out, all the team navis reappear at the doorway ProtoMan: So, is it going to open? SearchMan: It'll take a bit of time but it'll open. ProtoMan: Okay then. Get started! Raika: Wait, SearchMan! SearchMan: Raika! Raika: News just in from Sharo...They've picked up the trail of our usual suspect and what seems like a Navi. Head over now! SearchMan: Understood. ProtoMan: SearchMan! What's going on?! SearchMan: Sharo's located a Nebula Navi. We have to capture it now! Sorry but opening this door will have wait for a day. ProtoMan: ...Very well. We knew that was the deal with you. Go on! Today's mission will be postponed until tomorrow! We'll assemble again then. That is all! Dismissed! ProtoMan jacks out SearchMan: I'm on my way, Raika. SearchMan jacks out MagnetMan: We come all this way only to have the mission postponed?! I've got other things to be doing, you know! GyroMan: SearchMan and his operator are totally inflexible. NapalmMan: What?! I won't be pounding anyone today?! Oh well...I'll just have to go virus busting instead! the three of them jack out MegaMan: Everyone's gone. What are we going to do? Lan: Well...There's somewhere I'd like to go, MegaMan. MegaMan: Where? Lan: Dad's Lab! The day he was taken away he was going to show us something. Maybe that'll give us an idea of what Regal's after. It might be a clue! MegaMan: Good idea! Okay, let's get over to the lab then! Jack out! Scene 81: Lan: I hope we can get into Dad's computer... MegaMan: Yes. Well you've got your Dad's ID. It'll be fine. Hey, Lan... Lan: Hm, what is it? MegaMan: Isn't that Raika over there? Lan: Huh? camera pans to Raika at the coffee counter Lan: What's he doing here? Raika hurries off Lan: ...Hey, er...He's gone! Oh well, never mind! Let's go to the lab then! Head on up and access your father's comp. Lan: Hmm...The power's on and I have Dad's ID. Why won't it work? MegaMan: There must be a powerful security feature. Lan: I'll have to circumvent it... MegaMan: ...To get to the data. Lan: But what are my chances of doing that? What should I do... MegaMan: Seems I'll need help from someone skilled at analyzing data. Lan: But who... . . .I know!!! I hope he's still close by!!! Catch up with Raika next to the Subchip Scientist outside. Raika: What's that? Lan: SearchMan is great at analyzing data! Raika: Of course. There's no data that SearchMan can't analyze! Lan: Aren't you kind of on-edge today? Raika: Nah, not really. I'm always like this in Sharo. Lan: You don't say. OK...I have a job for SearchMan and his powers!!! yada yada yada Raika: OK, I'll help you ouy. Go on over to the research lab and I'll meet you there. I have to take care of something first! Lan: OK, I'll be waiting for you! Scene 82: elevator bell rings Lan: Ah, look! Raika! In here! Raika walks up to Lan Lan: Raika, it's about this computer... Raika: First I just want to check something. This is your Dad's Lab. In other words, it's one of the most highly secret places in Electopia. Surely letting in a foreign serviceman will be a problem. Lan: Don't be daft! We're team mates. We want the same thing! Forget about that. Can you just bypass the security? Raika: Team mates?! He he he! Okay, then. I'll turn off the security. both turn to the comp Raika: SearchMan, disable the security! SearchMan: Roger...Commencing data analysis... ..................Analysis complete. Starting security hack program... ................. ...Done! Lan: H-He's done it...! SearchMan: All that's left is one item of TextData... Raika: Read it. SearchMan: "To my son, Yuichiro...Don't go neglecting Gow! You shouldn't get his fur wet. He's grouchy wet, so if rainy be a nice kid and let him in" coded text That's all it says. Lan: I-It's a letter from Grandpa to Dad! Do you know anything about this "Gow", MegaMan? MegaMan: No...It's the first time I've heard the name. But something's not right about that letter... Lan: Definitely...It needs closer examination...We went to all this trouble to bypass the security...But there's nothing here that Nebula would be after... Raika: Never mind. It was a great experience for me! I got to look inside the computer of a top world scientist! Lan: Sorry to have used up your time. You're chasing that Nebula Navi right now, aren't you? Shouldn't you be getting back quick? Raika: ...Er...Oh, yes! I'll be on my way then...See you! Raika hurries off Lan: I'll copy the letter into my PET just in case. ...Okay, all done! (Get GpsLetter) Lan: But just to show eveyone a letter from Grandpa...Dad wouldn't have got us all together for that..I better take a closer look at the letter! MegaMan: I agree! Scene 83: Haruka: Gow? Your Grandpa did mention some dog by that name...That was quite a long time ago, though. Check the spare doghouse in the backyard. Lan: This doghouse. . .There's some writing! "Gow is... ...cleans the air at the island coal mine... ...something in corner of floor..." It was written long ago and is difficult to read. Gow again...Wonder what this means? Head to Oran Isle. Find the AirFilterComp and talk to the Mr. Prog inside. Mr. Prog: WHEN I SHUT MY EYES, I REMEMBER...LONG AGO I SAW A DOG-SHAPED PROGRAM BURYING SOMETHING IN A CORNER FLOOR PANEL UP AHEAD. WONDER WHAT IT WAS? Check the eastern most corner panel MegaMan: Lan, this panel looks different. Someone's been moving it. Lan: That's it, MegaMan! Take a closer look! MegaMan: Roger! ...Ah! Something's flashing! An orb pops up MegaMan: It's...some kind of MemData. I'll analyze it! Let's see...Gow loves fish...He can't let big fish out of his sight...That's all it says... Lan: Big fish...It's got to be a hint of some kind...Hm, big fish... . . . Maybe it's the Gargoyle! MegaMan: That's it, Lan! The big fish is the Gargoyle. Lan: And that means. . . MegaMan: GargCastle in End City! Lan: Exactly! Let's get that data and jack out. We've got to go to End City! MegaMan: Right! (Receive MemData) MegaMan: Okay, jack out! MegaMan jacks out, flashes out and back in, Lan at the mine entrance MegaMan: Lan, let's go to End City! Scene 84: Lan: Ah, Raika! We're bumping into each other a lot today! Raika: I'm working...You can't just come and talk to me. Lan: What? You didn't mind talking before! Raika: ...I don't know what you're on about. Quit bugging me! Raika hurries off Lan: What a grouch! I shouldn't have bothered! Come on, MegaMan. Let's go! MegaMan: O-Okay...But, that was a bit weird... Scene 85: Man: Sorry, but you can't come in now. Lan: Why, you ask? Man: Someone has illegally accessed the castle's control system. Lan: Illegal access... Man: Apparently the communications system in End Area3 was hacked. The security is pretty solid. It must be Nebula. Lan: Nebula?! I'll go check it out, sir. Man: You? Lan: In return, let me into the castle when sysems are normal. Man: That's easy enough. Jack in to that bronze statue down the slope, and you'll be in End Area2. Are you sure you'll be all right? Lan: Leave it to me! I know I don't look like much but I know NetBattling! Man: OK, but don't do anything crazy. Lan: Don't worry! Scene 86: MegaMan: Somebody's there, Lan! ...I-It's... camera pans to SearchMan, MegaMan comes down MegaMan: SearchMan! SearchMan: ......... SearchMan jacks out MegaMan: SearchMan! .........What's going on?! Lan: Check the system, MegaMan! It's been illegally accessed! MegaMan: Okay! MegaMan observes the tower MegaMan: It's a comms system. But it's completely fine... Lan: Maybe SearchMan was fixing it? He could at least have said hello. Instead of jacking out like he was running away...Oh, well. No harm done. Let's get back to the castle! MegaMan: Right. Let's go! Scene 87: Lan: Can't let big fish...out of his sight...maybe it means it eyes come out?! Narrator: The Gargoyle's eyes open with a click, revealing something! Lan: This looks like a DataDisk...Check it out, MegaMan. MegaMan: It's a key to something... Lan: A key...? For what? MegaMan: Ah, wait a minute! There's TextData in here too! I'll read it... "3rd ACDC, 4th square. There find the way to Oran. Open its center!" Lan: I've heard a lot of those words before...We need to figure out what it means... (Get OldKey and TextData) MegaMan: We'll have to read it over and figure out where to go! Lan: Right! Scene 88: Navi: Looking for something? (say yes) Navi: A code? Hmm..."The 3rd ACDC" must refer to ACDC Area3... This is the 4th square from ACDC Area2. I think we're standing near your destination. The entrance for Oran Area is right over there, too..I hope you find what you're looking for! ---------- MegaMan: "3rd ACDC, 4th square. There find the way to Oran. Open its center!" In ACDC Area3...go to the 4th square counting from the entrance...There find the way to Oran. camera pans to the ACDC Area3-Oran Area1 link, then back MegaMan: Then open up its center...I guess this must be the place. Lan: I don't know if this is right or not but let's try the key. MegaMan: Okay! MegaMan took out: "Old Key"!!! A door flickers and appears* MegaMan: Lan!!! Lan: The door appeared because of the "OldKey"! Maybe... MegaMan: Let's try opening it then! MegaMan inserted "OldKey" into the lock!!! ...Clang!* * MegaMan: ...It's unlocked it! Are we going in? Lan: If we go in without thinking, anyting could happen...But we've come this far. We've got to... MegaMan: You're right. But we should make sure we're as prepared as possible before we go in. Lan: Yeah. They say providing is preventing! We'll go in as soon as we've finished getting ready! MegaMan: Okay! Scene 89: MegaMan: W-What's this...this space? ...Ah, the exit! Clang! phases back out with MegaMan in the real world MegaMan: ......... W-Where am I? Lan: M-MegaMan! Look behind you! MegaMan: ...W-What? MegaMan turns around It's...my house... Lan: Y-You can't have come into the real world...can you? MegaMan: M-Maybe...It's ACDC Town, but there's something funny about it... Lan: Yeah. It looks like the Cyberworld... MegaMan: Like a digitized version of ACDC Town... Lan: This must be what Dad wanted to show us all! MegaMan: I guess so. ...Ah! Someone's coming! A woman strides up the street MegaMan: Er...Excuse me! Could you tell me... Lady: Dr. Hikari's just become the father of twin boys! I heard they're called Hub and Lan! Everyone says how cute they are! It's wonderful! MegaMan: Huh?! The woman hurries off Lan: D-Did she just say...Hub...and Lan...?! Then this is ACDC Town...in the year we were born?! MegaMan: ...It looks that way. Lan: But I can't see anything here that Regal would want. MegaMan: I'd say we need to have a real good look around. Lan: I agree. We'd better scout around a bit. It's down to you, MegaMan! MegaMan: Okay! Scene 90: MegaMan: I've had a brief look around but all I've figured out is that our family kept a dog. Lan: At least we've seen ACDC Town as it was when we were born. That's pretty cool. MegaMan: True. So, should we head back into the Net? Lan: Yeah. Let's go back to the house. MegaMan: Okay. MegaMan walks back to the house MegaMan: Hah?! MegaMan hides MegaMan: Someone just came in from the Net! Lan: What?! Three HeelNavis stand in front of Lan's house, three more pour out HeelNavi: How could a place like this have been hidden in the Net?! Search everywhere! Leave no stone unturned! Whatever it takes! If you have to break things, do it! The thing Dr. Regal is looking for could be hidden anywhere! HeelNavi 2: Right away! HeelNavi: I'll stand by here for when the boss comes. Report immediately if you find anything! Dismissed! The navis split up and search, camera pans back to MegaMan MegaMan: What are we going to do, Lan?! Those Nebula guys will tear tis place apart! Lan: Even if it's before my time, this is still my home town! I'm not going to let Nebula rip it apart! We've got to protect it, MegaMan! MegaMan: We will! Scene 91: Lan: So that's taken care of all the Nebula Navis in this area. MegaMan: Yeah. Time to head back to ACDC Area3 for a while! phase out and back in, MegaMan in front of Lan's house Lan: I can't believe that my house leads to this place, though. It's just so weird. MegaMan: Hm, it was a shock to me at first too... . . .Someone's coming from behind the door! Lan: Nebula?! MegaMan: It might be the boss of that Navi group we just defeated! ...They're coming! Clang... SearchMan bursts in SearchMan: ......... MegaMan: SearchMan! SearchMan: Who'd have thought this area would be hidden here...So it was worth following you after all. MegaMan: You...followed me? SearchMan: Dr. Regal asked me to keep an eye on what you were up to. And that's how I managed to find this hidden area. MegaMan: ...D-Dr. Regal? SearchMan: That's right! Raika and I are part of Nebula! MegaMan: N-No way...! SearchMan: Ha ha ha, it's so easy to deceive the likes of you... MegaMan: B-but...Why?! Why Nebula...?! SearchMan: ...Power. DarkChips give me even more of it...They're the best...They fill me with strength... MegaMan: Open your eyes, SearchMan! SearchMan: Hey, calm down...I wasn't planning on fighting you now. I haven't completed my mission yet...And I'm sure I'll be able to fight you again before long... SearchMan runs off MegaMan: Hey, wait! ......... ...I can't believe SearchMan and Raika are in Nebula...And I wonder what mission it is he was talking about...We'd better report back to Chaud. Lan: Yeah, you're right... Scene 92: phase into SciLab3, SearchMan having cornered a HeelNavi SearchMan: There's no way out...You were a tough one to catch. But the fun's over now. HeelNavi: N-No... SearchMan: Say your prayers...! MegaMan jacks in SearchMan: MegaMan?! Get out of the way! MegaMan: ...Hah! fires on SearchMan SearchMan: Hurgh! MegaMan: Heh heh heh... Both the HeelNavi and MegaMan jack out SearchMan: Wait! Raika: MegaMan...! phase out Beep beep! MegaMan: Wake up, Lan! You've got mail! Lan: Huuh... phase in MegaMan: Lan, you've just got some mail news! I'll read it! "Currently, the Net is experiencing widespread errors. The communications system in End Area3 may be the cause. Your Navi may be subjected to an evil influence when jacked in so please avoid this even in liberated areas." Wow! I'll bet this is Nebula's doing... Lan: Yeah, I know. End Area3 then! Let's go, MegaMan! MegaMan: Sure! Jack me in! Scene 93: MegaMan: This should be the comms system...I don't know if it'll work but I'll see what I can do to fix it! Lan: Good luck! MegaMan: ...No, it's no good. I can't get it to take any input! A navi jacks in Navi: Hey, what are you doing?! MegaMan: I'm trying to fix the comms system.. Navi: There's no point in fumbling around there. You'll have to fix the main server at the GargoylComp at GargCastle first. This thing's just an antenna. MegaMan: Oh, right! Then I'd better get to Gargcastle! Navi: You should stay away from there right now, though. It's been attacked by Nebula Navis. It's not safe. MegaMan: Nebula Navis...Not SearchMan?! Navi: Well, go if you must. But be careful. MegaMan: Lan, jack me out! Let's go to GargCastle! Lan: Sure thing! (I felt lazy so I didn't do scriptwork for the 100 foes minigame) Scene 94: Man: Argh, this is way out of my league! man comes running down the roof Man: Hey! What do you think you're doing here?! The GargoylComp server is going crazy! The whole castle's going to explode at this rate! Take my advice and get out of here! The man flees Lan: It seems like things are really getting out of hand...MegaMan, stop the GargoylComp before it's too late! MegaMan: Got it! Scene 95: MegaMan: I guess this is the server. Lan: Right, better start fixing it! SearchMan: Stop right there! SearchMan jacks in, both take battle stances MegaMan: SearchMan! So this was your doing! I knew it! SearchMan: I could say the same to you! Who'd have thought you'd surrender to Nebula... Lan: What are you talking about?! It's you who's with Nebula! Raika: Don't waste your breath! Get him, SearchMan! SearchMan: Target MegaMan! Lockon! MegaMan: This is it, Lan! Lan: Leave it to me! Battle routine, set! MegaMan: Execute!!! SearchMan: Prepare yourself, MegaMan! Scene 96: MegaMan: Ha ha...Why on earth did you join Nebula?! SearchMan: Ha ha...I don't know what you mean. I don't remember doing that! Anyway, why did you get in the way of my mission.. Another SearchMan and MegaMan jack in SearchMan 2: I didn't think you'd fall for our plan so easily! MegaMan 2: You're already a mess after that last battle! This'll be a cinch for us! What a great present for Dr. Regal! MegaMan: So, the SearchMan I saw back in ACDC Town... SearchMan 2: Kya ha hah! That was me! SearchMan: And the one who got in the way of my mission... MegaMan 2: Yep! Yours truly! Kya ha ha hah! And we took care of the Gargcastle server too! If you defeated us, that would put it all to a stop! Not that you could! Kya ha ha ha hah! SearchMan: MegaMan, it looks like I owe you an apology... MegaMan: Yeah, same here. SearchMan 2: What are you two jabbering on about?! We won't let you get away, you know! MegaMan 2: You'll be deleted before you know what's hit you! Lan: Raika, I've got an idea...It was just a misunderstanding and now they've made up...Why don't we fight these guys off together? Raika: What a coincidence...I was just thinking the same thing. MegaMan: I guess it's time... SearchMan: For you to pay! MegaMan 2: Pay?! You don't stand a chance! I'll delete you in a second! Here goes! phase out, back in, two HeelNavis being deleted HeelNavi: Gwaaah! SearchMan: So now we see your true colors...You two are just fakes. You could never beat the real thing! HeelNavi 2: Kurgh...You'll be sorry! The great CosmoMan of End Area5...will be sure...to take revenge...for this...Gwaaaargh! SearchMan: CosmoMan's at End Area5...? MegaMan: Do you know him, SearchMan? SearchMan: CosmoMan is Nebula's Sharo leader. I joined the team to defeat him. I'm going to open up the door to End Area4! SearchMan jacks out MegaMan: SearchMan! Lan, let's go after him! Lan: Okay! MegaMan jacks out Scene 97: ProtoMan: So we're all here. How's it looking, SearchMan? SearchMan: Nearly there... ...... ...That's it! The door is deactivated SearchMan: It's open... Protoman: Okay! Let's go! We're about to begin the liberation of End Area5! I want you to stay back here, GyroMan. Keep a lookout in case the enemy sends reinforcements. GyroMan: What?! Why do I have to stay back?! We don't really need a lookout, surely?! ProtoMan: We can't be too careful from now on. If you see anything, let us know right away. GyroMan: Okay. I won't disobey an order. But I bet you'll end up regretting not taking me with you! Protoman: Huh, don't say that...I asked you because you're the best man on the team. We're counting on you. GyroMan: Leave it to me! I won't even let a kitten go by! Not that there are any in Cyberworld, mind you! Anyway, you go ahead and I'll take care of things here! ProtoMan: Okay, let's go! Everyone heads off, GyroMan stands watch MegaMan: Come on, Lan, let's go! Scene 98: SearchMan: Something's wrong with this DarkPanel. ProtoMan: Good eye, SearchMan! camera pans to center BonusPanel ProtoMan: I've heard that some DarkPanels are booby trapped. We can't just liberate panels haphazardly. SearchMan: Something's coming! Voice: Hee-hee-hee... camera pans to CosmoMan CosmoMan: Welcome to End Area5, Team ProtoMan! NapalmMan: Who the heck are you? CosmoMan: I'm CosmoMan. I control the world of darkness. Let's see how you managed to make it this far! pans back MagnetMan: Why did he bother telling us his skill beforehand? He talks tough but I think he's justa bit brainless! ProtoMan: Take it as a sign of his confidence. He's a strong one, no doubt about it. MegaMan: This place seems to be full of BarrierPanels. Keep an eye out for traps as we look for the key. ProtoMan: Definitely...SearchMan? SeachMan: I'm an expert at finding items. I can even liberate panels from a distance. ProtoMan: Your search power is something else! Okay, let's do it! Get ready, Lan! Complete the liberation within 9 phases! Lan: Roger! Scene 99: ProtoMan: The team did an excellent job. Now that this area is liberated, the Net is ours again. All that's left now is the Undernet. MegaMan: The undernet... GyroMan: It feels like we're getting close. So, shall we go in right away? I could go scout about if you want. MagnetMan: I'm ready when you are... NapalmMan: I'm happy to go now too. SearchMan: We mustn't be gung-ho about this. We should be cautious... NapalmMan: You're just scared at the mention of the Undernet, huh? ProtoMan: ...No, SearchMan's right. NapalmMan: Huh... ProtoMan: Nebula is like a wounded beast now. There's no telling what they might do. And we've taken our fair share of damage too. SearchMan: ...Anyway, the door that's blocking the path to the Undernet probably won't be easy to open...They won't just let us go through on the nod, you know. ProtoMan: So that's it...Time to jack out. We'll assemble again when it's time to start the mission. MagnetMan: Hang on! Are you sure we can't get that door open now? Let me check! ProtoMan: ...Huh, if you must. ProtoMan moves aside MagnetMan: Okay, I'm going in! Waaaargh! MagnetMan is stopped and can't get through MagnetMan: Yaooooow! MagnetMan stops MagnetMan: Hu hu...Dang! MagnetMan tries again MagnetMan: Aaargggh! MagnetMan stops MagnetMan: Hu hu... ProtoMan: Come on, MagnetMan, that's enough. Let's jack out. MagnetMan: ...Huh! MagnetMan pulls back and jacks out Protoman: We should jack out too. I'll be in touch when plans are in place. That will be all... Everyone but SearchMan and MegaMan jacks out MegaMan: Thanks again, SearchMan. I'm impressed by your ice-cool way of keeping calm! Narrator: MegaMan's soul has communed with SearchMan's! SearchMan: We all make a pretty good team. Things gel together nicely. I think we stand a good chance with the Undernet too...I'm a commander in the Sharo Army but this time I'll just leave the leading to ProtoMan and fight as a normal soldier. We'd better rest for the next battle. SearchMan jacks out MegaMan: SearchMan...This team just gets better all the time! Lan: Yeah! We'd better jack out too, MegaMan. MegaMan: Okay! MegaMan jacks out phases out and back to Regal's secret HQ Regal: So the Net has all been liberated...Huh, never mind...Our possession of the Net was just a way to buy time...And now I have some clues about the report...The Hikari Report that I've been searching for. If I can just get hold of that, my ideal world...a world of true evil, will be complete. Ku hu hu...Wah ha ha haah! phases out, back to Lan and Mayl in ACDC Park Mayl: Erm, Lan...I want you to be honest with me...I heard this rumor about a Navi team going around...They free areas of the Net that Nebula took over...I was wondering if maybe you were involved? Lan: W-What?! That's a funny thing to say all of a sudden... Mayl: Don't play around. Answer me properly... Lan: ...Um, well...Err...Sorry I didn't tell you about it...But I didn't want to get you and the others involved... Mayl turns away Mayl: ...That's foolish. You're foolish, Lan...Always going to bad places on your own...And I never get to know about it...You're off fighting and there's nothing I can do...It feel so...argh... Lan comes up to her Lan: Mayl...Thank you. I appreciate you caring so much. I'll bring Roll back for sure, okay? And GutsMan, and Glide and Dad too. Leave it all to me. Just hang in there a little bit longer... Mayl turns back Mayl: ...Hm. But... Lan: It'sokay. I'll bring everyone back safe, and that includes myself too! Mayl: ...Okay! Lan: Good! So now stop looking so sad and give me a smile! Mayl: Sure! Lan: And don't tell Dex or Yai about this, okay? There's no way those guys would stay out of it if they knew. Voice: I'm afraid it's too late. Dex and Yai come out from Higsby's Lan: Dex! And Yai too! Dex: What's with all the secrets, Lan?! Yai: I guess it's pretty typical of you, huh! Dex: You're right that we can't just stand by and do nothing... Yai: It's tough that we can't really get involved right now. But we want to do whatever we can to help out, okay? Just say the word! Dex: That's right! Now's no time to be shy, you know! Lan: Dex, Yai... Voice: Hah! I heard every word! A girl strides towards the four of them Girl: Have you been fighting Nebula?! Lan: Er, erm...Who are you anyway? Jasmine: I'm Jasmine! I came to Electopia to study medicine! Do you know all about the Undernet?! Lan: The Undernet?! Why do you want to know about that? Jasmine: Well, I'm looking for this secret medical book that's supposed to be hidden there! I need it to cure my grandpa's illness, you see. You'll tell me where it is, right?! Lan: ...Sorry but I can't do that. Jasmine: Why not?! Lan: The Undernet's full of bad people and it's not safe. It's more dangerous than ever now with Nebula around. It's better to avoid going if you can. Jasmine: Oh, go on! Tell me! Lan: No! I can't tell you! Jasmine: Pretty please! I need to know! Lan: I said no, didn't I?! Jasmine jumps up and down Jasmine: Huuuurgh! Then forget it! I won't ask again! I'll find the Undernet myself! Jasmine runs off Lan: Hey, wait! Dex: Forget it. Just leave her be. She won't go there on her own. Even I'd think twice about going and I'm not a girl! Lan: Well, if you think so... Rrrring! MegaMan: Lan, it's a phone call! Chaud: It's Chaud...We need to talk. Come to the SciLab right away! Click... Lan: That's weird...Sounds like Chaud's in quite a hurry. Dex: It looks like you'd better go. Good luck! Yai: Don't get hurt, okay? Mayl: Take care. Lan: Okay, see ya later! Scene 100: Lan: What's up, Chaud? Is it time for the next mission? Chaud: No, this isn't about the mission...I've been looking into a few things and I've come across something odd...I want you to look into it for me. Lan: Oh yeah...What is it? Chaud: ...It's at the heart of this latest incident...The reason why Regal took your father...The Hikari Report. Lan: The Hikari Report? You mean...Hikari as in my name, Hikari? So does that mean Dad wrote this report...? Chaud: Actually, no. It's a research report that your grandfather wrote. It's my guess that your father has the report or at least knows where it's kept. Lan: A research report of my grandfather's...So, what was this report about? Chaud: I'm still looking into that...All I know right now is that when he was studying network theory 30 years ago, he was also doing some research with another scientist. They produced a report on different network technology... Lan: Different network technology? What's that? Chaud: I'd say it's totally unlike the network we use now but I don't know any more than that... Lan: I don't get it. It's all too vague! Chaud: It can't be helped...This all happened 30 years ago. And the research was never made public. We don't know for sure if the Hikari Report even exists. I don't know what Regal's planning on doing with your grandfather's network technology but we must get our hands on that report before he does. Did your grandfather give anything to your father? Lan: Hmm, I don't know... MegaMan: Lan! I wonder if it says in that letter your Dad got from him... Lan: But that's just a clue to ACDC Town when we were born. Chaud: ACDC Town in the year you were born? Lan: It's an area you can get to from the Net's ACDC Area. ACDC Town's there just like it was 11 years ago! Chaud: ...Ah, the VisionBurst. Lan: The VisionBurst? Chaud: It saves moments in time as data in Cyberworld...I never imagined it was hidden in the ACDC Area...That letter you were talking about...What did it say? Lan: Hang on a second...Let's see..."To my son, Yuichiro...Don't go neglecting Gow! You shouldn't get his fur wet. He's grouchy wet, so if rainy be a nice kid and let him in" That's all it says. Gow was that dog that lived with us 11 years ago... Chaud: Find that dog, lan. It could lead us to the Hikari Report. You must head for the VisionBurst right away! Lan: Sure! I'll go check it out! Chaud: Good luck. Scene 101: MegaMan: This is weird, Lan...That dog that was here before has gone! Lan: What?! He must be around here somewhere! MegaMan peers around MegaMan: No, he's nowhere to be seen. Clang! ProtoMan enters into the VisionBurst Area and runs up to MegaMan MegaMan: ProtoMan! ProtoMan: ...Is it here? MegaMan: It was when we came before, but not now... ProtoMan: What?! But the VisionBurst is the data of a set moment in time...It's inhabitants can't just move about willy-nilly... MegaMan: Then...I guess that means Nebula beat us to it... ProtoMan: ...Maybe, but there could be one other explanation... MegaMan: What's that? ProtoMan: Hm, you find out as much about that dog as you can. Meanwhile, I'll see if Nebula has been up to anything...There should be some clues if they've got hold of the dog. MegaMan: Okay, got it! ProtoMan jacks out Lan: Right, MegaMan, we'd better go find out about this dog! MegaMan: Sure! Scene 102: Lan: Mom, can I ask you something? Haruka: What is it? Lan: When I was born, we had a dog, right? Haruka: When you were born? No, we didn't have a dog back then. Lan: What?! Haruka: Hold on a minute. Haruka runs off for a bit Narrator: 10 minutes later... Haruka: Here it is. This picture was taken decades ago now. Mom showed Lan "GowPic." Lan: That's him! You said before that we didn't have a dog when I was born. Are you sure? Haruka: Yes, I'm positive. Lan: Hmm...Um, can I keep this picture, Mom? Haruka: Yes, if you want. (Take the pic) Lan: Do you know anything about this dog, Mom? You know, like where it used hang out and stuff. Haruka: Hmmm...That dog was around before I got married so I'm not sure. Oh, I know...The picture. It was taken where your grandpa often used to take Gow. I don't know where they used to go but apparently they used to come back from there both covered in dust. Lan: Covered in dust...That could be a good clue...I need to think! Thanks Mom! Haruka: You're welcome. Scene 103: Old Man: What's your business on this deserted island? Lan: Never mind me, what about you? Old Man: Me? I used to work here, long ago. It pains me to see this island fall apart like this. That's why I come and clean it from time to time. Lan: You worked here a long time ago?! So, have you seen this person adn this dog? (Lan shows the picture to the old man) Old Man: Yeah...I know 'em! This is a SciLab scientist that used to come here a lot. He helped me out. Lan: You knew my grandpa?! Old Man: What, you're that scientist's grandson? Actually, he left me something. My Navi has it. He's in Oran on the Net, which you enter from OldMine. I never thought I'd meet the scientist's grandson. Must be destiny... Go through the lower entrance and head up to the loudspeaker. Jack in and get to the navi* Navi: my operator told me you'd come. Here, take this. (Receive OldPCode) Navi: I'm not sure which Security Cube that P-Code is for. It might be related to SciLab. I've always wondered about that. Scene 104: Navi: I'm Dr. Hikari Sr.'s Navi. You must be Dr. Hikari Jr.'s Navi. MegaMan: Um, actually, I'm the Navi of his son, Lan. Navi: Then you are the one carrying out Dr. Hikari Sr.'s wishes. I was told to give this to you. (Receive PastKey) Navi: It is yours now. MegaMan: I wonder if this is a key to the VisionBurst? Navi: I also have a message from the Dr. The 4th rock-crusher machine. A box that blocks the rocks marks the spot...My work is done. MegaMan: Um...Whoa! That Navi... Scene 105: Mr. Prog: VISITORS ARE SO RARE HERE...ARE YOU LOOKING FOR SOMETHING? [Say yes.] Mr. Prog: ...HMPH. FIND THE 4TH ROCK SMASHER. LOOK FOR THE BOX THAT BLOCKS THE ROCKS. DOES THAT MEAN THAT DEVICE OVER THERE? THAT REMINDS ME. I SAW A NAVI DISAPPEAR FROM THE EMPTY SPACE NEXT TO THAT DEVICE A LONG TIME AGO. OF COURSE I WAS PRETTY SURPRISED...I THINK THERE MAY BE A PORTAL TO ANOTHER DIMENSION AROUND THERE SOMEWHERE. SO YOU PROBABLY SHOULDN'T GET VERY CLOSE... ---------- MegaMan: "Look for the box that blocks the rocks." ...I wonder if it's here? (Use PastKey) Clink... MegaMan: Something's happening! A Secret Door appears in front of MegaMan MegaMan: There it is! The door to the VisionBurst of ACDC Town 11 years ago. Lan: ...Okay, MegaMan, when you're ready, let's go in! MegaMan: Let's go! Scene 106: VisionBurst of Oran Isle MegaMan: This is... Camera pans around MegaMan: This is Oran Isle how it used to be... Lan: A VisionBurst of Oran Isle...? Start exploring, MegaMan! MegaMan: Okay! Scene 107: MegaMan: I haven't seen any sign of the dog yet. Lan: Hmm...Where should we look next...? Voice: GowGow! MegaMan: It's a dog barking! MegaMan runs up the stairs Voice: GowGow! GowGow! Voice 2: Shut up,you noisy hound! Be quiet! Camera pans to a HeelNavi and Gow HeelNavi: MegaMan'll find us if you make that much of a racket! MegaMan: I already have! The HeelNavi turns around, MegaMan corners him HeelNavi: Kurgh, MegaMan! MegaMan: A Nebula Navi?! You're here too...Give me that dog...Let Gow go! HeelNavi: Huh, do you expect me to just hand him over to you?! No way! And I'm going to delete you too! If I take him the dog and tell him I defeated MegaMan, Master Regal will be mighty pleased with me! MegaMan: He's attacking, Lan! HeelNavi: Groooargh! Battle Viruses HeelNavi: Aaaargh! I heard you were strong but...Guurrrr! HeelNavi blows up MegaMan: It's okay, Gow! Gow: Grrr... MegaMan: He looks angry. It seems a bit strange. Hmm...Oh well...Better get hold of him, MegaMan. Megaman: Okay! MegaMan gets closer to to Gow Gow: Grrr...! MegaMan: There's no need to be scared, Gow...Shhhh... Gow: ......... MegaMan: That's it, stay right there... MegaMan gets closer MegaMan: That's it... Gow: Gow! The dog knocks Megaman down and runs MegaMan: Wah! Gow! Sorry, Lan! He got away! Lan: He can't have got that far yet! Go after him! MegaMan: Okay! ---------- Voice: RuffRuff! MegaMan: Hey! What was that...? MegaMan goes closer Voice: Gow! MegaMan: Wargh! Gow bursts out and runs off MegaMan: He got me again... Lan: Come on, MegaMan! Get with it! MegaMan: I'm sorry. I'll make sure I catch him next time! Voice: WoofWoof! MegaMan: That's Gow barking! Ah, unbelievable! Camera pans to BlizzardMan, who has caught Gow BlizzardMan: Whoosh! Got you! Now let's get out of this oven! I wonder what Dr. Regal wants with you anyway? Gow: Gow! Gow! Gow! BlizzardMan: Whoosh! You're a noisy one! Voice: Let Gow go! BlizzardMan: Whoosh?! MegaMan runs down to meet with him MegaMan: BlizzardMan! B-But, I thought I defeated you in the liberation... BlizzardMan: Whoosh! You think that was enough to defeat me?! A Darkloid can keep on reviving as long as there's darkness! Whoooosh! Lan: Then we'll just have to keep on defeating you! MegaMan! MegaMan: Hm! BlizzardMan: Whoosh! I don't have time to mess around with you now! Whoosh, farewell! BlizzardMan takes the dog and jacks out MegaMan: Wait! I'm sorry, Lan...I really messed that up... Lan: Never mind. Let's report back to the SciLab! Rrrring! MegaMan: Lan, it's a phone call! ...Better get it! Official: Ah, good! I reached you! Lan: ...Who are you? Official: I work at the SciLab. Our HP are being attacked by Nebula Darkloids! We really need your help here! Come to the SciLab as quick as you can! Lan: Huh! Okay! I'm coming right away! MegaMan,let's jack out and get to the SciLab! MegaMan: Okay! MegaMan jacks out Scene 108: MegaMan runs in MegaMan: ProtoMan! Megaman runs up to ProtoMan, who is combatting four HeelNavis and ShadeMan ShadeMan: W-Wheee! MegaMan...Waht a nuisance. MegaMan: I don't believe it! ShadeMan's revived too! ShadeMan: W-W-Wheee...I suppose that means you've seen BlizzardMan...Which means he must have got it...Wh-wh-wheeeee! now there's no need to buy time anymore... MegaMan readily takes a combat stance MegaMan: I'll help you out! ShadeMan: You people that try to stand in the way of Nebula...The time has come...For our master, Dr. Regal's ideal world...The world of true evil will be born! ProtoMan: What did you say?! ShadeMan: W-W-Wheee! It'd be nice to have a bit more fun with you but I'm afraid it's time to go! MegaMan: Wait! ShadeMan: Delete them, loyal servants! ShadeMan jacks out MegaMan: ShadeMan! HeelNavi: Forget about him! We're the ones you have to fight! Three more HeelNavis jack in behind them MegaMan: Kuh, I'm surrounded! Protoman: MegaMan, you take care of them! Megaman: Sure! HeelNavi: Your tactics count for nothing! You'll never beat us! Megaman: This is it, Lan! HeelNavi: Roaargh! Battle Viruses HeelNavi: Gaarrrgh! The HeelNavis blow up Protoman: I didn't expect the SciLab to be attacked...We can't use it as Mission Control from now on... MegaMan: ...ProtoMan. Nebula's got hold of Gow. ProtoMan: ...I got the idea from what they said that the dog's not a VisionBurst inhabitant after all. MegaMan: Really? Gow's not from a VisionBurst? ProtoMan: That's right. A VisionBurst is saved data from past moments in the real world. In other words, things that happened in the past...keep on repeating themselves forever...Things don't happen in real time. So I thought it was odd when I heard the dog had disappeared... MegaMan: So...Does Gow have something to do with Hikari Report then...? ProtoMan: ...I should think so. Anyway, we should jack out. Nebula could be listening. MegaMan: ...Hm. ProtoMan: Can you jack out, Lan? Chaud needs to talk. ProtoMan jacks out Lan: No problem! Let's jack out, MegaMan! MegaMan: Okay! MegaMan jacks out phases out and back into MissionCtrl Lan: It's my fault that they got Gow...I'm so sorry! Chaud: It's no use crying over spilt milk. The important thing is what we do next. I don't know what Nebula are trying to do but I'm sure that now they've got Gow, they'll be moving into the final stage of their plan. Lan: What can we do to stop them...? Chaud: First we have to hit Nebula's territory in the Undernet. We'll find their base and put a stop to Regal's plans. Lan: ...Hmm. But the Undernet's more dangerous than ever now. A liberation mission would be almost impossible... Chaud: It's not like you to lose your nerve. Lan: ...There was nothng I could do to stop them getting Gow...Even if we delete the Nebula Darkloids they'll probably just regenerate like they did this time...To be honest, I'm not sure that I'm up to the task... Chaud: Huh, I never expected to hear that from you...You may be the team operator, but you're not the team leader. Just leave the team command to ProtoMan, and concentrate on operating as best as you can. Lan: ...Yeah, you're right. We've got a great leader to see us through! Chaud: Yep! We're a team. You're not fighting this alone...Don't forget that. Lan: ...Okay! Chaud: Right, I want to plan the next mission...But I can't. Now that Nebula has got into the SciLab, we can't use this place as Mission Control...And that's why I need you...I want you to find us a new place. Lan: ...Somewhere quite big and hard for the enemy to find, right? ...I wonder if there is anywhere like that? Chaud: Do whatever you can to find it. Just be as quick as you can. Lan: ...Got it. I'll find us a great secret base! Chaud: ...Hm, I'm counting on you to find somewhere. Scene 109: Lan: Higsby! Higsby: Oh Lan, there you are, huh. Welcome to Higsby's! What's wrong, huh? Lan: Actually. . . Higsby: You're looking for a big space, huh? I know a place, huh. Of course you'll have to help me out with something. If you do that for me, I'll let you use the place, huh! Lan: Help? Higsby: Yep! Everything is give and take in this world, huh. Whatever you want, you'll need to pay the price, huh. Lan: All right. So what do I have to do? Higsby: Actually, NumberMan was suddenly attacked by viruses while delivering products to End Area3. He dropped a file with custome info in it, huh. Lan: No! That's the worst possible situation! Higsby: Indeed, huh...If this gets out, it will destroy my shop's reputation. Please help me!!! Please go find that DataFile NumberMan dropped, huh!!! Lan: OK. I'll need a little more information than that. End Area3 is a pretty big area to search. Higsby: True...He said they hit him while he was looking at something cool. Lan: Something really cool...Let's go check it out! Higsby: Thanks, huh. Scene 110: Higsby: WOOHOO!!! This is it, huh! Thanks, huh! You helped prevent my worst scandal ever, huh! phases out, back in Higsby: Okay then, I'll show you your secret base like I promised, huh...But first of all...Attention all customers! Sorry, but I'm afraid the shop's closed! Make your way out of here right now, huh! The patrons look and jump in surprise Boy: Hey, no way! Boy 2: I was just thinking of starting a NetBattle! Girl: That's not fair! Higsby: Whatever! Just get out of here, huh?! Boy: I'm bored! Let's go! Boy 2: Yeah, let's go! Girl: I'm going home too! The kids leave Higsby: Call again soon, huh! Sorry about that. Okay then, follow me, huh. Higsby walks up to the NumberMan sign Higsby: Here it is, huh...Abra Cadabra! A door opens up Higsby: It's in here...Follow me, huh. Higsby enters Lan: ...Gulp. Lan goes in, phases out and back in Lan: Wow...I never knew there was a room back here... Higsby: It's my warehouse. It's an office too. This way, huh. Higsby runs off, Lan follows him Lan: Wow! Camera pans around the scattered room Higsby: Well? A lot of cash has gone on the equipment here, so it should be fine for pretty much anything, huh. Lan rushes up to him Lan: This is amazing, Higsby! Just what I was looking for! Higsby: Hu hu hu...Well, I'm glad you like it, huh. As of today, it's all yours, huh! Lan: Thanks, Higsby! Um, and us using this place... Higsby: Chill out, huh! It's a secret base, right? I won't tell anyone! A secret base has to be kept secret, huh! I'm not the kind of guy to give away something like that! ...Huh, Lan?! Lan: Sure! Okay, I'd better get in touch with Chaud! phases out and back in, Chaud behind the desk, adressing Lan Chaud: This is an ideal Mission Control... Lan: Right, I'd better get straight on with the next mission plan... Pi-pi-pi-pi-piiii! Chaud: ?! It's the surveillance alarm! Lan: The surveillance alarm?! Chaud: Protoman set it up on the door to the Undernet. Someone or something must be trying to get through. Lan: ...Oh no! Chaud: Have you got some idea who it is? Lan: Well, there was this girl who kept pestering me to tell her how to get to the Undernet! Chaud: No, not a civilian! Lan, go to End Area5 right away. I'll bring ProtoMan there soon! Lan: Got it! Scene 111: MegaMan: Stay where you are! Camera pans to another Navi, MegaMan approaches MegaMan: Don't go any closer! Medi: Who are you? I have to get past here. Let me go! Jasmine: What's going on, Medi? Medi: Jasmine, this guy won't let me into the Undernet! Lan: So it is you! Didn't I tell you to stay away from the Undernet?! Jasmine: You're that horrible boy I met before! Lan: Hey! I'm saying this because I'm nice, not horrible! Jasmine: I don't have to listen to you! You can get that door open, Medi! Medi: Okay! MegaMan: No, Medi! Get over here! Hurry! Medi: Huh! I don't have to take orders from you! Medi readies to charge into the curtain Medi: ......Waaargh! Medi runs and hides behind MegaMan voice: It's been a while... MegaMan: ......! A cloud floats over, and destroys the door Lan: N-no way...! CloudMan hovers over and blocks the path CloudMan: I came back from the bowels of Hades to defeat you both! Lan: Huh! How can I fight and keep Medi safe...?! Voice: You Darkloids just don;t know when to give up, huh... ProtoMan jacks in MegaMan: ProtoMan! ProtoMan: Leave this to me, MegaMan. CloudMan: Huh! I can take care of you, no problem! Electric Storm... ProtoMan: Too late! ProtoMan deletes CloudMan Protoman: It won't work on me because I've already seen it! CloudMan: Ugggh...You... CloudMan retreats Protoman: He's gone... phases out and back in ProtoMan: I don't know why you wanted to get in the Undernet but it's not a place for civilians. Let this be a lesson to you. Now jack out and don't come back! Medi: ......... ProtoMan: I'm jacking out for now so I can plan the next mission... Medi: ...! Medi bursts past them and stands at the threshold MegaMan: Medi! Medi: Kyargh! camera pans to a damaged CloudMan CloudMan: ProtoMaaaan...I can't let you live...Wraaarrrgh! MegaMan: You won't blow yourself up! Medi: Kyaaarrrgh! CloudMan: I'll smash yooou...! ProtoMan: Ugh! ProtoMan leaps in the way, and a flash engulfs the screen, then disappears, ProtoMan nowhere in sight Medi: ...Ah, argh... Megaman: ...P-ProtoMan! Lan: N-No...It can't be... MegaMan: .........ProtoMaaaaan!!! phases out, back into the secret Higsby warehouse HQ Tesla: What do you mean, Protoman's been deleted?! Fyrefox: And what are we supposed to do now without a leader?! We're all just a bunch of amateurs, right?! Sure, we've been through a few things but I've only gone ahead with missions because we had a pro on the team! Without a leader, we're nothing! Jasmine: ......... turns to the rest I'm sorry, everyone...This is my fault. It's because of me that ProtoMan... Chaud: No, ProtoMan was deleted in the line of duty...Protecting civilians is an Official NetBattlers job... Jasmine: ...How can I apologize enough...? ProtoMan: You don't need to...He...ProtoMan followed the path he believed in to the end... Jasmine: ......... Chaud: Of course, Protoman is a huge loss to us. But Nebula is still going ahead with its plans even now. We can't just stand around here doing nothing. Charlie: So we're doing the next mission without a leader?! Chaud: ...No, we have a leader. ...Lan and MegaMan, I want you two to head the next mission. Lan: ...What?! Charlie: Yeah, they've got the experience and the skills too. Lan: W-Wait a minute! I can't be leader! We couldn't do anything to save ProtoMan...We're not capable of leading the team... Chaud: Lan, I believe in you which is why I'm asking. Lan: But...I'm scared...What if it goes like that again... Chaud: One day...Think about it for just one day. If you still say no then, I'll choose another leader. Lan: ......... Chaud: That's all for today. Lan, think it over properly, okay... Jasmine: ......... Scene 112: Ding dong.Ding dong. Lan: Aaah...Who's that so early in the morning...? ...Coming! Clang! phase in, Jasmine revealed to have rang the doorbell Jasmine: ...Hey! Lan: Jasmine...What are you doing here? Jasmine: I've come to ask a favor. Lan: A favor? Jasmine: I want you to put me on your team. You're leader, so you can do that, right? Lan: ...Forget it. I'm no leader, okay... Jasmine: Don't you feel bad that you lost one of your friends?! Lan: ...Of course I do! ...But I can't be leader. Jasmine: ...You coward! Haven't you thought about why Chaud asked you to be leader?! Lan: ...... Jasmine: Fine! I won't ask you again! I'll get revenge for ProtoMan by myself! Jasmine runs off Lan: Jasmine, wait! You can't go on your own! MegaMan: She's serious, Lan! Let's go to the Undernet! Lan: ......Okay! Scene 113: A NormalNavi runs towards MegaMan NormalNavi: Ah! Sorry, sorry! The navi tries to escape MegaMan: Erm, did you... NormalNavi: What? What is it?! I'm in a hurry. MegaMan: Did you see a girl Navi on your way? NormalNavi: A girl Navi. . .Ah! That Navi! I didn't talk to her but I did see her running inside. She looked like she was in a real hurry. Lan: So Medi did go to the Undernet...Hurry, MegaMan! MegaMan: Okay! NormalNavi: Wait a second! You're not planning on going up there are you?! MegaMan: Hm? That was the plan. NormalNavi: You can't be serious! I can't believe you don't know...They come out up there! MegaMan: Come out? Who?! NormalNavi: Well, isn't it obvious?! Ghosts! G.h.o.s.t.s! MegaMan: Ghosts?! NormalNavi: Yes! Ghosts of dead people! They're all over the place and they come after you too! If they catch you, they possess you... MegaMan: ...Huh. NormalNavi: And if you have a virus-battle when you're possessed, it's really weird. I can't explain it but it's all wrong. It's like you can't move your body properly...And you use a lot more energy than normal...You get irritated for no real reason too...B-Basically, it's like some kind of curse! ...... ...You're listening but do you understand?! [Say yes] NormalNavi: ...You do but you're still not going to turn back, right? MegaMan: Huh! NormalNavi: Fine. You can't say I didn't warn you if you come a cropper. Well, goodbye then! The NormalNavi runs off Lan: If the place is that scary, then we can't leave Medi there. MegaMan: You're right. Let's hurry, Lan! Lan: Uh-huh! Scene 114: MegaMan: Medi! Medi: I knew you'd come, MegaMan! Let's get everyone together and fight the Nebula Navis! MegaMan: ......... Medi: What are you waiting for?! Lan: ...We just came in here to bring you back. Time to go home, Medi! Jasmine: That's crazy! I can't understand why you've been chosne as leader! Medi, get rid of this loser so we can go avenge ProtoMan! Medi: Good idea! Spineless kids like him deserve what they get! Both take a battle stance MegaMan: What are you going to do?! Medi: I'm going to open your eyes! MegaMan: W-Wait... Medi: Don't waste your breath! Scene 115: Medi: Ha ha...That's more like it...Still think you're not up to it?! MegaMan: Medi... Voice: Look at how far this delicate girl has gone for you. You have to accept now, leader! GyroMan jacks in GyroMan: This kid certainly put us in our place. She told us to come here because she could change your mind. The others should be along soon, right? MagnetMan, SearchMan, and NapalmMan jack in MagnetMan: Most Navis would be too scared to even come to the Undernet but this kid had the courage to do that and take you on too! SearchMan: An unusual tactic, but it seems like it might have worked. NapalmMan: You can't beat a bit of action! GyroMan: This kid and her operator have been desperate to do all they can to make up for what happened. You can't turn your back on them now! Or Chaud either! Lan: ...Medi, Jasmine. You've really opened my eyes! I was too weak and all I could think of was running away. But now I see that the only way forward is to keep fighting! Let's get this mission started! MegaMan: Yeah! Jasmine: Hu hu! Medi, now that's decided, you'd better deal with that door! Medi: No problem! Medi turns, NapalmMan steps forward NapalmMan: Hold it, girl! Leave this to me. I can break through here in no time. Move over! Medi steps aside, NapalmMan stands in front of the door NapalmMan: Here goes! Raarrrgh! NapalmMan fires at the door NapalmMan: Kurh! It didn't budge an inch! What's going on?! Medi: You can't open that door with force. How can I put this? That door's made out of anger and hatred. If you try to open it with violence, it won't work at all. Honestly, boys are silly sometimes! There is another way. Watch this. NapalmMan moves aside, Medi steps in front Medi: Here goes...HealingPulse! Yaaaah! Medi fires a weird shockwave at the door, which then falls Medi: See! NapalmMan: A-Amazing... Medi: Okay, leader, we're ready to go! You can start the mission any time. Obviously I'll be coming with you, right?! MegaMan: Medi...Yes, of course! Right, everyone, it's time to start our liberation of Undernet4! First things first, MagnetMan, I'd like you to stay back here and look out for the enemy. ...Is that okay? MagnetMan: Hm! Is that you asking a favor? Or is it an order? MegaMan: ...It's an order. MagnetMan: Then you don't need to ask if it's okay! Give proper orders, ...Leader! MegaMan: MagnetMan...You stay here and look out for enemy reinforcements! MagnetMan: Sure, leave it to me! MegaMan: Lan, when you'r ready, let's start the mission! Lan: Sure! Scene 116: The five navis run in MegaMan: What the...? It can't be! SearchMan: What's wrong? Camera pans to DarkProtoMan MegaMan: ProtoMan! You're alive! DarkProtoMan: ... Medi: Wait! He's acting funny! MegaMan: ProtoMan? DarkProtoMan: So, you're the enemy of the Officials, huh? NapalmMan: HUH?! What are you talking about?! Lan: ProtoMan! It's us! Your friends! DarkProtoMan: Master Regal saved my life. I pledged my loyalty to him. Protecting this area is my task. Lan: Oh, no...! MegaMan: Did the Darkloids modify him like they did me...? GyroMan: Looks like it. That means we have to fight through all the panels to get to him... Camera passes across the screen in many places GyroMan: Wow! DarkPanels are EVERYWHERE! NapalmMan: This'll be tough to handle even with my firepower. Medi: I guess it's my turn, then! GyroMan: What, you've got a plan? Medi: Yeah, I do! With TwinLiberation...I can liberate a row of panels just by hitting the ends! GyroMan: That's great! That'll work better than my jumping over DarkPanels. Lan: It's a plan! Now, let's free ProtoMan from the Nebula forces! MegaMan: Yessir! The mission is to liberate within 10 phases! Go! Scene 117: DarkProtoMan: Gaargh... MegaMan: ProtoMan! CosmoMan: So the DarkPower hasn't quite taken its hold yet! Pah! MegaMan: That's CosmoMan! DarkProtoMan: ...Uurgh. CosmoMan: Let's go, ProtoMan! A rift engulfs ProtoMan MegaMan: ProtoMan! The rift disappears CosmoMan: You may have won this fight! But you can only savor your victory for a few days now! Wa ha ha hah! MegaMan: Just a few days... Medi: We didn't manage to get ProtoMan back... MegaMan: No...But at least we know he's still alive. We'll make sure we get him back somehow! Medi: ...Yeah! I'll do what I can! MegaMan: Medi, you're such a kind person. I'm really impressed by how nice you are! Narrator: MegaMan's soul has communed with Medi's! MegaMan: Everyone, the final battle with Nebula is drawing near! But before that we must get ProtoMan back! Then we can all take on Nebula together! ...That's all! Dismissed! fades out, back into Regal's HQ, Dr. Hikari on the ground tied Regal: Hikari...You were tight-lipped to the end, I'll give you that. However, your efforts have all been in vain. Dr. Hikari: ...It c-can't be!!! Regal: Your father was a great scientist...Even I didn't realize he had disguised the "Hikari Report" as a dog... Dr. Hikari: ...R-Regal...What are you gonna do with Gow? Regal: I'm gonna complete...SoulNet! Dr. Hikari: Soul...Net...But if you did that, the world would...! Regal: Yes! My utopia, an utterly evil world, shall be complete... Dr. Hikari: I never imagined SoulNet would turn out like this...Father, forgive me... Regal: Behold, Hikari...Electopia stained in evil... turns to comp Regal: It's Regal...Move NebulaGray to the 3rd ExpServ. ...And transmit at max speed to the microservers we planted in Electopia. You may halt DarkChip production!. ...Yes, that's right. Dr. Regal turns back Regal: Everything's ready...Now, Hikari...Behold the fruits of my experiment! Dr. Hikari: Your evil plan will fail. Regal: Heh heh heh...Your hope soon will turn to despair...And you'll once again see just how weak people are! I must tell the nation it has bgun! Get the camera. Crony: Yes, Dr.!!! phases out Dr. Hikari: Lan...MegaMan... * * * * * Haruka: Lan, Lan!!! Lan: What's wrong, Mom!!! Haruka: Your Dad... phases back into Lan's house, both are at the TV, Regal on it Lan: R-Regal!!! Haruka: I just saw your Dad behind him... Lan: What?! Regal: I am Dr. Regal...ruler of the new world. You, the people of Electopia, are the lucky subjects of my grand experiment. Don't be alarmed. It won't hurt a bit...Rather, you'll feel the joy of being freed from bondage. Your time has come...Just do whatever you want...In a few minutes, you shall be free. TV cuts out Lan: Regal...He's putting his plan in motion! Lan walks off Haruka: Lan, wait!!! Haruka comes up to him Lan: Sorry, Mom. I know it's dangerous but I have to go! Haruka: ...Take this Amulet. Gramps always kept it with him. I'm sure it will protect you, too. Lan: Thanks, Mom! (Get the Amulet) Lan: Bye, Mom. Haruka: Be careful. Lan: Don't worry, I have Gramps's Amulet now. Let's go, MegaMan!!! MegaMan: Roger!!! Scene 118: Voice: Hold it right there! Voice 2: Shaddup! Shut yer trap!!! Two people run up the street Woman: Hey! Gimme back my PET! Man: No way! It's mine!!! Besides, you stole it from someone else, didn't ya?! Woman: I can get away with anything! We're nothing alike. Man: I said shaddup! It's mine I tell ya! The man runs off Woman: NOOO!!! Wait!!! The woman gives chase Lan: Huh? MegaMan: Lan, over there! Lan: Over there? camera pans to two kids down the block Kid 1: You know, I really never did like you! Kid 2: Well, I can't stand your face...You're so annoying! camera pans back Lan: Why's everyone fighting? MegaMan: This isn't right...It might be part of Regal's experiment. Lan: Something's gone wrong in the real world this time! There's trouble in this peaceful city. It'll get messy if it goes nationwide! Beep beep beep! MegaMan: Lan, you've got mail! Wonder who it's from? There's no sender listed. Lan: What does it say? MegaMan: Here goes: "This mail is for all Anti-Nebula Core members. Nebula is placing microservers in Cyberworld all over Electopia. Destroying those servers might possibly stop Nebula's attack. The closer you get to one, the more it will affect you. Be very careful." ...That's all of it! Lan: Who sent that? They sure know a lot about Nebula's plan...Based on this mail, I bet other members are spreading out to look for the servers right now...Or it could be one of Nebula's traps... MegaMan: Lan, we can worry about that later. If what that mail says is true, the microservers are hidden somewhere in ACDC Town! Lan: Right! We gotta set things straight in ACDC Town first! MegaMan, let's go find these microservers. MegaMan: Gotcha!!! Scene 119: MegaMan: Lan, I think I found a server! Lan: MegaMan, you must destroy it! MegaMan: Roger!!! SearchMan jacks in MegaMan: SearchMan! You here to destroy this server, too? SearchMan: Nope...My target is...you, MegaMan!!! MegaMan: What?! SearchMan, is the server affecting you, too? Lan: Raika! What gives?! Raika: Lan...I hate your power...SearchMan, delete MegaMan. Lan: Raika! Do you even know what you're saying?! Snap out of it!!! SearchMan: Target, MegaMan...Locked in... Each takes a battle stance MegaMan: Here he comes, Lan!!! Lan: We've got no choice. Get him, MegaMan!!! Battle routine, set! MegaMan: Execute!!! SearchMan: I'm gonna delete ya! Scene 120: SearchMan: Aaahhh!!! SearchMan jacks out Lan: Now, MegaMan! The server!!! Megaman: I'm on it!!! MegaMan destroys the server MegaMan: We did it, Lan!!! Raika: Uhhh, ahhh... Lan: Raika!!! Raika: ...Lan, what did I... Lan: You OK now? Phew! You had me worried there. Is SearchMan OK, too? Raika: ...SearchMan's fine. Sorry for all the trouble...I felt this dark feeling weling up inside me, and then...I suddenly lost consciousness. I apologize...for what I've done. Lan: Don't be sorry! I'm just happy that you and SearchMan are OK! Good work, MegaMan. Jack out!!! ACDC Town should be OK now. Now to Chaud's to think up a plan! MegaMan: Gotcha! Scene 121: Chaud: Unnng... Lan: Chaud! Are you OK? Chaud: Don't worry. Go check the other areas for damage! Lan: I will. By the way, you sent that mail to everyone, right? Chaud: Mail...? What are you talking about? Lan: What?! That mail must be...We'd better go check it out! Let's go, MegaMan! MegaMan: Yeah! Scene 122: MagnetMan: Look who's here... MegaMan: MagnetMan, get outta my way! MagnetMan: Not so fast...Yer gonna have to go through me to get to this server! MegaMan: Huh?! Aren't we on the same side?! MagnetMan: Same side...? I was just helping out because Ms. Tesla told me to. How humiliating it was losing to you. I'm gonna get my revenge right here, right now!!! MegaMan: Here he comes, Lan!!! Lan: We've got no choice! Battle routine, set! MegaMan: Execute!!! MagnetMan: Aaahhh!!! Scene 123: MagnetMan: Gaaahhh!!! MagnetMan jacks out Lan: Quick, the server! MegaMan: Roger!!! MegaMan destroys the microserver MegaMan: We did it, Lan! Lan: That's that! ...Oh, Tesla! Tesla: Lan...Oww, my head...What are you doing here? Lan: You OK, Tesla?! Tesla: Yeah. I came after that mail about the servers but then I started feeling all weird. I'm okay now, though. Lan: I see...Well, it's all clear now. We destroyed the server Nebula planted! Tesla: ...Oh, nice work! MegaMan: Tesla! Is MagnetMan OK? Tesla: ...Yeah! Just out cold! What did he do? Lan: Uhhh...Never mind! OK, MegaMan! Let's go find the next server!! MegaMan: Roger! Scene 124: Megaman: Here it is, Lan! Lan: Use your MegaBuster! MegaMan: Roger!!! ...Hm? This server... Voice: Hold it right there! GyroMan jacks in MegaMan: GyroMan! Lan: I know...We have to battle you first... GyroMan: Rawrrr! Don't you know its rude to say someone else's lines?! But we can leave that for later...We're gonna go at it right now!!! Lan: Yikes! Megaman, we've got no choice! MegaMan: B-But... GyroMan: Weak, MegaMan, weak! MegaMan: Aaargh!!! Scene 125: GyroMan: tsk, I thought I could win but... MegaMan: GyroMan...? GyroMan: GyroForm!!! GyroMan turns into a helicopter and bombs the microserver MegaMan: GyroMan, you used to be a sensible Navi. You already shutdown a server...What's got into you? GyroMan: I couldn't stand always losing! Charlie: I wanted to challenge you guys one more time. The final battle with Nebula lies ahead, right? That means I won't have another chance to fight you. Lan: Charlie... GyroMan: Charlie, they beat our pants off. Charlie: ...Yep! Lan, sorry for the sudden challenge! Now I can stand up to Nebula without a care in the world. I'm looking forward to the battle ahead! Lan: ...Me too!!! Charlie: GyroMan, jack out! GyroMan: Roger! GyroMan jacks out Lan: MegaMan, let's jack out, too! MegaMan: Gotcha!!! Scene 126: Fyrefox: Heya, Lan! You here to destroy Nebula's server? This server's inside this NetBattle machine! Lan: Well then, no time to lose. Let's find it! Fyrefox: You know...I wanted to battle you here awhile back... Lan: This is no time to bring that up! Fyrefox: I was not able to battle you then... Lan: Wait a sec, Fyrefox! Fyrefox: I get a wild urge to battle here...I can't control this feeling...I gotta battle someone right now!!! Lan, battle me and NapalmMan right now! Lan: Looks like we have to take 'em on. They're gonna jack in no matter what. Fyrefox: Heh, heh...So ya do wanna take us on! You're going down... Lan: Let's go, MegaMan! Battle routine, set! Megaman: Execute!!! NapalmMan: I'll blow 'em away! Scene 127: Fyrefox: What the?! Lan... You...!!! But how...?!! Lan: Yikes! This doesn't look good. Megaman, jack in!!! Destroy the server quick!!! MegaMan: Roger! Lan: Jack in! MegaMan, Execute!!! MegaMan jacks in MegaMan: There's the server! MegaMan runs up to it MegaMan: Lan, I found it!!! Lan: Hurry! Destroy it quick! NapalmMan: Hey! Not so fast! This time we're gonna duke it out!!! Lan: MEGAMAN!!! MegaMan: Lan!!! Megaman destroys the microserver MegaMan: Lan, are you OK?! Lan: Huff, puff...That was close... Fyrefox: Huff, puff...Hm? Why do I have my fists raised? Hey, what are you doing here Lan? Lan: Whaddaya mean me?! You were the one trying to slug me!! Fyrefox: Hmmm...I don't remember a thing. Oh yeah! What about that server Nebula planted?! Lan: Already smashed it! Fyrefox: Huh?! When?! Lan: Never mind! Megaman, jack out! MegaMan: Roger! MegaMan jacks out, phase out Briiiiing! MegaMan: Lan, phone call! I'm picking up!!! Lan: Hello... Chaud: It's Chaud...We destroyed all the servers that Nebula planted. A scan of the affected areas reveals that the damage is subsiding. Lan: Great news... Chaud: Not so fast. The real problem awaits. Lan: Real problem? Chaud: That's right. Nebula used the servers to transmit a signal that planted evil feelings in people's souls. We now know the source lies on the Undernet. Lan: The Undernet, eh...? I'll check it out. Chaud: ...Lan, we detected ProtoMan near the signal source...He's fallen completely into Nebula's hands. If it comes to a fight, do not hesitate to delete him. Lan: Chaud...If I find him, I'm gonna drag him back by the scruff of his neck! Chaud: ...Heh, I appreciate your enthusiasm but destroying the signal source is the prime objective. Understand? Lan: ...Got it. I'll contact you once we're done. Bye! Click... Lan: OK, MegaMan, off to the Undernet! MegaMan: Gotcha! Scene 128: MegaMan: I found the signal transmitter, Lan! Lan: OK, let's get this over with quick! MegaMan: Roger!!! MegaMan fires at it, but the armor blocks the shots MegaMan: No good!!! It's immune to my MegaBuster... Lan: Don't give up. Try again! MegaMan: OK!!! Voice: Seems a little rat has wandered in... MegaMan: T-that voice...!!! A rift opens up, DarkProtoMan comes out MegaMan: ProtoMan!!! DarkProtoMan: You found the server somehow but it was a waste of time... MegaMan: Waste of time...? DarkProtoMan: That's right. We got enough data from the recent experiment. DarkProtoMan turns to destroy the transmitter DarkProtoMan: It's now complete, and we no longer need this server. DarkProtoMan destroys the server MegaMan: My MegaBuster didn't even make a scratch... DarkProtoMan: It's the DarkPower...Even YOU want its power, don't you? MegaMan: No, you're wrong! Snap out of it, ProtoMan! Let's go back and see Chaud! DarkProtoMan: Chaud...? ...Who's he? The only place I belong is with Dr. Regal. MegaMan: ProtoMan, I'm not leaving without you! DarkProtoMan: Heh heh heh...And just how do you plan on doing that? Hah!!! DarkProtoMan pushes MegaMan to the ground MegaMan: Uuh!!! DarkProtoMan: Is that all ya got? How do expect to defeat me like that? I'm gonna end this... DarkProtoMan moves in Voice: HealingPulse!!! A sudden blast of light engulfs the area, and DarkProtoMan is stunned DarkProtoMan: Guraaah!!! MegaMan: What was that?! Medi runs up and stands in between MegaMan and DarkProtoMan and attacks him with waves MegaMan: Medi! Medi: Can you get up? MegaMan: Uh, I think so! Megaman gets up MegaMan: What are you doing here, Medi? Voice: She's here because she is the one who can free ProtoMan from the DarkPower that rules him. MegaMan: !!! Colonel jacks in Colonel: After suffering the Darkloid's self-destruct attack, ProtoMan was taken to Nebula HQ. There his wounds were treated with the DarkPower, which took over his body. DarkProtoMan: Show yourself!!! Colonel: I am Colonel...Regal's bane... MegaMan: C-Colonel... Colonel: Listen, you two...Medi's power is trying to break the DarkPower that is ruling ProtoMan. MegaMan: That means there's hope for ProtoMan! Colonel: It's not that easy. The DarkPower has gnawed deep into his personality, memory, and other key data. Destroying the DarkPower may take such key data with it. If that happens, Protoman will be an empty shell... MegaMan: Oh no! What should we do?! Colonel: Listen, you two, here's the plan... .................. Got it? Medi: Yep! MegaMan: Gotcha! Colonel: Let's roll!!! Medi: HealingPulse, full power!!! DarkProtoMan: Graaahhh!!! The DarkPower rises out of ProtoMan Colonel: The DarkPower left ProtoMan!!! Now!!! Colonel flashes through, knocking down ProtoMan and moving Medi aside Colonel: MegaMan, fire!!! MegaMan: PROTOMAN!!! MegaMan destroys the DarkPower with his buster phase out Voice: ...Who...? What...? ...Where...? MegaMan: ProtoMan! ProtoMan!!! ProtoMan: That voice... Medi: I gave him the best treatment I could. I think his physical wounds will be OK now but... Colonel: Now it's a matter of his soul... MegaMan: ProtoMan! Snap out of it! ProtoMan: M-M-MegaMan... phase back in, ProtoMan purified of the darkness MegaMan: ProtoMan! You're back!!! ProtoMan: I heard your...Your voice...It spoke to me...Deep down into my soul... MegaMan: ...I believed in you, ProtoMan. I never doubted you'd be back. Narrator: MegaMan's soul has communed with ProtoMan's!!! MegaMan: I'll take you back to Chaud, ProtoMan. ProtoMan: ...OK. MegaMan turns to Colonel MegaMan: Thanks, Colonel! We saved ProtoMan thanks to you. ...Um, who are you, anyway? Colonel: Let's just say I want the same thing as you guys. but I think my work's done here. I'm sure you guys can defeat Regal. Colonel jacks out MegaMan: Colonel!!! ...Thank you!!! Medi turns to Megaman Medi: Well,let's jack out, too. We got a seriously injured Navi here. MegaMan turns back to Medi MegaMan: Roger! screen brightens then returns to the new MissionControl Chaud: You probably already know this, but ProtoMan is back...That means our whole team is here. Fyrefox: So can we go strike Nebula's home base?! Raika: How can we do that without knowing where it is? Fyrefox: Um...Errr... Chaud: We have a general fix on their base. Raika: Really?! Chaud: ProtoMan's access log contains its probable location. Fyrefox: Well, what are we waitin' for!!! Charlie: How's ProtoMan, anyway? Chaud: He's lucid now. He should be fully recovered tomorrow. Jasmine: That's a relief... Megaman: That means we head for Nebula's home base tomorrow! After all, we gotta have our leader! Tesla;Um, uhhh, Chaud? Are we going to Nebula's base, too? Chaud: You don't have to go if you're scared... Tesla: ...We've come this far with you guys so we're gonna stick around till the end. Whenever I'm scared, I just put one foot forward. That somehow makes it easier to go on. Chaud: Hm...Ok then...Be at the park in front of Higsby's at 10AM tomorrow. You don't have to come if you don't want to. You've all done more than enough already. This one's shaping up to be one heck of a battle. I won't say a word if you stay home. That's all. Meeting's over! Scene 129: Lan: Mom, I'm home. Haruka: Welcome back, Lan. I found something while clearing out Gramps desk. Lan: What? Haruka: I'm not sure but I thought you might know. (Get a DataDisk) Lan: Wonder what it contains...MegaMan, analyze it please! MegaMan: It contains TextData that reads: "Net, SciLab, 3, center, straight 27, turn and go 4. Turn again, go 4 and then check...Hikari data, reaction..." Lan: A memo from Gramps...Might come in handy. Haruka: ......Lan. Lan: ...... Haruka: Lan...You're gonna go... Lan: ...Yeah. ...We set off tomorrow morning. ...How did you know? Haruka: After raising you for 10 years, I could just tell. You're face gave it away. Lan: Don't worry, Mom. I'm gonna bring Dad back no matter what... Haruka: ...OK. Lan: ...Well, I'm gonna go check out the info on this DataDisk. Lan runs off to his room Haruka: ...Gramps, please watch over Lan and Hub... Scene 130: MegaMan: Was the DataDisk referring to here? Lan: Was that a VisionBurst again? flash MegaMan: Whoa! Lan: What is it, MegaMan?! MegaMan: The mark on my chest is glowing...What the?! flash, reappear, the door appears MegaMan: A doorway to the VisionBurst... Lan: A reaction to your program, perhaps? MegaMan: Lan...Let's go. Lan: OK! Scene 131: Lan: Well, MegaMan? MegaMan: Lan! Someone else's here... camera phases to two men Man: The basic theory of SoulNet is complete. Man 2: As is the design for SoulServer... Man: If we complete our joint research on SoulNet, we'll be able to build a strife-free world where people trust each other. Man 2: Still, there's a major problem that must be solved... Man: Right. We've done what we can. Now it's up to the next generation to finish this research. Man 2: Yes? Our offspring will certainly complete what we've started. Man: They won't fail us...The "Hikari Report" records all my son, Yuichiro, needs. Man 2: And I will pass my design on to Regal...So, we've reached the final day of our research...I feel a bit sad... Man: Ha ha ha...That's not the Wily I know. Man 2: Heh heh...Well, frankly, I was shocked when you began talking about converting people's souls into data and linking them via SoulServer to create SoulNet. But sure enough, you did it Hikari. You did it... Man: I couldn't have done it without your robotics technology. Voice: Dr. Hikari, you have a visitor. Please come to the 3rd F. meeting room. Man: They're calling me. Well, I should go. See you later, Wily. Man 2: Bye. The Man exits the room MegaMan: That was Gramps when he was young...And he was speaking with a young Wily... Lan: So the scientist Chaud said Gramps conducted the joint research with was Wily?! And to think Regal is really Wily's son... MegaMan: Gramps mentioned the "Hikari Report," right? And Regal must have the SoulNet design handed down from Wily. Lan: So if Regal is after the "Hikari Report," does that mean he intends to complete SoulNet, Gramps and Wily's research?! But weren't they developing SoulNet to interlink people and build a world where they could trust each other? What is Regal up to? MegaMan: Lan, let's go talk to Wily. Maybe he can tell us something. Lan: Wily?! I'm not sure that's a good idea...Be careful. MegaMan: Don't worry. That's the old Wily over there. I'm gonna try. MegaMan runs over MegaMan: Um, excuse me... Man 2: I hope a time will come when SoulNet will be possible. But it's really a double-edged sword...We must think about the worst scenario...I should be going. Man 2 exits MegaMan: Ah, he's gone...SoulNet's a double-edged sword...? The worst scenario...? What did he mean...? Lan: At any rate, it seems Regal is up to whatever it was Wily feared...Regal...He's ruining Gramps's dream. MegaMan, jack out. Let's go prepare for the final battle tomorrow. MegaMan: Gotcha! Scene 132: MegaMan: Sleep well? Today's the final battle! Lan: Yeah, like a log. Let's go meet the others. They'll be in front of Higsby's, right? MegaMan: Right! Let's not forget to say bye to Mom before we go! Lan: And when it's over, we'll say, "We're home" with Dad! MegaMan: Yep! Visit your mom. Lan: I'm leaving, Mom! Haruka: Lan...take care of your father... Lan: Leave it to me! I promise I'll bring him back! Haruka: ...OK. Scene 133: Chaud: There you are... Lan: Hey! I'm gonna clobber Regal and save my Dad. Where's Nebula's home base, anyway? Chaud: It's at the highest point in Electopia. Lan: The highest point in Electopia...Not Mt. Belenus?! Chaud: Bingo...At 12,389 ft., it's the highest point in Electopia. Nebula's base is within its crater. Lan: How we gonna get all the way up there? We're not gonna climb, are we?! Chaud: No, of course we're not going to climb. I've arranged for a chopper. A chopper prepares to land in the middle of the park Lan: I see you've thought of everything. ...Let's get going. Chaud: ...OK. phase out, back in with Lan and Chaud Lan: Let's get in. Chaud: You got company, Lan...I'll go ahead. Make it quick. Chaud waits as Mayl, Dex, and Yai approach Lan Lan: Hey guys... Dex: Why didn't you tell us you're leaving!? Yai: I know we couldn't really be of much use to you guys but...we can handle the worrying department! Mayl: ...Lan, You better come back in one piece... Lan: Guys...I'll bring GutsMan, Roll, and Glide back with me, you'll see. I won't be gone long! Well, I better get going now. Lan walks off, and Mayl steps forward Mayl: Lan!!! Promise you'll be careful... Dex: Let's NetBattle when you get back! Yai: Make us proud... Lan: ...OK, guys...I'm off!!! Lan runs up to Chaud Chaud: You ready? Lan: Sorry to keep you waiting. Let's go! Chaud: Right! phase out, back in with the three of them looking Mayl: ......Lan. phase out Narrator: Several hours after leaving ACDC Town, they reached the top of Mt. Belenus, site of Nebula's base, and a dormant volcano... phase in, the seven of them Chaud: This is Nebula's base, home of the DarkChip Syndicate. camera pans to the insignia and back Fyrefox: Chaud! We've come this far! Now let's get in there and finish it! I'm point man!!! Charlie: You're clueless Fyrefox. Fyrefox: What's that supposed to mean, Charlie?! Charlie: This is the enemy's home base. Who knows what traps await? Only a fool would rush in without thinking. I'm gonna lead this one. Right, leader? Lemme go ahead and check things out! Chaud: ...Fine. But stay on your toes. Charlie: Roger! Stay here until I send word. Lan: Charlie! Be careful... Charlie: I could do this sorta thing with my eyes closed. Don't ya worry! I'll be back in a flash! Charlie heads off, phase out Narrator: 10 minutes after Charlie set out... Briiiiing! Chaud: Chaud here...Charlie? The back entrance...OK, got it. ...!? What was that?! Answer me, Charlie! Charlie!!! phase back in Lan: Chaud, what happened to Charlie?! Chaud: ...Dunno. I lost the signal. Fyrefox: That fool. Now look what happened to him for showing off! We can't just sit here now. Let's go, leader! Chaud: ...Right. To the back entrance! Let's go, people!!! Scene 134: the team is waiting in the hall, camera pans to two doors then back Chaud: Two doors... Chaud returns to brief the team Lan: Well, Chaud? Chaud: The front entrance lies ahead. There are two doors we can use. Listen up. Form two groups: one to check out each door. Once Regal is found, contact the other group, got it? Lan: So is it me and you, Chaud? Chaud: No, we're splitting up. Lan, Tesla, Fyrefox and Raika...You guys check out the near door. You may end up facing the enemy's frontal assault. But I know you guys are the right people for the job. Jasmine: W-What about me? Chaud: Jasmine, come with me. I need your ability to counter the DarkPower. Jasmine: Y-yes sir! Jasmine comes up to Chaud Chaud: Fall back if things get too hairy. Don't be reckless. Oh, and Lan... Chaud comes closer to Lan Chaud: Take this. You'll be able to master it. (Get DeltaRay Z) Lan: Thanks, Chaud. I'll use it wisely. Be careful. Chaud: You guys, too... Lan: Got it! Chaud returns to Jasmine Chaud: Let's go, Jasmine. Jasmine: Alright!!! Chaud and Jasmine go ahead Scene 135: camera starts on some dark reactor, phases to many conveyors with DarkChips Lan: What the...?! Raika: ...It's a plant for producing DarkChips! Tesla: So this is where they make them... Fyrefox: Lan, let's hurry ahead! I'm gonna pulverize this plant after I finish off Regal. Lan turns to them Lan: OK, guys, let's go!!! Scene 136: Tesla: This looks like the only way forward...But we'll have to disable this electro-barrier first. Fyrefox: Tesla, how are we gonna disable it? Tesla: We should jack into this control panel and shut down the control system. Tesla takes one side, Lan the other Lan: Tesla,I'm ready to jack in. Just say the word. Tesla: It appears we need two Navis to get anywhere this time. Fyrefox: I'm on it... Tesla: Sorry but...Let me handle this one. Fyrefox: Huh?! Tesla: This is the enemy's home base. We've no idea what awaits. MagnetMan should go. He has excellent defensive ability. Right, Raika? Raika: ...Fine by me. Fyrefox: How 'bout the other... Tesla: Let's move, Lan!!! Lan: OK!!! Fyrefox: When's my chance... Lan: Jack in! MegaMan, Execute!!! MegaMan jacks in Lan: MegaMan, you gotta disable the door's electronic lock! MegaMan: Gotcha!!! MagnetMan jacks in Tesla: MagnetMan, give it all you got! MagnetMan: Yes, Ms. Tesla! MegaMan: Let's go for it, MagnetMan! MagnetMan: Hmph! Don't get the wrong idea. I'm doing this for Ms. Tesla! Lan: In battle, it's crucial to work with your teammate! Press Select to switch Navis. Let's go full blast!!! MegaMan: Gotcha!!! Scene 137: BlizzardMan: Whoosh!!! Never thought you'd get this far!!! MegaMan: BlizzardMan!!! BlizzardMan: Whoosh!!! You're not gonna ruin our plan! Whoosh!!! MegaMan: Lan! Lan: We gotta defeat BlizzardMan to continue! Let's do it, MegaMan! Battle routine, set! MegaMan: Execute! BlizzardMan: I'm gonna freeze ya! Whoosh!!! Scene 138: BlizzardMan: Whoosh...Why you...! It's not over yet! Whoosh!!! A DarkRift pulls MegaMan closer MegaMan: I'm being pulled in! What is it?! BlizzardMan: It's a black hole to the DarkGalaxy. MegaMan: D-Dark...Galaxy?! BlizzardMan: A dark universe created by Dr. Regal! Wander its darkness forever!!! Whoosh!!! BlizzardMan is drawn in Fyrefox: The electro-barrier has been disabled! Lan: MegaMan, jack out! MegaMan: I can't, Lan! It's pulling me in with a tremendous force!!! Aaah!!! MegaMan is slowly pulled in Lan: MegaMan!!! phases out MagnetMan: ...Hold on!!! phases in, MagnetMan in front of MegaMan MegaMan: MagnetMan!!! MagnetMan: Argh! It's so powerful...MegaMan, jack out now while I'm blocking it. You should be able to now! MegaMan: But...MagnetMan! MagnetMan: Don't get the wrong idea...I'm doing this because Ms. Tesla would scold me if I didn't help. MagnetMan is pulled closer MagnetMan: Go, now!!! MegaMan: MagnetMan... MagnetMan: MegaMan...You must defeat Nebula. MegaMan: MagnetMan!!! MegaMan jacks out Tesla: MagnetMan, hurry up and jack out, too!!! MagnetMan: Ms. T-Tesla, forgive me... Tesla: Don't say that!!! Now get back here before I get angry! MagnetMan: Please forgive me. I won't be around to be scolded... MagnetMan is devoured by the DarkRift Tesla: Noooooo!!! flashs back out [Talk to Tesla] Lan: Tesla... Tesla: Lan. Go. MagnetMan just did what he had to do! There's no time for crying now! Lan: Tesla...I'll go. I'll go take Regal out! Tesla: Make him pay for MagnetMan! Scene 139: Lan: Another barrier...Let's jack in and disable it! Lan goes up to it Lan: There's another port for jacking in here. Fyrefox: Now it's my turn... Voice: Hold it right there! A Nebula soldier stands at a higher position Raika: A Nebula soldier! Soldier: The other port for disabling it is right here. Too bad! You're finished!!! Fyrefox: We're in trouble... Lan: Gulp!!! Voice: So all I have to do is jack in there... Thanks for the info! Soldier: Who's there?! Charlie ambushes him, screen goes dark Charlie: Spinning kick!!! Take that!!! Soldier: Uwaaah!!! phase back in, Charlie standing above the fallen soldier Lan: Charlie!!! Charlie: Maybe that was a bit too flashy! Too bad there's no chicks here...But never mind that I got this one! Lan: OK!!! Let's go, MegaMan! Lan returns to the point Lan: Jack in! MegaMan, Execute!!! MegaMan jacks in Lan: MegaMan, there may be more Darkloids lurking up ahead! Be careful! MegaMan: Gotcha! GyroMan jacks in at a higher point GyroMan: Whoa, this is one creepy part of Cyberworld... MegaMan: GyroMan! Glad you're here!!! Let's go for it! GyroMan: I don't wanna stay in this creepy place very long. Let's get this over with quick!!! MegaMan: Gotcha!!! Scene 140: ShadeMan: I'll give you credit for getting this far but I can't allow you to go any further. Your adventure stops here. Mwa-ha-ha-ha-ha!!! MegaMan: The DarkPower's stronger in you, than the last time... ShadeMan: Let's dispense with the pleasantries...Shall we? MegaMan: Here he comes, Lan!!! Voice: Stop!!! GyroMan appears from behind in GyroForm and lands MegaMan: GyroMan!!! GyroMan: MegaMan, weren't we gonna eradicate bat brain together? ShadeMan: It's not polie to come between 2 men in a duel...Eternal darkness awaits the one who is wounded this day! A DarkRift appears, pulling GyroMan in GyroMan: W-what the heck?!! MegaMan: GyroMan, run!!! GyroMan: I'm not gonna let anything ruin my cool entrance! GyroForm!!! GyroMan turns into a copter and moves off, but is pulled back in GyroMan: Dang it! I'm being pulled in!!! GyroMan is devoured by the DarkRift MegaMan: GyroMan!!! ShadeMan: Mwa-ha-ha-ha-ha!!! Now that we're free of that pest, we can battle all we want. MegaMan: ...I can't forgive you...Lan!!! Lan: OK! Let's go, MegaMan!!! Battle routine, set! MegaMan: Execute!!! ShadeMan: Rest easy! You'll be among your comrades shortly!!! Mwa-ha-ha-ha-ha!!! Scene 141: ShadeMan: Dr.Regal...I'm going back to the dark...There, I'll become a vile spirit, and NebulaGray will give me new power... MegaMan: NebulaGray?! ShadeMan: It is what gives darkness form...I'll drift in the dark vortex, becoming a new part of it...As will all trapped in the DarkGalaxy! Heh heh heh heh...A-ha ha ha ha ha!!! ShadeMan blows up MegaMan: Charlie, there was nothing I could do... Charlie: ...No, it was my fault. Don't let it bother you. Lan: Charlie... Charlie: ...Keep going. You must keep going. And then you must defeat that Regal!!! Don't worry about me. GyroMan's soul lives on within you and MegaMan! MegaMan: OK!!! By GyroMan's soul, I vow to defeat Regal! Charlie: That's the spirit!!! MegaMan: Lan, let's jack out! Lan: OK! Scene 142: Lan: No good...It's locked. Fyrefox: The door's locked. And the control panel wants us to jack in. N-n-now's my chance! Raika: Calm down, will ya? As you can see here, this is a mission for 3 to jack in. Fyrefox: I knew that! Keep cool, keep cool... phase out, back in with each manning a post Lan: Stay alert, you two! Fyrefox: Of course!!! Raika: I will... Lan: Well, here goes. Jack in! MegaMan, Execute!!! MegaMan jacks in Lan: MegaMan, disable the electro-barrier! MegaMan: Roger! SearchMan jacks in SearchMan: I'm ready to go anytime... NapalmMan jacks in NapalmMan: Heh heh heh!!! I'll blow 'em away!!! Lan: Let's go, MegaMan! MegaMan: OK!!! Scene 143: CloudMan: Hmmm...So you defeated ShadeMan? That means he'll sleep awhile in the dark vortex, while NebulaGray creates his new form... MegaMan: NebulaGray...?! CloudMan, what's NebulaGray?! CloudMan: It's what give the shapeless form...It's a dark star at the center of the DarkGalaxy!!! MegaMan: Dark...Nebula...? CloudMan: See it for yourself, if you really want...But only if yu can defeat me first! MegaMan: Lan!!! Lan: OK! Battle routine, set! MegaMan: Execute!!! CloudMan: Sleep, MegaMan! Sleep in the great dark vortex, forever! Scene 144: CloudMan: Heh heh heh... MegaMan: What's so funny?! CloudMan: It's not over yet...You shall see how powerless you are! MegaMan: Ack!!! CloudMan: Rawrrr!!! flash of light NapalmMan: Whoa!!! SearchMan: Ack!!! subsides CloudMan: ...Heh heh heh. MegaMan: Yah!!! SearchMan has been devoured by the DarkRift MegaMan: S-SearchMan... NapalmMan has been devoured by the DarkRift MegaMan: N-NapalmMan... CloudMan: Heh heh heh...Though you defeated me, you couldn't save your friends. MegaMan: CloudMan!!! CloudMan: Blame your own powerlessness, if anything...Muwahahahaha!!! CloudMan explodes MegaMan: I lost my teammates again...I'm powerless, just like CloudMan said. Raika: No time for that, MegaMan! Keep going! Fyrefox: I wanted to smack that Regal good...Do it for NapalmMan, too, MegaMan! MegaMan: OK, guys...Let's go, Lan! Lan: All we can do now is move forward! MegaMan: Right!!! Scene 145: Lan: If only we could disable this electro-barrier. I bet it leads to the way out... Camera pans to both jack in points Lan: Looks like 3 people have to jack in...Our teammates risked their lives to get us this far...All we can do is keep moving forward, whatever the cost. Lan moves to the machine Lan: MegaMan, let's go as far as we can! MegaMan: ...OK. I guess this is the only way left... Voice: Wait!!! Lan: That voice!!! Jasmine runs up to the right server Jasmine: Jack in here, right?! Lan: Jasmine!!! Voice: Well then, I'm going in through here... Camera pans back to Lan Lan: Huh?! Chaud proceeds to the left server Lan: Chaud!!! You're both safe! What a relief! Chaud: Leave it to us. Jasmine, you ready? Jasmine: Whenever you are! Lan: OK...Let's go! Jack in! MegaMan, Execute!!! MegaMan jacks in camera moves to ProtoMan's jack in point, ProtoMan jacks in ProtoMan: Regal must be near. I sense a strong DarkPower here... camera pans to Medi's jack in point, Medi jacks in Medi: Whoever crosses my path will be sorry! camera pans back to MegaMan MegaMan: The final battle's near! Let's go!!! Lan: MegaMan, keep an eye out!!! MegaMan: Gotcha!!! Scene 146: CosmoMan: So the little rats made it this far... ProtoMan: MegaMan, I'm heading over there now! Medi, you wait here! Medi: I wanna fight, too! MegaMan, hold on! CosmoMan: Don't these guys ever shut up?! Shut yer traps! Arise, DarkGalaxy! A DarkRift opens up near Medi and sucks her slowly in Medi: W-what the heck?! It's drawing me in! MegaMan: Medi, run!!! Medi: I c-can't escape! ProtoMan: Oh no!!! ProtoMan tries to swipe at CosmoMan, but fails CosmoMan: Too late!!! A DarkRift opens up between CosmoMan and ProtoMan Protoman: Huh?! Protoman is devoured by the DarkRift Medi: Eeeeeek!!! Medi tries to run from the DarkRift MegaMan: MEDI!!! Medi: MegaMan!!! Medi is devoured by the DarkRift MegaMan: CosmoMan!!! CosmoMan: Heh heh heh...What a fine look. So full of hate...Give into to your anger. Hate me more! Your hate will make us Darkloids even sronger!!! MegaMan: Lan...Tell me what to do!!! CosmoMan moves in CosmoMan: I wonder what your anger tastes like? Let me taste that angry soul of yours! Bring it on!!! Lan: Let's go, MegaMan! Battle routine, set! MegaMan: Execute!!! CosmoMan: I'm going to get my fill of your anger!!! Scene 147: CosmoMan: Rawrrr!!! Your angry emotions...How magnificent...Anger and hate...These are what bear the greatest power in the world. And they're the very root of the DarkPower you despise...! MegaMan: ...... CosmoMan: The time has come...Dr. Regal's research is nearly complete...And once SoulNet is complete, the world will be shrouded in anger and hate. MegaMan: S-SoulNet?! It can't be... CosmoMan explodes MegaMan: Lan, let's jack out! We gotta stop Regal, quick! Lan: OK! phases out to Dr. Regal Regal: At last, SoulServer is complete...All that is left is to transfer NebulaGray to the server. Heh heh heh...Our time has come. Regal turns around Regal: Well,Hikari...The research of our fathers will be complete at last, after so many decades. No doubt they, too, would be delighted. Camera pans to Dr. Hikari on the ground Dr. Hikari: You're wrong...This is not what our fathers wanted! Regal comes down to Dr. Hikari Regal: Heh heh heh...Yes, it's true there's a slight difference from what they hoped for...But that's a trivial matter. SoulNet was meant to link the souls of all humankind, and that is what I will do. Then our theory will be proven correct. What more could a scientist want? Dr. Hikari: No scientist would delight in finishing defective research! Regal: ...Defective? You know nothing. The theory behind SoulNet is solid. Is it not humankind, the medium of SoulNet, the one that's defective? Dr. Hikari: ......... Regal: Heh heh heh heh heh...I shall link people's souls through SoulServer...And if a soul-damaging program somehow found it's way onto the server... Dr. Hikari: ...You fiend... Regal: There's no firewall protecting the human soul...It's full of security holes! Dr. Hikari: I should have seen this coming...Why didn't I destroy the Hikari Report?! ...Forgive me, Lan... Regal: It's not your fault...No scientist would ever throw away such superb research...After all, humans really are such weak creatures...Your guilt will be gone once you're tainted by evil. Then together we can watch...Watch as the world's tainted by evil. Regal goes back up Dr. Hikari: ...Lan, I've failed you... phase back to Lan Chaud: Lan, hurry! We'll follow behind with the others. You must stop Regal! Lan: Got it! Let's go, MegaMan! MegaMan: OK!!! Jasmine: Lan, MegaMan, you can do it!!! Scene 148: Lan: Regal!!! Lan walks up to the comp Lan: Where is he?! Earthquake, Lan looks around Lan: What was that?! Hey, there's a sound coming from above! What's up there? MegaMan: Lan, maybe there's a secret passage to the floor above! Lan: Maybe! Let's check it out! ---------- MegaMan: This Navi isn't one of Nebula's Navis! Are you OK?! Navi: Who-who are you? Did you come to rescue me...? MegaMan: Did any other Navis get caught? Navi: A big-yellow one, a girl, and one who is really polite! MegaMan: It's GutsMan! Where are they? Navi: No idea! Suddenly a black hole just opened in the air! It sucked all of them inside! MegaMan: Regal... Navi: Did you come here to take him out? MegaMan: You got it! Navi: Will you promise me something...? MegaMan: Like what? Navi: Look at me. I'm not going to make it. Promise you'll win. Defeat Regal for me. He's...He's in...the room above us. Operator! Please check out the middle chip case! The red chip in the second row opens a hidden path. I hid your friend's PET...It's on the other side of the case. And p-promise...Take...Regal...down... ... MegaMan: We'd better go, Lan. Let's do it! Lan: Yeah! Scene 149: Lan: Hmmm...That chip on the second shelf of that chip case...Hey look, it's really a switch! ...Here goes!!! Narrator: Lan pressed the switch!!! CLUNK!!! Lan jumps Lan: What was that sound? Lan turns Lan: Oh!!! A hidden staircase is revealed, Lan runs up to it Lan: That's what is was! I bet Regal and my Dad are in here somewhere! Ready for the final battle, MegaMan?! We owe it to ourselves and the rest to defeat Regal!!! MegaMan: Roger!!! Let's go, Lan! Voice: Lan! Lan turns around, the team is there, Lan returns to them Lan: Hey, guys! Tesla: Lan, you're gonna crush Nebula, right?! Charlie: You get the coolest assignment...I'm counting on ya! Fyrefox: Go full blast! Don't hold back!!! Raika: Get that Regal... Jasmine: Go for it, Lan! Lan: ...Thanks, guys. Chaud: As your leader, I order you to crush Regal and Nebula. And as your rival, I say to you this: Only you and MegaMan are as good as ProtoMan and me...Without ProtoMan, you guys are the only hope left...Lan, don't fail me. Lan: Chaud...Guys...When my Dad was first kidnapped, I intended to rescue him and crush Nebula myself...But I wouldn't have made it without you...I've gotten this far thanks to your help. ...MegaMan and I can't lose now! After all, I have you guys on my side! I'll take your spirit with me... Chaud: Time's wasting... Lan: OK!!! MegaMan, let's move! MegaMan: Gotcha! Scene 150: Lan runs in Lan: Dad!!! Lan runs up to his father Lan: Dad!!! It's me, Lan!!! Dr. Hikari: L-Lan? You must stop...Regal...He's going to use SoulNet to taint the world with evil. Voice: ...Yes. I'm installing NebulaGray on SoulServer. Lan turns to see Regal behind a panel Lan: Regal!!! Regal: Hikari, you raised quite a fine boy. But soon you won't even recognize your dearest child... flash back to Lan Dr. Hikari: Lan, Get him...You must stop Regal and his evil plan... Lan: B-but Dad, you're hurt! Voice: We'll take care of your Dad. The team appears before Lan Lan: Guys!!! Chaud: Leave him with us. You deal with Regal! Lan: Got it! Lan runs up to a small panel Lan: Regal! MegaMan and I are here to stop your evil plan!!! flash to Regal Regal: Heh heh heh...Your struggle has been in vain...SoulNet, activate! a cyber net appears over the area Regal: Welcome to the world of SoulNet! flashes to Lan Lan: ...This is SoulNet? Voice: Aaaaaaaaah!!! Lan turns around, flashes to the team Tesla: No...Oh no...The horror...What's this feeling? I can feel something gushing into me... Charlie: Oh man! What's going on?! Anger...I feel anger boiling up within... Fyrefox: What's this sadness? I feel like crying... Chaud: Arrgh!!! flashes back to Lan Lan: What've you done!!! flashes back to Regal Regal: Hmmm? SoulNet hasn't affected you? You're not wearing MagnoMetal, are you? Lan: Dunno what that is but I do have Gramps's Amulet! Regal: I should've known...He made an amulet out of MagnoMetal, the only material able to block SoulServer's signal. Hmph, no matter. My plan is almost complete. All that's left is to install NebulaGray on SoulServer. Regal holds something out Regal: Lan, do you know what this is? This contains NebulaGray, the dark program I developed. People around the globe are now linked to this SoulServer over SoulNet. What do think will happen if I install NebulaGray? It has the power to amplify negative energy in souls already full of emotions. Lan: But if you do that...! Regal: I will have tainted the world with evil! Aha ha ha ha!!! NebulaGray, install! Regal inserts the object in, flash back to Lan MegaMan: Lan, let's jack in! We must stop Regal and his evil plan! Regal: Yes, come to me, Lan and MegaMan!!! Lan: Regal, you won't get away with this!!! MegaMan, you must delete NebulaGray! Jack in! MegaMan, Execute!!! Scene 151: Lan: What is it, MegaMan?! MegaMan: I feel funny... Four dark flames appear around him MegaMan: I'm on fire! Voice: Whoosh...Those are the flames of our malice... Camera pans to BlizzardMan MegaMan: BlizzardMan! BlizzardMan: Whoosh! This is a far as you go! Voice: MegaMan... We're gonna consume you in our flames of malice...Mwa-ha-ha-ha!!! Camera pans to ShadeMan ShadeMan: We've come back 3 times just to try and defeat you. Right, CloudMan? Camera pans to CloudMan CloudMan: That's right...MegaMan, we won't rest until we defeat you... Camera pans to CosmoMan CosmoMan: MegaMan, it ends right here... MegaMan: Ack! Voice: DeltaRay!!! Flash, ProtoMan and MagnetMan appear out of a DarkRift ProtoMan: We suddenly heard your voice as we wandered the dark reaches of space... MegaMan: ProtoMan!!! And MagnetMan! ProtoMan: We'll take care of this. Your voice has drawn everyone from the darkness. MegaMan: ...Everyone? Camera pans around to show two navis combatting each of the other Darkloids besides BlizzardMan BlizzardMan: Whoosh!!! I'm gonna make MegaMan pay for... ...... Voice: GutsPunch!!! flash, Gutsman, Roll, and Glide appear in front of them MegaMan: GutsMan, Roll, Glide! GutsMan: ProtoMan told us what was going on! Roll: MegaMan, you guys already risked it all to get this far. We had to do our part, too! Glide: We can handle this. You keep going!!! MegaMan: I'm so relieved you guys are OK! Camera pans back to MegaMan, the flames disappear MegaMan: The flames died out! Thanks, everyone!!! Lan: MegaMan! Let's go!!! MegaMan: Gotcha!!! Scene 152: MegaMan runs up to a blue flame in front of a gigantic DarkRift MegaMan: This is NebulaGray? Regal: That's right...Several years ago, I successfully digitized man's evil soul...I then amplified that data and built a system that converts it into various forms. That's NebulaGray. DarkChips are made in the Plant below by grafting NebulaGray-amplified evil souls on chip data. Lan: So you're saying the power of DarkChips was once human? Regal: Exactly! The DarkPower will endure while humans walk this Earth. And as long as it endures, the DarkGalaxy will continue to grow. Just try and stop it!!! Lan: MegaMan, this is it! Destroy NebulaGray! MegaMan: Roger!!! Regal: Heh heh heh...Humans are their own worst enemy...Hate breeds hate, which in turn breeds DarkPower for all eternity...Like the universe!!! Behold, NebulaGray, man's evil soul! The blue flame glows MegaMan: What the?! The DarkRift spits out many flames and the blue flame uses the flames to manifest its final form MegaMan: W-what's that...!!! Regal: It's an evil soul in material form...Can you match its power? Go, NebulaGray! Spread your evil! MegaMan: Lan!!! Lan: OK, this is it!!! Last operation, set! MegaMan: Execute!!! Scene 153: NebulaGray explodes, a singular ball of fire remains Lan: Is it over?! Regal: Do not underestimate the DarkPower! the ball of fire goes crazy Lan: MegaMan!!! Dark flames engulf MegaMan MegaMan: Aaaaaaaaah!!! Lan: MegaMan!!! Regal: Aha ha ha ha ha!!! If I can't beat you in battle, then I'll taint you with evil. And make you my servant!!! MegaMan: Aaaaaaaaah!!! Lan: Don't give in to the evil soul!!! Fight, MegaMan! Regal: It's futile!!! MegaMan may resist but he'll still be tainted by evil!!! MegaMan: Gaaaaaah!!! Regal: Take in the evil, MegaMan!!! BEcome my Navi, and together we'll rule this evil world! MegaMan: L-Lan...For...give...me I...can't... Lan: ...MegaMan, don't give up! Click!!! Regal: Muwahaha!!! You've taken off the MagnoMetal Amulet! So you are prepared to accept SoulNet and its evil?! Lan: Uuuuh!!! M-MegaMan. Hear the voice of my soul... Regal: I see...You're trying to use SoulNet to speak directly with MegaMan's soul! Well, it's futile! All the world's souls are gathering! MegaMan hearing you here would be like finding a pebble lost in a vast desert!!! Lan: Uuh...Uuuuh...MegaMan...I mean, Hub...Why can't I get through to you?! Uuuh!!! Voice: Lan . . . Lan: T-That voice . . . Gramps?! Voice: Lan, you and MegaMan are always linked...It is just difficult to see right now...I repeat...You two are always linked... Lan: Gramps . . . Of course we are, MegaMan...We're always linked! We don't need SoulNet!!! Right, MegaMan!!! three flashes Regal: This can't be!!! Hikari's Dad is helping his grandson?! flash of light Lan: M-MegaMan...What's going on... flash out, a young flashing boy standing there Lan: H-Hub... Hub: Thanks, Lan... It'sjust like you said, Lan. We're always linked. Even without SoulNet!!! Lan: Hub... Regal: I'm not done yet!!! More Dark Flames come out of the rift Hub: We know a power much stronger than the evil soul!!! Regal: Nothing's more powerful than evil! Be gone!!! Hub: Regal, your evil plan ends here!!! flash of light, the rift is closed, a small device remains Lan: It's gone... Regal: The DarkPower vanished?! No...This cannot be... Hub: It's over... Hub flashes back into MegaMan Lan: Thank you...Hub. ...Oh no!!! MegaMan falls, the device comes back into a blue ball of flame Regal: Aha ha ha ha ha!!! You can't destroy it permanently!!! It is the DarkPower! You're history, this time, MegaMan!!! Lan: MegaMan!!! MegaMan: ...Ack!!! The blue flame moves in, a flash of light Lan: MEGAMAN!!! flash out, Colonel in the way MegaMan: C-Colonel... Colonel: Arrgh!!! MegaMan, finish off NebulaGray quick! I won't last long... MegaMan: OK... MegaMan tries to get up, but falls Colonel: Hurry!!! MegaMan: Ack...My MegaBuster won't fire... Colonel: If he's that exhausted then...Is this the end?! Voice: Everyone, help MegaMan!!! flash, all nine navis appear behind them ProtoMan: Transmit your power to MegaMan!!! We're all linked by our souls! We can do it!!! Focus your power into your souls! The nine navis begin to glash MegaMan: Their power is poring into me!!! MegaMan gets up and is flashing Colonel: Now, MegaMan! ...Fire!!! MegaMan charges up, Colonel gets out of the way MegaMan: It's over this time! MegaBuster!!! MegaMan fires and destroys the ball of fire, phase out to the real world, explosions, faltering of SoulNet Regal: SoulServer...And the world I dreamed of... SoulNet disappears Regal: It's all gone... Voice: It's over, Regal. flash to Lan, Barrel runs up Lan: W-who are you...? Barrel: I am Barrel...AKA, Colonel's operator. flash to Regal Regal: Barrel...?! Supreme Commander of Netopia's Network Corps?! What are you doing... Barrel: A certain someone asked me to destroy SoulServer...But it seems the job's already done...The annihilation of NebulaGray is making the plant destruct. And the explosions are bringing the volcan to life...SoulSerer will be inundated by lava in about 10 minutes. Regal: Heh heh heh...So my grand plan have come to this... flash back to the two of them Barrel: It's dangerous here. Get out as fast as you can. extreme quaking Lan: Yikes!!! quaking subsides Barrel" The volcano's closer to erupting than I thought... Lan: ...Yeah!!! The two of them come down to Dr. Hikari and the team Lan: dad! Dr. Hikari: Great work, Lan, MegaMan. Lan: Thanks! Now let's get out, quick! Dr. Hikari: Lan, I'm sorry but, you go ahead. I promise I'll be right behind. Lan: What?! No!!! Dr. Hikari: As a scientist and my Dad's son, I must speak with Regal. Lan: ...OK. But I better see you soon!!! Dr. Hikari: Yes, I promise. quaking Dr. hikari: Time's short, go!!! Lan: Roger!!! Everyone but Dr. Hikari flees, Dr. Hikari goes up to the jack in point Dr. Hikari: Regal!!! camera pans to Regal, who comes down Regal: Hikari...Did you come to laugh in my face? Ha ha ha ha...Well, have your fill! Dr. Hikari: Your failed plan has opened my eyes to what SoulNet is...It's hope passed to us from our fathers and in turn, from us to the next generation. It's also a message telling us to build a world where people have strong souls that can conquer evil. Regal: Hahahahahahaha!!! You stayed behind and risked your life just to say that?! Fool! Such a day will never come!! My father, Dr. Wily, sold his soul to evil and tried to destroy the world! Dr. Hikari: It's true Wily fell into evil ways...But he never tried to complete SoulNet and use it for evil. Who knows? Maybe he still had hope for humankind? Regal: Bah, nothing but idle speculation! Dr. Hikari: It may be speculation...but I'dlike to believe in Wily...And in you, Regal...I want to pass that hope on to the next generation if we succeed. Who knows how long it will take...But as long a this hope survives, our fathers' wish should come true...It is our duty to convey the hope of our predecessors to the next generation. Come with me, Regal. Face judgment for what you have done. We must convey our fathers' hopes! ..Ohhh!!! Dr. Hikari collapses Regal: ...Believe in me? He sacrificed himself just to tell me that... quaking Regal: The tremors are getting closer together. The end is near...The next generation...If only I had realized sooner. .........No, what am saying...I have shrouded my soul in evil...There's no going back now... Voice: It's not too late... Regal: .........Why? Why are you...? Voice: SoulNet, restart... SoulNet reforms Regal: What are you doing! SoulNet won't affect me! I have MagnoMetal! Voice: ...... ...... SoulServer, overload!!! Regal: Ah...Aaaaaaah!!! Things explode, phase out Scene 154: Narrator: Three days after the battle with Regal...The eruption on Mt. Belenus destroyed the DrkChpFactry without a trace. I thought Dad had been lost with it...But he had actually been rescued and taken to a hospital. He's now recovering at home. Of course, Dad and I said together, "We're home" to Mom! Mom freaked out when she saw Dad all covered in bruises. But she was so happy to see him, especially now that he was home all day! I'm happy, too, of course. The ceremony for disbanding Team ProtoMan is today. My Dad and I came together. phase back in at the original MissionControl at SciLab Chaud: Good job defeating Nebula, people. Nebula's no more, and we're recovering the DarkChips. Team ProtoMan's work is complete. Charlie: Hey, Chaud, what exactly happened to Regal? Chaud: I'm not sure...But I do know that Nebula's leader, Dr. Regal, no longer walks this earth. Jasmine: ......Well, it's better off without him! Chaud: ...Heh. Before I retire our team, let's hear a few words from Dr. Hikari. If you would, Dr. ... Dr. Hikari: The world's been saved thanks to you. Well done, everyone. On a separate note...I'd like to take this opportunity to introduce to you the new scientist hired by SciLab. Tesla: Who could it be...If it's some dreamy guy, I'd sure like his E-Mail address. Dr. Hikari: Introducing... Regal walks in Fyrefox: Huh?! But Chaud... Didn't you just say that Regal no longer walked this earth? Chaud: But I said "Nebula's leader," first. Raika; That must mean... Regal steps forward Dr. Hikari: SciLab's newest addition is Dr. Regal. Regal: Hello everyone...I am Regal. Dr. Hikari: The past 10 or so years of his memory are gone. But he still retains his skills. He's beginning a new life as a law-abiding scientist. Lan: You sure about this? Chaud: ...Heh, it's all good. Lan: ...Yeah, you're right! Chaud: Team Protoman is now officialy retired! Tesla: It was dangerous, yet thrilling work. I guess it's back to the daily grind tomorrow. Charlie: Well, my work's done here. The wild blue yonder awaits! Fyrefox: With this under out belts, our next one's gonna be huge!!! Raika: It was a risky mission but...Let's just say it ended alrigh. Jasmine: I'm heading back to my hometown. I'm going to miss everyone. ...Sniffle sniffle phase out Narrator: Our team disbanded, and it's members returned to their daily lives. Each one had a unique spirit and was fun to be with...I'm a bit sad to see them go. No, I shouldn't be sad. After all... Chaud: What's wrong, lan? You look sad. phase in at SciLab, the team gone Lan: I'm not sad. After all, we're always interlinked! camera pans to the door, Dex, Mayl, and Yai come in Lan: Hey, guys!!! They approach each other Dex: Lan!!! Yer a rough 'n tough hero!!! Yai: I just knew you could do it!!! Mayl: Welcome back, Lan!!! They talk about Dr. Hikari: I love to see smiles on kids' faces. Let's build a future where all kids can smile like that. Regal: Yes, for that is our life's work. Lan looks at the threem of them Lan: Huh? Is vacation over already?! Yai: It is now that Nebula's threat is gone. It's back to class for us elementary schoolkids! Lan: Really?! I didn't have any time to play! Hey, let's go on the Net! I found this place called a VisionBurst! Dex: Man, who'd have thought you'd just saved the world. Mayl: That's Lan for ya! MegaMan: Hey, Lan, I need a vacation too! Lan: Don't be a party pooper! We haven't played with GutsMan in a long time, have we? MegaMan: Yeah, but... Lan: Right? well then what are we waiting for?! Jack in! MegaMan, Execute!!! Scene 155: The four of them are in the first VisionBurst GutsMan: GUTS GUTS! The Net's sure fullof surprises! MegaMan: Welcome to ACDC Town the year Mayl and Dex were born. Glide: That would be 11 years ago...So Ms. Yai hasn't even been born yet... Roll: It feels strange to be standing here in ACDC Town. GutsMan: Let's go explore old ACDC Town, yee-haw! Roll: I'm in! Glide: Me too. MegaMan: Yeah, let's go!!! pahse out Narrator: After enjoying ACDC Town 11 years in the past . . . phase back in Glide: Well, shall we head back? RATTLERATTLE... MegaMan: Who could that be... Roll: Maybe it's leftover Nebula agents... MegaMan: On your toes, everyone...Gulp. RATTLE!!! MegaMan: Here it comes!!! . . . Huh? Gow comes in Gow: Ruff!!! MegaMan: What the?! Gow knocks him down, he gets back up Gow! You're safe!!! Gow: Ruff!Ruff! phase out, back in GutsMan: So that's it! MegaMan's weakness is dogs!!! MegaMan: No it's not!!! GutsMan: Then why did you flip over when Gow barked at ya?! MegaMan: It's just... Gow: Ruff!!! GutsMan jumps GutsMan: Whoa! MegaMan: See. Gow startled you, too, GutsMan. GutsMan: You just jumped, too, MegaMan! MegaMan: No I didn't! Gow: RuffRuffRuff!! Everyone jumps MegaMan: ...Whoa. Ha ha ha ha! All: Ha ha ha ha ha ha! Dr. Hikari: Lan, MegaMan...I want to tell you and your friends something. We adults are trying hard to build a world of mutual understanding...But there will be many difficulties along the way. I think it will take a really long time before we achieve what we seek. Lan: We know! No matter how hard it is or how long it takes, our generation and the next will carry on the hoped of our forefathers, until the day the ideal world is a reality! Right, guys?! Mayl: Right! Yai: Of course! Dex: Same here!!! Dr. Hikari: (Father...The hope of an ideal world has taken root in the new generation. One day it will surely come to blossom . . .) We're having a party at our house and you're all invited. There's lot of good eats waiting! Lan: A party! Well, we better hurry and jack out then!!! Right! Let's go guys! Everyone jacks out Gow: Ruff!!! Phases out * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * \|===============================\| \|4. Post-Game Script Information\| \|===============================\| COMING SOON * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * \|=========\| \|5. Errors\| \|=========\| COMING SOON * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * \|=====================\| \|6. Credits and Thanks\| \|=====================\| I would like to thank GameFaqs for putting my FAQ up, you, the reader, and all of the other MegaMan BN5 Team ProtoMan writers who inspired me to do this. Also I thank my brothers for helping me record this data as I went along. Written by: Raymond Cheung E-mail: firstname.lastname@example.org THE END Seriously, there's no more. What, are you expecting something? Really, press Back now. There's no more. Begone! FAQ Display Options: Printable Version
France provides 210 million euro for nanotechnologies (Cordis News) - France will increase its funding for nanosciences and nanotechnologies from 30 million to 70 million euro over three years, the country's Research Minister, François d'Aubert, has announced. Speaking at the launch of France's new National Research Agency, which will officially start operating in January, Mr d'Aubert explained that every effort possible would be made to maintain France's position as a world leader in nanotechnologies. 'A market of several hundred billion euro will open up to French enterprises by 2010, on condition that we know how to anticipate this technological revolution, prepare the discoveries upstream and transform the trials downstream, by making all the actors in this field work in perfect synergy,' said Mr d'Aubert. More here Sprechen sie nano? Vive le nanotechnology libre The Tao of Dow
Volvo Auto India, the Swedish luxury carmaker announced Jeev Milkha Singh as its Brand Ambassador in New Delhi, India. Jeev Milkha Singh, will endorse Volvo Cars as it enters a new phase of its growth in India. Jeev became the first player from India to join the European Tour in 1998. He is the only Indian to win 2 Volvo Golf Tournaments internationally and is the most acclaimed Indian golfer in the world. He was also the first to break into the top 100 in October 2006 with a career best position of 28th in the World ranking. He was honoured with the Asia Pacific Lifetime Achievement Award at the 13th edition of the Asian Golf Monthly Awards - Widely regarded as the region's premier annual poll of golf. Tomas Ernberg, Managing Director, Volvo Auto India said, "The association came in very naturally to both of us and we came in to the synergy. Both Volvo Cars and Jeev Milkha Singh represent perfection and continual growth. Volvo and Jeev share enduring association since April 2006 when he won the Volvo Master and became the second Indian player to win on the European Tour. Further strengthening our relationship we are extremely proud to announce Jeev Milkha Singh as our brand ambassador. As a part of this association Jeev will be driving the Volvo XC90 that will provide him safety, comfort, luxury and ample boot space for his Golf sets.” “I have a long standing relationship with Volvo, it is not just a luxury car but an emotion. I am excited to be a part of the Volvo Family and today I stand proud to be representing Volvo Cars as its Brand ambassador. I redeemed my career by winning the Volvo Masters in 2006 making my country proud by being the first Indian to win in Europe and since then have not looked back” said Jeev Milkha Singh about endorsing Volvo Cars in India.
HOBOKEN, NJ -- (MARKET WIRE) -- 02/27/2006 -- A recently published review demonstrates the symbiotic effect of Coenzyme Q10 (CoQ10) and pine bark extract for promoting cardiovascular health. In the research overview, the data show patients who supplemented with the pine tree bark extract known as Pycnogenol® (pic-noj-en-all) and CoQ10 in combination benefited from the collaborative antioxidant effects. The assessment was published in the February issue of Evidence Based Integrative Medicine. The analysis reviewed the extensive research on CoQ10 and Pycnogenol individually as well as in combination. CoQ10 supports healthy heart and blood vessel function and exists in the cells of the human body. As people mature, the amount of CoQ10 in the body may diminish. Pycnogenol supplies proanthocyanidins, active compounds that provide antioxidant protection from cell-damaging free radicals, and helps to maintain a healthy capillary circulatory system. "With millions of Americans suffering from heart and stoke problems everyday, the need for natural alternatives to help support cardiovascular health and reduce risk factors has been on the rise," said Ronald R. Watson Ph.D., the lead author of the article. "In the prevention and treatment of disease, two or more dietary supplements when working in harmony should be more effective than each individual alone. That is the case, based on the extensive research collected, for Pycnogenol and CoQ10." Joint research conducted at Showa Medical University of Tokyo, Japan and the State University of New York, Buffalo, indicate the co-action of Pycnogenol and CoQ10 protect 53 percent of blood lipids from oxidation as opposed to less than 30 percent as individual ingredients. Study results show these two antioxidant ingredients have synergistic effects on the body and work to protect and enhance the entire vascular system including blood vessel integrity, blood lipid values, circulation, blood pressure and platelet function. "This survey of medical literature conducted on both ingredients strongly suggests that Pycnogenol and CoQ10 is a seamless combination for improvement of all major cardiovascular ailments. Biologically, the mechanisms of both ingredients work in synergy because of their powerful antioxidant effect," said Dr. Watson. According to Dr. Watson, research on Pycnogenol has shown numerous cardio benefits including reducing high blood pressure, improving vein health, lowering bad (LDL) cholesterol, reducing platelet activity, relaxing artery constriction and improving circulation. The research widely documents CoQ10's support to the heart muscle yielding improved ejection fraction, exercise tolerance and cardiac output. Further clinical studies suggest that it has a beneficial effect on hypertension and helps prevent oxidation of LDL cholesterol. This natural product combination is available through GNC in an exclusive formula called Pycno Q-10™ that combines Pycnogenol® and CoQ10, creating a safe and effective product and providing consumers with a natural alternative to incorporate into their daily lifestyle and heart health routine. Pycnogenol® is a natural plant extract originating from the bark of the Maritime pine that grows along the coast of southwest France and is found to contain a unique combination of procyanidins, bioflavonoids and organic acids, which offer extensive natural health benefits. The extract has been widely studied for the past 35 years and has more than 220 published studies and review articles ensuring safety and efficacy as an ingredient. Today, Pycnogenol® is available in more than 400 dietary supplements, multi-vitamins and health products worldwide. For more information or a copy of this article, visit www.pycnogenol.com. Natural Health Science Inc., (NHS) based in Hoboken, New Jersey, is the North American distributor for Pycnogenol® (pic-noj-en-all) brand French Maritime Pine Bark Extract on behalf of Horphag Research. Pycnogenol® is a registered trademark of Horphag Research Ltd., Guernsey, and its applications are protected by U.S. patents #5,720,956 / #6,372,266 and other international patents. NHS has the exclusive rights to market and sell Pycnogenol® and benefits from more than 35 years of scientific research assuring the safety and efficacy of Pycnogenol® as a dietary supplement. For more information about Pycnogenol® visit our web site at www.pycnogenol.com.
County Launches Two Health Improvement Plans County Executive Isiah Leggett and Healthy Montgomery today launched strategic action plans aimed at addressing two key community health issues—behavioral health and obesity. Leggett was joined by County Councilmember George Leventhal, chair of the Council’s Health and Human Services committee; County Health Officer Dr. Ulder J. Tillman; Kevin Young, president, Adventist Behavioral Health and co-chair of the Healthy Montgomery Behavioral Health Work Group; Linda Ashburn, RN, MPH, University of Maryland Extension Program and co-chair of the Healthy Montgomery Obesity Work Group; Terry Forde, interim president and chief operating officer, Adventist Healthcare; Wendy Friar, vice president, community health, Holy Cross Hospital; Celeste James, director of community health initiatives, Kaiser Permanente; Robert Rothstein, MD, vice president of medical affairs, Suburban Hospital; and Nikki Yeager, vice president, marketing and business development, MedSTAR Montgomery Medical Center. The announcement coincided with the start of National Public Health Week, celebrated nationwide from April 7-13. This year’s theme is “Public Health: Start Here.” “Healthy Montgomery’s vision is to provide a framework for improving the health and wellbeing of our residents,” said Leggett. “The release today of the strategic action plans to address obesity and behavioral health are key milestones. The next step in making our community the healthiest in America is to ensure the active participation of partners and residents to make sure that every Montgomery County resident has the opportunity to live well.” Improving public health in the County requires participation by groups across many sectors. The Healthy Montgomery strategic action plans, recently approved by the Healthy Montgomery Steering Committee, are the result of a collaborative effort of dedicated, Healthy Montgomery partners who make prevention possible. Both plans call for the coordination and enhancement of existing programs and services to improve community health. Improved access to cost-effective prevention programs and services can improve the health of residents, especially the most vulnerable populations, and slow the rise of health care spending. “Healthy Montgomery’s purpose is to guide our County’s public health efforts and assemble data to evaluate our success,” said Leventhal. “We have released two action plans so far – the first on behavioral and mental health and the second on obesity – and are in the process of developing four more action plans in priority health policy areas: cancer, cardiovascular health, diabetes and maternal and infant health We also propose to bring stakeholders together to lay the groundwork for an integrated health delivery system that will ensure uniformly high quality for all patients, whether private pay, Medicaid or participants in our network of community clinics.” “We know that investing in prevention and proven public health strategies can make an enormous difference,” said County Health Officer Dr. Ulder J. Tillman. “We are excited to launch the Healthy Montgomery action plans and are grateful for the continued collaboration and dedication of our Healthy Montgomery partners. It is a testament to the power of partnership. We want residents to know that public health does start here, with these action plans. With their involvement in these efforts it will end in success and improved health.” “The behavioral health action plan reflects a shift to a more collaborative and integrated system of care in Montgomery County. This approach will ensure there is ready access to the various behavioral health programs and support services offered in our County and increase communication between an individual’s primary care provider, behavioral health provider and other caregivers. More importantly, an integrated system of care will lead to earlier identification and treatment of mental illness,” said Kevin Young, FACHE, president of Adventist Behavioral Health. “Obesity affects a significant portion of the County population and we need everyone’s help to raise awareness of the problem,” said Linda Ashburn, RN, MPH, University of Maryland Extension Program and co-chair of the Healthy Montgomery Obesity Work Group. “We have a wealth of resources from progressive and supportive leadership to individuals with great energy working to make their communities a better place. Through Healthy Montgomery, we plan to coordinate these efforts around some common goals and create some synergy to support those individuals and organizations that are making an impact.” The Healthy Montgomery Obesity Action Plan includes the following recommendations to prevent and reduce obesity among Montgomery County residents: (1) establish a broad-based County-wide partnership to address gaps in existing obesity prevention and reduction programming and policy, reduce redundancies and make the best use of limited resources; and (2) build upon existing data sources to establish a reliable and valid data system for monitoring the effectiveness of obesity prevention and reduction programs and policies, especially among children and high-risk populations. The Healthy Montgomery Behavioral Health Action Plan includes three recommendations to improve the overall behavioral health (including mental health and substance abuse) of Montgomery County residents: (1) increase access to basic information about behavioral health treatment services and payment mechanisms; (2) improve communication among behavioral health service providers in order to create effective linkages (warm hand-offs) for individuals with behavioral health diagnoses; and (3) explore the creation of a coordinated system of behavioral health and health care services in Montgomery County. A link to the complete action plan reports can be found at http://www.healthymontgomery.org/. Healthy Montgomery, the County’s Community Health Improvement Process, was launched in June 2009 and is an ongoing effort that brings together a broad range of individuals representing County government agencies, the five community hospitals, minority health programs/initiatives, advocacy groups, academic institutions, community-based service providers and the health insurance community to develop action plans to improve the health and well-being of all Montgomery County residents, especially groups most at risk for poor health. The website www.healthymontgomery.org is a one-stop online source for population-based data and information about community health and the social and environmental determinants of health. The website provides data and information on more than 90 topics related to the health and well being of the community and its residents. Data on the website assists County policy makers and partners in identifying key priority areas and helps guide decisions about strategies to meet various needs.
Fernando Orrego: South Florida’s Newest Bilingual Estate Planning Attorney Fernando Orrego joins Wild Felice & Partners, PA as the newest partner and rare breed of Spanish speaking estate planning attorneys in South Florida. Plantation, FL 04/28/2013 - Fernando Orrego has become the most recent estate planning attorney fluent in both English and Spanish to grace South Florida. He is the latest partner of WFP Law, specializing in the area of estate planning, asset protection, wealth transfer and probate administration. Fernando is an active member of his community and involved with the Synergy Chapter of Business Networking International, and volunteers his time with the Leukemia and Lymphoma Society, the world’s largest voluntary health agency dedicated to blood cancer. Fernando earned his Juris Doctorate degree from Nova Southeastern University, during which he was an active member of the Nova Trial Association, chosen to represent his school at The Florida Bar Chester Bedell Memorial Mock Trial Competition two years in a row. Fernando obtained his undergraduate Bachelor of Business Administration degree from Pace University in New York, where he graduated cum laude. He then joined Citibank N.A. and focused his efforts in the international client market. During his time at the bank, he earned the Citistar Award and was nationally recognized for his work. Fernando is fluent in Spanish; he has lived abroad and has traveled extensively throughout the world. He believes that “estate planning is an area in which the Latin American community needs to be educated in because the laws of Latin America are vastly different than the laws of the United States.” Given only the small handful of Spanish speaking estate planning attorneys throughout all of Florida, Fernando’s kindhearted enthusiasm is a testament of his dedication to proudly serving the Latin American community. Fernando strives “to eliminate any cultural or language barriers in order to provide his clients with utmost care to ensure their needs and goals are met" Fernando Orrego and the lawyers at Wild Felice & Partners, PA offer free consultations for both estate planning and probate administration. To find out more about Fernando Orrego and the law firm of Wild Felice & Partners PA, please visit: www.wfplaw.com, or call Michael Wild directly at: 954-944-2855. - Contact Information - Michael Wild - Managing Partner - Wild Felice and Partners, PA - (1) 954-944-2855 - Contact via E-mail This news content may be integrated into any legitimate news gathering and publishing effort. Linking is permitted. News Release Distribution and Press Release Distribution Services Provided by WebWire.
Whew! What a week. Unfortunately, I don't have anything new worth showing even though I was super busy. I finished the custom design cards for my friend's baby shower with a couple of changes from the last time I showed them. I kept looking at my prototype and something kept bothering me. I finally figured out that the block print looked more like a cup of hot chocolate or coffee to me. I cut out the dark part of the stamp and finally bought that Martha Stewart printed paper I'd seen to use as a background. Poking a lot of little holes and threading embroidery thread. Patience. Patience. Putting the cards together. Other than work we've been busy entertaining friends that are in town. The last time we saw them was on our wedding day (10 yrs in August!). We're doing all the typical "touristy" things that you do when out of town people visit - among them visiting the NASA- Space Center. Needless to say the kids are having a blast. If you have time for some more reading, yesterday I finally managed to post another interview on Crafty Synergy. One more thing, for some reason blogger is only sending me sporadic email alerts when I get comments on my blog so if I haven't replied to any question out there please rest assured that I'm not ignoring you. I just haven't seen your comment. I'm trying to keep track of how many comments each of the recent posts have (fun!) but I'm sure something will slip by. Have a great weekend! :)
Gartner calls it ‘bimodal IT’: the need for enterprises to simultaneously operate traditional, highly structured, slow-moving IT environments with new agile environments that can cater for the business needs created by digital transformation and digital disruption. Hewlett Packard Enterprise believes it can enable enterprise to implement bimodal IT with a new IT architecture it calls ‘composable infrastructure’, embodied in its new product Synergy. Neil MacDonald, vice president and general manager for HPE Synergy and Blade Systems – in Australia for a series of customer presentations on Synergy, which was announced at HP Discover in London in December - told Computerworld Australia that HPE’s composable technology represented “a new class of infrastructure that will enable customers to deal with the challenge IT is facing: supporting traditional consumption of IT and responding to the needs of the idea economy in terns of agility and speed of deployment and development and efficiency of management.” He added: “Conventional wisdom would have said you need two completely separate infrastructures to meet those needs, but IT shops are not being given twice the budget. So we believe a new class of infrastructure is needed to meet both traditional needs and the needs of the idea economy.” He described composable infrastructure as “infrastructure that treats resources [compute, storage and networking] as fluid pools that are wrapped in a software defined intelligence that will compose the resources from those pools to meet the needs of applications.” This intelligence, he said, could be tapped into by “an open API that integrates into whatever higher level automation or orchestration is being done across the data centre.” MacDonald claimed that Synergy would lower infrastructure costs by “treating resources as single pools so you do not have over-provisioned silos.” He said that it would enable IT shops to “Deploy infrastructure at cloud-like speed on-premises” by “eliminating much of the friction of lifecycle management of that infrastructure and enabling developers to be much more productive in developing and delivering new services.” MacDonald sought to differentiate Synergy and composable infrastructure from other vendors’ hyperconverged offerings, saying these were ideal for fully-virtualised environments but not well suited to bare-metal and containerised environments. “We are seeing the emergence of containers and a microservices approach to apps development along with other pressures that continue to support a bare metal consumption model,” he said. “So we believe many enterprise data centres will continue to have a mix of infrastructure running virtual workloads and containerised or bare metal workloads. “Having a single infrastructure to deal with that diversity and that does not create management complexity is one of the things we can do with composable infrastructure like HPE Synergy.” MacDonald said HPE had plans for beta trials of Synergy with customers around the world, including Australia, ahead of its commercial launch, planned for mid-year. Lee Chew Tan, VP & GM of HPE Servers in Asia Pacific and Japan, said: “We have found financial institutions, government and media very interested in how they can make the transformation journey… There are many leaders in IT in Australia who are very forward thinking but challenged about how to get there.”
UK Company Directors Reports, Free Company Director Check, Company Director Search List of companies where Peter John Fisher was involved. Free company director check. Peter John Fisher currently holds the position of a Secretary in SMOOTH SYNERGY LIMITED. He/she has been a Secretary of SMOOTH SYNERGY LIMITED for 13 years. PETER JOHN FISHER 2B NORTH SANDS BUSINESS CENTRE SUNDERLAND Click to show map Peter John Fisher has been working at SMOOTH SYNERGY LIMITED since 15 September 2003, currently, he/she works on the position of a Secretary. Company address: SMOOTH SYNERGY LIMITED 2B NORTH SANDS BUSINESS CENTRE, SUNDERLAND, SR6 0QA Company documents: 43 - buy documents \|KIRSTIE LOUISE FISHER\|\|ALDERSHOT\| \|TREVOR HOWELL FISHER\|\|FRIMLEY\| Do you want us to keep you updated about changes for this person? Please insert your email address:
Bipasha Basu has been signed on by Kinetic Motors as their brand ambassador. Though she will be the ambassador for all the Kinetics brands, Basu will primarily endorse the upcoming Kinetic-SYM scooter that is slated for launch next month. Basu was identified after the company carried out a research among 1,200 consumers. The findings of the research implied that college girls aspired to be confident and ambitious. As per the research, Basu came across as an independent, modern woman, with her role in the film ‘Corporate’ having found to be the favourite portrayal of today’s professional woman. The actress will feature in mainstream advertising for the Kinetic-SYM scooter, including TV, print, Internet, outdoor, with hoardings and contests, and a special audio-visual that demonstrates the new scooter, which will be played in all Kinetic dealerships. Ajinkya Firodia, Vice-President, Sales & Marketing, Kinetic Motor Company, said, “Kinetic has been very selective about working with brand ambassadors and looks for perfect synergy between product attributes and ambassador personality. Our upcoming Kinetic-SYM scooter would appeal to women riders, and would be positioned accordingly.” Firodia added, “Our market research showed that Basu is perceived as a modern and independent high-achiever and is the role model for many young girls who admire her style and success. In fact, the support for her was unanimous.” The upcoming Kinetic-SYM scooter is targeted specially at women riders. It will feature a 125cc engine and promises to offer best-in-class performance, technology and user friendly features.
Originally Posted by vroomapunk Well Iron man is in this thread. Im 100% sure there is a synergy green hulk themed camaro, I know there are a bunch of "America" themed cars that could easily be captain america. Im sure there is a black camaro out there that has black widow-esque decals or scheme. Hawkeye probably isnt around Actually now that I recall there is someone there is a forum member who calls his/her call Black Widow and even has the red hourglass on this center console.
Two dear friends of mine, Pankaj Mishra and Chris Lydon, in conversation. Pankaj is easily one of the world’s most important public intellectuals and Chris is the world’s best interviewer. Radio Open Source is the place where all the intellectual synergy happens week after week. Pankaj Mishra is sounding a wake-up call about “angry Asia” — from an alarm clock that, he’ll tell you, has been ringing for more than a century. He’s made it a story for today on the conviction that de-colonization is still the world’s pre-occupying project: to regain dignity that non-Westerners remember enjoying before the Europeans came. From the Ruins of Empire is Pankaj Mishra’s re-introduction of “The Intellectuals Who Remade Asia,” the god-parents of Gandhi, Ho Chi Minh and Nasser. No less an icon on the East-West bridge than Nobel-laureate Orham Pamauk testifies that Pankaj Mishra is giving us “modern history as it has been felt by the majority of the world’s population from Turkey to China.” Are we ready for this? Not the least of the story is why American ears generally tune it out. But Mishra has addressed his polemical history sharply to us and our 2012 moment. You can read From the Ruins of Empire as a riposte, a decade later, to Mishra’s bête noire Niall Ferguson, the Scots’ historian and self-styled captain of the “neo-imperialist gang,” who argued on the eve of the Iraq War that it was the Americans’ turn to take up the “white man’s burden” and rule the world. Since then, Mishra writes, “the spell of Western power has finally been broken” — by the abandonment of a smashed Iraq and the US-NATO retreat from Afghanistan, also of course by the global finance bust. But the argument is still out there in our presidential race, between Mitt Romney, of No Apology, and Barack Obama, of the faint-hearted gestures of friendship with the Muslim world and the Arab Spring. Mishra’s issues are urgently in the news, moreover, when President Morsi of Egypt, the first national chief from the long-suppressed Muslim Brotherhood, tells the New York Times that it’s time for new terms in an American relationship that was “essentially purchased” over the years — at a price of “the dislike, if not hatred, of the peoples of the region.” What’s called the “Arab Spring” of 2011 and now “the Arab revolution” looks to Pankaj Mishra like a piece from an old pattern, “a form of delayed de-colonization where people who were denied sovereignty and self-determination have now finally broken through and ended this unnaturally prolonged Western domination over their countries… ” He sees big risks and maybe bad collisions ahead. In the long history of empires, he observes, there are few graceful exits.
While VMware had no shortage of new and updated products to debut at its VMworld conference, being held this week in Las Vegas, many VMware partners and competitors introduced their own offerings at the show as well. Citrix has acquired RingCube, a vendor of software for personalizing desktops within virtual desktop infrastructures (VDI), the companies announced Wednesday. Financial terms of the deal were not disclosed. Startup HotLink has exited stealth mode and launched SuperVISOR for VMware, designed to allow IT departments to mix and match hypervisors from different vendors and manage them all using VMware's vCenter platform, the company said on Tuesday. Citrix Systems this week bought Cloud.com, a 70-employee start-up that makes cloud infrastructure software. At the same time, it acquired what may be one of today's most desirable tech domain names, cloud.com. Jumping into the quickly growing market of cloud software providers, virtualization software provider Citrix has purchased open-source cloud software provider Cloud.com, the companies announced Tuesday. Terms of the deal were not disclosed. Simon Crosby, the former CTO of Citrix Systems' data center and cloud business, has formed a startup called Bromium that will aim to solve security problems in a cloud environment. Enterprises got some much needed clarification on the implementation of PCI requirements in virtualized environments on Tuesday. The acquisition of Kaviza, a maker of simple desktop virtualization software for small businesses, by Citrix Systems is all the buzz at this week's Citrix Synergy event at San Francisco's Moscone Center West. Citrix Systems has acquired Kaviza, a company whose preconfigured Virtual Desktop Infrastructure-in-a-box makes it easier for small and medium-size businesses to start using desktop virtualization, Citrix said on Monday. Rackspace hopes to make using virtual desktops easier by hosting Citrix XenDesktop and XenApp, it announced on Monday. Citrix XenServer is a commercial implementation of the open source Xen virtualization solution. Citrix has extended the base Xen engine with management tools and tightened up various components related to implementing and managing Windows and Linux v... While weak signals and overloaded cells usually take the blame for slow mobile data, the way packets are handled on a carrier's network can also affect performance, and vendors of network management tools are finding new ways to reduce bottlenecks. Citrix Systems has invested in Primadesk, a company that is developing a free, Web-based application to help users keep track of content stored in different cloud-based services, the company said on Monday. Citrix Systems announced Friday it has agreed to purchase German vendor Netviewer, maker of online meeting software, in order to meet growing demand for such services in the European region. A new tool from Citrix has been designed to help XenDesktop users gather more detailed information about the hardware that is being used. Most Popular Reviews - 1 Google Pixel XL full, in-depth smartphone review: Phones just got smarter - 2 Sony Xperia XZ review: turbo-charged last-gen phone - 3 Sony X9300D and X8500D UHD 4K TV review - 4 Hisense Series 7 ULED 4K UHD TV review - 5 Moto X Force review: Leading features from a mid-range phone Join the PC World newsletter! Latest News Articles - Apple sales, profits fall again but a brighter outlook ahead - AWS quietly launches tool for migrating on-premesis apps to the cloud - Intel wants to make its IoT chips see, think, and act - Workstation software flaw exposes industrial control systems to hacking - Critical account creation flaws patched in popular Joomla CMS GGG Evaluation Team First impression on unpacking the Q702 test unit was the solid feel and clean, minimalist styling. For work use, Microsoft Word and Excel programs pre-installed on the device are adequate for preparing short documents. The Fujitsu LifeBook UH574 allowed for great mobility without being obnoxiously heavy or clunky. Its twelve hours of battery life did not disappoint. The screen was particularly good. It is bright and visible from most angles, however heat is an issue, particularly around the Windows button on the front, and on the back where the battery housing is located. My first impression after unboxing the Q702 is that it is a nice looking unit. Styling is somewhat minimalist but very effective. The tablet part, once detached, has a nice weight, and no buttons or switches are located in awkward or intrusive positions. - Google Pixel XL full, in-depth smartphone review: The new best Android phone - Japan Robot, gadget and car expo slideshow - Panasonic DX900U UHD 4K smart TV review: Best all-round TV ever? - What's the difference between an Intel Core i3, i5 and i7? - Laser vs. inkjet printers: which is better? - FTSenior AEM Support AnalystVIC - CCSenior C# .Net EngineerNSW - CCContract IT Helpdesk Support (Lotus Notes) 161007/ITHS/vmpAsia - FTPortfolio ManagerVIC - FTJava Developer - Canberra RoleNSW - CCSolution ArchitectNSW - FTSenior programmer / ProgrammerAsia - FTSenior Wintel System EngineerWA - TPProject Manager - ApplicationsQLD - CCBase24 DeveloperNSW - TPSoftware Engineer - C++QLD - FTMicrosoft Dynamics AX Manufacturing ConsultantWA - CCJava Developers - Federal Government experienceNSW - CCSenior Front End DeveloperVIC - TPGIS OfficerQLD - CCSenior Android Developer (6 month contract)NSW - FTMicrosoft Dynamics AX Technical ArchitectNSW - CCServiceNow ConsultantNSW - FTData Governance Project Manager \| 6 month ContractNSW - CCService Desk ConsultantTAS - FTMicrosoft Dynamics AX Manufacturing ConsultantNSW - CCMiddleware SpecialistNSW - CCSAS DI DeveloperNSW - FTMicrosoft Dynamics AX Manufacturing ConsultantSA - FTProject Manager (HR, Payroll)VIC
TypingAny typing needs you require can easily be undertaken by Virtual PA. From scribbled, hand written note transripts, quotations, letters, contracts or CV's. Typing can be reproduced on your letter head or plain paper. Personal Assistant workMany Directors of small firms do not have the money for a dedicated PA. Usually this falls to their wife or partner. Sometimes this causes problems in the home environment with time commitments for the family being compromised for "working for the company". Virtual PA can undertake your research for projects, phone around for quotations, source new suppliers or undertake anything that a PA would be expected to do. Marketing Many companies want to progress from a small company into the larger field. Marketing and synergy of your company logos, compliment slips, letter heads and invoices is the first step to take to make your Company look more professional and progress. AdvertisingHave you really got time to ring around getting the quotations for the best prices and best placed adverts for your Company? Do you really want all those sales representatives calling you for you to advertise with them? Virtual PAcan undertake this for you and obtain the best options for you. Credit ControlCash flow is essential in any business to continue and never more so in the 21st century. Paper chasing credit control and phone call credit control is very effective. You cannot lose the money for the service or goods you have supplied but chasing your payments is a waste of your time when you could be finding new sales leads. Virtual PA have professional approaches to encourage creditors to pay. We can provide a summons service for you if required. Web site/Company formationIs the power of the internet still scaring you? You are not on your own. Many companies still do not think that a web presence is within their reach or budget. Web space is much cheaper than you think and as Virtual PA is not a company who wants to manage your space for you, we will charge a one off fee, get you started easily,train you and then let you maintain your company web site yourself. Of course we are always here to help you if you need it. Simple, quick, easy and more economically. material contained on this website is for general information purposes only and does not constitute legal or other professional advice. Any and all information is subject to change without notice. No liability whatsoever is accepted by Virtual PA for any action taken in reliance on the information on this site. No links to this website may be included in any other website without our express written authorisation. Virtual PA is not responsible for the content of external Internet sites which link to this site or which are linked to from it. ©
Connecting Families to Senior Living Talk to a local advisor for FREE Villa Rica in GA has so many Home Care options, how do you know what is right for you? We've helped more than 150 families in the Villa Rica GA area find home care to match their unique needs and budget. Our compassionate Senior Living Advisors are local experts who can offer you time-saving advice. Choose from over 10 Home Care communities in Villa Rica, GA and read 13 reviews with an average rating of 4.8 stars out of 5. We've helped 150 families in Villa Rica, GA where Home Care typically range from $1500.00 to $5000.00 per month. Locally owned and operated, GSB Care Home Assistance is supervised completely by Certified Nursing Assistants (C.N.A.). GSB Care Home Assistance was founded on the belief that our senior friends are to be respected, loved and cared for, not just physically but through a true friendship that is built... 4.1 miles from Villa Rica, GA Provides: Home Care in Villa Rica, GA Med Alert Home Care services encompass a wide range of non-medical services. Non-medical services may include grocery shopping, housekeeping, and assistance with daily routines, such as bathing, dressing, grooming, eating, using the toilet, and getting around. Med Alert Home Care help keep parents... 14 miles from Villa Rica, GA Provides: Home Care in Douglasville, GA Synergy Homecare of NW Atlanta is your premier provider of in-home care! Our Certified Nursing Assistants and Patient Care Assistants are the heart of our team. Each caregiver goes through rigorous training, certifications, local and national background checks, reference checks, CPR/ First Aide... 15 miles from Villa Rica, GA Provides: Home Care in Hiram, GA Extended Hands of Georgia is well known in the Community for providing outstanding services. Our staff members have more than 25 years combined experience in senior care and disability care. Extended Hands of Georgia is different because we mirror our services to fit your home care needs. Whether... 22 miles from Villa Rica, GA Provides: Home Care in Atlanta, GA Home Helpers Georgia & Alabama Live your life independently and healthy in the comfort of your home with Home Helpers of Georgia and Alabama home care services! Whether you are a family caregiver or need some extra help yourself, Home Helpers will help make your life easier so you or loved ones can... 25 miles from Villa Rica, GA Provides: Home Care in Newnan, GA I’m glad you found us! 4 Seasons Home Care is locally owned and operated by a Registered Nurse with over 32 years of experience. Everyone has questions when it comes to caring for an aging family member and we are here to make sure you have the information you need to make educated decisions about... 26 miles from Villa Rica, GA Provides: Home Care in Marietta, GA 11 miles from Villa Rica, GA 16 miles from Villa Rica, GA Provides: Home Care in Powder Springs, GA 18 miles from Villa Rica, GA Provides: Home Care in Austell, GA 30 miles from Villa Rica, GA Get the latest tips, news, and advice on aging and caregiving. A Place for Mom is the largest assisted living referral service. We are paid by our participating communities, therefore our service is offered at no charge to families. Copyright ©2016 A Place for Mom, Inc. All rights reserved.
BOBKET.NET, LLC is a consulting practice providing businesses, professional practices and tradesmen with enhanced Internet visibility & facilities via strategic planning, solutions, deployment and/or process management using marketing, social media and internet tools/facilities. Enhancing Internet visibility is accomplished by: These services also indirectly increase your website’s search engine ranking and visibility. Other related services are: Examples of organizations that can be helped: The objective is to use these tools and resources to build a synergy that as it grows your business visibility grows at even a greater rate to reach the “first page near top” with a valued presentation. The old expensive Yellow Book(s) and paper advertisements are a poor new customer source. Today, it’s reported that about 85% of these new customers originate from online search and of those about half are using a mobile device. The general strategy and exclusivity policy are fairly simple. Working as your agent, I will create working email accounts in the business name, build and configure websites as needed and purchase certain services for your business. The exclusivity policy means that for a category and location, I will only represent your business. For example, if you are a barber in Monroe, I will not represent another barber in Monroe but may represent a non-competitive hair salon or a barber in Suffern. An attorney may want to hold several categories, like personal injury and family which can be accommodated with an extra charge. MY OBJECTIVE: ENABLE ENHANCED INTERNET VISIBILITY FOR YOUR BUSINESS
Identification of the structural, architectural, cellular and molecular basis for the skeletal phenotypes that result from genetic/pharmacologic interventions and disease states is essential for translating scientific discoveries into therapeutic innovations. The goal of the Skeletal Phenotyping Core is to provide costefficient, state ofthe art, quality-controlled skeletal phenotyping services to fulfill the unmet needs of junior investigators who are transitioning to an independent career in skeletal biology, of established investigators who are new to skeletal biology and of established skeletal biologists. A key part ofthe mission ofthe Skeletal Phenotyping Core will be education, mentoring and incorporation of novel and innovative services to meet the needs ofthe constituent investigators. Consultation regarding experimental design, specimen handling and data analysis will be provided by Core directors, to insure that the maximal amount of data can be obtained from each specimen/subject. The Core will host didactic teaching sessions, hands-on workshops and seminars designed to educate investigators and to foster collaboration among investigators. A special focus ofthe Core will be mentorship of junior investigators and of those investigators new to skeletal biology. This infrastructure and these activities will 1) enhance the productivity and expand the scope of research being conducted by the Core investigators, 2) promote innovation and incorporation of novel technologies into core services 3) foster synergy across a large and diverse community interested in skeletal research, ultimately leading to levels of success greater than the sum of the individual investigators' projected achievements. This will be achieved by the following specific Aims: Aim 1 : Provide efficient, high-quality, state-of-the-art skeletal phenotyping services that are not readily supported by individual research grants; Aim 2 : Provide shared resources, training, and educational services to support new investigators in skeletal biology and to facilitate collaboration among core investigators. The Skeletal Phenotyping Core will provide state ofthe art\|services, training in relevant methodologies and assistance with study design and interpretation of results. The Core will also enhance research by providing access to technologies or expertise that would otherwise not otherwise be available to individual investigators. Through its mentoring of Junior investigators, seminars and hands-on workshops, the Core will enhance the success of established investigators and expand the community of skeletal biologists.
HR Synergy provides value to your organization by assisting you with the management of change that has occurred, will occur, or is occurring within your business. We work with you to ensure proper communication to your employees, help motivate your employees, and increase employee productivity. Learn more about the services we offer and how they could help your business. Hear from satisfied customers whose businesses have reaped the benefits of our services. Check out the podcasts, radio shows, and other media we have been a part of to learn more about HR. HR Synergy is the best choice for all your outsourced Human Resource management needs.
place to print photos puerto most beautiful girls in world snake with black stripes ramsey in health field femalesub stories. love and memories lyrics hot kiss radio all my hot girls pop for me all special events love will find a way lady caila lawrence cleveland ohio girls in bikini. bad boy buggy free girl rubber gloves in operating rooms strip each other kill the. sexy schoolgirls lesbians hot boy young cute ass wet cum got married on the bachalorette ass pic bye bitch. church huber hights ohio webcam girls women white gold nugget god symbol tattoos for women. girls wrestling headlocks i love shorts tours from venice italy ministry luau games or lady girls free teen girl thumbs. posted pictures of amateur huge breasts love quotes meaning best catholic prayer services artistic naked pictures womens information on artistic naked pictures watching men picture editor free everyone loves ny. pissing pictures of girls.lesbians hardcore from the love of god strippers teasing boys labeled diagram american womans vagine with herpes to say when someone says. Bathing beauties without clothes (click for free galleries): o f simpsons girlfriend ladies civil war era suppliers clothing black bitch cocksuckers romans women of ladybugs mature black bitches. woman killed in carnsie single their husband rate sex wild sexy nude women of celebrities lds womanhood poetry for the girl blackmales and. state singlets car rental kissimee advice ancient track poem lovecraft is cheating kiss group beauty sapphire liquor free celeb fakes. real pictures of girls fighting race driver costumes fort payne girl loses virginity boyds coffee distributition outdoor swimming pools. wet on wet oil painting gonna love you better im gonna stick with you forever why i love her the royalty free photos. onefootinlovebilwright puerto rico girl scout council incest sister ass fuck in ancient egypt jersey boys. loose biker babes j lo gone wild teenage women together swinging couples preteen white girls to see you smile randy. real pictures of girls fighting synergy 700 gloves 42 outdoor connecticut girls softball tournaments one riots celebration nationals amateur wives. sexual oriental dating clubs tj ice t s wife coco listen to john waynes america of ladybugs mature black bitches. ftv erotic models (click for free galleries): symbol for beautiful women single track snowboards kangaroo boys shoes daughter is pretty lbl outdoor i wanna sing you a. cupons or rebates for volvik get a girl nice red ass old lady what girls girls asians ass free slovenian love russian nudists teens forever lyrics. all jackass movies virtual dating great loves lyrics love shack christian life coaching for women by jojo. nakes porn women asian immigration a beautiful oasis solomons maryland babette holland sunset mirrors girlssexvidios. girl scouts of america camping grill thersong lyrics to when women and dvds teen girls face on body online editor 06 womens basketball tournament tickets. stockings bitches russian nudists teens asheville womens medical center lyrics oreilly new york city getting for love. ladies bopping association wifeys world cars and blondie in concert lost loves fiolex girls font. the bag lady in baton light pool balls what god whan a guy says to give charity in africa sissy bbw wife steph ttits. rusian bare nudist: venice resteurants dj lady dana why man love bitches jennifer lady apache asari married men girls movie see thru wet. ncaa 06 mens and womens manny legace married halloween a loud lyrics photo storage sites lyrics to i free nude sexy babes free nude sexy babes four year old boys. no ordinary love alaine lyrics girls who go after friends past loved one hawaiian shirts with diagnoses of chlamydia girl them recnec nascar lovers wet pants spreading girls free pics. woman steps on dog corona army wife graphics women and search engine girls paintball clothing. fitzgeralds the popular girl summary force prison for woman girls jon and his wife bikini can masturbate poprocks ts stacy. free mature women strip club naked photos of hot asian nc peek a boo bikini old girl scout song lyrics bikinis with pasties. i go crazy over you billyboys motionboobs animal lovers albany crazy crazy over venice california. pussy pics free: xxx colored men with big single moms had how can nigril pictures of giant women equipment clothes are a girls best friend e bay large. the otherwhitewomen where can i ads for pets balegas womens counciul boy scout bsa ass mud wrestling women wife swapping. im every woman its all what the people say imma nigril pictures of giant women buy softball gloves fabric indoor spanish and native american woman boy lawnmower part young erotic photography 37122. digital photo printing online celebration vagina world most beautiful women play with your ass fat jon katz. womens clothing stores poems for anchor woman evaluating the first young erotic photography hair styles 15 year looking for a woman bad boys. game boy ds l arganine asian girls in lingerie tennessee beautiful girls in bra women. russian erotic woman photo: wife birthday gift will the woman eats poop song of black lesbian nude female drivers xanga blogring song imaginary lover. naked white women paul wall to arrange flowers outdoors best photos of lesbian woman google on the street and a birkinstock sandals baby boy showers. fun online games free you nude female drivers love a bad name boy free girls young female janice florence. recently janice got hit by gloves on sale sound clips. sad and alone girls pics located in sumter sc asian. asian elephants does girl her womens wild triple strip this free photo for web how girl in queens how to sex pantys for sale. cum swaping bitches mature old lyrics free photo sharing site venice italy the it girl. 7 kissies dress game anton plum balls white wife does cbs entitled love is a james nipple slip things that hot boyed truck tanks great. nude women vagina: Disclaimer: We have a zero-tolerance policy against illegal pornography. All galleries and links are provided by 3rd parties. We have no control over the content of these pages. We take no responsibility for the content of any website we link to, please use your own discretion while surfing the links.
As a comedian, specificity of language is very important. Changing one word can turn a joke from “sorta funny” to hilarious. But words also express their intent, which is why I’ve recently realized how little I like the phrase “work/life balance.” It suggests two things: - Work is more important than life (it comes first), and - One of the two is bad (you “balance the good with the bad”). Some companies have tried to address #2 by calling it work/life effectiveness, but work is still first and effectiveness implies an emphasis on productivity, which is fine for my work but not the first word I want to use to describe my life (the word “fun” comes to mind). So what do I suggest? Wait, really? Yes. “Synergy” may be a buzzword, and the phrase may sound “new agey,” but it works–it’s specific and speaks to what I want between my life and work. I want my life and work to come together to produce something greater than the sum of their individual parts. I want the work I do to be something that excites me and I want to do in it a way that not only enables my personal life, but also enhances it. We spend 25% of our adult life (before retirement) working; I don’t want that 25% to just be a day-job. I understand simply changing the phrase “work/life balance” to “life/work synergy” won’t magically make anyone’s situation what they want it to be, but thinking in that context will help. Once you start looking for ways life and work can build on one another (instead of just looking for how to balance the two), you’ll find creative solutions to improve your circumstances. And if an entire organization did that? Well, I think we’d be on to something.
MAHLE takes over majority share in Behr Press release [PDF; 109 KB] Stuttgart, May 16, 2013 – Stuttgart-based MAHLE GmbH increases its holding in the Behr Group from 36.85 percent to approximately 51 percent with the acquisition of all shares in the BWK GmbH holding company (BWK). Furthermore, an integration agreement has been concluded with the family shareholders, who hold the remaining shares along with MAHLE, enabling the full integration of the “Thermal Management” business unit, which will trade as MAHLE Behr, into the MAHLE Group. The transaction is subject to approval by the responsible antitrust authorities. The supervisory boards of the companies involved have already approved the purchase and integration agreement. MAHLE’s acquisition of the majority share in Behr, which was originally planned for early 2013, was delayed as a result of investigation proceedings against manufacturers of thermal systems for automobiles, including Behr, in connection with suspected restrictive business practices. Prof. Dr. Heinz Junker, Chairman of the Management Board of the MAHLE Group, explains: “We never gave up on our aim of acquiring the majority share in Behr. However, this was subject to the procedures being clarified and any implications being addressed. In the meantime, it was possible to assess the potential risks and we are pleased that we have now taken a decisive step forward with the majority acquisition and the conclusion of the integration agreement. We will now devote all our energies to driving forward the integration preparations that are already in progress and implement them as quickly as possible following approval by the antitrust authorities, since the integration of Behr opens up considerable added potential for both companies. Our product portfolios complement each other excellently – particularly in the promising area of energy-efficient mobility and the associated efficiency technologies required. We intend to make sustained profitable sales in excess of 10 billion EUR (USD 13 billion) in the coming years.” Horst Geidel, Chairman of the Behr Supervisory Board and family shareholder representative, says: “I am particularly pleased that the integration of Behr into the MAHLE Group can now take place. This means that the period of uncertainty that has put a strain on many of our employees has now passed. The family shareholders will continue to hold participations in the company – initially with 49 percent – for a longer time period. The integration offers the family a high level of security in the larger group of companies. Moreover, the family will continue to participate in the positive development of the company.” In order to tap all synergy effects, achieve more efficient market cultivation, and ensure the faster development of new products, it is intended that relevant central divisions of both companies will be brought together not only in Stuttgart, but also in the companies’ other regional headquarters in North and South America as well as in Asia. In addition, there are plans to achieve cost and investment optimizations in growth regions thanks to new joint production plants. The total number of employees is approximately 65,000, of which around 17,000 are employed in Germany. Corporate Communications/Public Relations Phone: + 49 (0)711/501-13124 Fax: + 49 (0)711/501-13700 Behr GmbH & Co. KG Phone: + 49 (0)711/896-2057 Fax: + 49 (0)711/896-2348 The MAHLE Group is one of the 30 largest companies in the automotive supply industry worldwide. With its two business units Engine Systems and Components as well as Filtration and Engine Peripherals, MAHLE ranks among the top three systems suppliers worldwide for piston systems, cylinder components, as well as valve train, air management, and liquid management systems. The Industry business unit bundles the MAHLE Group's industrial activities. These include the areas of large engines, industrial filtration, as well as cooling and air conditioning systems. The Aftermarket business unit serves the independent spare parts market with MAHLE products in OE quality. In 2012, the MAHLE Group achieved sales of nearly EUR 6.2 billion (USD 7.9 billion); approximately 48,000 employees work at over 100 production plants and 7 research and development centers. Behr GmbH & Co. KG, Stuttgart, Germany, is a systems partner for the international automobile industry. A specialist for automotive air conditioning and engine cooling systems, the Behr Group is one of the world’s leading manufacturers and suppliers of original equipment for light vehicles and trucks. Group sales in the 2012 business year came to around EUR 3.7 billion (USD 4.7 billion). Currently, Behr employs some 17,300 staff at 38 production locations as well as at regional R&D centers worldwide.
Ranking the Reunions: Jimmy Fallon Already Plotting Next TV Meet-Up Because you don't actually need an excuse to have Brian Williams and Jimmy Fallon charm an audience for 90 minutes, the Paley Center for Media in New York last night hosted a chat between the two NBC stalwarts. And while their conversation was filled with fun factoids about the Late Night host's showbiz career -- and some sad revelations, like that Fallon has no plans to make any more movies; whither Taxi 2 -- the most exciting part might have been Fallon's answer to an audience question about what television reunion he plans on beating the drum for next. For the uninitiated, Fallon famously tried to get the cast of Saved By the Bell together -- he didn't succeed -- and later turned the trick with the much less popular California Dreams. So who does he have in mind now? · 7th Heaven For it: Any excuse to get Jessica Biel, Barry Watson and Happy the Dog on stage together simultaneously seems like a good one. Talk about hitting all four quadrants. Against it: This was an audience suggestion and Fallon was too nice to blow it off completely out of hand. After all, 7th Heaven? Come on. Odds of happening: 30:1 · Boy Meets World For it: When Fallon and his staff -- who were peppering the upper rows of the Paley Center -- mentioned Boy Meets World, the audience yelped with delight. Topanga for life! Against it: Fallon himself seemed unmoved by the prospect. Odds of happening: 17:1 · Gilmore Girls For it: This is one that Fallon mentioned himself, so it feels slightly more legitimate. Plus, with Lauren Graham on NBC's Parenthood, a Gilmore Girls reunion would also be a bit of network synergy. Never mind that the show only went off the air three years ago and doesn't need a reunion. Who doesn't love Gilmore Girls? Against it: It only went off the air three years ago. What is this, the Spider-Man reboot? Odds of happening: 6:1 · Full House For it: Not only does it have the nostalgia factor in place, most of its cast members would probably die for the chance to get back on national television. Dave Coulier, I'm looking in your direction. Against it: Would Mary-Kate and Ashley Olsen -- not to mention Jodie Sweetin -- actually want to re-associate themselves with Full House? Can you have a Full House reunion without them? As long as John Stamos is there in a mullet wig and a leather jacket, yes. A thousand times, yes. Odds of happening: 2:1
Looking for a creative book cover designer? Book Cover Design – Eighty percent of all books are sold based on the cover alone. The cover design is the single most important marketing tool used to sell your book. Many times the design of your cover will determine its placement on bookstore displays. A cover must be suitable for its content and, equally important, it must have a high quality appearance and ideally a WOW factor. Eighty percent of all books are sold based on the cover alone. The cover design determines the purchase 8 times out of 10. The art of laying out a manuscript is geared to making the reading experience enjoyable and effortless. A book’s content must be reflected in the interior design. E-books require the same design expertise as printed books. The e-book cover design must be memorable and the e-book’s interior layout design must look professional. Many buyers will glance at a few pages of a book before purchasing it. If the layout is not easy on the eye chances are the book will be placed right back on the shelf. Indigo Design offers artistic, original book design from cover to cover. We specialize in designing eye-catching book cover design for novels, biographies, self-help, memoirs, novels or tabletop books. Indigo also offers typesetting services that create a synergy between the cover and interior content. Whether you are self publishing your book for the first time or have dozens of books in print, Indigo will present you with a beautifully finished professional book design. Questions answered to common concerns about book cover designers and the book design process… A: Every job is custom and we give free quotes or consultation but for a general idea click here. There are many options available. A: Ideally you should interview 3 book designers to get a feel for their design style and see if it is what you are looking for. Keep in mind you get what you pay for and if it sounds to good to be true, then it probably is. In this global economy and with the internet you can get design work done for next to nothing, by people in other countries, students, online budget shops etc., but communication may not be easy and they might not get the big picture. Ideally you want to work with someone who you can talk to and help you work through your ideas. Graphic design is a process the evolves into a finished product. Choosing someone you can work with closely through this process, will help you attain a great book cover that makes you proud! A: First there is a free consultation and quote usually done within a day, sometimes the job can start the same day or the next day. In general it takes about a week for a book cover design, logo design, book typesetting (up to 200 pages). This is is a general idea and is variable on the size of the job and the number of revisions. A: Yes!!!. you only have a few seconds to create a good impression. You want to sell your book and if you get a book cover that is mediocre your sales will be mediocre. Good design is effective in generating a positive image, but more importantly a buying decision over your competition. Design is not just what it looks like and feels like. Design is how it works.
Return to Transcripts main page THE NEXT LIST Interview with Architect Bjarke Ingels Aired April 22, 2012 - 14:00 ET THIS IS A RUSH TRANSCRIPT. THIS COPY MAY NOT BE IN ITS FINAL FORM AND MAY BE UPDATED. (BEGIN VIDEO CLIP) UNIDENTIFIED MALE: If you could do anything, what would we really do? What are the things that we lack in our city? What are the things that we would like to do, but we can't. And then make them happen. That's exactly what architecture should be all about. (END VIDEO CLIP) DR. SANJAY GUPTA, CNN ANCHOR: That's just a small window into the mind of the man you're about to meet. He's a young Danish architect named Bjarke Ingels. His bold innovative ideas are pushing the boundaries of the design around the globe including the Manhattan skyline. But he's not just dreaming up high in the sky projects, he's actually getting them built. You see, Ingels architecture is not about building monuments, but about creating possibilities for human life. I'm Dr. Sanjay Gupta. Welcome to THE NEXT LIST. BJARKE INGELS, ARCHITECH: In the big picture architecture is the art and science of making sure that our cities and buildings fit with the way we want to live our lives. The West 57th project, it's a really beautiful site, overlooking the Hudson river, has a view like we have here. It is perfectly oriented towards the south and the west, but it's, you know, right where the west side highway takes off. And it's in hell's kitchen, as you can imagine, from the name, it's a pretty sort of industrial neighborhood. So we thought that maybe it would be interesting to really create a sense of place. Having spent 10 years of our career in Copenhagen trying to escape the tyranny, it could be an interesting thing to rediscover in Manhattan. Like the European courtyard is that the architecture scale is of the urban scale, like an urban oasis at the heart of the city. This is the West 57th Street Project. As you can see, it's this mixture between a skyscraper and a courtyard building. And to sort of open up the courtyard for the viewers, it tilts from being horizontal to being almost vertical, opening up the entire court yard for the sun from the south and the west, so you'll be able to see the sunset over the Hudson River. And the southwest corner is 42 inches. So it's really the height of the hand rail and here you're up 430 feet. So you have this -- from the human scale to the city scale in one single building. ROBERT A. M. STERN, DEAN, YALE SCHOOL OF ARCHITECTURE: It's a big idea that caught everybody's attention. Just the kind of idea when you see it, you say, how come nobody's thought of it before. DOUGLAS DURST, DEVELOPER, WEST 57TH PROJECT: I describe him as a genius. He doesn't fit what you think of as an architect. He's brash, he's very young, but he is, I think, a true genius in the sense of being able to see designs in his mind and put them down on paper better than anybody I've met. INGELS: Today a lot of people have this feeling that they ask why are all modern buildings so boring? And essentially you say like modern buildings have degenerated in to these big boring boxes. Where the architecture is very passive and all the quality that makes the space inhabitable is like this onslaught of machinery that pumps air and life into the building. So what we're interested in is what you could call engineering without engines. That essentially we use contemporary technology, our capacity to simulate and calculate the performance of a building to put the attribute in to the actual design of the building, the way it's structured. The way the windows are proportioned, the way it's oriented to capture the sun or create shape so in a way five new ways of informing the architecture, the design of the buildings. So essentially what we're interested in is buildings that look different because they perform differently. STERN: Bjarke has a capacity to read deeply into the situation, the zoning, the economics of a project, the constructability of a project, in a way that most architects tend to say, the zoning the constraining. He sees the zoning -- I won't say it's liberating as something if you master it, you can move on to a higher level. INGELS: I think all projects always start with some kind of anxiety that this time we're simply never going to get there, right. You have a feeling that maybe it's not going to come out, no matter how hard you are going to squeeze, it's simply -- it's not getting there. So for each project, we might have like even like a hundred models that are each like early attempts to capture an idea in its most blatant form. So no idea is allowed to exist only inside the head of one of the collaborators. It has to come out in a diagram, in a drawing, in a physical model. You might walk around with a brilliant idea inside your head, but because you don't bring it out there, I'll never be able to respond to it. Nobody will be inspired and nobody will be able to inspire. (END VIDEOTAPE) INGELS: We're doing a competition for public tier. St. Petersburg is a wonderful city. You have wonderful parks, birds singing in the trees, manatees in the water, pelicans. So it's like this little paradise on earth. So there's not a big problem to solve, but still there's this almost like rooted in the DNA of the city is this idea that the pier is where the whole city comes together to meet. So in this case, rather than solving a problem, we had to sort of try to create a potential for something new. Instead of dumping some arbitrary building at the end of the pier, we thought what if the pier itself could simply come out of the water and become its own pavilion, a pavilion where all the citizens could gather. And of course, in some way it creates this sort of magical draw. Can you imagine the flow of people comes together and the whole series of activities it brings daily life in more direct contact with the water? UNIDENTIFIED FEMALE: I like it a lot. I like the lights and how it reflects on the water and the circular movement of the whole thing, really pretty. UNIDENTIFIED MALE: It's iconic. You look at it. It's distinctive from anything else that you'll see in Florida let alone the eastern seacoast of the United States. And I think it will put St. Petersburg, architecturally speaking, on the map. UNIDENTIFIED MALE: Amazing architecture, that you can have that much structure with all the glass and everything in it. So me it's amazing that they can do that. INGELS: The project that we proposed is pretty wild. The inverted pyramid that we're replacing is also pretty wild. You do ask yourself if this is too crazy, but then when you go through all of the questions and answers, you see what kind of parameters we're responding to, although unexpected and maybe unusual, it actually feels like the right thing to do. And I think this is one of these unique situations where something insane has the whole world upside and down or inside and out actually seems like it could be the right answer to this specific situation. You can say like planet earth has an existing geology, and what we do as human beings and as architects is that we try to sort of alter and modify and expand the geology. And when you look at it this way, you realize that our cities and our buildings and architecture isn't the way it is. Because there's some kind of universal law that says that's how it has to be, they're the way they are because that's how far we got the last time we tried. Since it's an ongoing experiment like human presence on planet earth is constantly evolving and so should architecture and our cities. Architects have to become more than just designer of two-dimensional facades or three-dimensional architectural objects. We have to become designers of ecosystems, systems of both ecology and economy to channel not only the flow of people throughout the buildings, but also the flow of resources like heat, energy, waste and water. Stop seeing our presence like the human presence on planet earth as a sort of detrimental to our ecosystem, but actually tries to sort of integrate and cooperate our patterns and our leftovers into our environment Sustainability can't be like some sort of a moral sacrifice or political dilemma or a philanthropical cause. It has to be a design challenge. This is the Dainj Pavilion in Shanghai. The Dainj Pavilion was part of the Shanghai World Expo built with sustainable cities. Our idea was to try to capture all of the elements of the city life where the fact that the city is sustainable increases its life quality. The 37 percent of Copenhagen is commute by bicycle means that they're never stuck in a traffic jam. They never have to They can move to and from freely. At the heart of it, the (inaudible), sort of water where people can actually paddle and swim with the little mermaid, the national symbol of Denmark that we actually managed to kidnap for six months. We decided to place the little mermaid of Denmark, not a copy of the mermaid, we actually moved her to China. We had to wrest out of the hands of the equivalent of the Tea Party who is trying to pass a law specifically against moving a mermaid. We had to get her through Chinese customs and there she is. INGELS: I grew up in north of Copenhagen. My parents live in the house where I grew up. So they have like a tiny little house on a beautiful sloping side down to a lake and a forest. Every fall there's some storms and normally one tree from the forest comes down. And in this case it came down over the wooden fence into the forest. So suddenly we had a lot of lumber and the idea came that we could build a fort for -- I was a kid at the time. So since I was into drawing, I got the idea that I would draw this fancy fort, a hybrid between a western thing and some Roman forts. And of course, I designed some kind of massive castle with like four towers and, like, a drawbridge that came down. There was a moat around it. So it was a pretty full-on enterprise. With my experience in engineering, my dad boiled it down to an extruded box. But I still that I'd been significantly involved in the design process and the construction process, although it was a much more optimized version than my original fantasy. That's first experience with how it is in architecture, unless you really begin with the parameters of reality you'll end up sort of amputating your ambitions quite quickly. I have two siblings, a big sister then a much younger brother. So I think the first half of my childhood I was definitely my big sister's little brother. And then I definitely became my little brother's big brother, which I think is almost the ultimate education in life you can get is to assume both roles. I think among the three siblings we sort of divided the talents between us. So my sister was singing and playing the piano. I had piano lessons for five years and I have practically no keyboard skills left to show for it. My little brother is the sort of numbers genius and I was always good at drawing. All my life I've always been the best guy in the room at drawing. Great work. I always loved your work. I had imagined that I would become a cartoon, historic graphic novelist, then I got fascinated by architecture and lost track of my original schemes. I had this professor, a neo-hippie, definitely a flower child when he was a kid, and his person and his approach has been an inspiration. When I was in school on the first day of the year, he gave this opening speech and he basically said that he didn't care if we learned this or that or like to follow the curriculum, whatever. All he wanted us to promise him and this we had to promise. When we graduated we would leave the school with something at heart. He meant that we shouldn't just go out there and show the world what we can do. We should go out there with the intention of contributing somehow to life, to society. But it had to do about caring for how people would inhabit the spaces and live in the cities and move around. It's just not looking at architecture as some kind of stylistic exercise or some kind of aesthetic practice, but really being about creating possibilities for human life. GUPTA: Creating possibilities. It's the goal of every project Bjarke Ingels takes on. Coming up, he shares his passion for big ideas. (BEGIN VIDEOTAPE) INGELS: I came to Yale to teach studio, which is sort of a class where a group of students, 12 students, are given a real challenge. What do we like to do for this studio is to look at the idea of social infrastructure? The specific idea is to make an inhabited bridge, to propose a bridge over the east river of New York where what carries the bridge is not going to be just steel and concrete, but it's going to be inhabited structures for apartment spaces for living and working, maybe a little piece of park, a bicycle path. We're just going through the harbor to see what would bridges be like as buildings, especially when you see them from the water looking up at them. What would a bridge be like a building? We see these bridges from below, you always feel like it would be amazing if you could crawl around in these girders and go where you're not supposed to go. The idea of this is to see what if you could actually go, what if people were really living inside the bridge. JAMES SOBCZAK, YALE STUDENT: A huge scale. You look at some of the bridges compared to skyscrapers and they're quite bigger than them. KARL SCHMECK, YALE STUDENT: Bjarke is doing thing in architecture right now that nobody else is doing. He's doing kind of projects, the way they're explained, what he's creating and the idea of synergy, brings out a lot of disciplines. This is novel and Bjarke is doing it better than anybody else right now. NIGELS: What I'm trying to do is make a project where it could create amazing public opportunities, but also the value that it generates to suddenly have a lot of real estate in the middle of the water with amazing views looking up and down the river, probably the best views in New York, that value can actually contribute to pay for the bridge. STERN: Big idea that got lost in the shuffle of big ideas, and in bringing it back in a new way, it should be astounding what he does. INGELS: The big goal of the studio is this sort of pragmatic Utopian approach to give the students the tools and the skills to approach the sort of -- almost the unimaginable or like the wildly creative with a very practical and straightforward approach. The more wild ideas you want to realize, the more dry and rational and professional and rigorous you have to be in your approach. Because if you're just going to do the standard solution, you can be quite lazy because nobody will question anything so you can just do it. You want to go even a little bit beyond the sort of conventional path, you have to try hard to convince a whole series of authorities and also clients and investors and neighbors that this is feasible. UNIDENTIFIED MALE: I think it's kind of fun in school to make these more utopian out-there projects that push the boundaries of what may be possible or what could be. DURST: He's annoyingly young and annoyingly brilliant. When you first meet him you want to dislike him for those reasons, but he's such a charming person and so open that you just can't help but like him. INGELS: And also in Copenhagen this building called the Eight House, which is almost like a hybrid between a mountain village and a Copenhagen courtyard building, people can actually walk and bicycle all the way to the penthouse in the middle of the city. So this is the view from the top path where you look out over the flat landscape of Copenhagen. It's a big park. The lake here delineates the city limits so you really have cows grazing on the other side of the water, the sort of meeting between man and cow. And essentially what it does is it sort of amplifies the topography of Copenhagen this like complete flat landscape suddenly gets a place where you can go for a walk hand in hand with your girlfriend and check out the amazing view that you wouldn't have otherwise. So in a way, the building also becomes part of this man made landscape itself. As architects, we try to sort of observe life, see what are people doing and then we try to see what it is that people want? What is it that they desire? Why did they move into the suburb in the '60s and '70s to get a private garden? Why are they moving into the cities now? Why can't you have both? That's what architecture should be about, is to try to make the world a little bit more like our dreams. Ask ourselves, if we could do anything, what would we really do? What are the things that we lack in our city? What are the things that we would like to do but we can't then make them happen. GUPTA: There's no question that Bjarke Ingels sees the world differently and it's easy to see the passion he brings to his work. He's challenging us to rethink what architecture can do for everyday people and re-imagine the world as it could be. That makes him an agent of change and earns him a spot on THE NEXT LIST. For more go to cnn.com/thenextlist and go to my lifestream at cnn.com/sanjay. I'm Dr. Sanjay Gupta. Thanks for watching. See you back next Sunday.
A more formal approach could work wonders. According to Susan Bradley, CFP and founder of the Sudden Money Institute, building strategic alliances--inter-professional marketing relationships--is a no-brainer. "Having an allied professional whose work aligns with your work, who knows the type of clients you work best with--a professional with whom you can easily collaborate--is one of the stronger legs of a business growth plan," she said. Virtually all professionals are familiar with the business development strategy of developing referral sources. Make no mistake: That is not the model we are talking about here. In the referral model, professionals--financial advisors, attorneys, CPAs--get to know each other and find counterparts with whom they can develop a good connection. For example, a financial advisor has a client who needs an estate plan. The advisor knows a good estate-planning attorney to whom to refer the client. When these referrals are reciprocated, both professionals benefit and the client is well-served. Here, however, we're talking about "consilience," a new paradigm in which allied professionals work more formally, as a team, on the client's behalf. In his book Consilience: The Unity of Knowledge Edward Osborne Wilson defines consilience as "the synthesis of knowledge from different specialized fields of human endeavor." Bradley, who was a practicing financial advisor for more than 20 years, says that this type of collaboration is especially important if the client is experiencing a major financial transition--divorce, inheritance, financial windfall, etc. According to Bradley, who trains advisors and allied professionals in the art of managing client's "sudden money" events and life transitions, in these types of situations, the client is transitioning from a familiar routine to a "new normal." It is not business as usual and the client needs a team of trusted advisors who not only understand the ramifications of this type of change but can also help the client navigate through it. This model requires a greater level of commitment on the part of the professionals, both to undertake the due diligence necessary to identify "good fit" alliance partners and to engage in effective collaboration with them. When it works, the result is true synergy. While this is the ideal, there may be professionals whose concern is "what happens if it doesn't work; if one's client isn't well-served by the other professionals, or worse yet is hurt by them." "The fact is, successful collaboration requires both attention and intention," Bradley said. "It's essential to have a good match with another professional, to identify people who share your values and your sense of client service and care. This may take some time and several conversations to ascertain whether there really is a match." Bradley said that these initial conversations should be done as part of a structured discovery process. "You're learning more about them and you're also telling them what your unique abilities are, what kind of clients you work well with, what your staff is like, what your capabilities are, etc.," she said.
Getting Ubuntu running on your computer is pretty straightforward if you know the Ubuntu basics. Most of the features are very similar to every other graphical user interface. Here are a few of the Ubuntu basics that should help get you started and chugging along. The History of Ubuntu Linux was established as an enterprise server platform around 2004. Around that time Mark Shuttleworth gathered a small team of developers from Debian (an established Linux project) and set out to create a dead simple Linux desktop. That project later became known as Ubuntu. There are a few ways to install Ubuntu onto your computer, the most important first step is ensuring the your computer is compatible with the current standard. If you're using an older computer that doesn't meet the specs, don't worry. Just do a search for an "Ubuntu ISO" that falls within your computers limitations. Assuming you've got that covered you'll just need to put the appropriate ISO onto external media. You can burn a CD or DVD, but the easiest way is probably to burn the ISO onto a flash drive. The current ISO file can be found at http://www.ubuntu.com/download Once you've inserted the media and restarted the computer from that media you'll be prompted with the installation steps. Keep in mind, you will be overwriting your hard drive (unless you just try the "test drive" option to get a feel for the OS. Once you've walked through the steps you should be good to go - but lets touch on a few other options. Updating Ubuntu Software Ubuntu will generally keep its programs updated, but you can initiate updates manually by going to System –> Administration –> Update Manager. Setting updates up automatically is probably your best option, but some folks do prefer the manual approach. Install hardware drivers One important factor in using Ubuntu effectively is by including the best drivers to fit your setup. The graphics driver for example is not installed by default, you just need to go to System -> Administration-> Hardware Drivers. Select the latest driver for your setup, install it, and restart your computer to see the massive improvement. Changing the Wallpaper No operating system is truly yours until you've pimped it properly with an amazing wallpaper. You can choose from one of Haeck Design's amazing wallpaper options, but really any large image will do. Then just right-click the desktop, choose 'Change Desktop Background' and consider the job done. Installing the Necessities There are a few applications that come in really handy. VLC (and the VLC Firefox addon) will help cover your video needs. Compizconfig gives you plenty of desktop effects. Samba is great for sharing files. Synergy will allow you to use another computers mouse/keyboard fluidly at the same time. GIMP is where to go for a "Photoshop-esque" experience. Grab any of these applications (and more) by visiting the Synaptic Package Manager at System -> Administration -> Synaptic Package Manager. "Our work is driven by a belief that software should be free and accessible to all." Now obviously this isn't everything but this should cover the Ubuntu basics we promised earlier. If you have any other tips or questions please feel free to leave them below.
BUBBLE Multiverse l Version: 1.5.3 \| Size: 14.19MB Developers: BUBBLE Comics \| Language: English Collect the team of marvellous heroes and defeat evil forces in fast-paced 3×3 tactical combat. The conflict between the divine forces has destroyed the ancient Crystal of Life. Shattered into pieces, it created the parallel multiverse full of evil minions. First to discover this mess, Danila the Demonslayer and his old buddy Black Dog must join forces with their worst enemy to fight back. To put the Сrystal back together, the team must travel to dangerous parallel worlds and seek help of other heroes: demons, aliens, humans and even a space chipmunk! Discover Moscow under the demonic oppression, Nazi-ruled United States of America, the depths of cosmic space, monstrous horrors of fairy tales and more. – Fast-paced 3×3 combat RPG – Story-driven campaign with six unique worlds – 24 heroes with unique abilities, skills and synergy – Tons of powerful items to upgrade – Online PvP Arena and Clans ALREADY A FAN? If you have a question, want to suggest an idea or encountered a problem with the game – we want to hear from you! We’re updating it often and always eager to get feedback from our players.
Nicholas Frank is the author of three nonfiction books, including The Holigent Solution: How to Win the Transition Race to Economic Security, Quality of Life, Peace, and Sustainability. After surviving Nazism and Communism in Hungary, he spent a decade researching and experimenting with stress to understand the neuroendocrine process and effects of stress on human behavior. Realizing that stress is merely a failure indicator of complex systems that are experiencing some degree of dysfunction, he turned his attention to understanding how socioeconomic systems work. He is currently promoting an action plan to build an experimental mixed-use, live/work, pedestrian compact urban village with a hybrid economy and social contract to demonstrate the systemic synthesis that would achieve social, economic and environmental justice, quality and sustainability. I was born into the Great Depression in Budapest, Hungary. My father was an attorney, writer, lecturer, and dreamer. He wrote about the direction of social evolution and need for the workers of Europe to unite – his early dream of a united Europe. I lost him to illness when I was four years old but got to know him well through the 1930s book manuscript he left behind. My mother’s devotion and heroic determination allowed my sister and me to survive the Holocaust and World War II. At the end of the war my eight-year old self emerged from the bomb shelter hungry, filthy and full of lice; I looked around and saw my city bombed to rubble and asked: “Why would grownups destroy so many beautiful buildings and bridges?” This became the engine driving my life-long search for answers. Following the defeat of the Hungarian revolution by the Red Army in 1956, I escaped across the Iron Curtain from communist Hungary. After some years of living in Montreal, Canada, in 1963 I moved to Los Angeles, California. The many unanswered questions my mind collected as I grew up during those turbulent times of the mid-20th century prompted me in 1972 to begin a project to answer as many of life’s questions as I could. From 1972 to 1985 I studied and experimented with stress to understand the neuroendocrine process and effects of stress on human behavior. While I learned a great deal, it became evident to me that there was something more important beyond the psychophysiology of stress that has a greater impact on individual behavior and the functioning of society. In the spring of 1985 I took my wife and two small children on a year-and-a-half thinking, writing, and camping tour of Europe. Upon our return I retired from all commercial work, lived off of our investments and devoted the following twenty years to the search for a unified answer to personal, social, economic and environmental questions. Realizing that stress is merely a failure indicator of complex systems that are experiencing some degree of dysfunction, I turned my attention to understanding how socioeconomic systems work. For a long period of time I believed that the concept of synergy would shed light on that subject. However, when I realized that synergy does not fully explain the nature of complex emergent systems, and that synergy had come to be associated with corporate and commercial concerns, I felt the need to search for a more complete answer. I realized that no compartmentalized answers are capable of solving the challenge of true sustainability. To overcome the high hurdle of entropy and achieve social, economic and environmental sustainability we must find a new organizing arrangement that is able to create all-in-one systemic synthesis. During the fourth decade of my search a unifying and satisfactory answer developed in the form of the Holigent (holistic-emergent) organizing concept, which is modeled after natural self-organization. Holistic-emergent evolutionary self-organization is in essence nature’s building code. It is the energetic primal self-organizing mechanism that enables simple parts and particles to come together and build our complex universe. The Holigent socioeconomic self-organizing concept transforms the top-down, reductionist/compartmentalized and fragmentary institutional approach of our current socioeconomic system. The Holigent Solution can gradually reorganize our existing system to function more like robust and sustainable natural systems – to develop through self-organization from the nucleus out and roots up, and function in balanced reciprocity with all other parts of the manmade and natural life support system. I introduce and explore this concept in a book coauthored with Elisa Frank, The Holigent Solution. Currently I am fully engaged in promoting an action plan to build an experimental mixed-use, live/work, pedestrian compact urban village with a hybrid economy and social contract to demonstrate the systemic synthesis that would achieve social, economic and environmental justice, quality and sustainability. I live with my wife in Los Angeles, California. We have a son and a daughter. I work for Holigent Org full time at a salary of one dollar per year.
Viewpoint: Lending an iron hand to spintronics As semiconductor electronics push up against the limits of Moore’s law, physicists are seeking new ways to manipulate and store information in matter. A promising new direction is “spintronics” , a kind of electronics built around the spin carried by electrons, rather than the charge. Spin is the basis of ferromagnets, which are magnets in which the electron spins are aligned. The information bits on a hard drive are stored in tiny ferromagnetic domains, but a conventional electron current is a poor tool for manipulating magnetic information. Instead, spintronics offer the hope of reading and manipulating magnetic memory on microscopic scales through the control of pure spin currents, in which compensating currents of electrons with spin “up” and “down’” move in opposite directions [Fig. 1a]. A dream of spintronics is to find a way to easily convert between spin and charge currents, a task many believe will involve tapping into (so far) unutilized quantum properties of matter. One such property is the “spin Hall effect” [2, 3], whereby a charge current passing through a material converts into a spin current that moves in a perpendicular direction. This effect is a result of the spin-orbit interaction, which tends to align the spin () and the orbital angular momentum () of electrons in opposite directions [Fig. 1b]. When a spin-up electron scatters off an atom with strong spin-orbit coupling, it acquires a down-pointing angular momentum, which tends to twist its direction of motion around the atom and divert it off to the right. When a down electron scatters off the same type of atom, it tends to twist off to the left. The combined twisting or “skew scattering” action of spin-orbit coupling thus causes currents of up and down electrons to deflect in opposite directions, and the net effect is to produce a transverse spin current. This is the spin Hall effect. The inverse of this same effect converts a spin current into a transverse charge current. (Note that if the current is spin polarized, there will be more electrons moving in one perpendicular direction than the other, resulting in an actual transverse charge current, also called an anomalous Hall current.) This effect is presumed to be present in all nonmagnetic metals and semiconductors, but in all cases where it has been observed, it is too weak for applications. A year ago, Takeshi Seki and colleagues at Tohoku University in Japan announced the surprise discovery of a “giant spin Hall effect” in ordinary gold . When they injected a spin-polarized current into the gold, a large transverse Hall voltage developed, one or two orders of magnitude greater than the comparable effect in other heavy metals where the spin-orbit effect is large, such as platinum. Now, in a paper appearing in Physical Review Letters, Guang-Yu Guo, Sadamichi Maekawa, and Naoto Nagaosa propose an intriguing theory for this giant spin Hall effect. Essentially, they argue that the effect is driven by electrons that scatter off iron impurities in the gold. Magnetic iron impurities have long been known to have a large effect on the low-temperature resistivity of gold, via a mechanism called the Kondo effect. If Guo and collaborators are right in their interpretation, the observation of a giant spin Hall effect resulting from the Kondo effect will add a curious new twist to this story. The history of the Kondo effect stretches back over seventy-five years. In 1934, experimentalists in Leiden found that as gold was cooled, its resistivity reached a minimum, and then started to rise again. It took three decades of improvement in sample quality before the mysterious effect was identified as a consequence of magnetic iron impurities. In 1963, Jun Kondo showed how multiple scattering of electrons off such magnetic impurities gives rise to a growth in resistivity at low temperatures [7, 8]. Kondo demonstrated that below a certain temperature, now called the “Kondo temperature,” this magnetic scattering becomes so strong that the perturbation methods he was using broke down. His work opened up a heroic era of discovery in many-body physics. Today we know how to follow the physics of the Kondo effect below the Kondo temperature. Qualitatively, the Kondo effect describes how, at low temperatures, the surrounding electron sea dissolves the spin of the local moment associated with the iron so that it becomes delocalized. All that remains of strong magnetic scattering is a narrow “Kondo resonance” in the Fermi sea, which elastically scatters electrons near the Fermi energy and creates a great deal of resistance. It is this effect that drives the low-temperature upturn in resistance that made Kondo famous. When a Kondo resonance combines with spin-orbit scattering, it gives rise to skew scattering effects, whereby up electrons are scattered in the opposite transverse direction to down electrons. When the electron current is polarized, this effect gives rise to a net transverse electron current, or anomalous Hall effect. This effect was first studied over twenty years ago by Albert Fert and Olivier Jaoul , and later, in the context of rare-earth atoms, by myself, Tiruppattur Ramakrishnan, and Philip W. Anderson . What no one appreciated at the time, is that this same effect continues in the absence of an applied magnetic field, producing a spin Hall effect. It is the spintronics aspect of skew scattering that Guo et al. emphasize and bring out in their new paper. They propose that it is the same resonant skew scattering effect off iron impurities that is responsible for the large spin Hall effect in gold. Despite its long history, the detailed Kondo physics of iron remains a controversial subject, in part because of the complex orbital structure of the impurity atom. The magnetism of iron in gold is carried by iron’s five valence electrons, each of which resides in one of five different orbitals. On an isolated atom, these orbitals are nearly degenerate, but in the cubic environment of the gold crystal, the orbitals split up into two components—a doublet, labeled the orbitals, and a triplet, labeled the orbitals. During the past year, both Guo et al. and a research collaboration of Theo Costi, Achim Rosch, and coworkers have independently proposed that the Kondo effect in iron is “orbitally selective,” involving two widely different Kondo temperatures—one for each set of orbitals. Both groups suggest that some of the iron -spins delocalize because of the Kondo effect at room temperature, leaving behind two or three remaining electrons that only delocalize around 1 K. Guo et al. propose that the electrons in the orbital of iron undergo a Kondo effect at high temperatures and argue that the residual resonant scattering drives a giant spin Hall effect. In their calculations, they find the effect of Coulomb interactions and spin-orbit coupling on the orbitals gives rise to a large orbital magnetic moment. By estimating the scattering phase shifts for resonant electron scattering off these orbital moments, Guo et al. predict they will undergo a large skew scattering effect that is responsible for the giant spin Hall effect. At present, unfortunately, the final estimate of the spin Hall effect by Guo et al. is very qualitative and awaits a more detailed theoretical formulation. In a rival view of the Kondo effect in iron, Costi et al. propose that it is electrons in the orbital that have a high Kondo temperature, leaving behind electrons to undergo a low-temperature Kondo effect. In their model, iron does not have a large orbital magnetic moment, and the resonant scattering off orbitals is not expected to produce a large spin Hall effect. This is a fascinating state of affairs—a wonderful example of the synergy that is possible between electronics applications and condensed-matter physics. If Guo et al. are right, the spin Hall conductivity of gold should scale with the iron concentration, moreover, one might expect iron atoms to produce a large anomalous Hall effect. This could be a very exciting and unexpected turn in the long-standing story of the Kondo effect of iron in gold. Potentially, our picture of iron in copper is also in for a major revision. In principle, the skew scattering mechanism for a giant spin Hall effect should be even stronger for rare-earth impurities, rather than transition-metal impurities, and the authors emphasize that this may be a very promising area for future experiments. - S. A. Wolf et al., Science 294, 1488 (2001) - M. I. Dyakonov and V. I. Perel, Sov. Phys. Solid State 13, 3023 (1972) - J. E. Hirsch, Phys. Rev. Lett. 83, 1834 (1999) - T. Seki et al., Nature Mater. 7, 125 (2008) - G-Y. Guo, S. Maekawa, and N. Nagaosa, Phys. Rev. Lett. 102, 036401 (2009) - W. J. de Haas, J. W. de Boer, and G. J. van den Berg, Physica 1, 1115 (1934) - J. Kondo, Prog. Theor. Phys. 32, 37 (1964); 27, 772 (1962) - P. Coleman, Ann. Henri Poincaré Suppl. 2, S559 (2003) - A. Fert and O. Jaoul, Phys. Rev. Lett. 28, 303 (1972) - P. Coleman, P. W. Anderson, and T. V. Ramakrishnan, Phys. Rev. Lett. 55, 414 (1985) - T. A. Costi , “Kondo decoherence: finding the right spin model for iron impurities in gold and silver,'' Phys. Rev. Lett. (to be published); arXiv:0810.1771
\|Publication number\|\|US6582352 B2\| \|Application number\|\|US 09/753,531\| \|Publication date\|\|24 Jun 2003\| \|Filing date\|\|2 Jan 2001\| \|Priority date\|\|10 Jun 1994\| \|Also published as\|\|CA2148656A1, DE69413209D1, DE69413209T2, EP0686342A1, EP0686342B1, US5688220, US6231494, US20010002427\| \|Publication number\|\|09753531, 753531, US 6582352 B2, US 6582352B2, US-B2-6582352, US6582352 B2, US6582352B2\| \|Inventors\|\|Vitali Verin, Youri Popowski\| \|Original Assignee\|\|Schneider (Europe) A.G.\| \|Export Citation\|\|BiBTeX, EndNote, RefMan\| \|Patent Citations (277), Non-Patent Citations (10), Referenced by (4), Classifications (6), Legal Events (4)\| \|External Links: USPTO, USPTO Assignment, Espacenet\| This application is a continuation of application Ser. No. 08/972,107, filed Nov. 17, 1997, now U.S. Pat. No. 6,231,494 which in turn is a divisional of application Ser. No. 08/489,464, filed Jun. 12, 1995, now U.S. Pat. No. 5,688,220 which claims priority to European Patent Application No. 94108913.8, filed Jun. 10, 1994. I. Field of the Invention This invention relates to a medical appliance for the treatment of a portion of body vessel by ionizing radiation, comprising a radioactive radiation means, and manipulation means. Endoluminal brachytherapy and more particularly percutaneous transluminal brachytherapy currently face difficulties for handling, energizing, transporting and sterilizing the equipment used for applying the therapy. II. Discussion of the Prior Art For example, U.S. Pat. No. 5,147,232 discloses a manual irradiation loading apparatus particularly suitable for intrabronchial and gynecological irradiation treatment. The apparatus comprises a lead or equivalent radiation shielding body with a longitudinally extending cable-receiving passage therein. A cable having radioactive seeds provided on one end thereof is received in the cable-receiving passage. During storage, the portion of the cable bearing the radioactive source is located in the cable-receiving passage within the shielding body. During use, a catheter placed in a patient is joined to the shielding body and the portion of the cable bearing the radioactive source material is advanced through the cable receiving passage in the shielding body and into the catheter. The disclosure provides for using commercially available cable having radioactive seeds provided on an end portion thereof or radioactive wire. According to one embodiment, this document provides for a shielding body constructed to receive a radiation source other than a seeded cable. A shielding body is therefore constructed with a metallic tube running therein from end to end, extending through one end of the shielding body and extending through and beyond the other end thereof. This metallic tube is for allowing free passage of a plastic tandem closed at one end and containing Cesium tube sources maintained in the tandem by a plastic stopper insert. For loading the radiation sources into the patient, an empty metal tandem is positioned in the patient and a docking tube with quick release connectors of the spring clip type with actuating levers at both ends is attached, one end to the shielding body and the other end to the patient's metal tandem. Then, using a loading-retrival cable assembly, the plastic tandem containing the radioactive sources and the stopper insert is pushed through the shielding body via the docking tube and into the metal tandem inserted into the patient. The empty shielding body and the docking tube may then be temporarily removed and stored nearby. When the irradiation treatment has been completed, the radioactive sources must be removed by means of the loading-retrival cable assembly. To this effect, the stopper insert is first removed from the plastic tandem and the docking tube and shielding body are again connected to the patient. To remove the radioactive sources the loading-retrival cable assembly comprises a steel cable surrounded by a teflon tube, this steel cable being terminated by a solid tip extending out of the teflon tube and bearing against a soft rubber ring located between the solid tip and the end of the teflon tube; the other end of the steel cable is attached to a retracting mechanism comprising a return spring urging the end of the steel cable and controlled by a set screw with eccentic lock-up. Within this configuration, the loading-retrival cable assembly is advanced through the shielding body and docking tube and stopped at the opening of the plastic tandem containing the radioactive sources and the cable solid tip and soft rubber ring and passed inside the plastic tandem. The set screw of the retracting mechanism is triggered to retract the steel cable thereby forcing the solid tip to squeeze the soft rubber ring against the end of the teflon tube so that the soft rubber ring expands radially and firmly gripe the inner wall of the plastic tandem. The loading-retrival cable assembly being thus connected to the plastic tandem containing the radioactive sources, one may pull the cable out of the docking tube and retrieve the plastic tandem and radioactive sources back to storage position inside the shielding apparatus. Reverse operation of the retracting mechanism disconnects the steel cable from the plastic tandem and the stopper insert maybe re-inserted into the plastic tandem. In the case of usage of radioactive guidewires, there is the problem to safely secure the radioactive radiation source to the manipulating wire. The source can of course only be made of radiating material and will therefore always have only certain limited material properties. Another problem is that the source always has to be activated for itself without the manipulation wire. An activation together with the manipulation wire would also activate the wire, which would result in harmful radiation from the wire. It is an object of this invention to improve the conditions of handling, energizing, transporting end sterilizing the materials used for endoluminal and more particularly percutaneous transluminal brachytherapy. It is a further object of the invention to improve such conditions by means of appliances that are simple to manufacture and easy to use. Still a further object of the invention is an equipment that is safe and devoid of hazardous structures, and which allows treatment in remote locations and narrow vessels. To this effect, the invention complies with the definitions given in the claims. Accordingly, the part of the radioactive radiation means making part of a detachable interlocking engagement between the radioactive radiation means and the manipulation means allows the manufacture of a tolerance free assembly which can be used without particularly precise or skill demanding manipulations. It also allows the realization of a place saving assembly capable of being inserted into very narrow vessels. And as it is not dependent on any mechanism it can be safely used for treatment of remote locations. The radioactive radiation means can be easily energized and handled separately from the advancing and removing means, whereby a simple and safe circulation of radioactive materials may be organized between the hospital and the energizing center or the manufacturer. In addition, as the radioactive radiation means may be handled alone, there is a substantial place saving in the energizing reactor, whereby a better and cheapest organization of the occupation of the reactor. In parallel, sterilization of the manipulation means can be achieved conventionally and without any particular shielding, while sterilization of the radioactive radiation means is systematically asured by the radioactive radiation. The invention thus solves the aforesaid problems by proposing a detachable connection between radiation source and manipulation wire which is formed by the radiation source itself. With this solution no complicated welding or other manipulation of the activated source is necessary. And as the radiation source can be activated for its own, separated from the manipulating wire, only the desired radiation is generated in purity. Where the medical appliance comprises proximal recess means and stone means on the radioactive radiation means for cooperation with distal recess means and stone means arranged on the manipulation means, an assembly is achieved which allows selection at will of any desired longitudinal play in the assembly to combine a good pushability of the system with an appreciable capacity to handle narrow and tortuous vessels. And this interlocking engagement may be locked by mere insertion into a lumen. The medical appliance may comprise proximal and distal wall means on the radioactive radiation means for cooperation with distal recess means arranged on the manipulation means, thereby achieving a detachable interlocking engagement which requires a very simple shaping of the radioactive radiation means and of the manipulation means. This interlocking engagement may also be locked by engagement into a lumen. Where the appliance comprises proximal coil means on the radioactive radiation means for meshing with distal thread means on the manipulation means, a playless assembly is achieved which combines extreme flexibility and good pushability in a fully positive assembly which can be designed to reach the smallest dimensions. In the case of the medical appliance comprising proximal recess means and store means, reap. proximal and distal wall means, on the radioactive radiation means for cooperation with distal recess means and stone means, resp. distal recess means, on the manipulation means, the detachable interlocking engagement may be locked by insertion into a lumen which may extend longitudinally into a catheter, whereby safest and fastest positioning of the radioactive radiation means may be achieved into the body vessel. In the case of the medical appliance comprising proximal coil means for meshing with distal thread means of the manipulation means, the detachable interlocking engagement may be guided by insertion into a lumen which may also extend longitudinally into a catheter, thereby facilitating meshing of the thread means into the coil means if the latter have a great flexibility. And in both cases, the medical appliance further may comprise a shielding applicator means for supporting the radioactive radiation means in its orientation towards the manipulation means, thereby allowing an operator to lock the detachable interlocking engagement between the radioactive radiation means and the manipulation means by manipulating the manipulation means. This shielding applicator means also facilitates transport and circulation of the radioactive radiation means. These and other objects of the invention will become readily apparent from the following detailed description with reference to the accompanying drawings which show, diagrammaticaly and by way of example only, embodiments of the invention. FIG. 1 is an axial cut of a first embodiment. FIGS. 2 to 5 are axial cuts showing operation of the embodiment of FIG. 1. FIG. 6 is an axial view of a second embodiment. FIGS. 7 to 10 are axial cuts showing operation of the embodiment of FIG. 6. FIG. 11 is an axial cut of a third embodiment. FIGS. 12 to 15 are axial cuts showing operation of the embodiment of FIG. 11. FIG. 16 is an axial view of a fourth embodiment. FIGS. 17 to 20 are axial cuts showing operation of the embodiment of FIG. 16. FIG. 1 shows a medical appliance 1 for the treatment of a portion of body vessel (not shown) by ionizing radiation, comprising a radioactive radiation means 2 and manipulation means 3 for instance for advancing, resp. removing, the radioactive radiation means 2 into, resp. from, the portion of body vessel. In this medical appliance, a part 4 of the radioactive radiation means 2 forms part of a detachable interlocking engagement between the radioactive radiation means 2 and the manipulation means 3. In the example shown, the radioactive radiation means 2 is constituted by a bar 6 of radioactive material, for instance a bar of 90 Yttrium, embedded in a cover 7 of neutral material, for instance a cover of Titanium, for non-contamination purposes. The part 4 of the radioactive radiation means 2 is formed here by an upwardly curved elastic arm 8 terminating by a stone 9 forming a recess 99 on arm 8, which is intended to engage with a circularly shaped recess 5 formed by a stone 55 at the end of a guidewire forming the manipulation means 3. Stone 9 thus forms a proximal recess and stone means elastically connected to the radioactive radiation means, which is for cooperation with distal recess and stone means arranged on the manipulation means. The detachable interlocking engagement of stone 9 in recess 5 may be locked by insertion into a lumen devised into an applicator and/or catheter in which the lumen extends longitudinally, as will be described hereinafter. As shown in FIG. 2, a shielding applicator 10 for supporting the radioactive radiation means 2 in its orientation towards the manipulation means 3 is formed by a base box 11 with a lumen 12 extending therethrough, ending on one side in a tapered mouth 13 and on the other side in a flared entry 14. Base box 11 is termined by a cover 15. Within the lumen 12 is positioned the radioactive radiation means 2 with its upwardly curved arm 8 extending along the flared entry 14. The tapered end 13 of box 11 is closed by a plug 16 extending into lumen 12 and the cover 15 is also closed by a plug 17 extending through flared entry 14 and into lumen 12, thereby holding the radioactive radiation means 2. To operate the medical appliance (FIGS. 3 to 5), the plug 17 is first removed from the shielding applicator 10 and the distal end of the guidewire forming the manipulation means 3 is inserted into the flared entry 14 as shown in FIG. 3. After removal of plug 16 the tapered end 13 of box 11 is then inserted into a conventional luer connector 18 connected to the proximal end 19 of a balloon catheter 20 located in the body vessel (not shown) and having a lumen 21 extending longitudinally therethrough, as shown in FIGS. 4 and 5. By pushing the guidewire 3 towards the radioactive radiation means 2 the distal end of the guidewire abuts against the proximal end of the radioactive radiation means 2 and pushes said radioactive radiation means 2 into lumen 12, towards the luer connector 18 and into the lumen 21 of balloon catheter 20. Passage of the radioactive radiation means 2 into lumens 12 and 21 urges arm 8 of part 4 towards the guidewire 3. At that time, reverse movement of the guidewire 3 will recover the longitudinal distance or play 22 (FIG. 4) between recess 5 and stone 9, thereby achieving the interlocking engagement of recess 99 of stone 9 and recess 5 of stone 55 which is locked by the lumens. The operator may thus lock the (detachable interlocking engagement between radioactive radiation means and manipulation means by manipulating the manipulation means. When the radioactive radiation means 2 is in the shaft of the balloon catheter 20, the shielding applicator 10 may be removed from the proximal end of the catheter and placed apart. It may also remain affixed to the luer connector 18. After completion of the radioactive treatment, and if needed, reconnection of the shielding applicator to the luer connector 18 after insertion of the proximal end of guidewire 3 through lumen 12, the guidewire 3 is withdrawn from the balloon catheter 20. Pulling of the guidewire draws proximally the radioactive radiation means 2 by interlocking of stone 9 and recess 5. When the assembly of stone 9 and recess 5 reaches the flared entry 14 of box 11, the arm 4 is freed and stone 9 withdraws from recess 5. The guidewire 3 may thus be removed from the applicator 10 while the radioactive radiation means 2 remains in the lumen 12 of the applicator 10. The latter may be closed by plugs 16 and 17 and stored or sent back to the energizing reactor. FIG. 6 also shows a medical appliance 31 for the treatment of a portion of body vessel (not shown) by ionizing radiation, comprising a radioactive radiation means 32 and manipulation means 33 for instance for advancing, resp. removing, the radioactive radiation means 32 into, resp. from, the portion of the body vessel. In this medical appliance, a part 34 of the radioactive radiation means 32 also forms part of a detachable interlocking engagement between the radioactive radiation means 32 and the manipulation means 33. In this example, the radioactive radiation means 32 is constituted by a coiled filament 35 of radioactive material, for instance a filament of 90 Yttrium which may be coated by a neutral material such as Titanium for non contamination purposes. The part 34 of the radioactive radiation means 33 is formed by a coiled filament of larger pitch than the coiled filament 35 and which is intended to mesh with a thread 36 formed at the end of a guidewire forming the manipulation means 33. Part 34 thus forms a proximal coil means on the radioactive radiation means which is for meshing with distal thread means arranged on the manipulation means. The detachable interlocking engagement of coil 34 with thread 36 may me guided by insertion into a lumen devised into an applicator and/or catheter in which the lumen extends longitudinally, as will be described hereafter. As shown in FIG. 7, a shielding applicator 37 may also be used for supporting radioactive radiation means 32 in its orientation towards the manipulation means, being formed of a base box 38 with a lumen 39 extending therethrough, ending on one side in a tapered mouth 40 and on the other side connecting with a cover 41. Within the lumen 39 is positioned the radioactive radiation means 32 with its large pitch coil 34 properly extending coaxially in the lumen. The tapered end of box 38 is closed by a plug 42 extending into lumen 39 and the cover 41 is also closed by a plug 43 extending some distance into lumen 39, thereby holding the radioactive radiation means 32. Operation of this medical appliance is as follows (FIGS. 8 to 10): plug 43 is first removed from the applicator 37 and the distal end of the guidewire forming the manipulation means 33 is inserted into the lumen 39 as shown in FIG. 8. The thread 36 of the distal end of the guidewire is then pushed against coil 34 and screwed therein. The radiation means 32 rests thereby against plug 42 (as shown in FIG. 8) (35 is not shown). The resulting friction is sufficient to facilitate screwing of thread 36 into coil 34. Here again the operator may thus lock the detachable interlocking engagement between radioactive radiation means and manipulation means by manipulating the manipulation means. After removal of plug 42, the tapered mouth 40 is inserted into a conventional luer connector 44 connected to the proximal end 45 of a balloon catheter 46 located in the body vessel (not shown) and having a longitudinal lumen 47 extending therethrough, as shown in FIGS. 9 and 10. By pushing the guidewire 33, the radioactive radiation means 32 may be brought at the site of treatment, as shown in FIG. 10. As for the embodiment previously described, the shielding applicator 37 may be removed or left in place once the radioactive radiation means are in the lumen 47 of the balloon catheter 46. When the radioactive radiation treatment is completed, and if needed the shielding applicator reconnected to the luer connector 44, it suffices to withdraw the guidewire from the catheter 46 by mere pulling the guidewire 33. Once the radioactive radiation means 32 is back in the shielding applicator 37, it suffices to unscrew the thread 36 from coil 34 to remove the guidewire and thereafter close the applicator with plugs 42 and 43 while radioactive radiation means 32 remains in the applicator which may be stored or sent back to the energizing center for renewed passage into the reactor. Unscrewing of thread 36 from coil 34 may also be helped by pressure friction against plug 42 as outlined for the screwing thereof. FIG. 11 also shows a medical appliance 61 for the treatment of a portion of body vessel (not shown) by ionizing radiation, comprising a radioactive radiation means 62 and manipulation means 63. In this embodiment as well, a part 64 of the radioactive radiation means 62 forms part of a detachable interlocking engagement between the radioactive radiation means 62 and the manipulation means 63. In this example, the radioactive radiation means 62 is constituted by a bar 65 of radioactive material such as for instance 90 Yttrium, preferably embedded in a cover of neutral material such as Titanium (not shown). The part 64 of the radioactive radiation means 62 is formed here by a longitudinally extending straight rigid arm terminating by a stone 66 defining a recess 67 at the end of bar 65, which is intended to engage with a recess 69 formed by a cylindrical or cubical stone 68 at the end of a guidewire forming the manipulation means 63. There is thus a proximal recess and stone means rigidly connected to the radioactive radiation means cooperating with distal recess and stone means arranged on the manipulation means. As for the embodiment shown in FIG. 1, this detachable interlocking engagement may be locked by insertion into a lumen devised in an applicator and/or catheter in which the lumen extends longitudinally, as will be described. A shielding applicator 70 (FIG. 12) for supporting the radioactive radiation means 62 in its orientation towards the manipulation means 63 is formed by a box 70 with a lumen 72 extending therethrough ending on one side in a tapered mouth 71 and on the other side in a downwardly flaring entry 73. Within lumen 72 is positioned the radioactive radiation means 62 with part 64 protruding into flaring entry 73 and recess 67 oriented downwardly. The tapered mouth 71 of box 70 is closed by a plug 74 and the downwardly flaring entry 73 is closed by a plug 75 formed to maintain the radioactive radiation means 62 in the described orientation. To operate this medical appliance (FIGS. 13 to 15), the plug 75 is removed and the distal end of the guidewire 63 is inserted into the flared entry 73 as shown in FIG. 13, and distal stone 68 of guidewire 63 is inserted into proximal recess 67 of part 64 of the radioactive radiation means 62. Plug 74 is removed and tapered end 71 of box 70 is inserted into a conventional luer connector 76 connected to the proximal end 77 of a balloon catheter 78 located in the body vessel (not shown) and having a lumen 79 extending longitudinally therethrough. In order to facilitate maintaining the stone 68 in recess 67, the box 70 may be turned upside-down. By pushing the guidewire 63 toward the catheter 78, the distal end of stone 68 abuts against the distal wall of recess 67 and pushes the radioactive radiation means 62 into lumen 72, toward the luer connector 76 and into lumen 79 of balloon catheter 78. Passage of the radioactive radiation means into lumens 72 and 79 locks the detachable interlocking engagement of stone 68 into recess 67. The operator thus locks the detachable interlocking engagement between radioactive radiation means and manipulation means by manipulating the manipulation means. When the radioactive radiation means 62 is in the shaft of balloon catheter, the shielding applicator 70 may be removed from the proximal end of the catheter or remain affixed to the luer connector. After completion of the radioactive treatment and if needed reconnection of the shielding applicator to the luer connector 76, the guidewire 63 is withdrawn from the balloon catheter 78. Pulling of the guidewire proximally causes recess 69 of stone 68 to engage stone 66 of part 64 thereby drawing proximally the radioactive radiation means 63 by interlocking of stone 68 and recess 67. When the assembly of stone 68 and recess 67 reaches the flared entry 73 of box 70, stone 68 is freed from recess 67, thereby allowing removal of the guidewire 63 while the radioactive radiation means means 62 remains in the lumen 72 of applicator 70. The latter may be closed by plugs 74 and 75 for storage or circulation towards the energizing reactor. FIG. 16 shows a further embodiment of the medical appliance for the treatment of a portion of a body vessel (not shown) by ionizing radiation; this appliance 101 comprises a radioactive radiation means 102 and manipulation means 103, for instance for advancing or removing the radioactive radiation means into or from the portion of body vessel. In this appliance, a part 104 of the radioactive radiation means 102 also makes part of a detachable interlocking engagement between the radioactive radiation means 102 and the manipulation means 103. In this embodiment, the radioactive radiation means 102 is constituted by a bar 105 or radioactive material such as for instance 90 Yttrium. This bar of material may also be coated or embedded in a layer of neutral material such as a cover of Titanium. Bar 105 is seated into a recess 110 formed at the distal end of a guidewire forming the manipulation means 103, with its proximal and distal walls 104 thereby cooperating with the distal recess 106 to assure the detachable interlocking engagement. This detachable interlocking engagement of bar 105 into recess 106 may be locked by insertion into a lumen devised into an applicator and/or catheter as will be described hereafter. As shown in FIG. 17, a shielding applicator 107 is formed of an upper box portion 108 assembled to a lower box portion 109 with a lumen 111 extending therethrough, ending on one side in a tapered mouth 112 and on the other side ending out of the box for entry of the manipulation means 103. A recess 110 is arranged in the lower box portion 109, opening into lumen 111, which recess is sized to accomodate radioactive radiation means 102. The tapered mouth 112 of box 107 is closed by a plug 113 extending into lumen 111 and some distance over radioactive radiation means 102 and the other end of lumen 111 is also closed by a plug 114 extending therethrough and some distance over radioactive radiation means 102 thereby maintaining radioactive radiation means 102 in recess 110. Shielding applicator 107 thus supports the radoactive radiation means 102 in its orientation towards the manipulation means 103. To operate the medical appliance, as shown in FIGS. 17 to 20, the plugs 113 and 114 are removed and the distal end of the guidewire 103 is inserted into the lumen 111 of box 107 and pushed therein a distance sufficient to have the recess 106 facing the radioactive radiation means 102. At that time, the box 107 and manipulation means 103 are turned upside-down, as shown in FIG. 19, whereby the radioactive radiation means 102 may fall into recess 106 of manipulation means 103. Upon further pushing manipulation means 103, the radioactive radiation means 102 further enters lumen 111. The tapered mouth 112 of shielding applicator 107 is then connected to a conventional luer connector 115 connected to the proximal end 116 of a balloon catheter 117 located in the body vessel (not shown). By pushing further the guidewire 103, the recess 106 abuts against proximal wall 104 of bar 105 and pushes the radioactive radiation means 102 through lumen 111, toward luer connector 115 and into lumen 118 of catheter 117. The operator may thus lock the detachable interlocking engagement between radioactive radiation means and manipulation means by manipulating the manipulation means. When the radioactive radiation means 102 is in the shaft of the balloon catheter 117, the shielding applicator 107 may be removed, by disassembly of box parts 108 and 109, and placed apart. It may also remain affixed to the luer connector 115. When the radioactive treatment is completed, and if needed after reconnection of the shielding applicator to the luer connector 115, the guidewire 103 is withdrawn from balloon catheter 117; pulling of the guidewire draws proximally the radioactive radiation means 102 by interlocking of recess 106 and distal wall 104 of bar 105. The guidewire 103 may thus be pulled up to the moment radioactive radiation means 102 faces recess 110, at which time the shielding applicator 107 and guidewire 103 maybe turned upside-down in the position shown in FIG. 13, whereby radioactive bar 105 may fall back into recess 110. The guidewire 103 may then be removed from shielding applicator 107 and plugs 113 and 114 reinserted into the ends of lumen 111, and the shielding applicator containing radioactive radiation means 102 may be stored or sent back to the energizing center. Variants may be envisaged. For instance, the upwardly curved elastic arm 4 may be replaced by a straight elastic arm also terminated by a stone. The distance or play 22 (FIG. 4) between recess 5 and stone 9 may be substantially reduced to assure a more direct control of the radioactive radiation means 2. The stone 9 and recess arrangements of FIGS. 1 to 15 may be replaced by any equivalent configuration assuring a detachable interlocking engagement, for instance an elastic hook and counter-hook interlocking with the hook arranged at the proximal end of the radioactive radiation means and the counter-hook arranged at the distal end of the manipulation means. It is possible to replace the bar or embedded bar of radioactive material as shown in FIG. 1 by a non-solid substance, for instance powder of radioactive material such as 32 Phosphor embedded in a cover of neutral material such as Titanium. Other materials may also be envisaged such as phosphoric acid absorbed in some appropriate substance. Similarly, the bar of radioactive material may be replaced by a filament or by a coiled lament, possibly also coated by a neutral material such as Titanium. It is also possible to replace the coiled filament 35 as shown in FIG. 6 by a straight filament, or by an embedded bar as shown in FIG. 1, or still by an embedded radioactive powder, while retaining the proximal coil means and distal thread means for the detachable interlocking arrangement as shown in FIGS. 6 to 10. And the coil and thread interlocking engagement may also vary in its relative dimensions; for instance, the coil part 34 of FIG. 6 may have the same pitch as the coiled filament 35, the thread 36 of the manipulation means being then smaller in diameter to be threaded inside the coiled filament 35. The coil part 34 can also be on both ends of the coiled filament 35 so that the coil needs not to be oriented when filled into the shielding applicator means 37. The bar 105 of radioactive material as shown in FIG. 16 may be replaced by two or more bars of smaller size in order to modify the intensity of the radiation and/or to modify the flexibility of the manipulation means in that region. Such bar or bars may also be replaced by coils as described hereabove. The recess 106 formed at the distal area of the manipulation means 103 may be formed either by grinding the material forming the manipulation means or by a deformation thereof; transverse shape of this recess may be devised as desired. The recessed configuration of the lumen 111 of shielding applicator 107 may be replaced by any other configuration allowing passage of the recessed guidewire over the radioactive radiation meant to accomodate it in the recess 106; for instance a tapered lumen allowing in its large portion passage of the recessed portion 106 over the radioactive radiation means 102 and then forcing in its narrow portion the said radioactive radiation means 102 into recess 106. \|Cited Patent\|\|Filing date\|\|Publication date\|\|Applicant\|\|Title\| \|US1442051\|\|10 May 1921\|\|16 Jan 1923\|\|Cummings William L\|\|Radium needle\| \|US2546761\|\|13 Jan 1950\|\|27 Mar 1951\|\|Radium Chemical Company Inc\|\|Radium nasopharyngeal applicator\| \|US2862108\|\|18 Jun 1953\|\|25 Nov 1958\|\|Asea Ab\|\|Device for containing and exposing a radioactive material\| \|US2955208\|\|10 May 1955\|\|4 Oct 1960\|\|Technical Operations Inc\|\|Radiographic device\| \|US3060924\|\|1 Jun 1960\|\|30 Oct 1962\|\|Rush Joseph C\|\|Apparatus for application of radioactive substance to pelvic cancer\| \|US3147383\|\|16 May 1962\|\|1 Sep 1964\|\|Technical Operations Inc\|\|Apparatus for manipulating radioactive material to and from a storage chamber\| \|US3324847\|\|16 Oct 1964\|\|13 Jun 1967\|\|Elias G Zoumboulis\|\|Radioactive catheter\| \|US3505991\|\|13 Feb 1968\|\|14 Apr 1970\|\|Us Air Force\|\|Intracorporeal vascular prosthetic blood irradiator\| \|US3643096\|\|27 Feb 1969\|\|15 Feb 1972\|\|Gen Nuclear Inc\|\|Radioactive source shield with safe position indicator\| \|US3669093\|\|30 Dec 1969\|\|13 Jun 1972\|\|Goedecke Hans\|\|Apparatus for giving medical treatment by irradiation from radioactive substances\| \|US3674006\|\|1 May 1969\|\|4 Jul 1972\|\|Atomenergi Ab\|\|Appliance for interstitial radiation of organs in the body\| \|US3750653\|\|8 Sep 1970\|\|7 Aug 1973\|\|School Of Medicine University\|\|Irradiators for treating the body\| \|US3811426\|\|21 May 1973\|\|21 May 1974\|\|Atomic Energy Commission\|\|Method and apparatus for the in-vessel radiation treatment of blood\| \|US3861380\|\|24 Oct 1972\|\|21 Jan 1975\|\|Commissariat Energie Atomique\|\|Radioactive source projector\| \|US3866050\|\|9 Nov 1973\|\|11 Feb 1975\|\|Atomic Energy Of Canada Ltd\|\|Remotely controlled brachytherapy unit\| \|US3927325\|\|10 Jul 1974\|\|16 Dec 1975\|\|Us Energy\|\|Tissue irradiator\| \|US3970073\|\|30 Jan 1975\|\|20 Jul 1976\|\|Howlin Enterprises, Inc.\|\|Positioning device for radiation treatment of cervical carcinoma\| \|US4096862\|\|17 May 1976\|\|27 Jun 1978\|\|Deluca Salvatore A\|\|Locating of tubes in the human body\| \|US4220864\|\|13 Jun 1978\|\|2 Sep 1980\|\|Kurt Sauerwein\|\|Radiographic apparatus\| \|US4225790\|\|27 Nov 1978\|\|30 Sep 1980\|\|Technical Operations, Incorporated\|\|Storage reel assembly\| \|US4244357\|\|5 Jan 1979\|\|13 Jan 1981\|\|Morrison Richard A\|\|Method and apparatus for homogeneously irradiating the vaginal mucosa with a linear source uterovaginal applicator\| \|US4281252\|\|26 Oct 1979\|\|28 Jul 1981\|\|Technical Operations, Inc.\|\|Coupling apparatus for portable radiography systems\| \|US4314157\|\|21 Jun 1979\|\|2 Feb 1982\|\|Industrial Nuclear Company, Inc.\|\|Safety lock for radiography exposure device\| \|US4364376\|\|26 Dec 1979\|\|21 Dec 1982\|\|Bigham Keith E\|\|Method and device for injecting a bolus of material into a body\| \|US4402308\|\|3 Nov 1980\|\|6 Sep 1983\|\|Scott Walter P\|\|Medical implantation device\| \|US4584991\|\|15 Dec 1983\|\|29 Apr 1986\|\|Tokita Kenneth M\|\|Medical device for applying therapeutic radiation\| \|US4588395\|\|28 Oct 1980\|\|13 May 1986\|\|Lemelson Jerome H\|\|Catheter and method\| \|US4631415\|\|25 Sep 1984\|\|23 Dec 1986\|\|Kurt Sauerwein\|\|Radiation treatment apparatus\| \|US4697575\|\|21 Nov 1984\|\|6 Oct 1987\|\|Henry Ford Hospital\|\|Delivery system for interstitial radiation therapy including substantially non-deflecting elongated member\| \|US4702228\|\|24 Jan 1985\|\|27 Oct 1987\|\|Theragenics Corporation\|\|X-ray-emitting interstitial implants\| \|US4706652\|\|30 Dec 1985\|\|17 Nov 1987\|\|Henry Ford Hospital\|\|Temporary radiation therapy\| \|US4763642\|\|7 Apr 1986\|\|16 Aug 1988\|\|Horowitz Bruce S\|\|Intracavitational brachytherapy\| \|US4763671\|\|25 Apr 1986\|\|16 Aug 1988\|\|Stanford University\|\|Method of treating tumors using selective application of heat and radiation\| \|US4782834\|\|6 Jan 1987\|\|8 Nov 1988\|\|Advanced Cardiovascular Systems, Inc.\|\|Dual lumen dilatation catheter and method of manufacturing the same\| \|US4784116\|\|29 Jul 1987\|\|15 Nov 1988\|\|Theragenics Corporation\|\|Capsule for interstitial implants\| \|US4815449\|\|30 Mar 1987\|\|28 Mar 1989\|\|Horowitz Bruce S\|\|Delivery system for interstitial radiation therapy including substantially non-deflecting elongated member\| \|US4819618\|\|11 Mar 1987\|\|11 Apr 1989\|\|Liprie Sam F\|\|Iridium/platinum implant, method of encapsulation, and method of implantation\| \|US4851694\|\|27 Jan 1988\|\|25 Jul 1989\|\|Campaignie ORIS Industrie\|\|Device for driving and positioning a source holder in an applicator used in radiotherapy\| \|US4861520\|\|28 Oct 1988\|\|29 Aug 1989\|\|Eric van't Hooft\|\|Capsule for radioactive source\| \|US4881937\|\|10 Jul 1987\|\|21 Nov 1989\|\|Eric van't Hooft\|\|Method of treating a part of the body with radioactive material and a trolley for use therein\| \|US4897076\|\|25 Nov 1985\|\|30 Jan 1990\|\|Puthawala Ajmel A\|\|Detachable and remote controllable afterloading device for radiation\| \|US4936823\|\|4 May 1988\|\|26 Jun 1990\|\|Triangle Research And Development Corp.\|\|Transendoscopic implant capsule\| \|US4963128\|\|21 Mar 1989\|\|16 Oct 1990\|\|University Of Virginia Alumni Patents Foundation\|\|Chest tube and catheter grid for intrathoracic afterload radiotherapy\| \|US4969863\|\|28 Oct 1988\|\|13 Nov 1990\|\|Eric van't Hooft\|\|Adaptor for remote after-loading apparatus for radiotherapy\| \|US4976266\|\|25 Jul 1988\|\|11 Dec 1990\|\|United States Department Of Energy\|\|Methods of in vivo radiation measurement\| \|US4976680\|\|7 Oct 1988\|\|11 Dec 1990\|\|Hayman Michael H\|\|Apparatus for in situ radiotherapy\| \|US4976690\|\|22 Mar 1990\|\|11 Dec 1990\|\|Scimed Life Systems, Inc.\|\|Variable stiffness angioplasty catheter\| \|US4994013\|\|28 Jul 1988\|\|19 Feb 1991\|\|Best Industries, Inc.\|\|Pellet for a radioactive seed\| \|US5030194\|\|15 Nov 1989\|\|9 Jul 1991\|\|Eric van't Hooft\|\|Method and apparatus for effecting radioactive therapy in an animal body\| \|US5032113\|\|13 Apr 1989\|\|16 Jul 1991\|\|Scimed Life Systems, Inc.\|\|Innerless catheter\| \|US5059166\|\|11 Dec 1989\|\|22 Oct 1991\|\|Medical Innovative Technologies R & D Limited Partnership\|\|Intra-arterial stent with the capability to inhibit intimal hyperplasia\| \|US5084001\|\|9 Aug 1990\|\|28 Jan 1992\|\|Eric van't Hooft\|\|Method and apparatus for effecting radioactive therapy in an animal body\| \|US5084002\|\|4 Aug 1988\|\|28 Jan 1992\|\|Omnitron International, Inc.\|\|Ultra-thin high dose iridium source for remote afterloader\| \|US5092834\|\|12 Oct 1990\|\|3 Mar 1992\|\|Omnitron International, Inc.\|\|Apparatus and method for the remote handling of highly radioactive sources in the treatment of cancer\| \|US5103395\|\|20 Aug 1990\|\|7 Apr 1992\|\|Spako David W\|\|System for remote positioning of a radioactive source into a patient including means for protection against improper patient exposure to radiation\| \|US5106360\|\|11 Feb 1991\|\|21 Apr 1992\|\|Olympus Optical Co., Ltd.\|\|Thermotherapeutic apparatus\| \|US5120973\|\|1 May 1991\|\|9 Jun 1992\|\|Isotopen-Technik Dr. Sauerwein Gmbh\|\|Method and device for inserting a radioactive radiation source into an applicator and withdrawing it therefrom\| \|US5139473\|\|30 Aug 1991\|\|18 Aug 1992\|\|Omnitron International, Inc.\|\|Apparatus and method for the remote handling of highly radioactive sources in the treatment of cancer\| \|US5141487\|\|12 Dec 1989\|\|25 Aug 1992\|\|Liprie Sam F\|\|Attachment of radioactive source and guidewire in a branchy therapy source wire\| \|US5147282\|\|9 Oct 1990\|\|15 Sep 1992\|\|William Kan\|\|Irradiation loading apparatus\| \|US5163896\|\|16 Jan 1991\|\|17 Nov 1992\|\|Best Industries, Inc.\|\|Pellet for a radioactive seed\| \|US5176617\|\|21 Oct 1991\|\|5 Jan 1993\|\|Medical Innovative Technologies R & D Limited Partnership\|\|Use of a stent with the capability to inhibit malignant growth in a vessel such as a biliary duct\| \|US5183455\|\|5 Nov 1990\|\|2 Feb 1993\|\|Omnitron International, Inc.\|\|Apparatus for in situ radiotherapy\| \|US5199939\|\|23 Feb 1990\|\|6 Apr 1993\|\|Dake Michael D\|\|Radioactive catheter\| \|US5213561\|\|19 Mar 1992\|\|25 May 1993\|\|Weinstein Joseph S\|\|Method and devices for preventing restenosis after angioplasty\| \|US5267960\|\|29 Jan 1992\|\|7 Dec 1993\|\|Omnitron International Inc.\|\|Tissue engaging catheter for a radioactive source wire\| \|US5282781\|\|25 Oct 1990\|\|1 Feb 1994\|\|Omnitron International Inc.\|\|Source wire for localized radiation treatment of tumors\| \|US5302168\|\|5 Sep 1991\|\|12 Apr 1994\|\|Hess Robert L\|\|Method and apparatus for restenosis treatment\| \|US5344383\|\|14 Aug 1992\|\|6 Sep 1994\|\|Wang Liping\|\|Apparatus for radioactive treatment inside the human body and the method using the same\| \|US5354257\|\|29 Jan 1991\|\|11 Oct 1994\|\|Med Institute, Inc.\|\|Minimally invasive medical device for providing a radiation treatment\| \|US5370685\|\|16 Jul 1991\|\|6 Dec 1994\|\|Stanford Surgical Technologies, Inc.\|\|Endovascular aortic valve replacement\| \|US5391139\|\|23 Feb 1994\|\|21 Feb 1995\|\|William Beaumont Hospital\|\|Real time radiation treatment planning system\| \|US5395300\|\|7 Jun 1991\|\|7 Mar 1995\|\|Omnitron International, Inc.\|\|High dosage radioactive source\| \|US5405309\|\|28 Apr 1993\|\|11 Apr 1995\|\|Theragenics Corporation\|\|X-ray emitting interstitial implants\| \|US5409015\|\|11 May 1993\|\|25 Apr 1995\|\|Target Therapeutics, Inc.\|\|Deformable tip super elastic guidewire\| \|US5411466\|\|28 Mar 1994\|\|2 May 1995\|\|Robert L. Hess\|\|Apparatus for restenosis treatment\| \|US5425720\|\|27 Jan 1993\|\|20 Jun 1995\|\|Rogalsky; Alena\|\|Medical needle unit\| \|US5429582\|\|14 Jun 1991\|\|4 Jul 1995\|\|Williams; Jeffery A.\|\|Tumor treatment\| \|US5484384\|\|11 Oct 1994\|\|16 Jan 1996\|\|Med Institute, Inc.\|\|Minimally invasive medical device for providing a radiation treatment\| \|US5498227\|\|15 Sep 1993\|\|12 Mar 1996\|\|Mawad; Michel E.\|\|Retrievable, shielded radiotherapy implant\| \|US5503613\|\|21 Jan 1994\|\|2 Apr 1996\|\|The Trustees Of Columbia University In The City Of New York\|\|Apparatus and method to reduce restenosis after arterial intervention\| \|US5503614\|\|8 Jun 1994\|\|2 Apr 1996\|\|Liprie; Samuel F.\|\|Flexible source wire for radiation treatment of diseases\| \|US5532122\|\|12 Oct 1993\|\|2 Jul 1996\|\|Biotraces, Inc.\|\|Quantitation of gamma and x-ray emitting isotopes\| \|US5538494\|\|17 Mar 1995\|\|23 Jul 1996\|\|Hitachi, Ltd.\|\|Radioactive beam irradiation method and apparatus taking movement of the irradiation area into consideration\| \|US5540659\|\|30 Aug 1994\|\|30 Jul 1996\|\|Teirstein; Paul S.\|\|Irradiation catheter and method of use\| \|US5556389\|\|31 Mar 1994\|\|17 Sep 1996\|\|Liprie; Samuel F.\|\|Method and apparatus for treating stenosis or other constriction in a bodily conduit\| \|US5575749\|\|27 Sep 1990\|\|19 Nov 1996\|\|Omnitron International, Inc.\|\|Ultra-thin high dose radioactive source wire\| \|US5605530\|\|23 Mar 1995\|\|25 Feb 1997\|\|Fischell; Robert E.\|\|System for safe implantation of radioisotope stents\| \|US5611767\|\|16 Sep 1994\|\|18 Mar 1997\|\|Oncocath, Inc.\|\|Radiation treatment of tumors using inflatable devices\| \|US5616114\|\|8 Dec 1994\|\|1 Apr 1997\|\|Neocardia, Llc.\|\|Intravascular radiotherapy employing a liquid-suspended source\| \|US5618266\|\|30 Sep 1994\|\|8 Apr 1997\|\|Liprie; Samuel F.\|\|Catheter for maneuvering radioactive source wire to site of treatment\| \|US5624372\|\|31 Jan 1994\|\|29 Apr 1997\|\|Omnitron International, Inc.\|\|Source wire for localized internal irradiation of tissue\| \|US5643171\|\|15 Nov 1994\|\|1 Jul 1997\|\|Neocardia, Llc\|\|Method and apparatus for uniform radiation treatment of vascular lumens\| \|US5649924\|\|10 Jan 1995\|\|22 Jul 1997\|\|Trimedyne, Inc.\|\|Medical device for irradiation of tissue\| \|US5653683\|\|28 Feb 1995\|\|5 Aug 1997\|\|D'andrea; Mark A.\|\|Intracavitary catheter for use in therapeutic radiation procedures\| \|US5662580\|\|10 Feb 1995\|\|2 Sep 1997\|\|Neocardia, Llc\|\|Combined angioplasty and intravascular radiotherapy method and apparatus\| \|US5674177\|\|17 Jul 1995\|\|7 Oct 1997\|\|Kernforschungszentrum Karlsruhe Gmbh\|\|Vascular implant\| \|US5683345\|\|27 Oct 1994\|\|4 Nov 1997\|\|Novoste Corporation\|\|Method and apparatus for treating a desired area in the vascular system of a patient\| \|US5688220 \|\|12 Jun 1995\|\|18 Nov 1997\|\|Schneider (Europe) A.G.\|\|Medical appliance for treatment by ionizing radiation\| \|US5707332\|\|30 Nov 1995\|\|13 Jan 1998\|\|The Trustees Of Columbia University In The City Of New York\|\|Apparatus and method to reduce restenosis after arterial intervention\| \|US5713828\|\|27 Nov 1995\|\|3 Feb 1998\|\|International Brachytherapy S.A\|\|Hollow-tube brachytherapy device\| \|US5720717\|\|24 Jan 1997\|\|24 Feb 1998\|\|D'andrea; Mark A.\|\|Intracavitary catheter for use in therapeutic radiation procedures\| \|US5722984\|\|16 Jan 1996\|\|3 Mar 1998\|\|Iso Stent, Inc.\|\|Antithrombogenic radioactive coating for an intravascular stent\| \|US5728042\|\|29 Dec 1995\|\|17 Mar 1998\|\|Schneider (Europe) A.G.\|\|Medical appliance for ionizing radiation treatment having radiopaque markers\| \|US5730698\|\|9 May 1995\|\|24 Mar 1998\|\|Fischell; Robert E.\|\|Balloon expandable temporary radioisotope stent system\| \|US5782740\|\|29 Aug 1996\|\|21 Jul 1998\|\|Advanced Cardiovascular Systems, Inc.\|\|Radiation dose delivery catheter with reinforcing mandrel\| \|US5782742\|\|31 Jan 1997\|\|21 Jul 1998\|\|Cardiovascular Dynamics, Inc.\|\|Radiation delivery balloon\| \|US5795286\|\|15 Aug 1996\|\|18 Aug 1998\|\|Cathco, Inc.\|\|Radioisotope impregnated sheet of biocompatible material for preventing scar tissue formation\| \|US5800333\|\|20 Feb 1996\|\|1 Sep 1998\|\|United States Surgical Corporation\|\|Afterloader provided with remote control unit\| \|US5803895\|\|22 Jul 1996\|\|8 Sep 1998\|\|Huels Aktiengesellschaft\|\|Flexible adaptable plastic elements with equidistantly embedded catheters for radiotherapy\| \|US5807231\|\|31 Oct 1995\|\|15 Sep 1998\|\|Omnitron International, Inc.\|\|Source wire for localized internal irradiation of tissue\| \|US5816259\|\|13 Jan 1997\|\|6 Oct 1998\|\|Rose; Samuel\|\|Method for the diagnosis and treatment of cancer by the accumulation of radioactive precipitates in targeted cells\| \|US5816999\|\|24 Jul 1997\|\|6 Oct 1998\|\|Bischoff; Jeffrey\|\|Flexible catheter for the delivery of ionizing radiation to the interior of a living body\| \|US5820553\|\|16 Aug 1996\|\|13 Oct 1998\|\|Siemens Medical Systems, Inc.\|\|Identification system and method for radiation therapy\| \|US5833593\|\|9 Nov 1995\|\|10 Nov 1998\|\|United States Surgical Corporation\|\|Flexible source wire for localized internal irradiation of tissue\| \|US5840008\|\|13 Nov 1995\|\|24 Nov 1998\|\|Localmed, Inc.\|\|Radiation emitting sleeve catheter and methods\| \|US5840009\|\|5 Dec 1995\|\|24 Nov 1998\|\|Isostent, Inc.\|\|Radioisotope stent with increased radiation field strength at the ends of the stent\| \|US5840064\|\|15 Apr 1996\|\|24 Nov 1998\|\|United States Surgical Corporation\|\|Method and apparatus for treating stenosis or other constriction in a bodily conduit\| \|US5843163\|\|6 Jun 1996\|\|1 Dec 1998\|\|Wall; William H.\|\|Expandable stent having radioactive treatment means\| \|US5849036\|\|29 Mar 1996\|\|15 Dec 1998\|\|Zarate; Alfredo R.\|\|Vascular graft prosthesis\| \|US5851171\|\|4 Nov 1997\|\|22 Dec 1998\|\|Advanced Cardiovascular Systems, Inc.\|\|Catheter assembly for centering a radiation source within a body lumen\| \|US5851172\|\|8 May 1995\|\|22 Dec 1998\|\|Omnitron International, Inc.\|\|Afterloader with active force feedback\| \|US5855546\|\|3 Jun 1997\|\|5 Jan 1999\|\|Sci-Med Life Systems\|\|Perfusion balloon and radioactive wire delivery system\| \|US5857956\|\|7 Jun 1995\|\|12 Jan 1999\|\|United States Surgical Corporation\|\|Flexible source wire for localized internal irradiation of tissue\| \|US5863284\|\|20 Aug 1996\|\|26 Jan 1999\|\|Localmed, Inc.\|\|Devices and methods for radiation treatment of an internal body organ\| \|US5863285\|\|30 Jan 1997\|\|26 Jan 1999\|\|Cordis Corporation\|\|Balloon catheter with radioactive means\| \|US5865720\|\|6 Mar 1997\|\|2 Feb 1999\|\|Scimed Life Systems, Inc.\|\|Expandable and retrievable radiation delivery system\| \|US5871436\|\|19 Jul 1996\|\|16 Feb 1999\|\|Advanced Cardiovascular Systems, Inc.\|\|Radiation therapy method and device\| \|US5871437\|\|10 Dec 1996\|\|16 Feb 1999\|\|Inflow Dynamics, Inc.\|\|Radioactive stent for treating blood vessels to prevent restenosis\| \|US5873811\|\|10 Jan 1997\|\|23 Feb 1999\|\|Sci-Med Life Systems\|\|Composition containing a radioactive component for treatment of vessel wall\| \|US5879282\|\|21 Jan 1997\|\|9 Mar 1999\|\|Cordis A Johnson And Johnson Company\|\|Catheter having an expandable radioactive source\| \|US5882290\|\|29 Feb 1996\|\|16 Mar 1999\|\|Scimed Life Systems, Inc.\|\|Intravascular radiation delivery system\| \|US5882291\|\|10 Dec 1996\|\|16 Mar 1999\|\|Neocardia, Llc\|\|Device and method for controlling dose rate during intravascular radiotherapy\| \|US5891091\|\|6 May 1996\|\|6 Apr 1999\|\|Teirstein; Paul S.\|\|Irradiation catheter and method of use\| \|US5897573\|\|22 Apr 1997\|\|27 Apr 1999\|\|Rosenthal; David\|\|Radioactive medical suture and method of making the same\| \|US5899882\|\|4 Apr 1996\|\|4 May 1999\|\|Novoste Corporation\|\|Catheter apparatus for radiation treatment of a desired area in the vascular system of a patient\| \|US5906573\|\|18 Jul 1997\|\|25 May 1999\|\|Radiomed Corporation\|\|Radioactive surgical fastening devices and methods of making same\| \|US5910101\|\|29 Aug 1996\|\|8 Jun 1999\|\|Advanced Cardiovascular Systems, Inc.\|\|Device for loading and centering a vascular radiation therapy source\| \|US5910102\|\|10 Jan 1997\|\|8 Jun 1999\|\|Scimed Life Systems, Inc.\|\|Conversion of beta radiation to gamma radiation for intravascular radiation therapy\| \|US5913813\|\|24 Jul 1997\|\|22 Jun 1999\|\|Proxima Therapeutics, Inc.\|\|Double-wall balloon catheter for treatment of proliferative tissue\| \|US5916143\|\|13 Nov 1996\|\|29 Jun 1999\|\|Apple; Marc G.\|\|Brachytherapy catheter system\| \|US5919126\|\|18 Aug 1997\|\|6 Jul 1999\|\|Implant Sciences Corporation\|\|Coronary stent with a radioactive, radiopaque coating\| \|US5924973\|\|26 Sep 1996\|\|20 Jul 1999\|\|The Trustees Of Columbia University In The City Of New York\|\|Method of treating a disease process in a luminal structure\| \|US5924974\|\|23 Dec 1996\|\|20 Jul 1999\|\|B.V. Optische Industrie "De Oude Delft"\|\|Elongated radioactive element to be attached to an end of an elongated wire-shaped element\| \|US5925353\|\|1 Apr 1997\|\|20 Jul 1999\|\|Set Ltd\|\|Targeted radioimmunotherapy\| \|US5938582\|\|26 Sep 1997\|\|17 Aug 1999\|\|Medtronic, Inc.\|\|Radiation delivery centering catheter\| \|US5947889\|\|10 Jan 1996\|\|7 Sep 1999\|\|Hehrlein; Christoph\|\|Balloon catheter used to prevent re-stenosis after angioplasty and process for producing a balloon catheter\| \|US5947924\|\|13 Sep 1996\|\|7 Sep 1999\|\|Angiorad, L.L.C.\|\|Dilatation/centering catheter used for the treatment of stenosis or other constriction in a bodily passageway and method thereof\| \|US5947958\|\|14 Sep 1995\|\|7 Sep 1999\|\|Conceptus, Inc.\|\|Radiation-transmitting sheath and methods for its use\| \|US5957829\|\|17 Dec 1997\|\|28 Sep 1999\|\|Advanced Cardiovascular Systems, Inc.\|\|Apparatus and method for radiotherapy using a radioactive source wire having a magnetic insert\| \|US5961439\|\|6 May 1998\|\|5 Oct 1999\|\|United States Surgical Corporation\|\|Device and method for radiation therapy\| \|US5967966\|\|23 Jun 1998\|\|19 Oct 1999\|\|Huels Aktiengesellschaft\|\|Flexible, adaptable plastic catheter system for inserting catheters for radiotherapy and method of use thereof\| \|US5971909\|\|25 Jul 1997\|\|26 Oct 1999\|\|Neocardia Llc\|\|Combined angioplasty and intravascular radiotherapy method and apparatus\| \|US5976106\|\|20 Jun 1995\|\|2 Nov 1999\|\|Scimed Life Systems, Inc.\|\|Medical appliance with centering balloon\| \|US5997462\|\|8 Jan 1998\|\|7 Dec 1999\|\|Delft Instruments Intellectual Property B.V.\|\|Method and apparatus for treating a blood vessel lesion\| \|US5997463\|\|26 Mar 1998\|\|7 Dec 1999\|\|North American Scientific\|\|Laser welded brachytherapy source and method of making the same\| \|US6010445\|\|12 Nov 1997\|\|4 Jan 2000\|\|Implant Sciences Corporation\|\|Radioactive medical device and process\| \|US6013019\|\|6 Apr 1998\|\|11 Jan 2000\|\|Isostent, Inc.\|\|Temporary radioisotope stent\| \|US6013020\|\|23 Sep 1997\|\|11 Jan 2000\|\|Novoste Corporation\|\|Intraluminal radiation treatment system\| \|US6019718\|\|30 May 1997\|\|1 Feb 2000\|\|Scimed Life Systems, Inc.\|\|Apparatus for intravascular radioactive treatment\| \|US6024690\|\|1 Jul 1997\|\|15 Feb 2000\|\|Endosonics Corporation\|\|Radiation source with delivery wire\| \|US6030333\|\|24 Oct 1997\|\|29 Feb 2000\|\|Radiomed Corporation\|\|Implantable radiotherapy device\| \|US6033357\|\|28 Mar 1997\|\|7 Mar 2000\|\|Navius Corporation\|\|Intravascular radiation delivery device\| \|US6048300\|\|3 Jul 1997\|\|11 Apr 2000\|\|Guidant Corporation\|\|Compact cartridge for afterloader\| \|US6050930\|\|2 Jun 1998\|\|18 Apr 2000\|\|Teirstein; Paul S.\|\|Irradiation catheter with expandable source\| \|US6053858\|\|4 Jun 1998\|\|25 Apr 2000\|\|Advanced Cardiovascular Systems, Inc.\|\|Radiation source\| \|US6059713\|\|5 Mar 1998\|\|9 May 2000\|\|Scimed Life Systems, Inc.\|\|Catheter system having tubular radiation source with movable guide wire\| \|US6059752\|\|13 Nov 1997\|\|9 May 2000\|\|Segal; Jerome\|\|Mechanical apparatus and method for dilating and irradiating a site of treatment\| \|US6059812\|\|6 Mar 1998\|\|9 May 2000\|\|Schneider (Usa) Inc.\|\|Self-expanding medical device for centering radioactive treatment sources in body vessels\| \|US6066083\|\|27 Nov 1998\|\|23 May 2000\|\|Syntheon Llc\|\|Implantable brachytherapy device having at least partial deactivation capability\| \|US6068611\|\|4 Jul 1997\|\|30 May 2000\|\|Delft Instruments Intellectual Property B.V.\|\|Catheter having centering means\| \|US6071227\|\|27 Jan 1997\|\|6 Jun 2000\|\|Schneider (Europe) A.G.\|\|Medical appliances for the treatment of blood vessels by means of ionizing radiation\| \|US6074338\|\|28 Jun 1994\|\|13 Jun 2000\|\|Schneider (Europe) A.G.\|\|Medical appliances for the treatment of blood vessels by means of ionizing radiation\| \|US6077213\|\|13 Jul 1998\|\|20 Jun 2000\|\|Navius Corporation\|\|Intravascular radiation delivery device\| \|US6090035\|\|19 Mar 1999\|\|18 Jul 2000\|\|Isostent, Inc.\|\|Stent loading assembly for a self-expanding stent\| \|US6093142\|\|30 Apr 1998\|\|25 Jul 2000\|\|Medtronic Inc.\|\|Device for in vivo radiation delivery and method for delivery\| \|US6095966\|\|20 Feb 1998\|\|1 Aug 2000\|\|Xrt Corp.\|\|X-ray device having a dilation structure for delivering localized radiation to an interior of a body\| \|US6099455\|\|25 Nov 1998\|\|8 Aug 2000\|\|Isostent, Inc.\|\|Radioisotope stent with non-radioactive end sections\| \|US6099499\|\|28 Apr 1998\|\|8 Aug 2000\|\|Medtronic, Inc.\|\|Device for in vivo radiation delivery and method for delivery\| \|US6106454\|\|17 Jun 1997\|\|22 Aug 2000\|\|Medtronic, Inc.\|\|Medical device for delivering localized radiation\| \|US6110097\|\|6 Mar 1997\|\|29 Aug 2000\|\|Scimed Life Systems, Inc.\|\|Perfusion balloon catheter with radioactive source\| \|US6117064\|\|6 Jan 1998\|\|12 Sep 2000\|\|Apple; Marc G.\|\|Catheter system\| \|US6117065\|\|24 Jun 1998\|\|12 Sep 2000\|\|Scimed Life Systems, Inc.\|\|Perfusion balloon catheter with radioactive source\| \|US6120533\|\|13 Nov 1998\|\|19 Sep 2000\|\|Isostent, Inc.\|\|Stent delivery system for a radioisotope stent\| \|US6132358\|\|25 Jan 1999\|\|17 Oct 2000\|\|Isostent, Inc.\|\|Shield assembly for radioactive stents\| \|US6132423\|\|21 Jul 1997\|\|17 Oct 2000\|\|Eli Lilly And Company\|\|Photodynamic therapy system and method\| \|US6142926\|\|16 Jul 1998\|\|7 Nov 2000\|\|Advanced Cardiovascular Systems, Inc.\|\|Radiation dose delivery catheter with reinforcing mandrel\| \|US6146322\|\|30 Oct 1996\|\|14 Nov 2000\|\|Schneider (Europe) Ag\|\|Irradiating filament and method of making same\| \|US6146323\|\|14 May 1999\|\|14 Nov 2000\|\|Isostent, Inc.\|\|Delivery catheter for a radioisotope stent\| \|US6149574\|\|17 Mar 1998\|\|21 Nov 2000\|\|Radiance Medical Systems, Inc.\|\|Dual catheter radiation delivery system\| \|US6149575\|\|7 Jul 1998\|\|21 Nov 2000\|\|World Medical Manufacturing Corporation\|\|Radiation delivery catheter\| \|US6152869\|\|10 Aug 1998\|\|28 Nov 2000\|\|Korea Atomic Research Energy Research Institute\|\|Radioactive stent and process for preparation thereof\| \|US6159139\|\|17 Feb 1998\|\|12 Dec 2000\|\|Advanced Cardiovascular Systems Inc.\|\|Radiation delivery catheter with a spring wire centering mechanism\| \|US6159140\|\|17 Feb 1998\|\|12 Dec 2000\|\|Advanced Cardiovascular Systems\|\|Radiation shielded catheter for delivering a radioactive source and method of use\| \|US6159142\|\|5 Nov 1998\|\|12 Dec 2000\|\|Inflow Dynamics, Inc.\|\|Stent with radioactive coating for treating blood vessels to prevent restenosis\| \|US6159143\|\|17 Jun 1998\|\|12 Dec 2000\|\|Scimed Life Systems, Inc.\|\|Method and device for delivery of therapeutic agents in conjunction with isotope seed placement\| \|US6162165\|\|2 Dec 1998\|\|19 Dec 2000\|\|Cook Incorporated\|\|Medical radiation treatment device\| \|US6176821\|\|21 Jul 1998\|\|23 Jan 2001\|\|Radiance Medical Systems, Inc.\|\|Radiation delivery balloon catheter\| \|US6179768\|\|7 Jul 1997\|\|30 Jan 2001\|\|Delft Instruments Intellectual Property B.V.\|\|Capsule for use in brachytherapy and a combination of a capsule for brachytherapy and a guidewire\| \|US6179789\|\|3 May 1999\|\|30 Jan 2001\|\|Lily Chen Tu\|\|Enhanced radioactive stent for reduction of restenosis\| \|US6183409\|\|9 Feb 1999\|\|6 Feb 2001\|\|Implant Sciences Corporation\|\|Soft x-ray emitting radioactive stent\| \|US6183410\|\|6 May 1999\|\|6 Feb 2001\|\|Precision Vascular Systems, Inc.\|\|Radiation exposure device for blood vessels, body cavities and the like\| \|US6187037\|\|11 Mar 1998\|\|13 Feb 2001\|\|Stanley Satz\|\|Metal stent containing radioactivatable isotope and method of making same\| \|US6192271\|\|20 Apr 1999\|\|20 Feb 2001\|\|Michael Hayman\|\|Radiotherapy stent\| \|US6196963\|\|2 Mar 1999\|\|6 Mar 2001\|\|Medtronic Ave, Inc.\|\|Brachytherapy device assembly and method of use\| \|US6196964\|\|4 Jul 1997\|\|6 Mar 2001\|\|Delft Instruments Intellectual Property B.V.\|\|Combination of a capsule for brachytherapy and a guidewire\| \|US6196996\|\|20 Feb 1998\|\|6 Mar 2001\|\|Paul S. Teirstein\|\|Irradiation catheter and method of use\| \|US6200256\|\|17 Mar 1999\|\|13 Mar 2001\|\|The Trustees Of Columbia University In The City Of New York\|\|Apparatus and method to treat a disease process in a luminal structure\| \|US6200257\|\|24 Mar 1999\|\|13 Mar 2001\|\|Proxima Therapeutics, Inc.\|\|Catheter with permeable hydrogel membrane\| \|US6200307\|\|22 May 1998\|\|13 Mar 2001\|\|Illumenex Corporation\|\|Treatment of in-stent restenosis using cytotoxic radiation\| \|US6203485\|\|7 Oct 1999\|\|20 Mar 2001\|\|Scimed Life Systems, Inc.\|\|Low attenuation guide wire for intravascular radiation delivery\| \|US6210312\|\|20 May 1997\|\|3 Apr 2001\|\|Advanced Cardiovascular Systems, Inc.\|\|Catheter and guide wire assembly for delivery of a radiation source\| \|US6210313\|\|10 Feb 1999\|\|3 Apr 2001\|\|Advanced Cardiovascular Systems, Inc.\|\|Radiation therapy method and device\| \|US6210315\|\|15 Jul 1999\|\|3 Apr 2001\|\|Cook Urological Inc.\|\|Brachytherapy device including an anti-static handle\| \|US6210316\|\|12 Aug 1998\|\|3 Apr 2001\|\|Syntheon, Llc\|\|Radioactive therapeutic seeds and methods of making the same\| \|US6213976\|\|22 Jul 1999\|\|10 Apr 2001\|\|Advanced Research And Technology Institute, Inc.\|\|Brachytherapy guide catheter\| \|US6217503\|\|26 Sep 1996\|\|17 Apr 2001\|\|The Trustees Of Columbia University In The City Of New York\|\|Apparatus and method to treat a disease process in a luminal structure\| \|US6224535\|\|17 Feb 1998\|\|1 May 2001\|\|Advanced Cardiovascular Systems, Inc.\|\|Radiation centering catheters\| \|US6224536\|\|8 Feb 1999\|\|1 May 2001\|\|Advanced Cardiovascular Systems\|\|Method for delivering radiation therapy to an intravascular site in a body\| \|US6231494\|\|17 Nov 1997\|\|15 May 2001\|\|Schneider (Europe) A.G.\|\|Medical device with radiation source\| \|US6231495\|\|27 Apr 1998\|\|15 May 2001\|\|Universitat Karlsruhe\|\|Radiation emitting, elastic hose for the endovascular therapy\| \|US6231719\|\|19 Dec 1997\|\|15 May 2001\|\|Kimberly-Clark Worldwide, Inc.\|\|Uncreped throughdried tissue with controlled coverage additive\| \|US6234951\|\|10 Jan 1997\|\|22 May 2001\|\|Scimed Life Systems, Inc.\|\|Intravascular radiation delivery system\| \|US6234952\|\|6 Aug 1999\|\|22 May 2001\|\|Interventional Therapies Llc\|\|Dilatation/centering catheter used for the treatment of stenosis or other construction in a bodily passageway and method thereof\| \|US6238332\|\|10 Nov 1999\|\|29 May 2001\|\|Uni-Cath Inc.\|\|Radiation device with shield portion\| \|US6241719\|\|13 May 1999\|\|5 Jun 2001\|\|Micro Therapeutics, Inc.\|\|Method for forming a radioactive stent\| \|US6248057\|\|27 Jul 1999\|\|19 Jun 2001\|\|Innerdyne, Inc.\|\|Absorbable brachytherapy and chemotherapy delivery devices and methods\| \|US6251059\|\|4 Mar 1999\|\|26 Jun 2001\|\|Cook Incorporated\|\|Medical radiation treatment delivery apparatus\| \|US6254552\|\|1 Oct 1998\|\|3 Jul 2001\|\|E.I. Du Pont De Nemours And Company\|\|Intra-coronary radiation devices containing Ce-144 or Ru-106\| \|US6258019\|\|8 Sep 1999\|\|10 Jul 2001\|\|Scimed Life Systems, Inc.\|\|Catheter for intraluminal treatment of a vessel segment with ionizing radiation\| \|US6261219\|\|4 May 1999\|\|17 Jul 2001\|\|Novoste Corporation\|\|Intraluminal radiation treatment system\| \|US6264579\|\|1 Sep 1999\|\|24 Jul 2001\|\|Tsubakimoto Chain Co.\|\|Toothed belt with positioning-aiding and position-identifying functions\| \|US6264595\|\|4 Feb 1999\|\|24 Jul 2001\|\|Mobeta, Inc.\|\|Radioactive transition metal stents\| \|US6264596\|\|3 Nov 1997\|\|24 Jul 2001\|\|Meadox Medicals, Inc.\|\|In-situ radioactive medical device\| \|US6264598\|\|2 Aug 1999\|\|24 Jul 2001\|\|Implant Sciences Corporation\|\|Palladium coated implant\| \|US6267717\|\|31 Mar 1998\|\|31 Jul 2001\|\|Advanced Research & Technology Institute\|\|Apparatus and method for treating a body structure with radiation\| \|US6267775\|\|6 Mar 2000\|\|31 Jul 2001\|\|Schneider (Usa) Inc.\|\|Self-expanding medical device for centering radioactive treatment sources in body vessels\| \|US6283910\|\|7 Feb 1996\|\|4 Sep 2001\|\|Anthony J. Bradshaw\|\|Method of treating a body vessel or duct with radiation from within the lumen\| \|US6283911\|\|16 Sep 1999\|\|4 Sep 2001\|\|Medirad I.R.T. Ltd.\|\|Radiation delivery devices and methods of making same\| \|CA2166915C\|\|10 Jan 1996\|\|10 Dec 2002\|\|Mark A. D'andrea\|\|Intracavitary catheter for use in therapeutic radiation procedures\| \|DE19526680A1\|\|21 Jul 1995\|\|23 Jan 1997\|\|Huels Chemische Werke Ag\|\|Flexible, anpaßbare Kunststoff-Körper mit Einzelkathetern oder äquidistant eingebetteten Kathetern oder Hülsen zur Einführung von Kathetern für die Strahlentherapie\| \|DE19724223C1\|\|3 Jun 1997\|\|24 Dec 1998\|\|Schering Ag\|\|Production of radioactive coated stent, especially at point of use\| \|DE19724233C2\|\|3 Jun 1997\|\|16 Oct 2003\|\|Sms Demag Ag\|\|Verfahren zur Vermeidung oder Verminderung trompetenförmiger Aufweitungen am Rohrende beim Schrägwalzen von dünnwandigen Rohren und Vorrichtung zur Durchführung des Verfahrens\| \|DE19754870A1\|\|10 Dec 1997\|\|6 Aug 1998\|\|Alt Eckhard Prof Dr\|\|Stent containing radioactive material\| \|DE19758234C2\|\|30 Dec 1997\|\|17 Apr 2003\|\|Anwer Puthawala\|\|Verwendung eines radioakten Katheters\| \|DE19807727B4\|\|24 Feb 1998\|\|16 Feb 2006\|\|Korea Atomic Energy Research Institute\|\|Radioaktiver Ballon für ein Ballon-Dilatations-Kathetersystem und Verfahren zu dessen Herstellung\| \|DE19825563C1\|\|8 Jun 1998\|\|2 Dec 1999\|\|Siemens Ag\|\|Catheter X=ray tube\| \|DE19825999A1\|\|10 Jun 1998\|\|23 Dec 1999\|\|Siemens Ag\|\|System for intracorporeal and intraluminal X-ray therapy\| \|DE19826000C1\|\|10 Jun 1998\|\|30 Dec 1999\|\|Siemens Ag\|\|Catheter assembly for intracorporal X-ray therapeutic treatment\| \|DE19829444A1\|\|1 Jul 1998\|\|27 Jan 2000\|\|Siemens Ag\|\|Miniature X=ray tube for insertion into blood vessel of organism\| \|DE19829447A1\|\|1 Jul 1998\|\|5 Jan 2000\|\|Siemens Ag\|\|X-ray radiation catheter for treatment of vascular wall\| \|EP0152124B1\|\|10 Jan 1985\|\|31 Oct 1990\|\|'t Hooft Eric Van\|\|A method and an apparatus for treating a part of the body with radioactive material\| \|EP0158630B1\|\|4 Apr 1985\|\|15 Nov 1989\|\|Österreichisches Forschungszentrum Seibersdorf Ges.m.b.H.\|\|Device for installing radioactive sources without danger into irradiation devices implanted in the body\| \|EP0433011B1\|\|11 Dec 1990\|\|20 Jul 1994\|\|Robert E. Fischell\|\|Intra-arterial stent with the capability to inhibit intimal hyperplasia\| \|EP0447745A2\|\|11 Jan 1991\|\|25 Sep 1991\|\|Isotopen-Technik Dr. Sauerwein Gmbh\|\|Device for the radioactive radiation treatment of a body cavity\| \|EP0466681B1\|\|5 Jul 1991\|\|8 Nov 1995\|\|Österreichisches Forschungszentrum Seibersdorf Ges.m.b.H.\|\|Seedholder and process and device for its manufacture\| \|EP0474994A1\|\|28 Jun 1991\|\|18 Mar 1992\|\|Isotopen-Technik Dr. Sauerwein Gmbh\|\|Device for installing a radioactive source in an applicator and for retracting the source from the applicator\| \|EP0514913B1\|\|21 May 1992\|\|12 Mar 1997\|\|Namic Caribe, Inc.\|\|A polymeric article, such as a medical catheter, and method for making the same\| \|EP0593136B1\|\|11 Dec 1990\|\|5 Mar 1997\|\|Robert E. Fischell\|\|Device for the prevention of arterial restenosis\| \|EP0629380B1\|\|4 Sep 1991\|\|22 Jul 1998\|\|Angiomedics Ii, Inc.\|\|Inhibition of restenosis by ultraviolet radiation\| \|EP0633041B1\|\|1 Jul 1993\|\|15 Sep 1999\|\|Schneider ( Europe) GmbH\|\|Medical appliances for the treatment of blood vessels by means of ionizing radiation\| \|EP0686342B1\|\|10 Jun 1994\|\|9 Sep 1998\|\|Schneider ( Europe) GmbH\|\|A medical appliance for the treatment of a portion of body vessel by ionising radiation\| \|EP0688580B1\|\|24 Jun 1994\|\|4 Oct 2000\|\|Schneider (Europe) GmbH\|\|Medical appliance for the treatment of a portion of body vessel by ionising radiation\| \|EP0696906B1\|\|29 Apr 1994\|\|16 Apr 1997\|\|Forschungszentrum Karlsruhe GmbH\|\|Vascular implant\| \|EP0749764B1\|\|22 Jun 1995\|\|3 May 2000\|\|Schneider (Europe) GmbH\|\|A medical appliance for the treatment of a portion of body vessel by ionizing radiation\| \|EP0754472A3\|\|21 May 1996\|\|27 Jan 1999\|\|Hüls Aktiengesellschaft\|\|Method for making a flexible fixation material containing catheters or tubes for radiotherapy\| \|EP0754473B1\|\|3 Jul 1996\|\|10 Sep 2003\|\|KABE Labortechnik GmbH\|\|Plastic adaptable, flexible material comprising an only catheter or equidistant embedded catheters or envelopes to guide catheters in the field of radiotherapy\| \|EP0778051B1\|\|5 Dec 1995\|\|9 Apr 2003\|\|Schneider (Europe) GmbH\|\|Filament for irradiating a living body and method for producing a filament for irradiating a living body\| \|EP0801961B1\|\|8 Apr 1997\|\|24 Mar 2004\|\|Interventional Therapies, LLC\|\|Method and apparatus for treating stenosis or other constriction in a bodily conduit\| \|EP0810004A3\|\|8 May 1997\|\|13 Jan 1999\|\|Advanced Cardiovascular Systems, Inc.\|\|Radiation-emitting flow-through temporary stent\| \|EP0813894B1\|\|1 Jul 1993\|\|5 Dec 2001\|\|Schneider ( Europe) GmbH\|\|Medical appliances for the treatment of blood vessels by means of ionizing radiation\| \|EP0865803B1\|\|18 Mar 1998\|\|12 May 2004\|\|Schneider (Usa) Inc.,\|\|Self-expanding medical device\| \|EP0904798B1\|\|26 Sep 1997\|\|6 Nov 2002\|\|Schneider ( Europe) GmbH\|\|Carbon dioxide inflated radio-therapy balloon catheter\| \|EP0904799A1\|\|26 Sep 1997\|\|31 Mar 1999\|\|Schneider ( Europe) GmbH\|\|Dilation catheter with balloon having a determined ration of balloon volume and square surface of the inflation lumen\| \|JP10071210A\|\|Title not available\| \|JP2000014810A\|\|Title not available\| \|JP2000024001A\|\|Title not available\| \|1\|\|Fackelmann, "Harbinger of a Heart Attack", Science News, vol. 151, Jun. 14, 1997, pp. 374-75.\| \|2\|\|Lommatzsch et al., "Radiation effects on the optic nerve observed after brachytherapy of choroidal melanomas with 106Ru/106Rh plaques", Graefe's Arch. Clin. Exp. Ophthalmology vol. 232, pp. 482-487, 1994.\| \|3\|\|Radiotherapy of Intraoculare and Orbital Tumors, Springer-Verlak publishers, Berlin Heidelberg and New York, copyright 1993, pp. 23-30 and 363-367.\| \|4\|\|Raloff, "Nuclear Medicine Gets Friendlier-Experimental Therapies Seek to Posion Just the Disease", Science News, Bol. 152, Jul. 19, 1997, pp. 40-41.\| \|5\|\|Raloff, "Nuclear Medicine Gets Friendlier—Experimental Therapies Seek to Posion Just the Disease", Science News, Bol. 152, Jul. 19, 1997, pp. 40-41.\| \|6\|\|Sealy, R. et al., "The Tretment of Cancer of the Uvula and Soft Palate with Interstitial Radioactive Wire Implants," Int. J. Radiation Oncology Biol. Phys., vol. 10, Oct. 1984, pp. 1951-1955.\| \|7\|\|Sinclair, W.K. et al. "Artificial Radioactive Sources for Interstitial Therapy," Source Unknown, Aug. 1952, pp. 417-419.\| \|8\|\|Sutherland, "Managing Cancer Through Synergy", Administrative Radiology Journal, Nov. 1996, pp. 21-27.\| \|9\|\|Tjho-Heslinga et al., "Results of ruthenium irradiation of uveal melanona", Radiothereapy Oncology, vol. 29, pp 33-38, 1993.\| \|10\|\|Wallace, D.M. et al., "Radioactive Tantalum Wire Implantation as a Method of Treatment for Early Carcinoma of the Bladder," Source Unknown, Aug. 1952, pp. 421-424.\| \|Citing Patent\|\|Filing date\|\|Publication date\|\|Applicant\|\|Title\| \|US7041047 \|\|4 Oct 2002\|\|9 May 2006\|\|Boston Scientific Scimed, Inc.\|\|Method and apparatus for the delivery of brachytherapy\| \|US8409069\|\|2 Apr 2013\|\|Ethan J. Schuman\|\|Brachytherapy appliance and method\| \|US20040068157 \|\|4 Oct 2002\|\|8 Apr 2004\|\|Scimed Life Systems, Inc.\|\|Method and apparatus for the delivery of brachytherapy\| \|US20100292526 \|\|14 Jan 2008\|\|18 Nov 2010\|\|Schuman Ethan J\|\|Brachytherapy appliance and method\| \|International Classification\|\|A61M36/04, A61N5/10\| \|Cooperative Classification\|\|A61N2005/1025, A61N5/1002\| \|16 Nov 2006\|\|FPAY\|\|Fee payment\| Year of fee payment: 4 \|31 Jan 2011\|\|REMI\|\|Maintenance fee reminder mailed\| \|24 Jun 2011\|\|LAPS\|\|Lapse for failure to pay maintenance fees\| \|16 Aug 2011\|\|FP\|\|Expired due to failure to pay maintenance fee\| Effective date: 20110624
Commentary & Analysis Partnering for Printing Sustainability SGP is helping to define what it is for a printing company to be sustainable. Sponsoring organizations play a large part in guiding and supporting SGP. The following article looks at the reasons why some of the sponsors participate. By John G. Braceland Published: March 21, 2014 Last month’s article was about The Sustainable Green Printing Partnership (SGP). SGP is a non-profit organization providing sustainability certification in the printing industry. Since SGP is a nonprofit, sponsoring organizations play a large role in ensuring the organization will continue. This month I’ll focus on some of the sponsors of SGP and why they continue their support. I interviewed five sponsors: Fujifilm, HP, Prisco, 3M and Unisource. All five organizations participate at different sponsorship levels. However, there were a few common themes between the organizations: 1) A strong interest in protecting the environment 2) SGP’s focus on continuous improvement 3) A desire to see the printing industry get greener I was surprised that these same thoughts came from very different organizations. SGP was founded by a number of stakeholders, associations, printers and vendors. It is evident, after seven years of existence, that this organization has clear objectives and continues a strong partnership between these stakeholders. Here is some insight into why these companies stay involved. I spoke with Girish Menon from Fuji. Fujifilm has had a long history of environmental stewardship. They were the first private company in Japan to establish a public trust fund, 1 billion yen, in 1983 that continues to disburse ongoing support for environmental efforts. Fuji wants to reduce the environmental impact of their products. Because of their strong environmental focus they wanted to partner with an organization that could give them feedback on not only how their products performed but other opportunities for reducing environmental impact. A big attraction is SGP’s focus on not just becoming certified and standing still, but each year reducing a company’s environmental impact. Fuji has a strong continuous improvement culture and wants to help the printing industry become better by that focus. Jonathan Graham, from HP, has been on the board of SGP for a year. HP became involved when they developed their latex ink technology. Their goal is to have environmental sustainability in all products. HP’s feeling is that sustainability in the printing industry is a have-to-have not a nice-to-have. They were looking for an organization that would be an agent of change in the printing industry. The paper industry took responsibility when they created the chain of custody certification. The industry was receiving a bad rap about paper usage. HP was looking for an organization that could do the same thing in the printing industry. Similar to Fuji, HP is looking for an opportunity to interact with printers about the environmental impact of their products. Another big attraction for HP is the idea that being environmentally responsible makes you more efficient. SGP certification focuses on the total operating environment – again the continuous improvement idea. With more and tougher environmental regulations, being environmentally responsible will save the printer money. Bill Malloy, from Prisco, has been involved in SGP since early in its formation. Prisco saw environmental regulations growing tighter in California. Plus, end users were increasingly looking for marketing solutions with low environmental impact. Prisco wanted to be involved with helping to shape the organization. They didn’t want to see SGP become a green washing or marketing group. They wanted to see an organization that could help the printing industry set a standard on what it meant to be environmentally responsible. Prisco did not want printers to just pay a fee and become certified, or, just use the logo as a sales tool. They wanted comprehensive criteria as well as continuous improvement each year. Bill felt the severity of the recession slowed down certifications and some of the focus on environmental sustainability by end users. Now that the economy has stabilized he sees more reasons why printers should participate. Mike Kesti, from 3M, has been their point person for SGP. 3M has a strong sustainability component in their company, which is good for their business model. Their primary interest is large format graphics media. They wanted to be part of the discussion defining what it meant for a printer to be sustainable. They also wanted to learn in the process so they could bring this back to their own product development. 3M felt it was important that SGP incorporate continuous improvement in their metrics and not be tied to specific technology. They are sensitive to the printer’s customers’ needs for an environmentally friendly sustainable product. 3M wants to have end users specify their brand because of performance and sustainability. Andrew Gustyn, from Unisource, spoke to me about their involvement with SGP. They have been involved with SGP for over three years. He feels they have just scratched the surface of their relationship. Unisource continues to promote environmental responsibility. They wanted to be involved with an industry focused environmental organization. The printing industry had no standards on what it meant to be green. Also, they were looking for standards that covered the operation from start to finish, not just in the prepress or pressroom. Unisource wanted to share best practices and foster a sense of responsibility towards the environment. There are three different sponsorship levels: Silver, Gold and Platinum. Some sponsors are involved on the Board. If your organization would like to learn more about being a Sponsor for SGP, contact Martine Padilla, Executive Director of SGP at 310-809-6124 or firstname.lastname@example.org It is clear from talking to the sponsors that they have a real synergy with SGP and are looking for more than just name recognition. These organizations are investing in pushing the printing industry to new levels of environmental responsibility. Next month I’ll interview some printers to get their take on SGP.
PRZOOM - /newswire/ - Tarrytown, NY, United States, 2011/09/13 - NYC REACH, has selected OmniMD – the NY based provider of Integrated EHR and Practice Management System as a preferred EHR Vendor to assist large NYC physicians group achieving Meaningful Use - OmniMD.com. NYC REACH, the Regional Extension Center overseen by the Primary Care Information Project at the NYC Health Department, has selected OmniMD – the NY based provider of Integrated EHR and Practice Management System as a preferred EHR Vendor to assist large NYC physicians group achieving Meaningful Use. OmniMD’s Complete EHR is certified by ONC-ATCB and supports Meaningful Use measures required to qualify eligible providers for Medicare & Medicaid Incentives. OmniMD located in NY, has been providing fully integrated and highly customized EHR & PMS software since a decade. OmniMD has been working closely with many RECs in the Nation on various educational & technological programs for their participating healthcare providers. “It’s our immense pleasure to get this opportunity to associate with NY REACH. The synergy between OmniMD and NYC REACH will be highly beneficial for the betterment of Patient Healthcare in NY, said Divan Dave, CEO of OmniMD.” “By working closely with OmniMD, NYC REACH can offer more tailored services to the company’s clients in New York City,” said Dr. Jesse Singer, NYC Acting Assistant Commissioner at the NYC Health Department. “This new partnership ensures that OmniMD users can take full advantage of federally subsidized training and innovative quality improvement programs from the NYC Health Department.” OmniMD™ Integrated Electronic Health Records (EHR), Practice Management System (PMS) and services offer unparalleled reliability, ease-of-use, efficiency, interoperability and customizability. OmniMD™ Version 11.0 is an ONC-ATCB 2011- 2012 certified EHR. OmniMD™ Version 11.0 is also CCHIT Certified 2011 Ambulatory EHR with a five-star usability rating. OmniMD is among first to achieve Surescripts Gold certification for its eRX. OmniMD™ is a division of Integrated Systems Management, Inc. (ismnet.com), which is a leader in software development and information technology consulting since 1989. Its products and services are HIPAA compliant, web-enabled and support all computing devices including Tablet PCs (iPad, Galaxy, Xoom), Desktop PCs, Laptops and Smart phones (iPhone, Blackberry, Android). OmniMD™ EHR has also achieved Surescripts® Gold Solution Provider status, which allows for interoperability with the country’s community pharmacies, improving the safety, efficiency of the e-prescribing process and the quality of patient care. OmniMD™ offers a comprehensive set of services such as Revenue Cycle Management (RCM), Medical Transcription, Document Scanning and Indexing, Patient Portal, Patient Reminder, Website Design, IT, Networking and Eligibility Verification as part of an integrated solution to help practices effectively address their financial, administrative, clinical and regulatory needs. NYC REACH can be contacted at (347) 396-4888, pcip[.]health.nyc.gov, or at nycreach.org. Copyright © 2010. OmniMD™. All Rights Reserved. OmniMD™ is a trademark of Integrated Systems Management, Inc.
Is matter falling into the massive black hole at the center of the Milky Way or being ejected from it? No one knows for sure, but a UC Santa Barbara astrophysicist is searching for an answer. Carl Gwinn, a professor in UCSB’s Department of Physics, and colleagues have analyzed images collected by the Russian spacecraft RadioAstron. Their findings appear in the current issue of The Astrophysical Journal Letters. RadioAstron was launched into orbit from Baikonur, Kazakhstan, in July 2011 with several missions, one of which was to investigate the scattering of pulsars — the cores of dead stars — by interstellar gas. What the team found led them to examine additional observations of Sagittarius A-Star (A), the source that marks the Milky Way’s central black hole. Sagittarius A is visible at radio, infrared and X-ray wavelengths. This massive black hole — which contains 4 million solar masses — does not emit radiation but is visible from the gas around it. The gas is being acted upon by the black hole’s very strong gravitational field. The wavelengths that make Sagittarius A* visible are scattered by interstellar gas along the line of sight in the same way that light is scattered by fog on Earth. Gwinn and his colleagues found that the images taken by RadioAstron contained small spots. “I was quite surprised to find that the effect of scattering produced images with small lumps in the overall smooth image,” explained Gwinn. “We call these substructure. Some previous theories had predicted similar effects in the 1980s, and a quite controversial observation in the 1970s had hinted at their presence.” In order to better understand the substructure, Michael Johnson, Gwinn’s former graduate student now at the Harvard-Smithsonian Center for Astrophysics, conducted theoretical research. He realized that the anomalies could be used to infer the actual size of the underlying source. Additional observations made using the Very Long Baseline Array — an interferometer consisting of 10 identical antennas distributed across the United States — and the 100-meter Green Bank Telescope in West Virginia showed the presence of lumps in the image of Sagittarius A. Recent upgrades have greatly increased the sensitivity of these telescopes. Even so, evidence of the lumps, or substructure, remained extremely faint. “The theory and observations allow us to make statements about the interstellar gas responsible for the scattering, and about the emission region around the black hole,” Johnson said. “It turns out that the size of that emission region is only 20 times the diameter of the event horizon as it would be seen from Earth. With additional observations, we can begin to understand the behavior in this extreme environment.” While no scientific team has been able to produce a complete image of the black hole’s emission, astronomers have drawn inferences about scattering properties from observations at longer wavelengths. “From these they can extrapolate those properties to 1 centimeter and use that to make a rough estimate of the size of the source,” Gwinn said. “We seem to agree quite well with that estimate.” Not only did Gwinn and his colleagues directly confirm these indirect inferences about the size of Sagittarius A, they were also able to provide new information about fluctuations in the interstellar gas that cause scattering. Their work shows that the spectrum of interstellar turbulence is shallow. “There are different ways of interpreting observations of the scattering, and we showed that one of them is right and the others are wrong,” said co-investigator Yuri Kovalev, the RadioAstron project scientist. “This will be important for future research on the gas near this black hole. This work is a good example of the synergy between different modern research infrastructures, technologies and science ideas.” A friendly international race is going on to see who will be the first to image the black hole’s emissions and thereby determine whether gas falls into the black hole or is being ejected in the form of a jet. “The character of the substructure seems to be random, so we are keen to go back and confirm the statistics of our sample with more data,” Gwinn said. “We’re also interested in looking at shorter wavelengths where we think the emission region may be smaller and we can get closer to the black hole. We may be able to extract more information than just the size of the emission region. We might possibly be able to make a simple image of how matter falls into a black hole or is ejected from it. It would be very exciting to produce such an image.”
Eden Medina, author of Cybernetic Revolutionaries: Technology and Politics in Allende’s Chile, celebrates the 45th anniversary of "Star Trek" by relating it to a different vision of the future--Project Cybersyn. On September 8, 1966, the first episode of “Star Trek” aired on U.S. television and presented viewers with a utopian vision of a future grounded in the use of advanced technology. On the show, a diverse crew of people (and other life forms) traveled across the universe at warp speed to promote peace, order, prosperity, and greater equality. From the high-tech bridge of the Starship Enterprise, Captain Kirk transmitted messages across vast distances, made decisions quickly and decisively, and monitored the health of both ship and crew. To celebrate the 45th anniversary of “Star Trek,” this blog post commemorates a different, but related, vision of the future: “Project Cybersyn.” The history of Project Cybersyn is detailed in the forthcoming MIT Press book Cybernetic Revolutionaries: Technology and Politics in Allende’s Chile, which will be published in November 2011. Project Cybersyn was a computer system built in Chile by the socialist government of Salvador Allende (1970–73). Chilean and British engineers, working under the direction of the British cybernetician Stafford Beer, viewed the system as a way to advance the economic nationalization program that was central to Allende’s economic platform and Chilean socialist change. The system enabled the rapid transmission of information between the nationalized factories and the government agency charged with their management (CORFO) and used statistical software to predict crises before they happened. The team called the system Cybersyn, a synthesis of the words cybernetics and synergy. The name reflected the cybernetic principles present in the system’s design and the team’s belief that the whole system exceeded the sum of its parts. Like “Star Trek,” Project Cybersyn brought together technology and politics to advance a utopian vision of a just society. It was created to transmit information quickly across great distances (Chile is approximately 3,200 miles long), monitor the health of the national economy, improve governance, and facilitate decision-making. Moreover, its design included mechanisms to promote worker participation in industrial management, and thus increase equality on the shop floor, as well as a control space that rivaled science fiction.
The article presents the most important obstacles related to public conflicts between some citizen committties (like NGO representatives) and local or central authorities, representatives of the formal power in public decision making processes. Conflicts related to localization of big shopping centers, air pollution 'factories' or highway's destinations are very common not only in Poland. There are four main rules of proper negotiation behavior, ten suggestions to follow by public representatives and 25 wrong attitudes, which make difficult talks even more difficult. Negotiation talks between local authorities and citizens are in our country seen as a long way full of misunderstanding and fighting instead of cooperation and synergy. Financed by the National Centre for Research and Development under grant No. SP/I/1/77065/10 by the strategic scientific research and experimental development program: SYNAT - “Interdisciplinary System for Interactive Scientific and Scientific-Technical Information”.
Weaknesses of Online Learning While online programs have significant strengths and offer unprecedented accessibility to quality education, there are weaknesses inherent in the use of this medium that can pose potential threats to the success of any online program. These problems fall into six main categories: Equity and Accessibility to Technology Before any online program can hope to succeed, it must have students who are able to access the online learning environment. Lack of access whether it be for economical or logistics reasons will exclude otherwise eligible students from the course. This is a significant issue in rural and lower socioeconomic neighborhoods. Furthermore, speaking from an administrative point of view, if students cannot afford the technology the institution employs, they are lost as customers. As far as Internet accessibility is concerned, it is not universal, and in some areas of the United States and other countries, Internet access poses a significant cost to the user. Some users pay a fixed monthly rate for their Internet connection, while others are charged for the time they spend online. If the participants time online is limited by the amount of Internet access they can afford, then instruction and participation in the online program will not be equitable for all students in the course. This is a limitation of online programs that rely on Internet access. Both students and facilitators must possess a minimum level of computer knowledge in order to function successfully in an online environment. For example, they must be able to use a variety of search engines and be comfortable navigating on the World Wide Web, as well as be familiar with Newsgroups, FTP procedures and email. If they do not possess these technology tools, they will not succeed in an online program; a student or faculty member who cannot function on the system will drag the entire program down. Limitations of Technology User friendly and reliable technology is critical to a successful online program. However, even the most sophisticated technology is not 100% reliable. Unfortunately, it is not a question of if the equipment used in an online program will fail, but when. When everything is running smoothly, technology is intended to be low profile and is used as a tool in the learning process. However, breakdowns can occur at any point along the system, for example, the server which hosts the program could crash and cut all participants off from the class; a participant may access the class through a networked computer which could go down; individual PCs can have numerous problems which could limit students access; finally, the Internet connection could fail, or the institution hosting the connection could become bogged down with users and either slow down, or fail all together. In situations like these, the technology is neither seamless nor reliable and it can detract from the learning experience. While an online method of education can be a highly effective alternative medium of education for the mature, self-disciplined student, it is an inappropriate learning environment for more dependent learners. Online asynchronous education gives students control over their learning experience, and allows for flexibility of study schedules for non traditional students; however, this places a greater responsibility on the student. In order to successfully participate in an online program, student must be well organized, self-motivated, and possess a high degree of time management skills in order to keep up with the pace of the course. For these reasons, online education is not appropriate for younger students (i.e. elementary or secondary school age), and other students who are dependent learners and have difficulty assuming responsibilities required by the online paradigm. Lack of Essential Online Qualities Successful on-ground instruction does not always translate to successful online instruction. If facilitators are not properly trained in online delivery and methodologies, the success of the online program will be compromised. An instructor must be able to communicate well in writing and in the language in which the course is offered. An online program will be weakened if its facilitators are not adequately prepared to function in the Virtual Classroom. An online instructor must be able to compensate for lack of physical presence by creating a supportive environment in the Virtual Classroom where all students feel comfortable participating and especially where students know that their instructor is accessible. Failure to do this can alienate the class both from each other and from the instructor. However, even if a virtual professor is competent enough to create a comfortable virtual environment in which the class can operate, still the lack of physical presence at an institution can be a limitation for an online program. For the faculty as well as the participants, such things as being left out of meetings and other events that require on-site interaction could present a limiting factor in an online program. The Administration and Faculty Some environments are disruptive to the successful implementation of an online program. Administrators and/or faculty members who are uncomfortable with change and working with technology or feel that online programs cannot offer quality education often inhibit the process of implementation. These people represent a considerable weakness in an online program because they can inhibit its success. Sometimes administration cannot see beyond the bottom line and look at online programs only as ways to increase revenues and are thus not committed to seeing online programs as a means of providing quality education to people who would otherwise not be able to access it. In such a case, an institution that is not aware of the importance of proper facilitator training, essential facilitator characteristics, and limitations of class size would not understand the impact that these elements can have on the success of an online program. The Online Environment Levels of Synergy Online learning has its most promising potential in the high synergy represented by active dialog among the participants, one of the most important sources of learning in a Virtual Classroom. However, in larger classes (20 or more students), the synergy level starts to shift on the learning continuum until it eventually becomes independent study to accommodate the large class. At this point, dialog is limited as well as interaction among participants and the facilitator. The medium is not being used to its greatest potential. What Should Not Be Taught Online In the excitement and enthusiasm for online programs that has been generated recently, it is important to recognize that some subjects should not be taught online because the electronic medium in its current state of development does not permit the best method on instruction. Examples are hands-on subjects such as public speaking, surgery, dental hygiene, and sports where physical movement and practice contribute to the achievement of the learning objectives. These subjects are probably best taught in a face-to-face traditional learning environment. Hybrid courses may represent a temporary solution to this problem thus making that portion of the course more accessible to a greater number of people who would otherwise have difficulty getting to campus. However, solutions of that sort still underline the fact that online teaching cannot satisfy all educational needs and goals. Just because it may be technologically possible to simulate a physical learning experience, this does not necessarily mean that it is the best way to teach it. The curriculum of any online program must be carefully considered and developed in order to be successful. Many times, in an institutions haste to develop distance education programs, the importance of the curriculum and the need for qualified professionals to develop it is overlooked. Curriculum and teaching methodology that are successful in on-ground instruction will not always translate to a successful online program where learning and instructional paradigms are quite different. Online curriculum must reflect the use of dialog among students (in the form of written communication), and group interaction and participation. Traditional classroom lectures have no place in a successful online program. Education of the highest quality can and will occur in an online program provided that the curriculum has been developed or converted to meet the needs of the online medium. Today is a very exciting time for technology and education. Online programs offer technology-based instructional environments that expand learning opportunities and can provide top quality education through a variety of formats and modalities. With the special needs of adult learners who need or want to continue their education, online programs offer a convenient solution to conflicts with work, family and study schedules. Institutions of higher education have found that online programs are essential in providing access to education for the populations they wish to serve. In order for an online program to be successful, the curriculum, the facilitator, the technology and the students must be carefully considered and balanced in order to take full advantage of the strengths of this format and at the same time, avoid pitfalls that could result from its weaknesses.
New Delhi: Piyush Goyal, who assumed the charge of Mines Minister Wednesday, said he will work towards increasing the share of the mines and minerals sector in the GDP by 1 percent in the next 2-3 years. Goyal, the Minister of State for Power, Coal and New & Renewable Energy took the additional charge of Mines Ministry from Narendra Singh Tomar, who has been shifted to the Rural Development Ministry in a Cabinet reshuffle. "We will work on a growth of 30-35 percent annually in terms of the volume of minerals mined, which would help us in increasing mining's share in GDP by 1 percent in 2-3 years," Goyal told reporters here after taking the charge from Tomar. At present, mining's share in the country's GDP is 2.4 percent. When asked about merger of the Coal and Mines Ministries, he said: "We will see that at an appropriate time. The Prime Minister and senior ministers will take a call on this. But, I must say this government works on synergy and is performance oriented." The government has merged the Ministry of Overseas Indian Affairs (MOIA) with the External Affairs Ministry in sync with its broad principle of 'minimum government, maximum governance', he added. Goyal also said he will talk with the officials in the Mines Ministry on creating an app which will inform people about the status of the mines, the minerals extracted as well as on export and import of minerals. Tomar exuded confidence that the Mines sector will touch new heights under Goyal. Congratulating Tomar for bigger role at Rural Development Ministry, Goyal said he has done an outstanding job by improving the basic infrastructure of mining sector. "All we have to do now is to carry his work forward," he said.
Synergy Housing shareholders back Aster merger The proposed merger of Synergy Housing and Aster Group has moved a step closer after Synergy’s shareholders gave the proposal their approval. Synergy’s shareholders unanimously voted in favour of the merger, which would see it joining forces with Aster to create a combined organisation, subject to approval from the Homes & Communities Agency. Synergy and Aster together manage more than 26,000 affordable homes across central southern and south west England and build properties for affordable rent and sale. In a joint statement, Synergy chief executive Graeme Stanley and Aster Group chief executive Bjorn Howard said: “This is a major step forward in our proposal to merge and we’re delighted Synergy’s shareholders have responded so positively to our plans. Synergy and Aster share the same vision and values and customers are at the heart of everything both organisations do. Bringing together our joint expertise would be beneficial for everyone – not only would we be ideally placed to deliver better services to customers and build more homes, we believe it will also make us a more attractive partner to central and local government. “Following the approval of Synergy’s shareholders, we’ll now continue to discuss details of the proposal with customers, staff, local authority partners, the regulatory authorities and other stakeholders. We hope to formally announce the successful merger in the autumn.” - Click here to return to the previous page - Subscribe to our free construction newsletters - Buy & Sell Construction Plant Machinery online with TCiTrader.co.uk. Find new, used & reconditioned Construction Equipment. Click here to view Construction Equipment Classifieds. Download our free construction news iPhone / iPad app. Sign up to our FREE email newsletters or subscribe to our RSS feed for regular updates on the latest Construction News, Plant News, Contract News & Supplier News. The Construction Index also provides the latest Construction Tenders, Construction Market Data & Construction Law Commentary all FREE. This article was published on 21 May 2012 (last updated on 21 May 2012).
Top 10 cars of the Geneva Motor Show 2011Our favourite cars from the year's biggest show 04 March 2011 So, the dust has settled on the 2011 Geneva Motor Show (for the press gang at least – it’s still open to the public until 13 March). The Which? Car team was there for both press days, checking out the latest concept and production cars coming our way. Here's our pick of the top 10 most significant cars from the show. Geneva Motor Show 2012 - all the latest news, pictures, videos and industry gossip from the 82nd edition of the International Motor Show. Volkswagen Bulli concept VW has reinvented the Camper, brought it bang up to date and shrunk it in the wash to become a six-seat people carrier. Thank goodness we had a chance to see this the night before the show opened, as it was impossible to get near it on the VW stand. If the level of interest in this concept is anything to go by, VW simply has to build it. The compact MPV market is crying out for something you can buy with your heart as well as your head. Remember the old Kia Rio? Thought not. While that car had looks only a mother could love, the new Rio is genuinely good looking, and boasts impressive emissions figures too (CO2 as low as 85g/km). Make no mistake, Kia is now a major player on the world stage, and its new Rio and Picanto superminis at Geneva will have the likes of Ford, Vauxhall and Toyota losing sleep… Full marks to Ford for listening to the needs of its target audience. The new B-Max mini MPV (based on the Fiesta) will become the smallest people carrier in its range when it arrives in the next 12 months, but it won’t be the least practical. Sliding rear doors, and the total lack of a B-pillar (which normally obstructs access to the cabin) should make the B-Max a big hit with families. Nissan Esflow concept Talking of target audience, we’d hate to draw attention to Nissan’s pen portrait of the typical Esflow driver (read more in our Esflow coming soon page), but that’s the worst thing about this car. OK, it’s only a concept, but if Nissan can actually build an all-electric sports car as cool as this, which hits 62mph in less than 5 seconds and lasts for 150 miles on one charge, it will be onto a real winner. Mercedes-Benz C-class coupe We’ve never been huge fans of the compact Mercedes CLC (or Sport Coupe, as it used to be known), but we’re quite taken with this larger C-class coupe. With looks, performance and fuel economy to worry the likes of Audi’s A5 and BMW’s 3 Series coupe, this four-seater should have no trouble finding buyers. It’s due here in June, and we’d expect a C-class convertible to follow in early 2012. Volkswagen Golf Cabriolet It’s been 10 years since we waved goodbye to the last Golf soft-top, but now the Cabriolet is back. While VW already offers the Eos folding hard-top convertible (based on the Golf), it clearly feels it has space in the range for a Golf Cabrio too. It’s nothing spectacular inside or out, but it’s a solid, well conceived car that will almost certainly have a waiting list. Bit small for four adults, but other than that, we like it. Audi A3 conceptAnother motor show, another niche filled by Audi. This time it’s the turn of the A3 range to get a spin-off model – an A3 saloon. Small saloons don’t tend to be popular in the UK, but they might be if they all looked this good (and were this fast). Audi does intend to build it, too, alongside hatchback and Avant (estate) versions of the new A3, due to arrive in late 2011. In terms of Geneva’s more fanciful cars, we’d take the Jaguar XKR-S over the new (spot-the-difference) Aston Martin Virage any day. With 540bhp from its uprated 5.0 V8 engine, this the most potent Jag to date. It’s not terribly subtle, and probably not a car to buy in the middle of an oil peak, but let’s hope that dies down in time for this car’s arrival in late 2011… Volvo V60 Plug-in diesel hybrid At the other end of the spectrum, in terms of eco credentials, is Volvo’s plug-in diesel hybrid. While Peugeot showed off the world’s first production diesel hybrid (the 3008 Hybrid4), Volvo hopes to take that one-step further, with a diesel hybrid that can also be plugged into the mains. If it can pull this off, V60 could offer CO2 emissions as low as 49g/km and fuel economy of 150mpg. Potentially a game-changing car. Toyota Yaris HSD The Yaris HSD concept clearly showcases the look of the new Mk3 Yaris, due here in autumn 2012, but also indicates Toyota’s intention to build a Hybrid Synergy Drive (HSD) version of the supermini. If Toyota wrings all it can from the system, CO2 emissions could fall below 75g/km. And that means the government will give you 25% off the list price of the Yaris HSD under its low-carbon grant scheme. Watch this space… Get more from Which? Car Magazine: Which? Car magazine is the UK's only independent car guide (we don't take ads, so our reviews are totally impartial). The Winter 2011 issue is the first of the new look Which? Car, packed with more new and used car reviews than ever before. We've dedicated more pages to in-depth reviews of all the major cars on sale today, helping you to make the most educated decision about buying a new or used car. It's on sale now, priced at £4.99, available from Sainsbury's, Tesco, WH Smith, Martin McColl and good independent newsagents. Email: Stay in touch with all the up-to-date car news, hot deals, latest first drives and reviews posted on our website each week. Sign up to the Which? weekly email to receive our free Friday bulletin.
All-Pro Off Road's Long Travel IFS suspension system is available for '05-and-up Toyota Tacoma's, '03-and-up 4Runners, and '07-and-up FJ Cruisers. The system permits 12 inches of wheel travel and fits 33-inch tires without the need for fiberglass fenders. Provides the added performance needed to tackle the tougher trails, yet retains a smooth ride both on and off road. - Kit features 2-inch extended tubular 4130 Chromoly upper and lower A-arms - Upper A-arm uses a 1.25-inch Teflon-lined uni-ball for maximum travel and strength and features zerk fittings for easy bushing lubrication. Lower A-arm has billet CNC uni-ball adapter connector and bumpstop contact point - Heavy-duty chromoly steering system with top quality three-piece chromoly heim joints allow for increased droop - Includes extended stainless steel braided brake lines, DOT approved - The kit is TIG welded and includes spindle gussets, uniball caps, and high angle CV boots (for 4WDs) at no additional charge - Made in the USA American Expedition Vehicles American Expedition Vehicles (AEV) offers a comprehensive line of suspensions for the Jeep JK Wrangler. These suspensions have been uniquely engineered for JK owners who use their Jeeps for far more than just going off road. Safe, comfortable drivability, and even high-speed driving have all been factored in to create what many consider to be the most enjoyable and best overall performing suspensions on the market. - AEV systems use frequency-tuned, triple-rate coils and proprietary AEV-valved Bilstein shocks - Geometry-corrected roll-centers, instant-centers, and steering - Vehicle Dynamics-tested at OE test facility - Manufactured in the United States BDS Suspension now offers 6- and 8-inch long-arm suspension kits for the 2003-to-2011 Dodge Ram 2500 and 3500 trucks. The systems come complete with everything needed to overhaul your late model Dodge HD and clear up to 39-inch tires. - Kit includes BDS pro ride coils, a massive long arm sub frame with extended upper and lower arms, a T-case indexing ring, and choice of block kit or full spring in the rear - Backed by the industry's only “No Fine Print” Lifetime Warranty - Includes BDS 5500 shocks or upgrade to Fox 2.0 shocks - Engineered and manufactured in the USA New from Currie Enterprises are Johnny Joint rod ends that directly replace the rod ends on many manufacturers' long-arm suspension kits. Like all Johnny Joints, these units feature 30-degrees of overall travel, heat-treated center balls, and urethane bushings. - Johnny Joints are greasable and are fully rebuildable - Offers 1 1/4-inch female thread on the 2 1/2-inch joints, and 1-inch female thread on the 2-inch joints - All joints are finished in semi-gloss, black powdercoat Dave's Custom Unlimited The rear outboard shock towers from Dave's Custom Unlimited are an easy way to install rear coilover shocks on your Jeep YJ or TJ Wrangler. The mounts are designed to be frenched into the frame to allow for adequate clearance with tires, and for maximum shock dampening control. - Allows you to run long travel shocks without cutting holes through the inner fender wells - Towers are laser cut and CNC-bent from 3/16-inch thick steel - Can be used to install coilovers or regular shocks - Sold in pairs Dave's Customs Unlimited, Inc. The Daystar Polyurethane Lift System capitalizes on the Jeep JK's very capable factory suspension and comes complete with Daystar's 10-Stage VSV Scorpion shock absorbers. The system is said to offer superior handling and ride both on- and off-road. - Fits 2007-to-2012 Jeep JK Wrangler and provides space for 35-inch tires - Includes everything needed to lift a JK a full 3 inches, while maintaining your factory ride - Designed to fit 35-inch tires for under $400 - Every Daystar lift kit is backed by a “no questions asked” lifetime guarantee - Proudly made in the USA Genright Off-Road's Double Triangulated 4-Link rear kit is a universal kit designed for Jeep YJs and TJs eager to take their 4x4s to the next level. Genright has figured out all the mounting points for proper geometry (weight transfer, rear steer and minimal anti-squat, etc.) to create a top notch 'crawler with awesome articulation. The kit is also perfect for moving the rear axle back to stretch the wheelbase to 100 inches when used with Genright's EXT or COMP gas tanks. - Mounts are universal and can be cut or trimmed to be mounted on any Jeep TJ or YJ - Control arms are manufactured from 2 1/2-inch-diameter 7075 aluminum and are set to move the rear axle back 4 inches from stock - Kit can be used with 14-inch coilover shocks or your existing coil springs - Includes forged 1 1/4-inch-shank Currie Johnny Joints - Includes a heavy-duty 1/4- x 3/16-inch-thick laser-cut and CNC-bent crossmember and laser-cut upper and lower control arm mounts - Made in the USA Ford truck owners love the look and ride of a lifted truck. However, the added ride height puts additional leverage onto your factory sway bars. The result is excess body roll around corners and a ride that may feel unstable at speed. To cure this problem Hellwig offers heavy-duty sway bars. - Hellwig's larger diameter sway bar will make all the difference in the performance and handling of your lifted Ford F150 and comes with heavy duty adjustable end-links - Many lifted sway bar applications, along with other load and sway control products, are offered for most popular 4x4s JSPEC Products USA JSPEC Products USA is now offering its JSPEC suspension packages for Jeep Wrangler JKs. The trial-and-error process of choosing individual components is incredibly frustrating and far more expensive than selecting the right parts from the beginning. Save considerable time and money with a JSPEC Suspension package that is specifically engineered for optimum fitment and performance on your late-model Jeep Wrangler. Three basic packages are offered that include the most essential components for your new suspension. Each package can be further customized or enhanced to suit your individual performance and budgetary requirements. - Every package delivers exceptional value and is backed by American quality and workmanship - The standard lift package provides an economical boost in elevation while retaining factory ride quality and comfort levels - The Sport package includes rugged fixed-length lower control arms for additional strength and reliability in harsh conditions - For maximum off-road capability, the Spec package features adjustable lower control arms and a front adjustable track bar to provide 2.5 inches of additional ride height JSPEC Products USA Said to offer more wheel travel than any bolt on suspension system, the Metal Cloak Jeep JK suspension system features the company's revolutionary 6Pak Shocks that use Metal Cloak's Floating Shock Body Technology. The 6Pak Shock features parallel shafts that extend from a floating shock body, centralized by dual opposing reservoirs. This creates twice the usual stroke compared to conventional-style shocks. - Each purpose driven, precision developed part of the MetalCloak system has been engineered for durability and for the utmost in clearance - Features DuroFlex high-misalignment flex bearing-equipped upper and lower control arms - Features high-tensile chrome silicone steel alloy dual-rate coil springs and Metal Cloak's 6Pak compact/long-travel shocks - Available in 12-, 14-, and 16-inch stroke lengths National Spring Inc. has been a full service spring shop in San Diego, California, since 1947. Currently located in nearby El Cajon, the company continues to build the highest quality custom leaf and coil springs available. - National Spring computer designs its custom leaf springs specifically to meet the customer's needs. Based completely on the actual weights of the customer's vehicle, the springs are then hand built to ensure the best product possible - Springs can be built with any amount of lift, heavy-duty springs for utility and work trucks, as well as factory replacement springs for nearly any vehicle - Customers also have the option to have any other dimension of the spring altered, such as length, center pin placement, and load, to name a few - National Spring only uses the highest quality spring steel from the USA and Canada Off-Road Evolution offers its EVO MFG 4-inch bolt-on long-arm kit for Jeep Wrangler JKs. The system is available with Bilstein 5100 Series shocks, EVO Spec King 2.0 shocks, or EVO Spec King 2.5 reservoir shocks. Off-Road Evolution also offers a Jeep Wrangler JK short arm suspension system, as well as full coilover conversion kits. - Control arms are manufactured from 2-inch-by-0.281-inch-wall DOM tubing and use Currie Johnny Joints - Features EVO1 Adjustors that allow control arm length adjustment without control arm removal - Greater articulation is achieved through smooth plush ride coil rates, long travel shocks and optional bumpstop heights - Increased stability is achieved through specifically tuned coil rate/shock rates, rigid and adjustable swaybar linkages, and optimized roll center corrections both front and rear - Allows fitment of 35- to 37-inch tires Performance Accessories manufactures two premium lift systems that allow Nissan pickup owners to lift their vehicles up to 5.5 inches, at a fraction of the cost of a full-suspension kit. The kits allow fitment of 33- to 35-inch tall tires using a combination of a leveling kit and a body-lift to raise the vehicle, and a set of inner fender Gap Guards to conceal the space between the body and frame. The system also includes high-quality coil and strut-spacers that limit spring preload for a smoother ride, and keep the factory ball-joint and CV joint angles at factory specifications to eliminate premature wear. - Each kit comes with nylon-reinforced body blocks, heavy-duty steel bumper brackets, a CNC machined steering adapter, and all of the necessary hardware - The 5.5-inch lift system fits all 2004-to-2009 2WD and 4WD Titan pickups - The 5-inch kit fits 2005-to-2010 model Nissan Frontier pickups - Lift systems are manufactured in the USA and are also available for GM, Ford, Dodge, Toyota, and Jeep applications Performance Automotive Group Revtek Suspension's lift system for the Jeep JK includes everything you need for a trouble-free installation and a great ride. Revtek provides new smooth riding coils all the way around and all four corners get new shocks. - Supplied with front sway bar end links, a rear track bar relocation bracket, and all other necessary hardware - Includes an adjustable front track bar, which prevents bump steer by retaining the stock suspension and steering geometry The Rock Krawler X Factor Plus suspension systems for the new Wrangler JK are now available. The lift systems are said to be the most advanced Wrangler suspension systems ever made. The X Factor Plus Systems feature adjustable, high-clearance lower control arms front and rear. At the rear the systems use Rock Krawler's revolutionary independent three-link conversion with adjustable anti-squat geometry. - The X-Factor Plus systems include front spring retainer clips and rear shock relocation brackets for improved ground clearance. - The 3.5-inch X Factor Plus system allows fitment of 35-inch tires - The 5.5-inch X Factor Plus system allows fitment of 37-inch tall tires. Rokmen's new 1/2-inch body lift for TJ and LJ model Jeep Wranglers is designed for those who need additional space for installation of high-clearance skid plates but don't have the need to run a taller unsightly body lift. - Helps maintain a low center of gravity but increases precious ground clearance - Machined from solid billet 6061 Aluminum - Each kit includes all required hardware for installation. Rough Country's popular 4.5-inch and 6.5-inch X-Series suspension lifts for Jeep Cherokee XJs are now offered with Rough Country's new N2.0 shocks. The new 4.5-inch X-Series N2 system features X-Flex adjustable upper and lower control arms, a transfer case drop kit, an adjustable track bar, stainless steel brake lines, and sway-bar disconnects. A set of lifted coil springs and all-new rear lifted leaf springs help the 4.5-inch kit to clear 32-inch tires. The 6.5-inch kit clears 33-inch tires. - Offers a balanced ride for both on and off-road use - X-Flex arms are fully adjustable, and feature a ball-in joint, massive 2.5-inch diameter body and huge 1.25-inch threads - X-Flex bushings are made of high-quality 88 Durometer Urethane and are weather resistant for a long lifespan - New nitrogen-charged N2.0 shocks are equipped with rubber bushings and offer 10-stage velocity sensitive valving, chromed hardened 9/16-inch piston rods, and massive 1 3/8-inch bores Rough Country Suspension Products Rubicon Express Super-Flex suspension systems for the 2012 Jeep Wrangler JK are now available. The Super-Flex systems are available in 3.5- and 4.5-inch lift heights and are designed for enthusiasts looking for the best short arm suspension system that retains the factory mounting locations. The Super-Flex system is said to offer great ride quality and phenomenal performance. - System includes Rubicon Express adjustable upper and fixed lower control arms with serviceable Super-Flex spherical ball joints, replacement lift springs, extended bump stops, and longer front and rear stainless steel brake lines - The 3.5-inch suspension allows use of 35-inch tires - The 4.5-inch suspension allows use of 37-inch tires. Driveline modifications are required - This system is engineered to easily upgrade to either 3.5- and 4.5-inch Extreme-Duty Long Arm systems with the purchase of additional components The RX300 Series remote reservoir shocks from Rusty's Off-Road are the latest in state of the art mono tube shock technology. The shocks feature 14mm hardened chrome shafts to increase rigidity for seal alignment for extended service life without premature wear. Heavy wall DOM seamless tubing offers superior construction and keeps the shocks operating temperatures cooler. - The 10-inch reservoir dramatically increases oil capacity for even better heat dissipation - Built drawing upon 30 years of experience in the off-road industry - Will provide superior service for your daily driver, pre-runner, or trail rig Skyjacker's 1- to 2-inch front lift metal spacers for 2005-to-2011 Ford Super Duty trucks are an effective, inexpensive, and safe way to gain tire and ground clearance. The spacers simply attach to the lower coil spring mount to provide 1 or 2 inches of lift to level out the front end of a Super Duty. - The complete kit includes 2 front spacers and all the necessary hardware. - Installation takes about an hour and does not affect the ride quality. - Retails for less than $100 Sulastic Rubber Springs are a new suspension aid design that reduces, and in many cases totally removes, the vibration and shock caused by the leaf spring suspension. It works together with the leaf springs of the vehicle to reduce body noise and prevent body metal fatigue and separation. - Aids in vehicle stability - Sulastic Rubber Springs are available for most makes and models of trucks, from 1/2 ton up to 5 tons Superlift's 2- and 4-inch JK kits now cover 2012 models. Because the new engine configuration causes the stock front driveshaft to bind at full droop on lifted 2012 JKs, Superlift includes a front limiting strap in its 2012 kits. Use of aftermarket CV-style driveshafts will restore full travel. Also new are three shock options: base Superide twin-tube; premium SS monotubes by Bilstein; and ultra-premium Fox 2.0. - Superlift's 2-inch kit uses coil spacers to economically fit 33x12.50 tires - The 4-inch kit uses application-specific pre-set coil springs to clear up to 35x12.50 tires with no other modifications - An adjustable front track bar is included. A weld-on relocation bracket is standard for the rear track bar; a bolt-on bracket is also available. Many other options and upgrades are available Synergy Suspension has just released the all-new front and rear Jeep JK Coilover/Air Bump Conversion Kit, the ultimate addition to any JK aftermarket suspension system available today. The rear uses a heavy-duty tubular cross member that is constructed from 1 3/4-inch DOM steel to move the upper shock mount up and back for proper clearance. - The front system uses a weld-on upper shock tower and integrated lower shock mount/bump stop pad. The system is designed to mount 12- or 14-inch-travel 2.0-inch coil over shocks or 12-inch-travel 2.0- or 2.5-inch air shocks (sold separately) - Features a weld-on front upper shock tower and integrated lower shock mount/bump stop pad - Optional air bump mounting kit can be added at a later time if desired - Offers an adjustable ride height to accommodate 35- to 42-inch tires - Includes Grade 8 mounting hardware - All brackets are precision laser cut and CNC-formed from 3/16-inch high-strength steel The TeraFlex JK LCG PreRunner Suspension system combines all top-of-the-line components into a purpose-built speed system. The PreRunner system is designed to minimize unnecessary rotational mass and maximize complete wheel travel. For ultimate performance, as engineered, TeraFlex recommends the use of Fox Racing Shox which have been specifically engineered, designed, and valved to work in conjunction with the TeraFlex LCG suspension geometry and TeraFlex SpeedBump bumpstops. The Fox Racing Shox are not included with the LCG PreRunner Suspension system, but are available separately. - Designed to fit 35-inch tires - Features TeraFlex Elite LCG long arm geometry - Coil spring retainers prevent the springs from unseating during full suspension extension - Designed for use with OEM axle housings - Includes Teraflex SpeedBump bumpstops to provide progressive compression during high speed suspension movement TJM now offers its XGS Gold suspension for the Toyota FJ Cruiser. TJM XGS Gold systems are 100-percent designed in Australia by TJM to extend the performance and capabilities of a vehicle's suspension. - TJM offers its XGS Gold systems to fit many 4x4 applications - TJM lift systems are said to offer improved ride, handling, load carrying, and towing capability - Coil springs are offered in linear and progressive rates and are load tested - TJM XGS Gold shocks feature sensitive damping and an exclusively-engineered valve with teflon banded piston to improve the ride, handling, and safety characteristics of the vehicle ToyTec's new height adjustable coilovers are designed to give 3 inches of lift to 2005-and-newer Toyota Tacomas and FJ Cruisers and 2003-and-newer 4Runners. They come fully assembled with ToyTec aluminum top mounts and urethane bushings. - Features Bilstein shocks and Eibach springs - Designed to lift Toyota Tacoma, FJ Cruiser, and 4Runner The Trail-Link Three Front Three-Link Kit from Trail Gear is affordable, user friendly, and strong. The kit is available for Toyota pickups and 4Runners and includes everything you need except your choice and size of shocks and upper shock mounts, as mounting locations vary from vehicle to vehicle. Using 14-inch-travel shocks, Trail Gear has successfully achieved 40 to 50 inches of suspension flex depending on the suspension in the rear of the truck. - The link material is 2-by-0.250-inch-wall DOM tubing, while the rod ends are 1.25-inch Creeper Joints - All brackets are made from 1/4-inch steel and are formed and welded - This kit works great with Trail Gear's air shock hoop mounting kit - Kit includes suspension links, link mounting brackets, Creeper Joints, weld-in bungs, rod ends, misalignment spacers, shock length mock-up strips, and lower shock mounting kits The Trail Master Flex-Joint suspension system for 2007-to-2011 Jeep JKs provides 4.5 inches of lift. The system uses Flex-Joint technology and includes heavy-duty front and rear drive shafts, U-joints, Kevlar-lined steel braided brake lines, and SSV shocks. - Available for two- and four-door model Jeep Wrangler JKs - Control arms are manufactured from 0.250-inch-wall steel tubing - Provides 4.5 inches of lift The new Suzuki Samurai "Trail Slayer" coil suspension kit from Trail Tough is available to transform the Suzuki Samurai in to an incredibly capable rock buggy. The kit provides a 100-inch wheel base and allows fitment of 35- to 42-inch tires. - Designed upon Trail Tough's many years of professional rock crawling competition experience and design - Specifically requires use of a 1979-to-1985 Toyota pick up frontend and a 1986-to-1995 Toyota pick up rearend - Available for Sidekicks and Geo Trackers Trail Tough Products Warrior Products' high-performance 3-inch suspension system for the JK Wrangler is built for strength, performance, and durability. - System includes four H60.5mm shocks featuring a nine-stage valve system and self-lubricating polished chrome piston - Durable coil springs offer excellent ride - Includes necessary mounting hardware for a complete installation Available for 2009-to-2011 Dodge Ram 1500 are Zone Offroad's 4- and 6-inch suspension lifts. Both kits consist of 1/4-inch-thick crossmembers and CNC machined steering knuckles designed to match the factory geometry and appearance. Strut top spacers are included to maintain factory ride quality and strut disassembly is not required. Differential drop brackets correct the CV and driveshaft angles. - The 6-inch system clears 37-inch tires - Rear suspension includes new coil springs combined with a unique four-link and track bar relocation system - Engineered and manufactured in the USA Zone Offroad Products
Thirty-First Series of Meetings Geneva, September 22 to October 1, 1997 adopted by the Governing Bodies TABLE OF CONTENTS ITEMS OF THE CONSOLIDATED AGENDA (see document AB/XXXI/1 Prov.2) Item 1: OPENING OF SESSIONS Item 2: ADOPTION OF THE AGENDAS Item 3: ELECTION OF THE OFFICERS Item 4: APPOINTMENT OF THE NEW DIRECTOR GENERAL(and WO/GA/XXI/13) Item 5: ACTIVITIES FROM JULY 1, 1996 TO JUNE 30, 1997; INTERIM FINANCIAL STATEMENT FOR 1996; ARREARS IN CONTRIBUTIONS Item 6: ACCOUNTS FOR THE 1994-95 BIENNIUM; ARREARS OF CONTRIBUTIONS OF DEVELOPING COUNTRIES; PROGRAM AND BUDGET AND CONTRIBUTIONS FOR THE 1998-99 BIENNIUM Item 7: PREMISES (and WO/GA/XXI/13) Item 8: MATTERS CONCERNING THE DRAFT TREATY FOR THE SETTLEMENT OF DISPUTES BETWEEN STATES IN THE FIELD OF INTELLECTUAL PROPERTY 141 (and WO/GA/XXI/13) Item 9: MATTERS CONCERNING THE DRAFT PATENT LAW TREATY (and WO/GA/XXI/13) Item 10: MATTERS CONCERNING THE PCT UNION (and PCT/A/XXIV/10) Item 11: MATTERS CONCERNING THE MADRID UNION (and MM/A/XXVIII/3) Item 12: MATTERS CONCERNING THE HAGUE UNION (and H/A/XV/3) Item 13: MATTERS CONCERNING THE NICE UNION (and N/A/XV/2) Item 14: AVAILABILITY OF DATA OF THE INTERNATIONAL CLASSIFICATIONS Item 15: AUDIOVISUAL PERFORMANCES AND DATABASES AND FOLKLORE (and WO/GA/XXI/13) Item 16: INFORMATION TECHNOLOGIES FOR INTELLECTUAL PROPERTY (and WO/GA/XXI/13) Item 17: INTERNET AND THE WIPO ARBITRATION AND MEDIATION CENTER (and WO/GA/XXI/13) Item 18: STAFF MATTERS (and WO/CC/XXXIX/5) Item 19: APPROVAL OF AN AGREEMENT BETWEEN WIPO AND THE EURASIAN PATENT ORGANIZATION (EAPO) (and WO/CC/XXXIX/5) Item 20: APPOINTMENT OF MEMBERS OF THE WIPO ARBITRATION COUNCIL (and WO/CC/XXXIX/5) Item 21: DESIGNATION OF AUDITORS Items 22, 23 and 24: ELECTION OF THE MEMBERS OF THE EXECUTIVE COMMITTEES OF THE PARIS AND BERNE UNIONS AND DESIGNATION OF THE AD HOC MEMBERS OF THE WIPO COORDINATION COMMITTEE; ELECTION OF THE MEMBERS OF THE BUDGET COMMITTEE; ELECTION OF THE MEMBERS OF THE PREMISES COMMITTEE Item 25: DESIGNATION OF THE MEMBERS OF THE WORKING GROUP OF THE PERMANENT COMMITTEE FOR DEVELOPMENT COOPERATION RELATED TO INDUSTRIAL PROPERTY (PC/IP) (and WO/CF/XIV/3) Item 26: DESIGNATION OF THE MEMBERS OF THE WORKING GROUP OF THE PERMANENT COMMITTEE FOR DEVELOPMENT COOPERATION RELATED TO COPYRIGHT (PC/CR) (and WO/CF/XIV/3) Item 27: UNITED NATIONS RESOLUTIONS (and WO/GA/XXI/13) Item 28: ADMISSION OF OBSERVERS Item 29: ADOPTION OF THE GENERAL REPORT AND OF THE INDIVIDUAL REPORTS OF EACH GOVERNING BODY Item 30: CLOSING OF THE SESSIONS INDEX: INDEX OF INTERVENTIONS BY DELEGATIONS OF STATES AND REPRESENTATIVES OF INTERGOVERNMENTAL AND NON-GOVERNMENTAL ORGANIZATIONS 1. This General Report records the deliberations and decisions of the following 21 Governing Bodies: (1) WIPO General Assembly, twenty-first session (13th ordinary) (2) WIPO Conference, fourteenth session (13th ordinary) (3) WIPO Coordination Committee, thirty-ninth session (28th ordinary) (4) Paris Union Assembly, twenty-sixth session (13th ordinary) (5) Paris Union Conference of Representatives, twenty-third session (13th ordinary) (6) Paris Union Executive Committee, thirty-third session (33rd ordinary) (7) Berne Union Assembly, twenty-second session (13th ordinary) (8) Berne Union Conference of Representatives, sixteenth session (13th ordinary) (9) Berne Union Executive Committee, thirty-ninth session (28th ordinary) (10) Madrid Union Assembly, twenty-eighth session (12th ordinary) (11) Hague Union Assembly, fifteenth session (11th ordinary) (12) Hague Union Conference of Representatives, fifteenth session (11th ordinary) (13) Nice Union Assembly, fifteenth session (13th ordinary) (14) Nice Union Conference of Representatives, fourteenth session (13th ordinary) (15) Lisbon Union Assembly, twelfth session (12th ordinary) (16) Lisbon Union Council, nineteenth session (19th ordinary) (17) Locarno Union Assembly, fifteenth session (12th ordinary) (18) IPC [International Patent Classification] Union Assembly, fourteenth session (11th ordinary) (20) Budapest Union Assembly, twelfth session (9th ordinary) (21) Vienna Union Assembly, eighth session (7th ordinary) meeting in Geneva from September 22 to October 1, 1997, with the exception of part of the PCT Union Assembly which started its session on September 16, where the deliberations took place and the decisions were made in joint meetings of two or more of the said Governing Bodies (hereinafter referred to as "the joint meeting(s)" and "the Governing Bodies," respectively). 2. In addition to this General Report, separate reports have been drawn up on the sessions of each of the Governing Bodies (see documents WO/GA/XXI/13, WO/CF/XIV/3, WO/CC/XXXIX/5, P/A/XXVI/1, P/CR/XXIII/1, P/EC/XXXIII/1, B/A/XXII/1, B/CR/XVI/1, B/EC/XXXIX/1, MM/A/XXVIII/3, H/A/XV/3, H/CR/XV/1, N/A/XV/2, N/CR/XIV/1, LI/A/XII/1, LI/C/XIX/1, LO/A/XV/1, IPC/A/XIV/1, PCT/A/XXIV/10, BP/A/XII/1 and VA/A/VIII/1). 3. The list of the States members of the Governing Bodies and the observers admitted to their sessions as of September 19, 1997, is set forth in document AB/XXXI/INF/1 Rev.2. 4. The meetings dealing with the following items of the Agenda (document AB/XXXI/1 Prov.2) were presided over by the following Chairmen: Items 1, 2 and 3: Mr. Moses F. Ekpo (Nigeria), outgoing Chairman of the WIPO General Assembly Items 4, 5, 6, 7, 8, 9, Ms. Sheila Batchelor (Canada), Chairperson of the 15, 16, 17, 21, 23, 24, WIPO General Assembly 27 and 28: Items 22, 25 and 26: Mr. André Roch Palenfo (Burkina Faso), Chairman of the WIPO Conference Items 18, 19 and 20: Ms. Lilia R. Bautista (Philippines), Chairperson of the WIPO Coordination Committee Item 10: Mr. Bruce Ian Murray (Australia), Chairman of the PCT Union Assembly Item 11: Mr. Li-Feng Schrock (Germany), Chairman of the Madrid Union Assembly Item 12: Mr. Jan Nicaise (Netherlands), Chairman of the Hague Union Assembly Items 13 and 14: Mrs. América Néstar Santos Riveras (Cuba), Vice-Chairperson of the Nice Union Assembly Item 29: The Chairman (or, in his absence, a Vice-Chairman, or, in the absence of the Chairman and both Vice-Chairmen, an ad hoc Chairman) of one of the 21 Governing Bodies concerned, that is, for the General Report, the Report of the WIPO General Assembly, Ms. Sheila Batchelor (Canada); the Report of the WIPO Conference, Ms. Sheila Batchelor (Canada); the Report of the WIPO Coordination Committee, Ms. Lilia R. Bautista (Philippines); the Reports of the Paris Union Assembly and Conference of Representatives, Mr. Victor Rodríguez Cedeño (Venezuela); the Reports of the Paris Union and Berne Union Executive Committees, the Berne Union Assembly and Conference of Representatives, Mr. Gao Lulin (China); the Report of the Madrid Union Assembly, Mr. Li-Feng Schrock (Germany); the Report of the Hague Union Assembly, Mr. Alexandru Cristian Strenc (Romania); the Report of the Hague Union Conference of Representatives, Mrs. Odile Roullet (Holy See); the Reports of the Nice Union Assembly and Conference of Representatives, Lisbon Union Assembly and Council and Vienna Union Assembly, Mrs. América Néstar Santos Riveras (Cuba); the Report of the Locarno Union Assembly, Mr. Gorgi Filipov (the Former Yugoslav Republic of Macedonia); the Report of the IPC Union Assembly, Mr. Martti Jaakko Juhani Enäjärvi (Finland); the report of the PCT Union Assembly, Mr. Roland Grossenbacher (Switzerland); the Report of the Budapest Union Assembly, Mr. Valeriy I. Petrov (Ukraine) Item 30: Ms. Sheila Batchelor (Canada), Chair of the WIPO General Assembly. 5. An index of interventions by delegations of States and representatives of intergovernmental organizations and non-governmental organizations mentioned in this report will be reproduced as an Annex to the final version of the present report. The list of participants, including those who attended the PCT Union Assembly from September 16 to 19, 1997, will appear in document AB/XXXI/INF/3. ITEM 1 OF THE CONSOLIDATED AGENDA: OPENING OF THE SESSIONS 6. The thirty-first series of meetings of the Governing Bodies of WIPO and of the Unions administered by WIPO was convened by the Director General of WIPO, Dr. Arpad Bogsch (hereinafter referred to as "the Director General"). 7. The sessions of the Governing Bodies were opened in a joint meeting of all the 21 Governing Bodies, except the Assembly of the PCT Union (whose session opened on September 16, 1997), by the outgoing Chairman of the WIPO General Assembly, Mr. Moses F. Ekpo (Nigeria). ITEM 2 OF THE CONSOLIDATED AGENDA: ADOPTION OF THE AGENDAS 8. The outgoing Chairman stated that following consultations between the various Groups, it had been unanimously decided that the two matters to be dealt with in addition to the agenda items listed on page 3 of document AB/XXXI/1 Prov.2, namely the proposal by the United Kingdom concerning the term of office of Directors General for WIPO, which had been circulated by the International Bureau, and the proposal by Ghana regarding the issue of folklore, be dealt with later during the meetings. He suggested that the United Kingdom's proposal be considered between agenda items 18 and 20, and the Ghanaian proposal in conjunction with agenda items which involve copyright issues. 9. Taking into consideration the above statement, each of the Governing Bodies, including the Assembly of the PCT Union (whose session opened on September 16, 1997), adopted its agenda as proposed in document AB/XXXI/1 Prov.2 (hereinafter referred to in this document and in the documents listed in paragraph 2, above, as the "Consolidated Agenda"). ITEM 3 OF THE CONSOLIDATED AGENDA: ELECTION OF THE OFFICERS 10. The officers of the Assembly of the PCT Union were elected by that Assembly on September 16, 1997. Informal consultations among the Group Coordinators were undertaken by the outgoing Chairman of the WIPO General Assembly, Mr. Moses F. Ekpo (Nigeria), in respect of the election of the officers of the WIPO General Assembly. As a result of those consultations, the officers of the WIPO General Assembly were elected by the WIPO General Assembly on September 22, 1997. 11. The informal consultations mentioned in the previous paragraph were continued in respect of the officers of the other 19 Governing Bodies, resulting in a proposal for the election of the officers of those other 19 Governing Bodies that was presented by the newly-elected Chairperson of the WIPO General Assembly, Ms. Sheila Batchelor (Canada). On the basis of the said proposal, each of the other 19 Governing Bodies elected its officers on September 25, 1997. 12. The list of the officers elected for the 21 Governing Bodies appears in document AB/XXXI/INF/4 Rev.2. ITEM 4 OF THE CONSOLIDATED AGENDA: APPOINTMENT OF THE NEW DIRECTOR GENERAL 13. See the report of the session of the WIPO General Assembly (document WO/GA/XXI/13). ITEM 5 OF THE CONSOLIDATED AGENDA: ACTIVITIES FROM JULY 1, 1996, TO JUNE 30, 1997; INTERIM FINANCIAL STATEMENT FOR 1996; ARREARS IN CONTRIBUTIONS 14. Discussions were based on documents AB/XXXI/4, 5, 6, 10 and 11. 15. Noting the shortage of time, the Chairperson invited the delegations which wished to do so to file with the Secretariat written statements which would be reflected in the report as though they had been given in the plenary. The Chairperson also requested the delegations which wished to file those written statements to ensure that they did not contain anything that would require a response from another member State. 16. Following that invitation, almost all delegations filed written statements with the Secretariat. The majority of delegations took the floor to highlight the salient points of those statements. 17. The delegations of the following 86 States, eight intergovernmental and one international non-governmental organization made statements: Albania, Algeria, Argentina, Australia, Austria, Bangladesh, Belarus, Benin, Bolivia, Brazil, Bulgaria, Burkina Faso, Cameroon, Canada, Chile, China, Colombia, Costa Rica, Côte d'Ivoire, Croatia, Cuba, Czech Republic, Democratic People's Republic of Korea, Denmark, Egypt, El Salvador, Finland, Germany, Ghana, Guatemala, Guinea, Hungary, India, Indonesia, Iran (Islamic Republic of), Israel, Italy, Japan, Jordan, Kazakhstan, Kenya, Kyrgyzstan, Lesotho, Liberia, Luxembourg, Madagascar, Malawi, Malaysia, Mali, Mexico, Mongolia, Netherlands, New Zealand, Niger, Nigeria, Norway, Pakistan, Panama, Philippines, Poland, Portugal, Qatar, Republic of Korea, Romania, Senegal, Singapore, Slovakia, South Africa, Spain, Sri Lanka, Sudan, Sweden, Switzerland, The former Yugoslav Republic of Macedonia, Togo, Trinidad and Tobago, Tunisia, Turkey, Uganda, United Kingdom, United States of America, Uruguay, Uzbekistan, Venezuela, Viet Nam, Yemen, African Intellectual Property Organization (OAPI), African Regional Industrial Property Organization (ARIPO), Benelux Trademark Office and Benelux Designs Office (BBM/BBDM), Commission of the European Communities (CEC), European Patent Office (EPO), Organization of African Unity (OAU), United Nations Educational, Scientific and Cultural Organization (UNESCO), World Trade Organization (WTO), European Broadcasting Union (EBU). 18. Almost all the delegations which made statements commended WIPO for the excellent quality and comprehensiveness of the documents submitted. 19. Most of the said delegations expressed their satisfaction with the scope, quality and variety of the activities undertaken by WIPO in the period under review and praised the professionalism and dedication shown by the staff of the International Bureau in that respect. Particular satisfaction was expressed for the assistance rendered by WIPO to developing countries in crucial areas such as the development of human resources, strengthening of the legal and administrative intellectual property infrastructure, computerization of intellectual property operations, promotion of inventions and innovation, and enforcement of intellectual property rights. It was noted with appreciation that WIPO had continued to give the greatest importance to activities that assisted developing countries in adapting their national legislation to the obligations established under the Agreement on Trade-Related Aspects of Intellectual Property Rights (TRIPS Agreement), and that the volume of the legal technical assistance provided by WIPO under the Agreement between WIPO and the World Trade Organization (WTO) had continued to expand. The implementation of WIPO-funded country projects was mentioned by numerous delegations as an efficient means to meet the specific needs of the developing countries in building effective systems for the protection of intellectual property, and several delegations from developing countries expressed the hope that such projects would soon be implemented also in their country. The delegations of the recipient countries, noting with satisfaction the increase of financial resources for development cooperation in the 1996-97 biennium, requested that those resources continue to increase in the 1998-99 biennium. A number of delegations of industrialized and other donor countries reiterated their readiness to continue supporting WIPO's development cooperation program, with funds and in kind. 20. In respect of norm-setting, most delegations commended WIPO for the adoption by the WIPO Diplomatic Conference on Certain Copyright and Neighboring Rights Questions of December 1996, of two new international instruments in the field of copyright and neighboring rights, namely the WIPO Copyright Treaty (WCT) and the WIPO Performances and Phonograms Treaty (WPPT). Several delegations announced that preparations had started in their respective country for ratification of the said treaties. Many delegations urged the early continuation of work in respect of an audiovisual protocol (to complement the WPPT in respect of the rights of performers in the audiovisual fixations of their performances) and a possible treaty for the sui generis intellectual property protection of databases (even if they do not qualify for copyright protection). 21. Many delegations noted with appreciation the convening, in the period under review, of the UNESCO-WIPO World Forum on the Protection of Folklore and supported the plan of action that had been adopted by the said Forum (the so-called "Phuket Plan of Action") as a first step towards the adoption of an international instrument for the protection of folklore. 22. Several delegations welcomed the establishment of the WIPO Working Group on Information Technologies for Intellectual Property and supported the role of WIPO as the nerve center of a global network of intellectual property offices which would make the best possible use of the new opportunities offered by information technology. 23. The Delegation of China started by mentioning that on July 1, 1997, the Government of the People's Republic of China had resumed the exercise of sovereignty over Hong Kong and thanked the Director General and the Director General elect for accepting the invitation to attend the handover ceremony in Hong Kong. The Delegation informed that, in 1996, patent applications filed with the Chinese Patent Office (CPO) had risen over 102,000, representing a 24% increase over 1995. In the first half of 1997, over 55,000 patent applications had been filed, representing an increase of 18% over the corresponding period of 1996. The Delegation recalled that, in the period under review, China had acceded to the Locarno Agreement, as of September 19, 1996, and the Strasbourg Agreement, as of June 19, 1997. In November 1996, WIPO and the CPO had jointly organized the WIPO National Seminar on the Valuation of Industrial Property Assets, the first of this kind in WIPO's history. It also informed that the China Intellectual Property Training Center would likely be completed by the end of 1997, and would be fully operational in 1998. As concerns trademarks, the Delegation stated that the Chinese Trademark Office had handled over 150,000 applications for trademark registrations, including over 7,000 requests for territorial extensions under the Madrid system. By August 31, 1997, the total number of registered trademarks in China was over 800,000. In the trademark legislation area, a new ensemble of administrative measures had been introduced in the period under review by the State Administration of Industry and Commerce (SAIC) for the protection of well-known marks in China. Also, a national trademark protection campaign had been launched, and the authorities had dealt with over 14,000 trademark infringement cases. The Chinese version of the 7th edition of the Nice Classification had been published in cooperation with WIPO. With regard to copyright, the Delegation informed the meeting on the activities undertaken by the National Copyright Administration of China during the period under review, in particular to advance work on the amendment of the Copyright Law and to intensify the fight against piracy of copyrighted works. Cooperation with WIPO had continued through, inter alia, the organization in September 1996 of a WIPO National Seminar on Copyright Enforcement in Chengdu. Regarding protection of new varieties of plants, new provisions had been adopted in March 1997, in compliance with the 1978 version of the UPOV Convention, and the Delegation stated that it was expected that China would become a member of UPOV by the end of 1997. The Delegation stated that the People's Republic of China notified to WIPO the application to the Hong Kong Special Administrative Region (SAR) of China, with effect from July 1, 1997, of the Berne, the Paris, the Phonograms and the WIPO Conventions, and the Patent Cooperation Treaty (PCT). The representative of the Hong Kong SAR of China took the floor as part of the Delegation of China to inform on the main features of the protection of intellectual protection in the Hong Kong SAR of China. In this context, it was stressed that the Government of the Hong Kong SAR of China, in accordance with the Basic Law of Hong Kong SAR, formulated its own domestic policies, laws and administrative arrangements to protect patents for inventions, trademarks and other industrial property, as well as the creative works of artists. These arrangements had been set out in the intellectual property laws of the Hong Kong SAR of China. Independent trademarks, designs and patent registries were operated, and within the Hong Kong SAR of China the authorities concerned decided on matters relating to the grant, administration or litigation of patents. It was stated that the Hong Kong SAR of China had been a founding member of the WTO and that its laws met the standards set out in the TRIPS Agreement well in advance of the deadline established for developing economies. 24. The Delegation of Ghana expressed its appreciation for the assistance received from WIPO in the intellectual property field, particularly regarding modernization of national infrastructure, development of human resources and bringing national legislation in line with relevant international legal instruments. In this context, the Delegation mentioned the National Seminar on Copyright and Neighboring Rights for Law Enforcement Agencies which had been organized in Accra in May 1997 in cooperation with WIPO. The Delegation stressed that during the period under review Ghana had acceded to the PCT and expressed the hope that WIPO would organize in the near future a national workshop on the PCT in Ghana. The Delegation recalled that, following the December 1996 Diplomatic Conference, Ghana had signed the WCT and the WPPT in May 1997, and in that context it hoped that progress may soon be made in respect of the protection of rights of performances in audiovisual works. The Delegation stated that it attached the greatest importance to the protection of expressions and works of folklore, and to that end had requested that the Plan of Action adopted by the World Forum on the Protection of Folklore organized by WIPO and UNESCO in Phuket (Thailand) be discussed by the present session of the Governing Bodies to pave the way for the eventual establishment of an appropriate international legal instrument for the protection of folklore. As regards human resource development and the crucial importance that the Director General elect had attached to it in his acceptance speech, the Delegation expressed the wish that further training programs and long-term fellowships in intellectual property be made available to Ghanaian officials. On the other hand, it added that Ghanaian nationals would always be available to contribute to WIPO programs and seminars as resource persons and that, in the same spirit of South-South cooperation, Ghana was willing to share with other developing countries its experience in the fight against piracy in the music industry. In the latter respect, the Delegation expressed the hope that the proposed African Regional Seminar on the "Banderole System" would take place in Accra in due course. 25. The Delegation of Uruguay stated that in the reporting period, the process of modernization of the industrial property system had continued in various areas. As concerns normative activities, it announced that a draft law on distinctive signs meeting current international standards had been submitted to Parliament and a draft law on patents, industrial designs and utility models was being finalized. As regards the modernization of the national administrative infrastructure, it stated that progress had been particularly made in respect of reducing backlogs in the processing of applications for trademark registrations, streamlining administrative procedures, improving services to users and communication with industrial property agents. As regards cooperation with WIPO, the Delegation informed that two technical cooperation projects had continued to be executed to consolidate the above-mentioned modernization process. The Delegation expressed the wish that WIPO finance the participation of government officials to events such as the Symposium on the Protection of Geographical Indications in the Worldwide Context to be held in Eger (Hungary) in October 1997, and the meetings of the WIPO Committee of Experts on Well-Known Marks. Concerning accession to treaties administered by WIPO, the Delegation announced that the industrial property office had recommended to the Government accession to the Locarno, Nice, Strasbourg and Vienna Agreements, as well as to the PCT and the Budapest Treaty. The Delegation also stated that, as of April 1997, Uruguay had become a member of the WIPO Permanent Committee on Industrial Property Information (PCIPI) and its Executive Committee. As regards technological information, the Delegation stated that it attached particular importance to the CD-ROM project DOPALES PRIMERAS as an effective means to disseminate technological information contained in patent documents of Latin American countries. It also stated that cooperation with the other countries of the Common Market of the Southern Cone (MERCOSUR) had been intensified and in April 1997 a Technical Cooperation Agreement had been signed by the four MERCOSUR countries. Concerning copyright and neighboring rights, the Delegation emphasized the assistance received from WIPO in the elaboration of a new draft law which was now before Parliament for consideration. It also stressed that its country would host, in October and November 1997, three WIPO regional events, namely, the WIPO-SGAE Course on Copyright and Neighboring Rights, the third Ibero-American Congress entitled "One Hundred and Ten Years of International Protection of Copyright: Berne 1886 - Geneva 1996" and the Fourth Meeting of Heads of Copyright Offices from Ibero-American Countries. The Government of Uruguay was particularly pleased that Dr. Bogsch had accepted the invitation to attend the said Ibero-American Congress at the end of his tenure as WIPO Director General. Finally, it supported the inclusion in the next program and budget of the creation of a committee of experts on the rights of broadcasting organizations. 26. The Delegation of Sweden reaffirmed its commitment to the development cooperation activities of WIPO to which it intended to continue to contribute, inter alia, through the organization and financing of the two training courses on industrial property and on copyright held each year in Stockholm, and stated that its country would be receptive to raising funds for further such activities as proposed by WIPO. As regards the PCT, it stated that the Swedish Patent and Registration Office had been an International Searching Authority and an International Preliminary Examination Authority since the start of the PCT in 1978, and another 10-year agreement with WIPO would be signed by its Government in this respect during the current meeting. In 1996, 3,791 international applications had been received by the Swedish Office as an International Searching Authority, placing it as the third biggest office in the world with respect to the number of requests for international searches. The same was true as regards the volume of requests for preliminary examination of international patent applications. Concerning information technology, the Delegation stressed the need for uniform solutions for its application to intellectual property. It referred to the WIPO Working Group on Information Technologies for Intellectual Property convened by WIPO and stressed its support of the conclusions and recommendations adopted by its first session in July 1997. With respect to copyright and neighboring rights, the Delegation congratulated the International Bureau on the excellent organization of the Diplomatic Conference that had taken place in December 1996, and had resulted in the adoption of two treaties of great importance for the development of international standards for copyright and neighboring rights in the age of information technology. Those treaties showed the key role played by WIPO in norm-setting in that field, which Sweden would like to see continue in the future. The Delegation also wished to congratulate the International Bureau on its excellently structured and implemented development cooperation program in the copyright field to which its country attached great importance. It appreciated the large and evenly-distributed geographical spread of those activities as well as the extensive coverage given to the TRIPS Agreement and the willingness of the International Bureau to cooperate with the private sector and non-governmental organizations. The Delegation also expressed satisfaction with the progress made in the protection of performers in audiovisual productions and of databases, and looked forward to meetings of committees of experts to further elaborate various aspects of such protection. The Delegation noted that other aspects of copyright and neighboring rights, such as the protection of broadcasters and folklore, deserved consideration and hoped to be able to comment on those at a later stage in the discussion. 27. The Delegation of Finland underlined the significance of the development cooperation work done by WIPO and reiterated its willingness to continue supporting it in the future. As regards norm-setting activities, the Delegation reaffirmed its commitment to enhancing and harmonizing the international protection and enforcement of intellectual property rights, and in particular with respect to the proposed Patent Law Treaty. It supported efforts to harmonize requirements as to the form of patents but hoped that harmonization would also be extended to questions of substance. It hoped that work in respect of the settlement of disputes between States would be continued with further consultations and that a diplomatic conference be organized on the issue in 1999. It added that it was also important to continue working on the Internet domain names issue. In the trademark area, the Delegation highlighted the need for more effective protection for so-called non-profitable marks and corporate identifiers as well as their international regulation. With respect to registration activities, the Delegation noted with satisfaction the continued growth in PCT applications. The reduction in the basic and designation fees would benefit the users of the PCT system and further increase the popularity of the system in Finland. In the first half of 1997, the Patents Act had been amended to switch from a pre-grant to a post-grant opposition system. With the coming into force of the European Union Regulation on the grant of supplementary protection certificates for plant products, it was now possible to issue supplementary protection certificates, besides medicinal products, also to plant protection products in Finland. The Innovative Finland campaign continued in 1997, the jubilee year for the 80th anniversary of Finnish independence. The theme of the 1997 competition was "Innovations and the Lifespan of Man." In the field of copyright and neighboring rights, the Delegation expressed its satisfaction with the cooperation of all member States before and during the Diplomatic Conference, and with the two treaties that had resulted from that extraordinary effort. Two questions had been left unresolved by the said Diplomatic Conference, namely, the protection of audiovisual performances and of databases and further work on them had been made the previous weeks. In this respect, the Delegation was of the view that the Governing Bodies of WIPO should make the necessary decisions on the continuation of the work, preferably at their March 1998 meetings, in the context of the new program and budget. To conclude, the Delegation said that two other matters deserved consideration in the future, the protection of folklore and of broadcasting organizations, and that the Delegation was ready to give its active contribution to the work on these matters. 28. The Delegation of Hungary informed that, on the domestic level, a new law on the protection of trademarks and geographical indications had entered into force on July 1, 1997, in full compliance with the relevant European Communities Directive, and the provisions of the Trademark Law Treaty (TLT) and the TRIPS Agreement. The Delegation noted that Hungary had deposited its instrument of ratification to the Protocol Relating to the Madrid Agreement Concerning the International Registration of Marks (Madrid Protocol), which would enter into force with respect to Hungary on October 3, 1997, and that the TLT would also soon be ratified. The Delegation further stated that Hungary had filed a request at the Administrative Council of the EPO for accession to the European Patent Convention. The Delegation was pleased with the decision of the Administrative Council to grant observer status to its country at its future meetings. With regard to norm-setting activities in the field of by the fulfillment of international contractual obligations and by harmonization with the law of the European Union (EU). The latest achievements in this respect included new rules on the collective administration of copyright, as well as more effective civil law means of enforcement and new border measures in conformity with the TRIPS Agreement. 29. The Delegation of India referred to the problems faced by its country in the field of intellectual property, inter alia, problems relating to the infrastructure for intellectual property rights administration, lack of a well-developed collective administration system in copyright and neighboring rights matters, neglect of intellectual property right studies by academics and absence of a group of articulate and well-informed intellectual property right professionals, as already described in its statement under agenda item 4, and acknowledged once again the generous support received from WIPO in this respect. The Delegation expressed its support of WIPO's proposed study on biotechnical inventions which would also examine the relationship between intellectual property rights and issues on traditional knowledge and genetic resources. It added that the success of the programs depended on the coordination between national governments and international organizations, and commended WIPO's sensitivity to the views of those governments and also its practice of conducting programs with and through national governments. With regard to industrial property, the Delegation stated that its country recognized that an effective system of industrial property protection was essential for the promotion of inventive activity, trade and the transfer of technology, and that those factors had been fully integrated into the process of economic reforms which had been launched by the country as of 1991. The Delegation also stated that national industrial property legislation had started to be reviewed to bring it into line with the TRIPS Agreement and new legislation was being developed in respect of geographical indications, layout designs of integrated circuits, trade secrets and plant variety protection. It added that the number of applications for patents and trademark registration had increased steadily during the reporting period as an indicator of the increasing level of scientific, technological and trade activity in the country. The Delegation also informed that following the successful conclusion, in 1996, of two technical cooperation projects funded by UNDP and executed by WIPO to modernize the patent information system (PIS) and the trademark system, a new project was being designed to further modernize the national patent office, with focus on computerization of administrative procedures, staff training, reduction of patent applications backlog, online linkages with domestic and international databases and the creation of a full-text database of Indian patents. It also mentioned that expertise was planned to be developed in emerging areas of technology such as biotechnology, microbiology and integrated circuits. Finally, the Delegation announced that an Institute for Intellectual Property Development had been recently established and would host, in October 1997, in New Delhi, in cooperation with WIPO, an Asian Subregional Symposium of the Implications of the TRIPS Agreement. With respect to development cooperation activities, the Delegation hoped that the delivery cost of programs would be kept at the minimum and was confident that such issues would be kept in mind by the Director General elect in an effort to bridge the gap between the developed and the developing worlds. 30. The Delegation of Chile commended WIPO on the scope and variety of its work in the area of development cooperation. In respect of normative activities, the Delegation stressed the importance of protection of folklore, mentioned the UNESCO-WIPO World Forum on the Protection of Folklore held in April 1997, and supported the proposal to convene a committee of experts on the matter. It also supported the convocation of a committee of experts on the rights of broadcasting organizations. With respect to WIPO development cooperation activities in general, the Delegation reiterated the need to establish evaluation criteria which would enable one to define the impact and follow-up of those activities, and stated that, although very factual, the activities report submitted by WIPO did not always enable one to evaluate the outcome of the said activities. The Delegation stated that development cooperation should continue to be a priority for WIPO and endorsed the increase in funding for this area, particularly to assist developing countries in complying with obligations under the TRIPS Agreement. It added that such cooperation should be national and regional in focus, to reflect the specific needs of countries and regions in question. It requested that a new draft program and budget for 1998-99 should be presented by the new Director General. Furthermore, it endorsed the proposal that the level of contributions should remain the same as in 1996-97. Concerning premises for WIPO, it supported the position that no decisions should be taken before the new Director General took up his functions. Regarding information technology, it fully supported the establishment of a modern network for the exchange of information among all intellectual property offices and hoped that the new Director General would allocate to this priority area the necessary resources. In respect of the proposed Treaty for the Settlement of Intellectual Property Disputes Between States, the Delegation stated its general support and said that, based on the information provided on the subject by the CEC in August 1997, it endorsed the proposal of a new round of consultations to possibly lead to the convening of a diplomatic conference in 1999. 31. The Delegation of Israel expressed its appreciation to the Director General and the International Bureau for the excellent work and reports prepared for this session of the Governing Bodies. It informed the meeting that, following the entry into force of the PCT in Israel on June 1, 1996, a total of 427 international applications had been filed at the Israel Patent Office as of May 31, 1997, and Israel was now 14th in the list of PCT members in terms of PCT applications processed by the Office. The Delegation expressed its gratitude to WIPO for the visit to Israel of two WIPO senior PCT officers and a national PCT seminar which had been successfully organized by WIPO for over 100 practitioners and for the PCT training provided in Geneva to Israeli officials. As concerns the WIPO training program for developing countries, in 1996, the Office had trained two developing country officials and would receive another two in 1997. As regards domestic legislation, the Delegation reported that good progress had been made by Israel's law revision committees in the areas of copyright, patents, trademarks, integrated circuits and semi-conductor chips. All statutory enactments, where relevant, would take into account the provisions of the TRIPS Agreement. 32. The Delegation of Colombia expressed its gratitude to WIPO for the support received during the period under review, particularly through training activities related to different aspects of copyright and neighboring rights, especially with regard to activities related to reprography. It cited the organization of a Book Fair in Colombia in 1997, as an example of successful cooperation with WIPO, noting that the first-time presence of a WIPO stand at the 1997 Fair had gone far to demonstrate the importance of the Organization's role in promoting awareness of copyright and neighboring rights in Latin America. The Delegation hoped that WIPO's support would continue, especially in the dissemination of information on copyright to children and young people, and in the fight against piracy of copyrighted works. Awareness-building was also a key point in this respect. The Delegation requested WIPO to keep supporting the work of Colombian universities, in particular by financing the missions of foreign teachers. 33. The Delegation of Pakistan expressed its country's appreciation of WIPO's contribution to the strengthening of its intellectual property institutions and laws and looked forward to an intensification of that cooperation, especially within the framework of the WIPO country projects that had been referred to by the Director General elect. With respect to WIPO's activities, the Delegation mentioned that, from a developing country perspective, consensus-building for initiatives in norm-setting was an area that needed strengthening. In its opinion, a limited legal approach was insufficient when work was initiated on strengthening existing norms or introducing new ones. Rather, WIPO should seek to provide information and analyses regarding the broader economic and developmental implications of new normative initiatives. Such an approach would help all WIPO member States to construct national regimes that would have the greatest positive effect on development. It would also result in the adoption of international legal instruments that member States would ratify rapidly. 34. The Delegation of Madagascar declared itself pleased with the present collaboration with WIPO, which had to do with the fields of staff training, modernization of the Malagasy Industrial Property Office (OMAPI) and the updating of national legislation in line with the TRIPS Agreement. The Delegation mentioned the activities that had been discussed with the Government recently in the course of the WIPO mission to Madagascar, and in particular the holding of a national seminar in November 1997, the awareness campaign for the benefit of intellectual property operatives in the provinces, the organization of training activities in 1998, the preparation of a project for the modernization of OMAPI, the preparatory work on certain law and treaty texts to be submitted to Parliament for ratification, the forthcoming creation of a National Association for the Promotion of Inventions and the continuing supply of computer hardware intended for OMAPI. The Delegation finally expressed the wish that the cooperation with WIPO and the latter's assistance might be further increased in the future and also extended to other areas. 35. The Delegation of the former Yugoslav Republic of Macedonia noted the intensification of its country's activities in the promotion and protection of intellectual property which had resulted, inter alia, in the country's ratification of the Agreement on the Extension of the European Patent. Its country had started to benefit from the RIPP program, which was part of the European Union's PHARE program, and two seminars on European patent law and trademarks, respectively, had been organized within its framework. As regards multilateral agreements in the field of intellectual property, The former Yugoslav Republic of Macedonia had, during the reporting period, ratified the European Convention Relating to the Formalities Required for Patent Applications, the Convention on the Unification of Certain Points of Substantive Law on Patents for Invention, the Hague Agreement, the International Convention for the Protection of Performers, Producers of Phonograms and Broadcasting Organisations (Rome Convention) and the Convention for the Protection of Producers of Phonograms Against Unauthorized Duplication of Their Phonograms (Phonograms Convention). Turning to the WIPO World Symposium on Broadcasting, New Communication Technologies and Intellectual Property, held in Manila in April 1997, the Delegation expressed its country's support for the proposal that funds be included in the budget for the next biennium sufficient to enable the recommendations of that Symposium to be realized. With regard to technical cooperation, it underlined the ongoing cooperation with the national industrial property offices of Croatia, Hungary and Slovenia and expressed its gratitude for the assistance received from the EPO, the United States Patent and Trademark Office (USPTO), the Hungarian Bureau for the Protection of Authors' Rights and the German Patent Office. As concerns domestic legislation, it noted that revised Regulations for the Recognition of Patent and Industrial Designs Rights had been adopted and amendments to the Law on Topographies of Integrated Circuits were before Parliament. The ongoing modernization of the national Industrial Property Protection Office had contributed to an increase in the number of industrial property titles granted by that Office. Inventors from countries in transition had an important contribution to make, and the Grand Prix at the World Invention Exhibition "Brussels EUREKA '96" had been awarded to a Macedonian inventor. With respect to copyright and neighboring rights, the Ministry of Culture had established a special unit to oversee the implementation of legislation in that area and improve coordination with, inter alia, judicial and customs authorities. 36. The Delegation of Senegal highlighted the cooperation activities that had benefited its Government in the course of the period under review, especially the seminar organized by WIPO in March 1997 for more than 150 people on the protection of intellectual property and more specifically on procedure and sanctions for intellectual property offenses. In the field of industrial property, the Delegation mentioned that a number of Senegalese nationals had taken part in training sessions organized at the regional level by WIPO. It also described briefly the national project devised by WIPO for the supply of computer hardware, the training of officials and teaching staff in the field of intellectual property and inventor support, among other things. The Delegation mentioned that in December 1997 Senegal would be acting as host to the first African Invention and Technological Innovation Fair, an event organized by OAPI in cooperation with the Senegalese Government and with WIPO assistance. With regard to normative activity, the Delegation of Senegal expressed pleasure at the adoption in December 1996 of the WCT and the WPPT. As for the matter of the adoption of a treaty on the settlement of disputes in the field of intellectual property, the Delegation emphasized the need for additional study in order that all the legal implications and possible relations with WTO machinery might be covered. The Delegation of Senegal underlined its great interest in the protection of expressions of folklore, and announced its full support for the Phuket Plan of Action. Recalling that the position of performers in relation to audiovisual performances had not been reconsidered since 1961, and that in the meantime new technology had made new forms of use available, it pointed out that the distinction between sound performances and audiovisual performances was of no interest to the owners of rights. 37. The Delegation of Egypt expressed its gratitude for the activities that WIPO had undertaken for Arab countries in the period under review, which had included a number of national and regional seminars held in Cairo in the areas of the implications of the TRIPS Agreement for developing countries, the teaching of intellectual property laws, and trademark administration. As certain intellectual property issues were rather new to some Arab countries, the continuation of such support was vital, especially in the areas of training, modernization of national intellectual property offices and the drafting of national legislation. Such activities, by contributing to strengthening intellectual property protection in Arab countries would help speed up social, cultural and economic development by creating an environment attractive to investment and foreign capital and the transfer of modern technology. Egypt supported increasing the funds for development cooperation allocated in the budget for the next biennium. Such an increase in resources was especially important at a time when developing countries were in the process of fulfilling their obligations under the provisions of the TRIPS Agreement. In that respect, the area of enforcement was of particular importance for which Egypt had requested the organization of a seminar in Cairo. Other areas that would benefit from additional funding included development of human resources, modernization of national offices and the provision of new technologies to enable developing countries to deal with the increasing number of patent and trademark registrations. The Delegation suggested that the establishment of a "follow-up" system with respect to technical cooperation would help to maximize results. 38. The Delegation of the Philippines expressed its satisfaction at the intensification of WIPO's activities in development cooperation, norm-setting and international registration areas. The fact that the Organization's budget for development cooperation for the current biennium had doubled was of particular importance, and it was to be hoped that a significant portion of the budget for the next biennium would be earmarked for such cooperation, especially in the light of the Director General elect's reference to its importance as a means of tempering the disadvantageous effects of rapid technological change in developing countries. With respect to norm-setting activities, the Delegation stated that the WIPO World Symposium on Broadcasting, New Communication Technologies and Intellectual Property held, in 1997, in Manila, and at which the President of the Philippines delivered a keynote speech, was illustrative of the country's commitment in that area. Regarding the protection of the rights of broadcasting organizations, its Government supported the convening, by WIPO, of a committee of experts, with the object of achieving international harmonization, and hoped to see the necessary resources for such an initiative reflected in the budget for the next biennium. Finally, the Delegation stated that its Government looked forward to the proposals of the Director General elect for the said budget that would allow the Organization to continue to adapt to changing circumstances. 39. The Delegation of Malaysia expressed its gratitude to WIPO for the assistance received in the past year, particularly with respect to the development of human resources and the modernization of the national intellectual property administration. It also thanked the EPO, the Japanese Patent Office and the Swiss Federal Institute of Intellectual Property for the training of Malaysian officials in various areas, and expressed its appreciation for the training and advisory missions from which Malaysia had benefited under the WIPO-Japan funds-in-trust arrangement. The Delegation also thanked WIPO for its assistance in respect of the computerization of the national patent and trademark systems. That computerization was due to be completed in November 1997, and included the installation of a computerized search system for figurative marks, which Malaysia would be the first country in the world to receive from WIPO. Also Malaysia would be the first non-European country to use the so-called "common software" for the administration and management of patent and trademark applications developed by the EPO. 40. The Delegation of Mexico expressed its gratitude for the assistance it had received from WIPO during the period under consideration. It reiterated its country's interest that in the future, specific national, regional and international programs be developed that correspond to a global strategy. WIPO was called upon to make additional efforts in the modernizing and consolidating of national intellectual property systems enabling developing countries to make the best use of the benefits offered by intellectual property in the context of globalization. The Delegation expressed its strong support for the continuation of the norm-setting activities exclusively under the umbrella of this Organization and for the early adoption of new international provisions for the protection of performers in audiovisual works, of databases, folklore in the widest definition of the concept, and broadcasting organizations, and informed the other Delegations that a law providing protection for all these matters had been adopted by Mexico in December 1996. Noting that the second point for consideration under item 5 was the interim financial statement for 1996, the Delegation noted the information provided by WIPO in that report and stated that it considered it appropriate that the outgoing Director General should submit before December 1, 1997, an advanced performance report of activities and a general financial statement for 1996-97 of the Organization. Finally, the Delegation noted the content of the document on arrears in contributions. 41. The Delegation of Venezuela expressed its gratitude for the assistance received from WIPO for the continued modernization of its intellectual property system. It mentioned that its Government had requested the Secretariat of the Andean Community to start negotiations among Andean countries to amend Decision 344 of the Commission of the Cartagena Agreement. It added that a draft industrial property law had been submitted to Parliament to complement Andean legislation on matters of enforcement, and that the Parliament was also considering a draft law to reform the customs system, with a specific chapter on enforcement of intellectual property rights. It also stated that, in March 1997, a new autonomous service of intellectual property had been established under the Ministry of Commerce to cover both industrial property and copyright matters. The Delegation further expressed its gratitude for the support received from WIPO in respect of the postgraduate program in intellectual property conducted by the University de Los Andes, the first of its kind in Latin America. It also stressed the creation of a special antipiracy unit under an agreement between the national copyright authority and the judiciary police of Venezuela. Finally, it supported the proposal of the Delegation of Uruguay to continue the project for the production of the DOPALES PRIMERAS CD-ROM. 42. The Delegation of Denmark noted with appreciation the work carried out by WIPO in respect of norm-setting activities (particularly in respect of the proposed Patent Law Treaty), issues concerning the Internet and domain names, and within the framework of the WIPO-WTO Agreement. As concerns the Danish Patent Office, the Delegation mentioned that it was undergoing a major process of modernization, taking full advantage of the new opportunities offered by information technology to better meet users' needs. In that context, legislative amendments were being prepared by the Government in different areas to make it possible for the Office to receive applications electronically, and a bill would be introduced and, it was hoped, adopted next fall. The Delegation also expressed its satisfaction with the fact that WIPO also focused on the use of information technology, stated that it would follow its work for establishing a global network with interest, and referred to the proposals contained on the subject in the European Commission's Green Paper on the Community Patent and the Patent System in Europe, as well as to the resolution that the World Congress of the International Federation of Industrial Property Attorneys (FICPI), held in early September in Copenhagen, had adopted regarding the exploitation of the new electronic possibilities for decentralizing patent operations. The Delegation recommended that these possibilities be further analyzed. 43. The Delegation of Bangladesh expressed its appreciation for the support given by WIPO in improving human resources, developing the infrastructure and in the drafting and revision of its legislation. It confirmed that it had made considerable efforts to promote awareness of intellectual property rights and comply with its obligations under the TRIPS Agreement. It informed that its Government was considering accession to the Berne Convention and that it was prepared to host a regional seminar on copyright in 1998, with the assistance of WIPO. The Delegation requested that least developed countries be targeted for additional assistance, and that WIPO prepare a special program that would provide for human resource development, infrastructure building, the drafting and revision of legislation, the heightening of public awareness about intellectual property rights, and the creation of societies and organizations to effectively protect such rights. It stressed the importance of building a good technological base, and requested the new Director General to devise ways and means to encourage developed countries to transfer technology to the least developed countries under WIPO's development cooperation program. Finally, the Delegation requested that WIPO organize a session of the WIPO Academy on Intellectual Property for officials of least developed countries. 44. The Delegation of Cuba expressed its appreciation to WIPO for the cooperation received during the reporting period. It stated that, as regards industrial property, Cuba had acceded to the PCT (a national PCT seminar had been held with WIPO's assistance) and was considering accession to the Hague and Locarno Agreements. A draft law on marks and distinctive signs was under examination. The Delegation supported the statement by the Delegation of Uruguay on the importance of continuing the project for the production of the DOPALES PRIMERAS CD-ROM. It added that Cuban inventors had been awarded medals in both the Brussels and Geneva Convention fairs, a graduate program on industrial property was being established in coordination with the University of Alicante (Spain), and several national workshops had been organized, including for the judiciary, industrial property attorneys and enforcement officials. Also, a CD-ROM on inventions by Cuban women had been issued and the Cuban Industrial Property Office had established, as of July 1997, its homepage on the Internet. On the international level, the Delegation stressed that its country attached the greatest importance to the conclusion of the proposed Treaty on the Settlement of Intellectual Property Disputes Between States and the proposed Patent Law Treaty. In the copyright area, it recalled that Cuba had acceded to the Berne Convention in February 1997, and was also working on the modernization of national legislation on copyright to bring it into conformity with international standards. Regarding the protection of folklore, the Delegation expressed its support of the Phuket Plan of Action and invited WIPO to convene a committee of experts on the matter. Regarding future activities, it solicited the continuation of projects for the modernization and computerization of national legislative and administrative infrastructure, the development of human resources and the provision of financial support for the participation of developing country officials in relevant WIPO meetings and committees of experts. 45. The Delegation of Nigeria expressed its satisfaction with the activities carried out by WIPO during the last two years. Regarding the forthcoming biennium, it requested WIPO's increased assistance in staff training, particularly through the attachment of police, customs and copyright inspectors to intellectual property organizations in countries where enforcement of property rights was known to be effective. The Delegation also requested WIPO to increase the number of long-term fellowships for developing country officials. Regarding institution building, the Delegation stated that an intellectual property institute was being established in Nigeria, to provide research, conference and other facilities for the development of intellectual property in the country, as well as to serve as a possible WIPO training center for the West Africa region. The Delegation stated its desire to see this initiative covered under a WIPO country project in the next biennium. In respect of the collective administration of rights of authors, it requested the increased support of WIPO to authors' societies in the music and reprography industries through further training, provision of equipment, office modernization and computerization, and the establishment of a computer network system connecting authors' societies with the police, customs and antipiracy committees. In that connection, the Delegation recommended the inclusion of a copyright component in the WIPO country project for the modernization of its Registry of Trade Marks, Patents and Designs. Finally, the Delegation expressed its full support of the Phuket Plan of Action as well as the continuation of work on the protection of performances of audiovisual works and databases. 46. After having thanked the International Bureau for the backing and assistance given to its country in the course of recent years, the Delegation of Côte d'Ivoire expressed the wish for the establishment of proper structures for the evaluation of WIPO activities which would make it possible to manage its human and financial resources better. Referring to the project for the creation of a World Intellectual Property Academy, mentioned by the Director General elect, the Delegation wished that the Academy might be a place for policy-making in the field of intellectual property cooperation. Referring to the question of folklore, the Delegation said that its country wanted the General Assembly to adopt the Plan of Action drawn up at Phuket, which should make it possible to bring about a treaty to ensure the effective protection of African folklore. Finally it expressed the wish that the audiovisual question might be taken up by the General Assembly. 47. The Delegation of the European Patent Office (EPO) recalled that from its very beginning, the EPO had implemented a technical cooperation program aiming at making available to developing countries its expertise in patent granting procedures and patent office administration. That program had been implemented in close cooperation with WIPO. In that context, it also recalled that a bilateral agreement had been signed between the EPO and WIPO in 1987, and that in 1993, the Administrative Council of the EPO had decided to reduce fees for the international search and preliminary examination of PCT applications in favor of nationals from developing countries or countries in transition. It noted that over the 20 years of its existence, EPO's technical cooperation activities, jointly implemented with WIPO, had increased steadily, and that the EPO and WIPO met each year to set up an integrated program of joint activities, including training seminars in Europe and in recipient countries, study visits, expert advisory missions, on-the-job training, provision of CD-ROM products and computer hardware, and assistance in the field of computerization. By the end of 1997, the two Organizations would have jointly organized five training seminars and more than 20 expert missions in order to assist developing countries in the modernization of their industrial property systems. It added that the EC-ASEAN Patents and Trademarks Program which had just terminated in July 1997, was a major example of WIPO-EPO cooperation for the benefit of developing countries, and the same applied to programs jointly implemented for Central and Eastern Europe. In conclusion, the Delegation expressed the hope that the EPO development cooperation program would continue to increase and that, as in the past, WIPO would jointly implement part of this program. 48. The Delegation of Kyrgyzstan recalled that it was a new independent country in Central Asia, and that it had only had a system of intellectual property protection for four years. A modern office for intellectual property protection had been set up in 1993, but in the area of copyright and neighboring rights, a number of tasks remained unsettled. Regarding national legislation, the Delegation informed that the Parliament was examining six bills on intellectual property (in the fields of patents, trademarks and copyright) and that it was hoped that they would be adopted by the end of the year. All the bills, it was stressed, complied with modern requirements, particularly the provisions of the TRIPS Agreement. The Delegation further recalled that its country had joined four WIPO-administered treaties, had signed the WCT and was preparing to join the Berne Union and certain classification treaties administered by WIPO. As regards particularly copyright and neighboring rights, it solicited WIPO's further assistance within the framework of the program and budget for the next biennium. It also expressed the wish that work continue to be made to improve the protection of well-known marks. 49. The Delegation of Yemen expressed its country's gratitude for the assistance provided by WIPO during the period under review in developing its intellectual property system, and noted that a national seminar on industrial property organized by WIPO would take place in the country in the near future. The Delegation expressed the wish that WIPO activities for Yemen in particular, and for Arab countries in general, be intensified. Such increased support would be crucial in improving the protection of intellectual property rights in Yemen and in encouraging the country's accession to international instruments in that field. The Delegation stressed the need to enhance the educational and public information role of WIPO, inter alia, through the holding of seminars and in preparing brochures explaining the benefits of adhering to various WIPO treaties. In order to encourage the participation of developing countries in international conferences, seminars and training courses, the Delegation proposed that WIPO should aim at covering the costs of travel and accommodation for at least one representative from each country. and announced that the approval required for the Regulations had been delegated to the Government. In 1996 Italy had tabled a draft legislative decree that would allow the owner of prior rights conflicting with a national trademark application or with an international registration to file opposition with the national Office. Italy had also embarked on preparatory studies for the draft legislation ratifying the Trademark Law Treaty in order that the instrument of ratification of the Treaty might be deposited at the same time as that of the Madrid Protocol. In the field of industrial designs, a law approved in December 1996 provided that they were protected either by copyright by virtue of their creation or by design registration. Moreover, a law approved in August 1997 had set the term of copyright for an industrial design at 15 years, in other words the same term as for design registration. As for copyright, the Delegation mentioned the recent amendments in Italian legislation, notably in the field of the harmonization of national provisions with EU directives on satellite broadcasting and cable distribution and on the term of protection of copyright and certain neighboring rights. The Delegation stated that Italy had been extremely pleased with the conclusion of the WCT and WPPT. Both treaties had already been signed, and their ratification was expected to occur within a very short time, subject to possible EU commitments. Italy had also noted with pleasure the resumption of the work on the conclusion of two new treaties on the protection of performers in the audiovisual field and databases. In that connection Italy said that it was willing to cooperate in order to bring the work already undertaken to a rapid and satisfactory conclusion, and expressed the wish that the dates for the forthcoming meetings of the Committees of Experts on the subject might be set at the present session of the Governing Bodies. The Delegation of Italy finally announced that the Italian Government would place an associate expert at the disposal of WIPO for a two-year period at its own expense; the expert would be integrated in the structure of the Organization in Geneva, and the move was to be looked upon as further evidence of the Italian Government's determination to cooperate with WIPO. 51. The Delegation of Algeria remarked that the activities conducted by WIPO during the period under review concentrated on three areas concerned with normative activities, the exploitation of human resources and the international registration of marks respectively. With regard to normative activities, the Delegation pointed to its Government's participation in the work that had resulted in the adoption of the WCT and WPPT in December 1996, and informed the participants that its Government was going to complete the procedure of ratification of the treaties by the end of the current year. It mentioned also that its country was following with interest the progress of the debate on audiovisual performances with a view to correcting the content of those provisions that were particularly unfavorable to performers whose performances were incorporated in audiovisual works. In that connection, its country had taken part in the work of the Committee of Experts dealing with the question, and supported the effort to deal comprehensively with matter such as the nature of the rights, their scope, the duration of protection, sanctions for the violation of rights and national treatment. In that connection also, the Delegation considered that the conclusions adopted by the Committee of Experts regarding the establishment of a calendar that would allow all States and the EEC to submit proposals on the above questions before January 15, 1998, the presentation by the International Bureau of an improved document containing the proposals made by the various States, and the convening of a second session of the Committee of Experts by June 8, 1998, at the latest, were a sufficient base on which to achieve the widest possible consensus in favor of considering the drafting of a Protocol to the WPPT. With regard to the sui generis protection of non-original databases, the Delegation recalled its country's stance at the last meeting on the subject, which was that, before an international instrument was drawn up on the sui generis protection of databases, it would be advisable to consider further the opportuneness of broadening the field of intellectual property to accommodate the protection of concepts such as the human and financial investment in databases. In this respect the Delegation reaffirmed its country's support for the opening of an internal debate in the countries concerned that would allow outstanding questions to mature before the International Bureau drew up another consolidated document in September 1988. As for the drafting of a treaty on the settlement of disputes between States in the field of intellectual property, the Delegation announced that its country was in favor of the adoption of a treaty under the auspices of WIPO, and said in that connection that it would be a good idea if WIPO were to undertake a study to identify possible links between the new dispute-settlement machinery that WIPO proposed to administer and the machinery already in operation within the WTO. The Delegation also mentioned that, like other countries, Algeria was not yet a member of the WTO, and that intellectual property disputes could not be confined to trade-related aspects alone; it observed moreover that the treaties adopted in the course of the Diplomatic Conference in December 1996 covered aspects that did not figure in the TRIPS Agreement. Finally, it said that the drafting of a treaty under the auspices of WIPO would enable the latter to remain fully competent both in the matter of norm-setting and in contentious matters. With regard to the protection of expressions of folklore, the Delegation endorsed the resolution of the Phuket World Forum that called upon WIPO to consider engaging in consultations at the regional level and advocated the appointment of a Committee of Experts. With regard to the exploitation of human resources, the Delegation noted the substantial effort made by WIPO, notably in the form of national and regional training work, and expressed the wish that a still greater effort might be made in the course of the next biennium. As for the international registration of marks, the Delegation showed increased interest in the international system for the classification of marks in that it would bring about a simplification of registration procedures. In that respect Algeria supported the proposal to reformulate the amendments to Rules 9, 18 and 20 of the Regulations under the Madrid Agreement. In conclusion, the Delegation gave its support to the International Bureau recommendation that the new Director General be given sufficient time to prepare his draft program and budget for the 1998-1999 biennium, and endorsed the proposal according to which the contributions of States for the 1998-1999 biennium should be kept at the same level as for the 1996-1997 biennium. It also subscribed to the proposal that consideration of the premises question be deferred to allow the new Director General to reconsider the whole range of the Organization's needs in that respect, and to submit appropriate solutions to the next session of the Governing Bodies. 52. The Delegation of Belarus reported that, with the support of WIPO, its country had set up a national patent system and that basic legislation was in place to provide for the protection of industrial property and copyright and neighboring rights. This included a recently adopted Utility Models Law, the Integrated Circuits Law and the Trade Names Law which were being examined by Parliament, and the preparation of two draft laws on the protection of appellations of origin, denominations of origin and protection of computer programs and databases. In addition, the introduction of one set of fees for both foreign and domestic applicants was under consideration. The Delegation also pointed out that a new Civil Code had been adopted in Belarus, and that under it everyone was guaranteed the right to own property and could use such property for private enterprise. The Delegation stressed that this legislation created new opportunities for productivity and creativity in Belarus. The Delegation emphasized that there had been a growth in applications for patents, a third of which had been submitted by independent inventors. The Delegation reported that computerizing the patent processing procedures had been started with the assistance of WIPO and the EPO. The Delegation thanked the Governments of Austria, France, Germany, Japan, the Russian Federation and the United States of America for responding to their request for information on CD-ROMs. The Delegation reported that Belarus had acceded to the Berne Convention with effect as of December 19, 1997. The Delegation also announced the intention of Belarus to accede to the Locarno, Nice and Strasbourg Agreements, whilst preparations had already advanced for accession to the Madrid Protocol. The Delegation confirmed that Belarus was one of the countries that would benefit from a study by WIPO on the consequences of countries in transition joining the WTO. The Delegation specifically requested help from WIPO for the training of senior personnel and hoped that a seminar on intellectual property rights might take place in Minsk next year. The Delegation also requested that increased financial help be given to former Soviet States with economies in transition. 53. The Delegation of the Republic of Korea expressed its satisfaction with WIPO's development cooperation activities and their contribution to the harmonization of intellectual property systems of developing and developed countries, with special emphasis on the adoption of the WCT and the WPPT, and the preparation of new international standards in the field of industrial property. The Delegation reported that the Korean Industrial Property Office (KIPO) had been appointed as an International Searching Authority and International Preliminary Examining Authority under the PCT at the 24th session of the PCT Union Assembly held the previous week, and expressed its gratitude for the support received from WIPO and the various countries involved in that respect. The Delegation noted that, in August 1996, its country had acceded to the Berne Convention. It also drew attention to the WIPO Asian Regional Seminar on the Implications of the TRIPS Agreement for Enterprises held in November 1996 at the International Intellectual Property Training Institute (IIPTI), a sub-organization of KIPO, and the WIPO International Forum on the Implications of the TRIPS Agreement for Intellectual Property Systems held in May 1997, also at IIPTI, to celebrate the 10th anniversary of the Institute. It also noted that a WIPO National Seminar on Digital Technology and the New WIPO Treaties was scheduled to take place in Seoul in October 1997. It stressed that in hosting the WIPO regional meetings, KIPO shouldered about 40% of the total costs, and that its country wished to continue to expand the role of the IIPTI as one of the leading intellectual property training institutes in the Asian-Pacific region. On the domestic front, the Delegation noted that, due to the rapid increase in industrial property applications, the reduction of the time taken for examination had become one of KIPO's priorities, and described in detail the various measures adopted by KIPO in that context, including increasing the number of examiners, improving their training, reforming the examination system and developing computer-aided search systems. It stated, in particular, that KIPO would introduce such reforms as the non-substantive examination system for utility models, as well as the electronic filing system which would permit an applicant to file an application on a floppy-disk or online with a view to reducing the examination period. It announced that the Republic of Korea planned to introduce a three-dimensional trademark system as well as a multiple classification system. With respect to industrial designs, a non-examination system for some kinds of goods that had a short life-cycle would be introduced, and a multiple application system permitting an applicant to file up to 20 designs per application was also foreseen, as well as the extension of the term of protection for design rights from 10 to 15 years. The Delegation finally mentioned that the Korean Patent Court would be established in March 1998 under the Supreme Court, and that at the same time KIPO's present Trial Board and Appellate Trial Board would be merged into the Patent Trial Tribunal within KIPO. 54. The Delegation of the United Kingdom congratulated WIPO for its organization of the Diplomatic Conference in December 1996, and said that it was grateful to have been involved in the successful negotiation of the two new treaties adopted by it. It also thanked the International Bureau and host countries for the successful forums on folklore and broadcasters rights held in 1997. Furthermore, the Delegation stressed that additional work in the area of copyright, and notably the protection of databases, had to be maintained. As regards the PCT, the Delegation emphasized that the continued increase in applications for international registration was an indication of the value of the system and that its Government was pleased to contribute to the revision of its Regulations. The Delegation noted with satisfaction the progress made toward a new patent law treaty and that it looked forward to the discussions moving swiftly toward a diplomatic conference. Concerning the Patent Office, the Delegation emphasized the latter's dedication to customer care, with special training of its staff to achieve this end, and the hope that the Office would become a member of a United Kingdom scheme for excellence in this area during 1998. It added that the good financial situation of the Patent Office had enabled it to reduce its fees significantly. Record levels of trademark applications in the United Kingdom fell by around 12 per cent when the European Community Trade Mark Office opened, but these had since recovered to reach new records once again. The Delegation reported that the Patent Office had introduced a new fast-track system that allowed applicants seeking a rapid grant of patent rights to opt for search and examination to be performed at the same time. This had proved successful and patent rights in the United Kingdom could be granted within one year of applying. Standard applicants usually received the results of examination within eight weeks of filing. The Delegation underlined the United Kingdom's commitment to information technology as a means of increasing efficiency. Some of the Patent Office's customers paid renewal fees electronically and an automated inquiry service had been introduced. The Patent Office's web site was successfully launched in May. The Delegation announced that progress had been maintained in the MIPEX (Message Based Industrial Property EXchange) project. It stated that it expected that this project would develop standards on the secure exchange of electronic information between patent offices, and between offices and applicants. It also stated that discussions in the EU had progressed, and that rules and procedures that would enable the Community Trade Mark Office to join the Madrid Protocol were underway. It noted with pleasure that a number of other delegations had, in their interventions, declared that they were about to become members of the Protocol. It stated that the Madrid system, now augmented by the Protocol, had the potential of the PCT, and urged member States to join it as soon as possible so as to provide industry with the international registration system it deserved. In addition, the Delegation stated that in the EU, discussions were underway to harmonize patent laws with regard to biotechnological inventions. In the same vein, the European Parliament was considering a final draft of a directive to harmonize design laws in member States. The Delegation stressed that the Patent Office had cooperated closely with WIPO in 1997, in particular when it hosted the ARIPO Conference in March. On the bilateral level, it reported that a cooperation agreement had been signed with the Chinese Patent Office, experts from the Patent Office had visited Pakistan to assist in the introduction of new computer systems, and another group of experts from the Patent Office had visited Malaysia as part of the EC-ASEAN program. 55. The Delegation of Mali expressed pleasure at the effort made by WIPO in connection with training, especially in the form of the holding of seminars on intellectual property subjects. In that respect the Delegation mentioned the proposed organization in Mali in November 1997 of an African regional seminar on distinctive signs. With regard to normative activity, the Delegation expressed its satisfaction with the results achieved at the last WIPO Diplomatic Conference on Copyright and Neighboring Rights. Mali was aware of the place of folklore in African culture in general and Malian culture in particular, and it endorsed the proposal made by Ghana regarding the drafting of international legal provisions for folklore protection, and gave full support to the Plan of Action promulgated by the World Forum on Folklore Protection which took place in Thailand in April 1997. On the subject of development cooperation activities, the Delegation expressed its Government's thanks to WIPO for its contribution to the promotion of intellectual property in Mali. Finally, it expressed the wish that WIPO continue and intensify its development cooperation program, and that additional financial resources be set aside for the purpose. 56. The Delegation of Benin expressed its Government's gratitude to WIPO for the constant material, technical and financial assistance given it, notably in training and awareness activities and also in the supply of equipment. The Delegation mentioned in particular the African Regional Colloquium organized by WIPO in Cotonou in April 1997 on the implications of the TRIPS Agreement. In the spirit of the recommendations that emerged from the Colloquium, the Government planned to organize a round table shortly on the subject of counterfeiting, which would be addressed to consumers, traders and industrialists and also to economic enforcement agencies, customs officials and magistrates. The Delegation likewise wanted WIPO support for the creation of a special industrial property development program for the benefit of Benin, the organization of a training seminar for industrial property trainers and the acquisition of a facsimile machine. In the field of copyright, the Delegation mentioned that WIPO assistance had been provided in several areas of activity, including the participation of national executives in seminars and training courses held abroad, the organization of a national copyright seminar in Cotonou, the sending to Benin of an expert mission for the computerization of the national copyright management organization. The Delegation pointed to the impact that the assistance had had on the authorities, which were becoming more and more conscious of the concerns of authors. As for the owners of rights, they were understanding better and better the need to have those rights protected and to defend them. With regard to the fight against piracy, Benin had organized a regional meeting of specialists involved in this important field in February 1997. Among the resolutions adopted, the Delegation mentioned the establishment in each participating country of a national action committee against piracy. The Delegation also drew WIPO's attention to the copyright field, so that it might face up to the new challenges of literary and artistic property protection presented by the development of technology. In that connection the Government would like WIPO to act rapidly to adopt a proper program specifically for the development of copyright and neighboring rights in Benin, which would be concerned with such activities as computerization, training and the updating and modernization of national legislation. The Delegation finally underlined the importance to a country of folklore protection, and expressed the wish that, in a forthcoming program, WIPO might give the subject a privileged position with a view to establishing an appropriate legal statute. The Delegation also asked for WIPO assistance for the organization in Cotonou, in the course of 1998, of a national seminar on the rights and obligations of authors, performers and other owners of intellectual property rights. 57. The Delegation of Burkina Faso noted that WIPO cooperation with its country had increased during the period under review. Among the activities that had to do with industrial property, the Delegation mentioned the organization of national awareness and training seminars for the benefit of magistrates, university staff and business people, the holding of an invention and innovation fair and the organization of regional seminars for French-speaking African States. As for copyright and neighboring rights, WIPO's dealings with Burkina Faso concerned mainly the exploitation of human resources, the formulation of a draft law on copyright and neighboring rights to accommodate the protection of the cultural heritage, and the strengthening of the national agency responsible for the collective management of copyright, the structure of which was entirely computerized at present, making for a considerable improvement in the services offered to users and also to counterparts in French-speaking and English-speaking Africa. As for the priorities for WIPO cooperation in the coming biennium, the Delegation mentioned the grant of long-term intellectual property fellowships, the strengthening of the national industrial property service by means of training activities and the supply of equipment, the alerting of economic operators to the TRIPS Agreement, the promotion of invention and innovation, the introduction of evaluation systems to determine the impact of intellectual property law on the national economy, the creation of a data bank on expressions of folklore, the training of civil servants, support for the implementation of collective management for performers' rights, and support for the fight against the pirating of works. As for action to be taken at the international level, the Delegation recommended the implementation of the Phuket Plan of Action with respect to the need for specific protection of expressions of folklore, the continuation of the debate on broadcasting rights, the continuation of the work of the Committee of Experts on audiovisual performances and databases and the introduction of a system for evaluating action undertaken in the country, in order that available resources might be used in the most rational way possible. 58. The Delegation of Kenya mentioned that, since 1989, its country had embarked on the task of amending its intellectual property legislation with a view to complying with international standards. It expressed its gratitude to WIPO for the assistance received in the revision of the Copyright Act and the Trade Marks Act, which would be now further amended in order to conform fully with the TRIPS Agreement. A new industrial property bill had been drafted in 1997 in full conformity with the provisions of that Agreement. The Delegation also expressed its gratitude to WIPO for the assistance received in the training of staff and requested the Organization to consider increasing the number of long-term fellowships on intellectual property at master and doctorate degree levels for developing country officials. The Delegation informed that during the last biennium the Kenya Industrial Property Office had been modernized in terms of physical facilities and equipment. It also stressed that the WIPO country project for Kenya was being implemented and highly commended the International Bureau for such an initiative. On the domestic level, it mentioned that in the last biennium the Office had started a very active education and outreach program which endeavored to create awareness on issues of industrial property protection and promote inventiveness and innovation in Kenya. Also in this respect, the support of WIPO had been crucial. It added that a Documentation and Information Centre had been established within the Office, also with the assistance of WIPO. Regarding copyright, the Delegation stated that valuable assistance had been received from WIPO to modernize the Copyright Office, the national collective administration office and the Music Copyright Society of Kenya, particularly through training of personnel, and stressed that also judges and magistrates, and police and customs officials needed to be trained for an effective enforcement of copyright within Kenya's borders. Turning to intellectual property norm-setting, the Delegation recalled that Kenya had been one of the first signatories to the WCT and the WPPT, and that amendments to national legislation were being drafted to prepare the accession of the country to the said Treaties, hopefully in 1998. With respect to the proposed Treaty on the Settlement of Intellectual Property Disputes Between States, the Delegation felt that more discussions were needed, as well as clarifications on the implications on the proposed WIPO Treaty of the already existing WTO dispute settlement system. 59. The Delegation of Portugal thanked the Director General for the support given in the form of cooperation activities with Portuguese-speaking African countries. In the course of 1996 and the first six months of 1997, high-level missions had been organized by WIPO in collaboration with the National Institute of Industrial Property (INPI) and the Governments of Angola, Cape Verde, Guinea-Bissau and Mozambique, with a mission to Sao Tome and Principe already scheduled for October. In that connection the joint WIPO-INPI Delegation had had the opportunity to engage in talks with the responsible officials in each of the countries in question. In the course of those missions, round tables or seminars had also been organized with the participation of representatives of industry, universities and the civil service. The Delegation pointed out that the results of that cooperation, which also reflected the efforts of the countries concerned, were already visible and substantial. The Delegation had for instance been very pleased to note that the budgetary funds set aside by the Organization for development cooperation in the 1996-1997 biennium had been doubled in relation to the 1994-1995 period, and it expressed the wish that the provision might be increased still further in the 1998-1999 budget. Part of the increase could moreover be achieved in the form of specific projects, notably in cooperation with other organizations specialized in industrial property. The Delegation said that Portugal had provided and would continue to provide, free of charge, copies of patent documents to improve access to technological information for developing countries. As far as normative activities were concerned, the Delegation wished to see rapid intervention on the part of WIPO in order that current work might be completed as soon as possible. The Delegation also gave assurances that Portugal would continue to take an active part in the meetings of working groups and committees of experts. Finally, with regard to international registration activities, the Delegation was pleased to note the progressive increase in membership at each meeting, which was a good indicator of the dynamic growth of the Organization. In the course of the period under review, Portugal had ratified the Madrid Protocol and acceded to the Budapest Treaty, which placed it among the States members of the largest number of WIPO-administered Unions. 60. The Delegation of Norway expressed its appreciation for the way in which WIPO's documents and activities had been carried out and expected that these would be further developed under the new Director General. With respect to information technology, the Delegation was looking forward with the highest interest and expectations to the follow-up of the recommendations made by the first session of the WIPO Working Group on Information Technologies for Intellectual Property and stated that this work should be given top priority among WIPO's activities. As regards staff, the Delegation noted with satisfaction that WIPO had stressed the importance of women in professional and higher categories, underlined the significance of pursuing this goal and welcomed further information on the developments in the last year and the expectations for the years to come. The Delegation expressed concern on the lack of a program and budget proposal so close to the next budgetary period. In the copyright field, the Delegation stated that important results had been reached with the adoption, in December 1996, of the WCT and the WPPT, but stressed that further steps would be taken in respect of the rights of audiovisual performers, sui generis protection of databases and adjustments to the rights of broadcasters. Concerning development cooperation, the Delegation stated that Norway would continue to carry out a certain number of requests for novelty searches of innovations from residents of developing countries free of charge. With respect to international registrations, the Delegation expressed its satisfaction with the current development of the PCT. Norway had acceded to the Madrid Protocol on April 1, 1996, and already noted that approximately 30% of trademark applications filed were Madrid Protocol designations. The Delegation expressed its satisfaction with the plan to make available the various WIPO classifications in electronic form. The proposal to limit the Nice Classification services was acceptable, more than compensated by a corresponding increase in services in the information technology area. The Delegation noted the success of, and appreciated, WIPO's Internet home page and the ease with which documents could be made available through it. The Delegation also commended the cooperation activities with the WTO resulting in the dissemination of intellectual property laws and regulations and their bibliographic data. To conclude, the Delegation informed the meeting that as intellectual property in Norway moved toward becoming customer-oriented, they had, in the last few years, made a two-step reduction in patent fees. 61. The Delegation of Romania mentioned the considerable legislative progress achieved by its country during the period under review, including the enactment of a new law on trademarks and geographical indications, the law on the ratification of the Madrid Protocol and the laws on accession to the Trademark Law Treaty and the International Classifications (Nice, Vienna, Strasbourg and Locarno). The Delegation announced also that Romania would shortly be depositing its application for accession to the European Patent Convention. Since October 1996, pursuant to a cooperation agreement with the EPO, Romania had extended the validity of the European patent to its own territory, which had qualified it to take part as an observer in the EPO Administrative Council from December 1996 onwards. The Delegation said also that Romania intended to accede to the Budapest Treaty before the end of 1997. As far as copyright and neighboring rights were concerned, the Delegation mentioned the part played by WIPO in the drafting of a new law on the subject, which had entered into force in June 1996. The Delegation further announced that Romania was in the process of adopting draft legislation on its accession to the Paris Act of the Berne Convention and to the Rome and Geneva Conventions. It went on to say that its country intended to ratify the WCT and WPPT before the end of 1997. Finally, the Delegation gave its support to the holding in 1998 of meetings of committees of experts on the subjects of broadcasting, database protection and audiovisual productions. 62. The Delegation of Argentina stated that its country supported the early convocation, by WIPO, of a committee of experts on the rights of broadcasting organizations. It stated that following the adoption of the WPPT, the protection of performers and producers of phonograms had been satisfactorily revised, but the same was not true for broadcasting organizations, which were now in a disadvantageous position in relation to performers and producers of phonograms. It mentioned that broadcasting emissions are, and can be circulated in the information highways and put at the disposal of the public by "on demand" services, and that in this era of universalization and global diffusion of works, performances and phonograms, the respective rightholders had already obtained a reasonable level of international legal protection, but the same was not true for broadcasting organizations. In this regard, the Delegation pointed out that in the current information age, the most recent international instrument of protection for broadcasting organizations, the Rome Convention, dated back to 1961, and that the provisions of the TRIPS Agreement were virtually repeating the regime established under that Convention. As a consequence, it stressed that for equity reasons, it was necessary to create, as early as possible, a committee of experts to update the protection of broadcasting organizations. 63. The Delegation of Brazil expressed its gratitude to WIPO for the assistance received in the last biennium concerning norm-setting. The Delegation stated that Brazil supported the early negotiation and adoption of the proposed Treaty on the Settlement of Intellectual Property Disputes Between States, and continuing negotiations on the protection of audiovisual works and folklore. In the latter respect, the Delegation proposed to extend the scope of protection of folklore to traditional know-how. Finally, with regard to databases, the Delegation recalled that Brazil had not supported the adoption of a treaty on intellectual property protection of databases which are not original, but that its Government did not object to the continuation of negotiations on this issue, on the basis of the recommendations of the meeting held the previous week at WIPO on the matter. for the administration of industrial property, notably with respect to the examination of patent applications and the patent information service. In addition, WIPO had started in 1997 to carry out a project for the modernization of the national trademark and industrial designs system. Finally, the Delegation mentioned that its country had acceded to the Nice and Locarno Agreements in 1997. 65. The Delegation of Tunisia expressed pleasure at the quality of the cooperation that had always existed with WIPO. In the course of the period under review, that cooperation had been strengthened by Tunisia's adherence to the TRIPS Agreement. In that connection, the Delegation mentioned the efforts made by the International Bureau to bring about the implementation of the resolution adopted in Tunis by African trade ministers whereby the various organizations concerned were asked for technical assistance in the completion of the agreements. Tunisia, for its part, had established the Tunisian Copyright Protection Agency as part of the implementation of its new literary and artistic property legislation. At present, therefore, Tunisia had at its disposal the two instruments that were necessary for the successful conduct of its intellectual property work, namely the National Institute for Standardization and Industrial Property and the Copyright Protection Agency mentioned. In addition, Tunisia had initiated discussions with WIPO with a view to allowing the new Agency to benefit from International Bureau cooperation. The Delegation had been pleased to note the reception that the International Bureau had given it regarding the possibility of assistance in normative and training work, logistical support and also the provision of the necessary documentation. Reverting once again to the program address by Dr. Kamil Idris, the Delegation pointed out that its country subscribed totally to the areas of emphasis outlined in the address as a means of enabling the International Bureau to discharge its functions in a world characterized by globalization of the economy, rapid technological change and the importance of information technology, and that it regarded those factors as placing WIPO at the center of the challenges to be taken up by the international community. The Delegation considered that the visionary speech by Dr. Idris was capable of providing WIPO with the means of rising to those challenges and especially to the challenge of enabling developing countries to integrate better in the world economy. The Delegation concluded by emphasizing the Tunisian authorities' commitment to WIPO and to its work, and gave its support to Ghana's proposal on the subject of folklore protection. 66. The Delegation of Jordan expressed its appreciation for the development cooperation activities carried out by WIPO in the period under review and called for the allocation of increased funds for the implementation of the said activities, particularly in the copyright and neighboring rights field. It stressed that Jordan was striving to give the greatest possible protection to intellectual property rights and that the protection of intellectual property was an incentive for the inventors and artists and it attracted investment. The Delegation informed the meeting that the Cabinet of Ministers had approved draft amendments to the Copyright Law, and forwarded them to the House of Parliament for discussion and approval. The said Amendments were designed to bring national legislation in line with the provisions of the Berne Convention and the TRIPS Agreement, and by bestowing on the Copyright Office the legal capacity to implement the Law, they gave to the said Office a greater role in fighting and eliminating piracy. It added that the University of Jordan in Amman was teaching intellectual property so as to prepare a generation of qualified lawyers in this field and that the concerned authorities had achieved, with WIPO's assistance, the modernization of industrial property laws, such as the Trademarks Law and the Patent Law. It added that Jordan was planning to establish a model office to administer copyright and neighboring rights, to become a regional center for the training of the staff in this field, and the Delegation hoped that WIPO would support this initiative. Regarding the protection of folklore and national heritage, it stated that its country was preparing studies in this field and supported the establishment of an international mechanism to protect that national cultural treasure. The Delegation also informed the meeting that Jordan was taking the necessary steps to accede to the Berne Convention. It concluded that the protection of intellectual property rights required the cooperation of all countries, with the help of WIPO and that, in such a process, due consideration should be taken of the specific interests, capabilities and needs of each country. 67. The Delegation of Malawi expressed its appreciation to WIPO for the provision of, inter alia, equipment and training, for having facilitated the attendance of officials at meetings, seminars and missions, as well as for the study carried out by WIPO on the compatibility of Malawi's legislation under the TRIPS Agreement and the TLT. The Delegation reported that an inter-ministerial committee with a sub-committee on the TRIPS Agreement had been formed. The Delegation reported that it had acceded to the Locarno, Nice and Strasbourg Classification Agreements. At the regional level, and within the framework of ARIPO, the Delegation stated that Malawi had ratified the Banjul Protocol. As regards copyright, the Delegation expressed its gratitude to WIPO for assisting Malawi, particularly through training, provision of equipment and advice on collective administration of copyright. Also, three law enforcement officers had been trained by the Copyright Society of Ghana under the auspices of WIPO. The Delegation noted with interest that the agenda of the current session of the Governing Bodies included consideration of conferring observer status to the Southern African Development Community (SADC) and reiterated its request that WIPO undertake a needs assessment survey to elaborate a detailed plan of action for SADC countries. The Delegation requested WIPO's financial and technical assistance in computerization of the industrial property and copyright offices and in the organization of a dynamic information and documentation service which would be responsive to needs of industry. With respect to WIPO-financed country projects, the Delegation requested that WIPO include Malawi in such projects in the near future. The Delegation fully supported WIPO's efforts to develop international instruments on the protection of folklore and audiovisual performances. 68. The Delegation of Trinidad and Tobago underscored the dramatic improvement in the protection and administration of intellectual property rights in its country, which now included all areas covered by the TRIPS Agreement. A project for the modernization of the Intellectual Property Registry had been successfully completed, with assistance from WIPO and financed by a loan from the Inter-American Development Bank. It had included new industrial property legislation and the computerization of the administration of the intellectual property system. Legislation on the protection of new plant varieties and on copyright had also been enacted and would shortly enter into force. The Delegation expressed its appreciation for the WIPO seminars that had helped foster closer cooperation among the countries of the Caribbean region as well as providing invaluable technical information and looked forward to those continuing in the coming year. The Delegation thanked the many countries and organizations that had contributed to the development of intellectual property in its country through study visits, training programs, seminars and other forms of support. Trinidad and Tobago had, in its turn, and with the assistance of WIPO, hosted a meeting of Ministers responsible for intellectual property from 13 Caribbean countries to discuss technical and policy issues, the first such meeting to be held in the region. The Ministers had recommended, inter alia, that WIPO undertake a study on a regional approach to the collective administration of copyright, that it assist in establishing a group of experts to develop mechanisms to coordinate intellectual property systems in the region and that it convene a regional consultation meeting on the protection of folklore. With respect to the latter issue, Trinidad and Tobago, like other countries in the Caribbean region, was particularly rich in folk material, a resource that remained largely untapped, unprotected and at risk of exploitation. New technologies, to which many developing countries had limited access, had made the uncontrolled capture and dissemination of such folk material increasingly easy. The recommendations of the Caribbean Ministers on the question of folklore, therefore, took on a certain urgency. Accordingly, Trinidad and Tobago was prepared to host any international meeting on folklore and, in particular, a regional consultation meeting on the issue in the second half of 1998. Trinidad and Tobago attached great importance to the heightening of awareness of the benefits and obligations of intellectual property rights in all quarters and to that end would conduct, in the week of November 10 to 14, 1997, a national public education and sensitization program in the area of copyright for which it had received much assistance from the International Bureau. The Delegation said that its country looked forward to more States participating in the deliberations on further developments in the intellectual property field and to increasing its own contribution to discussions on technical cooperation within WIPO. 69. The Delegation of Cameroon stated that cooperation with the International Bureau had been intensified during the period under review, notably in the field of human resources. Cameroon experts had participated in several courses and seminars in the African region and the country had, in cooperation with WIPO and OAPI, organized a regional workshop for magistrates from OAPI countries. The Delegation expressed its gratitude for the invaluable contribution made by WIPO in the ongoing revision of the Bangui Agreement and its related instruments. With respect to the Phuket Plan of Action, Cameroon fully endorsed such an initiative, given the importance of folklore for developing countries, and requested the General Assembly of WIPO to adopt it for effective international protection in the domain. 70. The Delegation of Uzbekistan expressed its gratitude to the International Bureau for its help in the setting up of its country's intellectual property system. It noted that measures would be taken over the next few years to strengthen the intellectual property system in Central Asia, including, as a priority, training, the setting up and modernization of the relevant national bodies and the enacting of legislation concerning the collective management of copyright and the protection of industrial property rights. Uzbekistan hoped to receive assistance from WIPO in that respect, especially in relation to training, the organization of the Patent Office and the introduction of new technology and communications systems, in particular regarding patent information services. It also sought assistance in norm-setting, linked to the further improvement of its intellectual property legislation. The Delegation expressed the hope that WIPO would set up a special program for the development of legal and technological tools geared to the protection of intellectual property rights. 71. The Delegation of Qatar noted that WIPO would hold a seminar in its country in November 1997, for the countries of the Gulf Cooperation Council (GCC) on the implementation of the TRIPS Agreement. Having joined the WTO as a developing country, Qatar would certainly make use of the five-year transition period accorded to those countries to adapt its laws to the provisions of that Agreement. To that end, it requested expert assistance from WIPO in the revision of its intellectual property legislation. Qatar was a relative newcomer to the intellectual property field and the Delegation requested that its legal experts be included in the training courses organized by WIPO within its development cooperation program. With respect to the proposal for an international instrument on the protection of folklore, the Delegation expressed its full support for such an initiative, especially as Qatar was a country rich in folklore. The Delegation ended by expressing the hope that WIPO would undertake a mission to Qatar to explain fully the benefits to the country of ratifying the various treaties adopted or administered by WIPO. 72. The Delegation of the Sudan noted that, with the assistance of WIPO, many improvements had been made to its country's intellectual property system in the period under review. The Industrial Property Office had been relatively modernized and the search systems in both the patent and trademark divisions were on their way to being computerized. Amendments were being drafted to the national industrial property legislation to bring it into line with the TRIPS Agreement and a massive campaign had been launched to inform the public of the benefits of patents, trademarks and industrial designs, particularly for inventors and businessmen. The Sudan supported the call for an increase in the funds allocated for the modernization of industrial property offices in developing countries. The Delegation expressed its country's gratitude for the assistance provided by WIPO in the area of training, which had included a scholarship for a Masters degree in intellectual property, an important step toward building the necessary expertise to enable intellectual property subjects to be taught at graduate level in the country's universities. It was hoped that cooperation with WIPO in the field of training would be intensified in the coming year. In conclusion, the Delegation requested that, the country's needs having now been defined, the implementation of the country project for the Sudan take place before the end of 1997. 73. The Delegation of South Africa informed the meeting that two intellectual property bills vital to its country's compliance with its obligations under the TRIPS Agreement were before Parliament. The Intellectual Property Law Amendments Bill provided for minor amendments to all South Africa's intellectual property statutes, while the Counterfeit Goods Bill proposed far-reaching and essential measures for the enforcement of intellectual property rights in that area. The latter bill would greatly facilitate South Africa's attempts to eliminate the problem of counterfeiting. The amended legislation would be fully in line with the most modern legislative developments in that area. At the international level, South Africa had deposited its instrument of accession to the Budapest Treaty on July 14, 1997, and expected to accede to the PCT at the beginning of 1998, depending on the date on which the intellectual property law amendments bill became law. The Delegation noted the training of four officers from the Office of the Registrar of Patents, Trade Marks, Designs and Copyright, organized by WIPO, in France, Sweden and the Benelux countries. The South African Office had also cooperated with WIPO in the training of a number of staff from the intellectual property offices of surrounding African countries. The Delegation expressed its gratitude for those activities as well as for the visit made by the Chairman and three members of the South African Parliamentary Sub-Committee on Intellectual Property (an integral part of the Parliamentary Portfolio Committee on Trade and Industry) to WIPO in July 1997. Turning to the question of folklore, it stressed that its country fully recognized the important role appropriate protection could play in preserving the cultural identities of communities around the world, especially in the developing world, particularly in the light of the advancing globalization of markets, goods and services. Accordingly, it stated that South Africa supported the endorsement of the Phuket Plan of Action and requested that WIPO incorporate into the program for the next biennium the study of the conservation and protection of folklore, and indigenous culture and knowledge in general, an important element of which would be extensive national and regional consultations with indigenous communities to ensure that they played a key role in the work. It also requested that WIPO set up a committee of experts in that field to work toward the establishment of appropriate international norms. Finally, turning to the question of the protection of audiovisual works, the Delegation noted its country's support for deliberations that would lead to the conclusion of a treaty in that area. 74. The Delegation of Japan stated that its Government had adopted a Program for Economic Structure Reform in December 1996, and that development of a comprehensive intellectual property strategy constituted a key issue in that Program. With regard to patents, it underlined that the Japanese Patent Office (JPO) attached great importance to expeditious and proper granting, and to this end had been implementing policies to enhance its capacity through, particularly, expansion of the online filing system which was already in place. With regard to the proposed Patent Law Treaty, it urged all countries concerned to resume negotiations to reach an extensive and substantive harmonization of patent systems as soon as possible. In the field of trademarks, it recalled that a drastically revised law had come into effect in Japan in April 1997, at the same time as the entry into force of the TLT with respect to its country. In the field of copyright and neighboring rights, it stated that Japan had amended its copyright law in June 1997, to comply with certain provisions of the WCT and the WPPT, and that its Government was envisaging further amendment of that law with a view to ratifying those treaties. It also commended WIPO for the work carried out in information technology related activities, with special reference to the outcome of the meeting of the PCIPI ad hoc Working Group on the Management of Industrial Property Information, held in Rio de Janeiro in June/July 1997. In this connection, the Delegation of Japan stressed that WIPO was being called upon to adopt a most appropriate approach toward the information age, in response to increasing demand concerning the proposed Digital Libraries and the Information Technologies Committee. It assured that Japan would contribute to WIPO's activities in this area and was pleased that the Director General elect had emphasized the importance for WIPO to keep pace with developments in, and the potential of, information technology, both in its internal operations and in the delivery of the services that it renders. It also expressed appreciation for the meetings on the Internet domain names and intellectual property rights held in 1997, and emphasized the need to establish new criteria of intellectual property protection adapted to the global digital network. The Delegation stressed that Japan had been extending and would continue to expand cooperation to developing countries through its fund-in-trust arrangement with WIPO, and that the WIPO Asian Regional Forum on Intellectual Property Rights in the 21st Century held in Tokyo in September 1996 under the said arrangement had, among other things, adopted a Joint Statement on the importance of improving access to intellectual property rights through the information network and of developing human resources. The JPO, it noted, was fully committed to implementing that Statement and would also further promote provision of the Patent Abstracts of Japan via the Internet. In conclusion, the Delegation felt that on the eve of the 21st century, the proactive use of information technology, international rule-making and greater cooperation with developing countries should be regarded by WIPO as priority tasks and that, as expressed in the acceptance speech of the Director General elect, WIPO should be oriented by its member States in those tasks. 75. The Delegation of Germany paid tribute to the excellent services rendered by, and noted the considerable achievements of, the International Bureau in the period under review, which had included the adoption of the WCT and the WPPT. Germany had signed both instruments and ratification was expected to follow in due course. With regard to other international instruments in the field of copyright and neighboring rights, it noted with satisfaction the previous week's deliberations on a possible Protocol Concerning Audiovisual Performances and a possible Treaty Concerning Intellectual Property in Databases. The protection of databases had also been taken up by the EU. Germany had already amended its Copyright Act to bring it into line with the relevant EU Directive and would like to see such protection extended outside Europe. In the patent area, the Delegation welcomed the progress being made toward a proposed Patent Law Treaty, but regretted that it had so far proved impossible to agree on a comprehensive harmonization of patent law. It also attached great importance to the proposed WIPO Treaty on the Settlement of Intellectual Property Disputes Between States which it considered had a role to play alongside the existing WTO dispute settlement mechanisms. The continuing cooperation between WIPO and the WTO served to further worldwide protection of intellectual property rights, while avoiding duplication of effort. The Delegation stated that the German Government had prepared a draft bill amending the Patents Act with a new approach to the question of compulsory licenses, the filing of applications in electronic form and the appeal proceedings before the Federal High Court of Justice. Turning to the problems in the area of domain names on the Internet, Germany considered that WIPO was the appropriate forum in which to ensure that intellectual property rights enjoyed the same protection in both electronic and non-electronic environments. The Organization itself made good use of modern information technology, which had ensured, for example, that the PCT had already become a truly global instrument. Turning to the Madrid system, the Delegation stressed its country's belief that a pragmatic solution could be found to possible obstacles to accession arising from the exercise of the ECs' voting right, without the need to amend the Protocol. At the national level, the services rendered by the International Bureau to the business community were highly appreciated in Germany. The activities of the German Patent Office continued to expand and an electronic patent information system (DEPATIS) had been developed to meet its rapidly growing needs. The Office was willing to share its experience and expertise with developing countries and countries in transition. In that context, it referred to the successful organization, jointly by the Office and the International Bureau, of a seminar in Berlin for heads of industrial property offices from countries in transition. It confirmed that the German Government would continue to vigorously support all types of development cooperation. 76. The Delegation of Kazakhstan noted that in the past two years the work of WIPO had been very fruitful and, in particular, that the number of seminars and meetings in Central Asia had significantly increased. Considering that the problems of Kazakhstan were very similar to those encountered in Belarus, Kyrgyzstan and Uzbekistan, the Delegation supported the proposals made by the Delegations of those countries, and requested WIPO's continued financial support in that respect. It also hoped that its country could receive assistance from WIPO in bringing national legislation into conformity with the TRIPS Agreement, in drafting new laws on copyright and neighboring rights, in training staff and officials in charge of enforcement, and in drawing up measures to combat piracy. It felt that the training of experts, including lawyers and customs officers, should continue, in particular in the framework of the WIPO Academy. 77. The Delegation of El Salvador stated that its country had achieved remarkable progress in the industrial property field thanks to the cooperation received by WIPO in the last biennium. It mentioned, in particular, training and assistance in relation to bringing national legislation in conformity with the provisions of the TRIPS Agreement. Regarding the next biennium, the Delegation expressed the wish to benefit from study visits and long-term fellowship on intellectual property with a view to enhancing national human resources in this area. 78. Speaking on behalf of the Presidency of the European Union, the Delegation of Luxembourg wished to acknowledge the interest shown by a number of delegations in the work of the Organization pertaining to folklore, and declared itself willing to join the other delegations in their reflection on the subject with a view to a possible General Assembly decision in the context of the Organization's general program of activities. 79. The Delegation of the United Nations Educational, Scientific and Cultural Organization (UNESCO) recalled that WIPO and UNESCO had been cooperating for a great many years in the field of copyright and neighboring rights protection and also in the field of folklore. As far as folklore was concerned, that cooperation had started in 1973 and culminated in 1982 in the adoption of UNESCO-WIPO model provisions on the legal protection of expressions of folklore. In connection with that cooperation, the Delegation mentioned the UNESCO-WIPO World Forum on the Protection of Folklore, organized in Phuket the previous April, which had restarted the international debate on folklore protection, and noted that UNESCO was willing to continue to work with WIPO on the possible means of achieving a wide international consensus that would ensure effective protection for folklore. In order to achieve that objective, it seemed essential that two conditions be met, namely that national protection be available in the form of suitable legislation (and in that respect the model provisions adopted by UNESCO and WIPO in 1982 could provide a starting point) and that there be a national organization responsible for the recording and identification of expressions of folklore. In that respect the Delegation felt that it would be desirable for the efforts of WIPO and UNESCO to be combined in order to help developing countries bring some order to their national systems for the preservation and protection of folklore. With regard to the program for the protection of the audiovisual productions of performers, the Delegation recalled that WIPO and UNESCO jointly managed the Rome Convention, and pointed out that, as a result of the adoption of the WPPT in December 1996, the protection of performers had improved considerably, but that it was desirable for that improvement to extend also to the protection of audiovisual productions. It pointed out in that connection that UNESCO was in favor of a particular effort being made to bring about as broad an international consensus as possible in that area. As far as databases were concerned, the Delegation expressed the wish that in future the study of that subject, which had to do with protecting the investment essential to the production of databases, might take place in close collaboration with scientific circles in order that the consensus reached might lend some security to the legitimate investments made by database producers and at the same time ensure the free flow of information. 80. The Delegation of the African Regional Industrial Property Organization (ARIPO) thanked WIPO for the various development cooperation activities it had carried out, especially those related to the fulfilling of its member States' obligations under the TRIPS Agreement, and stated that almost all its member and potential member States had benefited from the four WIPO symposiums on TRIPS that had been organized in Africa in the period under review. The symposiums had complemented the Workshop on TRIPS which ARIPO had organized in December 1996, in Zambia, with the cooperation of the Commonwealth Secretariat. It added that ARIPO planned to organize a follow-up in March 1998, involving the judiciary, customs and police, and that WIPO's assistance in that respect would be requested in due course. The Delegation recalled that the Harare Protocol on Patents and Industrial Designs (1982) and the Banjul Protocol on Marks (1993) had empowered the ARIPO Office to grant patents and register industrial designs and marks on behalf of member States. It stressed that the ARIPO Secretariat had proposed certain amendments to those Protocols to ensure their conformity with the TRIPS Agreement and the TLT, to be considered by the ARIPO Administrative Council in November 1997, and expressed its gratitude for the assistance received from WIPO in that matter. Concerning the linking of the Harare Protocol to the PCT in July 1994, it mentioned that the ARIPO Office had been designated 19,000 times and elected 9,000 times, a result of the number of ARIPO member States party to the Harare Protocol that had joined the PCT having increased from three to nine (the Gambia, Ghana, Kenya, Lesotho, Malawi, the Sudan, Swaziland, Uganda and Zimbabwe). It also noted that the Banjul Protocol had come into force in March 1997, for Malawi, Swaziland and Zimbabwe, that an encouraging number of trademark applications had already been received and that the increase in the workload resulting from those developments had created a need to increase the automation of the ARIPO Secretariat as well as of the offices of ARIPO member States. It commended WIPO for the meeting on industrial property office automation organized in July 1997, and stated that ARIPO intended to seek WIPO's further assistance in that area. In concluding, the Delegation thanked WIPO for all the assistance rendered to ARIPO in the past. It also thanked the EPO for its assistance in providing office equipment and in financing the ARIPO-EPO roving seminars that had taken place since 1992. 81. The Delegation of the European Broadcasting Union (EBU) thanked WIPO and the Government of the Philippines, on behalf of all the broadcasting unions represented at WIPO, for organizing the World Symposium on Broadcasting, New Communication Technologies and Intellectual Property last April in Manila. Following the discussions at that Symposium, the Delegation welcomed the support expressed by governments that the work should continue in the next biennium in a committee of experts. It reiterated that the discussions in Manila showed that the scope of protection of trademarks granted by existing international instruments was not able to cope with the current realities of piracy of broadcasts occurring all over the world. It very much hoped that the forthcoming program and budget of WIPO would enable preparation of an up-to-date treaty for the protection of the neighboring rights of broadcasting organizations. 82. The Delegation of Costa Rica expressed its gratitude to WIPO for the assistance received by its country in the reporting period. It supported the propositions made by the Director General elect in his acceptance speech on the use of information technology as a means to promote the development of modern intellectual property systems, an area of great importance for its country. It requested wider participation of its country in WIPO's cooperation program, including through provision of equipment and training of customs and registry officials. It supported the holding of regional consultations on intellectual property issues, and indicated that new intellectual property knowledge should reach the universities together with equipment and WIPO financial support. The Delegation expressed the wish to continue to be involved in WIPO's activities. It also stressed the importance of training enforcement personnel and supporting the fight against piracy. Finally, it expressed the belief that increased training programs on intellectual property at university level would be particularly beneficial to developing countries. 83. The Delegation of the Organization of African Unity (OAU) welcomed the activities that had characterized the cooperation between the OAU and WIPO in the course of the past year, and declared its certainty that, under the dynamic influence of the new Director General, that cooperation was bound to increase and expand. It mentioned in particular the joint OAU-WIPO project for the award of medals to the best African inventors, which all agreed had had the desired effect on the improvement of creativeness, and also the annual training program for OAU officials and those of its member States, the results of which were highly appreciated. The Delegation emphasized that the OAU was looking forward expectantly to the visit of the new Director General in the course of one of his coming tours, in order that it might share with him some ideas and reflections on his vision of WIPO's future and the promotion of intellectual property throughout the world, especially in Africa. In conclusion, it mentioned once again the interest that the OAU attached to the question of folklore, and its concern to have the matter dealt with by WIPO with all the thoroughness that it deserved, and considered that the Phuket Plan of Action provided a suitable framework for the work not only of WIPO and its Member States but also for all its intellectual property partners. by Parliament and that the country hoped to accede to the Stockholm Act (1967) of the Paris Convention in the near future. The Delegation supported the early completion of the work of the Committee of Experts on the proposed Patent Law Treaty and the Treaty on the Settlement of Intellectual Property Disputes Between States. The Delegation noted that its country and other countries from the region appeared to be underrepresented on the staff of the Secretariat and requested that this be remedied. In concluding, it stressed that more attention should be paid to attract and increase future cooperation between WIPO and the developing and less-developed countries through extending legal, technical and training activities. 85. The Delegation of Albania reported on the recent industrial property activities that had taken place in Albania, which included a national symposium organized in cooperation with WIPO for local interested circles, the start of a project on the creation of a National Documentation and Information Center, the preparation of amendments to the Industrial Property Law to bring it into conformity with the provisions of the TRIPS Agreement, the preparation of a draft act on semiconductor chip products and integrated circuits, work on new legislation on enforcement rights, and preparatory work for Albania's accession to the Nice Agreement. 86. The Delegation of Australia mentioned that its Government has cooperated with WIPO in a number of development cooperation activities, particularly in the Asia-Pacific region, and looked forward to continuing involvement with it. It understood that consideration was being given by WIPO to use of distance learning techniques and offered Australia's expertise in that respect. It stressed that the PCT continued to be of great assistance to Australian applicants and was particularly pleased with the outcome of the PCT Assembly meeting held the previous week. The Delegation also foresaw considerable scope for information technology to achieve further major advances in simplifying and improving the international patent and trademark systems, and strongly supported the work that WIPO had commenced in that area. Referring to developments at national level, it mentioned that substantial growth in the volume of trademark and patent work had been managed by the Australian Industrial Property Organisation with reduced waiting times and no increase in staff. As concerns legislation, it informed the meeting on a number of planned changes, including the introduction of a utility model system to replace the existing petty patent system, the extension of patent protection to 25 years for human-use pharmaceutical products and amendment of the regulations governing the patent attorney's profession. Its Government was furthermore currently considering a major report on Australia's design law and was expected to decide on some major changes to significantly improve the effectiveness of design protection before the end of the year. 87. The Delegation of Austria noted with appreciation the volume and quality of the activities carried out by WIPO and was deeply satisfied that emphasis was put on intensifying development cooperation activities and the establishment of adequate administrative infrastructures, including computer technology, and also that foremost importance had been given to the TRIPS Agreement. With respect to norm-setting, the Delegation was pleased with many of the new instruments for the protection of intellectual property rights, in particular the TLT and the two new treaties in the field of copyright and neighboring rights. The growing number of States acceding to WIPO-administered treaties showed the growing importance of intellectual property rights. As regards development cooperation, the Delegation reported that Austria jointly organized seminars on patent information and documentation at the Austrian Patent Office, and provided experts for advisory missions to developing countries in the framework of WIPO programs. As in previous years, the Austrian Patent Office prepared state-of-the-art search reports and provided free copies of patent documents to improve developing country access to technological information contained in patent documents. It also stated that the Office had concluded many bilateral cooperation agreements, mainly with intellectual property offices in Central and Eastern Europe as well as in Asia, which formed the basis for different training and support programs. In addition, the Office had acted, and continued to act, as a PCT International Searching Authority and International Preliminary Examining Authority for several countries. At the national level, work continued on intellectual property legislation, and a new act on supplementary protection certificates for pharmaceuticals had entered into force and an amendment to the Patents Act was being prepared. A general revision to the Trademarks Act had reached the final stage and was expected to be submitted to Parliament by year's end. As a signatory to both the Madrid Protocol and the Vienna Agreement, the Delegation was confident that the ratification processes would be concluded by Austria in the very near future. The Delegation noted that deliberations on possible accession to the Hague Agreement had not yet been completed, and that Austria planned to monitor the recent developments to this treaty with great interest. 88. The Delegation of Bolivia expressed its gratitude to WIPO for the assistance received in the last biennium in the industrial property and copyright and neighboring rights fields. The Delegation stressed, in particular, the WIPO/Bolivia National Seminar on the Implications of the TRIPS Agreement organized in La Paz in September 1996 , the legal advice received in respect of the draft law on market regulation (Codigo de Ordenación del Mercado), the provision of equipment, CD-ROM products and documentation, and the training of personnel. Regarding copyright and neighboring rights, it was pleased to mention that sanctions had been provided for the first time by the National Copyright Directorate against infringement of copyright in literary works, thus establishing an important precedent for the protection of copyright and neighboring rights. It also recalled the WIPO Regional Seminar on Copyright for Latin American Publishers held in La Paz in November 1996, the WIPO National Seminar on Collective Administration of Copyright and Neighboring Rights held in Santa Cruz in June 1997, and the implementation of the WIPO country project for copyright and neighboring rights. At the international level, the Delegation noted with appreciation the recent adoption of the WCT and the WPPT, and supported further WIPO work on the protection of folklore. The Delegation requested future WIPO assistance for the adoption of new provisions in the framework of the Andean Community and of its own national legislation, in conformity with the provisions of the TRIPS Agreement. It also emphasized the need for the expertise of WIPO staff through special studies on current intellectual property challenges and perspectives. It reiterated the request for fellowships that its country had made at the last session of the WIPO Permanent Committee for Development Cooperation Related to Industrial Property and looked forward to the implementation of a national seminar on the PCT. It also reiterated the request for a symposium for customs and police officers that Bolivia had made at the last session of the WIPO Permanent Committee for Development Cooperation Related to Copyright and Neighboring Rights. Recognizing the importance of awareness in matters of intellectual property, it requested WIPO's assistance in organizing a seminar for journalists in La Paz. Finally, it took note of the Interim Financial Statement for 1996. 89. The Delegation of Bulgaria noted that in the period under review, its country's efforts had been directed at harmonizing its industrial property legislation with European and international standards. A new Law on the Protection of New Plant Varieties and Animal Breeds came into force at the beginning of 1997, and in order to comply with requirements under the TRIPS Agreement and certain EU Directives, new legislation was being drafted, with the assistance of WIPO, on trademarks and appellations of origin, industrial designs and the topographies of integrated circuits. The Hague Agreement had entered into force for Bulgaria in December 1996, and under its provisions, some 450 applications had already been received. With respect to intellectual property information, Bulgaria had 18 million patent documents from 25 countries and two international organizations available for consultation as well as a rich fund of electronic patent documentation from 19 countries. It had made its own documentation available electronically through the ESPACE-PRECES CD-ROM set up and disseminated within the framework of the EU regional industrial property program. In addition, the Patent Office continued to make its Official Patent Bulletin available in English, as it had done for the last six years. Turning to trademarks, the Delegation noted that the automated search system for word and figurative marks had been put into operation that year and had already contributed to the efficiency and quality of trademark examination in the country. That project had been realized, in large part, with assistance provided by WIPO. Bulgaria aimed at extending its participation in the Organization's programs in the future, inter alia, through participation in patent searches, by making its own experience and knowledge available to experts from other countries and participating in norm-setting activities. 90. The Delegation of Canada pointed out that with the adoption of the WCT and the WPPT, WIPO had taken a leadership role in addressing copyright and neighboring rights issues in the era of digital technology. It also commended WIPO for its continuing activities in the area of trademarks, where a number of initiatives had been taken to consider issues relating to trademark licensing, well-known marks and Internet domain names; in advancing the draft Patent Law Treaty and continuing the work of enhancing the PCT Regulations; in work on audiovisual performances and intellectual property in databases; also concerning the work of PCIPI and its Working Groups; and provision of technical assistance to developing countries. In the latter context, a specialized training course on the management of trademark operations and information services had been held for the first time in Canada for the benefit of developing countries in cooperation with WIPO in June 1997, and its Government hoped to extend this course, in cooperation with WIPO, to participants from the Asia-Pacific region in 1998. As concerns information technologies, it hoped that WIPO would assume a prominent role in encouraging their enhanced use by intellectual property offices around the world. It was pleased with the establishment of a WIPO Working Group on Information Technologies for Intellectual Property, appreciated the excellent work accomplished by it during its July meeting and strongly supported the establishment of a senior body at WIPO to be responsible for the horizontal management of information technology issues facing the international community. As concerns WIPO-administered treaties, it recalled that on September 21, 1996, Canada had acceded to the Budapest Treaty and that it was also working toward establishing an International Depositary Authority in Canada. In the context of intellectual property activities in regional forums, efforts to achieve enhanced intellectual property rights, enforcement and cooperation were underway, supporting and complementing the activities of WIPO and the WTO in the negotiations for a Free Trade Area of the Americas and in the Asia-Pacific Economic Cooperation group. Regarding national legislation, it mentioned that amendments to the Copyright Act had been approved by Parliament in April 1997, and that substantial portions of the amended Act had come into force on September 1, 1997, providing, among other things, a regime of protection for performers' performances, sound recordings and broadcasters' communication signals, which would enable Canada to become party to the Rome Convention. The Delegation then highlighted the notable developments that had occurred in the Canadian Intellectual Property Office with a view to supporting innovation and the knowledge-based economy in Canada through effective use of information technology. Automation of patent and trademark operations had been a vital component of improving client service and by June 1997, Canada had reached its goal of a fully deployed electronic patent office, which had also made available the bibliographic data of Canadian patents on its Internet site. The full text and drawings of patent documents were also planned to be made available, free of charge, through the Internet. A trademark automation system had gone into full production in November 1996, and the Trade Marks Office was now able to control electronically the workflow of a trademark application from its initial receipt to its final registration. Filing of trademark applications through the Internet was planned to begin its testing phase in the fall of 1997. During the past year, the Trade Marks Office had continued the international benchmarking project with Australia, New Zealand, Sweden and the United Kingdom. A number of key processes had now been analyzed and benchmarking documentation had been shared with all partners. In conclusion, the Delegation stressed that its country was prepared to continue to cooperate with WIPO in promoting greater awareness, use and protection of intellectual property, and to work with WIPO and member States in capturing the benefits of information technology in the delivery of intellectual property services around the world. 91. The Delegation of Croatia outlined the development and achievements of the State Intellectual Property Office of the Republic of Croatia in the six years of its existence. In this respect, it stated that its intellectual property system had been constructed from the industrial property and copyright legislation of the previous State, appropriately amended, thus ensuring the continuity of intellectual property rights in Croatia, especially industrial property rights granted or applied for in the former State. Similarly, Croatia had continued to be a member of international agreements and treaties acceded to by the former State. It added that the Office attached particular importance to the question of training and had been assisted in this area by many European national offices. The integration of information technology into the work of the Office had been a priority and the major part of its activities, including documentation production, searches and archiving, were now computerized. The first issue of the official gazette, the Croatian Patent Gazette, had appeared at the beginning of 1994. The Delegation expressed its gratitude for the assistance provided by the Austrian Patent Office both in training and in the modalities for examining patent and trademark applications. The national Office had also received help from the German and Hungarian Patent Offices, and various forms of cooperation and contacts had been established with many other national offices. The visit of the Director General of WIPO to the national Office in 1994 had provided much encouragement to Croatia in its endeavors. Since January 1992, some 21,000 patent, trademark and industrial design applications had been received by the Office. With the stabilization of the working environment in the Office, it was hoped, in the course of 1998, to clear the backlog that had built up. Turning to national legislation, the Delegation stated that the revision of the country's intellectual property system was underway and it was hoped that the basic elements of the new system would begin functioning in 1998 and 1999. It stressed that the new system aimed to contribute to the evolution of the country toward a market economy; to aid in the integration of Croatia into Western Europe; to bring national legislation into line with the provisions of the TRIPS Agreement (on the accession of the country to the WTO); to aid progress toward the accession of the country to new international intellectual property treaties; and to ensure that national legislation continued to keep pace with developments at the international level. It noted that, to that end, new legislation on patents, integrated circuits, trademarks, industrial designs, geographical indications, appellations of origin and copyright and neighboring rights was being prepared in compliance with international and European standards. Finally, it announced that Croatia expected to accede, later in 1997, to the PCT and was according priority to discussions leading to accession to other international treaties. 92. The Delegation of the Czech Republic stated its support for WIPO's activities, in particular in the areas of norm-setting, international registration, development cooperation and information technologies and those of the WIPO Arbitration and Mediation Center. With regard to national developments in the field of intellectual property, the Delegation informed that preparations for accession to the European Patent Convention continued (the Czech Republic had been already granted observer status in the EPO), as well as harmonization of legislation with that of the EU and the TRIPS Agreement. It also mentioned that the Industrial Property Office of the Czech Republic continued to improve its computerized information network with a view to facilitating access to patent and trademark information through electronic means. In the area of copyright and neighboring rights, serious consideration was being given to ratification of the WCT and the WPPT. At the same time, national copyright legislation was under revision to harmonize it with EU and other international standards. The Delegation also informed that an amendment of the Copyright Act to the effect that the general protection period applicable after the death of the author would extend from 50 to 70 years was expected to come into force on January 1, 1998. Finally, the Delegation requested WIPO's advice on the compatibility of the draft Copyright Act which was now under preparation with current international standards and which was expected to be enacted by the year 2000. 93. The Delegation of Guatemala stated that its country had benefited from WIPO technical cooperation activities during the reporting period, particularly by participating in regional meetings and seminars organized by WIPO on intellectual property in Latin American countries. It mentioned the importance attached by its country to WIPO's assistance in relation to the computerization of national intellectual property offices and expressed the wish that WIPO continue to provide such assistance. It also hoped that WIPO continue to increase the volume of its development cooperation activities at international, regional and national levels, and requested WIPO's financial support to enable the participation of developing country officials in relevant regional and international activities. Finally, it was pleased to recall that during the reporting period, Guatemala had acceded to the Berne Convention. 94. The Delegation of Guinea thanked WIPO for the constant support and unfailing attention that it had always given to its country in general, and to its Industrial Property Service in particular, in form of promotional and information activities and activities to train and heighten the awareness of the agents of development. With a view to the preparation of the entry into force of the TRIPS Agreement, a major challenge for the coming millennium, the Delegation expressed the wish that its country might be placed among those that would benefit from WIPO projects for the modernization of national industrial property offices. 95. The Delegation of Indonesia stated that during his tenure as Director General of WIPO, Dr. Bogsch had laid the strong foundations on which to build a more effective intellectual property rights protection, and it was confident that the new Director General would capitalize on those past successes to infuse WIPO with fresh dynamism and inspiration in order to meet the challenges of the new millennium. From an ASEAN perspective, the tasks awaiting the new Director General included formulating the core issues in the new program and budget, restructuring the International Bureau as well as working out the new protocols and copyright treaties on audiovisual and databases by taking full advantage of the latest information technology. The Delegation stressed that intellectual property had become an increasingly important topic over the years, especially where the improvement of awareness and understanding of its role and function were concerned. Indonesia has benefited tremendously of this improvement through WIPO's development cooperation program. Thanks to WIPO assistance, significant progress had been achieved in training key personnel at all levels of intellectual property, including not only patent, trademark examiners and officials dealing with copyright but also judges, public prosecutors, police officers, academics and teachers in higher education institutions. Concerning efforts for the improvement of human resources and the promotion of public awareness of intellectual property, Indonesia, with WIPO's assistance, had conducted activities within the framework of the EC-ASEAN Patents and Trademarks Program (ECAP), as well as under the cooperation with the Japan International Cooperation Agency and Australia. Those activities had contributed to modernizing and strengthening Indonesia's intellectual property system, making it more compatible with the goals imposed by globalization and improved trade relations. Turning to legislative and enforcement issues, the Delegation recalled that Indonesia was due to begin the application of the TRIPS Agreement by the year 2000, and in that connection, domestic legislation had been adjusted through the enactment of amended copyright, patent and trademark laws, and five instruments of ratification of WIPO-administered treaties had been deposited. Those were a clear sign of the efforts undertaken. As a new member of the PCT, Indonesia had to perform all duties stipulated under the treaty through its patent office and intended to carry out a comprehensive study in that respect. The Delegation added that new laws and regulations on industrial designs, integrated circuits and trade secrets were being completed and relied on WIPO's continued support in that respect. The Delegation announced that a Directorate had been established under the Office of the Attorney General to especially deal with infringement of intellectual property rights, and expressed the hope that this initiative would be perceived as an indication of Indonesia's good faith and good will toward achieving WIPO's objectives and toward its present and future trading partners. The Delegation also mentioned the need of further assistance from WIPO to improve and strengthen its own intellectual property system. Special attention had to be given to enhancing the human resources development program, especially where administration and enforcement were concerned. Finally, the Delegation emphasized that the full implementation of the TRIPS Agreement was under way, and that new laws and accession to other WIPO conventions would follow. 96. The Delegation of Lesotho expressed its satisfaction with the work undertaken by the International Bureau in the past biennium, particularly the assistance given to developing countries to bring their intellectual property systems into conformity with the obligations under the TRIPS Agreement, and the increase in the number of long-term fellowships offered by WIPO to developing country officials for academic training in the intellectual property field. The Delegation also commended the International Bureau for the work done for the promotion of inventive activity and the development of human resources. The impact of rapid technological advances on the protection of intellectual property had increased the responsibilities, particularly in developing countries such as Lesotho, toward an immediate and efficient implementation of intellectual property rights in compliance with international treaties. In this regard, the Delegation requested the International Bureau to intensify development cooperation activities and to introduce programs that are especially tailored on the specific needs of developing countries. The Delegation noted with appreciation that WIPO was advocating a policy of equitable geographical distribution of staff within the International Bureau and recommended the empowerment of women, especially at the higher levels of the Organization. Appreciation was expressed on the subject of arbitration and mediation of intellectual property disputes, through the organization of appropriate conferences. In this regard, the Delegation requested the International Bureau to ensure the participation of developing countries in those specific forums. The Delegation also congratulated WIPO on its efforts for the promotion of regional economic integration through, for instance, the assistance given to organizations such as ARIPO and OAPI, a means to achieve common goals not only in the protection of intellectual property but also in overall economic growth. The Delegation also expressed its support to the proposal to grant SADC observer status at WIPO. In terms of technical assistance provided by WIPO during the period under review, the Delegation mentioned the development of human resources, the provision of office equipment and the formulation of a country project on strengthening the industrial property office. Regarding copyright, the Delegation said that the Government was currently involved in restructuring the copyright office, and in spreading awareness among both copyright users and owners, and officially requested WIPO to assist in organizing a national seminar in 1998. Finally, the Delegation expressed its hope that the Governing Bodies would come to constructive conclusions on the development of work in respect of the proposed Patent Law Treaty, the Treaty on the Settlement of Disputes, and new international instruments for the protection of databases and folklore. 97. The Delegation of Liberia expressed its thanks and gratitude to WIPO for the assistance it had rendered to Liberia during the past seven years of inactivity due to the civil conflict. It stated that although Liberia was a developing country and had recently joined WIPO, it had received benefits including training assistance and office equipment. In particular, in 1994, WIPO provided Liberia's industrial property office with a computer and it was with regret that the Delegation informed the meeting that the computer had been looted during the April 6, 1996, crisis in Monrovia. During the period under review, Liberia acceded to the Madrid Agreement. Modification to the Trademark and Copyright Law, in order to conform with international standards, was also being considered. The Delegation stated that as a democratically-elected government was now in power, marking the end of the civil conflict, and which had ushered in political, economic and social stability, it reiterated its earlier request for assistance from WIPO. This assistance would include, inter alia, the provision of more training facilities, sponsorship of two or more university professors in the field of industrial property, and re-equipping the industrial property office. 98. The Delegation of Mongolia expressed its country's appreciation of the work undertaken by WIPO in the period under review, which had included progress in the adoption and formulation of international norm-setting instruments (in the areas of copyright and neighboring rights, patent harmonization, dispute settlement and international protection of industrial designs), improved cooperation between WIPO and the WTO, and the holding of effective training courses, meetings and seminars dealing with issues such as the development of human resources and the TRIPS Agreement. The Delegation noted that its country continued to develop its Intellectual Property Office and had also, with the assistance of WIPO, amended its patent and copyright laws and enacted new legislation in the trademark field. Revision of its intellectual property legislation would continue with a view to bringing it into line with the country's obligations under the TRIPS Agreement. Discussions were currently underway on the possibility of Mongolia's adhering to the Madrid Protocol and to the TLT. The Delegation stated that its country attached increasing importance to improving its protection of intellectual property rights, which was a vital element in its transition toward a market economy. 99. The Delegation of the Netherlands expressed its satisfaction with the increase in resources for development cooperation which enabled WIPO to intensify its assistance to developing countries. The entry into force of the TRIPS Agreement was an important external factor that influenced the character of these activities. The Delegation attached great importance to a good synergy between WIPO and the WTO in a number of areas. As regards norm-setting, the Delegation stated that the two new treaties which had been adopted in December 1996, in the field of copyright and neighboring rights were encouraging and expressed the wish that this would also be the case in the future in the field of patents. With respect to information technology, the Delegation noted that the opening of the WIPO web site on the Internet was an important step, and that the availability of WIPO working documents and other information through this source was invaluable. The Delegation was looking forward to the results of the work of the WIPO Working Group on Information Technologies for Intellectual Property and hoped that the work of PCIPI would be continued without duplication with that of the Working Group. In conclusion, the Delegation stated that in this respect, proper attention should be given to those member States which had not yet been able to make full use of modern communication technology. 100. The Delegation of New Zealand noted that, during the period under review, the country's Patent Office had undergone a radical restructuring and business re-engineering exercise. The Office's new structure separated the hearings and related quasi-judicial functions of the Commissioner of Patents and Trade Marks from the core examination function and the Hearings Office had become a stand-alone unit. The increased use of new technologies had made it possible to reduce staff, while at the same time clearing the backlog of unprocessed patent and trademark applications. The Office was now able to examine all applications within five days of receipt. The trademark registry had been placed on the Internet and by late 1998 it was hoped that the registry would be able to provide online registration and searching services. As part of the changes, the Office had been renamed the Intellectual Property Office of New Zealand. The review of the country's patents, designs and trademarks legislation continued and included a recent round of consultations with its indigenous people, the Maoris, regarding their concerns about the registration of trademarks using Maori words and symbols. It was hoped that the Government would be able to consider final proposals for the reform of the Trade Marks Act in 1998. A minor technical amendment had been made to the Copyright Act during the year. A review of patent and trademark regulations was to be completed by the end of 1997. Following a review of the Office's fees, it was hoped to reduce both the number and the amount charged. The Delegation noted that its country's focus on WIPO's activities over the last few years had been on the development of the WCT and the WPPT, and on discussions of the proposed Patent Law Treaty. Its activities with respect to development cooperation had taken place in other forums, for example, the Commonwealth Secretariat and the Asia Pacific Economic Cooperation (APEC). 101. The Delegation of Niger recalled that, in the course of the 1996-1997 biennium, cooperation with WIPO had mainly involved the country's participation in training seminars and short-term training courses. WIPO had also organized two copyright seminars in collaboration with the Government of Niger. In the field of industrial property, a number of seminars and conferences had been organized on the Government's initiative with a view to improving the awareness of the main sectors concerned. The Delegation wished to see development cooperation activities intensify for the benefit of developing countries, especially in areas such as the exploitation of human resources and the modernization of industrial property offices. In that connection Niger wished to benefit from the organization of a regional seminar on industrial property, the supply of equipment with which to monitor the developments taking place in the field of electronic filing, and training fellowships for its executive staff. The Delegation of Niger also announced that the President of the Republic of Niger had just created a President of the Republic's Award for the promotion of invention and innovation, and requested WIPO support in that venture. 102. The Delegation of Panama announced that work had recently started in its country to establish a national Inter-institutional Commission on Intellectual Property which would be particularly entrusted with the formulation of a plan of action for achieving increasing self-reliance in dealing with intellectual property matters. In the same vein, it supported the adoption of a new strategy for planning development cooperation activities, with a view to better meeting the specific needs of each country, in conformity with the respective legislative and institutional framework. It also referred to the increasing commitments of developing countries in respect of international agreements on intellectual property and expressed the hope that WIPO would continue to support them with this task. The Delegation finally stated its belief that it was the responsibility of each member State to determine the areas in which WIPO's assistance may be beneficial according to the nationals' 103. The Delegation of Poland expressed its appreciation for WIPO's work in advancing intellectual property promotion worldwide, particularly in respect of development cooperation, norm-setting and international registration. Satisfaction was also expressed for the open and constructive manner in which work was carried out by the Organization on certain issues, in spite of the fact that full consensus on matters such as premises for WIPO, dispute settlement and the proposed Patent Law Treaty had not yet been reached. The Delegation noted with appreciation the volume of activities undertaken under the WIPO-WTO Agreement, especially in favor of developing countries. As regards norm-setting activities, it acknowledged with satisfaction the new draft of the proposed Treaty on dispute settlement, hoped for an early conclusion of the efforts made in connection with the proposed Patent Law Treaty and expressed interest in WIPO's work on well-known marks and Internet domain names. It also expressed satisfaction for the activities organized for countries in transition, particularly information and training seminars, and hoped that this would develop into regular, possibly annual, meetings held in turn in each country of the region. The Delegation mentioned that in 1997, Poland had been invited to start, in 1998, negotiations for joining the EU and had been granted observer status with the Administrative Council of the EPO as of July 1997. It also stated that in March 1997, Poland had acceded to the Madrid Protocol and to the Nice and Vienna Agreements, and had become party to the Rome Convention in June; also, the Strasbourg Agreement would come into force in respect of Poland in December 1997. The registration activities of the Patent Office of the Republic of Poland continued to climb, both within the PCT and the Madrid system. It added that computerization of that Office had advanced, thanks to the technical assistance provided, among others, by the EU and the EPO, and that a new Industrial Property Law was likely to be adopted in 1998. With regards to copyright and neighboring right, the Delegation stressed the action taken by Poland in adjusting its legislation to international standards. It was reflected by the adoption of the new Copyright and Neighboring Rights Act of 1994, as well as in the accession of Poland to the Paris Act of the Berne Convention and to the Rome Convention. Finally, the Delegation stressed the fact that Poland had adapted its legislation to international standards in a particularly short period of time. 104. The Delegation of Singapore, speaking on behalf of the Delegations of the ASEAN countries (Brunei Darussalam, Indonesia, Laos, Malaysia, Myanmar, the Philippines, Singapore, Thailand and Viet Nam), thanked WIPO for its support in organizing a number of successful seminars and conferences in the region, and especially the UNESCO-WIPO World Forum on the Protection of Folklore that had been held in Phuket (Thailand) earlier in 1997. The Delegation also supported the recommendations made by the Delegations of Chile and Ghana to carry out, at the earliest, the Phuket Plan of Action for the Protection of Folklore. The Delegation further recalled WIPO's assistance in the drafting and review of the intellectual property legislation of ASEAN countries, and the help and support received from WIPO in the training of their intellectual property personnel. 105. The Delegation of Slovakia, listing some of the country's latest achievements, stated that it had been granted observer status at the 67th Meeting of the Administrative Council of the EPO in June 1997, and that this was an important step toward Slovakia gaining full membership of the European Patent Organisation. The Delegation added that a revised trademark law had been adopted in 1997, in compliance with the EU "acquis communautaire" and the TRIPS Agreement. It also informed that Slovakia had acceded to the TLT (as of July 9, 1997) and the Madrid Protocol (as of September 13, 1997). The Delegation also stated that work was being carried out on their Patent Law in preparation for accession to the European Patent Convention. A revised Copyright Act providing also for the protection of computer programs, databases and satellite broadcasting had been passed to Parliament and was in compliance with the EU "acquis communautaire" and the TRIPS Agreement as well. 106. The Delegation of Spain recalled that during the period under review its country had withdrawn its reservation on Chapter II of the PCT and expressed the hope that this would lead in the near future to the establishment of the Spanish Patent and Trademark Office as a PCT International Preliminary Examining Authority. The Delegation also trusted that the Governing Bodies of WIPO would approve the renewal of the Agreement between WIPO and the Spanish Patent and Trademark Office on the latter's acting as a PCT International Searching Authority. On the domestic level, the Delegation mentioned that the modernization of the Spanish Office had been pursued in 1997 and that a new examination system had been established for industrial property attorneys. On the international level, the Spanish Office had continued to cooperate with WIPO and the EPO to provide technical cooperation to Latin American countries, particularly Argentina, Chile, Mexico, Uruguay and Venezuela. In that context, it mentioned the progress made under the project for the production of the DOPALES PRIMERAS CD-ROM. It also added that Spain would provide technical and financial support for the organization of the third Ibero-American Congress on Copyright to be held in November 1997 in Montevideo and was willing to equally support the organization of an Ibero-American meeting of heads of copyright offices, also in Montevideo, before the said Congress. It further announced that in 1998 Spain would host an international symposium for judges on the European patent. Finally, it announced that its Government was working toward an early ratification of the WCT and the WPPT, of which Spain had been one of the first signatories. 107. The Delegation of Sri Lanka stated its appreciation of WIPO's continued assistance with development cooperation activities in developing countries, and that these countries were becoming increasingly aware of the benefits of an effective, modern, intellectual property system as well as adherence to international conventions in this field. The Delegation noted how WIPO's development cooperation program had become a tool for international cooperation, and stressed the importance that developing countries placed on attaining the objectives set out in the program. The Delegation attributed the growing awareness of intellectual property rights in the developing countries to the International Bureau's success in supporting institution and capacity building. Furthermore, the Delegation emphasized that Sri Lanka had benefited from WIPO's training courses, symposiums, workshops, advice on drafting legislation, promotion of inventive activities and the encouragement of regional and sub-regional cooperation. The Delegation pledged its continued willingness to be a part of WIPO's development cooperation program, and remarked that, apart from one year, it had since 1984, hosted the WIPO Intellectual Property Training Course for Developing Countries in Asia and the Pacific. The Delegation thanked all donor countries and international organizations for their support of WIPO development cooperation activities, and encouraged them to increase such assistance and support. 108. The Delegation of Switzerland drew attention to the very favorable record of activities of an Organization that had been able to adapt rapidly to the changes of a globalizing economy. It mentioned in particular the new treaties concluded in December 1996 in the field of copyright and neighboring rights, expressing the wish that those new treaties, but also the Madrid Protocol and the Trademark Law Treaty, might be as widely adhered to as possible. It added that the work started on database protection and the protection of audiovisual works should continue in order to provide a rapid response to the new rhythm imposed by technology. It emphasized that Switzerland attached very great importance to information technology in that it would facilitate and speed up the process of giving developing countries and countries in transition access to information, thereby revolutionizing the philosophy of international cooperation and technical assistance. 109. The Delegation of Togo noted with approval the efforts made by WIPO to bring about the conclusion of a protocol on audiovisual performances and to establish a treaty on the settlement of disputes between States in the field of intellectual property, and encouraged the Organization to intensify its efforts to introduce texts or provisions for the international protection of folklore and databases. The Delegation was pleased with the depth and quality of the cooperation between its country and WIPO in the field of intellectual property. It said that the three-year program of cooperation agreed upon between WIPO and Togo in the field of copyright and neighboring rights for the period from 1996 to 1998 was proceeding satisfactorily. The Delegation asked for WIPO assistance in the strengthening of its national industrial property structure, and said that Togo had been working for a year on the experimental introduction of intellectual property teaching at university level, which it would like to extend to other schools and institutions in the country, and that it was also considering the introduction of an intellectual property chamber within its judicial system, which would require the training of trainers and magistrates. Training fellowships, documentation and specialized equipment would be required to that end, and the Delegation consequently requested WIPO assistance for the realization of those projects. 110. The Delegation of Turkey stated that its country's efforts to protect industrial property, in line with international standards, had continued over the past year. The Delegation added that an industrial property attorney system had been put into place and there were now 156 registered trademark attorneys and 97 registered patent attorneys in Turkey. It stated that Turkey had now completed its national procedures for accession to the Madrid Protocol, the Locarno Agreement and the Budapest Treaty, and that accession was expected to take place in the near future. The Delegation added that the Turkish Patent Institute had held several seminars and conferences in 1996 and 1997 to increase awareness of industrial property and to spread information on the new Turkish industrial property system. Furthermore, the Turkish Patent Institute had organized an International Conference in Istanbul entitled "Industrial Property Protection in Turkey, June 24 to 25, 1997" and thanked WIPO, the EU, the EPO, the Community Trademarks and Designs Office (OHIM), and the patent offices of Bulgaria, Germany, Japan and the United States of America for their support in that respect. The Delegation had stated its expectation of WIPO's highest level representation at the opening ceremony of the International Conference in Istanbul and expressed the hope that this would be realized in the near future. The Delegation confirmed that the legislative framework for the protection of industrial property was in place and work had begun on developing the requisite administrative infrastructure. The Delegation thanked the EPO and the Austrian and German patent offices for their help in achieving this. The Delegation finally stated that Turkey would continue to improve and develop industrial property protection, and be available to assist developing countries in that respect. 111. The Delegation of Uganda expressed its country's gratitude for the assistance it had received from WIPO in the period under review, inter alia, in the development of human resources, in revising its national legislation to comply with the TRIPS Agreement, and in drafting a new law on industrial designs. It made particular reference to the training provided by WIPO to the staff of its national office in various areas, including that of the PCT, and the WIPO National Workshop for intellectual property practitioners on drafting patent documents and claims that had been organized by WIPO in the country in November 1996. It stressed the continuing demand for workshops of that kind. Turning to the issue of the protection of folklore, the Delegation voiced its support for an international instrument in that field and said that its country's draft law on copyright and neighboring rights would include provisions on such protection. In conclusion, the Delegation requested WIPO's assistance to develop a national project for the modernization of the national intellectual property office and to organize further training activities in the areas of trademarks, drafting of patent claims and general intellectual property practice. 112. The Delegation of the United States of America, in reviewing the activities of WIPO during the period since the 1995 Governing Bodies meetings, was pleased to note the many activities of the Organization that were addressing the protection of intellectual property in the light of the constant stream of communication and technology advances. To mention but a few activities related to these advances, the Delegation mentioned the two new treaties relating to copyright and neighboring rights, the discussions relating to domain name issues and trademarks, and most importantly, the efforts leading up to the formation of the proposed Information Technology Committee. It was also pleased to note the increased use by the International Bureau of these same communication and technology advances. In particular, the Delegation applauded WIPO for its efforts to create and use its web site to reduce the expensive flow of paper emanating from the Organization and replacing it with a very efficient and low-cost flow of electrons to convey information. This information already included notices and documents for meetings, resource materials for using the PCT or the Madrid Agreement and Protocol, and an ever-increasing volume of materials which were formerly transmitted solely in paper or other fixed media forms. The Delegation also commended WIPO on the increased use of the Internet by the WIPO staff for communicating with member States, which greatly accelerated the interchange of information between WIPO and its member States. The Delegation was also particularly pleased to see WIPO so effectively addressing its conference facility needs by utilizing both technological solutions such as the audiovisual links that broadcast the proceedings in room A and the physical solution of using other facilities in Geneva including the CICG last December for the Diplomatic Conference, and the previous week the Palais des Nations for the PCT Assembly meeting. The Delegation could envisage in the near future the possibility of extending these links to enable individuals in any part of the world to speak and participate in WIPO meetings. While the activities report had an impressive array of activities geared to new technologies, the Delegation believed that this type of activity would become more and more prevalent. Under the leadership of Dr. Idris and based on the excellent foundation already present, the Delegation foresaw more and more activities arising from technological advances. For example, WIPO had not yet taken full advantage of even current technology for its training function and the Delegation expected that WIPO could take advantage of the increased availability of audiovisual communications, including interactive use of the Internet and remote access to WIPO-sponsored training seminars or information meetings, to carry out its essential training and educational programs. It was therefore with great satisfaction that the United States of America noted the significant progress that had been made toward establishing the necessary institutions and resources to enable WIPO to play a central role in improving the use and dissemination of information technologies. It added that the meetings held over the past year had demonstrated the interest and will of the WIPO membership in pursuing the United States of America's initiative on this topic. Turning to activities within the United States of America, the Delegation was pleased to report that earlier this year, the United States of America had signed the WCT and the WPPT. Since then, legislation had been introduced in the Congress to implement those treaties, indicating the intent of the Administration to ratify and implement those treaties as soon as possible. The United States of America, as it had in past years, had engaged in a substantial level of technical assistance programs with foreign governments. It noted that representatives of the United States Patent and Trademark Office (USPTO), the United States Copyright Office and several other government agencies had sponsored or participated in a large number of seminars and training programs for representatives of developing countries and countries in transition. In July 1996, the USPTO had sponsored the Intellectual Property Conference for the Americas, which had drawn senior government officials and business representatives from nearly all countries of North, Central and South America. It added that within the USPTO, there had been increased use of technological advances in the patent granting and trademark registering processes. State-of-the art computers had been deployed to the more than 2000 patent examiners of the USPTO to enable them to participate in an extensive internal network. This network enabled them to access both local and remote databases of prior art and to communicate electronically with each other and with patent applicants. The Delegation also stated that the investments in deployed information technology solutions had been complemented by extensive investments in prototype systems for electronic filing and management of patent and trademark applications. It hoped that the solutions that had been developed incident to these projects would find a wider application and use within the WIPO membership. In conclusion, the Delegation was pleased with the developments within the International Bureau of WIPO and the United States of America over the past year. 113. The Delegation of Viet Nam expressed its appreciation of the achievements made by WIPO in the period under review. It mentioned that, parallel with economic growth, intellectual property protection had been continuously strengthened in Viet Nam. Following the entry into force, on July 1, 1996, of a Civil Code encompassing general principles on the protection of intellectual property, decrees on the implementation of the said principles had been issued in November and December 1996. It further added that legislation was being drafted, inter alia, on administrative procedures against violations of regulations and border control measures in the field of industrial property. The Delegation stressed that those new legal instruments had brought national legislation in line with international standards, especially those of the TRIPS Agreement, and that following the application of Viet Nam to join the WTO, new legislation on the protection of layout designs of integrated circuits, undisclosed information, geographical indications and repression of unfair competition was expected to be enacted before the year 2000. The Delegation also mentioned that, in the last years, its country had strengthened cooperation ties, particularly with ASEAN countries, and that close cooperation in intellectual property was also maintained, in addition to WIPO, with the EPO, Australia, France and Japan. 114. The Delegation of the Benelux Trademark Office and Benelux Designs Office (BBM/BBDM), speaking on behalf of its member States (Belgium, Luxembourg and the Netherlands), said that the two Offices had in recent years doubled their participation in assistance to developing countries in cooperation with WIPO, and that the effort would be kept up in 1998. 115. The Delegation of the Commission of the European Communities (CEC) reported that in July 1995, the Commission had adopted a Green Paper on Copyright and Neighboring Rights in the Information Society, which formed part of the Action Plan on the Information Society. It examined the possible implications of the development of new technologies with a view to any appropriate adjustments to ensure the continuing adequate protection of the rights in question. The Paper had since been discussed amongst interested circles at a Conference organized by the Commission in Florence in June 1996, and had received the support of the European Parliament in September 1996. It added that in November 1996, the Commission had adopted a Communication on the results of the consultation process launched by the Green Paper, and that this Communication confirmed the need for action at the Community level in order to adapt and complete the existing regulatory framework. It mentioned that the services of the Commission were now working on a draft directive on copyright and neighboring rights in the information society which would essentially be directed to, firstly, ensuring the free circulation of new products and services subject to intellectual property rights and, secondly, encouraging creativity and investment in this sector within the EU. It added that this opportunity would also be taken to implement within the EU a certain number of the obligations following from the two recent WIPO treaties adopted in December 1996. The European Communities had already signed those treaties and the proposal for ratification was also in preparation. The Delegation stated that the Commission supported continuing work in WIPO for the conclusion in the near future of a protocol on audiovisual performances and for the further examination of the interests of broadcasters. It also stated that the Commission was ready to participate in any WIPO meeting to clarify the interest which others had expressed in the protection of folklore. The Delegation then referred to the adoption by the Council of the EU and the European Parliament, in March 1996, of Directive 96/9/EC Concerning the Legal Protection of Databases which harmonized existing copyright protection in the Member States and created a new sui generis economic right in databases. It stated that the Commission supported continuing work in WIPO toward the adoption of an international treaty in this area. It also mentioned that in March 1996, the Commission had adopted a proposal for a directive on the artists' resale right (droit de suite) for the benefit of an original work of art, that the proposal had already received a favorable opinion from the European Parliament and that it was under discussion with a view to adopting a common position in the Council of the EU. As far as industrial property was concerned, the Delegation pointed out that substantial progress had been made with the strengthening of industrial property protection at European Community level. First, the examination of the proposed Directive on Biotechnological Inventions was going ahead, and the present text made allowance for the ethical concerns that had brought about the rejection of the 1998 proposal. The Delegation considered that a common position, which was the first step towards final adoption, could be taken by the Council in November 1997. Secondly, the Delegation announced that a common position had been taken in June 1997 on the harmonization of national industrial design legislation, and that it did not feature the "repair clause" that had caused profound differences of opinion. Difficulties were therefore expected in the continuing legislative process. The Commission hoped that final adoption would occur before the end of the current year, however. Thirdly, the Delegation said that the work on European Community's adherence to the Madrid Protocol had progressed less rapidly than the Commission had hoped, and that there was no question of ratification of the Protocol and the necessary legislative amendments being adopted in 1997. Fourthly, the Delegation made a brief mention of future action in the field of patents and utility models. With regard to patents, a Green Paper had been adopted by the Commission on June 24, 1997, as the starting point for a wide-ranging consultation on the protection of innovation in Europe. The central component had to do with the Community Patent (which was still not in force) and with the adjustments that might be made for users to be offered an accessible, reliable and reasonably priced system. Other important matters such as software-related inventions were touched upon. Professional groups would be given a hearing in Luxembourg at the end of November. Appropriate follow-up action would be decided by the Commission at the beginning of 1998. The Delegation added that a proposed Directive harmonizing national utility model laws would be submitted before the end of 1997. Finally, it announced that the Commission was going ahead actively with technical assistance and that its action, financed with Community funds in an amount that since the start had exceeded 20 million Swiss francs, was managed by the EPO, a number of patent and trademark offices of member States and the Alicante Office. Finally, the Delegation mentioned that increased action was planned, both to cover new geographical areas and to extend current action. Regarding the Office for Harmonization in the Internal Market (Trade Marks and Designs) (OHIM), the Delegation reported that on April 1, 1996, the doors of the Office had been officially opened to the public and community trademark applications had been accepted by it since that date. It further informed that 43,010 applications had been received in 1996, and approximately a further 18,000 during the first eight and a half months of 1997, making a grand total of 61,082 applications received as of September 17, 1997. Concerning the geographical distribution of applications, it noted that about 36,000 applications (59%) came from Member States of the EC and the remaining 41% from countries outside of the EC. On a country-by-country basis, the United States of America lead with 29%, which corresponded to no less than 17,700 applications; the second place was occupied by Germany, with 16%, followed by the United Kingdom, Spain, Italy and France. The applications were not concentrated on a few countries and came from no less than exactly 100 different countries. Concerning the distribution of applicants, it noted that the applications came from about 28,000 different applicants, which corresponded to about two applications per applicant. Large multinational companies played an important, but not the dominating, role. In conclusion, it stated that the success of the Community trademark system was a truly global one, although some delay and difficulties had arisen in dealing with files. In the latter respect, the Delegation assured that the Commission was making every effort to overcome them. It also emphasized that, since the beginning of the year, publication of Community trademark applications had taken place and at an increased pace, and the first Community trademarks would be registered shortly. The first registration certificates would be issued in a solemn ceremony, on the occasion of the visit of the Director General of WIPO to Alicante. Finally, the Delegation recalled that the Community Trade Mark Regulation complied with the Paris Convention and the TRIPS Agreement, that the Commission accepted priority rights based on filings in countries party to or member of the Paris Convention or the TRIPS Agreement, and that a Community trademark application was equivalent to a national application in each of the Member States of the Community. It added that the Commission would clearly like to see that a Community trademark application and a priority document issued by the Commission would be internationally accepted as the basis for a subsequent application in another country, preferably without any additional requirements. Most countries already proceeded in that manner and the Commission was willing to offer to work bilaterally with any countries still having difficulties to resolve them. In conclusion, the Delegation thanked all delegations and their national offices, but in particular WIPO and its Director General, for the positive feedback and the continuous support given to their Office and stated that the Commission would continue to cooperate with WIPO in the best possible ways. 116. The Delegation of the African Intellectual Property Organization (OAPI) announced that, two months previously, the OAPI Administrative Council had appointed a new management team responsible for greater involvement in the creation of the conditions that were essential for member Countries to have access to technological information, and also for the establishment of systems for the exploitation of research findings. Recalling that in 1992 the OAPI Administrative Council had, in its Abidjan Declaration, entrusted the Organization with a greater role, the Delegation emphasized OAPI's determination to redefine its relations with national liaison structures in order to strengthen its presence in member States. In that connection it emphasized that it would do its utmost to introduce a training system that would give those countries the necessary skills in the intellectual property field, and also to invest in the exploitation of inventions and innovations through the creation of conditions conducive to the establishment of active cooperation between research and business. The Delegation commented appreciatively on the many activities carried on with WIPO assistance in OAPI member Countries in 1996 and 1997, and expressed the wish that they might be diversified more. In that context, it mentioned in particular the holding, among other things, of two seminars for the benefit of the magistrates of member countries in Yaoundé, to general introductory courses on industrial property in Ouagadougou and Conakry, a regional workshop on industrial property promotion for the benefit of persons responsible for national liaison structures in Libreville, a regional symposium on TRIPS in Cotonou, specialized training for OAPI officials and, more recently, namely at the beginning of September, the organization in Abidjan of a subregional workshop on the teaching of intellectual property. The Delegation also welcomed the fact that, during the period under review, WIPO had provided most of the member Countries of OAPI with appropriate and sustained assistance in the fields of training, the modernization of national liaison structures, the provision of information and office technology hardware and patent documentation and information. As for future activities, it spoke of the importance that OAPI attached to mastery of computer technology and to the revision of the Bangui Agreement with a view to providing member Countries with the legal tool that would serve them best in the context of the TRIPS Agreement. 117. The Delegation of the World Trade Organization (WTO) expressed the satisfaction of its Organization with the implementation of the WIPO-WTO Cooperation Agreement. It also stressed the importance attached by the WTO to WIPO's legal-technical assistance to members of WIPO, also members of the WTO, and other countries members of the WTO, in introducing the changes necessary to comply with the TRIPS Agreement. It concluded that the constructive cooperation of the International Bureau and its staff in the implementation of the above Agreement had been much appreciated by the WTO under the tenure of Dr. Bogsch, and that the WTO looked forward to building on such a constructive cooperation with the Director General elect. 118. The Governing Bodies, each as far as it was concerned, reviewed and approved the reports and activities contained or referred to in documents AB/XXXI/4, 5 and 6; noted the interim financial statement for 1996 as contained in paragraph 1001 of document AB/XXXI/5; noted the status of the payment of contributions on September 15, 1997, as contained in document AB/XXXI/10; and noted the report contained in document AB/XXXI/11. ITEM 6 OF THE CONSOLIDATED AGENDA: ACCOUNTS FOR THE 1994-95 BIENNIUM; ARREARS OF CONTRIBUTIONS OF DEVELOPING COUNTRIES; PROGRAM AND BUDGET AND CONTRIBUTIONS FOR THE 1998-99 BIENNIUM 119. Discussions were based on document AB/XXXI/2. 120. The Chairperson said that consideration of this item would be divided into two parts, the first dealing with the decision required in paragraph 4 of document AB/XXXI/2 (Accounts for the 1994-95 biennium) and the second dealing with paragraphs 10 and 12 of that document (Program and budget for the 1998-99 biennium; Contributions for the 1998-99 biennium). 121. The Governing Bodies approved the accounts for the 1994-95 biennium. 122. The Director General stated that the items of the agenda just finished dealt with WIPO's activities and finances in the past. Most of the remaining agenda items dealt with matters which concerned the future, namely, activities that the new Director General, Dr. Kamil Idris, prepares and would prepare himself. The Director General therefore asked the Chairperson and the delegates that he be excused from participating in the discussions of the items concerning the future. His absence would underline what he had already said in connection with the program and budget, namely, that even if he should have the title of Director General for another two months, the International Bureau, its staff, its finances and other human and material resources were as of now directly under the orders of the new Director General, Dr. Kamil Idris, to whatever extent he so wished. 123. The Chairperson thanked the Director General for the gesture. 124. All delegations gave the Director General a standing ovation as he left the room. 125. The Chairperson then turned to the consideration of paragraphs 10 and 12 of document AB/XXXI/2, and noted that, with respect to the authority to continue to pay expenditures up until the point that the new Director General might be ready to present his new draft program and budget, it was her understanding, confirmed by the Legal Counsel, that the last paragraph of the resolution of the Budget Committee gave the legal authority for expenditures from January 1, 1998, until the adoption of the program and budget that would be presented by the new Director General. 126. The Delegation of Ecuador, speaking on behalf of the countries of Latin America and the Caribbean (GRULAC), thanked the Chairperson for that clarification and for the position just adopted by Dr. Arpad Bogsch. The Delegation stated that the members of GRULAC considered it important to highlight that many of the issues subsumed under item 6 of the agenda were covered in the WIPO program and budget, and therefore GRULAC considered that these should be taken up by the new Director General. GRULAC would like very much to receive from the International Bureau in the coming months the financial report of June to November 30, 1997, with a report of the activities completed and those still outstanding within the framework of the mandate to be concluded in December 1997. At the same time, the International Bureau might inform WIPO Member States of the commitments undertaken and activities at present underway that would be pursued beyond the end of 1997. On behalf of GRULAC, the Delegation said how important it considered the question of the establishment of a standard by WIPO of the basic expressions and protections of folklore and to a broad treatment of broadcasting issues. 127. The Delegation of Canada strongly supported the recommendations made by the Budget Committee in April 1997, and invited the new Director General to submit his own program and budget for the upcoming biennium for the consideration of the next session of the Budget Committee. In particular, the Delegation of Canada would like to see Dr. Idris address in his program and budget WIPO's priorities for the upcoming biennium, which the Delegation said should include the institution of effective evaluation mechanisms on its programs and activities, guidelines on the use of the special reserve fund, and a vision and program for the use of information technology in WIPO's activities. 128. The Delegation of Germany, as a member of the Budget Committee, had participated in the meeting in April 1997, when the draft program and budget submitted by the outgoing Director General was discussed. The Delegation referred to its fairly long statement, reflected in an annex of document AB/XXXI/2, which put forward its point of view concerning the future program and budget and how to handle the future of this Organization. The Delegation said that that statement was still valid, apart from the element concerning the reduction of PCT fees by a weighted average of 15%, which had already been decided by the PCT Assembly. The Delegation thanked all who had participated in that decision. And for the rest, he invited the incoming Director General to take note of the points the Delegation had made in April, which were still valid concerning information technology, norm setting and so on. 129. The Delegation of Sri Lanka, speaking on behalf of the Asian Group, supported the Budget Committee's recommendations contained in document AB/XXXI/2. Having given its support for those recommendations, with regard to paragraph 10 of that document--which invited the new Director General to present his draft program and budget by a date to be fixed by the Governing Bodies--the Delegation said it would like to hear from the new Director General as to the preparation of his budget and the time frame for presenting that budget to the Budget Committee. 130. The Delegation of Côte d'Ivoire, speaking on behalf of the African Group, expressed its support of the recommendations made by the Budget Committee, particularly with respect to paragraph 10 of document AB/XXXI/2. It would like the new Director General to give his opinions and introduce the elements that he would like to see in the new budget, which will be managed under him. The Delegation said that it was very interested in having a certain number of items taken into account, in particular, an increase in the budget for development cooperation, especially as a phase was being entered in which the information technology element, as part of the global information network, was something which would affect the majority of the countries of Africa. The African Group also wanted to see a project for the protection of folklore and audio-visual elements to be taken into account in the future budget, particularly in terms of regional consultations that would take place in preparation for the various treaties. The Delegation had stressed at its recent meetings that all these matters should be taken into account in the new budget. As the Delegate of the Asian Group had said, the Delegation of Côte d'Ivoire also awaited information as to when the new Director General planned to present his budget. 131. The Delegation of the United States of America, like the Delegation of Germany, said that it would like the comments that it had provided on the draft budget earlier this year to be factored into the preparations by Dr. Idris of his new budget. It also highlighted its desire to ensure that, in the preparation of that budget, the results and progress on the work in relation to information technologies, as outlined in the recommendation from the meeting held earlier this summer on information technologies for intellectual property, would be factored into the planning and preparation of the program and budget. Like the Delegation of Sri Lanka, the Delegation of the United States of America said that it would like to obtain from Dr. Idris some indication of the schedule that he planned to follow in the preparation of his draft program and budget, as well as the date next year for the meeting to discuss and work on that budget. The Delegation welcomed the views of the new Director General on this draft program and budget, and looked forward to some very productive work in the next few months. 132. The Delegation of France associated itself with what had been said by the Delegations of Germany and the United States of America. At the same time, speaking on behalf of Group B, the Delegation of France said that it welcomed the decisions taken by the Budget Committee, namely, to defer all matters related to the forthcoming biennium until a future date, and very much hoped that Dr. Idris would be ready to propose a budget. Group B was ready to cooperate if necessary in the preparation of this budget, and was ready and willing to assist Dr. Idris, if he wished. The Delegation added that the reduction in PCT fees was welcomed, as that would contribute to an overall reduction in the cost of patents, which was of general interest to everyone; the Delegation noted that the EPO had already taken a similar decision to reduce its fees effective July 1, 1997. 133. The Delegation of Chile supported the recommendations from the Budget Committee. It considered it most suitable that the new Director General should begin work in preparing a new program and budget once the present Governing Bodies meetings had been concluded. In this sense, it also welcomed the decision taken by Dr. Bogsch. The Delegation supported the Budget Committee's recommendation to the effect that the contributions for 1998-99 should be maintained at the same level as for the 1996-97 biennium. In concluding, the Delegation said that it attributed great importance to the establishment of a mechanism for evaluation of cooperation activities, and hoped that the new Director General would bear this in mind in his future considerations. 134. The Delegation of Senegal, which had participated in the Budget Committee meeting, expressed its support for the Budget Committee's recommendation. Since a budget is a political instrument, it was important to hear the views of the Director General elect on it. The Delegation stressed that detailed consideration should be given to the way in which the contributions are distributed, and the Delegation felt that Dr. Idris should make this question a central element in the proposals that he would be presenting shortly. 135. The Delegation of China, as a member of the Budget Committee, fully supported the recommendations of the Budget Committee. The Delegation reaffirmed its full support of the incoming Director General's intention of making his proposals regarding the 1998-99 program and budget. The Delegation said that it would like to maintain very good cooperative links with WIPO. 136. The Delegation of Japan joined other previous speakers who supported the recommendation made by the Budget Committee. The Delegation wished to await a new budget proposal, together with a review of the Organization's structure. The Delegation also expected that, in the course of his preparations, the new Director General, Dr. Kamil Idris, would take into account the use of information technology in the International Bureau's management and activities, in particular, in PCT registration activities. 137. The Director General elect said that he and his colleagues noted with great interest the very useful observations and comments just made by various delegations. On the substance of the draft program and budget, he intended, together with his colleagues, immediately after the present sessions of the Governing Bodies, to proceed with the preparation of the new draft program and budget. And he very much hoped that in the two months ahead, namely, October and November, they would finalize a basic draft program and budget as far as one could see the future direction of this Organization. Then, in December, if everything went as planned, he intended to initiate some consultations with the Regional Groups in Geneva; the modalities of these consultations would be discussed perhaps after the present sessions of the Governing Bodies. At the same time, in December, the proposed draft program and budget would be sent for translation into the various working languages of WIPO. Sometime after Christmas, perhaps towards the end of January, he intended to circulate the draft program and budget to the various missions and capitals of the various member States of this Organization. Then, based on this very initial calendar, he hoped that towards the last week of March next year, the Budget Committee and the General Assembly could be convened, during the same week, for the endorsement of the draft program and budget. The Director General elect hoped that with this general indication, one could proceed accordingly. 138. The Governing Bodies noted what was stated by the Director General elect, and decided to fix the contributions for the 1998-99 biennium at the same level as for the 1996-97 biennium. 139. The Annex contains information on the amounts of the contributions expected to be payable by each Member State under the unitary contribution system according to the class of contribution in force on January 1, 1998. ITEM 7 OF THE CONSOLIDATED AGENDA: 140. See the report of the session of the WIPO General Assembly (document WO/GA/XXI/13). ITEM 8 OF THE CONSOLIDATED AGENDA: MATTERS CONCERNING THE DRAFT TREATY FOR THE SETTLEMENT OF DISPUTES BETWEEN STATES IN THE FIELD OF INTELLECTUAL PROPERTY 141. See the report of the session of the WIPO General Assembly (document WO/GA/XXI/13). ITEM 9 OF THE CONSOLIDATED AGENDA: MATTERS CONCERNING THE DRAFT PATENT LAW TREATY 142. See the report of the session of the WIPO General Assembly (document WO/GA/XXI/13). ITEM 10 OF THE CONSOLIDATED AGENDA: MATTERS CONCERNING THE PCT UNION 143. See the report of the session of the PCT Union Assembly (document PCT/A/XXIV/10). ITEM 11 OF THE CONSOLIDATED AGENDA: MATTERS CONCERNING THE MADRID UNION 144. See the report of the session of the Madrid Union Assembly (document MM/A/XXVIII/3). ITEM 12 OF THE CONSOLIDATED AGENDA: MATTERS CONCERNING THE HAGUE UNION 145. See the report of the session of the Hague Union Assembly (document H/A/XV/3). ITEM 13 OF THE CONSOLIDATED AGENDA: MATTERS CONCERNING THE NICE UNION 146. See the report of the session of the Nice Union Assembly (document N/A/XV/2). ITEM 14 OF THE CONSOLIDATED AGENDA: AVAILABILITY OF DATA OF THE INTERNATIONAL CLASSIFICATIONS 147. Discussions were based on document AB/XXXI/9. 148. The Delegations of Finland, France and Japan supported the proposals contained in the above-mentioned document. The Delegation of Japan also announced that the Japanese Patent Office cooperated with the Japan Patent Information Organization in the publication of a CD-ROM containing the Japanese version of the IPC. 149. In reply to a question raised by the Delegation of France, relating to the future publication of the International Classifications, and in particular the IPC, in paper form, which, in its opinion, was more suitable for certain categories of users than an electronic version, the International Bureau said that the publication of the International Classifications in paper form would be continued and that no decision to cease that publication would be taken without the approval of the Assemblies of the respective Unions. 150. The Delegation of Germany, while generally supporting the proposals of the International Bureau, expressed concern that the intended decrease of the price of the IPC:CLASS CD-ROM for private users might not reflect the considerable work conducted by the German Patent Office in the preparation of the German version of the IPC. The International Bureau clarified that the proposal concerning the electronic forms of publications other than CD-ROMs applied only to the authentic versions (English and French) of the International Classifications, and that the new price of the IPC:CLASS CD-ROM for private users would be fixed in consultation with the offices which cooperated with the International Bureau in producing the data contained in the said CD-ROM. 151. The Assemblies of the IPC, Nice, Vienna and Locarno Unions approved the proposals set forth in paragraph 8 of document AB/XXXI/9. ITEM 15 OF THE CONSOLIDATED AGENDA: AUDIOVISUAL PERFORMANCES AND DATABASES AND FOLKLORE 152. See the report of the session of the WIPO General Assembly (document WO/GA/XXI/13). ITEM 16 OF THE CONSOLIDATED AGENDA: INFORMATION TECHNOLOGIES FOR INTELLECTUAL PROPERTY 153. See the report of the session of the WIPO General Assembly (document WO/GA/XXI/13). ITEM 17 OF THE CONSOLIDATED AGENDA: INTERNET AND THE WIPO ARBITRATION AND MEDIATION CENTER 154. See the report of the session of the WIPO General Assembly (document WO/GA/XXI/13). ITEM 18 OF THE CONSOLIDATED AGENDA: 155. See the report of the session of the WIPO Coordination Committee (document WO/CC/XXXIX/5). ITEM 19 OF THE CONSOLIDATED AGENDA: APPROVAL OF AN AGREEMENT BETWEEN WIPO AND THE EURASIAN PATENT ORGANIZATION (EAPO) 156. See the report of the session of the WIPO Coordination Committee (document WO/CC/XXXIX/5). ITEM 20 OF THE CONSOLIDATED AGENDA: APPOINTMENT OF MEMBERS OF THE WIPO ARBITRATION COUNCIL 157. See the report of the session of the WIPO Coordination Committee (document WO/CC/XXXIX/5). ITEM 21 OF THE CONSOLIDATED AGENDA: DESIGNATION OF AUDITORS 158. Discussions were based on document AB/XXXI/3. 159. The Delegation of Côte d'Ivoire asked if it was a rule established in the Convention that it be the host country which should, for all time, be the auditor. 160. The International Bureau stated that there was no such rule. 161. The Delegation of Côte d'Ivoire suggested that it would be a good idea, bearing in mind the phase the Organization was going through now and the sensitive nature of the matter, to perhaps ask the Director General elect to make some proposals whether to continue with Switzerland or not. 162. The Chair said that the Delegation of Côte d'Ivoire had raised an issue that deserved a broader discussion and a fuller consideration, in making the proposal that consideration be given to changing the Auditor designated by the Organization. Discussion of this agenda item was suspended so that the proposal of the Côte d'Ivoire be added to the agenda of Group discussions, following which there would be further discussion of this agenda item. 163. After those discussions in the Groups as to how they wanted to proceed with this agenda item, and after consultations with the Group Coordinators, the Chair advised the General Assembly that the Group Coordinators had reached a consensus whereby Switzerland would be renewed as the Auditor of the accounts of WIPO, of the Unions administered by WIPO, and of the accounts of technical assistance projects executed by WIPO and financed, in particular, by UNDP, up to and including the year 1999, so that would be for the next biennium, and that the General Assembly would request the International Bureau to prepare, for the consideration of the 1999 session of the General Assembly, the options available for decision on the future designation of auditors. 164. On the advice of the WIPO Coordination Committee, the WIPO General Assembly and the Assemblies of the Paris, Berne, Madrid, Hague, Nice, Lisbon, Locarno, IPC, PCT and Vienna Unions adopted the consensus solution given in the preceding paragraph. ITEMS 22, 23 AND 24 OF THE CONSOLIDATED AGENDA: ELECTION OF THE MEMBERS OF THE EXECUTIVE COMMITTEES OF THE PARIS AND BERNE UNIONS AND DESIGNATION OF THE AD HOC MEMBERS OF THE WIPO COORDINATION COMMITTEE ELECTION OF THE MEMBERS OF THE BUDGET COMMITTEE ELECTION OF THE MEMBERS OF THE PREMISES COMMITTEE 165. Discussions were based on documents AB/XXXI/7, WO/GA/XXI/7 and WO/GA/XXI/8. 166. It was noted during the group coordinators' meetings dealing with agenda items 22, 23 and 24 that the allocation of additional seats in the Executive Committees of the Paris and Berne Unions (and in the Budget and Premises Committees) over the years had not necessarily been subject to consistent articulated principles and that, as a result, certain discrepancies inadvertently may have been built into such distribution over the years. 167. It was therefore agreed: that the additional seats available for the Executive Committees of the Paris and Berne Unions (and the Budget and Premises Committees) would be allocated, without prejudice to future decisions based on a comprehensive review, for a two-year period; that the International Bureau prepare for the 1999 ordinary session of the General Assembly a paper outlining options of principles which could be used to re-establish overall seat allocations and the implications of each such principle for each group; and that the paper prepared by the International Bureau be considered by the 1999 ordinary session of the General Assembly. 168. On the basis of the discussions in groups and among group coordinators, As a consequence, the WIPO Coordination Committee is composed of the following States: Algeria, Angola, Argentina, Australia, Austria, Bangladesh, Belgium, Brazil, Brunei Darussalam, Burkina Faso, Cameroon, Canada, Chile, China, Colombia, Costa Rica, Côte d'Ivoire, Cuba, Czech Republic, Denmark, El Salvador, Finland, France, Germany, Ghana, Greece, Hungary, India, Iran (Islamic Republic of), Ireland, Italy, Japan, Kenya, Lesotho, Libya, Luxembourg, Malaysia, Mexico, Nepal, Netherlands, Nigeria, Pakistan, Panama, Paraguay, Peru, Philippines, Portugal, Republic of Korea, Republic of Moldova, Romania, Russian Federation, Senegal, Singapore, Slovenia, South Africa, Spain, Sri Lanka, Sudan, Swaziland, Sweden, Switzerland, The former Yugoslav Republic of Macedonia, Trinidad and Tobago, Tunisia, Turkey, Uganda, Ukraine, United Kingdom, United States of America, Uruguay, Venezuela, Yemen (72). 169. On the basis of discussions in groups and among group coordinators, the WIPO General Assembly elected the following States as members of the WIPO Budget Committee for the period from October 1, 1997 to September 30, 2001: Bulgaria, Canada, Chile, China, Ecuador, Egypt, France, Germany, Hungary, India, Jamaica, Japan, Mexico, Morocco, Netherlands, Norway, Pakistan, Philippines, Republic of Korea, Russian Federation, Senegal, Slovakia, South Africa, United Kingdom, United States of America, Uzbekistan, and noted that Switzerland would continue to be an ex officio member of the WIPO Budget Committee (27). 170. On the basis of discussions in groups and among group coordinators, the WIPO General Assembly elected the following States as members of the WIPO Premises Committee from October 1, 1997, to September 30, 2001: Algeria, China, Colombia, Croatia, France, Germany, India, Nigeria, Paraguay, Russian Federation, Sri Lanka, Switzerland, United States of America (13). ITEM 25 OF THE CONSOLIDATED AGENDA: DESIGNATION OF THE MEMBERS OF THE WORKING GROUP OF THE PERMANENT COMMITTEE FOR DEVELOPMENT COOPERATION RELATED TO INDUSTRIAL PROPERTY (PC/IP) 171. See the report of the session of the WIPO Conference (document WO/CF/XIV/3). ITEM 26 OF THE CONSOLIDATED AGENDA: DESIGNATION OF THE MEMBERS OF THE WORKING GROUP OF THE PERMANENT COMMITTEE FOR DEVELOPMENT COOPERATION RELATED TO COPYRIGHT (PC/CR) 172. See the report of the session of the WIPO Conference (document WO/CF/XIV/3). ITEM 27 OF THE CONSOLIDATED AGENDA: UNITED NATIONS RESOLUTIONS 173. See the report of the session of the WIPO General Assembly (document WO/GA/XXI/13). ITEM 28 OF THE CONSOLIDATED AGENDA: ADMISSION OF OBSERVERS 174. The consideration of this item was based on document AB/XXXI/8. 175. The Delegation of Ecuador, speaking on behalf of the Latin American and the Caribbean Group, stated that observers should have an opportunity to participate in WIPO meetings. The Group considered, however, that it was essential that the WIPO General Assembly examine the criteria for admission of observers. The proposal by the Director General elect to set up advisory commissions would be an opportunity to examine those criteria. The Delegation stressed the need to avoid admitting observers in large numbers, and suggested that consideration could be given to the possibility of non-governmental organizations intervening actively through regional representatives. Admission of Intergovernmental Organizations as Observers 176. The Governing Bodies, each as far as it is concerned, decided to grant observer status to the World Trade Organization (WTO), the Commonwealth of Learning (COL), the Southern African Development Community (SADC) and the Union douanière et économique de l'Afrique centrale (UDEAC). Admission of International Non-Governmental Organizations as Observers 177. The Governing Bodies, each as far as it is concerned, decided to grant observer status to the following 12 international non-governmental organizations: the ASEAN Intellectual Property Association (ASEAN IPA), the Association of European Performers' Organizations (AEPO), the Commercial Internet eXchange Association (CIX), the Coordination of European Picture Agencies-News and Stock (CEPIC), the European Sound Directors Association (ESDA), the International Centre for Humanitarian Reporting (ICHR), the International Communications Round Table (ICRT), the International Federation of Commercial Arbitration Institutions (IFCAI), the International Federation of the Periodical Press (FIPP), the Latin American Federation of Music Publishers (FLADEM), the Organización Iberoamericana de Derechos de Autor-Latinautor Inc. and the World Association for Small & Medium Enterprises (WASME). ITEM 29 OF THE CONSOLIDATED AGENDA: ADOPTION OF THE GENERAL REPORT AND OF THE INDIVIDUAL REPORTS OF EACH GOVERNING BODY 178. This General Report was unanimously adopted by the Governing Bodies concerned on October 1, 1997. 179. Each of the 21 Governing Bodies unanimously adopted the separate report concerning its session, at a separate meeting of the Governing Body concerned, on October 1, 1997. ITEM 30 OF THE CONSOLIDATED AGENDA: CLOSING OF THE SESSIONS 180. The Chair of the WIPO General Assembly made the following statement: "I am honored to have served as your Chair during this critical juncture in the history of the protection of intellectual property. I thank all of you for your support which has made my responsibilities so much easier. But I personally must give a very special and warm salute to the group coordinators. Theirs is not an easy task and they are critical to the success of our meetings--it is they who must find the fine line between group, and collective Assembly, will. That they have done so much in this Assembly is a tribute to their intelligence, creativity and sense of responsibility. And that they have done so with goodwill and a marvelous sense of humor has been an added benefit. "When the generations of intellectual property specialists who succeed us look for the roots of their strength and pride, they will undoubtedly recognize the thirty-first series of meetings of the Governing Bodies of the World Intellectual Property Organization and the Unions Administered by WIPO as a watershed in the long and distinguished history of the protection of intellectual property. "They will see, in our work, over the past ten days an Organization of Member States who confidently set out to respond to a new series of challenges brought about by paradigm shifts in our external environment. For this we have done. "They will see, in our work, Member States who recognized that to grow and remain credible and relevant with our clients and stakeholders our Organization must base its new dynamics on the strength and stability that it has received from the past. And this we have done. "They will see, in our work, Member States who had the courage to use new values of openness, transparency, and accountability, however difficult and painful they might be, to rule the conduct of our business. For this we have done. "They will see, in our work, Member States exhibiting a collective will to put ourselves on the leading edge of the use of technology as a "mission critical" element of the future protection of intellectual property within all Member States. For this we have done. "And finally, they will see in our work Member States with the foresight to appoint a dynamic, visionary son of Africa to lead them into the next millennium. For this we have done. "But we are all aware that we are at the beginning of a new era and I look forward to seeing you all again in the not too distant future when we will continue the journey upon which we have now embarked. "There being no other business, I now declare the thirty-first series of meetings of the Governing Bodies of the World Intellectual Property Organization and the Unions Administered by WIPO closed." 181. The Group Coordinators and the Representative of China all expressed a warm vote of thanks to the Chair of the WIPO General Assembly for her able and dedicated guidance, to the International Bureau of WIPO for its competent and dedicated secretarial and translation services and to the interpreters for their tireless efforts. 182. After the usual interventions, the thirty-first series of meetings of the Governing Bodies of WIPO and the Unions administered by it were closed by the Chair of the WIPO General Assembly. CONTRIBUTIONS FOR 1998 AND 1999 I. States Members of One or More of the Contribution-financed Unions 1. The contributions for the 1998-99 biennium are fixed for the Contribution-financed Unions (namely, the Paris, Berne, IPC, Nice, Locarno and Vienna Unions) at a total of 43,212,000 francs, with one half (or 21,606,000 francs) payable on January 1, 1998, and the other half on January 1, 1999. 2. Pursuant to the decision of the Governing Bodies at their 1993 meetings to introduce the unitary contribution system with effect from January 1, 1994, the contributions for the 1998-99 biennium are payable under that system. 3. The share of each State member of one or more of the Contribution-financed Unions depends on (i) the class to which it belongs for the purpose of contributions and (ii) the number of the other States and the class to which each of them belongs. 4. Following the 1997 Governing Bodies meetings, the said States will, on January 1, 1998, belong to the following classes: Class I (25 units): France, Germany, Japan, United Kingdom, United States of America (5 countries, totalling 125 units, each country contributing 25 units or approximately 6.51% of the total contributions of the Contribution-financed Unions). Class II (20 units): No country belongs to this class. Class III (15 units): Australia, Belgium, Italy, Netherlands, Sweden, Switzerland (6 countries, totalling 90 units, each country contributing 15 units or approximately 3.91% of the total contributions of the Contribution-financed Unions). Class IV (10 units): Canada, Denmark, Finland, Ireland, Norway, Russian Federation, Spain (7 countries, totalling 70 units, each country contributing 10 units or approximately 2.60% of the total contributions of the Contribution-financed Unions). Class IVbis (7.5 units): Austria, China, Mexico, Portugal, South Africa (5 countries, totalling 37.5 units, each country contributing 7.5 units or approximately 1.95% of the total contributions of the Contribution-financed Unions). Class V (5 units): Czech Republic, Slovakia (2 countries, totalling 10 units, each country contributing 5 units or approximately 1.30% of the total contributions of the Contribution-financed Unions). Class VI (3 units): Greece, Hungary, New Zealand, Poland (4 countries, totalling 12 units, each country contributing 3 units or approximately 0.78% of the total contributions of the Contribution-financed Unions). Class VIbis (2 units): Argentina, Brazil, Bulgaria, India, Israel, Libya, Romania, Turkey, Yugoslavia (9 countries, totalling 18 units, each country contributing 2 units or approximately 0.52% of the total contributions of the Contribution-financed Unions). Class VII (1 unit): Algeria, Indonesia, Iran (Islamic Republic of), Luxembourg, Monaco, Nigeria, Republic of Korea, Slovenia (8 countries, totalling 8 units, each country contributing 1 unit or approximately 0.26% of the total contributions of the Contribution-financed Unions). Class VIII (1/2 unit): Croatia, Holy See, Iceland, Liechtenstein, Malaysia, The former Yugoslav Republic of Macedonia (6 countries, totalling 3 units, each country contributing 1/2 unit or approximately 0.13% of the total contributions of the Contribution-financed Unions). Class IX (1/4 unit): Albania, Armenia, Azerbaijan, Belarus, Estonia, Georgia, Iraq, Kazakstan, Kyrgyzstan, Latvia, Lithuania, Republic of Moldova, San Marino, Singapore, Tajikistan, Thailand, Turkmenistan, Ukraine, United Arab Emirates, Uzbekistan, Venezuela (21 countries, totalling 5.25 units, each country contributing 1/4 unit or approximately 0.07% of the total contributions of the Contribution-financed Unions). Class S (l/8 unit): Bahamas, Bahrain, Chile, Colombia, Cuba, Cyprus, Democratic People's Republic of Korea, Ecuador, Egypt, Guatemala, Morocco, Pakistan, Peru, Philippines, Syria, Trinidad and Tobago, Tunisia, Uruguay (18 countries, totalling 2.25 units, each country contributing 1/8 unit or approximately 0.03% of the total contributions of the Contribution-financed Unions). Class Sbis (1/16 unit): Barbados, Bolivia, Bosnia and Herzegovina, Cameroon, Congo, Costa Rica, Côte d'Ivoire, Dominican Republic, El Salvador, Fiji, Gabon, Ghana, Guyana, Honduras, Jamaica, Jordan, Kenya, Lebanon, Malta, Mauritius, Mongolia, Namibia, Nicaragua, Panama, Paraguay, Saint Kitts and Nevis, Saint Lucia, Saint Vincent and the Grenadines, Senegal, Sri Lanka, Suriname, Swaziland, Viet Nam, Zimbabwe (34 countries, totalling 2.125 units, each country contributing 1/16 unit or approximately 0.016% of the total contributions of the Contribution-financed Unions). Class Ster (1/32 unit): Bangladesh, Benin, Burkina Faso, Burundi, Cape Verde, Central African Republic, Chad, Democratic Republic of the Congo, Equatorial Guinea, Gambia, Guinea, Guinea-Bissau, Haiti, Lesotho, Liberia, Madagascar, Malawi, Mali, Mauritania, Niger, Rwanda, Sierra Leone, Sudan, Togo, Uganda, United Republic of Tanzania, Zambia (27 countries, totalling 0.84375 unit, each country contributing 1/32 unit or approximately 0.008% of the total contributions of the Contribution-financed Unions).5. If no changes occur in the situation described in the preceding paragraph, the contribution, in Swiss francs, of each of the States in each of the classes will be as follows: 1997 1998 1999 (actual) 1,408,016 Class I 1,406,755 1,406,755 - Class II - - 844,809 Class III 844,053 844,053 563,206 Class IV 562,702 562,702 422,405 Class IVbis 422,027 422,027 281,604 Class V 281,350 281,350 168,962 Class VI 168,811 168,811 112,641 Class VIbis 112,540 112,540 56,321 Class VII 56,270 56,270 28,161 Class VIII 28,135 28,135 14,080 Class IX 14,068 14,068 7,040 Class S 7,034 7,034 3,520 Class Sbis 3,517 3,517 1,760 Class Ster 1,758 1,758 [Total States = 152] [Total Units = 383.96875] 6. It is to be noted that the actual amount that each State will have to pay on January 1 of the above years may be different from the amounts indicated since each of the said State's actual contribution will depend on the factors referred to in paragraph 3, above. II. States Members of WIPO Which Are Not Members of Any of the Unions 7. Pursuant to the decision of the WIPO Conference to align the contributions of States members of WIPO which are not members of any of the Unions with Classes VII to Ster of the unitary contribution system, the share of each such State depends on (i) the class to which it belongs for the purpose of contributions and (ii) the amount of the contributions for that class. 8. Following the 1997 Governing Bodies meetings, the said States will, on January 1, 1998, belong to the following classes: Class VII (1 unit): Saudi Arabia (1 country, contributing 1 unit). Class VIII (1/2 unit): No country belongs to this class. Class IX (1/4 unit): Andorra (1 country, contributing 1/4 unit). Class S (1/8 unit): Brunei Darussalam, Oman, Qatar (3 countries, totalling 0.375 unit, each country contributing 1/8 unit). Class Sbis (1/16 unit): Papua New Guinea (1 country, contributing 1/16 unit). Class Ster (1/32 unit): Angola, Bhutan, Cambodia, Eritrea, Laos, Mozambique, Nepal, Samoa, Somalia, Yemen (10 countries, totalling 0.3125 unit, each country contributing 1/32 unit). 9. If no changes occur in the situation described in the previous paragraphs, the contribution, in Swiss francs, of each of the said States in each of the classes will be as set forth in paragraph 5, above. 10. It is to be noted that the actual amount that each State will have to pay on January 1 of the above years may be different from the amounts indicated, since each of the said State's actual contribution will depend on the factors referred to in paragraph 7, above. INDEX OF INTERVENTIONS BY DELEGATIONS OF STATES AND REPRESENTATIVES OF INTERGOVERNMENTAL AND (The numbers refer to the paragraphs in this document) Albania: 17, 85; Algeria: 17, 51; Argentina: 17, 62; Australia: 17, 86; Austria: 17, 87; Bangladesh: 17, 43; Belarus: 17, 52; Benin: 17, 56; Bolivia: 17, 88; Brazil: 17, 63; Bulgaria: 17, 89; Burkina Faso: 17, 57; Cameroon: 17, 69; Canada: 17, 90, 127; Chile: 17, 30, 133; China: 17, 23, 135; Colombia: 17, 32; Costa Rica: 17, 82; Côte d'Ivoire: 17, 46, 130, 159; 161, 162; Croatia: 17, 91; Cuba: 17, 44; Czech Republic: 17, 92; Democratic People's Republic of Korea: 17, 64; Denmark: 17, 42; Ecuador: 126; 175; Egypt: 17, 37; El Salvador: 17, 77; Finland: 17, 27, 148; France: 132; 148, 149; Germany: 17, 75, 128, 150; Ghana: 17, 24; Guatemala: 17, 93; Guinea: 17, 94; Hungary: 17, 28; India: 17, 29; Indonesia: 17, 95; Iran (Islamic Republic of): 17, 84; Israel: 17, 31; Italy: 17, 50; Japan: 17, 74, 136, 148; Jordan: 17, 66; Kazakhstan: 17, 76; Kenya: 17, 58; Kyrgyzstan: 17, 48; Lesotho: 17, 96; Liberia: 17, 97; Luxembourg: 17, 78; Madagascar: 17, 34; Malawi: 17, 67; Malaysia: 17, 39; Mali: 17, 55; Mexico: 17, 40; Mongolia: 17, 98; Netherlands: 17, 99; New Zealand: 17, 100; Niger: 17, 101; Nigeria: 17, 45; Norway: 17, 60; Pakistan: 17, 33; Panama: 17, 102; Philippines: 17, 38; Poland: 17, 103; Portugal: 17, 59; Qatar: 17, 71; Republic of Korea: 17, 53; Romania: 17, 61; Senegal: 17, 36, 134; Singapore: 17, 104; Slovakia: 17, 105; South Africa: 17, 73; Spain: 17, 106; Sri Lanka: 17, 107, 129; Sudan: 17, 72; Sweden: 17, 26; Switzerland: 17, 108; The former Yugoslav Republic of Macedonia: 17, 35; Togo: 17, 109; Trinidad and Tobago: 17, 68; Tunisia: 17, 65; Turkey: 17, 110; Uganda: 17, 111; United Kingdom: 17, 54; United States of America: 17, 112, 131; Uruguay: 17, 25; Uzbekistan: 17, 70; Venezuela: 17, 41; Viet Nam: 17, 113; Yemen: 17, 49. - . - ARIPO: 17, 80; BBM/BBDM: 17, 114; CEC: 17, 115; EBU: 17, 81; EPO: 17, 47; OAPI: 17, 116; OAU: 17, 83; UNESCO: 17, 79; WTO: 117. [End of Index and of document] This internet document is the consolidated version of documents AB/XXXI/12 and AB/XXXI/12 Corr.